Science.gov

Sample records for quantum dot-labeled aptamer

  1. Dual-Quantum-Dots-Labeled Lateral Flow Strip Rapidly Quantifies Procalcitonin and C-reactive Protein

    NASA Astrophysics Data System (ADS)

    Qi, XiaoPing; Huang, YunYe; Lin, ZhongShi; Xu, Liang; Yu, Hao

    2016-03-01

    In the article, a dual-quantum-dots-labeled (dual-QDs-labeled) lateral flow strip (LFS) method was developed for the simultaneous and rapid quantitative detection of procalcitonin (PCT) and C-reactive protein (CRP) in the blood. Two QD-antibody conjugates with different fluorescence emission spectra were produced and sprayed on the LFS to capture PCT and CRP in the blood. Furthermore, a double antibody sandwich method for PCT and, meanwhile, a competitive inhibition method for CRP were employed in the LFS. For PCT and CRP in serum assayed by the dual-QDs-labeled LFS, their detection sensitivities reached 0.1 and 1 ng/mL, respectively, and their linear quantitative detection ranges were from 0.3 to 200 ng/mL and from 50 to 250 μg/mL, respectively. There was little evidence that the PCT and CRP assays would be interfered with each other. The correlations for testing CRP and PCT in clinical samples were 99.75 and 97.02 %, respectively, between the dual-QDs-labeled LFS we developed and commercial methods. The rapid quantification of PCT and CRP on dual-QDs-labeled LFS is of great clinical value to distinguish inflammation, bacterial infection, or viral infection and to provide guidance for the use of antibiotics or other medicines.

  2. A Quick and Parallel Analytical Method Based on Quantum Dots Labeling for ToRCH-Related Antibodies

    NASA Astrophysics Data System (ADS)

    Yang, Hao; Guo, Qing; He, Rong; Li, Ding; Zhang, Xueqing; Bao, Chenchen; Hu, Hengyao; Cui, Daxiang

    2009-12-01

    Quantum dot is a special kind of nanomaterial composed of periodic groups of II-VI, III-V or IV-VI materials. Their high quantum yield, broad absorption with narrow photoluminescence spectra and high resistance to photobleaching, make them become a promising labeling substance in biological analysis. Here, we report a quick and parallel analytical method based on quantum dots for ToRCH-related antibodies including Toxoplasma gondii, Rubella virus, Cytomegalovirus and Herpes simplex virus type 1 (HSV1) and 2 (HSV2). Firstly, we fabricated the microarrays with the five kinds of ToRCH-related antigens and used CdTe quantum dots to label secondary antibody and then analyzed 100 specimens of randomly selected clinical sera from obstetric outpatients. The currently prevalent enzyme-linked immunosorbent assay (ELISA) kits were considered as “golden standard” for comparison. The results show that the quantum dots labeling-based ToRCH microarrays have comparable sensitivity and specificity with ELISA. Besides, the microarrays hold distinct advantages over ELISA test format in detection time, cost, operation and signal stability. Validated by the clinical assay, our quantum dots-based ToRCH microarrays have great potential in the detection of ToRCH-related pathogens.

  3. CdSe/ZnS Quantum Dots-Labeled Mesenchymal Stem Cells for Targeted Fluorescence Imaging of Pancreas Tissues and Therapy of Type 1 Diabetic Rats.

    PubMed

    Liu, Haoqi; Tang, Wei; Li, Chao; Lv, Pinlei; Wang, Zheng; Liu, Yanlei; Zhang, Cunlei; Bao, Yi; Chen, Haiyan; Meng, Xiangying; Song, Yan; Xia, Xiaoling; Pan, Fei; Cui, Daxiang; Shi, Yongquan

    2015-12-01

    Mesenchymal stem cells (MSCs) have been used for therapy of type 1 diabetes mellitus. However, the in vivo distribution and therapeutic effects of transplanted MSCs are not clarified well. Herein, we reported that CdSe/ZnS quantum dots-labeled MSCs were prepared for targeted fluorescence imaging and therapy of pancreas tissues in rat models with type 1 diabetes. CdSe/ZnS quantum dots were synthesized, their biocompatibility was evaluated, and then, the appropriate concentration of quantum dots was selected to label MSCs. CdSe/ZnS quantum dots-labeled MSCs were injected into mouse models with type 1 diabetes via tail vessel and then were observed by using the Bruker In-Vivo F PRO system, and the blood glucose levels were monitored for 8 weeks. Results showed that prepared CdSe/ZnS quantum dots owned good biocompatibility. Significant differences existed in distribution of quantum dots-labeled MSCs between normal control rats and diabetic rats (p < 0.05). The ratios of the fluorescence intensity (RFI) analysis showed an accumulation rate of MSCs in the pancreas of rats in the diabetes group which was about 32 %, while that in the normal control group rats was about 18 %. The blood glucose levels were also monitored for 8 weeks after quantum dots-labeled MSC injection. Statistical differences existed between the blood glucose levels of the diabetic rat control group and MSC-injected diabetic rat group (p < 0.01), and the MSC-injected diabetic rat group displayed lower blood glucose levels. In conclusion, CdSe/ZnS-labeled MSCs can target in vivo pancreas tissues in diabetic rats, and significantly reduce the blood glucose levels in diabetic rats, and own potential application in therapy of diabetic patients in the near future.

  4. CdSe/ZnS Quantum Dots-Labeled Mesenchymal Stem Cells for Targeted Fluorescence Imaging of Pancreas Tissues and Therapy of Type 1 Diabetic Rats

    NASA Astrophysics Data System (ADS)

    Liu, Haoqi; Tang, Wei; Li, Chao; Lv, Pinlei; Wang, Zheng; Liu, Yanlei; Zhang, Cunlei; Bao, Yi; Chen, Haiyan; Meng, Xiangying; Song, Yan; Xia, Xiaoling; Pan, Fei; Cui, Daxiang; Shi, Yongquan

    2015-06-01

    Mesenchymal stem cells (MSCs) have been used for therapy of type 1 diabetes mellitus. However, the in vivo distribution and therapeutic effects of transplanted MSCs are not clarified well. Herein, we reported that CdSe/ZnS quantum dots-labeled MSCs were prepared for targeted fluorescence imaging and therapy of pancreas tissues in rat models with type 1 diabetes. CdSe/ZnS quantum dots were synthesized, their biocompatibility was evaluated, and then, the appropriate concentration of quantum dots was selected to label MSCs. CdSe/ZnS quantum dots-labeled MSCs were injected into mouse models with type 1 diabetes via tail vessel and then were observed by using the Bruker In-Vivo F PRO system, and the blood glucose levels were monitored for 8 weeks. Results showed that prepared CdSe/ZnS quantum dots owned good biocompatibility. Significant differences existed in distribution of quantum dots-labeled MSCs between normal control rats and diabetic rats ( p < 0.05). The ratios of the fluorescence intensity (RFI) analysis showed an accumulation rate of MSCs in the pancreas of rats in the diabetes group, and was about 32 %, while that in the normal control group rats was about 18 %. The blood glucose levels were also monitored for 8 weeks after quantum dots-labeled MSC injection. Statistical differences existed between the blood glucose levels of the diabetic rat control group and MSC-injected diabetic rat group ( p < 0.01), and the MSC-injected diabetic rat group displayed lower blood glucose levels. In conclusion, CdSe/ZnS-labeled MSCs can target in vivo pancreas tissues in diabetic rats, and significantly reduce the blood glucose levels in diabetic rats, and own potential application in therapy of diabetic patients in the near future.

  5. A CCD-based reader combined quantum dots-labeled lateral flow strips for ultrasensitive quantitative detection of anti-HBs antibody.

    PubMed

    Zhang, Xueqing; Li, Ding; Wang, Can; Zhi, Xiao; Zhang, Chunlei; Wang, Kan; Cui, Daxiang

    2012-06-01

    Herein we reported a CCD-based reader combined quantum dots-labeled lateral flow strips for ultrasensitive quantitative detection of anti-HBs antibody. The CdTe quantum dots were prepared, then were used to label Hepatitis B Virus surface antigen, and then were fabricated into lateral flow strips. The as-prepared lateral flow strips were used to test different concentration of anti-HBV surface antibodies. The CCD-based reader was designed and fabricated, the quantitative analysis software was compiled, and resultant CCD-based reader system was used for quantitative analysis of examined anti-HBs antibodies on the strips. Results showed that the quantum dots-labeled lateral flow strips could detect the anti-HBs antibody with the limitation concentration of 200 pg/mL, the CCD-based reader system could detect anti-HBs antibody with the sensitivity of 2 pg/mL. In conclusion, the prepared CCD-based reader combined quantum dots-labeled lateral flow strips can be used for quantitative detection of anti-HBs antibody in sera with the sensitivity of 2 pg/mL, and has great potential in applications such as ultrasensitive detection of HBV antigens or antibodies, and other tumor biomarkers in near future.

  6. Correlative fluorescence and electron microscopy of quantum dot labeled proteins on whole cells in liquid.

    PubMed

    Peckys, Diana B; Dukes, Madeline J; de Jonge, Niels

    2014-01-01

    Correlative fluorescence microscopy and scanning transmission electron microscopy (STEM) of cells fully immersed in liquid is a new methodology with many application areas. Proteins, in live cells immobilized on microchips, are labeled with fluorescent quantum dot (QD) nanoparticles. In this protocol, the epidermal growth factor receptor (EGFR) is labeled. The cells are fixed after a selected labeling time, for example, 5 min as needed to form EGFR dimers. The microchip with cells is then imaged with fluorescence microscopy. Thereafter, the microchip with the labeled cells and one with a spacer are assembled in a special microfluidic device and imaged with STEM.

  7. In Vivo Quantum Dot Labeling of Mammalian Stem and Progenitor Cells

    PubMed Central

    Slotkin, Jonathan R.; Chakrabarti, Lina; Dai, Hai Ning; Carney, Rosalind S.E.; Hirata, Tsutomu; Bregman, Barbara S.; Gallicano, G. Ian; Corbin, Joshua G.; Haydar, Tarik F.

    2009-01-01

    Fluorescent semiconductor nanocrystal quantum dots (QDs) are a class of multifunctional inorganic fluorophores that hold great promise for clinical applications and biomedical research. Because no methods currently exist for directed QD-labeling of mammalian cells in the nervous system in vivo, we developed novel in utero electroporation and ultrasound-guided in vivo delivery techniques to efficiently and directly label neural stem and progenitor cells (NSPCs) of the developing mammalian central nervous system with QDs. Our initial safety and proof of concept studies of one and two-cell QD-labeled mouse embryos reveal that QDs are compatible with early mammalian embryonic development. Our in vivo experiments further show that in utero labeled NSPCs continue to develop in an apparent normal manner. These studies reveal that QDs can be effectively used to label mammalian NSPCs in vivo and will be useful for studies of in vivo fate mapping, cellular migration, and NSPC differentiation during mammalian development. PMID:17626285

  8. Enhanced detection of quantum dots labeled protein by simultaneous bismuth electrodeposition into microfluidic channel.

    PubMed

    Medina-Sánchez, Mariana; Miserere, Sandrine; Cadevall, Miquell; Merkoçi, Arben

    2016-02-01

    In this study, we propose an electrochemical immunoassay into a disposable microfluidic platform, using quantum dots (QDs) as labels and their enhanced detection using bismuth as an alternative to mercury electrodes. CdSe@ZnS QDs were used to tag human IgG as a model protein and detected through highly sensitive stripping voltammetry of the dissolved metallic component (cadmium in our case). The modification of the screen printed carbon electrodes (SPCEs) was done by a simple electrodeposition of bismuth that was previously mixed with the sample containing QDs. A magneto-immunosandwich assay was performed using a micromixer. A magnet placed at its outlet in order to capture the magnetic beads used as solid support for the immunoassay. SPCEs were integrated at the end of the channel as detector. Different parameters such as bismuth concentration, flow rate, and incubation times, were optimized. The LOD for HIgG in presence of bismuth was 3.5 ng/mL with a RSD of 13.2%. This LOD was about 3.3-fold lower than the one obtained without bismuth. Furthermore, the sensitivity of the system was increased 100-fold respect to experiments carried out with classical screen-printed electrodes, both in presence of bismuth.

  9. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    PubMed

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs.

  10. Identification of quantum dots labeled metallothionein by fast scanning laser-induced breakdown spectroscopy

    NASA Astrophysics Data System (ADS)

    Konecna, Marie; Novotny, Karel; Krizkova, Sona; Blazkova, Iva; Kopel, Pavel; Kaiser, Jozef; Hodek, Petr; Kizek, Rene; Adam, Vojtech

    2014-11-01

    The technique described in this paper allows detection of quantum dots (QDs) specifically deposited on the polystyrene surface by laser-induced breakdown spectroscopy (LIBS). Using LIBS, the distribution of QDs or their conjugates with biomolecules deposited on the surface can be observed, regardless of the fact if they exhibit fluorescence or not. QDs deposited on the specific surface of polystyrene microplate in the form of spots are detected by determination of the metal included in the QDs structure. Cd-containing QDs (CdS, CdTe) stabilized with mercaptopropionic (MPA) or mercaptosuccinic (MSA) acid, respectively, alone or in the form of conjugates with metallothionein (MT) biomolecule are determined by using the 508.58 nm Cd emission line. The observed absolute detection limit for Cd in CdTe QDs conjugates with MT in one spot was 3 ng Cd. Due to the high sensitivity of this technique, the immunoanalysis in combination with LIBS was also investigated. Cd spatial distribution in sandwich immunoassay was detected.

  11. Quantum dot labeling of butyrylcholinesterase maintains substrate and inhibitor interactions and cell adherence features.

    PubMed

    Waiskopf, Nir; Shweky, Itzhak; Lieberman, Itai; Banin, Uri; Soreq, Hermona

    2011-03-16

    Butyrylcholinesterase (BChE) is the major acetylcholine hydrolyzing enzyme in peripheral mammalian systems. It can either reside in the circulation or adhere to cells and tissues and protect them from anticholinesterases, including insecticides and poisonous nerve gases. In humans, impaired cholinesterase functioning is causally involved in many pathologies, including Alzheimer's and Parkinson's diseases, trait anxiety, and post stroke conditions. Recombinant cholinesterases have been developed for therapeutic use; therefore, it is important to follow their in vivo path, location, and interactions. Traditional labeling methods, such as fluorescent dyes and proteins, generally suffer from sensitivity to environmental conditions, from proximity to different molecules or special enzymes which can alter them, and from relatively fast photobleaching. In contrast, emerging development in synthesis and surface engineering of semiconductor nanocrystals enable their use to detect and follow molecules in biological milieus at high sensitivity and in real time. Therefore, we developed a platform for conjugating highly purified recombinant human BChE dimers (rhBChE) to CdSe/CdZnS quantum dots (QDs). We report the development and characterization of highly fluorescent aqueous soluble QD-rhBChE conjugates, present maintenance of hydrolytic activity, inhibitor sensitivity, and adherence to the membrane of cultured live cells of these conjugates, and outline their advantageous features for diverse biological applications.

  12. Quantum Dot Labeling of Butyrylcholinesterase Maintains Substrate and Inhibitor Interactions and Cell Adherence Features

    PubMed Central

    2010-01-01

    Butyrylcholinesterase (BChE) is the major acetylcholine hydrolyzing enzyme in peripheral mammalian systems. It can either reside in the circulation or adhere to cells and tissues and protect them from anticholinesterases, including insecticides and poisonous nerve gases. In humans, impaired cholinesterase functioning is causally involved in many pathologies, including Alzheimer’s and Parkinson’s diseases, trait anxiety, and post stroke conditions. Recombinant cholinesterases have been developed for therapeutic use; therefore, it is important to follow their in vivo path, location, and interactions. Traditional labeling methods, such as fluorescent dyes and proteins, generally suffer from sensitivity to environmental conditions, from proximity to different molecules or special enzymes which can alter them, and from relatively fast photobleaching. In contrast, emerging development in synthesis and surface engineering of semiconductor nanocrystals enable their use to detect and follow molecules in biological milieus at high sensitivity and in real time. Therefore, we developed a platform for conjugating highly purified recombinant human BChE dimers (rhBChE) to CdSe/CdZnS quantum dots (QDs). We report the development and characterization of highly fluorescent aqueous soluble QD-rhBChE conjugates, present maintenance of hydrolytic activity, inhibitor sensitivity, and adherence to the membrane of cultured live cells of these conjugates, and outline their advantageous features for diverse biological applications. PMID:22778863

  13. Magnetic Electrochemical Immunoassays with Quantum Dot Labels for Detection of Phosphorylated Acetylcholinesterase in Plasma

    SciTech Connect

    Wang, Hua; Wang, Jun; Timchalk, Charles; Lin, Yuehe

    2008-11-01

    A new magnetic electrochemical immunoassay has been developed as a tool for biomonitoring exposures to organophosphate (OP) compounds, e.g., insecticides and chemical nerve agents, by directly detecting organophosphorylated acetylcholinesterase (OP-AChE). This immunoassay uniquely incorporates highly efficient magnetic separation with ultrasensitive square wave voltammetry (SWV) analysis with quantum dots (QDs) as labels. A pair of antibodies was used to achieve the specific recognition of OP-AChE that was prepared with paraoxon as an OP model agent. Antiphosphoserine polyclonal antibodies were anchored on amorphous magnetic particles preferably chosen to capture OP-AChE from the sample matrixes by binding their phosphoserine moieties that were exposed through unfolding the protein adducts. This was validated by electrochemical examinations and enzyme-linked immunosorbent assays. Furthermore, antihuman AChE monoclonal antibodies were labeled with cadmium-source QDs to selectively recognize the captured OP-AChE, as characterized by transmission electron microscopy. The subsequent electrochemical SWV analysis of the cadmium component released by acid from the coupled QDs was conducted on disposable screen-printed electrodes. Experimental results indicated that the SWV-based immunoassays could yield a linear response over a broad concentration range of 0.3-300 ng/mL OP-AChE in human plasma with a detection limit of 0.15 ng/mL. Such a novel electrochemical immunoassay holds great promise as a simple, selective, sensitive, and field-deployable tool for the effective biomonitoring and diagnosis of potential exposures to nerve agents and pesticides.

  14. Magnetic electrochemical immunoassays with quantum dot labels for detection of phosphorylated acetylcholinesterase in plasma.

    PubMed

    Wang, Hua; Wang, Jun; Timchalk, Charles; Lin, Yuehe

    2008-11-15

    A new magnetic electrochemical immunoassay has been developed as a tool for biomonitoring exposures to organophosphate (OP) compounds, e.g., insecticides and chemical nerve agents, by directly detecting organophosphorylated acetylcholinesterase (OP-AChE). This immunoassay uniquely incorporates highly efficient magnetic separation with ultrasensitive square wave voltammetry (SWV) analysis with quantum dots (QDs) as labels. A pair of antibodies was used to achieve the specific recognition of OP-AChE that was prepared with paraoxon as an OP model agent. Antiphosphoserine polyclonal antibodies were anchored on amorphous magnetic particles preferably chosen to capture OP-AChE from the sample matrixes by binding their phosphoserine moieties that were exposed through unfolding the protein adducts. This was validated by electrochemical examinations and enzyme-linked immunosorbent assays. Furthermore, antihuman AChE monoclonal antibodies were labeled with cadmium-source QDs to selectively recognize the captured OP-AChE, as characterized by transmission electron microscopy. The subsequent electrochemical SWV analysis of the cadmium component released by acid from the coupled QDs was conducted on disposable screen-printed electrodes. Experimental results indicated that the SWV-based immunoassays could yield a linear response over a broad concentration range of 0.3-300 ng/mL OP-AChE in human plasma with a detection limit of 0.15 ng/mL. Such a novel electrochemical immunoassay holds great promise as a simple, selective, sensitive, and field-deployable tool for the effective biomonitoring and diagnosis of potential exposures to nerve agents and pesticides.

  15. A CCD-based reader combined with CdS quantum dot-labeled lateral flow strips for ultrasensitive quantitative detection of CagA

    NASA Astrophysics Data System (ADS)

    Gui, Chen; Wang, Kan; Li, Chao; Dai, Xuan; Cui, Daxiang

    2014-02-01

    Immunochromatographic assays are widely used to detect many analytes. CagA is proved to be associated closely with initiation of gastric carcinoma. Here, we reported that a charge-coupled device (CCD)-based test strip reader combined with CdS quantum dot-labeled lateral flow strips for quantitative detection of CagA was developed, which used 365-nm ultraviolet LED as the excitation light source, and captured the test strip images through an acquisition module. Then, the captured image was transferred to the computer and was processed by a software system. A revised weighted threshold histogram equalization (WTHE) image processing algorithm was applied to analyze the result. CdS quantum dot-labeled lateral flow strips for detection of CagA were prepared. One hundred sera samples from clinical patients with gastric cancer and healthy people were prepared for detection, which demonstrated that the device could realize rapid, stable, and point-of-care detection, with a sensitivity of 20 pg/mL.

  16. Simultaneous Quantitative Detection of Helicobacter Pylori Based on a Rapid and Sensitive Testing Platform using Quantum Dots-Labeled Immunochromatiographic Test Strips

    NASA Astrophysics Data System (ADS)

    Zheng, Yu; Wang, Kan; Zhang, Jingjing; Qin, Weijian; Yan, Xinyu; Shen, Guangxia; Gao, Guo; Pan, Fei; Cui, Daxiang

    2016-02-01

    Quantum dots-labeled urea-enzyme antibody-based rapid immunochromatographic test strips have been developed as quantitative fluorescence point-of-care tests (POCTs) to detect helicobacter pylori. Presented in this study is a new test strip reader designed to run on tablet personal computers (PCs), which is portable for outdoor detection even without an alternating current (AC) power supply. A Wi-Fi module was integrated into the reader to improve its portability. Patient information was loaded by a barcode scanner, and an application designed to run on tablet PCs was developed to handle the acquired images. A vision algorithm called Kmeans was used for picture processing. Different concentrations of various human blood samples were tested to evaluate the stability and accuracy of the fabricated device. Results demonstrate that the reader can provide an easy, rapid, simultaneous, quantitative detection for helicobacter pylori. The proposed test strip reader has a lighter weight than existing detection readers, and it can run for long durations without an AC power supply, thus verifying that it possesses advantages for outdoor detection. Given its fast detection speed and high accuracy, the proposed reader combined with quantum dots-labeled test strips is suitable for POCTs and owns great potential in applications such as screening patients with infection of helicobacter pylori, etc. in near future.

  17. High Sensitivity Detection of CdSe/ZnS Quantum Dot-Labeled DNA Based on N-type Porous Silicon Microcavities

    PubMed Central

    Lv, Changwu; Jia, Zhenhong; Lv, Jie; Zhang, Hongyan; Li, Yanyu

    2017-01-01

    N-type macroporous silicon microcavity structures were prepared using electrochemical etching in an HF solution in the absence of light and oxidants. The CdSe/ZnS water-soluble quantum dot-labeled DNA target molecules were detected by monitoring the microcavity reflectance spectrum, which was characterized by the reflectance spectrum defect state position shift resulting from changes to the structures’ refractive index. Quantum dots with a high refractive index and DNA coupling can improve the detection sensitivity by amplifying the optical response signals of the target DNA. The experimental results show that DNA combined with a quantum dot can improve the sensitivity of DNA detection by more than five times. PMID:28045442

  18. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4

    NASA Astrophysics Data System (ADS)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

    2016-03-01

    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

  19. Quantum-dot-labeled DNA probes for fluorescence in situ hybridization (FISH) in the microorganism Escherichia coli.

    PubMed

    Wu, Sheng-Mei; Zhao, Xiang; Zhang, Zhi-Ling; Xie, Hai-Yan; Tian, Zhi-Quan; Peng, Jun; Lu, Zhe-Xue; Pang, Dai-Wen; Xie, Zhi-Xiong

    2006-05-12

    Semiconductor quantum dots (QDs) as a kind of nonisotopic biological labeling material have many unique fluorescent properties relative to conventional organic dyes and fluorescent proteins, such as composition- and size-dependent absorption and emission, a broad absorption spectrum, photostability, and single-dot sensitivity. These properties make them a promising stable and sensitive label, which can be used for long-term fluorescent tracking and subcellular location of genes and proteins. Here, a simple approach for the construction of QD-labeled DNA probes was developed by attaching thiol-ssDNA to QDs via a metal-thiol bond. The as-prepared QD-labeled DNA probes had high dispersivity, bioactivity, and specificity for hybridization. Based on such a kind of probe with a sequence complementary to multiple clone sites in plasmid pUC18, fluorescence in situ hybridization of the tiny bacterium Escherichia coli has been realized for the first time.

  20. Correlative fluorescence and scanning transmission electron microscopy of quantum dot-labeled proteins on whole cells in liquid.

    PubMed

    Peckys, Diana B; Bandmann, Vera; de Jonge, Niels

    2014-01-01

    Correlative fluorescence microscopy combined with scanning transmission electron microscopy (STEM) of cells fully immersed in liquid is a new methodology with many application areas. Proteins, in live cells immobilized on microchips, are labeled with fluorescent quantum dot nanoparticles. In this protocol, the epidermal growth factor receptor (EGFR) is labeled. The cells are fixed after a selected labeling time, for example, 5 min as needed to form EGFR dimers. The microchip with cells is then imaged with fluorescence microscopy. Thereafter, STEM can be accomplished in two ways. The microchip with the labeled cells and one microchip with a spacer are assembled into a special microfluidic device and imaged with dedicated high-voltage STEM. Alternatively, thin edges of cells can be studied with environmental scanning electron microscopy with a STEM detector, by placing a microchip with cells in a cooled wet environment.

  1. Analysis of the fluctuations of a single-tethered, quantum-dot labeled DNA molecule in shear flow.

    PubMed

    Laube, K; Günther, K; Mertig, M

    2011-05-11

    A novel technique for analyzing the conformational fluctuations of a single, surface-tethered DNA molecule by fluorescence microscopy is reported. Attaching a nanometer-sized fluorescent quantum dot to the free end of a λ-phage DNA molecule allows us to study the fluctuations of a native DNA molecule without the mechanical properties being altered by fluorescent dye staining. We report on the investigation of single-tethered DNA in both the unperturbed and the shear flow induced stretched state. The dependence of the observed fractional extension and the magnitude of fluctuations on the shear rate can be qualitatively interpreted by Brochard's stem-and-flower model. The cyclic dynamics of a DNA molecule is directly observed in the shear flow experiment.

  2. Directly interrogating single quantum dot labelled UvrA2 molecules on DNA tightropes using an optically trapped nanoprobe

    PubMed Central

    Simons, Michelle; Pollard, Mark R.; Hughes, Craig D.; Ward, Andrew D.; Van Houten, Bennett; Towrie, Mike; Botchway, Stan W.; Parker, Anthony W.; Kad, Neil M.

    2015-01-01

    In this study we describe a new methodology to physically probe individual complexes formed between proteins and DNA. By combining nanoscale, high speed physical force measurement with sensitive fluorescence imaging we investigate the complex formed between the prokaryotic DNA repair protein UvrA2 and DNA. This approach uses a triangular, optically-trapped “nanoprobe” with a nanometer scale tip protruding from one vertex. By scanning this tip along a single DNA strand suspended between surface-bound micron-scale beads, quantum-dot tagged UvrA2 molecules bound to these ‘”DNA tightropes” can be mechanically interrogated. Encounters with UvrA2 led to deflections of the whole nanoprobe structure, which were converted to resistive force. A force histogram from all 144 detected interactions generated a bimodal distribution centered on 2.6 and 8.1 pN, possibly reflecting the asymmetry of UvrA2’s binding to DNA. These observations successfully demonstrate the use of a highly controllable purpose-designed and built synthetic nanoprobe combined with fluorescence imaging to study protein-DNA interactions at the single molecule level. PMID:26691010

  3. Random walk of processive, quantum dot-labeled myosin Va molecules within the actin cortex of COS-7 cells.

    PubMed

    Nelson, Shane R; Ali, M Yusuf; Trybus, Kathleen M; Warshaw, David M

    2009-07-22

    Myosin Va (myoVa) is an actin-based intracellular cargo transporter. In vitro experiments have established that a single myoVa moves processively along actin tracks, but less is known about how this motor operates within cells. Here we track the movement of a quantum dot (Qdot)-labeled myoVa HMM in COS-7 cells using total internal reflectance fluorescence microscopy. This labeling approach is unique in that it allows myoVa, instead of its cargo, to be tracked. Single-particle analysis showed short periods (

  4. Correlative fluorescence microscopy and scanning transmission electron microscopy of quantum-dot-labeled proteins in whole cells in liquid.

    PubMed

    Dukes, Madeline J; Peckys, Diana B; de Jonge, Niels

    2010-07-27

    Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7x12 nm were visible in a 5 microm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs.

  5. Correlative Fluorescence Microscopy and Scanning Transmission Electron Microscopy of Quantum Dot Labeled Proteins in Whole Cells in Liquid

    PubMed Central

    Dukes, Madeline J.; Peckys, Diana B.; de Jonge, Niels

    2010-01-01

    Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7 × 12 nm were visible in a 5 μm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs. PMID:20550177

  6. Random Walk of Processive, Quantum Dot-Labeled Myosin Va Molecules within the Actin Cortex of COS-7 Cells

    PubMed Central

    Nelson, Shane R.; Ali, M. Yusuf; Trybus, Kathleen M.; Warshaw, David M.

    2009-01-01

    Abstract Myosin Va (myoVa) is an actin-based intracellular cargo transporter. In vitro experiments have established that a single myoVa moves processively along actin tracks, but less is known about how this motor operates within cells. Here we track the movement of a quantum dot (Qdot)-labeled myoVa HMM in COS-7 cells using total internal reflectance fluorescence microscopy. This labeling approach is unique in that it allows myoVa, instead of its cargo, to be tracked. Single-particle analysis showed short periods (≤0.5 s) of ATP-sensitive linear motion. The mean velocity of these trajectories was 604 nm/s and independent of the number of myoVa molecules attached to the Qdot. With high time (16.6 ms) and spatial (15 nm) resolution imaging, Qdot-labeled myoVa moved with sequential 75 nm steps per head, at a rate of 16 s−1, similarly to myoVa in vitro. Monte Carlo modeling suggests that the random nature of the trajectories represents processive myoVa motors undergoing a random walk through the dense and randomly oriented cortical actin network. PMID:19619465

  7. Dual-colored graphene quantum dots-labeled nanoprobes/graphene oxide: functional carbon materials for respective and simultaneous detection of DNA and thrombin

    NASA Astrophysics Data System (ADS)

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Chen, Jian Rong; Feng, Hui

    2014-10-01

    Convenient and simultaneous detection of multiple biomarkers such as DNA and proteins with biocompatible materials and good analytical performance still remains a challenge. Herein, we report the respective and simultaneous detection of DNA and bovine α-thrombin (thrombin) entirely based on biocompatible carbon materials through a specially designed fluorescence on-off-on process. Colorful fluorescence, high emission efficiency, good photostability and excellent compatibility enables graphene quantum dots (GQDs) as the best choice for fluorophores in bioprobes, and thus two-colored GQDs as labeling fluorophores were chemically bonded with specific oligonucleotide sequence and aptamer to prepare two probes targeting the DNA and thrombin, respectively. Each probe can be assembled on the graphene oxide (GO) platform spontaneously by π-π stacking and electrostatic attraction; as a result, fast electron transfer in the assembly efficiently quenches the fluorescence of probe. The presence of DNA or thrombin can trigger the self-recognition between capturing a nucleotide sequence and its target DNA or between thrombin and its aptamer due to their specific hybridization and duplex DNA structures or the formation of apatamer-substrate complex, which is taken advantage of in order to achieve a separate quantitative analysis of DNA and thrombin. A dual-functional biosensor for simultaneous detection of DNA and thrombin was also constructed by self-assembly of two probes with distinct colors and GO platform, and was further evaluated with the presence of various concentrations of DNA and thrombin. Both biosensors serving as a general detection model for multiple species exhibit outstanding analytical performance, and are expected to be applied in vivo because of the excellent biocompatibility of their used materials.

  8. Sensitive Bioanalysis Based on in-Situ Droplet Anodic Stripping Voltammetric Detection of CdS Quantum Dots Label after Enhanced Cathodic Preconcentration

    PubMed Central

    Qin, Xiaoli; Wang, Linchun; Xie, Qingji

    2016-01-01

    We report a protocol of CdS-labeled sandwich-type amperometric bioanalysis with high sensitivity, on the basis of simultaneous chemical-dissolution/cathodic-enrichment of the CdS quantum dot biolabel and anodic stripping voltammetry (ASV) detection of Cd directly on the bioelectrode. We added a microliter droplet of 0.1 M aqueous HNO3 to dissolve CdS on the bioelectrode and simultaneously achieved the potentiostatic cathodic preconcentration of Cd by starting the potentiostatic operation before HNO3 addition, which can largely increase the ASV signal. Our protocol was used for immunoanalysis and aptamer-based bioanalysis of several proteins, giving limits of detection of 4.5 fg·mL−1 for human immunoglobulin G, 3.0 fg·mL−1 for human carcinoembryonic antigen (CEA), 4.9 fg·mL−1 for human α-fetoprotein (AFP), and 0.9 fM for thrombin, which are better than many reported results. The simultaneous and sensitive analysis of CEA and AFP at two screen-printed carbon electrodes was also conducted by our protocol. PMID:27563894

  9. Sensitive Bioanalysis Based on in-Situ Droplet Anodic Stripping Voltammetric Detection of CdS Quantum Dots Label after Enhanced Cathodic Preconcentration.

    PubMed

    Qin, Xiaoli; Wang, Linchun; Xie, Qingji

    2016-08-23

    We report a protocol of CdS-labeled sandwich-type amperometric bioanalysis with high sensitivity, on the basis of simultaneous chemical-dissolution/cathodic-enrichment of the CdS quantum dot biolabel and anodic stripping voltammetry (ASV) detection of Cd directly on the bioelectrode. We added a microliter droplet of 0.1 M aqueous HNO₃ to dissolve CdS on the bioelectrode and simultaneously achieved the potentiostatic cathodic preconcentration of Cd by starting the potentiostatic operation before HNO₃ addition, which can largely increase the ASV signal. Our protocol was used for immunoanalysis and aptamer-based bioanalysis of several proteins, giving limits of detection of 4.5 fg·mL(-1) for human immunoglobulin G, 3.0 fg·mL(-1) for human carcinoembryonic antigen (CEA), 4.9 fg·mL(-1) for human α-fetoprotein (AFP), and 0.9 fM for thrombin, which are better than many reported results. The simultaneous and sensitive analysis of CEA and AFP at two screen-printed carbon electrodes was also conducted by our protocol.

  10. A novel quantum dots-labeled on the surface of molecularly imprinted polymer for turn-off optosensing of dicyandiamide in dairy products.

    PubMed

    Liu, Huilin; Zhou, Kaiwen; Wu, Dan; Wang, Jing; Sun, Baoguo

    2016-03-15

    A novel optosensing system based on quantum dots (QDs)-labeled on the surface of a molecularly imprinted polymer (MIP) was developed for turn-off fluorescence sensing of dicyandiamide (DCD). The QDs were modified with silica to covalently adhere to the MIP surface, which resulted in a higher fluorescence quantum yield than MIP-coated QDs. Under optimal conditions, there was a linear relationship, with a correlation coefficient of 0.9950, between the fluorescence intensity and the DCD concentration over the range 5-1600 μmolL(-1). The detection limit of this system was 2.7 μmolL(-1). The proposed method exhibited with good recoveries ranging from 95% to 106%. Most importantly, the optosensing approach can be successfully applied for the determination of DCD in dairy products. With excellent sensitivity and selectivity, such simple and cheap materials are potentially suitable for monitoring of DCD in other food, in agriculture and for environmental applications.

  11. High affinity scFv-hapten pair as a tool for quantum dot labeling and tracking of single proteins in live cells.

    PubMed

    Iyer, Gopal; Michalet, Xavier; Chang, Yun-Pei; Pinaud, Fabien F; Matyas, Stephanie E; Payne, Gregory; Weiss, Shimon

    2008-12-01

    We describe a general approach to label cell surface proteins using quantum dots (QD) for single-molecule tracking. QDs coated with small-hapten modified peptides are targeted to cell surface fusion proteins containing the corresponding single-chain fragment antibody (scFv). The approach is illustrated with the small hapten fluorescein (FL) and a high-affinity anti-FL scFv fused to two different proteins in yeast and murine neuronal cell line N2a.

  12. One-pot synthesis of quantum dot-labeled hydrophilic molecularly imprinted polymer nanoparticles for direct optosensing of folic acid in real, undiluted biological samples.

    PubMed

    Yang, Yaqiong; Wang, Zhengzheng; Niu, Hui; Zhang, Huiqi

    2016-12-15

    A facile and efficient one-pot approach for the synthesis of quantum dot (QD)-labeled hydrophilic molecularly imprinted polymer (MIP) nanoparticles for direct optosensing of folic acid (FA) in the undiluted bovine and porcine serums is described. Hydrophilic macromolecular chain transfer agent-mediated reversible addition-fragmentation chain transfer (RAFT) precipitation polymerization was used to implement the molecular imprinting of FA in the presence of CdTe quantum dots (QDs). The resulting FA-imprinted polymer nanoparticles with surface-grafted hydrophilic poly(glyceryl monomethacrylate) brushes and QDs labeling not only showed outstanding specific molecular recognition toward FA in biological samples, but also exhibited good photostability, rapid binding kinetics, and obvious template binding-induced fluorescence quenching. These characteristics make them a useful fluorescent chemosensor for directly and selectively optosensing FA in the undiluted bovine and porcine serums, with its limit of detection being 0.025μM and average recoveries ranging from 98% to 102%, even in the presence of several interfering compounds. This advanced fluorescent MIP chemosensor is highly promising for rapid quantification of FA in such applications as clinical diagnostics and food analysis.

  13. Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores.

    PubMed

    Ikanovic, Milada; Rudzinski, Walter E; Bruno, John G; Allman, Amity; Carrillo, Maria P; Dwarakanath, Sulatha; Bhahdigadi, Suneetha; Rao, Poornima; Kiel, Johnathan L; Andrews, Carrie J

    2007-03-01

    A novel assay was developed for the detection of Bacillus thuringiensis (BT) spores. The assay is based on the fluorescence observed after binding an aptamer-quantum dot conjugate to BT spores. The in vitro selection and amplification technique called SELEX (Systematic Evolution of Ligands by EXponential enrichment) was used in order to identify the DNA aptamer sequence specific for BT. The 60 base aptamer was then coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD). The assay is semi-quantitative, specific and can detect BT at concentrations of about 1,000 colony forming units/ml.

  14. Microfabricated tin-film electrodes for protein and DNA sensing based on stripping voltammetric detection of Cd(II) released from quantum dots labels.

    PubMed

    Kokkinos, Christos; Economou, Anastasios; Petrou, Panagiota S; Kakabakos, Sotirios E

    2013-11-19

    A novel disposable microfabricated tin-film electrochemical sensor was developed for the detection of proteins and DNA. The sensor was fabricated on a silicon wafer through photolithography to define the sensor geometry followed by tin sputtering. A sandwich-type immunoassay with biotinylated reporter antibody was employed for the determination of prostate-specific antigen (PSA) in human serum samples. For the detection of C533G mutation of the RET gene, biotinylated oligonucleotide probes were used. The biotinylated biomolecular probes were labeled with streptavidin (STV)-conjugated CdSe/ZnS quantum dots (QDs); quantification of the analytes was performed through acidic dissolution of the QDs and stripping voltammetric detection of the Cd(II) released. The proposed QD-based electrochemical sensor overcomes the limitations of existing voltammetric sensors and provides a mercury-free sensing platform with scope for mass-production and further potential for application in clinical diagnostics.

  15. Nitrogen-doped graphene quantum dots-labeled epitope imprinted polymer with double templates via the metal chelation for specific recognition of cytochrome c.

    PubMed

    Yan, Yun-Jing; He, Xi-Wen; Li, Wen-You; Zhang, Yu-Kui

    2017-05-15

    A novel fluorescent sensor nitrogen-doped graphene quantum dots (N-GQDs)/SiO2/molecular imprinting polymer(N-GQDs/SiO2/MIP)was fabricated by surface imprinting and epitope imprinting to recognize and detect the target protein cytochrome c (Cyt C) with fluorescence quenching. In the polymerization process, the C- and N-terminal nonapeptides of Cyt C were selected as the double templates which were fixed by functional monomer (zinc acrylate) through metal chelation and steady six-membered ring. The linear range of fluorescence quenching for this receptor towards Cyt C was 0.20-60μM, and the detection limit was 0.11μM. The precision for six times replicate determination of Cyt C at 30μM was 1.20%, and the imprinting factor (IF) was 3.06. The recoveries of the material to Cyt C in urine were 99.3-114.0%. In brief, this work proposed a strategy to prepare a new type fluorescent imprinting polymer based on N-GQDs and provided an attractive perspective for the detection of protein by using the combination of N-GQDs and molecular imprinting technique.

  16. Phage display evolution of a peptide substrate for yeast biotin ligase and application to two-color quantum dot labeling of cell surface proteins.

    PubMed

    Chen, Irwin; Choi, Yoon-Aa; Ting, Alice Y

    2007-05-23

    Site-specific protein labeling with Escherichia coli biotin ligase (BirA) has been used to introduce fluorophores, quantum dots (QDs), and photocross-linkers onto recombinant proteins fused to a 15-amino acid acceptor peptide (AP) substrate for BirA and expressed on the surface of living mammalian cells. Here, we used phage display to engineer a new and orthogonal biotin ligase-AP pair for site-specific protein labeling. Yeast biotin ligase (yBL) does not recognize the AP, but we discovered a new 15-amino acid substrate for yBL called the yeast acceptor peptide (yAP), using two generations of phage display selection from 15-mer peptide libraries. The yAP is not recognized by BirA, and thus, we were able to specifically label AP and yAP fusion proteins coexpressed in the same cell with differently colored QDs. We fused the yAP to a variety of recombinant proteins and demonstrated biotinylation by yBL at the N-terminus, C-terminus, and within a flexible internal region. yBL is extremely sequence-specific, as endogenous proteins on the surface of yeast and HeLa cells are not biotinylated. This new methodology expands the scope of biotin ligase labeling to two-color imaging and yeast-based applications.

  17. Quantum dots labelling allows detection of the homing of mesenchymal stem cells administered as immunomodulatory therapy in an experimental model of pancreatic islets transplantation.

    PubMed

    Mannucci, Silvia; Calderan, Laura; Quaranta, Paola; Antonini, Sara; Mosca, Franco; Longoni, Biancamaria; Marzola, Pasquina; Boschi, Federico

    2017-03-01

    Cell transplantation is considered a promising therapeutic approach in several pathologies but still needs innovative and non-invasive imaging technologies to be validated. The use of mesenchymal stem cells (MSCs) attracts major interest in clinical transplantation thanks to their regenerative properties, low immunogenicity and ability to regulate immune responses. In several animal models, MSCs are used in co-transplantation with pancreatic islets (PIs) for the treatment of type I diabetes, supporting graft survival and prolonging normal glycaemia levels. In this study we investigated the homing of systemically administered MSCs in a rat model of pancreatic portal vein transplantation. MSCs labelled with quantum dots (Qdots) were systemically injected by tail vein and monitored by optical fluorescence imaging. The fluorescence signal of the liver in animals co-transplanted with MSCs and PIs was significantly higher than in control animals in which MSCs alone were transplanted. By using magnetic labelling of PIs, the homing of PIs into liver was independently confirmed. These results demonstrate that MSCs injected in peripheral blood vessels preferentially accumulate into liver when PIs are transplanted in the same organ. Moreover, we prove that bimodal MRI-fluorescence imaging allows specific monitoring of the fate of two types of cells.

  18. Aptamer-based turn-on detection of thrombin in biological fluids based on efficient phosphorescence energy transfer from Mn-doped ZnS quantum dots to carbon nanodots.

    PubMed

    Zhang, Lu; Cui, Peng; Zhang, Baocheng; Gao, Feng

    2013-07-08

    This paper presents the first example of a sensitive, selective, and stable phosphorescent sensor based on phosphorescence energy transfer (PET) for thrombin that functions through thrombin-aptamer recognition events. In this work, an efficient PET donor-acceptor pair using Mn-doped ZnS quantum dots labeled with thrombin-binding aptamers (TBA QDs) as donors, and carbon nanodots (CNDs) as acceptors has been constructed. Due to the π-π stacking interaction between aptamer and CNDs, the energy donor and acceptor are taken into close proximity, leading to the phosphorescence quenching of donors, TBA QDs. A maximum phosphorescence quenching efficiency as high as 95.9% is acquired. With the introduction of thrombin to the "off state" of the TBA-QDs-CNDs system, the phosphorescence is "turned on" due to the formation of quadruplex-thrombin complexes, which releases the energy acceptor CNDs from the energy donors. Based on the restored phosphorescence, an aptamer-based turn-on thrombin biosensor has been demonstrated by using the phosphorescence as a signal transduction method. The sensor displays a linear range of 0-40 nM for thrombin, with a detection limit as low as 0.013 nM in pure buffers. The proposed aptasensor has also been used to monitor thrombin in complex biological fluids, including serum and plasma, with satisfactory recovery ranging from 96.8 to 104.3%. This is the first time that Mn-doped ZnS quantum dots and CNDs have been employed as a donor-acceptor pair to construct PET-based biosensors, which combines both the photophysical merits of phosphorescence QDs and the superquenching ability of CNDs and thus affords excellent analytical performance. We believe this proposed method could pave the way to a new design of biosensors using PET systems.

  19. Quantum dots-labeled strip biosensor for rapid and sensitive detection of microRNA based on target-recycled nonenzymatic amplification strategy.

    PubMed

    Deng, Huaping; Liu, Qianwen; Wang, Xin; Huang, Ru; Liu, Hongxing; Lin, Qiumei; Zhou, Xiaoming; Xing, Da

    2017-01-15

    MicroRNAs (miRNAs) have been proved to be potential biomarkers in early cancer diagnosis. It is of great significance for rapid and sensitive detection of miRNAs, particularly with point-of-care (POC) diagnosis. Herein, it is the first time to construct quantum dots (QDs)-labeled strip biosensor based on target-recycled nonenzymatic amplification strategy for miRNA detection. In the system, QDs were served as bright, photostable signal labels, which endow this biosensor with good detection efficiency. Moreover, a target-recycled amplification strategy relies on sequence-specific hairpins strand displacement process without the assistance of enzymes, was introduced to further improve the sensitivity. Meanwhile eliminating the requirement of environment-susceptible enzyme protein makes it easy to preserve and enhances the stability and reproducibility of this sensor. Benefiting from these outstanding characteristics, this platform exhibited a good detection sensitivity range from 2fmol to 200fmol with a limit of 200amol, using only 20μL of sample within 80min. The assay was also 10-fold more sensitive than that with a conventional colloidal gold-based test strip for miRNA detection. Additionally, the analysis of miRNA in various tumor cell extracts was in accordance with the performance of quantitative realtime polymerase chain reaction (qRT-PCR). Clinical tumor samples were also tested, and 16 of 20 samples gave out positive signals, which demonstrated the practical application capacity of the biosensor. Therefore, the proposed biosensor holds great promise for potential POC applications and early cancer diagnosis.

  20. Aptamer-based single-molecule imaging of insulin receptors in living cells

    NASA Astrophysics Data System (ADS)

    Chang, Minhyeok; Kwon, Mijin; Kim, Sooran; Yunn, Na-Oh; Kim, Daehyung; Ryu, Sung Ho; Lee, Jong-Bong

    2014-05-01

    We present a single-molecule imaging platform that quantitatively explores the spatiotemporal dynamics of individual insulin receptors in living cells. Modified DNA aptamers that specifically recognize insulin receptors (IRs) with a high affinity were selected through the SELEX process. Using quantum dot-labeled aptamers, we successfully imaged and analyzed the diffusive motions of individual IRs in the plasma membranes of a variety of cell lines (HIR, HEK293, HepG2). We further explored the cholesterol-dependent movement of IRs to address whether cholesterol depletion interferes with IRs and found that cholesterol depletion of the plasma membrane by methyl-β-cyclodextrin reduces the mobility of IRs. The aptamer-based single-molecule imaging of IRs will provide better understanding of insulin signal transduction through the dynamics study of IRs in the plasma membrane.

  1. Flourescence Assay Based on Aptamer-Quantum Dot Binding to Bacillus thuringiensis Spores

    DTIC Science & Technology

    2007-01-01

    Binding to Bacillus thuringiensis 5a. CONTRACT NUMBER N/A Spores 5b. GRANT NUMBER N/A 5c. PROGRAM ELEMENT NUMBER 62202F 6. AUTHOR(S) Milada...assay was developed for the detection of Bacillus thuringiensis (BT) spores. The assay is based on the fluorescence observed after binding an aptamer...units/ml. 15. SUBJECT TERMS Bacillus thuringiensis , Aptamer, Quantum dots, SELEX, Fluorescence 16. SECURITY CLASSIFICATION OF: Unclassified U

  2. Fluorescence Assay Based on Aptamer-Quantum Dot Binding to Bacillus thuringiensis Spores

    DTIC Science & Technology

    2007-01-01

    Binding to Bacillus thuringiensis 5a. CONTRACT NUMBER N/A Spores 5b. GRANT NUMBER N/A 5c. PROGRAM ELEMENT NUMBER 62202F 6. AUTHOR(S) Milada...assay was developed for the detection of Bacillus thuringiensis (BT) spores. The assay is based on the fluorescence observed after binding an aptamer...units/ml. 15. SUBJECT TERMS Bacillus thuringiensis , Aptamer, Quantum dots, SELEX, Fluorescence 16. SECURITY CLASSIFICATION OF: Unclassified U

  3. Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: A universal strategy for ratiometric detection of organophosphorus pesticides.

    PubMed

    Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu

    2016-01-01

    Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences.

  4. Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for Campylobacter.

    PubMed

    Bruno, John G; Sivils, Jeffrey C

    2017-03-24

    Previously reported DNA aptamers developed against surface proteins extracted from Campylobacter jejuni were further characterized by aptamer-based Western blotting and shown to bind epitopes on proteins weighing ~16 and 60 kD from reduced C. jejuni and Campylobacter coli lysates. Proteins of these approximate weights have also been identified in traditional antibody-based Western blots of Campylobacter spp. Specificity of the capture and reporter aptamers from the previous report was further validated by aptamer-based ELISA-like (ELASA) colorimetric microplate assay. Finally, the limit of detection of the previously reported plastic-adherent aptamer-magnetic bead and aptamer-quantum dot sandwich assay (PASA) was validated by an independent food safety testing laboratory to lie between 5 and 10 C. jejuni cells per milliliter in phosphate buffered saline and repeatedly frozen and thawed chicken rinsate. Such ultrasensitive and rapid (30 min) aptamer-based assays could provide alternative or additional screening tools to enhance food safety testing for Campylobacter and other foodborne pathogens.

  5. A microfluidic biosensor using graphene oxide and aptamer-functionalized quantum dots for peanut allergen detection.

    PubMed

    Weng, Xuan; Neethirajan, Suresh

    2016-11-15

    The increasing prevalence of food allergies and the intake of packing foods in the past two decades urge the need for more rapid, accurate, and sensitive assays to detect potential allergens in food in order to control the allergen content. Most of the commercial analytical tools for allergen detection rely on immunoassays such as ELISA. As far as disadvantages, ELISA can be time-consuming and expensive. Biosensors appear as a suitable alternative for the detection of allergens because they are rapid, highly sensitive, selective, less expensive, environmentally friendly, and easy to handle. In this study, we developed a microfluidic system integrated with a quantum dots (Qdots) aptamer functionalized graphene oxide (GO) nano-biosensor for simple, rapid, and sensitive food allergen detection. The biosensor utilized Qdots-aptamer-GO complexes as probes to undergo conformational change upon interaction with the food allergens, resulting in fluorescence changes due to the fluorescence quenching and recovering properties of GO by adsorption and desorption of aptamer-conjugated Qdots. This one-step 'turn on' homogenous assay in a ready-to-use microfluidic chip took ~10min to achieve a quantitative detection of Ara h 1, one of the major allergens appearing in peanuts. The results suggested this system had remarkable sensitivity and selectivity. The integration of a microfluidics platform in a homemade miniaturized optical analyzer provides a promising way for the rapid, cost-effective, and accurate on-site determination of food allergens. This biosensor can also be extended to the detection of other food allergens with a selection of corresponding aptamers.

  6. The detection of platelet derived growth factor using decoupling of quencher-oligonucleotide from aptamer/quantum dot bioconjugates

    NASA Astrophysics Data System (ADS)

    Kim, Gang-Il; Kim, Kyung-Woo; Oh, Min-Kyu; Sung, Yun-Mo

    2009-04-01

    High-sensitivity, high-specificity detection of platelet derived growth factor (PDGF)-BB was realized using the change in fluorescence resonance energy transfer (FRET) occurring between quantum dot (QD) donors and black hole quencher (BHQ) acceptors. CdSe/ZnS QD/mercaptoacetic acid (MAA)/PDGF aptamer bioconjugates were successfully synthesized using ligand exchange. Black hole quencher (BHQ)-bearing oligonucleotide molecules showing partial sequence matching to PDGF aptamer were attached to PDGF aptamers and photoluminescence (PL) quenching was obtained through FRET. By adding target PDGF-BB to the bioconjugates containing BHQs, PL recovery was detected due to detachment of BHQ-bearing oligonucleotide from the PDGF aptamer as a result of the difference in affinity to the PDGF aptamer. The detection limit of the sensor was ~0.4 nM and the linearity was maintained up to 1.6 nM in the PL intensity versus concentration curve. Measurement of PL recovery was suggested as a strong tool for high-sensitivity detection of PDGF-BB. Epidermal growth factor (EGF), the negative control molecule, did not contribute to PL recovery due to lack of binding affinity to the PDGF aptamers, which demonstrates the selectivity of the biosensor.

  7. 3D photonic crystal-based biosensor functionalized with quantum dot-based aptamer for thrombine detection

    NASA Astrophysics Data System (ADS)

    Lim, Chae Young; Choi, Eunpyo; Park, Youngkyu; Park, Jungyul

    2013-05-01

    In this paper, we propose a new technique for protein detection by using the enhancement of intensity in quantum dots (Qdot) whose emission is guided by 3D photonic crystal (PC) structures. For easy to use, we design the emitted light from the sensor can be recovered, when the chemical antibody (aptamer) conjugated with guard DNA (g-DNA) labeled with a quencher (Black FQ) hybridizes with the target proteins. In detail, we synthesis a Qdot-aptamer complex and then immobilize these complex on the PC surfaces. Next, we perform the hybridization of the Qdot-aptamer complex with g-DNA labeled with the quencher. It induces the quenching effect of fluoresce intensity in the Qdot-aptamer. In presence of target protein (thrombin), the Qdot-aptamer complex prefers to form the thrombin-aptamer complex: this results in the release of Black FQ-g-DNA and the quenched light intensity recovers into the original high intensity with Qdot. The intensity recovery varies quantitatively according to the level of the target protein concentration. This proposed sensor shows much higher detection sensitivity than the general fluorescent detection mechanism, which is functionalized on the flat surfaces because of the light guiding effect from 3D photonic crystal structures.

  8. Simultaneous imaging of two different cancer biomarkers using aptamer-conjugated quantum dots.

    PubMed

    Lee, Jonghwan; Kang, Hyo Jin; Jang, Hyeok; Lee, Youn Jung; Lee, Yong Seung; Ali, Bahy A; Al-Khedhairy, Abdulaziz A; Kim, Soonhag

    2015-04-13

    Studying gene expression profile in a single cancer cell is important because multiple genes are associated with cancer development. Quantum dots (QDs) have been utilized as biological probes for imaging and detection. QDs display specific optical and electrical properties that depend on their size that can be applied for imaging and sensing applications. In this study, simultaneous imaging of the cancer biomarkers, tenascin-C and nucleolin, was performed using two types of aptamer-conjugated QDs. The simultaneous imaging of these two different cancer markers in three cancer cell lines was reliable and cell line-specific. Current requirements for cancer imaging technologies include the need for simple preparation methods and the ability to detect multiple cancer biomarkers and evaluate their intracellular localizations. The method employed in this study is a feasible solution to these requirements.

  9. Quantum Dot Nanocrystals Coupled to DNA Aptamer Sensors for Biological Weapons Detection

    DTIC Science & Technology

    2010-08-25

    conducted using Bacillus thuringiensis (BT) spores as a pathogenic simulant. The QD-aptamer biosensor readily illuminated sections of the spore sample as...Continued studies with QD-aptamer detection of molecular bioweapon stimulant, thrombin and the spore bioweapon stimulant, bacillus thuringiensis (BT...bionanosensor was designed, optimized, and tested for robustness against stimulants of molecular and microbial biotoxins, e.g., thrombin and bacillus

  10. Tuning the Aggregation/Disaggregation Behavior of Graphene Quantum Dots by Structure-Switching Aptamer for High-Sensitivity Fluorescent Ochratoxin A Sensor.

    PubMed

    Wang, Song; Zhang, Yajun; Pang, Guangsheng; Zhang, Yingwei; Guo, Shaojun

    2017-02-07

    The design of graphene quantum dots (GQDs)-aptamer bioconjugates as the new sensing platform is very important for developing high-sensitivity fluorescent biosensors; however, achieving new bioconjugates is still a great challenge. Herein, we report the development of a new high-sensitivity fluorescent aptasensor for the detection of ochratoxin A (OTA) based on tuning aggregation/disaggregation behavior of GQDs by structure-switching aptamers. The fluorescence sensing process for OTA detection involved two key steps: (1) cDNA-aptamer (cDNA, complementary to part of the OTA aptamer) hybridization induced the aggregation of GQD (fluorescence quenching) after cDNA was added into the GQDs-aptamer bioconjugate solution, and (2) the target of OTA triggered disaggregation of GQD aggregates (fluorescence recovery). Such new fluorescent sensing platform can be used to monitor OTA with a linear range of 0 to 1 ng/mL and very low detection limit of 13 pg/mL, which is among the best in all the developed fluorescent nanoparticles-based sensors. Such sensing strategy is also successful in analyzing OTA in practical red wine sample with 94.4-102.7% of recoveries and relative standard deviation in the range of 2.9-5.8%. The present works open a new way for signaling the target-aptamer binding event by tuning aggregation/disaggregation behavior of GQDs-bioconjugates.

  11. A quantum dot-aptamer beacon using a DNA intercalating dye as the FRET reporter: application to label-free thrombin detection.

    PubMed

    Chi, Chun-Wei; Lao, Yeh-Hsing; Li, Yi-Shan; Chen, Lin-Chi

    2011-03-15

    A new quantum dot (QD)-aptamer (apt) beacon that acts by folding-induced dissociation of a DNA intercalating dye, BOBO-3(B), is demonstrated with label-free thrombin detection. The beacon, denoted as QD-apt:B, is constructed by (1) coupling of a single-stranded thrombin aptamer to Qdot 565 via EDC/Sulfo-NHS chemistry and (2) staining the duplex regions of the aptamer on QD with excess BOBO-3 before thrombin binding. When mixing a thrombin sample with QD-apt:B, BOBO-3 is competed away from the beacon due to target-induced aptamer folding, which then causes a decrease in QD fluorescence resonance energy transfer (FRET)-mediated BOBO-3 emission and achieves thrombin quantitation. In this work, the effects of Mg(2+), coupling time, and aptamer type on the beacon's performances are investigated and discussed thoroughly with various methods, including transmission electron microscopy (TEM), dynamic light scattering (DLS), and two-color differential gel electrophoresis. Using the best aptamer beacon (HTQ37), we attain highly specific and wide-range detection (from nM to μM) of thrombin in buffer, and the beacon can sense nM-range thrombin in 15% diluted serum. Compared to the reported QD aptamer assays, our method is advantageous from the aspect of using a simple sensory unit design without losing the detection sensitivity. Therefore, we consider the QD-apt:B beacon a potential alternative to immuno-reagents and an effective tool to study nucleic acid folding on QD as well.

  12. A novel aptasensor for the ultra-sensitive detection of adenosine triphosphate via aptamer/quantum dot based resonance energy transfer.

    PubMed

    Li, Zheng; Wang, Yijing; Liu, Ying; Zeng, Yongyi; Huang, Aimin; Peng, Niancai; Liu, Xiaolong; Liu, Jingfeng

    2013-09-07

    We designed a novel aptamer based biosensor (aptasensor) for ultrasensitive detection of adenosine triphosphate (ATP) through resonance energy transfer (RET). The ATP aptamer was modified with Cy3 at the 3' end, and a green quantum dot (525) was attached to the 5' end of its complementary sequence respectively. The ATP aptamer and its complementary sequence could assemble into a duplex structure in the absence of target ATP, and then decrease the distance between the quantum dot and Cy3 which could produce significant RET signal. Upon ATP binding, the ATP aptamer could dissociate with its complementary sequence and then increase the distance between the quantum dot and Cy3 which would significantly decrease the RET signal. Therefore, the ATP detection could be easily achieved through detection of the fluorescence intensity ratio between 525 nm and 560 nm. The results show that the emission fluorescence intensity ratio of 525/560 is linearly related to the logarithmic concentration of ATP. The linear range of this aptasensor is from 0.1 nM to 1 μM, and the detection limit is lower down to 0.01 nM. Excellent selectivity of this aptasensor for ATP has been demonstrated through the detection of thymidine triphosphate (TTP), cytidine triphosphate (CTP), guanosine triphosphate (GTP) and adenosine diphosphate (ADP) respectively as control. The method we described here could easily detect ATP with excellent selectivity, linearity and sensitivity down to the nanomolar range, as well as avoid photobleaching.

  13. Selective collection and detection of MCF-7 breast cancer cells using aptamer-functionalized magnetic beads and quantum dots based nano-bio-probes.

    PubMed

    Hua, Xin; Zhou, Zhenxian; Yuan, Liang; Liu, Songqin

    2013-07-25

    A novel strategy for selective collection and detection of breast cancer cells (MCF-7) based on aptamer-cell interaction was developed. Mucin 1 protein (MUC1) aptamer (Apt1) was covalently conjugated to magnetic beads to capture MCF-7 cell through affinity interaction between Apt1 and MUC1 protein that overexpressed on the surface of MCF-7 cells. Meanwhile, a nano-bio-probe was constructed by coupling of nucleolin aptamer AS1411 (Apt2) to CdTe quantum dots (QDs) which were homogeneously coated on the surfaces of monodispersed silica nanoparticles (SiO2 NPs). The nano-bio-probe displayed similar optical and electrochemical performances to free CdTe QDs, and remained high affinity to nucleolin overexpressed cells through the interaction between AS1411 and nucleolin protein. Photoluminescence (PL) and square-wave voltammetric (SWV) assays were used to quantitatively detect MCF-7 cells. Improved selectivity was obtained by using these two aptamers together as recognition elements simultaneously, compared to using any single aptamer. Based on the signal amplification of QDs coated silica nanoparticles (QDs/SiO2), the detection sensitivity was enhanced and a detection limit of 201 and 85 cells mL(-1) by PL and SWV method were achieved, respectively. The proposed strategy could be extended to detect other cells, and showed potential applications in cell imaging and drug delivery.

  14. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    PubMed Central

    Ozer, Abdullah; Pagano, John M; Lis, John T

    2014-01-01

    Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future. PMID:25093707

  15. Aptamer Sensors

    PubMed Central

    Marrazza, Giovanna

    2017-01-01

    In the last years, great progress has been accomplished in the development of aptamer sensors with different transducers. In order to improve the sensitivity of these biosensors, several methodologies have been employed. In this Special Issue, the state of art and the future trends in the field of aptamer sensors have been explored. PMID:28054983

  16. Highly sensitive bisphenol A detection by NanoAptamer assay with truncated aptamer.

    PubMed

    Lee, Eun-Hee; Lim, Hyun Jeong; Lee, Sang-Don; Son, Ahjeong

    2017-04-10

    We have developed NanoAptamer assay for sensitive quantification of bisphenol A. NanoAptamer assay employs aptamer and complementary signaling DNA, a set of quantum dots and magnetic beads. Signaling DNA - QD655 was tethered to magnetic bead - QD565 via the aptamer. Aptamer affinity with BPA resulted in the release of the signaling DNA - QD655 from the complex and hence corresponding decrease in QD655 fluorescence measurement signal. Three new aptamers (23, 58, and 24-mer) were designed via truncation of the reference aptamer (73-mer). Their respective sensitivity and selectivity of each aptamer for bisphenol A detection via NanoAptamer assay was investigated. One of the truncated aptamers (24-mer) has shown a significantly better performance (limit of detection, LOD 0.17 pg/mL) than the reference 73-mer aptamer (LOD 570 pg/mL). The 24-mer aptamer has also shown the best selectivity of bisphenol A detection over bisphenol A analogs (i.e., bisphenol B, bisphenol C, and diethylstilbestrol). It corresponded to a normalized fluorescence change of 33.7% at environmentally relevant concentration of 1 ng/mL (1 ppb) bisphenol A, while the analogs remained unchanged (2.3 - 3.9%).

  17. A homogeneous and "off-on" fluorescence aptamer-based assay for chloramphenicol using vesicle quantum dot-gold colloid composite probes.

    PubMed

    Miao, Yang-Bao; Ren, Hong-Xia; Gan, Ning; Zhou, You; Cao, Yuting; Li, Tianhua; Chen, Yinji

    2016-07-27

    In this work, a novel homogeneous and signal "off-on" aptamer based fluorescence assay was successfully developed to detect chloramphenicol (CAP) residues in food based on the fluorescence resonance energy transfer (FRET). The vesicle nanotracer was prepared through labeling single stranded DNA binding protein (SSB) on limposome-CdSe/ZnS quantum dot (SSB/L-QD) complexes. It was worth mentioning that the signal tracer (SSB/L-QD) with vesicle shape, which was fabricated being encapsulated with a number of quantum dots and SSB. The nanotracer has excellent signal amplification effects. The vesicle composite probe was formed by combining aptamer labeled nano-gold (Au-Apt) and SSB/L-QD. Which based on SSB's specific affinity towards aptamer. This probe can't emit fluoresce which is in "off" state because the signal from SSB/L-QD as donor can be quenched by the Au-aptas acceptor. When CAP was added in the composite probe solution, the aptamer on the Au-Apt can be preferentially bounded with CAP then release from the composite probe, which can turn the "off" signal of SSB/L-QD tracer into "on" state. The assay indicates excellent linear response to CAP from 0.001 nM to 10 nM and detection limit down to 0.3 pM. The vesicle probes with size of 88 nm have strong signal amplification. Because a larger number of QDs can be labeled inside the double phosphorus lipid membrane. Besides, it was employed to detect CAP residues in the milk samples with results being agreed well with those from ELISA, verifying its accuracy and reliability.

  18. A recognition-before-labeling strategy for sensitive detection of lung cancer cells with a quantum dot-aptamer complex.

    PubMed

    Wu, Chunlei; Liu, Jianbo; Zhang, Pengfei; Li, Jing; Ji, Haining; Yang, Xiaohai; Wang, Kemin

    2015-09-07

    A highly specific recognition-before-labeling strategy has been developed for sensitive detection of non-small cell lung cancer A549 cells, by using fluorescent QDs as signal units and DNA aptamers as recognition elements. A QD-aptamer system used for cell imaging and bioanalysis mostly relies on the recognition-after-labeling strategy in which aptamers were firstly labeled with QDs and then the QD-aptamer conjugates as a whole were utilized for specific recognition. Here in our strategy, aptamers were used firstly to recognize target cells, and then fluorescent QDs were sequentially added to bind the aptamers and light the target cells. The proposed recognition-before-labeling strategy didn't require the complex process of QD functionalization, and avoided the possible impact on the aptamer configuration from steric hindrance. Meanwhile, QDs, with strong fluorescence and good photostability, also give this method a high signal-to-background ratio (S/B). The recognition-before-labeling strategy is simple and sensitive, suggesting a new method for in vitro diagnostic assays of cancer cells.

  19. Robust and specific ratiometric biosensing using a copper-free clicked quantum dot-DNA aptamer sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Haiyan; Feng, Guoqiang; Guo, Yuan; Zhou, Dejian

    2013-10-01

    We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the native fluorescence quantum yield (QY) of the parent DHLA-PEG-N3 capped QD, but also well-suited for robust and specific biosensing; it can directly quantitate, at the pM level, both labelled and unlabelled complementary DNA probes with a good SNP (single-nucleotide polymorphism) discrimination ability in complex media, e.g. 10% human serum via target-binding induced FRET changes between the QD donor and the dye acceptor. Furthermore, this sensor has also been successfully exploited for the detection, at the pM level, of a specific protein target (thrombin) via the encoded anti-thrombin aptamer sequence in the QD-DNA conjugate.We report herein the successful preparation of a compact and functional CdSe-ZnS core-shell quantum dot (QD)-DNA conjugate via highly efficient copper-free ``click chemistry'' (CFCC) between a dihydro-lipoic acid-polyethylene glycol-azide (DHLA-PEG-N3) capped QD and a cyclooctyne modified DNA. This represents an excellent balance between the requirements of high sensitivity, robustness and specificity for the QD-FRET (Förster resonance energy transfer) based sensor as confirmed by a detailed FRET analysis on the QD-DNA conjugate, yielding a relatively short donor-acceptor distance of ~5.8 nm. We show that this CFCC clicked QD-DNA conjugate is not only able to retain the

  20. Recognition and capture of metastatic hepatocellular carcinoma cells using aptamer-conjugated quantum dots and magnetic particles.

    PubMed

    Wang, Fu-Bing; Rong, Yuan; Fang, Min; Yuan, Jing-Ping; Peng, Chun-Wei; Liu, Shao-Ping; Li, Yan

    2013-05-01

    Metastatic recurrence is the most important biological behavior of hepatocellular carcinoma (HCC) and the main cause of treatment failure. Early prediction of metastasis is currently impossible due to the lack of specific molecular probes to recognize metastatic HCC cells. Aptamers have recently emerged as promising potential molecular probes for biomedical applications. Two well-matched HCC cell lines including HCCLM9 with high metastatic potential and MHCC97-L with low metastatic potential, were used to select aptamers for HCC metastasis. With a whole-cell-SELEX strategy, in which HCCLM9 cells were used as target cells and MHCC97-L cells as subtractive cell, 6 potential aptamers had been generated. Detailed study on selected aptamer LY-1 revealed that it could bind metastatic HCC cells with high affinity and specificity, not only in cells culture and animal models of HCC metastasis, but also in clinical HCC specimens. Moreover, the aptamer LY-1 and magnetic particles conjugates could efficiently capture the HCC cells from complex mixture whole blood. These studies demonstrated that this HCC specific aptamer LY-1 could be a promising molecular probe to recognize metastatic HCC cells.

  1. Aptamer and 5-fluorouracil dual-loading Ag2S quantum dots used as a sensitive label-free probe for near-infrared photoluminescence turn-on detection of CA125 antigen.

    PubMed

    Jin, Hui; Gui, Rijun; Gong, Jun; Huang, Wenxue

    2017-06-15

    In this article, Ag2S quantum dots (QDs) were prepared by a facile aqueous synthesis method, using thiourea as a new sulfur precursor. Based on electrostatic interactions, 5-fluorouracil (5-Fu) was combined with the aptamer of CA125 antigen to fabricate aptamer/5-Fu complex. The surface of as-prepared Ag2S QDs was modified with polyethylenimine, followed by combination with the aptamer/5-Fu complex to form Ag2S QDs/aptamer/5-Fu hybrids. During the combination of Ag2S QDs with aptamer/5-Fu complex, near-infrared (NIR) photoluminescence (PL) of QDs (peaked at 850nm) was markedly reduced under excitation at 625nm, attributed to photo-induced electron transfer from QDs to 5-Fu. However, the addition of CA125 induced obvious NIR PL recovery, which was ascribed to the strong binding affinity of CA125 with its aptamer, and the separation of aptamer/5-Fu complex from the surface of QDs. Hence, the Ag2S QDs/aptamer/5-Fu hybrids were developed as a novel NIR PL turn-on probe of CA125. In the concentration range of [CA125] from 0.1 to 10(6)ngmL(-1), there were a good linear relationship between NIR PL intensities of Ag2S QDs and Log[CA125], and a low limit of detection of 0.07ngmL(-1). Experimental results revealed the highly selective and sensitive NIR PL responses of this probe to CA125, over other potential interferences. In real human body fluids, this probe also exhibited superior analytical performance, together with high detection recoveries.

  2. A fluorescent nanosensor based on graphene quantum dots-aptamer probe and graphene oxide platform for detection of lead (II) ion.

    PubMed

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Chen, Jian Rong; Feng, Hui

    2015-06-15

    The sensitive detection of heavy metal ions in the organism and aquatic ecosystem using nanosensors based on environment friendly and biocompatible materials still remains a challenge. A fluorescent turn-on nanosensor for lead (II) detection based on biocompatible graphene quantum dots and graphene oxide by employment of Pb(2+)-induced G-quadruplex formation was reported. Graphene quantum dots with high quantum yield, good biocompatibility were prepared and served as the fluorophore of Pb(2+) probe. Fluorescence turn-off of graphene quantum dots is easily achieved through efficient photoinduced electron transfer between graphene quantum dots and graphene oxide, and subsequent fluorescence turn-on process is due to the formation of G-quadraplex aptamer-Pb(2+) complex triggered by the addition of Pb(2+). This nanosensor can distinguish Pb(2+) ion from other ions with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a fast response time of one minute, a broad linear span of up to 400.0 nM and ultralow detection limit of 0.6 nM.

  3. Tracking Quantum-Dot labeled neurotropic factors transport along primary neuronal axons in compartmental microfluidic chambers.

    PubMed

    Gluska, Shani; Chein, Michael; Rotem, Nimrod; Ionescu, Ariel; Perlson, Eran

    2016-01-01

    Neurons are highly polarized cells, with very long axons. Neurotrophic factors like the neuronal growth factor (NGF) are secreted from neuronal targets to promote neuron survival and proper function. These neurotrophic factors must undergo retrograde axonal transport towards the cell body, wherein they initiate signaling pathways important for neurons' various functions and overall health. This process of long-distance axonal signaling is conducted by the dynein motor protein, which transmits signaling endosomes of ligand-receptor complexes retrogradely along microtubule tracks. Here we describe step by step the use of polydimethylsiloxane (PDMS) compartmentalized microfluidic chambers for tracking axonal transport of trophic factors, with a focus on labeled NGF. We describe in detail how to fabricate the molds, assemble the PDMS platform, plate neurons and image, as well as analyze NGF transport along the axon. This method is useful for studying molecular communication mechanisms within the neuron's different compartments as well as between the neuron and its diverse microenvironments, both in health and under pathological conditions.

  4. Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

    DTIC Science & Technology

    2008-12-01

    This process has been used to select aptamers against different types of targets ( Bacillus anthracis spores, Bacillus thuringiensis spores, MS-2...aptamers of Bacillus anthracis (Ba), Shiga toxin, botulinum neurotoxin (BoNT), and Francisella tularensis bacteria (all selected by SELEX) have been...preparation procedure for DNA capture element sensing system. quantum dots were used here for the DNA capture element sys- tems of Bacillus anthracis

  5. A new strategy for the detection of adenosine triphosphate by aptamer/quantum dot biosensor based on chemiluminescence resonance energy transfer.

    PubMed

    Zhou, Zi-Ming; Yu, Yong; Zhao, Yuan-Di

    2012-09-21

    We designed an aptasensor for the detection of adenosine triphosphate (ATP) based on chemiluminescence resonance energy transfer (CRET). An adenosine aptamer was cut into two pieces of ssDNA, which were attached to quantum dots (QDs) and horse radish peroxidase (HRP), respectively. They could reassemble into specific structures in the presence of ATP and then decrease the distance of HRP and QDs. ATP detection can be easily realized according to the fluorescent intensity of QDs, which is excited by CRET between luminol and QDs. Results show that the concentration of ATP is linear relation with the fluorescent intensity of the peak of QDs emission and the linear range for the linear equation is from 50 μM to 231 μM and the detection limit was 185 nM. When the concentration of ATP was 2 mM, the efficiency of CRET is 13.6%. Good specificity for ATP had been demonstrated compared to thymidine triphosphate (TTP), cytidine triphosphate (CTP) and guanosine triphosphate (GTP), when 1 mM of each was added, respectively. This method needs no external light source and can avoid autofluorescence and photobleaching, and ATP can be detected selectively, specifically, and sensitively in a low micromolar range, which means that the strategy reported here can be applicable to the detection of several other target molecules.

  6. A disposable electrochemiluminescence device for ultrasensitive monitoring of K562 leukemia cells based on aptamers and ZnO@carbon quantum dots.

    PubMed

    Zhang, Meng; Liu, Heng; Chen, Long; Yan, Mei; Ge, Lei; Ge, Shenguang; Yu, Jinghua

    2013-11-15

    We developed a new electrochemiluminescence (ECL) platform for ultrasensitive and selective detection of leukemia cells. In order to construct the platform, the nonporous gold with controllable three-dimensional porosity and good conductivity was used to modify the screen-printed carbon electrode. The carbon quantum dots (CQDs) coated ZnO nanosphere (ZnO@CQDs) were used as good ECL label with low cytotoxicity and good biocompatibility. Structure characterization was obtained by means of transmission electron microscopy and scanning electron microscopy images. The aptamer was used for cell capture and the concanavalin A conjugated ZnO@CQDs was used for selective recognition of the cell surface carbohydrate. The proposed method showed a good analytical performance for the detection of K562 cells ranging from 1.0 × 10(2) to 2.0 × 10(7) cells mL(-1) with a detection limit of 46 cells mL(-1). The as-proposed device has the advantages of high sensitivity, nice specificity and good stability and could offer great promise for sensitive detection of leukemia cells in response to therapy.

  7. Aptamers in Therapeutics

    PubMed Central

    2016-01-01

    Aptamers are single strand DNA or RNA molecules, selected by an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to various advantages of aptamers such as high temperature stability, animal free, cost effective production and its high affinity and selectivity for its target make them attractive alternatives to monoclonal antibody for use in diagnostic and therapeutic purposes. Aptamer has been generated against vesicular endothelial growth factor 165 involved in age related macular degeneracy. Macugen was the first FDA approved aptamer based drug that was commercialized. Later other aptamers were also developed against blood clotting proteins, cancer proteins, antibody E, agents involved in diabetes nephropathy, autoantibodies involved in autoimmune disorders, etc. Aptamers have also been developed against viruses and could work with other antiviral agents in treating infections. PMID:27504277

  8. Advances in aptamers.

    PubMed

    Syed, Muhammad Ali; Pervaiz, Saima

    2010-10-01

    Aptamers are nucleic acid sequences synthesized through in vitro selection and amplification technique, possessing a broader range of applications in therapeutics, biosensing, diagnostics, and research. Aptamers offer a number of advantages over their antibodies counterpart, one of them is their ability to undergo chemical derivatization to increase their life in the body fluids and bioavailability in animals. Although aptamers were discovered in 1990s, they have become one of the most widely investigated molecules, with a huge number of publications in the last decade. This article presents an overview of the advancements that have been made in aptamers. We mainly focused on articles published since 2005.

  9. Aptamer-Functionalized Nano-Biosensors

    PubMed Central

    Chiu, Tai-Chia; Huang, Chih-Ching

    2009-01-01

    Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs), metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs). We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused. PMID:22303178

  10. Aptamer-based nanobiosensors.

    PubMed

    Kim, Yeon Seok; Raston, Nurul Hanun Ahmad; Gu, Man Bock

    2016-02-15

    It has been more than two decades since aptamer and the systematic evolution of ligands by exponential enrichment (SELEX) method were discovered by Larry Gold and Andrew Ellington in 1990, respectively. Based on the various advantages of aptamers, they have become a potent rival of antibodies in therapeutics and bio-analysis. Especially, the recent advances in aptamer biosensor application are remarkable due to its intrinsic properties of aptamers as nucleic acids and target induced conformational changes, in addition to the introduction of graphene oxide-based easy and simple immobilization-free screening method even for dual aptamers. In addition, the incorporation of various nanomaterials such as metallic nanoparticles, carbon materials, and functional nanospheres in aptasensors has facilitated the improvement of analytical performance and commercial application of aptasensors. In this review, recent prominent reports on aptasensors utilizing nanomaterials were introduced to understand the principle of aptamer-based biosensors and provide an insight for new strategies of aptasensors and the application of various nanomaterials. The perspective on aptamer-based biosensors and diagnostics was also discussed in view of technology and market.

  11. Aptamers against pathogenic microorganisms

    PubMed Central

    Davydova, Anna; Vorobjeva, Maria; Pyshnyi, Dmitrii; Altman, Sidney; Vlassov, Valentin; Venyaminova, Alya

    2016-01-01

    Abstract An important current issue of modern molecular medicine and biotechnology is the search for new approaches to early diagnostic assays and adequate therapy of infectious diseases. One of the promising solutions to this problem might be a development of nucleic acid aptamers capable of interacting specifically with bacteria, protozoa, and viruses. Such aptamers can be used for the specific recognition of infectious agents as well as for blocking of their functions. The present review summarizes various modern SELEX techniques used in this field, and of several currently identified aptamers against viral particles and unicellular organisms, and their applications. The prospects of applying nucleic acid aptamers for the development of novel detection systems and antibacterial and antiviral drugs are discussed. PMID:26258445

  12. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    PubMed Central

    Opazo, Felipe; Eiden, Laura; Hansen, Line; Rohrbach, Falk; Wengel, Jesper; Kjems, Jørgen; Mayer, Günter

    2015-01-01

    Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications. PMID:26325628

  13. Fluorescent Aptamer Sensors

    NASA Astrophysics Data System (ADS)

    Chen, Hui William; Kim, Youngmi; Meng, Ling; Mallikaratchy, Prabodhika; Martin, Jennifer; Tang, Zhiwen; Shangguan, Dihua; O'Donoghue, Meghan; Tan, Weihong

    Aptamers are single-stranded nucleic acid probes that can be evolved to have high specificity and affinity for different targets. These targets include biomar-ker proteins, small molecules, and even whole live cells that express a variety of surface proteins of interest. Aptamers offer several advantages over protein-based molecular probes such as low immunogenic activity, flexible modification, and in vitro synthesis. In addition, aptamers used as molecular probes can be made with easy signaling for binding with their corresponding targets. There are a few different fluorescence-based signal transduction mechanisms, such as direct fluorophore labeling, fluorescence resonance energy transfer (FRET), fluorescence quenching, fluorescence anisotropy, and light-switching excimers. These signaling processes in combination with various labeling strategies of nucleic acid aptamers contribute to simple, rapid, sensitive, and selective biological assays. In this chapter, we discuss the optical signaling of aptamers for single proteins such as α-thrombin and platelet-derived growth factor (PDGF). We also present detailed discussion about fluorescent aptamers developed from cell-based systematic evolution of ligands by exponential enrichment (SELEX) for the recognition of different target tumor cells.

  14. Analysis and Identification of Aptamer-Compound Interactions with a Maximum Relevance Minimum Redundancy and Nearest Neighbor Algorithm

    PubMed Central

    Wang, ShaoPeng; Zhang, Yu-Hang; Lu, Jing; Cui, Weiren; Hu, Jerry; Cai, Yu-Dong

    2016-01-01

    The development of biochemistry and molecular biology has revealed an increasingly important role of compounds in several biological processes. Like the aptamer-protein interaction, aptamer-compound interaction attracts increasing attention. However, it is time-consuming to select proper aptamers against compounds using traditional methods, such as exponential enrichment. Thus, there is an urgent need to design effective computational methods for searching effective aptamers against compounds. This study attempted to extract important features for aptamer-compound interactions using feature selection methods, such as Maximum Relevance Minimum Redundancy, as well as incremental feature selection. Each aptamer-compound pair was represented by properties derived from the aptamer and compound, including frequencies of single nucleotides and dinucleotides for the aptamer, as well as the constitutional, electrostatic, quantum-chemical, and space conformational descriptors of the compounds. As a result, some important features were obtained. To confirm the importance of the obtained features, we further discussed the associations between them and aptamer-compound interactions. Simultaneously, an optimal prediction model based on the nearest neighbor algorithm was built to identify aptamer-compound interactions, which has the potential to be a useful tool for the identification of novel aptamer-compound interactions. The program is available upon the request. PMID:26955638

  15. Analysis and Identification of Aptamer-Compound Interactions with a Maximum Relevance Minimum Redundancy and Nearest Neighbor Algorithm.

    PubMed

    Wang, ShaoPeng; Zhang, Yu-Hang; Lu, Jing; Cui, Weiren; Hu, Jerry; Cai, Yu-Dong

    2016-01-01

    The development of biochemistry and molecular biology has revealed an increasingly important role of compounds in several biological processes. Like the aptamer-protein interaction, aptamer-compound interaction attracts increasing attention. However, it is time-consuming to select proper aptamers against compounds using traditional methods, such as exponential enrichment. Thus, there is an urgent need to design effective computational methods for searching effective aptamers against compounds. This study attempted to extract important features for aptamer-compound interactions using feature selection methods, such as Maximum Relevance Minimum Redundancy, as well as incremental feature selection. Each aptamer-compound pair was represented by properties derived from the aptamer and compound, including frequencies of single nucleotides and dinucleotides for the aptamer, as well as the constitutional, electrostatic, quantum-chemical, and space conformational descriptors of the compounds. As a result, some important features were obtained. To confirm the importance of the obtained features, we further discussed the associations between them and aptamer-compound interactions. Simultaneously, an optimal prediction model based on the nearest neighbor algorithm was built to identify aptamer-compound interactions, which has the potential to be a useful tool for the identification of novel aptamer-compound interactions. The program is available upon the request.

  16. Engineering new aptamer geometries for electrochemical aptamer-based sensors

    NASA Astrophysics Data System (ADS)

    White, Ryan J.; Plaxco, Kevin W.

    2009-05-01

    Electrochemical aptamer-based sensors (E-AB sensors) represent a promising new approach to the detection of small molecules. E-AB sensors comprise an aptamer that is attached at one end to an electrode surface. The distal end of the aptamer probed is modified with an electroactive redox marker for signal transduction. Herein we report on the optimization of a cocaine-detecting E-AB sensor via optimization of the geometry of the aptamer. We explore two new aptamer architectures, one in which we concatenate three cocaine aptamers into a poly-aptamer and a second in which we divide the cocaine aptamer into pieces connected via an unstructured, 60-thymine linker. Both of these structures are designed such that the reporting redox tag will be located farther from the electrode in the unfolded, target-free conformation. Consistent with this, we find that signal gains of these two constructs are two to three times higher than that of the original E-AB architecture. Likewise all three architectures are selective enough to deploy directly in complex sample matrices, such as undiluted whole blood, with all three sensors successfully detecting the presence of cocaine. The findings in this ongoing study should be of value in future efforts to optimize the signaling of electrochemical aptamer-based sensors.

  17. Aptamers and Their Biological Applications

    PubMed Central

    Song, Kyung-Mi; Lee, Seonghwan; Ban, Changill

    2012-01-01

    Recently, aptamers have attracted the attention of many scientists, because they not only have all of the advantages of antibodies, but also have unique merits, such as thermal stability, low cost, and unlimited applications. In this review, we present the reasons why aptamers are known as alternatives to antibodies. Furthermore, several types of in vitro selection processes, including nitrocellulose membrane filtration, affinity chromatography, magnetic bead, and capillary electrophoresis-based selection methods, are explained in detail. We also introduce various applications of aptamers for the diagnosis of diseases and detection of small molecules. Numerous analytical techniques, such as electrochemical, colorimetric, optical, and mass-sensitive methods, can be utilized to detect targets, due to convenient modifications and the stability of aptamers. Finally, several medical and analytical applications of aptamers are presented. In summary, aptamers are promising materials for diverse areas, not just as alternatives to antibodies, but as the core components of medical and analytical equipment. PMID:22368488

  18. The Toolbox for Modified Aptamers.

    PubMed

    Lapa, Sergey A; Chudinov, Alexander V; Timofeev, Edward N

    2016-02-01

    Aptamers are nucleic acid-based scaffolds that can bind with high affinity to a variety of biological targets. Aptamers are identified from large DNA or RNA libraries through a process of directed molecular evolution (SELEX). Chemical modification of nucleic acids considerably increases the functional and structural diversity of aptamer libraries and substantially increases the affinity of the aptamers. Additionally, modified aptamers exhibit much greater resistance to biodegradation. The evolutionary selection of modified aptamers is conditioned by the possibility of the enzymatic synthesis and replication of non-natural nucleic acids. Wild-type or mutant polymerases and their non-natural nucleotide substrates that can support SELEX are highlighted in the present review. A focus is made on the efforts to find the most suitable type of nucleotide modifications and the engineering of new polymerases. Post-SELEX modification as a complementary method will be briefly considered as well.

  19. Novel Aptamers to Target Metastasis

    DTIC Science & Technology

    2012-11-01

    AD_________________ Award Number: W81XWH-09-1-0154 TITLE: Novel Aptamers To Target Metastasis...August 2012 4. TITLE AND SUBTITLE Novel Aptamers to Target Metastasis 5a. CONTRACT NUMBER . 5b. GRANT NUMBER W81XWH-09-1-0154 5c. PROGRAM ELEMENT...problems. Aptamers , which have proven clinical efficacy for non-neoplastic disease and are generally more specific and stable than antibodies, may have

  20. Aptamers: versatile molecular recognition probes for cancer detection

    PubMed Central

    Sun, Hongguang; Tan, Weihong; Zu, Youli

    2015-01-01

    In the past two decades, aptamers have emerged as a novel class of molecular recognition probes comprising uniquely-folded short RNA or single-stranded DNA oligonucleotides that bind to their cognate targets with high specificity and affinity. Aptamers, often referred to as “chemical antibodies”, possess several highly desirable features for clinical use. They can be chemically synthesized and are easily conjugated to a wide range of reporters for different applications, and are able to rapidly penetrate tissues. These advantages significantly enhance their clinical applicability, and render them excellent alternatives to antibody-based probes in cancer diagnostics and therapeutics. Aptamer probes based on fluorescence, colorimetry, magnetism, electrochemistry, and in conjunction with nanomaterials (e.g., nanoparticles, quantum dots, single-walled carbon nanotubes, and magnetic nanoparticles) have provided novel ultrasensitive cancer diagnostic strategies and assays. Furthermore, promising aptamer targeted-multimodal tumor imaging probes have been recently developed in conjunction with fluorescence, positron emission tomography (PET), single-photon emission computed tomography (SPECT), and magnetic resonance imaging (MRI). The capabilities of the aptamer-based platforms described herein underscore the great potential they hold for the future of cancer detection. In this review, we highlight the most prominent recent developments in this rapidly advancing field. PMID:26618445

  1. Molecular diagnostic and drug delivery agents based on aptamer-nanomaterial conjugates.

    PubMed

    Lee, Jung Heon; Yigit, Mehmet V; Mazumdar, Debapriya; Lu, Yi

    2010-04-30

    Recent progress in an emerging area of designing aptamer and nanomaterial conjugates as molecular diagnostic and drug delivery agents in biomedical applications is summarized. Aptamers specific for a wide range of targets are first introduced and compared to antibodies. Methods of integrating these aptamers with a variety of nanomaterials, such as gold nanoparticles, quantum dots, carbon nanotubes, and superparamagnetic iron oxide nanoparticles, each with unique optical, magnetic, and electrochemical properties, are reviewed. Applications of these systems as fluorescent, colorimetric, magnetic resonance imaging, and electrochemical sensors in medical diagnostics are given, along with new applications as smart drug delivery agents.

  2. Molecular Diagnostic and Drug Delivery Agents based on Aptamer-Nanomaterial Conjugates

    PubMed Central

    Lee, Jung Heon; Yigit, Mehmet V.; Mazumdar, Debapriya; Lu, Yi

    2010-01-01

    Recent progress in an emerging area of designing aptamer and nanomaterial conjugates as molecular diagnostic and drug delivery agents in biomedical applications is summarized. Aptamers specific for a wide range of targets are first introduced and compared to antibodies. Methods of integrating these aptamers with a variety of nanomaterials, such as gold nanoparticles, quantum dots, carbon nanotubes, and superparamagnetic iron oxide nanoparticles, each with unique optical, magnetic, and electrochemical properties, are reviewed. Applications of these systems as fluorescent, colorimetric, magnetic resonance imaging, and electrochemical sensors in medical diagnostics are given, along with new applications as smart drug delivery agents. PMID:20338204

  3. Modifications of the chromophore of Spinach aptamer based on QM:MM calculations.

    PubMed

    Skúpa, Katarína; Urban, Ján

    2017-02-01

    Spinach aptamer was developed as an RNA analog of the green fluorescent protein. The aptamer interacts with its ligand and modifies its electronic spectrum so that it fluoresces brightly at the wavelength of 501 nm. Song et al. investigated modifications of the ligand in their experimental study and found a molecule emitting at 523 nm upon creating a complex with the Spinach aptamer. The crystal structure of the aptamer in complex with its original ligand has been published, which enabled us to study the system computationally. In this article, we suggest several new modifications of the ligand that shift the emission maximum of the complex to even longer wavelengths. Our results are based on combined quantum mechanical/molecular mechanical calculations with DFT method used for geometry optimization and TD-DFT for calculations of absorption and emission energies.

  4. Aptamer-Based Fluorescent Biosensors

    PubMed Central

    Wang, Rongsheng E.; Zhang, Yin; Cai, Jianfeng; Cai, Weibo; Gao, Ting

    2011-01-01

    Selected from random pools of DNA or RNA molecules through systematic evolution of ligands by exponential enrichment (SELEX), aptamers can bind to target molecules with high affinity and specificity, which makes them ideal recognition elements in the development of biosensors. To date, aptamer-based biosensors have used a wide variety of detection techniques, which are briefly summarized in this article. The focus of this review is on the development of aptamer-based fluorescent biosensors, with emphasis on their design as well as properties such as sensitivity and specificity. These biosensors can be broadly divided into two categories: those using fluorescently-labeled aptamers and others that employ label-free aptamers. Within each category, they can be further divided into “signal-on” and “signal-off” sensors. A number of these aptamer-based fluorescent biosensors have shown promising results in biological samples such as urine and serum, suggesting their potential applications in biomedical research and disease diagnostics. PMID:21838688

  5. Colorimetric Detection with Aptamer-Gold Nanoparticle Conjugates: Effect of Aptamer Length on Response

    DTIC Science & Technology

    2012-11-01

    AFRL-RH-WP-TR-2012-0152 COLORIMATETRIC DETECTION WITH APTAMER -GOLD NANOPARTICLE CONJUGATES: EFFECT OF APTAMER LENGTH ON RESPONSE...September 2011 4. TITLE AND SUBTITLE Colorimetric Detection with Aptamer -Gold Nanoparticle Conjugates: Effect of Aptamer Length on Response 5a...SUPPLEMENTARY NOTES 88ABW-2011-6451, cleared 15 Dec 11 14. ABSTRACT A riboflavin binding aptamer (RBA) was used in combination with gold

  6. Aptamers: Biomedical Interest and Applications.

    PubMed

    Romero-López, Cristina; Berzal-Herranz, Alfredo

    2017-03-16

    Aptamers are short DNA or RNA oligonucleotides specialized in the specific and efficient binding to a target molecule. They are obtained by in vitro selection or evolution processes. It was in 1990 that two independent research groups described the bases of a new in vitro technology for the identification of RNA molecules able to specifically bind to a target [1,2]. Tuerk and Gold established the principals of the in vitro selection process that was named SELEX (Systematic Evolution of Ligands by Exponential enrichment), which is based on iterative cycles of binding, partitioning, and amplification of oligonucleotides from a pool of variant sequences [2]. Ellington and Szostak coined the term aptamer to define the selected molecules by the application of this method [1]. To date, numerous reports have described the isolation of aptamers directed against a great variety of targets covering a wide diversity of molecules varying in nature, size, and complexity ranging from ions to whole cells, including small molecules (e.g., aminoacids, nucleotides, antibiotics), peptides, proteins, nucleic acids, and viruses, among others (for example, see [3-6]). Modifications and optimization of the SELEX procedure aimed to get newly modified aptamers has also attracted much interest (examples can be found in [7,8]). These advances along with the parallel progresses in the nucleic acids chemistry and cellular delivery fields have allowed for the rise of a new hope in developing aptamers as efficient molecular tools for diagnostics and therapeutics (for recent comprehensive reviews, see [9-11]).

  7. Selection of DNA aptamers against VEGF165 using a protein competitor and the aptamer blotting method.

    PubMed

    Hasegawa, Hijiri; Sode, Koji; Ikebukuro, Kazunori

    2008-05-01

    Two DNA aptamers against a tumor marker protein, human vascular endothelial growth factor (VEGF(165)) were identified. In the screening process, another protein was used as the competitor to isolate those aptamers that have high specificity for the target. In addition, we evaluated the affinities of the enriched library by means of aptamer blotting. The isolated aptamers bound to VEGF(165) with a K(d) value in the range of a few hundred nanomoles, and did not bind to the competitor. This selection method enabled us to efficiently select the specific aptamers against the target protein. These specific aptamers would be useful sensor elements for cancer diagnosis.

  8. Quantitative selection and parallel characterization of aptamers

    PubMed Central

    Cho, Minseon; Soo Oh, Seung; Nie, Jeff; Stewart, Ron; Eisenstein, Michael; Chambers, James; Marth, Jamey D.; Walker, Faye; Thomson, James A.; Soh, H. Tom

    2013-01-01

    Aptamers are promising affinity reagents that are potentially well suited for high-throughput discovery, as they are chemically synthesized and discovered via completely in vitro selection processes. Recent advancements in selection, sequencing, and the use of modified bases have improved aptamer quality, but the overall process of aptamer generation remains laborious and low-throughput. This is because binding characterization remains a critical bottleneck, wherein the affinity and specificity of each candidate aptamer are measured individually in a serial manner. To accelerate aptamer discovery, we devised the Quantitative Parallel Aptamer Selection System (QPASS), which integrates microfluidic selection and next-generation sequencing with in situ-synthesized aptamer arrays, enabling simultaneous measurement of affinity and specificity for thousands of candidate aptamers in parallel. After using QPASS to select aptamers for the human cancer biomarker angiopoietin-2 (Ang2), we in situ synthesized arrays of the selected sequences and obtained equilibrium dissociation constants (Kd) for every aptamer in parallel. We thereby identified over a dozen high-affinity Ang2 aptamers, with Kd as low as 20.5 ± 7.3 nM. The same arrays enabled us to quantify binding specificity for these aptamers in parallel by comparing relative binding of differentially labeled target and nontarget proteins, and by measuring their binding affinity directly in complex samples such as undiluted serum. Finally, we show that QPASS offers a compelling avenue for exploring structure−function relationships for large numbers of aptamers in parallel by coupling array-based affinity measurements with next-generation sequencing data to identify nucleotides and motifs within the aptamer that critically affect Ang2 binding. PMID:24167271

  9. Investigating the malleability of RNA aptamers

    SciTech Connect

    Ilgu, Muslum; Wang, Tianjiao; Lamm, Monica H.; Nilsen-Hamilton, Marit

    2013-03-25

    Aptamers are short, single-stranded nucleic acids with structures that frequently change upon ligand binding and are sensitive to the ionic environment. To achieve facile application of aptamers in controlling cellular activities, a better understanding is needed of aptamer ligand binding parameters, structures, intramolecular mobilities and how these structures adapt to different ionic environments with consequent effects on their ligand binding characteristics.The paper discusses the integration of biochemical analysis with NMR spectroscopy and computational modeling to explore the relation between ligand binding and structural malleability of some well-studied aptamers. Several methods for determining aptamer binding affinity and specificity are discussed, including isothermal titration calorimetry, steady state fluorescence of 2-aminopurine substituted aptamers, and dye displacement assays. Also considered are aspects of molecular dynamics simulations specific to aptamers including adding ions and simulating aptamer structure in the absence of ligand when NMR spectroscopy or X-ray crystallography structures of the unoccupied aptamer are not available. We focus specifically on RNA aptamers that bind small molecule ligands as would be applied in sensors or integrated into riboswitches such as to measure the products of metabolic activity.

  10. STED nanoscopy with fluorescent quantum dots

    NASA Astrophysics Data System (ADS)

    Hanne, Janina; Falk, Henning J.; Görlitz, Frederik; Hoyer, Patrick; Engelhardt, Johann; Sahl, Steffen J.; Hell, Stefan W.

    2015-05-01

    The widely popular class of quantum-dot molecular labels could so far not be utilized as standard fluorescent probes in STED (stimulated emission depletion) nanoscopy. This is because broad quantum-dot excitation spectra extend deeply into the spectral bands used for STED, thus compromising the transient fluorescence silencing required for attaining super-resolution. Here we report the discovery that STED nanoscopy of several red-emitting commercially available quantum dots is in fact successfully realized by the increasingly popular 775 nm STED laser light. A resolution of presently ~50 nm is demonstrated for single quantum dots, and sub-diffraction resolution is further shown for imaging of quantum-dot-labelled vimentin filaments in fibroblasts. The high quantum-dot photostability enables repeated STED recordings with >1,000 frames. In addition, we have evidence that the tendency of quantum-dot labels to blink is largely suppressed by combined action of excitation and STED beams. Quantum-dot STED significantly expands the realm of application of STED nanoscopy, and, given the high stability of these probes, holds promise for extended time-lapse imaging.

  11. A Highly Selective and Sensitive Fluorescence Detection Method of Glyphosate Based on an Immune Reaction Strategy of Carbon Dot Labeled Antibody and Antigen Magnetic Beads.

    PubMed

    Wang, Duo; Lin, Bixia; Cao, Yujuan; Guo, Manli; Yu, Ying

    2016-08-03

    A sensitive fluorescence detection method for glyphosate (GLY) was established based on immune reaction. First, carbon dot labeled antibodies (lgG-CDs) which were able to specifically identify glyphosate were prepared with the environmentally friendly carbon dots (CDs) and glyphosate antibody (lgG). lgG-CDs could be used to in situ visualize the distribution of glyphosate in plant tissues. In order to eliminate the effects of excess lgG-CDs on the determination of GLY, antigen magnetic beads Fe3O4-GLY based on magnetic nanoparticles Fe3O4 and glyphosate were constructed and utilized to couple with the excess lgG-CDs. After magnetic separation to remove antigen magnetic beads, there was a linear relationship between the fluorescence intensity of lgG-CDs and the logarithmic concentration of glyphosate in the range of 0.01-80 μg/mL with a detection limit of 8 ng/mL. The method was used for the detection of glyphosate in Pearl River water, tea, and soil samples with satisfactory recovery ratio between 87.4% and 103.7%.

  12. Microfluidic approaches to rapid and efficient aptamer selection

    PubMed Central

    Lin, Hui; Zhang, Weiting; Jia, Shasha; Guan, Zhichao; Yang, Chaoyong James; Zhu, Zhi

    2014-01-01

    With their advantages as molecular recognition elements, aptamers have been extensively studied and used for bioanalytical and biomedical applications. However, the process of enrichment and screening of aptamers remains a bottleneck for aptamer development. Recently, microfluidic methods have been increasingly used for rapid and efficient aptamer selection, showing their remarkable advantages over conventional methods. This review briefly introduces aptamers and their advantages. The conventional process of generating aptamers is discussed, followed by the analysis of the key obstacles to efficient aptamer selection. Microfluidic methods for highly efficient enrichment and screening of aptamers are reviewed in detail. PMID:25379085

  13. Metallated DNA Aptamers For Prostate Cancer Treatment

    DTIC Science & Technology

    2012-03-01

    including a polydA tail in one aptamer complex and a polydT tail in a second aptamer complex, with dimerization occurring by Watson - Crick base pair...by ANSI Std. Z39.18 W81XWH-10-1-0132 Metallated DNA Aptamers for Prostate Cancer Treatment Dr. William Gmeiner Wake Forest University Winston...efficacious for prostate cancer treatment. Significant progress has been made on refining novel Zn2+-binding DNA motifs that utilize FdU

  14. DNA Aptamer Technology for Personalized Medicine

    PubMed Central

    Xing, Hang; Hwang, Kevin; Li, Ji; Torabi, Seyed-Fakhreddin; Lu, Yi

    2014-01-01

    This review highlights recent progress in developing DNA aptamers for personalized medicine, with more focus on in vivo studies for potential clinical applications. Examples include design of aptamers in combination with DNA nanostructures, nanomaterials, or microfluidic devices as diagnostic probes or therapeutic agents for cancers and other diseases. The use of aptamers as targeting agents in drug delivery is also covered. The advantages and future directions of such DNA aptamer-based technology for the continued development of personalized medicine are discussed. PMID:24791224

  15. Aptamers overview: selection, features and applications.

    PubMed

    Hernandez, Luiza I; Machado, Isabel; Schafer, Thomas; Hernandez, Frank J

    2015-01-01

    Apatamer technology has been around for a quarter of a century and the field had matured enough to start seeing real applications, especially in the medical field. Since their discovery, aptamers rapidly emerged as key players in many fields, such as diagnostics, drug discovery, food science, drug delivery and therapeutics. Because of their synthetic nature, aptamers are evolving at an exponential rate gaining from the newest advances in chemistry, nanotechnology, biology and medicine. This review is meant to give an overview of the aptamer field, by including general aspects of aptamer identification and applications as well as highlighting certain features that contribute to their quick deployment in the biomedical field.

  16. DNAzyme-aptamer or aptamer-DNAzyme paradigm: biochemical approach for aflatoxin analysis.

    PubMed

    Jafari, Marzieh; Rezaei, Mohsen; Kalantari, Heibatullah; Tabarzad, Maryam; Daraei, Bahram

    2017-03-22

    DNAzyme and aptamer conjugations have already been used for sensitive and accurate detection of several molecules. In this study, we tested the relationship between conjugation orientation of DNAzyme and Aflatoxin B1 aptamer and their subsequent peroxidase activity. Circular dichroism (CD) spectroscopy and biochemical analysis were used here to difference between these two conjugation patterns. Results showed that DNAzyme-aptamer has more catalytic activity and efficiency than aptamer-DNAzyme. Thereby, DNAzyme-aptamer with its superior efficiency can be used for design and development of more sensitive Aflatoxin B1 DNA based biosensors. This article is protected by copyright. All rights reserved.

  17. Monitoring Intact Viruses Using Aptamers.

    PubMed

    Kumar, Penmetcha K R

    2016-08-04

    Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review.

  18. Monitoring Intact Viruses Using Aptamers

    PubMed Central

    Kumar, Penmetcha K. R.

    2016-01-01

    Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review. PMID:27527230

  19. Interactions of aptamers with sera albumins

    NASA Astrophysics Data System (ADS)

    Cortez, Célia Martins; Silva, Dilson; Silva, Camila M. C.; Missailidis, Sotiris

    2012-09-01

    The interactions of two short aptamers to human and bovine serum albumins were studied by fluorescence spectroscopic techniques. Intrinsic fluorescence of BSA and HSA were measured by selectively exciting their tryptophan residues. Gradual quenching was observed by titration of both proteins with aptamers. Aptamers are oligonucleic acid or peptide molecules that bind a specific target and can be used for both biotechnological and clinical purposes, since they present molecular recognition properties like that commonly found in antibodies. Two aptamers previously selected against the MUC1 tumour marker were used in this study, one selected for the protein core and one for the glycosylated MUC1. Stern-Volmer graphs were plotted and quenching constants were estimated. Plots obtained from experiments carried out at 25 °C and 37 °C showed the quenching of fluorescence of by aptamers to be a collisional phenomenon. Stern-Volmer constants estimated for HSA quenched by aptamer A were 1.68 × 105 (±5 × 103) M-1 at 37 °C, and 1.37 × 105 (±103) M-1 at 25 °C; and quenched by aptamer B were 1.67 × 105 (±5 × 103) M-1 at 37 °C, and 1.32 × 105 (±103) M-1 at 25 °C. Results suggest that the primary binding site for aptamers on albumin is close to tryptophan residues in sub domain IIA.

  20. Aptamer-based technology for food analysis.

    PubMed

    Liu, Xiaofei; Zhang, Xuewu

    2015-01-01

    Aptamers are short and functional single-stranded oligonucleotide sequences selected from systematic evolution of ligands by exponential enrichment (SELEX) process, which have the capacity to recognize various classes of target molecules with high affinity and specificity. Various analytical aptamers acquired by SELEX are widely used in many research fields, such as medicine, biology, and chemistry. However, the application of this innovative and emerging technology to food safety is just in infant stage. Food safety plays a very important role in our daily lives because varieties of poisonous and harmful substances in food affect human health. Aptamer technique is promising, which can overcome many disadvantages of existing detection methods in food safety, such as long detection time, low sensitivity, difficult, and expensive antibody preparation. This review provides an overview of various aptamer screening technologies and summarizes the recent applications of aptamers in food safety, and future prospects are also discussed.

  1. DNA Microarrays for Aptamer Identification and Structural Characterization

    DTIC Science & Technology

    2012-09-01

    AFRL-RH-WP-TR-2013-0130 DNA MICROARRAYS FOR APTAMER IDENTIFICATION AND STRUCTURAL CHARACTERIZATION Jennifer A. Martin National Research Council...Interim September 2010 to September 2012 4. TITLE AND SUBTITLE DNA Microarrays for Aptamer Identification and Structural Characterization 5a. CONTRACT... Aptamers are ideal recognition elements, but integrating aptamers onto a sensor platform has two main challenges: (1) aptamers are selected in

  2. Recent Advances in Aptamers Targeting Immune System.

    PubMed

    Hu, Piao-Ping

    2017-02-01

    The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.

  3. Optical Aptamer Probes of Fluorescent Imaging to Rapid Monitoring of Circulating Tumor Cell

    PubMed Central

    Hwang, Ji Yeon; Kim, Sang Tae; Han, Ho-Seong; Kim, Kyunggon; Han, Jin Soo

    2016-01-01

    Fluorescence detecting of exogenous EpCAM (epithelial cell adhesion molecule) or muc1 (mucin1) expression correlated to cancer metastasis using nanoparticles provides pivotal information on CTC (circulating tumor cell) occurrence in a noninvasive tool. In this study, we study a new skill to detect extracellular EpCAM/muc1 using quantum dot-based aptamer beacon (QD-EpCAM/muc1 ALB (aptamer linker beacon). The QD-EpCAM/muc1 ALB was designed using QDs (quantum dots) and probe. The EpCAM/muc1-targeting aptamer contains a Ep-CAM/muc1 binding sequence and BHQ1 (black hole quencher 1) or BHQ2 (black hole quencher2). In the absence of target EpCAM/muc1, the QD-EpCAM/muc1 ALB forms a partial duplex loop-like aptamer beacon and remained in quenched state because the BHQ1/2 quenches the fluorescence signal-on of the QD-EpCAM/muc1 ALB. The binding of EpCAM/muc1 of CTC to the EpCAM/muc1 binding aptamer sequence of the EpCAM/muc1-targeting oligonucleotide triggered the dissociation of the BHQ1/2 quencher and subsequent signal-on of a green/red fluorescence signal. Furthermore, acute inflammation was stimulated by trigger such as caerulein in vivo, which resulted in increased fluorescent signal of the cy5.5-EpCAM/muc1 ALB during cancer metastasis due to exogenous expression of EpCAM/muc1 in Panc02-implanted mouse model. PMID:27886058

  4. Aptamers for respiratory syncytial virus detection.

    PubMed

    Percze, Krisztina; Szakács, Zoltán; Scholz, Éva; András, Judit; Szeitner, Zsuzsanna; Kieboom, Corné H van den; Ferwerda, Gerben; Jonge, Marien I de; Gyurcsányi, Róbert E; Mészáros, Tamás

    2017-02-21

    The identification of the infectious agents is pivotal for appropriate care of patients with viral diseases. Current viral diagnostics rely on selective detection of viral nucleic acid or protein components. In general, detection of proteins rather than nucleic acids is technically more suitable for rapid tests. However, protein-based virus identification methods depend on antibodies limiting the practical applicability of these approaches. Aptamers rival antibodies in target selectivity and binding affinity, and excel in terms of robustness and cost of synthesis. Although aptamers have been generated for virus identification in laboratory settings, their introduction into routine virus diagnostics has not been realized, yet. Here, we demonstrate that the rationally designed SELEX protocol can be applied on whole virus to select aptamers, which can potentially be applied for viral diagnostics. This approach does not require purified virus protein or complicated virus purification. The presented data also illustrate that corroborating the functionality of aptamers with various approaches is essential to pinpoint the most appropriate aptamer amongst the panel of candidates obtained by the selection. Our protocol yielded aptamers capable of detecting respiratory syncytial virus (RSV), an important pathogen causing severe disease especially in young infants, at clinically relevant concentrations in complex matrices.

  5. Aptamers: A Feasible Technology in Cancer Immunotherapy

    PubMed Central

    Villanueva, H.; Pastor, F.

    2016-01-01

    Aptamers are single-chained RNA or DNA oligonucleotides (ODNs) with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy. PMID:27413756

  6. Aptamers for respiratory syncytial virus detection

    PubMed Central

    Percze, Krisztina; Szakács, Zoltán; Scholz, Éva; András, Judit; Szeitner, Zsuzsanna; Kieboom, Corné H. van den; Ferwerda, Gerben; Jonge, Marien I. de; Gyurcsányi, Róbert E.; Mészáros, Tamás

    2017-01-01

    The identification of the infectious agents is pivotal for appropriate care of patients with viral diseases. Current viral diagnostics rely on selective detection of viral nucleic acid or protein components. In general, detection of proteins rather than nucleic acids is technically more suitable for rapid tests. However, protein-based virus identification methods depend on antibodies limiting the practical applicability of these approaches. Aptamers rival antibodies in target selectivity and binding affinity, and excel in terms of robustness and cost of synthesis. Although aptamers have been generated for virus identification in laboratory settings, their introduction into routine virus diagnostics has not been realized, yet. Here, we demonstrate that the rationally designed SELEX protocol can be applied on whole virus to select aptamers, which can potentially be applied for viral diagnostics. This approach does not require purified virus protein or complicated virus purification. The presented data also illustrate that corroborating the functionality of aptamers with various approaches is essential to pinpoint the most appropriate aptamer amongst the panel of candidates obtained by the selection. Our protocol yielded aptamers capable of detecting respiratory syncytial virus (RSV), an important pathogen causing severe disease especially in young infants, at clinically relevant concentrations in complex matrices. PMID:28220811

  7. From selection hits to clinical leads: progress in aptamer discovery

    PubMed Central

    Maier, Keith E; Levy, Matthew

    2016-01-01

    Aptamers were discovered more than 25 years ago, yet only one has been approved by the US Food and Drug Administration to date. With some noteworthy advances in their chemical design and the enzymes we use to make them, aptamers and aptamer-based therapeutics have seen a resurgence in interest. New aptamer drugs are being approved for clinical evaluation, and it is certain that we will see increasingly more aptamers and aptamer-like drugs in the future. In this review, we will discuss the production of aptamers with an emphasis on the advances and modifications that enabled early aptamers to succeed in clinical trials as well as those that are likely to be important for future generations of these drugs. PMID:27088106

  8. ABCs of DNA aptamer and related assay development.

    PubMed

    Sharma, Tarun Kumar; Bruno, John G; Dhiman, Abhijeet

    This review is intended to guide the novice in aptamer research and development to understand virtually all of the aptamer development options and currently available assay modalities. Aptamer development topics range from discussions of basic and advanced versions of Systematic Evolution of Ligands by EXponential Enrichment (SELEX) and SELEX variations involving incorporation of exotic unnatural nucleotides to expand library diversity for even greater aptamer affinity and specificity to improved next generation methods of DNA sequencing, screening and tracking aptamer development throughout the SELEX process and characterization of lead aptamer candidates. Aptamer assay development topics include descriptions of various colorimetric and fluorescent assays in microplates or on membranes including homogeneous beacon and multiplexed Fluorescence Resonance Energy Transfer (FRET) assays. Finally, a discussion of the potential for marketing successful aptamer-based assays or test kits is included.

  9. Aptamer-assembled nanomaterials for biosensing and biomedical applications.

    PubMed

    Kong, Rong-Mei; Zhang, Xiao-Bing; Chen, Zhuo; Tan, Weihong

    2011-09-05

    Aptamers represent a class of single-stranded DNA or RNA oligonucleotides that play important roles in biosensing and biomedical applications. However, aptamers can gain more flexibility as molecular recognition tools by taking advantage of the unique chemical and physical properties provided by nanomaterials. Such aptamer-nanomaterial conjugates are having an increasing impact in the fields of biosensing, bioimaging, and therapy. The recent advances and limitations of aptamer-assembled nanomaterials in biosensing and biomedical applications are briefly introduced and discussed.

  10. Adenosine Triphosphate-Triggered Release of Macromolecular and Nanoparticle Loads from Aptamer/DNA-Cross-Linked Microcapsules.

    PubMed

    Liao, Wei-Ching; Lu, Chun-Hua; Hartmann, Raimo; Wang, Fuan; Sohn, Yang Sung; Parak, Wolfgang J; Willner, Itamar

    2015-09-22

    The synthesis of stimuli-responsive DNA microcapsules acting as carriers for different payloads, and being dissociated through the formation of aptamer-ligand complexes is described. Specifically, stimuli-responsive anti-adenosine triphosphate (ATP) aptamer-cross-linked DNA-stabilized microcapsules loaded with tetramethylrhodamine-modified dextran (TMR-D), CdSe/ZnS quantum dots (QDs), or microperoxidase-11 (MP-11) are presented. In the presence of ATP as trigger, the microcapsules are dissociated through the formation of aptamer-ATP complexes, resulting in the release of the respective loads. Selective unlocking of the capsules is demonstrated, and CTP, GTP, or TTP do not unlock the pores. The ATP-triggered release of MP-11 from the microcapsules enables the MP-11-catalyzed oxidation of Amplex UltraRed by H2O2 to the fluorescent product resorufin.

  11. Nucleic acid aptamers: clinical applications and promising new horizons

    PubMed Central

    Ni, Xiaohua; Castanares, Mark; Mukherjee, Amarnath; Lupold, Shawn E.

    2011-01-01

    Aptamers are a special class of nucleic acid molecules that are beginning to be investigated for clinical use. These small RNA/DNA molecules can form secondary and tertiary structures capable of specifically binding proteins or other cellular targets; they are essentially a chemical equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small in size, and non-immunogenic. Since the discovery of aptamers in the early 1990s, great efforts have been made to make them clinically relevant for diseases like cancer, HIV, and macular degeneration. In the last two decades, many aptamers have been clinically developed as inhibitors for targets such as vascular endothelial growth factor (VEGF) and thrombin. The first aptamer based therapeutic was FDA approved in 2004 for the treatment of age-related macular degeneration and several other aptamers are currently being evaluated in clinical trials. With advances in targeted-therapy, imaging, and nanotechnology, aptamers are readily considered as potential targeting ligands because of their chemical synthesis and ease of modification for conjugation. Preclinical studies using aptamer-siRNA chimeras and aptamer targeted nanoparticle therapeutics have been very successful in mouse models of cancer and HIV. In summary aptamers are in several stages of development, from pre-clinical studies to clinical trials and even as FDA approved therapeutics. In this review, we will discuss the current state of aptamers in clinical trials as well as some promising aptamers in pre-clinical development. PMID:21838685

  12. A systematic approach to evolve aptamers with new specificities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aptamers are single-stranded nucleic acids with high affinities and specificities for the targets against which they are selected. Both features, along with an ability to be integrated into a large variety of sensors, make possible a wide-range of aptamer applications. However, changing aptamer sp...

  13. Development of RNA aptamers for detection of Salmonella Enteritidis.

    PubMed

    Hyeon, Ji-Yeon; Chon, Jung-Whan; Choi, In-Soo; Park, Chankyu; Kim, Dong-Eun; Seo, Kun-Ho

    2012-04-01

    We developed and evaluated RNA aptamers to analyze their potential for use in detecting Salmonella Enteritidis. The selected aptamer was observed to specifically bind to Salmonella Enteritidis without any cross-reactivity to other Salmonella serovars. Thus, this study suggests that aptamers specific to Salmonella Enteritidis have a high potential for use in presumptive presumptive screening methods or alternative serotyping methods.

  14. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  15. An aptamer folding-based sensory platform decorated with nanoparticles for simple cocaine testing.

    PubMed

    Guler, Emine; Bozokalfa, Guliz; Demir, Bilal; Gumus, Zinar Pinar; Guler, Bahar; Aldemir, Ebru; Timur, Suna; Coskunol, Hakan

    2017-04-01

    The consumption of illicit drugs such as cannabis, cocaine, and amphetamines is still a major health and social problem, creating an abuse in adults especially. Novel techniques which estimate the drug of abuse are needed for the detection of newly revealed psychoactive drugs. Herein, we have constructed a combinatorial platform by using quantum dots (QDs) and gold nanoparticles (AuNPs) as well as a functional aptamer which selectively recognizes cocaine and its metabolite benzoylecgonine (BE). We have called it an aptamer folding-based sensory device (AFSD). For the fabrication of AFSD, QDs were initially immobilized onto the poly-L-lysine coated μ-well surfaces. Then, the AuNP-aptamer conjugates were bound to the QDs. The addition of cocaine or BE caused a change in the aptamer structure which induced the close interaction of AuNPs with the QDs. Hence, quenching of the fluorescence of QDs was observed depending on the analyte amount. The linearity of cocaine and BE was 1.0-10 nM and 1.0-25 μM, respectively. Moreover, the limits of detection for cocaine and BE were calculated as 0.138 nM and 1.66 μM. The selectivity was tested by using different interfering substances (methamphetamine, bovine serum albumin, codeine, and 3-acetamidophenol). To investigate the use of AFSD in artificial urine matrix, cocaine/BE spiked samples were applied. Also, confirmatory analyses by using high performance liquid chromatography were performed. It is shown that AFSD has a good potential for testing the cocaine abuse and can be easily adapted for detection of various addictive drugs by changing the aptamer according to desired analytes. Copyright © 2016 John Wiley & Sons, Ltd.

  16. Aptamers against prion proteins and prions.

    PubMed

    Gilch, Sabine; Schätzl, Hermann M

    2009-08-01

    Prion diseases are fatal neurodegenerative and infectious disorders of humans and animals, characterized by structural transition of the host-encoded cellular prion protein (PrP(c)) into the aberrantly folded pathologic isoform PrP(Sc). RNA, DNA or peptide aptamers are classes of molecules which can be selected from complex combinatorial libraries for high affinity and specific binding to prion proteins and which might therefore be useful in diagnosis and therapy of prion diseases. Nucleic acid aptamers, which can be chemically synthesized, stabilized and immobilized, appear more suitable for diagnostic purposes, allowing use of PrP(Sc) as selection target. Peptide aptamers facilitate appropriate intracellular expression, targeting and re-routing without losing their binding properties to PrP, a requirement for potential therapeutic gene transfer experiments in vivo. Elucidation of structural properties of peptide aptamers might be used as basis for rational drug design, providing another attractive application of peptide aptamers in the search for effective anti-prion strategies.

  17. Aptamer-mediated cancer gene therapy.

    PubMed

    Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Zhou, Shu-Feng; Li, Yong; Wei, Ming Q; Qiao, Liang; Shamaileh, Hadi Al; Zhu, Yimin; Zheng, Conglong; Pu, Chunwen; Duan, Wei

    2015-01-01

    Cancer as a genetic disorder is one of the leading causes of death worldwide. Conventional anticancer options such as chemo- and/or radio-therapy have their own drawbacks and could not provide a cure in most cases at present. More effective therapeutic strategies with less side effects are urgently needed. Aptamers, also known as chemical antibodies, are single strand DNA or RNA molecules that can bind to their target molecules with high affinity and specificity. Such site-specific binding ability of aptamers facilitates the delivery and interaction of exogenous nucleic acids with diseased genes. Thus, aptamer-guided gene therapy has emerged as a promising anticancer strategy in addition to the classic treatment regimen. Aptamers can directly deliver anti-cancer nucleic acids, e.g. small interfering RNA, micro RNA, antimicroRNA and small hairpin RNA, to cancer cells or function as a targeting ligand to guide nanoparticles containing therapeutic nucleic acids. This review focuses on recent progress in aptamer-mediated gene therapy for the treatment of hepatocellular carcinoma and other types of cancers, shedding light on the potential of this novel approach of targeted cancer gene therapy.

  18. Aptamer and its applications in neurodegenerative diseases.

    PubMed

    Qu, Jing; Yu, Shuqing; Zheng, Yuan; Zheng, Yan; Yang, Hui; Zhang, Jianliang

    2017-02-01

    Aptamers are small single-stranded DNA or RNA oligonucleotide fragments or small peptides, which can bind to targets by high affinity and specificity. Because aptamers are specific, non-immunogenic and non-toxic, they are ideal materials for clinical applications. Neurodegenerative disorders are ravaging the lives of patients. Even though the mechanism of these diseases is still elusive, they are mainly characterized by the accumulation of misfolded proteins in the central nervous system. So it is essential to develop potential measures to slow down or prevent the onset of these diseases. With the advancements of the technologies, aptamers have opened up new areas in this research field. Aptamers could bind with these related target proteins to interrupt their accumulation, subsequently blocking or preventing the process of neurodegenerative diseases. This review presents recent advances in the aptamer generation and its merits and limitations, with emphasis on its applications in neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, transmissible spongiform encephalopathy, Huntington's disease and multiple sclerosis.

  19. Function and dynamics of aptamers: A case study on the malachite green aptamer

    SciTech Connect

    Wang, Tianjiao

    2008-01-01

    Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH- is sterically excluded from the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD

  20. Sensitive fluorescence detection of ATP based on host-guest recognition between near-infrared β-Cyclodextrin-CuInS2 QDs and aptamer.

    PubMed

    Hu, Tianyu; Na, Weidan; Yan, Xu; Su, Xingguang

    2017-04-01

    We have developed a near-infrared (NIR) fluorescent aptamer-based sensor for sensitive detection of adenosine-5'-triphosphate (ATP) by using a ATP-binding aptamer and β-Cyclodextrin-CuInS2 quantum dots (β-CD-CuInS2 QDs). The fluorescence of β-CD-CuInS2 QDs has a slight enhancement with the addition of ATP-binding aptamer due to the host-guest recognition between aptamer and β-CD. When ATP is added, it will bind to aptamer to form G-quadruplexes. Aptamer-ATP complexes can enter into the hydrophobic cavities of β-CD and result in great enhancement of the fluorescence intensity. Under the optimum conditions, the fluorescence intensity of β-CD-CuInS2 QDs is proportional to the concentration of ATP, which shows a good linear response toward ATP concentration range of 6-1200μmolL(-1), the detection limit for ATP is 3μmolL(-1). The present assay shows a good selectivity for ATP over other biologically important proteins, and it is applied to the determination of ATP in human serum sample with satisfactory results.

  1. Analyzing models for interactions of aptamers to proteins

    NASA Astrophysics Data System (ADS)

    Silva, Dilson; Missailidis, Sotiris

    2014-10-01

    We have devised an experimental and theoretical model, based on fluorescent spectroscopy and molecular modelling, to describe the interaction of aptamer (selected against various protein targets) with proteins and albumins in particular. This model, described in this work, has allowed us to decipher the nature of the interactions between aptamers and albumins, the binding site of the aptamers to albumins, the potential role of primer binding to the albumin and expand to the ability of albumin to carry aptamers in the bloodstream, providing data to better understand the level of free aptamer for target binding. We are presenting the study of a variety of aptamers, including those against the MUC1 tumour marker, heparanase and human kallikrein 6 with bovine and human serum albumins and the effect these interactions may have on the bioavailability of the aptamer for target-specific binding and therapeutic activity.

  2. Selection of DNA aptamers with two modified bases

    PubMed Central

    Gawande, Bharat N.; Rohloff, John C.; Carter, Jeffrey D.; von Carlowitz, Ira; Zhang, Chi; Schneider, Daniel J.; Janjic, Nebojsa

    2017-01-01

    The nucleobases comprising DNA and RNA aptamers provide considerably less chemical diversity than protein-based ligands, limiting their versatility. The introduction of novel functional groups at just one of the four bases in modified aptamers has recently led to dramatic improvement in the success rate of identifying nucleic acid ligands to protein targets. Here we explore the benefits of additional enhancement in physicochemical diversity by selecting modified DNA aptamers that contain amino-acid–like modifications on both pyrimidine bases. Using proprotein convertase subtilisin/kexin type 9 as a representative protein target, we identify specific pairwise combinations of modifications that result in higher affinity, metabolic stability, and inhibitory potency compared with aptamers with single modifications. Such doubly modified aptamers are also more likely to be encoded in shorter sequences and occupy nonoverlapping epitopes more frequently than aptamers with single modifications. These highly modified DNA aptamers have broad utility in research, diagnostic, and therapeutic applications. PMID:28265062

  3. Selection of DNA aptamers with two modified bases.

    PubMed

    Gawande, Bharat N; Rohloff, John C; Carter, Jeffrey D; von Carlowitz, Ira; Zhang, Chi; Schneider, Daniel J; Janjic, Nebojsa

    2017-03-14

    The nucleobases comprising DNA and RNA aptamers provide considerably less chemical diversity than protein-based ligands, limiting their versatility. The introduction of novel functional groups at just one of the four bases in modified aptamers has recently led to dramatic improvement in the success rate of identifying nucleic acid ligands to protein targets. Here we explore the benefits of additional enhancement in physicochemical diversity by selecting modified DNA aptamers that contain amino-acid-like modifications on both pyrimidine bases. Using proprotein convertase subtilisin/kexin type 9 as a representative protein target, we identify specific pairwise combinations of modifications that result in higher affinity, metabolic stability, and inhibitory potency compared with aptamers with single modifications. Such doubly modified aptamers are also more likely to be encoded in shorter sequences and occupy nonoverlapping epitopes more frequently than aptamers with single modifications. These highly modified DNA aptamers have broad utility in research, diagnostic, and therapeutic applications.

  4. Aptamer nanomedicine for cancer therapeutics: barriers and potential for translation.

    PubMed

    Lao, Yeh-Hsing; Phua, Kyle K L; Leong, Kam W

    2015-03-24

    Aptamer nanomedicine, including therapeutic aptamers and aptamer nanocomplexes, is beginning to fulfill its potential in both clinical trials and preclinical studies. Especially in oncology, aptamer nanomedicine may perform better than conventional or antibody-based chemotherapeutics due to specificity compared to the former and stability compared to the latter. Many proof-of-concept studies on applying aptamers to drug delivery, gene therapy, and cancer imaging have shown promising efficacy and impressive safety in vivo toward translation. Yet, there remains ample room for improvement and critical barriers to be addressed. In this review, we will first introduce the recent progress in clinical trials of aptamer nanomedicine, followed by a discussion of the barriers at the design and in vivo application stages. We will then highlight recent advances and engineering strategies proposed to tackle these barriers. Aptamer cancer nanomedicine has the potential to address one of the most important healthcare issues of the society.

  5. An aptamer beacon responsive to botulinum toxins.

    PubMed

    Bruno, John G; Richarte, Alicia M; Carrillo, Maria P; Edge, Allison

    2012-01-15

    Sixty candidate DNA aptamers were developed against botulinum neurotoxin (BoNT) type A light chain (LC) from ten rounds of selection, resulting in several identical sequences. Secondary structures of the identical aptamers were compared to structures of previously reported BoNT A DNA aptamers. A series of ten candidate loop structures were selected from this comparison as potential binding pockets and aptamer beacons. These candidate beacons were synthesized with 5'-TYE 665 and 3'-Iowa Black quencher labels for comparison of fluorescence levels as a function of BoNT A LC concentration. Only three of the ten candidates exhibited any fluorescence response to increasing levels of BoNT A LC. However, of the two most responsive candidates, one represented a subset loop of the larger more intensely fluorescent double-looped structure, designated Beacon 10. This beacon yielded a lower limit of detection of 1 ng/mL in buffer using a spectrofluorometer and a portable handheld fluorometer, but also responded substantially to BoNT A, B, E holotoxins and heavy or light chain components even in a dilute soil suspension, but not in 50% human serum. Beacon 10 did not respond strongly to a variety of other divergent peptides, suggesting that it is relatively specific to the level of botulinum toxins and is only useful for environmental testing. Beacon 10 also shared short sequence segments with other published BoNT aptamer DNA sequences, suggesting that these may be points of physical contact between the aptamers and BoNTs.

  6. Aptamer-based sandwich-type biosensors.

    PubMed

    Seo, Ho Bin; Gu, Man Bock

    2017-01-01

    Sandwich-type biosensor platforms have drawn lots of attentions due to its superior features, compared to other platforms, in terms of its stable and reproducible responses and easy enhancement in the detection sensitivity. The sandwich-type assays can be developed by utilizing a pair of receptors, which bind to the different sites of the same target. In this mini-review paper, the sandwich-type biosensors using either pairs of aptamers or aptamer-antibody pairs are reviewed in terms of its targets and platforms, the schematic designs, and their analytical performance.

  7. RNA fluorescence with light-up aptamers

    NASA Astrophysics Data System (ADS)

    Ouellet, Jonathan

    2016-06-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way.

  8. The brighter side of soils: quantum dots track organic nitrogen through fungi and plants.

    PubMed

    Whiteside, Matthew D; Treseder, Kathleen K; Atsatt, Peter R

    2009-01-01

    Soil microorganisms mediate many nutrient transformations that are central in terrestrial cycling of carbon and nitrogen. However, uptake of organic nutrients by microorganisms is difficult to study in natural systems. We assessed quantum dots (fluorescent nanoscale semiconductors) as a new tool to observe uptake and translocation of organic nitrogen by fungi and plants. We conjugated quantum dots to the amino groups of glycine, arginine, and chitosan and incubated them with Penicillium fungi (a saprotroph) and annual bluegrass (Poa annua) inoculated with arbuscular mycorrhizal fungi. As experimental controls, we incubated fungi and bluegrass samples with substrate-free quantum dots as well as unbound quantum dot substrate mixtures. Penicillium fungi, annual bluegrass, and arbuscular mycorrhizal fungi all showed uptake and translocation of quantum dot-labeled organic nitrogen, but no uptake of quantum dot controls. Additionally, we observed quantum dot-labeled organic nitrogen within soil hyphae, plant roots, and plant shoots using field imaging techniques. This experiment is one of the first to demonstrate direct uptake of organic nitrogen by arbuscular mycorrhizal fungi.

  9. Multi-photon microscopy based on resonant four-wave mixing of colloidal quantum dots

    NASA Astrophysics Data System (ADS)

    Masia, F.; Langbein, W.; Borri, P.

    2009-02-01

    We demonstrate a novel multi-photon imaging modality based on the detection of four-wave mixing (FWM) from colloidal nanoparticles. Four-wave mixing is a third-order signal which can be excited and detected in resonance with the ground-state excitonic transition of CdSe/ZnS quantum dots. The coherent FWM signal is detected interferometrically to reject incoherent backgrounds for improved image contrast compared to fluorescence methods. We measure transversal and axial resolutions of 140nm and 590nm respectively, significantly beating the one-photon diffraction limit. We also demonstrate optical imaging of quantum-dot-labeled Golgi structures of HepG2 cells.

  10. Structure and Sequence Search on Aptamer-Protein Docking

    NASA Astrophysics Data System (ADS)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  11. Aptamer-based liposomes improve specific drug loading and release.

    PubMed

    Plourde, Kevin; Derbali, Rabeb Mouna; Desrosiers, Arnaud; Dubath, Céline; Vallée-Bélisle, Alexis; Leblond, Jeanne

    2017-04-10

    Aptamer technology has shown much promise in cancer therapeutics for its targeting abilities. However, its potential to improve drug loading and release from nanocarriers has not been thoroughly explored. In this study, we employed drug-binding aptamers to actively load drugs into liposomes. We designed a series of DNA aptamer sequences specific to doxorubicin, displaying multiple binding sites and various binding affinities. The binding ability of aptamers was preserved when incorporated into cationic liposomes, binding up to 15equivalents of doxorubicin per aptamer, therefore drawing the drug into liposomes. Optimization of the charge and drug/aptamer ratios resulted in ≥80% encapsulation efficiency of doxorubicin, ten times higher than classical passively-encapsulating liposomal formulations and similar to a pH-gradient active loading strategy. In addition, kinetic release profiles and cytotoxicity assay on HeLa cells demonstrated that the release and therapeutic efficacy of liposomal doxorubicin could be controlled by the aptamer's structure. Our results suggest that the aptamer exhibiting a specific intermediate affinity is the best suited to achieve high drug loading while maintaining efficient drug release and therapeutic activity. This strategy was successfully applied to tobramycin, a hydrophilic drug suffering from low encapsulation into liposomes, where its loading was improved six-fold using aptamers. Overall, we demonstrate that aptamers could act, in addition to their targeting properties, as multifunctional excipients for liposomal formulations.

  12. Isolation of peptide aptamers that inhibit intracellular processes

    PubMed Central

    Blum, Jonathan H.; Dove, Simon L.; Hochschild, Ann; Mekalanos, John J.

    2000-01-01

    We have developed a method for isolation of random peptides that inhibit intracellular processes in bacteria. A library of random peptides expressed as fusions to Escherichia coli thioredoxin (aptamers) were expressed under the tight control of the arabinose-inducible PBAD promoter. A selection was applied to the library to isolate aptamers that interfered with the activity of thymidylate synthase (ThyA) in vivo. Expression of an aptamer isolated by this method resulted in a ThyA− phenotype that was suppressed by simultaneous overexpression of ThyA. Two-hybrid analysis showed that this aptamer is likely to interact with ThyA in vivo. The library also was screened for aptamers that inhibited growth of bacteria expressing them, and five such aptamers were characterized. Four aptamers were bacteriostatic when expressed, whereas one showed a bactericidal effect. Introduction of translational stop codons into various aptamers blocked their activity, suggesting that their biological effects were likely to be due to protein aptamer rather than RNA. Combinatorial aptamers provide a new genetic and biochemical tool for identifying targets for antibacterial drug development. PMID:10688899

  13. Aptamers : The New Frontier In Drug Development?

    PubMed Central

    CARLSON, BOB

    2007-01-01

    Often called chemical antibodies, aptamers are poised to take on the monoclonal antibodies in therapeutics, diagnostics, and drug development. Stability, low toxicity and immunogenicity, and, perhaps, a higher safety profile – not to mention low-cost advantages – are drawing the attention of big pharma and biotech. PMID:23372509

  14. Nanomaterial-assisted aptamers for optical sensing.

    PubMed

    Wang, Guoqing; Wang, Yunqing; Chen, Lingxin; Choo, Jaebum

    2010-04-15

    Aptamers are single-strand DNA or RNA selected in vitro that bind specifically with a broad range of targets from metal ions, organic molecules, to proteins, cells and microorganisms. As an emerging class of recognition elements, aptamers offer remarkable convenience in the design and modification of their structures, which has motivated them to generate a great variety of aptamer sensors (aptasensors) that exhibit high sensitivity as well as specificity. On the other hand, the development of nanoscience and nanotechnology has generated nanomaterials with novel properties compared with their counterparts in macroscale. By integrating their strengths of both fields, recently, versatile aptamers coupling with novel nanomaterials for designing nanomaterial-assisted aptasensors (NAAs) make the combinations universal strategies for sensitive optical sensing. NAAs have been considered as an excellent sensing platform and found wide applications in analytical community. In this review, we summarize recent advances in the development of various optical NAAs, employing various detection techniques including colorimetry, fluorometry, surface-enhanced Raman scattering (SERS), magnetic resonance imaging (MRI) and surface plasmon resonance (SPR).

  15. Development of universal antidotes to control aptamer activity.

    PubMed

    Oney, Sabah; Lam, Ruby T S; Bompiani, Kristin M; Blake, Charlene M; Quick, George; Heidel, Jeremy D; Liu, Joanna Yi-Ching; Mack, Brendan C; Davis, Mark E; Leong, Kam W; Sullenger, Bruce A

    2009-10-01

    With an ever increasing number of people taking numerous medications, the need to safely administer drugs and limit unintended side effects has never been greater. Antidote control remains the most direct means to counteract acute side effects of drugs, but, unfortunately, it has been challenging and cost prohibitive to generate antidotes for most therapeutic agents. Here we describe the development of a set of antidote molecules that are capable of counteracting the effects of an entire class of therapeutic agents based upon aptamers. These universal antidotes exploit the fact that, when systemically administered, aptamers are the only free extracellular oligonucleotides found in circulation. We show that protein- and polymer-based molecules that capture oligonucleotides can reverse the activity of several aptamers in vitro and counteract aptamer activity in vivo. The availability of universal antidotes to control the activity of any aptamer suggests that aptamers may be a particularly safe class of therapeutics.

  16. Nucleic Acid Aptamers: Research Tools in Disease Diagnostics and Therapeutics

    PubMed Central

    Yadava, Pramod K.

    2014-01-01

    Aptamers are short sequences of nucleic acid (DNA or RNA) or peptide molecules which adopt a conformation and bind cognate ligands with high affinity and specificity in a manner akin to antibody-antigen interactions. It has been globally acknowledged that aptamers promise a plethora of diagnostic and therapeutic applications. Although use of nucleic acid aptamers as targeted therapeutics or mediators of targeted drug delivery is a relatively new avenue of research, one aptamer-based drug “Macugen” is FDA approved and a series of aptamer-based drugs are in clinical pipelines. The present review discusses the aspects of design, unique properties, applications, and development of different aptamers to aid in cancer diagnosis, prevention, and/or treatment under defined conditions. PMID:25050359

  17. Nucleic acid aptamers: research tools in disease diagnostics and therapeutics.

    PubMed

    Santosh, Baby; Yadava, Pramod K

    2014-01-01

    Aptamers are short sequences of nucleic acid (DNA or RNA) or peptide molecules which adopt a conformation and bind cognate ligands with high affinity and specificity in a manner akin to antibody-antigen interactions. It has been globally acknowledged that aptamers promise a plethora of diagnostic and therapeutic applications. Although use of nucleic acid aptamers as targeted therapeutics or mediators of targeted drug delivery is a relatively new avenue of research, one aptamer-based drug "Macugen" is FDA approved and a series of aptamer-based drugs are in clinical pipelines. The present review discusses the aspects of design, unique properties, applications, and development of different aptamers to aid in cancer diagnosis, prevention, and/or treatment under defined conditions.

  18. Inhibition of Hirame rhabdovirus growth by RNA aptamers.

    PubMed

    Hwang, S D; Midorikawa, N; Punnarak, P; Kikuchi, Y; Kondo, H; Hirono, I; Aoki, T

    2012-12-01

    RNA aptamers are artificial nucleic acids that specifically bind to a wide variety of targets. They are an effective tool for pharmaceutical research and development of antiviral agents. Here, we describe four Hirame rhabdovirus (HIRRV)-RNA aptamers (H1, H2, H3 and H4) that we obtained from an in vitro process called the systematic evolution of ligands by exponential enrichment (SELEX). The HIRRV-RNA aptamers specifically bind to HIRRV. Hirame natural embryo (HINAE) cells treated with virus and the RNA aptamer showed a decrease in appearance of cytopathic effect when compared with control (treated only with virus). Rhodovulum sulfidophilum was transformed with genes for the RNA aptamers, and the aptamers were detected in the culture medium, indicating that they were secreted from the cells. Thus, the recombinant R. sulfidophilum might be a powerful tool for the prevention of HIRRV in aquaculture.

  19. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    NASA Astrophysics Data System (ADS)

    Ruscito, Annamaria; DeRosa, Maria

    2016-05-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  20. Aptamers in Bordeaux, 24–25 June 2016

    PubMed Central

    Toulmé, Jean-Jacques; Giangrande, Paloma H.; Mayer, Günter; Suess, Beatrix; Ducongé, Frédéric; Sullenger, Bruce; de Franciscis, Vittorio; Darfeuille, Fabien; Peyrin, Eric

    2017-01-01

    The symposium covered the many different aspects of the selection and the characterization of aptamers as well as their application in analytical, diagnostic and therapeutic areas. Natural and artificial riboswitches were discussed. Recent advances for the design of mutated polymerases and of chemically modified nucleic acid bases that provide aptamers with new properties were presented. The power of aptamer platforms for multiplex analysis of biomarkers of major human diseases was described. The potential of aptamers for the treatment of cancer or cardiovascular diseases was also presented. Brief summaries of the lectures presented during the symposium are given in this report. A second edition of “Aptamers in Bordeaux” will take place on September 2017 (http://www.aptamers-in-bordeaux.com/). PMID:28117671

  1. Aptamers in Bordeaux, 24-25 June 2016.

    PubMed

    Toulmé, Jean-Jacques; Giangrande, Paloma H; Mayer, Günter; Suess, Beatrix; Ducongé, Frédéric; Sullenger, Bruce; de Franciscis, Vittorio; Darfeuille, Fabien; Peyrin, Eric

    2017-01-20

    The symposium covered the many different aspects of the selection and the characterization of aptamers as well as their application in analytical, diagnostic and therapeutic areas. Natural and artificial riboswitches were discussed. Recent advances for the design of mutated polymerases and of chemically modified nucleic acid bases that provide aptamers with new properties were presented. The power of aptamer platforms for multiplex analysis of biomarkers of major human diseases was described. The potential of aptamers for the treatment of cancer or cardiovascular diseases was also presented. Brief summaries of the lectures presented during the symposium are given in this report. A second edition of "Aptamers in Bordeaux" will take place on September 2017 (http://www.aptamers-in-bordeaux.com/).

  2. Current Progress of Aptamer-Based Molecular Imaging

    PubMed Central

    Wang, Andrew Z.; Farokhzad, Omid C.

    2014-01-01

    Aptamers, single-stranded oligonucleotides, are an important class of molecular targeting ligand. Since their discovery, aptamers have been rapidly translated into clinical practice. They have been approved as therapeutics and molecular diagnostics. Aptamers also possess several properties that make them uniquely suited to molecular imaging. This review aims to provide an overview of aptamers’ advantages as targeting ligands and their application in molecular imaging. PMID:24525205

  3. Aptamers and the RNA World, Past and Present

    PubMed Central

    Gold, Larry; Janjic, Nebojsa; Jarvis, Thale; Schneider, Dan; Walker, Jeffrey J.; Wilcox, Sheri K.; Zichi, Dom

    2012-01-01

    Summary Aptamers and the SELEX process were discovered over two decades ago. These discoveries have spawned a productive academic and commercial industry. The collective results provide insights into biology, past and present, through an in vitro evolutionary exploration of the nature of nucleic acids and their potential roles in ancient life. Aptamers have helped usher in an RNA renaissance. Here we explore some of the evolution of the aptamer field and the insights it has provided for conceptualizing an RNA world, from its nascence to our current endeavor employing aptamers in human proteomics to discover biomarkers of health and disease. PMID:21441582

  4. DNA-Templated Aptamer Probe for Identification of Target Proteins.

    PubMed

    Bi, Wenjing; Bai, Xue; Gao, Fan; Lu, Congcong; Wang, Ye; Zhai, Guijin; Tian, Shanshan; Fan, Enguo; Zhang, Yukui; Zhang, Kai

    2017-04-04

    Using aptamers as molecular probes for biomarker discovery has attracted a great deal of attention in recent years. However, it is still a big challenge to accurately identify those protein markers that are targeted by aptamers under physiological conditions due to weak and noncovalent aptamer-protein interactions. Herein, we developed an aptamer based dual-probe using DNA-templated chemistry and photo-cross-linking technique for the identification of target proteins that are recognized by aptamers. In this system, the aptamer was modified by a single strand DNA as binding probe (BP), and another complementary DNA with a photoactive group and reporter group was modified as capture probe (CP). BP was first added to recruit the binding protein via aptamer recognition, and subsequently CP was added to let the cross-linker close to the target via DNA self-assembly, and then a covalent bond between CP and its binding protein was achieved via photo-cross-linking reaction. The captured protein can be detected or affinity enrichment using the tag, finally identified by MS. By use of lysozyme as a model substrate, we demonstrated that this multiple functionalized probe can be utilized for a successful labeling and enrichment of target protein even under a complicated and real environment. Thus, a novel method to precisely identify the aptamer-targeted proteins has been developed and it has a potential application for discovery of aptamer-based biomarkers.

  5. Aptamer-Functionalized Nanoparticles for Medical Applications: Challenges and Opportunities

    PubMed Central

    Xiao, Zeyu; Farokhzad, Omid C.

    2012-01-01

    With advances in aptamer selection technologies and nanomedicine, aptamer-functionalized nanoparticles are being explored as promising platforms for targeted therapeutic and diagnostic applications. In this Perspective, we outline recent progress in this field, as exemplified by Bamrungsap et al. in this issue of ACS Nano. Furthermore, we highlight the challenges and opportunities in translating current proof-of-concept designs into in vivo applications, with emphasis on the intrinsic properties of aptamers and their interplay with nanoparticles. With continuous efforts, we expect aptamer-functionalized nanoparticles to advance from preclinical into clinical development for further evaluation. PMID:22574989

  6. DNA aptamer selection in methanolic media: Adenine-aptamer as proof-of-concept.

    PubMed

    Chaou, Thinhinane; Vialet, Brune; Azéma, Laurent

    2016-03-15

    The major objective of this study is to investigate the usefulness of aptamers as in situ detection tool in organic solvents, which are often used for environmental extraction. But two problems related to the use of methanol-containing buffers have to be addressed. Firstly, the folding of nucleic acids can be impaired, because of weaker hydrogen bonding interactions. Secondly, the affinity of aptamers selected in aqueous buffers can be altered by the presence of methanol. Thus, in order to improve hydrophobicity of the DNA pool, nucleotide with hydrophobic modification 5-(octa1,7-diynyl)-2'-deoxyuridine (ODT) has been chosen instead of thymidine. As a proof of concept, an adenine aptamer operating in presence 25% of methanol has been selected. We have shown that the modified nucleotide is essential for target binding in organic media, in addition to essential structural pattern as proposed through analysing truncated sequences analysis. The strategy described in this paper offers preliminary insight on the adaptability of the implementation of aptamers as key instrument for in situ detection. It could be broaden to identify other aptamers directed against other chemical species after alcoholic extraction or for monitoring by-product traces in drugs production.

  7. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection.

    PubMed

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-03

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5' and 3' termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  8. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    PubMed Central

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-01-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5′ and 3′ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses. PMID:28367958

  9. Replacing antibodies with aptamers in lateral flow immunoassay.

    PubMed

    Chen, Ailiang; Yang, Shuming

    2015-09-15

    Aptamers have been identified against various targets as a type of chemical or nucleic acid ligand by systematic evolution of ligands by exponential enrichment (SELEX) with high sensitivity and specificity. Aptamers show remarkable advantages over antibodies due to the nucleic acid nature and target-induced structure-switching properties and are widely used to design various fluorescent, electrochemical, or colorimetric biosensors. However, the practical applications of aptamer-based sensing and diagnostics are still lagging behind those of antibody-based tests. Lateral flow immunoassay (LFIA) represents a well established and appropriate technology among rapid assays because of its low cost and user-friendliness. The antibody-based platform is utilized to detect numerous targets, but it is always hampered by the antibody preparation time, antibody stability, and effect of modification on the antibody. Seeking alternatives to antibodies is an area of active research and is of tremendous importance. Aptamers are receiving increasing attention in lateral flow applications because of a number of important potential performance advantages. We speculate that aptamer-based LFIA may be one of the first platforms for commercial use of aptamer-based diagnosis. This review first gives an introduction to aptamer including the selection process SELEX with its focus on aptamer advantages over antibodies, and then depicts LFIA with its focus on aptamer opportunities in LFIA over antibodies. Furthermore, we summarize the recent advances in the development of aptamer-based lateral flow biosensing assays with the aim to provide a general guide for the design of aptamer-based lateral flow biosensing assays.

  10. Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes

    DOEpatents

    Lu, Yi [Champaign, IL; Liu, Juewen [Albuquerque, NM

    2011-11-15

    The present invention provides aptamer- and nucleic acid enzyme-based systems for simultaneously determining the presence and optionally the concentration of multiple analytes in a sample. Methods of utilizing the system and kits that include the sensor components are also provided. The system includes a first reactive polynucleotide that reacts to a first analyte; a second reactive polynucleotide that reacts to a second analyte; a third polynucleotide; a fourth polynucleotide; a first particle, coupled to the third polynucleotide; a second particle, coupled to the fourth polynucleotide; and at least one quencher, for quenching emissions of the first and second quantum dots, coupled to the first and second reactive polynucleotides. The first particle includes a quantum dot having a first emission wavelength. The second particle includes a second quantum dot having a second emission wavelength different from the first emission wavelength. The third polynucleotide and the fourth polynucleotide are different.

  11. Modern affinity reagents: Recombinant antibodies and aptamers.

    PubMed

    Groff, Katherine; Brown, Jeffrey; Clippinger, Amy J

    2015-12-01

    Affinity reagents are essential tools in both basic and applied research; however, there is a growing concern about the reproducibility of animal-derived monoclonal antibodies. The need for higher quality affinity reagents has prompted the development of methods that provide scientific, economic, and time-saving advantages and do not require the use of animals. This review describes two types of affinity reagents, recombinant antibodies and aptamers, which are non-animal technologies that can replace the use of animal-derived monoclonal antibodies. Recombinant antibodies are protein-based reagents, while aptamers are nucleic-acid-based. In light of the scientific advantages of these technologies, this review also discusses ways to gain momentum in the use of modern affinity reagents, including an update to the 1999 National Academy of Sciences monoclonal antibody production report and federal incentives for recombinant antibody and aptamer efforts. In the long-term, these efforts have the potential to improve the overall quality and decrease the cost of scientific research.

  12. Screening of aptamers on microfluidic systems for clinical applications.

    PubMed

    Weng, Chen-Hsun; Huang, Chao-Jyun; Lee, Gwo-Bin

    2012-01-01

    The use of microfluidic systems for screening of aptamers and their biomedical applications are reviewed in this paper. Aptamers with different nucleic acid sequences have been extensively studied and the results demonstrated a strong binding affinity to target molecules such that they can be used as promising candidate biomarkers for diagnosis and therapeutics. Recently, the aptamer screening protocol has been conducted with microfluidic-based devices. Furthermore, aptamer affinity screening by a microfluidic-based method has demonstrated remarkable advantages over competing traditional methods. In this paper, we first reviewed microfluidic systems which demonstrated efficient and rapid screening of a specific aptamer. Then, the clinical applications of screened aptamers, also performed by microfluidic systems, are further reviewed. These automated microfluidic systems can provide advantages over their conventional counterparts including more compactness, faster analysis, less sample/reagent consumption and automation. An aptamer-based compact microfluidic system for diagnosis may even lead to a point-of-care device. The use of microfluidic systems for aptamer screening and diagnosis is expected to continue growing in the near future and may make a substantial impact on biomedical applications.

  13. Structure and thermodynamics of Drug-RNA aptamer interactions.

    PubMed

    Da Costa, J B; Dieckmann, T

    2013-04-01

    This mini-review will provide an overview on the recent studies of structure and thermodynamics of RNA aptamers that target drug molecules. These aptamers are studied to provide insight into RNA drug interactions. This interaction is important due to the many roles RNA plays in cell biology.

  14. Aptamer-assembled nanomaterials for fluorescent sensing and imaging

    NASA Astrophysics Data System (ADS)

    Lu, Danqing; He, Lei; Zhang, Ge; Lv, Aiping; Wang, Ruowen; Zhang, Xiaobing; Tan, Weihong

    2016-09-01

    Aptamers, which are selected in vitro by a technology known as the systematic evolution of ligands by exponential enrichment (SELEX), represent a crucial recognition element in molecular sensing. With advantages such as good biocompatibility, facile functionalization, and special optical and physical properties, various nanomaterials can protect aptamers from enzymatic degradation and nonspecific binding in living systems and thus provide a preeminent platform for biochemical applications. Coupling aptamers with various nanomaterials offers many opportunities for developing highly sensitive and selective sensing systems. Here, we focus on the recent applications of aptamer-assembled nanomaterials in fluorescent sensing and imaging. Different types of nanomaterials are examined along with their advantages and disadvantages. Finally, we look toward the future of aptamer-assembled nanomaterials.

  15. Fit for the Eye: Aptamers in Ocular Disorders

    PubMed Central

    Drolet, Daniel W.; Green, Louis S.; Gold, Larry

    2016-01-01

    For any new class of therapeutics, there are certain types of indications that represent a natural fit. For nucleic acid ligands in general, and aptamers in particular, the eye has historically been an attractive site for therapeutic intervention. In this review, we recount the discovery and early development of three aptamers designated for use in ophthalmology, one approved (Macugen), and two in late-stage development (Fovista and Zimura). Every one of these molecules was originally intended for other indications. Key improvements in technology, specifically with regard to libraries used for in vitro selection and subsequent chemical optimization of aptamers, have played an important role in allowing the identification of development candidates with suitable properties. The lessons learned from the selection of these molecules are valuable for informing us about the many remaining opportunities for aptamer-based therapeutics in ophthalmology as well as for identifying additional indications for which aptamers as a class of therapeutics have distinct advantages. PMID:26757406

  16. Aptamer-assembled nanomaterials for fluorescent sensing and imaging

    NASA Astrophysics Data System (ADS)

    Lu, Danqing; He, Lei; Zhang, Ge; Lv, Aiping; Wang, Ruowen; Zhang, Xiaobing; Tan, Weihong

    2017-01-01

    Aptamers, which are selected in vitro by a technology known as the systematic evolution of ligands by exponential enrichment (SELEX), represent a crucial recognition element in molecular sensing. With advantages such as good biocompatibility, facile functionalization, and special optical and physical properties, various nanomaterials can protect aptamers from enzymatic degradation and nonspecific binding in living systems and thus provide a preeminent platform for biochemical applications. Coupling aptamers with various nanomaterials offers many opportunities for developing highly sensitive and selective sensing systems. Here, we focus on the recent applications of aptamer-assembled nanomaterials in fluorescent sensing and imaging. Different types of nanomaterials are examined along with their advantages and disadvantages. Finally, we look toward the future of aptamer-assembled nanomaterials.

  17. Clinical applications of nucleic acid aptamers in cancer.

    PubMed

    Pei, Xiaoyu; Zhang, Jun; Liu, Jie

    2014-05-01

    Nucleic acid aptamers are small single-stranded DNA or RNA oligonucleotide segments, which bind to their targets with high affinity and specificity via unique three-dimensional structures. Aptamers are generated by an iterative in vitro selection process, termed as systematic evolution of ligands by exponential enrichment. Owing to their specificity, non-immunogenicity, non-toxicity, easily modified chemical structure and wide range of targets, aptamers appear to be ideal candidates for various clinical applications (diagnosis or treatment), such as cell detection, target diagnosis, molecular imaging and drug delivery. Several aptamers have entered the clinical pipeline for applications in diseases such as macular degeneration, coronary artery bypass graft surgery and various types of cancer. The aim of this review was to summarize and highlight the clinical applications of aptamers in cancer diagnosis and treatment.

  18. Current progress on aptamer-targeted oligonucleotide therapeutics

    PubMed Central

    Dassie, Justin P; Giangrande, Paloma H

    2014-01-01

    Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

  19. Generating Cell Targeting Aptamers for Nanotheranostics Using Cell-SELEX

    PubMed Central

    Lyu, Yifan; Chen, Guang; Shangguan, Dihua; Zhang, Liqin; Wan, Shuo; Wu, Yuan; Zhang, Hui; Duan, Lian; Liu, Chao; You, Mingxu; Wang, Jie; Tan, Weihong

    2016-01-01

    Detecting and understanding changes in cell conditions on the molecular level is of great importance for the accurate diagnosis and timely therapy of diseases. Cell-based SELEX (Systematic Evolution of Ligands by EXponential enrichment), a foundational technology used to generate highly-specific, cell-targeting aptamers, has been increasingly employed in studies of molecular medicine, including biomarker discovery and early diagnosis/targeting therapy of cancer. In this review, we begin with a mechanical description of the cell-SELEX process, covering aptamer selection, identification and identification, and aptamer characterization; following this introduction is a comprehensive discussion of the potential for aptamers as targeting moieties in the construction of various nanotheranostics. Challenges and prospects for cell-SELEX and aptamer-based nanotheranostic are also discussed. PMID:27375791

  20. Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry.

    PubMed

    Bayraç, Ceren; Öktem, Hüseyin Avni

    2017-02-01

    To monitor the specificity of Staphylococcus aureus aptamer (SA-31) against its target cell, we used enzyme-linked aptamer assay. In the presence of target cell, horseradish peroxidase-conjugated streptavidin bound to biotin-labeled SA-31 showed specific binding to S  aureus among 3 different bacteria with limit of detection of 10(3) colony-forming unit per milliliter. The apparent Ka was 1.39 μM(-1)  ± 0.3 μM(-1) . The binding of SA-31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (Ka , ΔH, and ΔG). Since binding of aptamer to its targets solely depends on its 3-dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA-31 to its target on surface of bacteria. At 4°C, SA-31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA-31 slightly varied from Ka  = 1.56 μM(-1)  ± 0.69 μM(-1) at 25°C to Ka  = 1.03 μM(-1)  ± 0.9 μM(-1) at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S aureus aptamer to its target were also 9.44 μM(-1)  ± 0.38 μM(-1) at 50mM, 1.60 μM(-1)  ± 0.11 μM(-1) at 137mM, and 3.28 μM(-1)  ± 0.46 μM(-1) at 200 mM of salt concentration. In this study, it was demonstrated that enzyme-linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S aureus.

  1. Aptamer technology for tracking cells' status & function.

    PubMed

    Wiraja, Christian; Yeo, David; Lio, Daniel; Labanieh, Louai; Lu, Mengrou; Zhao, Weian; Xu, Chenjie

    2014-01-01

    In fields such as cancer biology and regenerative medicine, obtaining information regarding cell bio-distribution, tropism, status, and other cellular functions are highly desired. Understanding cancer behaviors including metastasis is important for developing effective cancer treatments, while assessing the fate of therapeutic cells following implantation is critical to validate the efficacy and efficiency of the therapy. For visualization purposes with medical imaging modalities (e.g. magnetic resonance imaging), cells can be labeled with contrast agents (e.g. iron-oxide nanoparticles), which allows their identification from the surrounding environment. Despite the success of revealing cell biodistribution in vivo, most of the existing agents do not provide information about the status and functions of cells following transplantation. The emergence of aptamers, single-stranded RNA or DNA oligonucleotides of 15 to 60 bases in length, is a promising solution to address this need. When aptamers bind specifically to their cognate molecules, they undergo conformational changes which can be transduced into a change of imaging contrast (e.g. optical, magnetic resonance). Thus by monitoring this signal change, researchers can obtain information about the expression of the target molecules (e.g. mRNA, surface markers, cell metabolites), which offer clues regarding cell status/function in a non-invasive manner. In this review, we summarize recent efforts to utilize aptamers as biosensors for monitoring the status and function of transplanted cells. We focus on cancer cell tracking for cancer study, stem cell tracking for regenerative medicine, and immune cell (e.g. dendritic cells) tracking for immune therapy.

  2. Applications of Aptamers in Targeted Imaging: State of the Art

    PubMed Central

    Dougherty, Casey A.; Cai, Weibo; Hong, Hao

    2015-01-01

    Aptamers are single-stranded oligonucleotides with high affinity and specificity to the target molecules or cells, thus they can serve as an important category of molecular targeting ligand. Since their discove1y, aptamers have been rapidly translated into clinical practice. The strong target affinity/selectivity, cost-effectivity, chemical versatility and safety of aptamers are superior to traditional peptides- or proteins-based ligands which make them unique choices for molecular imaging. Therefore, aptamers are considered to be extremely useful to guide various imaging contrast agents to the target tissues or cells for optical, magnetic resonance, nuclear, computed tomography, ultra sound and multimodality imaging. This review aims to provide an overview of aptamers' advantages as targeting ligands and their application in targeted imaging. Further research in synthesis of new types of aptamers and their conjugation with new categories of contrast agents is required to develop clinically translatable aptamer-based imaging agents which will eventually result in improved patient care. PMID:25866268

  3. Aptamers: Active Targeting Ligands for Cancer Diagnosis and Therapy

    PubMed Central

    Wu, Xu; Chen, Jiao; Wu, Min; Zhao, Julia Xiaojun

    2015-01-01

    Aptamers, including DNA, RNA and peptide aptamers, are a group of promising recognition units that can specifically bind to target molecules and cells. Due to their excellent specificity and high affinity to targets, aptamers have attracted great attention in various fields in which selective recognition units are required. They have been used in biosensing, drug delivery, disease diagnosis and therapy (especially for cancer treatment). In this review, we summarized recent applications of DNA and RNA aptamers in cancer theranostics. The specific binding ability of aptamers to cancer-related markers and cancer cells ensured their high performance for early diagnosis of cancer. Meanwhile, the efficient targeting ability of aptamers to cancer cells and tissues provided a promising way to deliver imaging agents and drugs for cancer imaging and therapy. Furthermore, with the development of nanoscience and nanotechnology, the conjugation of aptamers with functional nanomaterials paved an exciting way for the fabrication of theranostic agents for different types of cancers, which might be a powerful tool for cancer treatment. PMID:25699094

  4. Aptamers: active targeting ligands for cancer diagnosis and therapy.

    PubMed

    Wu, Xu; Chen, Jiao; Wu, Min; Zhao, Julia Xiaojun

    2015-01-01

    Aptamers, including DNA, RNA and peptide aptamers, are a group of promising recognition units that can specifically bind to target molecules and cells. Due to their excellent specificity and high affinity to targets, aptamers have attracted great attention in various fields in which selective recognition units are required. They have been used in biosensing, drug delivery, disease diagnosis and therapy (especially for cancer treatment). In this review, we summarized recent applications of DNA and RNA aptamers in cancer theranostics. The specific binding ability of aptamers to cancer-related markers and cancer cells ensured their high performance for early diagnosis of cancer. Meanwhile, the efficient targeting ability of aptamers to cancer cells and tissues provided a promising way to deliver imaging agents and drugs for cancer imaging and therapy. Furthermore, with the development of nanoscience and nanotechnology, the conjugation of aptamers with functional nanomaterials paved an exciting way for the fabrication of theranostic agents for different types of cancers, which might be a powerful tool for cancer treatment.

  5. Nanostructure shape effects on response of plasmonic aptamer sensors.

    PubMed

    Balamurugan, Subramanian; Mayer, Kathryn M; Lee, Seunghyun; Soper, Steven A; Hafner, Jason H; Spivak, David A

    2013-09-01

    A localized surface plasmon resonance (LSPR) sensor surface was fabricated by the deposition of gold nanorods on a glass substrate and subsequent immobilization of the DNA aptamer, which specifically bind to thrombin. This LSPR aptamer sensor showed a response of 6-nm λ(max) shift for protein binding with the detection limit of at least 10 pM, indicating one of the highest sensitivities achieved for thrombin detection by optical extinction LSPR. We also tested the LSPR sensor fabricated using gold bipyramid, which showed higher refractive index sensitivity than the gold nanorods, but the overall response of gold bipyramid sensor appears to be 25% less than that of the gold nanorod substrate, despite the approximately twofold higher refractive index sensitivity. XPS analysis showed that this is due to the low surface density of aptamers on the gold bipyramid compared with gold nanorods. The low surface density of the aptamers on the gold bipyramid surface may be due to the effect of shape of the nanostructure on the kinetics of aptamer monolayer formation. The small size of aptamers relative to other bioreceptors is the key to achieving high sensitivity by biosensors on the basis of LSPR, demonstrated here for protein binding. The generality of aptamer sensors for protein detection using gold nanorod and gold nanobipyramid substrates is anticipated to have a large impact in the important development of sensors toward biomarkers, environmental toxins, and warfare agents.

  6. Aptamer for imaging and therapeutic targeting of brain tumor glioblastoma.

    PubMed

    Delač, Mateja; Motaln, Helena; Ulrich, Henning; Lah, Tamara T

    2015-09-01

    Aptamers are short single-stranded nucleic acids (RNA or ssDNA), identified by an in vitro selection process, denominated SELEX, from a partially random oligonucleotide library. They bind to a molecular target, a protein or other complex macromolecular structures of interest with high affinity and specificity, comparable to those of antibodies. Recently, aptamer selection protocols were developed for targeting living cells, including tumors. Chemical modifications of the aptamers and modalities of their detection and delivery systems are already available with high selectivity and targeting ability for the desired cancer cell type, making them promising for diagnosis and therapy. Glioblastoma multiformae represents the most malignant and fatal stage of glioma, and is also the most frequent brain tumor. Glioblastoma-specific aptamers were developed by either targeting the whole cell surface or known glioma biomarkers. These aptamers may gain importance for imaging, tumor cell isolation from biopsies and drug delivery. In biomedical imaging techniques, aptamers coupled with radionuclide or fluorescent labels, bioconjugates and nanoparticles offer an advanced, noninvasive manner for defining the glioblastoma tissue border. Though single modality aptamer imaging probes have some limitations, these are overcome by the use of multimodal probes. Due to selectivity and chemical characteristics, aptamers can be coupled to functionalized nanoparticles and loaded with a drug, appeared promising for in vivo targeting of glioblastoma. Finally, aptamers are effective mediators for gene silencing when coupled to small interfering RNA and a viral vector, thus providing a novel tool with enhanced targeting capability in drug delivery, designed for tailored treatment of glioblastoma patients.

  7. Biosensor platform based on carbon nanotubes covalently modified with aptamers

    NASA Astrophysics Data System (ADS)

    Komarov, I. A.; Rubtsova, E. I.; Golovin, A. V.; Bobrinetskiy, I. I.

    2016-12-01

    We developed a new platform for biosensing applications. Aptamers as sensitive agents have a great potential and gives us possibility to have highest possible selectivity among other sensing agents like enzymes or antibodies. We covalently bound aptamers to the functional groups of c-CNTs and then put this system on the surface of polymer substrate. Thus we got high sensitive flexible transparent biological sensors. We also suggest that by varying aptamer type we can make set of biosensors for disease detection which can be integrated into self-healthcare systems and gadgets.

  8. Graphene- and aptamer-based electrochemical biosensor.

    PubMed

    Xu, Ke; Meshik, Xenia; Nichols, Barbara M; Zakar, Eugene; Dutta, Mitra; Stroscio, Michael A

    2014-05-23

    This study investigated the effectiveness of a graphene- and aptamer-based field-effect-transistor-like (FET-like) sensor in detecting lead and potassium ions. The sensor consists of a graphene-covered Si/SiO2 wafer with thrombin binding aptamer (TBA) attached to the graphene layer and terminated by a methylene blue (MB) molecule. K(+) and Pb(2+) both bind to TBA and cause a conformational change, which results in MB moving closer to the graphene surface and donating an electron. Thus, the abundance of K(+) and Pb(2+) can be determined by monitoring the current across the source and drain channel. Device transfer curves were obtained with ambipolar field effect observed. Current readings were taken for K(+) concentrations of 100 μM to 50 mM and Pb(2+) concentrations of 10 μM to 10 mM. As expected, I d decreased as ion concentration increased. In addition, there was a negative shift in V Dirac in response to increased ion concentration.

  9. Graphene- and aptamer-based electrochemical biosensor

    NASA Astrophysics Data System (ADS)

    Xu, Ke; Meshik, Xenia; Nichols, Barbara M.; Zakar, Eugene; Dutta, Mitra; Stroscio, Michael A.

    2014-05-01

    This study investigated the effectiveness of a graphene- and aptamer-based field-effect-transistor-like (FET-like) sensor in detecting lead and potassium ions. The sensor consists of a graphene-covered Si/SiO2 wafer with thrombin binding aptamer (TBA) attached to the graphene layer and terminated by a methylene blue (MB) molecule. K+ and Pb2+ both bind to TBA and cause a conformational change, which results in MB moving closer to the graphene surface and donating an electron. Thus, the abundance of K+ and Pb2+ can be determined by monitoring the current across the source and drain channel. Device transfer curves were obtained with ambipolar field effect observed. Current readings were taken for K+ concentrations of 100 μM to 50 mM and Pb2+ concentrations of 10 μM to 10 mM. As expected, I d decreased as ion concentration increased. In addition, there was a negative shift in V Dirac in response to increased ion concentration.

  10. Aptamers: A promising chemical antibody for cancer therapy

    PubMed Central

    Zhou, Gang; Wilson, George; Hebbard, Lionel; Duan, Wei; Liddle, Christopher; George, Jacob; Qiao, Liang

    2016-01-01

    Aptamers, also known as chemical antibodies, are single-stranded nucleic acid oligonucleotides which bind to their targets with high specificity and affinity. They are typically selected by repetitive in vitro process termed systematic evolution of ligands by exponential enrichment (SELEX). Owing to their excellent properties compared to conventional antibodies, notably their smaller physical size and lower immunogenicity and toxicity, aptamers have recently emerged as a new class of agents to deliver therapeutic drugs to cancer cells by targeting specific cancer-associated hallmarks. Aptamers can also be structurally modified to make them more flexible in order to conjugate other agents such as nano-materials and therapeutic RNA agents, thus extending their applications for cancer therapy. This review presents the current knowledge on the practical applications of aptamers in the treatment of a variety of cancers. PMID:26863567

  11. Aptamer based electrochemical sensors for emerging environmental pollutants

    NASA Astrophysics Data System (ADS)

    Hayat, Akhtar; Marty, Jean Louis

    2014-06-01

    Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide) as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.

  12. Aptamer Binding Studies Using MicroScale Thermophoresis.

    PubMed

    Breitsprecher, Dennis; Schlinck, Nina; Witte, David; Duhr, Stefan; Baaske, Philipp; Schubert, Thomas

    2016-01-01

    The characterization and development of highly specific aptamers requires the analysis of the interaction strength between aptamer and target. MicroScale Thermophoresis (MST) is a rapid and precise method to quantify biomolecular interactions in solution at microliter scale. The basis of this technology is a physical effect referred to as thermophoresis, which describes the directed movement of molecules through temperature gradients. The thermophoretic properties of a molecule depend on its size, charge, and hydration shell. Since at least one of these parameters is altered upon binding of a ligand, this method can be used to analyze virtually any biomolecular interaction in any buffer or complex bioliquid. This section provides a detailed protocol describing how MST is used to obtain quantitative binding parameters for aptamer-target interactions. The two DNA-aptamers HD1 and HD22, which are targeted against human thrombin, are used as model systems to demonstrate a rapid and straightforward screening approach to determine optimal buffer conditions.

  13. Evolution and Characterization of a Benzylguanine-binding RNA Aptamer

    PubMed Central

    Xu, J.; Carrocci, T.J.; Hoskins, A. A.

    2016-01-01

    Repurposing the “protein-labeling toolkit” for RNA research could be a pragmatic approach for developing new RNA-labeling methods. We have evolved an RNA aptamer that tightly binds benzylguanine (bG), the key ligand for the protein SNAP-tag. The aptamer tightly binds bG fluorophores and can be purified from cellular RNA with bG agarose under native conditions. PMID:26538152

  14. Identification and Characterization of RNA Aptamers: A Long Aptamer Blocks the AMPA Receptor and a Short Aptamer Blocks Both AMPA and Kainate Receptors.

    PubMed

    Jaremko, William J; Huang, Zhen; Wen, Wei; Wu, Andrew; Karl, Nicholas; Niu, Li

    2017-03-21

    AMPA and kainate receptors, along with NMDA receptors, represent different subtypes of glutamate ion channels. AMPA and kainate receptors share a high degree of sequence and structural similarities, and excessive activity of these receptors has been implicated in neurological diseases such as epilepsy. Therefore, blocking detrimental activity of both receptor types could be therapeutically beneficial. Here, we report the use of an in vitro evolution approach involving systematic evolution of ligands by exponential enrichment with a single AMPA receptor target (i.e. GluA1/2R) to isolate RNA aptamers that can potentially inhibit both AMPA and kainate receptors. A full-length or 101-nucleotide (nt) aptamer selectively inhibited GluA1/2R with a KI of ~5 µM, along with GluA1 and GluA2 AMPA receptor subunits. Of note, its shorter version (55 nt) inhibited both AMPA and kainate receptors. In particular, this shorter aptamer blocked equally potently the activity of both the GluK1 and GluK2 kainate receptors. Using homologous binding and whole-cell recording assays, we found that an RNA aptamer most likely binds to the receptor's regulatory site and inhibits it noncompetitively. Our results suggest the potential of using a single receptor target to develop RNA aptamers with dual activity for effectively blocking both AMPA and kainate receptors.

  15. FRET-based aptamer biosensor for selective and sensitive detection of aflatoxin B1 in peanut and rice.

    PubMed

    Sabet, Fereshte Sadat; Hosseini, Morteza; Khabbaz, Hossein; Dadmehr, Mehdi; Ganjali, Mohammad Reza

    2017-04-01

    Aflatoxins are potential food pollutants produced by fungi. Among them, Aflatoxin B1 (AFB1) is the most toxic. Therefore, a great deal of concern is associated with AFB1 toxicity. In this work, utilizing a FRET-based method, we have developed a nanobiosensor for detection of AFB1 in agricultural foods. Aptamer-conjugated Quantum dots (QDs) are adsorbed to Au nanoparticles (AuNPs) due to interaction of aptamers with AuNPs leading to quenching effect on QDs fluorescence. Upon the addition of AFB1, the specific aptamers are attracted to AFB1, getting distance from AuNPs which result in fluorescence recovery. Under optimized conditions the detection limit of proposed nanobiosensor was 3.4nM with linear range of 10-400nM. Selectivity test demonstrates that the nanobiosensor could be a promising tool for specific evaluation of food stuff. This method was successfully applied for the analysis of AFB1 in rice and peanut samples.

  16. APTAMER-BASED SERRS SENSOR FOR THROMBIN DETECTION

    SciTech Connect

    Cho, H; Baker, B R; Wachsmann-Hogiu, S; Pagba, C V; Laurence, T A; Lane, S M; Lee, L P; Tok, J B

    2008-07-02

    We describe an aptamer-based Surface Enhanced Resonance Raman Scattering (SERRS) sensor with high sensitivity, specificity, and stability for the detection of a coagulation protein, human a-thrombin. The sensor achieves high sensitivity and a limit of detection of 100 pM by monitoring the SERRS signal change upon the single step of thrombin binding to immobilized thrombin binding aptamer. The selectivity of the sensor is demonstrated by the specific discrimination of thrombin from other protein analytes. The specific recognition and binding of thrombin by the thrombin binding aptamer is essential to the mechanism of the aptamer-based sensor, as shown through measurements using negative control oligonucleotides. In addition, the sensor can detect 1 nM thrombin in the presence of complex biofluids, such as 10% fetal calf serum, demonstrating that the immobilized, 5{prime}-capped, 3{prime}-capped aptamer is sufficiently robust for clinical diagnostic applications. Furthermore, the proposed sensor may be implemented for multiplexed detection using different aptamer-Raman probe complexes.

  17. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  18. Aptamer-targeted RNAi for HIV-1 therapy.

    PubMed

    Zhou, Jiehua; Rossi, John J

    2011-01-01

    The highly specific mechanism of RNA (RNAi) that inhibits the expression of disease genes is increasingly being harnessed to develop a new class of therapeutics for a wide variety of human maladies. The successful use of small interfering RNAs (siRNAs) for therapeutic purposes requires safe and efficient delivery to specific cells and tissues. Herein, we demonstrate novel cell type-specific dual inhibitory function anti-gp120 aptamer-siRNA delivery systems for HIV-1 therapy, in which both the aptamer and the siRNA portions have potent anti-HIV activities. The envelope glycoprotein is expressed on the surface of HIV-1 infected cells, allowing binding and internalization of the aptamer-siRNA chimeric molecules. The Dicer substrate siRNA delivered by the aptamers is functionally processed by Dicer, resulting in specific inhibition of HIV-1 replication and infectivity in cultured CEM T-cells and primary blood mononuclear cells. Our results provide a set of novel aptamer-targeted RNAi therapeutics to combat HIV and further validate the use of anti-gp120 aptamers for delivery of Dicer substrate siRNAs.

  19. Aptamer-guided gene targeting in yeast and human cells

    PubMed Central

    Ruff, Patrick; Koh, Kyung Duk; Keskin, Havva; Pai, Rekha B.; Storici, Francesca

    2014-01-01

    Gene targeting is a genetic technique to modify an endogenous DNA sequence in its genomic location via homologous recombination (HR) and is useful both for functional analysis and gene therapy applications. HR is inefficient in most organisms and cell types, including mammalian cells, often limiting the effectiveness of gene targeting. Therefore, increasing HR efficiency remains a major challenge to DNA editing. Here, we present a new concept for gene correction based on the development of DNA aptamers capable of binding to a site-specific DNA binding protein to facilitate the exchange of homologous genetic information between a donor molecule and the desired target locus (aptamer-guided gene targeting). We selected DNA aptamers to the I-SceI endonuclease. Bifunctional oligonucleotides containing an I-SceI aptamer sequence were designed as part of a longer single-stranded DNA molecule that contained a region with homology to repair an I-SceI generated double-strand break and correct a disrupted gene. The I-SceI aptamer-containing oligonucleotides stimulated gene targeting up to 32-fold in yeast Saccharomyces cerevisiae and up to 16-fold in human cells. This work provides a novel concept and research direction to increase gene targeting efficiency and lays the groundwork for future studies using aptamers for gene targeting. PMID:24500205

  20. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  1. Carbon-based nanocomposites with aptamer-templated silver nanoclusters for the highly sensitive and selective detection of platelet-derived growth factor.

    PubMed

    Zhang, Zhihong; Guo, Chuanpan; Zhang, Shuai; He, Linghao; Wang, Minghua; Peng, Donglai; Tian, Junfeng; Fang, Shaoming

    2017-03-15

    We synthesized two kinds of carbon-based nanocomposites of silver nanoclusters (AgNCs). An aptamer for targeted platelet-derived growth factor-BB (PDGF-BB) detection was used as the organic phase to produce AgNCs@Apt, three dimensional reduced graphene oxide@AgNCs@Aptamer (3D-rGO@AgNCs@Apt), and graphene quantum dots@AgNCs@Aptamer (GQD@AgNCs@Apt) nanocomposites. The formation mechanism of the developed nanocomposites was described by detailed characterizations of their chemical and crystal structures. Subsequently, the as-synthesized nanoclusters containing aptamer strands were applied as the sensitive layers to fabricate a novel electrochemical aptasensor for the detection of PDGF-BB, which may be directly used to determine the target protein. Electrochemical impedance spectra showed that the developed 3D-rGO@AgNCs@Apt-based biosensor exhibited the highest sensitivity for PDGF-BB detection among three kinds of fabricated aptasensors, with an extremely low detection limit of 0.82pgmL(-1). In addition, the 3D-rGO@AgNCs@Apt-based biosensor showed high selectivity, stability, and applicability for the detection of PDGF-BB. This finding indicated that the AgNC-based nanocomposites prepared by a one-step method could be used as an electrochemical biosensor for various detection procedures in the biomedical field.

  2. Cell-SELEX Identifies a “Sticky” RNA Aptamer Sequence

    PubMed Central

    2017-01-01

    Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing) this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface. PMID:28194280

  3. High-affinity RNA aptamers to C-reactive protein (CRP): newly developed pre-elution methods for aptamer selection

    NASA Astrophysics Data System (ADS)

    Orito, N.; Umekage, S.; Sato, K.; Kawauchi, S.; Tanaka, H.; Sakai, E.; Tanaka, T.; Kikuchi, Y.

    2012-03-01

    We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be KD = 2.25×10-9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.

  4. Aptamer-initiated on-particle template-independent enzymatic polymerization (aptamer-OTEP) for electrochemical analysis of tumor biomarkers.

    PubMed

    Wang, Pengjuan; Wan, Ying; Deng, Shengyuan; Yang, Shulin; Su, Yan; Fan, Chunhai; Aldalbahi, Ali; Zuo, Xiaolei

    2016-12-15

    Herein, an aptamer-initiated on-particle template-independent enzymatic polymerization (aptamer-OTEP) strategy for electrochemical aptasensor (E-aptasensor) is developed for analysis of cancer biomarker carcino-embryonic antigen (CEA). A pair of DNA aptamers is employed which can be specifically bond with CEA simultaneously. One of the aptamer is thiolated at 3'-terminal and immobilized onto the gold electrode as a capture probe, while the other one has a thiol group at its 5'-terminal and is modified onto the gold nanoparticles surface to form a nanoprobe. In the present of target, the two aptamers can "sandwich" the target, thus the nanoprobe is attached to the electrode. Then terminal deoxynucleotidyl transferase (TdT) is employed to catalyze the incorporation of biotin labeled dNTPs into the 3'-OH terminals of the DNA aptamer on the nanoprobe. The as-generated long DNA oligo tentacles allow specific binding of numerous avidin modified horseradish peroxidase (Av-HRP), resulting in tens of thousands of HRP catalyzed reduction of hydrogen peroxide and sharply increasing electrochemical signals. Taking advantage of the enzyme based nucleic acid amplification and nanoprobe, this strategy is demonstrated to possess the outstanding amplification efficiency.

  5. RNA aptamer evolution: two decades of SELEction.

    PubMed

    Aquino-Jarquin, Guillermo; Toscano-Garibay, Julia D

    2011-01-01

    Aptamers are small non-coding RNAs capable of recognizing, with high specificity and affinity, a wide variety of molecules in a manner that resembles antibodies. This class of nucleic acids is the resulting product of applying a well-established screening method known as SELEX. First developed in 1990, the SELEX process has become a powerful tool to select structured oligonucleotides for the recognition of targets, starting with small molecules, going through protein complexes until whole cells. SELEX has also evolved along with new technologies positioning itself as an alternative in the design of a new class of therapeutic agents in modern molecular medicine. This review is an historical follow-up of SELEX method over the two decades since its first appearance.

  6. Polymeric nanoparticle-aptamer bioconjugates can diminish the toxicity of mercury in vivo.

    PubMed

    Hu, Xiangang; Tulsieram, Kurt Lomas; Zhou, Qixing; Mu, Li; Wen, Jianping

    2012-01-05

    Targeted delivery drugs by nanoparticles and aptamers is a hot issue; however, the application to ameliorate toxicity of toxicants is unknown, and the information about nanoparticle-aptamer toxicology and pharmacology is limited. In this work, nanoparticle-aptamer was synthesized and then its toxicological and pharmacological information was studied. Mercury was selected as a model toxicant and the antidote was entrapped by nanoparticle-aptamer. The nanoparticle-aptamer with a suitable size of 120 nm avoided aptamer biodegradation and achieved an effective release of antidote. Rats were orally administered mercury-contaminated rice and then nanoparticle-aptamer was intravenously injected. The nanoparticle-aptamer markedly reduced the quantity of mercury in both the brain and kidney, and enhanced the excretion of urinary mercury. Water Maze and Open Field tests showed that nanoparticle-aptamer ameliorated the neurotoxicity and improved the learning and memory of rats. The pharmacology of nanoparticle-aptamer involved slow antidote release, antidote-toxicant antagonism, enhancement of crucial enzymes activity and decreased lipid peroxidation. Toxicology of nanoparticle-aptamer was also studied by hematologic tests (creatinine, urea, red and white blood cell), and exhibited little toxicity. Nanoparticle-aptamer can diminish the toxicity of mercury in vivo with few adverse effects, and is a potential tool in reducing the hazards of toxicants to human health.

  7. Aptamer-Mediated Targeted Delivery of Therapeutics: An Update

    PubMed Central

    Catuogno, Silvia; Esposito, Carla L.; de Franciscis, Vittorio

    2016-01-01

    The selective delivery of drugs in a cell- or tissue-specific manner represents the main challenge for medical research; in order to reduce the occurrence of unwanted off-target effects. In this regard, nucleic acid aptamers have emerged as an attractive class of carrier molecules due to their ability to bind with high affinity to specific ligands; their high chemical flexibility; as well as tissue penetration capability. To date, different aptamer-drug systems and aptamer–nanoparticles systems, in which nanoparticles function together with aptamers for the targeted delivery, have been successfully developed for a wide range of therapeutics, including toxins; peptides; chemotherapeutics and oligonucleotides. Therefore, aptamer-mediated drug delivery represents a powerful tool for the safe and effective treatment of different human pathologies, including cancer; neurological diseases; immunological diseases and so on. In this review, we will summarize recent progress in the field of aptamer-mediated drug delivery and we will discuss the advantages, the achieved objectives and the challenges to be still addressed in the near future, in order to improve the effectiveness of therapies. PMID:27827876

  8. Aptamers in Diagnostics and Treatment of Viral Infections

    PubMed Central

    Wandtke, Tomasz; Woźniak, Joanna; Kopiński, Piotr

    2015-01-01

    Aptamers are in vitro selected DNA or RNA molecules that are capable of binding a wide range of nucleic and non-nucleic acid molecules with high affinity and specificity. They have been conducted through the process known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment). It serves to reach specificity and considerable affinity to target molecules, including those of viral origin, both proteins and nucleic acids. Properties of aptamers allow detecting virus infected cells or viruses themselves and make them competitive to monoclonal antibodies. Specific aptamers can be used to interfere in each stage of the viral replication cycle and also inhibit its penetration into cells. Many current studies have reported possible application of aptamers as a treatment or diagnostic tool in viral infections, e.g., HIV (Human Immunodeficiency Virus), HBV (Hepatitis B Virus), HCV (Hepatitis C Virus), SARS (Severe Acute Respiratory Syndrome), H5N1 avian influenza and recently spread Ebola. This review presents current developments of using aptamers in the diagnostics and treatment of viral diseases. PMID:25690797

  9. Aptamers as radiopharmaceuticals for nuclear imaging and therapy.

    PubMed

    Gijs, Marlies; Aerts, An; Impens, Nathalie; Baatout, Sarah; Luxen, André

    2016-04-01

    Today, radiopharmaceuticals belong to the standard instrumentation of nuclear medicine, both in the context of diagnosis and therapy. The majority of radiopharmaceuticals consist of targeting biomolecules which are designed to interact with a disease-related molecular target. A plethora of targeting biomolecules of radiopharmaceuticals exists, including antibodies, antibody fragments, proteins, peptides and nucleic acids. Nucleic acids have some significant advantages relative to proteinaceous biomolecules in terms of size, production, modifications, possible targets and immunogenicity. In particular, aptamers (non-coding, synthetic, single-stranded DNA or RNA oligonucleotides) are of interest because they can bind a molecular target with high affinity and specificity. At present, few aptamers have been investigated preclinically for imaging and therapeutic applications. In this review, we describe the use of aptamers as targeting biomolecules of radiopharmaceuticals. We also discuss the chemical modifications which are needed to turn aptamers into valuable (radio-)pharmaceuticals, as well as the different radiolabeling strategies that can be used to radiolabel oligonucleotides and, in particular, aptamers.

  10. Aptamer-Based Technologies in Foodborne Pathogen Detection

    PubMed Central

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome. PMID:27672383

  11. Targeting Insulin Receptor with a Novel Internalizing Aptamer

    PubMed Central

    Iaboni, Margherita; Fontanella, Raffaela; Rienzo, Anna; Capuozzo, Maria; Nuzzo, Silvia; Santamaria, Gianluca; Catuogno, Silvia; Condorelli, Gerolama; de Franciscis, Vittorio; Esposito, Carla Lucia

    2016-01-01

    Nucleic acid-based aptamers are emerging as therapeutic antagonists of disease-associated proteins such as receptor tyrosine kinases. They are selected by an in vitro combinatorial chemistry approach, named Systematic Evolution of Ligands by Exponential enrichment (SELEX), and thanks to their small size and unique chemical characteristics, they possess several advantages over antibodies as diagnostics and therapeutics. In addition, aptamers that rapidly internalize into target cells hold as well great potential for their in vivo use as delivery tools of secondary therapeutic agents. Here, we describe a nuclease resistant RNA aptamer, named GL56, which specifically recognizes the insulin receptor (IR). Isolated by a cell-based SELEX method that allows enrichment for internalizing aptamers, GL56 rapidly internalizes into target cells and is able to discriminate IR from the highly homologous insulin-like growth factor receptor 1. Notably, when applied to IR expressing cancer cells, the aptamer inhibits IR dependent signaling. Given the growing interest in the insulin receptor as target for cancer treatment, GL56 reveals a novel molecule with great translational potential as inhibitor and delivery tool for IR-dependent cancers. PMID:27648925

  12. QCM-based aptamer selection and detection of Salmonella typhimurium.

    PubMed

    Wang, Lijun; Wang, Ronghui; Chen, Fang; Jiang, Tieshan; Wang, Hong; Slavik, Michael; Wei, Hua; Li, Yanbin

    2017-04-15

    In this study, quartz crystal microbalance (QCM) was used to select aptamers against Salmonella typhimurium. To increase the success rate of Systematic Evolution of Ligands Exponential Enrichment (SELEX), the affinity of DNA pool in each round was simultaneously tracked using QCM in order to avoid the loss of high-quality aptamers. When the frequency change reached a maximum value after several rounds of selection and counter-selection, the candidate pool was cloned and sequenced. Out of three aptamer candidates, aptamer B5 showed high specificity and binding affinity with dissociation constant (Kd value) of 58.5nM, and was chosen for further studies. Subsequently, a QCM-based aptasensor was developed to detect S. typhimurium. This aptasensor was able to detect 10(3)CFU/mL of S. typhimurium with less than 1h. This study demonstrated QCM-based selection could be more effective selection of aptamers and QCM-based aptasensor could be more sensitive in detecting S. typhimurium.

  13. Isolation of an Aptamer that Binds Specifically to E. coli

    PubMed Central

    Cleto, Fernanda; Krieger, Marco Aurélio; Cardoso, Josiane

    2016-01-01

    Escherichia coli is a bacterial species found ubiquitously in the intestinal flora of animals, although pathogenic variants cause major public health problems. Aptamers are short oligonucleotides that bind to targets with high affinity and specificity, and have great potential for use in diagnostics and therapy. We used cell-based Systematic Evolution of Ligands by EXponential enrichment (cell-SELEX) to isolate four single stranded DNA (ssDNA) aptamers that bind strongly to E. coli cells (ATCC generic strain 25922), with Kd values in the nanomolar range. Fluorescently labeled aptamers label the surface of E. coli cells, as viewed by fluorescent microscopy. Specificity tests with twelve different bacterial species showed that one of the aptamers–called P12-31—is highly specific for E. coli. Importantly, this aptamer binds to Meningitis/sepsis associated E. coli (MNEC) clinical isolates, and is the first aptamer described with potential for use in the diagnosis of MNEC-borne pathologies. PMID:27104834

  14. Acousto-microfluidics for screening of ssDNA aptamer

    PubMed Central

    Park, Jee-Woong; Lee, Su Jin; Ren, Shuo; Lee, Sangwook; Kim, Soyoun; Laurell, Thomas

    2016-01-01

    We demonstrate a new screening method for obtaining a prostate-specific antigen (PSA) binding aptamer based on an acoustofluidic separation (acoustophoreis) technique. Since acoustophoresis provides simultaneous washing and separation in a continuous flow mode, we efficiently obtained a PSA binding aptamer that shows high affinity without any additional washing step, which is necessary in other screening methods. In addition, next-generation sequencing (NGS) was applied to accelerate the identification of the screened ssDNA pool, improving the selecting process of the aptamer candidate based on the frequency ranking of the sequences. After the 8th round of the acoustophoretic systematic evolution of ligands by exponential enrichment (SELEX) and following sequence analysis with NGS, 7 PSA binding ssDNA aptamer-candidates were obtained and characterized with surface plasmon resonance (SPR) for affinity and specificity. As a result of the new SELEX method with PSA as the model target protein, the best PSA binding aptamer showed specific binding to PSA with a dissociation constant (Kd) of 0.7 nM. PMID:27272884

  15. Selection of DNA aptamers against rat liver X receptors

    SciTech Connect

    Surugiu-Waernmark, Ioana . E-mail: Ioana.Warnmark@tbiokem.lth.se; Waernmark, Anette; Toresson, Gudrun; Gustafsson, Jan-Ake; Buelow, Leif

    2005-07-01

    Liver X receptors alpha and beta (LXR{alpha}; LXR{beta}) are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors. LXRs play an important role in the reverse cholesterol transport and govern the expression of many of the proteins that are indispensable for the regulation of normal cholesterol levels in the body. SELEX, an in vitro selection technology, was used on a single stranded DNA library harboring a 12 randomized nucleotide sequence in order to isolate aptamers showing affinity for LXR{alpha}. Enzyme-linked assays and surface plasmon resonance measurements showed that the selected aptamers had strong affinities for LXR{alpha} with apparent dissociation constants, K {sub d}s, in nanomolar range. All clones carried CG-repeats, indicating a probability for a similar manner of binding to LXR{alpha}. Very high cross-reactivities were observed when testing the aptamers with LXR{beta} (up to 700%) and RXR{alpha} (up to 50%). If instead we regard the aptamer sequences as selected against LXR{beta}, the cross-reactivities decrease considerably, to 17% for LXR{alpha} and 7% for RXR{alpha}. Therefore, in the future we are planning to use the obtained aptamers as binders for LXR{beta}.

  16. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing

    PubMed Central

    Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E.; Scheller, Frieder W.

    2016-01-01

    Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either “evolution in the test tube” of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the “biological” degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application. PMID:27438862

  17. DEK-targeting DNA aptamers as therapeutics for inflammatory arthritis

    PubMed Central

    Mor-Vaknin, Nirit; Saha, Anjan; Legendre, Maureen; Carmona-Rivera, Carmelo; Amin, M Asif; Rabquer, Bradley J.; Gonzales-Hernandez, Marta J.; Jorns, Julie; Mohan, Smriti; Yalavarthi, Srilakshmi; Pai, Dave A.; Angevine, Kristine; Almburg, Shelley J.; Knight, Jason S.; Adams, Barbara S.; Koch, Alisa E.; Fox, David A.; Engelke, David R.; Kaplan, Mariana J.; Markovitz, David M.

    2017-01-01

    Novel therapeutics are required for improving the management of chronic inflammatory diseases. Aptamers are single-stranded RNA or DNA molecules that have recently shown utility in a clinical setting, as they can specifically neutralize biomedically relevant proteins, particularly cell surface and extracellular proteins. The nuclear chromatin protein DEK is a secreted chemoattractant that is abundant in the synovia of patients with juvenile idiopathic arthritis (JIA). Here, we show that DEK is crucial to the development of arthritis in mouse models, thus making it an appropriate target for aptamer-based therapy. Genetic depletion of DEK or treatment with DEK-targeted aptamers significantly reduces joint inflammation in vivo and greatly impairs the ability of neutrophils to form neutrophil extracellular traps (NETs). DEK is detected in spontaneously forming NETs from JIA patient synovial neutrophils, and DEK-targeted aptamers reduce NET formation. DEK is thus key to joint inflammation, and anti-DEK aptamers hold promise for the treatment of JIA and other types of arthritis. PMID:28165452

  18. Micropatterning of Aptamer Beacons to Create Cytokine-Sensing Surfaces

    PubMed Central

    Tuleuova, Nazgul

    2010-01-01

    Aptamer beacons are DNA or RNA probes that bind proteins or small molecules of interest and emit signal directly upon interaction with the target analyte. This paper describes micropatterning of aptamer beacons for detection of IFN-γ—an important inflammatory cytokine. The beacon consisted of a fluorophore-labeled aptamer strand hybridized with a shorter, quencher-carrying complementary strand. Cytokine molecules were expected to displace quenching strands of the beacon, disrupting FRET effect and resulting in fluorescence signal. The glass substrate was first micropatterned with poly(ethylene glycol) (PEG) hydrogel microwells (35 μm diameter individual wells) so as to define sites for attachment of beacon molecules. PEG microwell arrays were then incubated with avidin followed by biotin-aptamer-fluorophore constructs. Subsequent incubation with quencher-carrying complementary strands resulted in formation of DNA duplex and caused quenching of fluorescence due to FRET effect. When exposed to IFN-γ, microwells changed fluorescence from low (quencher hybridized with fluorophore-carrying strand) to high (quenching strand displaced by cytokine molecules). The fluorescence signal was confined to microwells, was changing in real-time and was dependent on the concentration of IFN-γ. In the future, we plan to co-localize aptamer beacons and cells on micropatterned surfaces in order to monitor in real-time cytokine secretion from immune cells in microwells. PMID:21170394

  19. Selection of peptidoglycan-specific aptamers for bacterial cells identification.

    PubMed

    Ferreira, Iêda Mendes; de Souza Lacerda, Camila Maria; de Faria, Lígia Santana; Corrêa, Cristiane Rodrigues; de Andrade, Antero Silva Ribeiro

    2014-12-01

    Peptidoglycan is a highly complex and essential macromolecule of bacterial outer cell wall; it is a heteropolymer made up of linear glycan strands cross-linked by peptides. Peptidoglycan has a particular composition which makes it a possible target for specific bacterial recognition. Aptamers are single-stranded DNA or RNA oligonucleotides that bind to target molecules with high affinity and specificity. Aptamers can be labeled with different radioisotopes and possess several properties that make them suitable for molecular imaging. The purpose of this study was to obtain aptamers for use as radiopharmaceutical in bacterial infection diagnosis. Two aptamers (Antibac1 and Antibac2) against peptidoglycan were selected through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology. The dissociation constant (Kd) for Antibac1 was 0.415 + 0.047 μM and for Antibac2 was 1.261 + 0.280 μM. These aptamers labeled with (32)P showed high affinity for Staphylococcus aureus cells. The binding to S. aureus and Escherichia coli in vitro were significantly higher than for Candida albicans and human fibroblasts, demonstrating their specificity for bacterial cells. These results point Antibac1 and Antibac2 as promising tools for bacterial infections identification.

  20. Molecularly Imprinted Polymers with DNA Aptamer Fragments as Macromonomers.

    PubMed

    Zhang, Zijie; Liu, Juewen

    2016-03-01

    Molecularly imprinted polymers (MIPs) are produced in the presence of a template molecule. After removing the template, the cavity can selectively rebind the template. MIPs are attractive functional materials with a low cost and high stability, but traditional MIPs often suffer from low binding affinity. This study employs DNA aptamer fragments as macromonomers to improve MIPs. The DNA aptamer for adenosine was first split into two halves, fluorescently labeled, and copolymerized into MIPs. With a fluorescence quenching assay, the importance of imprinting was confirmed. Further studies were carried out using isothermal titration calorimetry (ITC). Compared to the mixture of the free aptamer fragments, their MIPs doubled the binding affinity. Each free aptamer fragment alone cannot bind adenosine, whereas MIPs containing each fragment are effective binders. We further shortened one of the aptamer fragments, and the DNA length was pushed to as short as six nucleotides, yielding MIPs with a dissociation constant of 27 μM adenosine. This study provides a new method for preparing functional MIP materials by combining high-affinity biopolymer fragments with low-cost synthetic monomers, allowing higher binding affinity and providing a method for signaling binding based on DNA chemistry.

  1. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing.

    PubMed

    Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E; Scheller, Frieder W

    2016-07-18

    Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either "evolution in the test tube" of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the "biological" degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.

  2. Recent Progress in Aptamer-Based Functional Probes for Bioanalysis and Biomedicine.

    PubMed

    Zhang, Huimin; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong

    2016-07-11

    Nucleic acid aptamers are short synthetic DNA or RNA sequences that can bind to a wide range of targets with high affinity and specificity. In recent years, aptamers have attracted increasing research interest due to their unique features of high binding affinity and specificity, small size, excellent chemical stability, easy chemical synthesis, facile modification, and minimal immunogenicity. These properties make aptamers ideal recognition ligands for bioanalysis, disease diagnosis, and cancer therapy. This review highlights the recent progress in aptamer selection and the latest applications of aptamer-based functional probes in the fields of bioanalysis and biomedicine.

  3. Superior Performance of Aptamer in Tumor Penetration over Antibody: Implication of Aptamer-Based Theranostics in Solid Tumors

    PubMed Central

    Xiang, Dongxi; Zheng, Conglong; Zhou, Shu-Feng; Qiao, Shuxi; Tran, Phuong Ha-Lien; Pu, Chunwen; Li, Yong; Kong, Lingxue; Kouzani, Abbas Z.; Lin, Jia; Liu, Ke; Li, Lianhong; Shigdar, Sarah; Duan, Wei

    2015-01-01

    Insufficient penetration of therapeutic agents into tumor tissues results in inadequate drug distribution and lower intracellular concentration of drugs, leading to the increase of drug resistance and resultant failure of cancer treatment. Targeted drug delivery to solid tumors followed by complete drug penetration and durable retention will significantly improve clinical outcomes of cancer therapy. Monoclonal antibodies have been commonly used in clinic for cancer treatment, but their limitation of penetrating into tumor tissues still remains because of their large size. Aptamers, as “chemical antibodies”, are 15-20 times smaller than antibodies. To explore whether aptamers are superior to antibodies in terms of tumor penetration, we carried out the first comprehensive study to compare the performance of an EpCAM aptamer with an EpCAM antibody in theranostic applications. Penetration and retention were studied in in vitro three-dimensional tumorspheres, in vivo live animal imaging and mouse colorectal cancer xenograft model. We found that the EpCAM aptamer can not only effectively penetrate into the tumorsphere cores but can also be retained by tumor sphere cells for at least 24 h, while limited tumor penetration by EpCAM antibody was observed after 4 h incubation. As observed from in vivo live animal imaging, EpCAM aptamers displayed a maximum tumor uptake at around 10 min followed by a rapid clearance after 80 min, while the signal of peak uptake and disappearance of antibody appeared at 3 h and 6 h after intravenous injection, respectively. The signal of PEGylated EpCAM aptamers in xenograft tumors was sustained for 26 h, which was 4.3-fold longer than that of the EpCAM antibody. Consistently, there were 1.67-fold and 6.6-fold higher accumulation of PEGylated aptamer in xenograft tumors than that of antibody, at 3 h and 24 h after intravenous administration, respectively. In addition, the aptamer achieved at least a 4-time better tumor penetration in

  4. Superior Performance of Aptamer in Tumor Penetration over Antibody: Implication of Aptamer-Based Theranostics in Solid Tumors.

    PubMed

    Xiang, Dongxi; Zheng, Conglong; Zhou, Shu-Feng; Qiao, Shuxi; Tran, Phuong Ha-Lien; Pu, Chunwen; Li, Yong; Kong, Lingxue; Kouzani, Abbas Z; Lin, Jia; Liu, Ke; Li, Lianhong; Shigdar, Sarah; Duan, Wei

    2015-01-01

    Insufficient penetration of therapeutic agents into tumor tissues results in inadequate drug distribution and lower intracellular concentration of drugs, leading to the increase of drug resistance and resultant failure of cancer treatment. Targeted drug delivery to solid tumors followed by complete drug penetration and durable retention will significantly improve clinical outcomes of cancer therapy. Monoclonal antibodies have been commonly used in clinic for cancer treatment, but their limitation of penetrating into tumor tissues still remains because of their large size. Aptamers, as "chemical antibodies", are 15-20 times smaller than antibodies. To explore whether aptamers are superior to antibodies in terms of tumor penetration, we carried out the first comprehensive study to compare the performance of an EpCAM aptamer with an EpCAM antibody in theranostic applications. Penetration and retention were studied in in vitro three-dimensional tumorspheres, in vivo live animal imaging and mouse colorectal cancer xenograft model. We found that the EpCAM aptamer can not only effectively penetrate into the tumorsphere cores but can also be retained by tumor sphere cells for at least 24 h, while limited tumor penetration by EpCAM antibody was observed after 4 h incubation. As observed from in vivo live animal imaging, EpCAM aptamers displayed a maximum tumor uptake at around 10 min followed by a rapid clearance after 80 min, while the signal of peak uptake and disappearance of antibody appeared at 3 h and 6 h after intravenous injection, respectively. The signal of PEGylated EpCAM aptamers in xenograft tumors was sustained for 26 h, which was 4.3-fold longer than that of the EpCAM antibody. Consistently, there were 1.67-fold and 6.6-fold higher accumulation of PEGylated aptamer in xenograft tumors than that of antibody, at 3 h and 24 h after intravenous administration, respectively. In addition, the aptamer achieved at least a 4-time better tumor penetration in xenograft

  5. DNA Aptamers against Taiwan Banded Krait α-Bungarotoxin Recognize Taiwan Cobra Cardiotoxins.

    PubMed

    Chen, Ying-Jung; Tsai, Chia-Yu; Hu, Wan-Ping; Chang, Long-Sen

    2016-03-05

    Bungarus multicinctus α-bungarotoxin (α-Bgt) and Naja atra cardiotoxins (CTXs) share a common structural scaffold, and their tertiary structures adopt three-fingered loop motifs. Four DNA aptamers against α-Bgt have been reported previously. Given that the binding of aptamers with targeted proteins depends on structural complementarity, in this study, we investigated whether DNA aptamers against α-Bgt could also recognize CTXs. It was found that N. atra cardiotoxin 3 (CTX3) reduced the electrophoretic mobility of aptamers against α-Bgt. Analysis of the changes in the fluorescence intensity of carboxyfluorescein-labeled aptamers upon binding toxin molecules revealed that CTX3 and α-Bgt could bind the tested aptamers. Moreover, the aptamers inhibited the membrane-damaging activity and cytotoxicity of CTX3. In addition to CTX3, other N. atra CTX isotoxins also bound to the aptamer against α-Bgt. Taken together, our data indicate that aptamers against α-Bgt show cross-reactivity with CTXs. The findings that aptamers against α-Bgt also suppress the biological activities of CTX3 highlight the potential utility of aptamers in regard to the broad inhibition of snake venom three-fingered proteins.

  6. High affinity truncated DNA aptamers for the development of fluorescence based progesterone biosensors.

    PubMed

    Alhadrami, Hani A; Chinnappan, Raja; Eissa, Shimaa; Rahamn, Anas Abdel; Zourob, Mohammed

    2017-02-24

    Aptamers have shown a number of potential applications in sensing and therapeutic due to the high affinity and specificity towards their target molecules. Not all the nucleotides in the full length aptamers are involved in the binding with their targets. The non-binding domain of the aptamer may affect the binding affinity of the aptamer-target complex. Mapping the aptamer binding region could increase the affinity and the specificity. In this paper, we designed aptamer-based fluorescence sensors from a truncated progesterone (P4) aptamer. Then, fluorescein and quencher labelled aptamer complementary oligonucleotide sequences were hybridized to the truncated aptamer at different sites to form duplex structures. We used fluorescence-quencher pair displacement assay upon progesterone binding for the determination of P4. One of the truncated sequences has shown high binding affinity with 16 fold increase in the dissociation constant, Kd (2.1 nM) compared to the original aptamer. The aptasensor was highly selective for P4 against similar compounds such as 17-β estradiol, bisphenol-A and vitamin D. The sensor has been applied for the detection of P4 in spiked tap water and in urine samples showing good recovery. This new developed aptamer-based fluorescence biosensor can be applied in food, pharmaceutical, and clinical industries.

  7. Probing the coagulation pathway with aptamers identifies combinations that synergistically inhibit blood clot formation.

    PubMed

    Bompiani, Kristin M; Lohrmann, Jens L; Pitoc, George A; Frederiksen, James W; Mackensen, George B; Sullenger, Bruce A

    2014-08-14

    Coordinated enzymatic reactions regulate blood clot generation. To explore the contributions of various coagulation enzymes in this process, we utilized a panel of aptamers against factors VIIa, IXa, Xa, and prothrombin. Each aptamer dose-dependently inhibited clot formation, yet none was able to completely impede this process in highly procoagulant settings. However, several combinations of two aptamers synergistically impaired clot formation. One extremely potent aptamer combination was able to maintain human blood fluidity even during extracorporeal circulation, a highly procoagulant setting encountered during cardiopulmonary bypass surgery. Moreover, this aptamer cocktail could be rapidly reversed with antidotes to restore normal hemostasis, indicating that even highly potent aptamer combinations can be rapidly controlled. These studies highlight the potential utility of using sets of aptamers to probe the functions of proteins in molecular pathways for research and therapeutic ends.

  8. Improved Aptamers for the Diagnosis and Potential Treatment of HER2-Positive Cancer

    PubMed Central

    Gijs, Marlies; Penner, Gregory; Blackler, Garth B.; Impens, Nathalie R.E.N.; Baatout, Sarah; Luxen, André; Aerts, An M.

    2016-01-01

    Aptamers provide a potential source of alternative targeting molecules for existing antibody diagnostics and therapeutics. In this work, we selected novel DNA aptamers targeting the HER2 receptor by an adherent whole-cell SELEX approach. Individual aptamers were identified by next generation sequencing and bioinformatics analysis. Two aptamers, HeA2_1 and HeA2_3, were shown to bind the HER2 protein with affinities in the nanomolar range. In addition, both aptamers were able to bind with high specificity to HER2-overexpressing cells and HER2-positive tumor tissue samples. Furthermore, we demonstrated that aptamer HeA2_3 is being internalized into cancer cells and has an inhibitory effect on cancer cell growth and viability. In the end, we selected novel DNA aptamers with great potential for the diagnosis and possible treatment of HER2-positive cancer. PMID:27213406

  9. The characterization and validation of 17β-estradiol binding aptamers.

    PubMed

    Svobodová, Markéta; Skouridou, Vasso; Botero, Mary Luz; Jauset-Rubio, Miriam; Schubert, Thomas; Bashammakh, Abdulaziz S; El-Shahawi, Mohammad S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

    2017-03-01

    The rapid and sensitive detection of small molecules is garnering increasing importance, and aptamers show great promise in replacing expensive, elaborate detection platforms exploiting chromatographic separation or antibody-based assays. The characterization of aptamer interaction with small molecule targets is not facile, and there is a mature need for a rapid, high-throughput technique for the analysis of aptamer-small molecule kinetics and affinity. In this work we present methodologies for the evaluation of aptamer-small molecule interactions, using the aptamers reported against the steroid 17β-estradiol as a model system. Microscale thermophoresis, apta-PCR affinity assay and surface plasmon resonance were explored to evaluate the reported aptamers' binding properties in terms of affinity and specificity, and were demonstrated to be successfully applied to the analysis of aptamer-small molecule interactions.

  10. Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems

    PubMed Central

    Jiang, Feng; Liu, Biao; Lu, Jun; Li, Fangfei; Li, Defang; Liang, Chao; Dang, Lei; Liu, Jin; He, Bing; Atik Badshah, Shaikh; Lu, Cheng; He, Xiaojuan; Guo, Baosheng; Zhang, Xiao-Bing; Tan, Weihong; Lu, Aiping; Zhang, Ge

    2015-01-01

    Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX), are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems. PMID:26473828

  11. DNA Aptamer Based Nanodrugs: Molecular Engineering for Efficiency

    PubMed Central

    Cansiz, Sena; Zhang, Liqin; Wu, Cuichen; Wu, Yuan; Teng, I-Ting; Hou, Weijia; Wang, Yanyue; Wan, Shuo; Cai, Ren; Jin, Chen; Liu, Qiaoling; Tan, Weihong

    2015-01-01

    In the past two decades, the study of cancer therapy has gradually advanced to the “Nano” era. Numerous novel nanomaterials armed with unique physical properties have been introduced into biomedical research. At the same time, functional nucleic acid molecules, especially aptamers, have aroused broad attention from the biomedical community. Benefiting from the advancement of molecular engineering strategies, it is now feasible to combine the cancer specific recognition capability of aptamers with various other special functions of nanomaterials to develop cancer specific drugs at the nanoscale. Nanodrugs are now offering an unprecedented opportunity to achieve the goal of efficient targeted delivery as well as controlled release. This review highlights some achievements of multiple aptamer-based nanodrug systems which have emerged in recent years, including studies in the infant stage of “proof-of-concept”. PMID:26177853

  12. RNA Aptamers as Effective Protein Antagonists in a Multicellular Organism

    NASA Astrophysics Data System (ADS)

    Shi, Hua; Hoffman, Bryan E.; Lis, John T.

    1999-08-01

    RNA aptamers selected against proteins can be used to modulate specific protein function. Expression of such reagents in cells and whole organisms could provide a means of dissecting and controlling molecular mechanisms in vivo. We demonstrate that Drosophila B53 protein can be specifically inhibited in vitro and in vivo by a multivalent RNA aptamer. This inhibitory aptamer RNA binds B52 avidly and inhibits B52-stimulated pre-mRNA splicing. It can be expressed in cultured cells and whole animals in a stable form that accumulates up to 10% of total mRNA. It binds B52 in vivo and suppresses all phenotypes caused by B52 overexpression. The strategies presented here should prove general in design and expression of functional and therapeutic RNAs.

  13. Massively Parallel Interrogation of Aptamer Sequence, Structure and Function

    SciTech Connect

    Fischer, N O; Tok, J B; Tarasow, T M

    2008-02-08

    Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  14. Computational modeling of peptide-aptamer binding.

    PubMed

    Rhinehardt, Kristen L; Mohan, Ram V; Srinivas, Goundla

    2015-01-01

    Evolution is the progressive process that holds each living creature in its grasp. From strands of DNA evolution shapes life with response to our ever-changing environment and time. It is the continued study of this most primitive process that has led to the advancement of modern biology. The success and failure in the reading, processing, replication, and expression of genetic code and its resulting biomolecules keep the delicate balance of life. Investigations into these fundamental processes continue to make headlines as science continues to explore smaller scale interactions with increasing complexity. New applications and advanced understanding of DNA, RNA, peptides, and proteins are pushing technology and science forward and together. Today the addition of computers and advances in science has led to the fields of computational biology and chemistry. Through these computational advances it is now possible not only to quantify the end results but also visualize, analyze, and fully understand mechanisms by gaining deeper insights. The biomolecular motion that exists governing the physical and chemical phenomena can now be analyzed with the advent of computational modeling. Ever-increasing computational power combined with efficient algorithms and components are further expanding the fidelity and scope of such modeling and simulations. This chapter discusses computational methods that apply biological processes, in particular computational modeling of peptide-aptamer binding.

  15. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    SciTech Connect

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  16. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

    PubMed

    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

    2016-12-14

    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  17. Selection and Biosensor Application of Aptamers for Small Molecules

    PubMed Central

    Pfeiffer, Franziska; Mayer, Günter

    2016-01-01

    Small molecules play a major role in the human body and as drugs, toxins, and chemicals. Tools to detect and quantify them are therefore in high demand. This review will give an overview about aptamers interacting with small molecules and their selection. We discuss the current state of the field, including advantages as well as problems associated with their use and possible solutions to tackle these. We then discuss different kinds of small molecule aptamer-based sensors described in literature and their applications, ranging from detecting drinking water contaminations to RNA imaging. PMID:27379229

  18. RNA aptamers inhibit the growth of the fish pathogen viral hemorrhagic septicemia virus (VHSV).

    PubMed

    Punnarak, Porntep; Santos, Mudjekeewis D; Hwang, Seong Don; Kondo, Hidehiro; Hirono, Ikuo; Kikuchi, Yo; Aoki, Takashi

    2012-12-01

    Viral hemorrhagic septicemia virus (VHSV) is a serious disease impacting wild and cultured fish worldwide. Hence, an effective therapeutic method against VHSV infection needs to be developed. Aptamer technology is a new and promising method for diagnostics and therapeutics. It revolves around the use of an aptamer molecule, an artificial ligand (nucleic acid or protein), which has the capacity to recognize target molecules with high affinity and specificity. Here, we aimed at selecting RNA aptamers that can specifically bind to and inhibit the growth of a strain of fish VHSV both in vitro and in vivo. Three VHSV-specific RNA aptamers (F1, F2, and C6) were selected from a pool of artificially and randomly produced oligonucleotides using systematic evolution of ligands by exponential enrichment. The three RNA aptamers showed obvious binding to VHSV in an electrophoretic mobility shift assay but not to other tested viruses. The RNA aptamers were tested for their ability to inhibit VHSV in vitro using hirame natural embryo (HINAE) cells. Cytopathic effect and plaque assays showed that all aptamers inhibited the growth of VHSV in HINAE cells. In vivo tests using RNA aptamers produced by Rhodovulum sulfidophilum showed that extracellular RNA aptamers inhibited VHSV infection in Japanese flounder. These results suggest that the RNA aptamers are a useful tool for protection against VHSV infection in Japanese flounder.

  19. Identification of an Aptamer Binding to Human Osteogenic-Induced Progenitor Cells

    PubMed Central

    Niederlaender, Jan; Aicher, Wilhelm K.; Reinert, Siegmar; Schweizer, Ernst; Wendel, Hans-Peter; Alexander, Dorothea

    2013-01-01

    The aim of this study was to generate a specific aptamer against human jaw periosteal cells (JPCs) for tissue engineering applications in oral and maxillofacial surgery. This aptamer should serve as a capture molecule to enrich or even purify osteogenic progenitor cells from JPCs or from adult stem cells of other sources. Using systematic evolution of ligands by exponential enrichment (SELEX), we generated the first aptamer to specifically bind to human osteogenically induced JPCs. We did not detect any binding of the aptamer to undifferentiated JPCs, adipogenically and chondrogenically induced JPCs, or to any other cell line tested. However, similar binding patterns of the identified aptamer 74 were detected with mesenchymal stromal cells (MSCs) derived from placental tissue and bone marrow. After cell sorting, we analyzed the expression of osteogenic marker genes in the aptamer 74-positive and aptamer 74-negative fractions and detected no significant differences. Additionally, the analysis of the mineralization capacity revealed a slight tendency for the aptamer positive fraction to have a higher osteogenic potential. In terms of proliferation, JPCs growing in aptamer-coated wells showed increased proliferation rates compared with the controls. Herein, we report the development of an innovative approach for tissue engineering applications. Further studies should be conducted to modify and improve the specificity of the generated aptamer. PMID:23289534

  20. Modified AS1411 Aptamer Suppresses Hepatocellular Carcinoma by Up-Regulating Galectin-14

    PubMed Central

    Lee, Jeong-Hoon; Lee, Dong Hyeon; Cho, Eun Ju; Yu, Su Jong; Kim, Yoon Jun; Kim, Jong In; Im, Jong Hun; Lee, Jung Hwan; Oh, Eun Ju; Yoon, Jung-Hwan

    2016-01-01

    Aptamers are small synthetic oligonucleotides that bind to target proteins with high specificity and affinity. AS1411 is an aptamer that binds to nucleolin, which is overexpressed in the cytoplasm and occurs on the surface of cancer cells. We investigated the therapeutic potential of aptamers in hepatocellular carcinoma (HCC) by evaluating anti-tumor effects and confirming the affinity and specificity of AS1411- and modified AS1411-aptamers in HCC cells. Cell growth was assessed using the MTS assay, and cell death signaling was explored by immunoblot analysis. Fluorescence-activated cell sorting was performed to evaluate the affinity and specificity of AS1411-aptamers in SNU-761 HCC cells. We investigated the in vivo effects of the AS1411-aptamer using BALB/c nude mice in a subcutaneous xenograft model with SNU-761 cells. Treatment with a modified AS1411-aptamer significantly decreased in vitro (under normoxic [P = 0.035] and hypoxic [P = 0.018] conditions) and in vivo (under normoxic conditions, P = 0.041) HCC cell proliferation compared to control aptamers. AS1411- and control aptamers failed to control HCC cell proliferation. However, AS1411- and the modified AS1411-aptamer did not induce caspase activation. Decrease in cell growth by AS1411 or modified AS1411 was not prevented by caspase or necrosis inhibitors. In a microarray, AS1411 significantly enhanced galectin-14 expression. Suppression of HCC cell proliferation by the modified AS1411-aptamer was attenuated by galectin-14 siRNA transfection. Modified AS1411-aptamer suppressed HCC cell growth in vitro and in vivo by up-regulating galectin-14 expressions. Modified AS1411-aptamers may have therapeutic potential as a novel targeted therapy for HCC. PMID:27494117

  1. Regulation of photosensitisation processes by an RNA aptamer.

    PubMed

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-02-24

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)3(2+), an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)3(2+) (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)3(2+) chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.

  2. Long Shelf Life of a Lyophilized DNA Aptamer Beacon Assay.

    PubMed

    Bruno, John G

    2017-03-01

    An aptamer beacon previously developed to detect C-telopeptide (CTx) from human bone collagen breakdown was lyophilized and shown to give a "lights on" concentration-dependent spectral fluorescence response essentially identical to that of the fresh reagent despite storage in a dark dry environment for the past 5.5 years.

  3. Aptamer-based Field-Effect Biosensor for Tenofovir Detection.

    PubMed

    Aliakbarinodehi, N; Jolly, P; Bhalla, N; Miodek, A; De Micheli, G; Estrela, P; Carrara, S

    2017-03-15

    During medical treatment it is critical to maintain the circulatory concentration of drugs within their therapeutic range. A novel biosensor is presented in this work to address the lack of a reliable point-of-care drug monitoring system in the market. The biosensor incorporates high selectivity and sensitivity by integrating aptamers as the recognition element and field-effect transistors as the signal transducer. The drug tenofovir was used as a model small molecule. The biointerface of the sensor is a binary self-assembled monolayer of specific thiolated aptamer and 6-mercapto-1-hexanol (MCH), whose ratio was optimized by electrochemical impedance spectroscopy measurements to enhance the sensitivity towards the specific target. Surface plasmon resonance, performed under different buffer conditions, shows optimum specific and little non-specific binding in phosphate buffered saline. The dose-response behavior of the field-effect biosensor presents a linear range between 1 nM and 100 nM of tenofovir and a limit of detection of 1.2 nM. Two non-specific drugs and one non-specific aptamer, tested as stringent control candidates, caused negligible responses. The applications were successfully extended to the detection of the drug in human serum. As demonstrated by impedance measurements, the aptamer-based sensors can be used for real-time drug monitoring.

  4. Aptamer-based Field-Effect Biosensor for Tenofovir Detection

    PubMed Central

    Aliakbarinodehi, N.; Jolly, P.; Bhalla, N.; Miodek, A.; De Micheli, G.; Estrela, P.; Carrara, S.

    2017-01-01

    During medical treatment it is critical to maintain the circulatory concentration of drugs within their therapeutic range. A novel biosensor is presented in this work to address the lack of a reliable point-of-care drug monitoring system in the market. The biosensor incorporates high selectivity and sensitivity by integrating aptamers as the recognition element and field-effect transistors as the signal transducer. The drug tenofovir was used as a model small molecule. The biointerface of the sensor is a binary self-assembled monolayer of specific thiolated aptamer and 6-mercapto-1-hexanol (MCH), whose ratio was optimized by electrochemical impedance spectroscopy measurements to enhance the sensitivity towards the specific target. Surface plasmon resonance, performed under different buffer conditions, shows optimum specific and little non-specific binding in phosphate buffered saline. The dose-response behavior of the field-effect biosensor presents a linear range between 1 nM and 100 nM of tenofovir and a limit of detection of 1.2 nM. Two non-specific drugs and one non-specific aptamer, tested as stringent control candidates, caused negligible responses. The applications were successfully extended to the detection of the drug in human serum. As demonstrated by impedance measurements, the aptamer-based sensors can be used for real-time drug monitoring. PMID:28294122

  5. Aptamer-based trapping of phytosphingosine in urine samples.

    PubMed

    Fischer, Christin; Klockmann, Sven; Wessels, Hauke; Hünniger, Tim; Schrader, Jil; Paschke-Kratzin, Angelika; Fischer, Markus

    2016-11-20

    Usually, small molecules like single metabolites used in clinical diagnostic can be quantified by instrumental approaches like LC-MS or bioanalytical techniques using antibodies or aptamers as selective receptors. The present work comprises the generation of aptamers with an affinity towards the medically relevant metabolite phytosphingosine via the previously reported just in time-Selection approach (Hünniger et al., 2014). The whole approach could be seen as a proof of concept to extend the existing just in time-Selection protocol for selection towards small molecules with dissociation constants in the low nanomolar range. Moreover it is conceivable that the shown methods could be quickly adapted to further scopes. Aptamers could be applied for clean-up or concentration processes prior to further analysis. As an example, we used the selected aptamers towards phytosphingosine bound to magnetic particles for affinity enrichment in both selection buffer and urine samples. As an outcome, enrichment factors of up to 9-fold (selection buffer)/4-fold (urine samples) were achieved by this approach.

  6. Aptamer conjugated silver nanoparticles for the detection of interleukin 6

    NASA Astrophysics Data System (ADS)

    Locke, Andrea K.; Norwood, Nicole; Marks, Haley L.; Schechinger, Monika; Jackson, George W.; Graham, Duncan; Coté, Gerard L.

    2016-03-01

    The controlled assembly of plasmonic nanoparticles by a molecular binding event has emerged as a simple yet sensitive methodology for protein detection. Metallic nanoparticles (NPs) coated with functionalized aptamers can be utilized as biosensors by monitoring changes in particle optical properties, such as the LSPR shift and enhancement of the SERS spectra, in the presence of a target protein. Herein we test this method using two modified aptamers selected for the protein biomarker interleukin 6, an indicator of the dengue fever virus and other diseases including certain types of cancers, diabetes, and even arthritis. IL6 works by inducing an immunological response within the body that can be either anti-inflammatory or pro-inflammatory. The results show that the average hydrodynamic diameter of the NPs as measured by Dynamic Light Scattering was ~42 nm. After conjugation of the aptamers, the peak absorbance of the AgNPs shifted from 404 to 408 nm indicating a surface modification of the NPs due to the presence of the aptamer. Lastly, preliminary results were obtained showing an increase in SERS intensity occurs when the IL-6 protein was introduced to the conjugate solution but the assay will still need to be optimized in order for it to be able to monitor varying concentration changes within and across the desired range.

  7. Development of Antithrombotic Aptamers: From Recognizing Elements to Drugs.

    PubMed

    Zavyalova, Elena; Golovin, Andrey; Pavlova, Galina; Kopylov, Alexey

    2016-01-01

    Blood hemostasis is attained with two sophisticated interconnected network systems, a coagulation cascade and a platelet activation system. Multiple inhibitors were developed to various components of both systems to prevent thrombosis-related morbid events that are of extremely high frequency in the human population. Antithrombotic inhibitors possess both positive and negative aspects. One of the essential modern requirements is a controllable mode of action for both anticoagulants and antiplatelets that could be achieved due to the high affinity and specificity of the inhibitor, as well as a possibility to apply an antidote, which quickly annihilates activity of the inhibitor and restores the proper hemostasis. Aptamers are DNA or RNA oligonucleotides with particular tertiary structure, such as DNA guanine quadruplex. Besides antibodies and other peptides/proteins, aptamers are one more example of the molecular recognizing elements that specifically bind to the target. Therefore, aptamers could be developed into a promising novel class of the drugs with high affinity, specificity, innate low toxicity, and rational antidote. Several aptamers with prospective antithrombotic activity have been reviewed; some of them are in preclinical and clinical trials.

  8. Aptamer-based Electrochemical Biosensor for Interferon Gamma Detection

    PubMed Central

    Liu, Ying; Tuleouva, Nazgul; Ramanculov, Erlan; Revzin, Alexander

    2010-01-01

    In this paper, we describe the development of an electrochemical DNA aptamer-based biosensor for detection of IFN-γ. A DNA hairpin containing IFN-γ-binding aptamer was thiolated, conjugated with Methylene Blue (MB) redox tag and immobilized on a gold electrode by self-assembly. Binding of IFN-γ caused the aptamer hairpin to unfold, pushing MB redox molecules away from the electrode and decreasing electron-transfer efficiency. The change in redox current was quantified using Square Wave Voltammetry (SWV) and was found to be highly sensitive to IFN-γ concentration. The limit of detection for optimized biosensor was 0.06 nM with linear response extending to 10 nM. This aptasensor was specific to IFN-γ in the presence of overabundant serum proteins. Importantly, the same aptasensor could be regenerated by disrupting aptamer-IFN-γ complex in urea buffer and re-used multiple times. Unlike standard sandwich immunoassays, the aptasensor described here allowed to detect IFN-γ binding directly without the need for multiple washing steps and reagents. An electrochemical biosensor for simple and sensitive detection of IFN-γ demonstrated in this paper will have future applications in immunology, cancer research and infectious disease monitoring. PMID:20815336

  9. Folding energy landscape of the thiamine pyrophosphate riboswitch aptamer.

    PubMed

    Anthony, Peter C; Perez, Christian F; García-García, Cuauhtémoc; Block, Steven M

    2012-01-31

    Riboswitches are motifs in the untranslated regions (UTRs) of RNA transcripts that sense metabolite levels and modulate the expression of the corresponding genes for metabolite import, export, synthesis, or degradation. All riboswitches contain an aptamer: an RNA structure that, upon binding ligand, folds to expose or sequester regulatory elements in the adjacent sequence through alternative nucleotide pairing. The coupling between ligand binding and aptamer folding is central to the regulatory mechanisms of thiamine pyrophosphate (TPP) riboswitches and has not been fully characterized. Here, we show that TPP aptamer folding can be decomposed into ligand-independent and -dependent steps that correspond to the formation of secondary and tertiary structures, respectively. We reconstructed the full energy landscape for folding of the wild-type (WT) aptamer and measured perturbations of this landscape arising from mutations or ligand binding. We show that TPP binding proceeds in two steps, from a weakly to a strongly bound state. Our data imply a hierarchical folding sequence, and provide a framework for understanding molecular mechanism throughout the TPP riboswitch family.

  10. Regulation of photosensitisation processes by an RNA aptamer

    PubMed Central

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-01-01

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions. PMID:28233875

  11. Regulation of photosensitisation processes by an RNA aptamer

    NASA Astrophysics Data System (ADS)

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-02-01

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.

  12. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    PubMed Central

    Ruscito, Annamaria; DeRosa, Maria C.

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  13. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules

    PubMed Central

    Ahirwar, Rajesh; Nahar, Smita; Aggarwal, Shikha; Ramachandran, Srinivasan; Maiti, Souvik; Nahar, Pradip

    2016-01-01

    Aptamers, the chemical-antibody substitute to conventional antibodies, are primarily discovered through SELEX technology involving multi-round selections and enrichment. Circumventing conventional methodology, here we report an in silico selection of aptamers to estrogen receptor alpha (ERα) using RNA analogs of human estrogen response elements (EREs). The inverted repeat nature of ERE and the ability to form stable hairpins were used as criteria to obtain aptamer-alike sequences. Near-native RNA analogs of selected single stranded EREs were modelled and their likelihood to emerge as ERα aptamer was examined using AutoDock Vina, HADDOCK and PatchDock docking. These in silico predictions were validated by measuring the thermodynamic parameters of ERα -RNA interactions using isothermal titration calorimetry. Based on the in silico and in vitro results, we selected a candidate RNA (ERaptR4; 5′-GGGGUCAAGGUGACCCC-3′) having a binding constant (Ka) of 1.02 ± 0.1 × 108 M−1 as an ERα-aptamer. Target-specificity of the selected ERaptR4 aptamer was confirmed through cytochemistry and solid-phase immunoassays. Furthermore, stability analyses identified ERaptR4 resistant to serum and RNase A degradation in presence of ERα. Taken together, an efficient ERα-RNA aptamer is identified using a non-SELEX procedure of aptamer selection. The high-affinity and specificity can be utilized in detection of ERα in breast cancer and related diseases. PMID:26899418

  14. Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery

    PubMed Central

    Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N.; Carter, Jeff; Dalby, Andrew B.; Eaton, Bruce E.; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R.; Kim, Nancy; Koch, Tad H.; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K.; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M.; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I.; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D.; Vrkljan, Mike; Walker, Jeffrey J.; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K.; Wolfson, Alexey; Wolk, Steven K.; Zhang, Chi; Zichi, Dom

    2010-01-01

    Background The interrogation of proteomes (“proteomics”) in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. Methodology/Principal Findings We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (∼100 fM–1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. Conclusions/Significance We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of

  15. Aptamers: A New Technological Platform in Cancer Immunotherapy

    PubMed Central

    Pastor, Fernando

    2016-01-01

    The renaissance of cancer immunotherapy is, nowadays, a reality. In the near future, it will be very likely among the first-line treatments for cancer patients. There are several different approaches to modulate the immune system to fight against tumor maladies but, so far, monoclonal antibodies may currently be the most successful immuno-tools used to that end. The number of ongoing clinical trials with monoclonal antibodies has been increasing exponentially over the last few years upon the Food and Drug Administration (FDA) approval of the first immune-checkpoint blockade antibodies. In spite of the proved antitumor effect of these reagents, the unleashing of the immune system to fight cancer cells has a cost, namely auto-inflammatory toxicity. Additionally, only a small fraction of all patients treated with immune-checkpoint antibodies have a clinical benefit. Taking into account all this, it is urgent new therapeutic reagents are developed with a contained toxicity that could facilitate the combination of different immune-modulating pathways to broaden the antitumor effect in most cancer patients. Based on preclinical data, oligonucleotide aptamers could fulfill this need. Aptamers have not only been successfully used as antagonists of immune-checkpoint receptors, but also as agonists of immunostimulatory receptors in cancer immunotherapy. The simplicity of aptamers to be engineered for the specific delivery of different types of cargos to tumor cells and immune cells so as to harvest an efficient antitumor immune response gives aptamers a significant advantage over antibodies. In this review all of the recent applications of aptamers in cancer immunotherapy will be described. PMID:27783034

  16. Comparison of the 'chemical' and 'structural' approaches to the optimization of the thrombin-binding aptamer.

    PubMed

    Tatarinova, Olga; Tsvetkov, Vladimir; Basmanov, Dmitry; Barinov, Nikolay; Smirnov, Igor; Timofeev, Edward; Kaluzhny, Dmitry; Chuvilin, Andrey; Klinov, Dmitry; Varizhuk, Anna; Pozmogova, Galina

    2014-01-01

    Noncanonically structured DNA aptamers to thrombin were examined. Two different approaches were used to improve stability, binding affinity and biological activity of a known thrombin-binding aptamer. These approaches are chemical modification and the addition of a duplex module to the aptamer core structure. Several chemically modified aptamers and the duplex-bearing ones were all studied under the same conditions by a set of widely known and some relatively new methods. A number of the thrombin-binding aptamer analogs have demonstrated improved characteristics. Most importantly, the study allowed us to compare directly the two approaches to aptamer optimization and to analyze their relative advantages and disadvantages as well as their potential in drug design and fundamental studies.

  17. Modeling the microscopic electrical properties of thrombin binding aptamer (TBA) for label-free biosensors

    NASA Astrophysics Data System (ADS)

    Alfinito, Eleonora; Reggiani, Lino; Cataldo, Rosella; De Nunzio, Giorgio; Giotta, Livia; Guascito, Maria Rachele

    2017-02-01

    Aptamers are chemically produced oligonucleotides, able to bind a variety of targets such as drugs, proteins and pathogens with high sensitivity and selectivity. Therefore, aptamers are largely employed for producing label-free biosensors (aptasensors), with significant applications in diagnostics and drug delivery. In particular, the anti-thrombin aptamers are biomolecules of high interest for clinical use, because of their ability to recognize and bind the thrombin enzyme. Among them, the DNA 15-mer aptamer (TBA), has been widely explored around the possibility of using it in aptasensors. This paper proposes a microscopic model of the electrical properties of TBA and of the aptamer-thrombin complex, combining information from both structure and function, following the issues addressed in an emerging branch of electronics known as proteotronics. The theoretical results are compared and validated with measurements reported in the literature. Finally, the model suggests resistance measurements as a novel tool for testing aptamer-target affinity.

  18. Modeling the microscopic electrical properties of thrombin binding aptamer (TBA) for label-free biosensors.

    PubMed

    Alfinito, Eleonora; Reggiani, Lino; Cataldo, Rosella; De Nunzio, Giorgio; Giotta, Livia; Guascito, Maria Rachele

    2017-02-10

    Aptamers are chemically produced oligonucleotides, able to bind a variety of targets such as drugs, proteins and pathogens with high sensitivity and selectivity. Therefore, aptamers are largely employed for producing label-free biosensors (aptasensors), with significant applications in diagnostics and drug delivery. In particular, the anti-thrombin aptamers are biomolecules of high interest for clinical use, because of their ability to recognize and bind the thrombin enzyme. Among them, the DNA 15-mer aptamer (TBA), has been widely explored around the possibility of using it in aptasensors. This paper proposes a microscopic model of the electrical properties of TBA and of the aptamer-thrombin complex, combining information from both structure and function, following the issues addressed in an emerging branch of electronics known as proteotronics. The theoretical results are compared and validated with measurements reported in the literature. Finally, the model suggests resistance measurements as a novel tool for testing aptamer-target affinity.

  19. Comparison of In-Solution Biorecognition Properties of Aptamers against Ochratoxin A

    PubMed Central

    McKeague, Maureen; Velu, Ranganathan; De Girolamo, Annalisa; Valenzano, Stefania; Pascale, Michelangelo; Smith, McKenzie; DeRosa, Maria C.

    2016-01-01

    Ochratoxin A (OTA) is a mycotoxin produced as a secondary metabolite by several species of Aspergillus and Penicillium and frequently found as a natural contaminant in a wide range of food commodities. Novel and robust biorecognition agents for detecting this molecule are required. Aptamers are artificial nucleic acid ligands able to bind with high affinity and specificity to a given target molecule. In the last few years, three separate research groups have selected aptamers for ochratoxin A. While each of these three families of aptamers have been incorporated into various methods for detecting OTA, it is unclear if each aptamer candidate is better suited for a particular application. Here, we perform the first head-to-head comparison of solution-based binding parameters for these groups of aptamers. Based on our results, we provide recommendations for the appropriate choice of aptamer for incorporation into solution-based biorecognition assays and applications. PMID:27854269

  20. Escort Aptamers: New Tools for the Targeted Delivery of Therapeutics into Cells

    PubMed Central

    Davydova, A.S.; Vorobjeva, M.A.; Venyaminova, A.G.

    2011-01-01

    Escort aptamers are DNA or RNA sequences with high affinity to certain cell-surface proteins, which can be used for targeted delivery of various agents into cells of a definite type. The peculiarities of the selection of escort aptamers are discussed in this review. The methods used in selection of escort aptamers via the SELEX technique are considered, including selection against isolated cell-surface proteins, cell fragments, living eukaryotic cells, and bacteria. Particular attention is given to the design and chemical modification of escort aptamers. The different fields of application of escort aptamers are described, including the targeted delivery of siRNAs, nanoparticles, toxins, and photoagents, as well as the identification of specific cell markers and the detection or isolation of cells of a definite type. The potential for the application of escort aptamers in the development of new therapeutic agents and diagnostic systems is also discussed. PMID:22649701

  1. Plasmonic Aptamer-Gold Nanoparticle Sensors for Small Molecule Fingerprint Identification

    DTIC Science & Technology

    2014-08-01

    AFRL-RH-WP-TR-2014-0107 PLASMONIC APTAMER-GOLD NANOPARTICLE SENSORS FOR SMALL MOLECULE FINGERPRINT IDENTIFICATION Jorge Chávez Grant Slusher...Plasmonic Aptamer-Gold Nanoparticle Sensors for Small Molecule Fingerprint Identification 5a. CONTRACT NUMBER N/A 5b. GRANT NUMBER 5c. PROGRAM...The utilization of the plasmonic response of aptamer -gold nanoparticle conjugates (Apt-AuNPs) to design cross- reactive arrays for fingerprint

  2. Robust aptamer sol-gel solid phase microextraction of very polar adenosine from human plasma.

    PubMed

    Mu, Li; Hu, Xiangang; Wen, Jianping; Zhou, Qixing

    2013-03-01

    Conventional solid phase microextraction (SPME) has a limited capacity to extract very polar analytes, such as adenosine. To solve this problem, aptamer conjugating sol-gel methodology was coupled with an SPME fiber. According to the authors' knowledge, this is the first reported use of aptamer SPME. The fiber of aptamer sol-gel SPME with a mesoporous structure has high porosity, large surface area, and small water contact angle. Rather than employing direct entrapment, covalent immobilization was the dominant method of aptamer loading in sol-gel. Aptamer sol-gel fiber captured a specified analyte from among the analog molecules, thereby, exhibiting an excellent selective property. Compared with commercial SPME fibers, this aptamer fiber was suitable for extracting adenosine, presenting an extraction efficiency higher than 20-fold. The values of repeatability and reproducibility expressed by relative standard deviation were low (9.4%). Interestingly, the sol-gel network enhanced the resistance of aptamer SPME to both nuclease and nonspecific proteins. Furthermore, the aptamer sol-gel fiber was applied in human plasma with LOQ 1.5 μg/L, which is an acceptable level. This fiber also demonstrates durability and regeneration over 20-cycles without significant loss of efficiency. Given the various targets (from metal ions to biomacromolecules and cells) of aptamers, this methodology will extend the multi-domain applications of SPME.

  3. Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data

    PubMed Central

    Thiel, William H

    2016-01-01

    Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment). High-throughput sequencing (HTS) revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs. PMID:28131286

  4. Aptamer-Functionalized Fluorescent Silica Nanoparticles for Highly Sensitive Detection of Leukemia Cells

    NASA Astrophysics Data System (ADS)

    Tan, Juntao; Yang, Nuo; Hu, Zixi; Su, Jing; Zhong, Jianhong; Yang, Yang; Yu, Yating; Zhu, Jianmeng; Xue, Dabin; Huang, Yingying; Lai, Zongqiang; Huang, Yong; Lu, Xiaoling; Zhao, Yongxiang

    2016-06-01

    A simple, highly sensitive method to detect leukemia cells has been developed based on aptamer-modified fluorescent silica nanoparticles (FSNPs). In this strategy, the amine-labeled Sgc8 aptamer was conjugated to carboxyl-modified FSNPs via amide coupling between amino and carboxyl groups. Sensitivity and specificity of Sgc8-FSNPs were assessed using flow cytometry and fluorescence microscopy. These results showed that Sgc8-FSNPs detected leukemia cells with high sensitivity and specificity. Aptamer-modified FSNPs hold promise for sensitive and specific detection of leukemia cells. Changing the aptamer may allow the FSNPs to detect other types of cancer cells.

  5. Evaluation of aptamers as molecular recognition elements for pathogens using capillary electrophoretic analysis

    NASA Astrophysics Data System (ADS)

    McMasters, Sun; Stratis-Cullum, Dimitra N.

    2006-10-01

    The biomolecular interactions between a fluorescently labeled aptamer and whole cell Campylobacter jejuni(C. jejuni) have been characterized using capillary electrophoresis with laser-induced fluorescence detection. From electrophoretic analysis, the bound complex forms, unbound aptamer, and cells were visualized. The relative binding affinity of the DNA aptamer with C. jejuni was compared with other food-borne pathogens including Escherichia coli O157:H7 and Salmonella typhimurium. Preliminary data suggests that this aptamer exhibits strong binding affinity towards C. jejuni with minimal cross reactivity over other food pathogens when equivalent cell concentrations were used.

  6. Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization.

    PubMed

    Battig, Mark R; Soontornworajit, Boonchoy; Wang, Yong

    2012-08-01

    Polymeric delivery systems have been extensively studied to achieve localized and controlled release of protein drugs. However, it is still challenging to control the release of multiple protein drugs in distinct stages according to the progress of disease or treatment. This study successfully demonstrates that multiple protein drugs can be released from aptamer-functionalized hydrogels with adjustable release rates at predetermined time points using complementary sequences (CSs) as biomolecular triggers. Because both aptamer-protein interactions and aptamer-CS hybridization are sequence-specific, aptamer-functionalized hydrogels constitute a promising polymeric delivery system for the programmable release of multiple protein drugs to treat complex human diseases.

  7. Electrical and Electron-Phonon Interactions in Graphene-Based Nanostructures and Aptamer-Based Electrical Sensors

    NASA Astrophysics Data System (ADS)

    Qian, Jun

    This research work contains two main parts: the theoretical study of confined phonon modes and electron states in confined graphene nanostructures; the experimental part including two topics about fabricating a graphene-FET aptamer-sensor for cocaine detection and the study of the electronic transport properties of dsDNA. In the theory part, we study the confined optical phonon modes in graphene nanoribbons (GNR) and rectangular graphene quantum dots (RGQD) by the elastic continuum model. The carrier states are studied by effective mass approximation. The phonon bottleneck effect is expected in general for RGQDs. The scattering rates are calculated for specific RGQDs with carefully chosen dimensions to fulfill the momentum and energy conservation conditions. In the experimental part, we have developed a combined technique of semiconductor processes and molecular biological protocols to fabricate a signal-off graphene-FET aptamer-sensor for cocaine. In addition, DNA transport properties were studied by STM on GNP-dsDNA-Au conjugates in atmospheric condition. The dsDNA-complexes exhibit as a slightly n-type semiconductor by simulated with a Landauer-type model. A geometrical model is proposed to explain the distinct I-V spectra.

  8. Colorimetric Detection of Hg(2+) Based on the Growth of Aptamer-Coated AuNPs: The Effect of Prolonging Aptamer Strands.

    PubMed

    Tan, Lulu; Chen, Zhengbo; Zhang, Chi; Wei, Xiangcong; Lou, Tianhong; Zhao, Yan

    2017-04-01

    Herein, a versatile and sensitive colorimetric sensor for Hg(2+) based on aptamer-target specific binding and target-mediated growth of AuNPs is reported. The 15 T bases are first designed to detect Hg(2+) through T-Hg(2+) -T coordination. Aptamer-target binding results in the desorption of the aptamer from AuNP surface, the remaining aptamers adsorbed on AuNP surface trigger the growth of AuNPs with morphologically varied nanostructures, and then different colored solutions are formed. On this occasion, the limit of detection (LOD) of 9.6 × 10(-9) m is obtained. The other two aptamer strands (25- and 59-mer) are designed by increasing A bases on either side and both sides of 15 T, respectively. The interaction of the binding domain and Hg(2+) makes desorption of 15 T from AuNP surface, whereas excess bases not committed to the binding domain still adsorbed on AuNP surface. These excess bases control the growth of AuNPs, and enhance the sensitivity. The LODs are 4.05 and 3 × 10(-9) m for 25- and 59-mer aptamers, respectively. In addition, the 59-mer aptamer system is applied to identify Hg(2+) in real river samples, the LOD of 6.2 × 10(-9) m is obtained.

  9. Development of an aptamer-ampicillin conjugate for treating biofilms.

    PubMed

    Lijuan, Cheng; Xing, Yan; Minxi, Wu; Wenkai, Li; Le, Deng

    2017-02-05

    Biofilm formation involves the development of extracellular matrix and initially depends on adherence and tropism by flagellar movement. With the widespread development of antibiotic resistance and tolerance of biofilms, there is a growing need for novel anti-infective strategies. No currently approved medications specifically target biofilms. Aptamers are single-stranded nucleic acid molecules that may bind to their targets with high affinity and affect the target functions. We developed a bifunctional conjugate by linking an aptamer targeting bacterial flagella with ampicillin. We investigated its influence on biofilm prevention and dissolution by ultraviolet-visible spectrophotometry, inverted microscopy, and atomic force microscopy. This conjugate had distinctive antibacterial activity. Notably, the conjugate was more active than either component, and thus had a synergistic effect against biofilms.

  10. Antidote-mediated control of an anticoagulant aptamer in vivo.

    PubMed

    Rusconi, Christopher P; Roberts, Joseph D; Pitoc, George A; Nimjee, Shahid M; White, Rebekah R; Quick, George; Scardino, Elizabeth; Fay, William P; Sullenger, Bruce A

    2004-11-01

    Patient safety and treatment outcome could be improved if physicians could rapidly control the activity of therapeutic agents in their patients. Antidote control is the safest way to regulate drug activity, because unlike rapidly clearing drugs, control of the drug activity is independent of underlying patient physiology and co-morbidities. Until recently, however, there was no general method to discover antidote-controlled drugs. Here we demonstrate that the activity and side effects of a specific class of drugs, called aptamers, can be controlled by matched antidotes in vivo. The drug, an anticoagulant aptamer, systemically induces anticoagulation in pigs and inhibits thrombosis in murine models. The antidote rapidly reverses anticoagulation engendered by the drug, and prevents drug-induced bleeding in surgically challenged animals. These results demonstrate that rationally designed drug-antidote pairs can be generated to provide control over drug activities in animals.

  11. Rupture of DNA aptamer: New insights from simulations

    SciTech Connect

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single molecule experiments.

  12. Aptamers Selected by Cell-SELEX for Molecular Imaging.

    PubMed

    Jin, Cheng; Zheng, Jing; Li, Chunmei; Qiu, Liping; Zhang, Xiaobing; Tan, Weihong

    2015-12-01

    Conventional diagnostics for cancer rely primarily on anatomical techniques. However, these techniques cannot monitor the changes at the molecular level in normal cells, which possibly signal the onset of cancer at its very earliest stages. For accurate prediction of the carcinogenesis at the molecular level, targeting ligands have been used in combination with imaging probes to monitor this biological process. Among these targeting ligands, aptamers have high binding affinity to various targets ranging from small molecules to whole organisms, and, hence, exceptional recognition ability. Many recent studies have been reported on aptamer-based molecular imaging, clearly indicating its clinical and diagnostic utility. In this review, we will discuss some key results of these studies.

  13. PET Imaging of Tenascin-C with a Radiolabeled Single-Stranded DNA Aptamer

    PubMed Central

    Jacobson, Orit; Yan, Xuefeng; Niu, Gang; Weiss, Ido D.; Ma, Ying; Szajek, Lawrence P.; Shen, Baozhong; Kiesewetter, Dale O.; Chen, Xiaoyuan

    2017-01-01

    Tenascin-C is an extracellular matrix glycoprotein that is expressed by injured tissues and by various cancers. Recent publications showed that tenascin-C expression by cancer lesions predicts tumor growth, metastasis, and angiogenesis, suggesting tenascin-C as a potential therapeutic target. Currently there is no noninvasive method to determine tumoral tenascin-C expression in vivo. To address the need for an agent to image and quantify tenascin-C, we report the development of a radioactive PET tracer based on a tenascin-C–specific single-stranded DNA aptamer (tenascin-C aptamer). Methods Tenascin-C aptamer was radiolabeled with 18F and 64Cu. PET imaging studies for the evaluation of tumor uptake and pharmacokinetics of tenascin-C aptamer were performed in comparison to a nonspecific scrambled aptamer (Sc aptamer). Results The labeled tenascin-C aptamer provided clear visualization of tenascin-C–positive but not tenascin-C–negative tumors. The uptake of tenascin-C aptamer was significantly higher than that of Sc aptamer in tenascin-C–positive tumors. The labeled tenascin-C aptamer had fast clearance from the blood and other nonspecific organs through the kidneys, resulting in high tumor contrast. Conclusion Our data suggest that suitably labeled tenascin-C aptamer can be used as a PET tracer to image tumor expression of tenascin-C with a high tumor-to-background ratio and might provide insightful and personalized medical data that will help determine appropriate treatment and monitoring. PMID:25698784

  14. Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters.

    PubMed

    Akki, Spurti U; Werth, Charles J; Silverman, Scott K

    2015-08-18

    We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.

  15. Aptamer fluorescence anisotropy sensors for adenosine triphosphate by comprehensive screening tetramethylrhodamine labeled nucleotides.

    PubMed

    Zhao, Qiang; Lv, Qin; Wang, Hailin

    2015-08-15

    We previously reported a fluorescence anisotropy (FA) approach for small molecules using tetramethylrhodamine (TMR) labeled aptamer. It relies on target-binding induced change of intramolecular interaction between TMR and guanine (G) base. TMR-labeling sites are crucial for this approach. Only terminal ends and thymine (T) bases could be tested for TMR labeling in our previous work, possibly causing limitation in analysis of different targets with this FA strategy. Here, taking the analysis of adenosine triphosphate (ATP) as an example, we demonstrated a success of conjugating TMR on other bases of aptamer adenine (A) or cytosine (C) bases and an achievement of full mapping various labeling sites of aptamers. We successfully constructed aptamer fluorescence anisotropy (FA) sensors for adenosine triphosphate (ATP). We conjugated single TMR on adenine (A), cytosine (C), or thymine (T) bases or terminals of a 25-mer aptamer against ATP and tested FA responses of 14 TMR-labeled aptamer to ATP. The aptamers having TMR labeled on the 16th base C or 23rd base A were screened out and exhibited significant FA-decreasing or FA-increasing responses upon ATP, respectively. These two favorable TMR-labeled aptamers enabled direct FA sensing ATP with a detection limit of 1 µM and the analysis of ATP in diluted serum. The comprehensive screening various TMR labeling sites of aptamers facilitates the successful construction of FA sensors using TMR-labeled aptamers. It will expand application of TMR-G interaction based aptamer FA strategy to a variety of targets.

  16. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    PubMed Central

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan; Kraus, George A; Nilsen-Hamilton, Marit

    2016-01-01

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitability as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. High background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription. PMID:26707205

  17. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    DOE PAGES

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; ...

    2015-12-17

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated twomore » light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. As a result, high background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.« less

  18. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    SciTech Connect

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M.; Kraus, George A.; Nilsen-Hamilton, Marit

    2015-12-17

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. As a result, high background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.

  19. Using atomic force microscopy and surface plasmon resonance to detect specific interactions between ricin and anti-ricin aptamers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nucleic acid aptamers have been widely used as binding reagents for the label free detections of biomolecules. Compare to antibodies, aptamers have demonstrated advantages such as easy synthesis, low cost, and better stability. Therefore, aptamers can be integrated into various detection platforms ...

  20. Ready-to-use Aptamer Biosensors for DNT and RDX

    DTIC Science & Technology

    2011-09-29

    Detection of Single Nucleotide Polymorphism via a Single Self- Complementary, Triple-Stem DNA Probe" Angewandte Chemie International Edition (48) 4354-4358...streptavidin-coated magnetic beads via biotin (step C). Next, the bead-library assemblies were challenged with the target. The single - stranded (ss...immobilization of the aptamer library onto the beads, and also used to generate single - stranded products after PCR amplification. To monitor the

  1. Spinach RNA aptamer detects lead (II) with high selectivity†

    PubMed Central

    DasGupta, Saurja; Shelke, Sandip A.; Li, Nan-sheng

    2015-01-01

    Spinach RNA aptamer contains a G-quadruplex motif that serves as a platform for binding and fluorescence activation of a GFP-like fluorophore. Here we show that Pb2+ induces formation of Spinach’s G-quadruplex and activates fluorescence with high selectivity and sensitivity. This device establishes the first example of an RNA-based sensor that provides a simple and inexpensive tool for Pb2+ detection. PMID:25940073

  2. RiboaptDB: A Comprehensive Database of Ribozymes and Aptamers

    PubMed Central

    Thodima, Venkata; Pirooznia, Mehdi; Deng, Youping

    2006-01-01

    Background Catalytic RNA molecules are called ribozymes. The aptamers are DNA or RNA molecules that have been selected from vast populations of random sequences, through a combinatorial approach known as SELEX. The selected oligo-nucleotide sequences (~200 bp in length) have the ability to recognize a broad range of specific ligands by forming binding pockets. These novel aptamer sequences can bind to nucleic acids, proteins or small organic and inorganic chemical compounds and have many potential uses in medicine and technology. Results The comprehensive sequence information on aptamers and ribozymes that have been generated by in vitro selection methods are included in this RiboaptDB database. Such types of unnatural data generated by in vitro methods are not available in the public 'natural' sequence databases such as GenBank and EMBL. The amount of sequence data generated by in vitro selection experiments has been accumulating exponentially. There are 370 artificial ribozyme sequences and 3842 aptamer sequences in the total 4212 sequences from 423 citations in this RiboaptDB. We included general search feature, and individual feature wise search, user submission form for new data through online and also local BLAST search. Conclusion This database, besides serving as a storehouse of sequences that may have diagnostic or therapeutic utility in medicine, provides valuable information for computational and theoretical biologists. The RiboaptDB is extremely useful for garnering information about in vitro selection experiments as a whole and for better understanding the distribution of functional nucleic acids in sequence space. The database is updated regularly and is publicly available at . PMID:17118149

  3. Bioactivity of 2′-deoxyinosine-incorporated aptamer AS1411

    PubMed Central

    Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

    2016-01-01

    Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2′-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2′-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2′-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2′-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2′-deoxyinosine moieties in interactive binding processes. PMID:27194215

  4. Conformationally Selective RNA Aptamers Allosterically Modulate the β2-Adrenoceptor

    PubMed Central

    Kahsai, Alem W.; Wisler, James W.; Lee, Jungmin; Ahn, Seungkirl; Cahill, Thomas J.; Dennison, S. Moses; Staus, Dean P.; Thomsen, Alex R. B.; Anasti, Kara M.; Pani, Biswaranjan; Wingler, Laura M.; Desai, Hemant; Bompiani, Kristin M.; Strachan, Ryan T.; Qin, Xiaoxia; Alam, S. Munir; Sullenger, Bruce A.; Lefkowitz, Robert J.

    2016-01-01

    G-protein-coupled receptor (GPCR) ligands function by stabilizing multiple, functionally distinct receptor conformations. This property underlies how “biased agonists” activate specific subsets of a given receptor’s signaling profile. However, stabilization of distinct active GPCR conformations to enable structural characterization of mechanisms underlying GPCR activation remains difficult. These challenges have accentuated the need for receptor tools that allosterically stabilize and regulate receptor function via unique, previously unappreciated mechanisms. Here, utilizing a highly diverse RNA library combined with advanced selection strategies involving state-of-the-art next-generation sequencing and bioinformatics analyses, we identify RNA aptamers that bind a prototypical GPCR, β2-adrenoceptor (β2AR). Using biochemical, pharmacological, and biophysical approaches, we demonstrate that these aptamers bind with nanomolar affinity at defined surfaces of the receptor, allosterically stabilizing active, inactive, and ligand-specific receptor conformations. The discovery of RNA aptamers as allosteric GPCR modulators significantly expands the diversity of ligands available to study the structural and functional regulation of GPCRs. PMID:27398998

  5. Selection of an aptamer antidote to the anticoagulant drug bivalirudin.

    PubMed

    Martin, Jennifer A; Parekh, Parag; Kim, Youngmi; Morey, Timothy E; Sefah, Kwame; Gravenstein, Nikolaus; Dennis, Donn M; Tan, Weihong

    2013-01-01

    Adverse drug reactions, including severe patient bleeding, may occur following the administration of anticoagulant drugs. Bivalirudin is a synthetic anticoagulant drug sometimes employed as a substitute for heparin, a commonly used anticoagulant that can cause a condition called heparin-induced thrombocytopenia (HIT). Although bivalrudin has the advantage of not causing HIT, a major concern is lack of an antidote for this drug. In contrast, medical professionals can quickly reverse the effects of heparin using protamine. This report details the selection of an aptamer to bivalirudin that functions as an antidote in buffer. This was accomplished by immobilizing the drug on a monolithic column to partition binding sequences from nonbinding sequences using a low-pressure chromatography system and salt gradient elution. The elution profile of binding sequences was compared to that of a blank column (no drug), and fractions with a chromatographic difference were analyzed via real-time PCR (polymerase chain reaction) and used for further selection. Sequences were identified by 454 sequencing and demonstrated low micromolar dissociation constants through fluorescence anisotropy after only two rounds of selection. One aptamer, JPB5, displayed a dose-dependent reduction of the clotting time in buffer, with a 20 µM aptamer achieving a nearly complete antidote effect. This work is expected to result in a superior safety profile for bivalirudin, resulting in enhanced patient care.

  6. Organic additives stabilize RNA aptamer binding of malachite green.

    PubMed

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis.

  7. Polypeptide Functional Surface for the Aptamer Immobilization: Electrochemical Cocaine Biosensing.

    PubMed

    Bozokalfa, Guliz; Akbulut, Huseyin; Demir, Bilal; Guler, Emine; Gumus, Z Pınar; Odaci Demirkol, Dilek; Aldemir, Ebru; Yamada, Shuhei; Endo, Takeshi; Coskunol, Hakan; Timur, Suna; Yagci, Yusuf

    2016-04-05

    Electroanalytical technologies as a beneficial subject of modern analytical chemistry can play an important role for abused drug analysis which is crucial for both legal and social respects. This article reports a novel aptamer-based biosensing procedure for cocaine analysis by combining the advantages of aptamers as selective recognition elements with the well-known advantages of biosensor systems such as the possibility of miniaturization and automation, easy fabrication and modification, low cost, and sensitivity. In order to construct the aptasensor platform, first, polythiophene bearing polyalanine homopeptide side chains (PT-Pala) was electrochemically coated onto the surface of an electrode and then cocaine aptamer was attached to the polymer via covalent conjugation chemistry. The stepwise modification of the surface was confirmed by electrochemical characterization. The designed biosensing system was applied for the detection of cocaine and its metabolite, benzoylecgonine (BE), which exhibited a linear correlation in the range from 2.5 up to 10 nM and 0.5 up to 50 μM for cocaine and BE, respectively. In order to expand its practical application, the proposed method was successfully tested for the analysis of synthetic biological fluids.

  8. Aptamer-facilitated Protection of Oncolytic Virus from Neutralizing Antibodies

    PubMed Central

    Muharemagic, Darija; Zamay, Anna; Ghobadloo, Shahrokh M; Evgin, Laura; Savitskaya, Anna; Bell, John C; Berezovski, Maxim V

    2014-01-01

    Oncolytic viruses promise to significantly improve current cancer treatments through their tumor-selective replication and multimodal attack against cancer cells. However, one of the biggest setbacks for oncolytic virus therapy is the intravenous delivery of the virus, as it can be cleared from the bloodstream by neutralizing antibodies before it reaches the tumor cells. We have selected DNA aptamers against an oncolytic virus, vesicular stomatitis virus, using a competitive binding approach, as well as against the antigen binding fragment (Fab) of antivesicular stomatitis virus polyclonal antibodies, in order to shield the virus from nAbs and enhance its in vivo survival. We used flow cytometry to identify these aptamers and evaluated their efficiency to shield vesicular stomatitis virus in a cell-based plaque forming assay. These oligonucleotides were then modified to obtain multivalent binders, which led to a decrease of viral aggregation, an increase in its infectivity and an increase in its stability in serum. The aptamers were also incubated in nondiluted serum, showing their effectiveness under conditions mimicking those in vivo. With this approach, we were able to increase viral infectivity by more than 70% in the presence of neutralizing antibodies. Thus, this method has the potential to enhance the delivery of vesicular stomatitis virus through the bloodstream without compromising the patient's immune system. PMID:24892725

  9. Aptamer-phage reporters for ultrasensitive lateral flow assays

    PubMed Central

    Adhikari, Meena; Strych, Ulrich; Kim, Jinsu; Goux, Heather; Dhamane, Sagar; Poongavanam, Mohan-Vivekanandan; Hagström, Anna E. V.; Kourentzi, Katerina; Conrad, Jacinta C.; Willson, Richard C.

    2015-01-01

    We introduce the modification of bacteriophage particles with aptamers for the use as bioanalytical reporters, and demonstrate the use of these particles in ultrasensitive lateral flow assays. M13 phage displaying an in vivo biotinylatable peptide (AviTag) genetically fused to the phage tail protein pIII were used as reporter particle scaffolds, with biotinylated aptamers attached via avidin-biotin linkages, and horseradish peroxidase (HRP) reporter enzymes covalently attached to the pVIII coat protein. These modified viral nanoparticles were used in immunochromatographic sandwich assays for the direct detection of IgE and of the penicillin-binding protein from Staphylococcus aureus (PBP2a). We also developed an additional lateral flow assay for IgE, in which the analyte is sandwiched between immobilized anti-IgE antibodies and aptamer-bearing reporter phage modified with HRP. The limit of detection of this LFA was 0.13 ng/mL IgE, ~100 times lower than those of previously reported IgE assays. PMID:26456715

  10. DNA aptamer beacon assay for C-telopeptide and handheld fluorometer to monitor bone resorption.

    PubMed

    Bruno, John Gordon; Carrillo, Maria P; Phillips, Taylor; Hanson, Douglas; Bohmann, Jonathan A

    2011-09-01

    A novel DNA aptamer beacon is described for quantification of a 26-amino acid C-telopeptide (CTx) of human type I bone collagen. One aptamer sequence and its reverse complement dominated the aptamer pool (31.6% of sequenced clones). Secondary structures of these aptamers were examined for potential binding pockets. Three-dimensional computer models which analyzed docking topologies and binding energies were in agreement with empirical fluorescence experiments used to select one candidate loop for beacon assay development. All loop structures from the aptamer finalists were end-labeled with TYE 665 and Iowa Black quencher for comparison of beacon fluorescence levels as a function of CTx concentration. The optimal beacon, designated CTx 2R-2h yielded a low ng/ml limit of detection using a commercially available handheld fluorometer. The CTx aptamer beacon bound full-length 26-amino acid CTx peptide, but not a shorter 8-amino acid segment of CTx peptide which is a common target for commercial CTx ELISA kits. The prototype assay was shown to detect CTx peptide from human urine after creatinine and urea were removed by size-exclusion chromatography to prevent nonspecific denaturing of the aptamer beacon. This work demonstrates the potential of aptamer beacons to be utilized for rapid and sensitive bone health monitoring in a handheld or point-of-care format.

  11. Selection and identification of DNA aptamers against okadaic acid for biosensing application.

    PubMed

    Eissa, Shimaa; Ng, Andy; Siaj, Mohamed; Tavares, Ana C; Zourob, Mohammed

    2013-12-17

    This work describes the selection and identification of DNA aptamers that bind with high affinity and specificity to okadaic acid (OA), a lipophilic marine biotoxin that accumulates in shellfish. The aptamers selected using systematic evolution of ligands by exponential enrichment (SELEX) exhibited dissociation constants in the nanomolar range. The aptamer with the highest affinity was then used for the fabrication of a label-free electrochemical biosensor for okadaic acid detection. The aptamer was first immobilized on the gold electrode by a self-assembly approach through Au-S interaction. The binding of okadaic acid to the aptamer immobilized on the electrode surface induces an alteration of the aptamer conformation causing a significant decrease in the electron-transfer resistance monitored by electrochemical impedance spectroscopy. The aptasensor showed a linear range for the concentrations of OA between 100 pg/mL and 60 ng/mL with a detection limit of 70 pg/mL. The dissociation constant of okadaic acid with the aptamer immobilized on the electrode surface showed good agreement with that determined using fluorescence assay in solution. Moreover, the aptasensor did not show cross-reactivity toward toxins with structures similar to okadaic acid such as dinophysis toxin-1 and 2 (DTX-1, DTX-2). Further biosensing applications of the selected aptamers are expected to offer promising alternatives to the traditional analytical and immunological methods for OA detection.

  12. Highly Multiplexed RNA Aptamer Selection using a Microplate-based Microcolumn Device

    PubMed Central

    Reinholt, Sarah J.; Ozer, Abdullah; Lis, John T.; Craighead, Harold G.

    2016-01-01

    We describe a multiplexed RNA aptamer selection to 19 different targets simultaneously using a microcolumn-based device, MEDUSA (Microplate-based Enrichment Device Used for the Selection of Aptamers), as well as a modified selection process, that significantly reduce the time and reagents needed for selections. We exploited MEDUSA’s reconfigurable design between parallel and serially-connected microcolumns to enable the use of just 2 aliquots of starting library, and its 96-well microplate compatibility to enable the continued use of high-throughput techniques in downstream processes. Our modified selection protocol allowed us to perform the equivalent of a 10-cycle selection in the time it takes for 4 traditional selection cycles. Several aptamers were discovered with nanomolar dissociation constants. Furthermore, aptamers were identified that not only bound with high affinity, but also acted as inhibitors to significantly reduce the activity of their target protein, mouse decapping exoribonuclease (DXO). The aptamers resisted DXO’s exoribonuclease activity, and in studies monitoring DXO’s degradation of a 30-nucleotide substrate, less than 1 μM of aptamer demonstrated significant inhibition of DXO activity. This aptamer selection method using MEDUSA helps to overcome some of the major challenges with traditional aptamer selections, and provides a platform for high-throughput selections that lends itself to process automation. PMID:27432610

  13. Following aptamer-ricin specific binding by single molecule recognition and force spectroscopy measurements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The atomic force microscope (AFM) recognition and dynamic force spectroscopy (DFS) experiments provide both morphology and interaction information of the aptamer and protein, which can be used for the future study on the thermodynamics and kinetics properties of ricin-aptamer/antibody interactions. ...

  14. AFBI assay – Aptamer Fluorescence Binding and Internalization assay for cultured adherent cells

    PubMed Central

    Thiel, William H.; Giangrande, Paloma H.

    2016-01-01

    The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process allows for the enrichment of DNA or RNA aptamers from a complex nucleic acid library that are specific for a target molecule. The SELEX process has been adapted from identifying aptamers in vitro using recombinant target protein to cell-based methodologies (Cell-SELEX), where the targets are expressed on the surface of cells. One major advantage of Cell-SELEX is that the target molecules are maintained in a native confirmation. Additionally, Cell-SELEX may be used to discover novel therapeutic biomarkers by performing selections on diseased versus healthy cells. However, a caveat to Cell-SELEX is that testing of single aptamers identified in the selection is laborious, time-consuming, and expensive. The most frequently used methods to screen for aptamer binding and internalization on cells are flow cytometry and quantitative PCR (qPCR). While flow cytometry can directly assess binding of a fluorescently-labeled aptamer to a target, it requires significant starting material and is not easily scalable. qPCR-based approaches are highly sensitive but have non-negligible experiment-to-experiment variability due to the number of sample processing steps. Herein we describe a cell-based aptamer fluorescence binding and internalization (AFBI) assay. This assay requires minimal reagents and has few experimental steps/manipulations, thereby allowing for rapid screening of many aptamers and conditions simultaneously and direct quantitation of aptamer binding and internalization. PMID:26972784

  15. Use of anchor protein modules in fluorescence polarisation aptamer assay for ochratoxin A determination.

    PubMed

    Samokhvalov, Alexey V; Safenkova, Irina V; Eremin, Sergei A; Zherdev, Anatoly V; Dzantiev, Boris B

    2017-04-15

    A new strategy for sensitive fluorescence polarisation (FP) analysis is proposed which uses aptamer as the receptor and anchor protein modules as the enhancers by including the aptamers in complexes with protein modules. This approach is based on increasing the size differences of bound and unbound fluorophores. The strategy was applied in an ochratoxin A (ОТА) assay with the competitive binding of fluorophore-labelled and free OTA with aptamer-based receptors. We showed that the binding of labelled OTA with aptamer included in complexes with anchors led to higher a FP than binding with free aptamer. This allowed the aptamer concentration to be reduced, thus lowering the limit of detection by a factor of 40, down to 3.6 nM. The assay time was 15 min. To evaluate the applicability of the FP assay with aptamer-anchor complex to real samples, we conducted OTA measurements in spiked white wine. The OTA limit of detection in wine was 2.8 nM (1.1 μg/kg), and the recoveries ranged from 83% to 113%. The study shows that the proposed anchor strategy is efficient for increasing the sensitivity of FP-based aptamer assays.

  16. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    PubMed Central

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-01-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays. PMID:26903199

  17. Determining the elastic properties of aptamer-ricin single molecule multiple pathways

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ricin and an anti-ricin aptamer showed three stable binding conformations with their special chemomechanical properties. The elastic properties of the ricin-aptamer single-molecule interactions were investigated by the dynamic force spectroscopy (DFS). The worm-like-chain model and Hook’s law were ...

  18. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin.

    PubMed

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-02-23

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.

  19. Competitive FRET-aptamer-based detection of methylphosphonic acid, a common nerve agent metabolite.

    PubMed

    Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Vail, Neal K; Hanson, Douglas

    2008-09-01

    Competitive fluorescence resonance energy transfer (FRET)-aptamer-based assay formats are described for one-step detection of methylphosphonic acid (MPA; a metabolite of several organophosphorus (OP) nerve agents). AminoMPA was attached to tosyl-magnetic beads and used for DNA aptamer selection from which one dominant aptamer sequence emerged. Two different FRET approaches were attempted. In one approach, the complementary DNA sequence was used as a template for labeling the aptamer with Alexa Fluor 546 (AF 546)-14-dUTP by asymmetric PCR. Following 3-dimensional (3-D), molecular modeling of the aptamer-MPA complex, a series of three fluoresceinated aptamers labeled at positions 50, 51, and 52 in the putative optimal binding pocket were synthesized. In both FRET formats, aminoMPA was linked to Black Hole Quencher (BHQ-1 or BHQ-2)-succinimides and allowed to bind the fluorescein or AF 546-labeled MPA aptamer. Following gel filtration to purify the labeled MPA aptamer-BHQ-aminoMPA FRET complexes, the complexes were competed against various concentrations of unlabeled MPA, MPA derivatives, and unrelated compounds in titration and cross-reactivity studies. Both approaches yielded low microgram per milliliter detection limits for MPA with generally low levels of cross-reactivity for unrelated compounds. However, the data suggest a pattern of traits that may effect the direction (lights on or off) and intensity of the FRET.

  20. DNA aptamer release from the DNA-SWNT hybrid by protein recognition.

    PubMed

    Yoo, Chang-Hyuk; Jung, Seungwon; Bae, Jaehyun; Kim, Gunn; Ihm, Jisoon; Lee, Junghoon

    2016-02-14

    Here we show the formation of the complex between a DNA aptamer and a single-walled carbon nanotube (SWNT) and its reaction with its target protein. The aptamer, which is specifically bound with thrombin, the target protein in this study, easily wraps and disperses the SWNT by noncovalent π-π stacking.

  1. Intracellular Expression of PAI-1 Specific Aptamers Alters Breast Cancer Cell Migration, Invasion and Angiogenesis

    PubMed Central

    Fortenberry, Yolanda M.; Brandal, Stephanie M.; Carpentier, Gilles; Hemani, Malvi; Pathak, Arvind P.

    2016-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is elevated in various cancers, where it has been shown to effect cell migration and invasion and angiogenesis. While, PAI-1 is a secreted protein, its intercellular levels are increased in cancer cells. Consequently, intracellular PAI-1 could contribute to cancer progression. While various small molecule inhibitors of PAI-1 are currently being investigated, none specifically target intracellular PAI-1. A class of inhibitors, termed aptamers, has been used effectively in several clinical applications. We previously generated RNA aptamers that target PAI-1 and demonstrated their ability to inhibit extracellular PAI-1. In the current study we explored the effect of these aptamers on intracellular PAI-1. We transiently transfected the PAI-1 specific aptamers into both MDA-MB-231 human breast cancer cells, and human umbilical vein endothelial cells (HUVECs) and studied their effects on cell migration, invasion and angiogenesis. Aptamer expressing MDA-MB-231 cells exhibited a decrease in cell migration and invasion. Additionally, intracellular PAI-1 and urokinase plasminogen activator (uPA) protein levels decreased, while the PAI-1/uPA complex increased. Moreover, a significant decrease in endothelial tube formation in HUVECs transfected with the aptamers was observed. In contrast, conditioned media from aptamer transfected MDA-MB-231 cells displayed a slight pro-angiogenic effect. Collectively, our study shows that expressing functional aptamers inside breast and endothelial cells is feasible and may exhibit therapeutic potential. PMID:27755560

  2. Aptamer-functionalized porous phospholipid nanoshells for direct measurement of Hg(2+) in urine.

    PubMed

    Li, Zhen; Muhandiramlage, Thusitha P; Keogh, John P; Hall, Henry K; Aspinwall, Craig A

    2015-01-01

    A porous phospholipid nanoshell (PPN) sensor functionalized with a specific aptamer sensor agent was prepared for rapid detection of Hg(2+) in human urine with minimal sample preparation. Aptamer sensors provide an important class of optical transducers that can be readily and reproducibly synthesized. A key limitation of aptamer sensors, and many other optical sensors, is the potential of biofouling or biodegradation when used in complex biological matrices such as serum or urine, particularly when high levels of nucleases are present. We prepared Hg(2+)-responsive, PPN-encapsulated aptamer sensors that overcome these limitations. PPNs provide a protective barrier to encapsulate the aptamer sensor in an aqueous environment free of diffusional restrictions encountered with many polymer nanomaterials. The unique porous properties of the PPN membrane enable ready and rapid transfer of small molecular weight ions and molecules into the sensor interior while minimizing the macromolecular interactions between the transducer and degradants or interferents in the exterior milieu. Using Hg(2+)-responsive, PPN-encapsulated aptamer sensors, we were able to detect sub-100 ppb (chronic threshold limit from urine test) Hg(2+) in human urine with no sample preparation, whereas free aptamer sensors yielded inaccurate results due to interferences from the matrix. The PPN architecture provides a new platform for construction of aptamer-functionalized sensors that target low molecular weight species in complex matrices, beyond the Hg(2+) demonstrated here.

  3. Aptamer-functionalized porous phospholipid nanoshells for direct measurement of Hg2+ in urine

    PubMed Central

    Li, Zhen; Muhandiramlage, Thusitha P.; Keogh, John P.; Hall, Henry K.; Aspinwall, Craig A.

    2014-01-01

    A porous phospholipid nanoshell (PPN) sensor functionalized with a specific aptamer sensor agent was prepared for rapid detection of Hg2+ in human urine with minimal sample preparation. Aptamer sensors provide an important class of optical transducers that can be readily and reproducibly synthesized. A key limitation of aptamer sensors, and many other optical sensors, is the potential of biofouling or biodegradation when used in complex biological matrices such as serum or urine, particularly when high levels of nucleases are present. We prepared Hg2+-responsive, PPN-encapsulated aptamer sensors that overcome these limitations. PPNs provide a protective barrier to encapsulate the aptamer sensor in an aqueous environment free of diffusional restrictions encountered with many polymer nanomaterials. The unique porous properties of the PPN membrane enable ready and rapid transfer of small molecular weight ions and molecules into the sensor interior while minimizing the macromolecular interactions between the transducer and degradants or interferents in the exterior milieu. Using Hg2+-responsive, PPN-encapsulated aptamer sensors, we were able to detect sub-100 ppb (chronic threshold limit from urine test) Hg2+ in human urine with no sample preparation, whereas free aptamer sensors yielded inaccurate results due to inteferences from the matrix. The PPN architecture provides a new platform for construction of aptamer-functionalized sensors that target low molecular weight species in complex matrices, beyond the Hg2+ demonstrated here. PMID:25326888

  4. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    NASA Astrophysics Data System (ADS)

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-02-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.

  5. Selection and characterization of single stranded DNA aptamers for the hormone abscisic Acid.

    PubMed

    Grozio, Alessia; Gonzalez, Victor M; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M; Bellotti, Marta; Zocchi, Elena

    2013-10-01

    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98 ± 0.14 μM and 0.80 ± 0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays.

  6. Antidote control of aptamer therapeutics: the road to a safer class of drug agents.

    PubMed

    Bompiani, K M; Woodruff, R S; Becker, R C; Nimjee, S M; Sullenger, B A

    2012-08-01

    Aptamers, or nucleic acid ligands, have gained clinical interest over the past 20 years due to their unique characteristics, which are a combination of the best facets of small molecules and antibodies. The high binding affinity and specificity of aptamers allows for isolation of an artificial ligand for theoretically any therapeutic target of interest. Chemical manipulations of aptamers also allow for fine-tuning of their bioavailability, and antidote control greatly expands their clinical use. Here we review the various methods of antidote control of aptamer therapeutics--matched oligonucleotide antidotes and universal antidotes. We also describe the development, recent progress, and potential future therapeutic applications of these types of aptamer-antidote pairs.

  7. Direct detection of aptamer-thrombin binding via surface-enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Pagba, Cynthia V.; Lane, Stephen M.; Cho, Hansang; Wachsmann-Hogiu, Sebastian

    2010-07-01

    In this study, we exploit the sensitivity offered by surface-enhanced Raman scattering (SERS) for the direct detection of thrombin using the thrombin-binding aptamer (TBA) as molecular receptor. The technique utilizes immobilized silver nanoparticles that are functionalized with thiolated thrombin-specific binding aptamer, a 15-mer (5'-GGTTGGTGTGGTTGG-3') quadruplex forming oligonucleotide. In addition to the Raman vibrational bands corresponding to the aptamer and blocking agent, new peaks (mainly at 1140, 1540, and 1635 cm-1) that are characteristic of the protein are observed upon binding of thrombin. These spectral changes are not observed when the aptamer-nanoparticle assembly is exposed to a nonbinding protein such as bovine serum albumin (BSA). This methodology could be further used for the development of label-free biosensors for direct detection of proteins and other molecules of interest for which aptamers are available.

  8. Targeting HMGA2 in Retinoblastoma Cells in vitro Using the Aptamer Strategy

    PubMed Central

    Nalini, Venkatesan; Deepa, Perinkulam Ravi; Raguraman, Rajeswari; Khetan, Vikas; Reddy, Maddy Ashwin; Krishnakumar, Subramanian

    2016-01-01

    High-mobility group A2 (HMGA2) protein regulates retinoblastoma (RB) cancer cell proliferation. Here, a stable phosphorothioate-modified HMGA2 aptamer was used to block HMGA2 protein function in RB cells. HMGA2-aptamer internalisation in RB cells (Y79, Weri Rb1) and non-neoplastic human retinal cells (MIO-M1) were optimised. Aptamer induced dose-dependent cytotoxicity in RB cancer cells (0.25-1.5 µM). Increased expression of TGFβ, SMAD4, CDH1, BAX, CASP 3, PARP mRNA and decreased SNAI1, Bcl2 mRNA levels in aptamer-treated RB cells suggests the activation of TGFβ-SMAD4-mediated apoptotic pathway. Synergistic effect with etoposide was observed in aptamer treated RB cells (p value ≤0.05). No significant toxicity was observed in non-neoplastic retinal cells. PMID:27843907

  9. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: the Next Generation of Cancer Medicine

    PubMed Central

    Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Wang, Tao; Kouzani, Abbas Z.; Zhou, Shu-Feng; Kong, Lingxue; Li, Yong; Pu, Chunwen; Duan, Wei

    2015-01-01

    Conventional anticancer therapies, such as chemo- and/or radio-therapy are often unable to completely eradicate cancers due to abnormal tumor microenvironment, as well as increased drug/radiation resistance. More effective therapeutic strategies for overcoming these obstacles are urgently in demand. Aptamers, as chemical antibodies that bind to targets with high affinity and specificity, are a promising new and novel agent for both cancer diagnostic and therapeutic applications. Aptamer-based cancer cell targeting facilitates the development of active targeting in which aptamer-mediated drug delivery could provide promising anticancer outcomes. This review is to update the current progress of aptamer-based cancer diagnosis and aptamer-mediated active targeting for cancer therapy in vivo, exploring the potential of this novel form of targeted cancer therapy. PMID:25553096

  10. Label-Free Aptamer-Based Immunoglobulin Sensors Using Graphene Field-Effect Transistors

    NASA Astrophysics Data System (ADS)

    Ohno, Yasuhide; Maehashi, Kenzo; Inoue, Koichi; Matsumoto, Kazuhiko

    2011-07-01

    Electrical detection of specific proteins was demonstrated using aptamer-modified graphene field-effect transistors (G-FETs). Immunoglobulin E (IgE) aptamers were immobilized onto the graphene surface with 1-pyrenebutanoic acid succinimidyl ester as a linker. From an atomic-force microscopy image, the height of the graphene channel was determined to be approximately 3 nm, indicating the successful functionalization of aptamers. The slope of the transport characteristics before and after aptamer functionalization did not change, indicating that the functionalization process was carried out without introducing defects. The aptamer-modified G-FET successfully detected only the target protein while the drain current of the bare G-FETs changed by various proteins. These results suggest that the binding of the non-target protein to the graphene channel surface was sufficiently suppressed.

  11. Nucleic acid aptamer-guided cancer therapeutics and diagnostics: the next generation of cancer medicine.

    PubMed

    Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Wang, Tao; Kouzani, Abbas Z; Zhou, Shu-Feng; Kong, Lingxue; Li, Yong; Pu, Chunwen; Duan, Wei

    2015-01-01

    Conventional anticancer therapies, such as chemo- and/or radio-therapy are often unable to completely eradicate cancers due to abnormal tumor microenvironment, as well as increased drug/radiation resistance. More effective therapeutic strategies for overcoming these obstacles are urgently in demand. Aptamers, as chemical antibodies that bind to targets with high affinity and specificity, are a promising new and novel agent for both cancer diagnostic and therapeutic applications. Aptamer-based cancer cell targeting facilitates the development of active targeting in which aptamer-mediated drug delivery could provide promising anticancer outcomes. This review is to update the current progress of aptamer-based cancer diagnosis and aptamer-mediated active targeting for cancer therapy in vivo, exploring the potential of this novel form of targeted cancer therapy.

  12. IN VITRO SELECTION AND CHARACTERIZATION OF CELLULOSE-BINDING RNA APTAMERS USING ISOTHERMAL AMPLIFICATION

    PubMed Central

    Boese, B. J.; Corbino, K.; Breaker, R. R.

    2017-01-01

    We sought to create new cellulose-binding RNA aptamers for use as modular components in the engineering of complex functional nucleic acids. We designed our in vitro selection strategy to incorporate self-sustained sequence replication (3SR), which is an isothermal nucleic acid amplification protocol that allows for the rapid amplification of RNAs with little manipulation. The best performing aptamer representative was chosen for reselection and further optimization. The aptamer exhibits robust affinity for cellulose in both the powdered and paper form, but did not show any significant affinity for closely related polysaccharides. The minimal cellulose-binding RNA aptamer also can be grafted onto other RNAs to permit the isolation of RNAs from complex biochemical mixtures via cellulose affinity chromatography. This was demonstrated by fusing the aptamer to a glmS ribozyme sequence, and selectively eluting ribozyme cleavage products from cellulose using the glucosamine 6-phosphate to activate glmS ribozyme function. PMID:18696364

  13. Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1.

    PubMed

    Huang, Yukun; Chen, Xiujuan; Duan, Nuo; Wu, Shijia; Wang, Zhouping; Wei, Xinlin; Wang, Yuanfeng

    2015-01-01

    Enterotoxins from pathogenic bacteria are known as the main reason that can cause the bacterial foodborne diseases. In this study, aptamers that bound to Staphylococcus aureus enterotoxin C1 (SEC1) with high affinity and selectivity were generated in vitro by twelve rounds of selection based on magnetic separation technology, with a low-level dissociation constant (Kd) value of 65.14 ± 11.64 nmol/L of aptamer C10. Aptamer-based quantification of SEC1 in the food sample by a graphene oxide (GO)-based method was implemented to investigate the potential of the aptamer against SEC1 with a limit of detection of 6 ng/mL. On the basis of this work, biosensors using the selected SEC1 aptamers as new molecular recognition elements could be applied for innovative determinations of SEC1.

  14. Determining the elastic properties of aptamer-ricin single molecule multiple pathway interactions

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Park, Bosoon; Kwon, Yongkuk; Xu, Bingqian

    2014-05-01

    We report on the elastic properties of ricin and anti-ricin aptamer interactions, which showed three stable binding conformations, each of which has its special elastic properties. These different unbinding pathways were investigated by the dynamic force spectroscopy. A series-spring model combining the worm-like-chain model and Hook's law was used to estimate the apparent spring constants of the aptamer and linker molecule polyethylene glycol. The aptamer in its three different unbinding pathways showed different apparent spring constants. The two reaction barriers in the unbinding pathways also influence the apparent spring constant of the aptamer. This special elastic behavior of aptamer was used to distinguish its three unbinding pathways under different loading rates. This method also offered a way to distinguish and discard the non-specific interactions in single molecule experiments.

  15. Semiautomated Multiplexed Quantum Dot-Based in Situ Hybridization and Spectral Deconvolution

    PubMed Central

    Byers, Richard J.; Di Vizio, Dolores; O’Connell, Fionnuala; Tholouli, Eleni; Levenson, Richard M.; Gossard, Kirk; Twomey, David; Yang, Yu; Benedettini, Elisa; Rose, Joshua; Ligon, Keith L.; Finn, Stephen P.; Golub, Todd R.; Loda, Massimo

    2007-01-01

    Gene expression profiling has identified several potentially useful gene signatures for predicting outcome or for selecting targeted therapy. However, these signatures have been developed in fresh or frozen tissue, and there is a need to apply them to routinely processed samples. Here, we demonstrate the feasibility of a potentially high-throughput methodology combining automated in situ hybridization with quantum dot-labeled oligonucleotide probes followed by spectral imaging for the detection and subsequent deconvolution of multiple signals. This method is semiautomated and quantitative and can be applied to formalin-fixed, paraffin-embedded tissues. We have combined dual in situ hybridization with immunohistochemistry, enabling simultaneous measurement of gene expression and cell lineage determination. The technique achieves levels of sensitivity and specificity sufficient for the potential application of known expression signatures to biopsy specimens in a semiquantitative way, and the semiautomated nature of the method enables application to high-throughput studies. PMID:17251332

  16. Development of an aptamer beacon for detection of interferon-gamma.

    PubMed

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  17. The DNA aptamer binds stemness-enriched cancer cells in pancreatic cancer.

    PubMed

    Kim, Yoon-Jin; Lee, Hee Seung; Jung, Dawoon E; Kim, Jeong Mi; Song, Si Young

    2017-04-01

    Pancreatic cancer remains one of the most common and lethal cancers. Most patients (80%) present with inoperable advanced pancreatic cancer at initial diagnosis, and their early diagnosis is a significant unmet challenge. Recent studies indicate that cancer, including pancreatic cancer, is initiated and propagated by cancer stem cells (CSCs). CSCs are responsible not only for the pathogenesis of cancer but also for the heterogeneity, malignant degree, anticancer therapy resistance, and recurrence of tumors. Therefore, the identification of CSCs may be a crucial stepping stone for overcoming this disastrous pancreatic cancer. Here, we investigated pancreatic CSC-associated aptamers as a novel tool for diagnosis and therapeutic agents. Aptamers that bind to stemness-enriched cancer cells in pancreatic cancer were developed by modified Cell-SELEX method. Positive selection was performed by the sphere cells generated by pancreatic cancer cell line, HPAC, and then the aptamer pool was negatively selected by pancreatic normal cell line, HPDE. Aptamers 1 and 146 showing high specificity upon the KD values with 22.18 and 22.62 nM were selected. These 2 aptamers were validated by binding to HPAC sphere cells and to HPDE cells, and both aptamers showed specificity to HPAC sphere cells only. Aptamer-positive cells showed high expression levels of CSC-associated genes compared with the aptamer-negative cells by FACS analysis. The colocalization of CD44, CD24, ESA, and CD133 was also observed in the aptamer-positive cells by confocal microscopy. In the present study, these 2 pancreatic CSC-associated aptamers may be potential candidates for novel diagnostic markers, CSC-targeting drug delivery, or circulating tumor cell detection.

  18. Surface plasmon resonance imaging for affinity analysis of aptamer-protein interactions with PDMS microfluidic chips.

    PubMed

    Wang, Zhuangzhi; Wilkop, Thomas; Xu, Danke; Dong, Yi; Ma, Guangyu; Cheng, Quan

    2007-10-01

    We report on the use of PDMS multichannels for affinity studies of DNA aptamer-human Immunoglobulin E (IgE) interactions by surface plasmon resonance imaging (SPRi). The sensing surface was prepared with thiol-terminated aptamers through a self-assembling process in the PDMS channels defined on a gold substrate. Cysteamine was codeposited with the thiol aptamers to promote proper spatial arrangement of the aptamers and thus maintain their optimal binding efficiencies. Four aptamers with different nucleic acid sequences were studied to test their interaction affinity toward IgE, and the results confirmed that aptamer I (5'-SH-GGG GCA CGT TTA TCC GTC CCT CCT AGT GGC GTG CCC C-3') has the strongest binding affinity. Control experiments were conducted with a PEG-functionalized surface and IgG was used to replace IgE in order to verify the selective binding of aptamer I to the IgE molecules. A linear concentration-dependent relationship between IgE and aptamer I was obtained, and a 2-nM detection limit was achieved. SPRi data were further analyzed by global fitting, and the dissociation constant of aptamer I-IgE complex was found to be 2.7 x 10(-7) M, which agrees relatively well with the values reported in the literature. Aptamer affinity screening by SPR imaging demonstrates marked advantages over competing methods because it does not require labeling, can be used in real-time, and is potentially high-throughput. The ability to provide both qualitative and quantitative results on a multichannel chip further establishes SPRi as a powerful tool for the study of biological interactions in a multiplexed format.

  19. Biocompatible hydrogel membranes for the protection of RNA aptamer-based electrochemical sensors

    NASA Astrophysics Data System (ADS)

    Schoukroun-Barnes, Lauren R.; Wagan, Samiullah; Liu, Juan; Leach, Jennie B.; White, Ryan J.

    2013-05-01

    Electrochemical-aptamer based (E-AB) sensors represent a universal specific, selective, and sensitive sensing platform for the detection of small molecule targets. Their specific detection abilities are afforded by oligonucleotide (RNA or DNA) aptamers employed as electrode-bound biorecognition elements. Sensor signaling is predicated on bindinginduced changes in conformation and/or flexibility of the aptamer that is readily measurable electrochemically. While sensors fabricated using DNA aptamers can achieve specific and selective detection even in unadulterated sample matrices, such as blood serum, RNA-based sensors fail when challenged in the same sample matrix without significant sample pretreatment. This failure is at least partially a result of enzymatic degradation of the RNA sensing element. This degradation destroys the sensing aptamer inhibiting the quantitative measurement of the target analyte and thus limits the application of E-AB sensors constructed with RNA aptamer. To circumvent this, we demonstrate that a biocompatible hydrogel membrane protects the RNA aptamer sensor surface from enzymatic degradation for at least 3 hours - a remarkable improvement over the rapid (~minutes) degradation of unprotected sensors. To demonstrate this, we characterize the response of sensors fabricated with representative DNA and RNA aptamers directed against the aminoglycoside antibiotic, tobramycin in blood serum both protected and unprotected by a polyacrylamide membrane. Furthermore, we find encapsulation of the sensor surface with the hydrogel does not significantly impede the detection ability of aptamer-based sensors. This hydrogel-aptamer interface will thus likely prove useful for the long-term monitoring of therapeutics in complex biological media.

  20. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications

    PubMed Central

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-01-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G–C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165. Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. PMID:27387284

  1. In Situ Live Cell Sensing of Multiple Nucleotides Exploiting DNA/RNA Aptamers and Graphene Oxide Nanosheets

    SciTech Connect

    Wang, Ying; Li, Zhaohui; Weber, Thomas J.; Hu, Dehong; Lin, Chiann Tso; Li, Jinghong; Lin, Yuehe

    2013-07-23

    Adenosine-5’-triphosphate (ATP) and guanosine-5’-triphosphate (GTP) are primary energy resources and function coordinately for numerous reactions such as microtubule assembly, insulin secretion and ion channel regulation. We have developed a novel DNA/RNA aptamer- graphene oxide nanosheet (GO-nS) sensing platform that can selectively and simultaneously detect ATP and GTP in live cells. A fluorescent tag is covalently attached to aptamers and fluorescence is quenched upon binding of aptamer to the GO-nS. Fluorescently tagged aptamers that selectively bind ATP or GTP were isolated from an aptamer library and were adsorbed onto GO-nS. Upon incubation with targets (ATP and/or GTP), the aptamers readily dissociated from GO-nS and the fluorescent signal was recovered. By covalently attaching fluorophores, both ATP and GTP sensing aptamers could be exploited to simultaneously visualize aptamer dissociation in live cells. In addition, the GO-nS appear to be biocompatible and protect the adsorbed DNA/RNA aptamers from enzymatic cleavage. Our results support the application of aptamer/GO-nS as a sensing platform for nucleotides in living cells and have implications for the development of additional sensor platforms for other bio-molecules that show selective interactions with aptamers and other biomarkers.

  2. DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

    PubMed

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

    2014-10-15

    An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility.

  3. Development, screening, and analysis of DNA aptamer libraries potentially useful for diagnosis and passive immunity of arboviruses

    PubMed Central

    2012-01-01

    Background Nucleic acid aptamers have long demonstrated the capacity to bind viral envelope proteins and to inhibit the progression of pathogenic virus infections. Here we report on initial efforts to develop and screen DNA aptamers against recombinant envelope proteins or synthetic peptides and whole inactivated viruses from several virulent arboviruses including Chikungunya, Crimean-Congo hemorrhagic fever (CCHF), dengue, tickborne encephalitis and West Nile viruses. We also analyzed sequence data and secondary structures for commonalities that might reveal consensus binding sites among the various aptamers. Some of the highest affinity and most specific aptamers in the down-selected libraries were demonstrated to have diagnostic utility in lateral flow chromatographic assays and in a fluorescent aptamer-magnetic bead sandwich assay. Some of the reported aptamers may also be able to bind viral envelope proteins in vivo and therefore may have antiviral potential in passive immunity or prophylactic applications. Results Several arbovirus DNA aptamer sequences emerged multiple times in the various down selected aptamer libraries thereby suggesting some consensus sequences for binding arbovirus envelope proteins. Screening of aptamers by enzyme-linked aptamer sorbent assay (ELASA) was useful for ranking relative aptamer affinities against their cognate viral targets. Additional study of the aptamer sequences and secondary structures of top-ranked anti-arboviral aptamers suggest potential virus binding motifs exist within some of the key aptamers and are highlighted in the supplemental figures for this article. One sequence segment (ACGGGTCCGGACA) emerged 60 times in the anti-CCHF aptamer library, but nowhere else in the anti-arbovirus library and only a few other times in a larger library of aptamers known to bind bacteria and rickettsia or other targets. Diagnostic utility of some of the aptamers for arbovirus detection in lateral flow chromatographic assays and a

  4. Complex formation with nucleic acids and aptamers alters the antigenic properties of platelet factor 4

    PubMed Central

    Jaax, Miriam E.; Krauel, Krystin; Marschall, Thomas; Brandt, Sven; Gansler, Julia; Fürll, Birgitt; Appel, Bettina; Fischer, Silvia; Block, Stephan; Helm, Christiane A.; Müller, Sabine; Preissner, Klaus T.

    2013-01-01

    The tight electrostatic binding of the chemokine platelet factor 4 (PF4) to polyanions induces heparin-induced thrombocytopenia, a prothrombotic adverse drug reaction caused by immunoglobulin G directed against PF4/polyanion complexes. This study demonstrates that nucleic acids, including aptamers, also bind to PF4 and enhance PF4 binding to platelets. Systematic assessment of RNA and DNA constructs, as well as 4 aptamers of different lengths and secondary structures, revealed that increasing length and double-stranded segments of nucleic acids augment complex formation with PF4, while single nucleotides or single-stranded polyA or polyC constructs do not. Aptamers were shown by circular dichroism spectroscopy to induce structural changes in PF4 that resemble those induced by heparin. Moreover, heparin-induced anti-human–PF4/heparin antibodies cross-reacted with human PF4/nucleic acid and PF4/aptamer complexes, as shown by an enzyme immunoassay and a functional platelet activation assay. Finally, administration of PF4/44mer–DNA protein C aptamer complexes in mice induced anti–PF4/aptamer antibodies, which cross-reacted with murine PF4/heparin complexes. These data indicate that the formation of anti-PF4/heparin antibodies in postoperative patients may be augmented by PF4/nucleic acid complexes. Moreover, administration of therapeutic aptamers has the potential to induce anti-PF4/polyanion antibodies and a prothrombotic diathesis. PMID:23673861

  5. Effect of linker structure on surface density of aptamer monolayers and their corresponding protein binding efficiency.

    PubMed

    Balamurugan, Subramanian; Obubuafo, Anne; McCarley, Robin L; Soper, Steven A; Spivak, David A

    2008-12-15

    A systematic study is reported on the effect of linker size and its chemical composition toward ligand binding to a surface-immobilized aptamer, measured using surface plasmon resonance. The results, using thrombin as the model system, showed that as the number of thymidine (T) units in the linker increases from 0 to 20 in four separate increments (T(0), T(5), T(10), T(20)), the surface density of the aptamer decreased linearly from approximately 25 to 12 pmol x cm(-2). The decrease in aptamer surface density occurred due to the increased size of the linker molecules. In addition, thrombin binding capacity was shown to increase as the linker length increased from 0 to 5 thymidine nucleotides and then decreased as the number of thymidine residues increased to 20 due to a balance between two different effects. The initial increase was due to increased access of thrombin to the aptamer as the aptamer was moved away from the surface. For linkers greater in length than T(5), the overall decrease in binding capacity was primarily due to a decrease in the surface density. Incorporation of a hexa(ethylene glycol) moiety into the linker did not affect the surface density but increased the amount of thrombin bound. In addition, the attachment of the linker at the 3'- versus the 5'-end of the aptamer resulted in increased aptamer surface density. However, monolayers formed with equal surface densities showed similar amounts of thrombin binding irrespective of the point of attachment.

  6. Aptamer-based surface plasmon resonance sensing of glycated human blood proteins

    NASA Astrophysics Data System (ADS)

    Reaver, Nathan G. F.; Zheng, Rui; Kim, Dong-Shik; Cameron, Brent D.

    2013-02-01

    The concentration ratio of glycated to non-glycated forms of various blood proteins can be used as a diagnostic measure in diabetes to determine a history of glycemic compliance. Depending on a protein's half-life in blood, compliance can be assessed from a few days to several months in the past, which can then be used to provide additional therapeutic guidance. Current glycated protein detection methods are limited in their ability to measure multiple proteins, and are susceptible to interference from other blood pathologies. In this study, we developed and characterized DNA aptamers for use in Surface Plasmon Resonance (SPR) sensors to assess the blood protein hemoglobin. The aptamers were developed by way of a modified Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process which selects DNA sequences that have a high binding affinity to a specific protein. DNA products resulting from this process are sequenced and identified aptamers are then synthesized. The SELEX process was performed to produce aptamers for a glycated form of hemoglobin. Equilibrium dissociation constants for the binding of the identified aptamer to glycated hemoglobin, hemoglobin, and fibrinogen were calculated from fitted Langmuir isotherms obtained through SPR. These constants were determined to be 94 nM, 147 nM, and 244 nM respectively. This aptamer can potentially be used to create a SPR aptamer based biosensor for detection of glycated hemoglobin, a technology that has the potential to deliver low-cost and immediate glycemic compliance assessment in either a clinical or home setting.

  7. RAGE-aptamer Blocks the Development and Progression of Experimental Diabetic Nephropathy.

    PubMed

    Matsui, Takanori; Higashimoto, Yuichiro; Nishino, Yuri; Nakamura, Nobutaka; Fukami, Kei; Yamagishi, Sho-Ichi

    2017-04-06

    Interaction of advanced glycation end products (AGEs) and their receptor (RAGE) plays a central role in diabetic nephropathy. We screened DNA aptamers directed against RAGE (RAGE-aptamers) in vitro, and examined the effects on development and progression of diabetic nephropathy in streptozotocin-induced diabetic rats. RAGE-aptamer bound to RAGE with a dissociation constant of 5.68 nM and resultantly blocked the binding of AGEs to RAGE. When diabetic rats received continuous intraperitoneal injection of RAGE-aptamer from week 7 to 11 of diabetes, the increases in renal NADPH oxidase activity, oxidative stress generation, AGE, RAGE, inflammatory and fibrotic gene and protein levels, macrophage and extracellular matrix accumulation, and albuminuria were significantly suppressed, which were associated with improvement of podocyte damage. Two-week infusion of RAGE-aptamer just after the induction of diabetes also inhibited the AGE-RAGE-oxidative stress system and monocyte chemoattractant protein-1 levels in the kidneys of 8-week old diabetic rats, and simultaneously ameliorated podocyte injury and albuminuria. Moreover, RAGE-aptamer significantly suppressed the AGE-induced oxidative stress generation and inflammatory and fibrotic reactions in human cultured mesangial cells. Our present findings suggest that continuous infusion of RAGE-aptamer could attenuate the development and progression of experimental diabetic nephropathy by blocking the AGE-RAGE axis.

  8. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    NASA Astrophysics Data System (ADS)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan

    2016-11-01

    Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  9. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering.

    PubMed

    Ardjomandi, N; Huth, J; Stamov, D R; Henrich, A; Klein, C; Wendel, H-P; Reinert, S; Alexander, D

    2016-10-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs.

  10. Positive Modulation of the Glycine Receptor by Means of Glycine Receptor–Binding Aptamers

    PubMed Central

    Aneiros, Eduardo; Blank, Michael; Mueller, Johan; Nyman, Eva; Blind, Michael; Dabrowski, Michael A.; Andersson, Christin V.; Sandberg, Kristian

    2015-01-01

    According to the gate control theory of pain, the glycine receptors (GlyRs) are putative targets for development of therapeutic analgesics. A possible approach for novel analgesics is to develop a positive modulator of the glycine-activated Cl− channels. Unfortunately, there has been limited success in developing drug-like small molecules to study the impact of agonists or positive modulators on GlyRs. Eight RNA aptamers with low nanomolar affinity to GlyRα1 were generated, and their pharmacological properties analyzed. Cytochemistry using fluorescein-labeled aptamers demonstrated GlyRα1-dependent binding to the plasma membrane but also intracellular binding. Using a fluorescent membrane potential assay, we could identify five aptamers to be positive modulators. The positive modulation of one of the aptamers was confirmed by patch-clamp electrophysiology on L(tk) cells expressing GlyRα1 and/or GlyRα1β. This aptamer potentiated whole-cell Cl− currents in the presence of low concentrations of glycine. To our knowledge, this is the first demonstration ever of RNA aptamers acting as positive modulators for an ion channel. We believe that these aptamers are unique and valuable tools for further studies of GlyR biology and possibly also as tools for assay development in identifying small-molecule agonists and positive modulators. PMID:26071243

  11. Aptamers as promising molecular recognition elements for diagnostics and therapeutics in the central nervous system.

    PubMed

    McConnell, Erin M; Holahan, Matthew R; DeRosa, Maria C

    2014-12-01

    Oligonucleotide aptamers are short, synthetic, single-stranded DNA or RNA able to recognize and bind to a multitude of targets ranging from small molecules to cells. Aptamers have emerged as valuable tools for fundamental research, clinical diagnosis, and therapy. Due to their small size, strong target affinity, lack of immunogenicity, and ease of chemical modification, aptamers are an attractive alternative to other molecular recognition elements, such as antibodies. Although it is a challenging environment, the central nervous system and related molecular targets present an exciting potential area for aptamer research. Aptamers hold promise for targeted drug delivery, diagnostics, and therapeutics. Here we review recent advances in aptamer research for neurotransmitter and neurotoxin targets, demyelinating disease and spinal cord injury, cerebrovascular disorders, pathologies related to protein aggregation (Alzheimer's, Parkinson's, and prions), brain cancer (glioblastomas and gliomas), and regulation of receptor function. Challenges and limitations posed by the blood brain barrier are described. Future perspectives for the application of aptamers to the central nervous system are also discussed.

  12. Defining the copper binding aptamotif and aptamer integrated recovery platform (AIRP).

    PubMed

    Sekhon, Simranjeet Singh; Lee, Sang-Hee; Lee, Kyeong-Ah; Min, Jiho; Lee, Byung-Tae; Kim, Kyoung-Woong; Ahn, Ji-Young; Kim, Yang-Hoon

    2017-02-23

    The potential copper binding sites in aptamers have been predicted on the basis of secondary structures and the binding affinity of aptamers with copper. Out of the 4 aptamers (Cu-A1 to Cu-A4) selected by SELEX and examined in the present study, the Cu-A2 aptamer shows the highest binding affinity to copper with the lowest KD value of 1.83 × 10(-11) M. In order to confirm the binding of copper to the proposed region, the binding affinity was experimentally validated using mutation and deletion analysis. We have confirmed that the high G-C pairing patterns and short stem-interval distance play important roles in copper binding. Aptamer specificity was also verified against diverse heavy metals. We also demonstrate an Aptamer Integrated Recovery Platform (AIRP) to recover copper from acidic mine drainage. AIRP can be easily regenerated at least 20 times without significant deterioration of the retrieval performance. To the best of our knowledge, AIRP is the first demonstration of copper specific recovery using aptamers. This can be scaled up and would have diverse applications in metal contaminated water treatment, recovery and as a potential biosensor for environmental analysis, monitoring, and risk assessment.

  13. Rapid detection of food pathogens using RNA aptamers-immobilized slide.

    PubMed

    Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

    2012-07-01

    The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

  14. Application of capillary electrophoresis to the development and evaluation of aptamer affinity probes

    NASA Astrophysics Data System (ADS)

    Sooter, Letha J.; McMasters, Sun; Stratis-Cullum, Dimitra N.

    2007-09-01

    Nucleic acid aptamers can exhibit high binding affinities for a wide variety of targets and have received much attention as molecular recognition elements for enhanced biosensor performance. These aptamers recognize target molecules through a combination of conformational dependent non-covalent interactions in aqueous media which can be investigated using capillary electrophoresis-based methods. In this paper we report on the results of our studies of the relative binding affinity of Campylobacter jejuni aptamers using a capillary electrophoretic immunoassay. Our results show preferential binding to C. jejuni over other common food pathogen bacteria. Capillary electrophoresis can also be used to develop new aptamer recognition elements using an in vitro selection process known as systematic evolution of ligand by exponential enrichment (SELEX). Recently, this process has been adapted to use capillary electrophoresis in an attempt to shorten the overall selection process. This smart selection of nucleic acid aptamers from a large diversity of a combinatorial DNA library is under optimization for the development of aptamers which bind to Army-relevant targets. This paper will include a discussion of the establishment of CE-SELEX methods for the future development of smart aptamer probes.

  15. Selection and elution of aptamers using nanoporous sol-gel arrays with integrated microheaters.

    PubMed

    Park, Seung-Min; Ahn, Ji-Young; Jo, Minjoung; Lee, Dong-Ki; Lis, John T; Craighead, Harold G; Kim, Soyoun

    2009-05-07

    RNA and DNA aptamers that bind to target molecules with high specificity and affinity have been a focus of diagnostics and therapeutic research. These aptamers are obtained by SELEX (Systematic Evolution of Ligands by EXponential enrichment) often requiring more than 10 successive cycles of selection and amplification, where each cycle normally takes 2 days per cycle of SELEX. Here, we have demonstrated the use of sol-gel arrays of proteins in a microfluidic system for efficient selection of RNA aptamers against multiple target molecules. The microfluidic chip incorporates five sol-gel binding droplets, within which specific target proteins are imbedded. The droplets are patterned on top of individually addressable electrical microheaters used for selective elution of aptamers bound to target proteins in the sol-gel droplets. We demonstrate that specific aptamers bind their respective protein targets and can be selectively eluted by micro-heating. Finally, our microfluidic SELEX system greatly improved selection efficiency, reducing the number of selection cycles needed to produce high affinity aptamers. The process is readily scalable to larger arrays of sol-gel-embedded proteins. To our knowledge, this is the first demonstration of a chip-based selection of aptamers using microfluidics, thereby allowing development of a high throughput and efficient SELEX procedures.

  16. Tailing DNA aptamers with a functional protein by two-step enzymatic reaction.

    PubMed

    Takahara, Mari; Hayashi, Kounosuke; Goto, Masahiro; Kamiya, Noriho

    2013-12-01

    An efficient, quantitative synthetic strategy for aptamer-enzyme conjugates was developed by using a two-step enzymatic reaction. Terminal deoxynucleotidyl transferase (TdT) was used to first incorporate a Z-Gln-Gly (QG) modified nucleotide which can act as a glutamine donor for a subsequent enzymatic reaction, to the 3'-OH of a DNA aptamer. Microbial transglutaminase (MTG) then catalyzed the cross-linking between the Z-QG modified aptamers and an enzyme tagged with an MTG-reactive lysine containing peptide. The use of a Z-QG modified dideoxynucleotide (Z-QG-ddUTP) or a deoxyuridine triphosphate (Z-QG-dUTP) in the TdT reaction enables the controlled introduction of a single or multiple MTG reactive residues. This leads to the preparation of enzyme-aptamer and (enzyme)n-aptamer conjugates with different detection limits of thrombin, a model analyte, in a sandwich enzyme-linked aptamer assay (ELAA). Since the combination of two enzymatic reactions yields high site-specificity and requires only short peptide substrates, the methodology should be useful for the labeling of DNA/RNA aptamers with proteins.

  17. Dual-colour imaging of RNAs using quencher- and fluorophore-binding aptamers.

    PubMed

    Arora, Ankita; Sunbul, Murat; Jäschke, Andres

    2015-12-02

    In order to gain deeper insight into the functions and dynamics of RNA in cells, the development of methods for imaging multiple RNAs simultaneously is of paramount importance. Here, we describe a modular approach to image RNA in living cells using an RNA aptamer that binds to dinitroaniline, an efficient general contact quencher. Dinitroaniline quenches the fluorescence of different fluorophores when directly conjugated to them via ethylene glycol linkers by forming a non-fluorescent intramolecular complex. Since the binding of the RNA aptamer to the quencher destroys the fluorophore-quencher complex, fluorescence increases dramatically upon binding. Using this principle, a series of fluorophores were turned into fluorescent turn-on probes by conjugating them to dinitroaniline. These probes ranged from fluorescein-dinitroaniline (green) to TexasRed-dinitroaniline (red) spanning across the visible spectrum. The dinitroaniline-binding aptamer (DNB) was generated by in vitro selection, and was found to bind all probes, leading to fluorescence increase in vitro and in living cells. When expressed in E. coli, the DNB aptamer could be labelled and visualized with different-coloured fluorophores and therefore it can be used as a genetically encoded tag to image target RNAs. Furthermore, combining contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA aptamer) and SRB-2 aptamers (a fluorophore-binding RNA aptamer) allowed dual-colour imaging of two different fluorescence-enhancing RNA tags in living cells, opening new avenues for studying RNA co-localization and trafficking.

  18. Robust Suppression of HIV Replication by Intracellularly Expressed Reverse Transcriptase Aptamers Is Independent of Ribozyme Processing

    PubMed Central

    Lange, Margaret J; Sharma, Tarun K; Whatley, Angela S; Landon, Linda A; Tempesta, Michael A; Johnson, Marc C; Burke, Donald H

    2012-01-01

    RNA aptamers that bind human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT) also inhibit viral replication, making them attractive as therapeutic candidates and potential tools for dissecting viral pathogenesis. However, it is not well understood how aptamer-expression context and cellular RNA pathways govern aptamer accumulation and net antiviral bioactivity. Using a previously-described expression cassette in which aptamers were flanked by two “minimal core” hammerhead ribozymes, we observed only weak suppression of pseudotyped HIV. To evaluate the importance of the minimal ribozymes, we replaced them with extended, tertiary-stabilized hammerhead ribozymes with enhanced self-cleavage activity, in addition to noncleaving ribozymes with active site mutations. Both the active and inactive versions of the extended hammerhead ribozymes increased inhibition of pseudotyped virus, indicating that processing is not necessary for bioactivity. Clonal stable cell lines expressing aptamers from these modified constructs strongly suppressed infectious virus, and were more effective than minimal ribozymes at high viral multiplicity of infection (MOI). Tertiary stabilization greatly increased aptamer accumulation in viral and subcellular compartments, again regardless of self-cleavage capability. We therefore propose that the increased accumulation is responsible for increased suppression, that the bioactive form of the aptamer is one of the uncleaved or partially cleaved transcripts, and that tertiary stabilization increases transcript stability by reducing exonuclease degradation. PMID:22948672

  19. Graphene-based aptamer logic gates and their application to multiplex detection.

    PubMed

    Wang, Li; Zhu, Jinbo; Han, Lei; Jin, Lihua; Zhu, Chengzhou; Wang, Erkang; Dong, Shaojun

    2012-08-28

    In this work, a GO/aptamer system was constructed to create multiplex logic operations and enable sensing of multiplex targets. 6-Carboxyfluorescein (FAM)-labeled adenosine triphosphate binding aptamer (ABA) and FAM-labeled thrombin binding aptamer (TBA) were first adsorbed onto graphene oxide (GO) to form a GO/aptamer complex, leading to the quenching of the fluorescence of FAM. We demonstrated that the unique GO/aptamer interaction and the specific aptamer-target recognition in the target/GO/aptamer system were programmable and could be utilized to regulate the fluorescence of FAM via OR and INHIBIT logic gates. The fluorescence changed according to different input combinations, and the integration of OR and INHIBIT logic gates provided an interesting approach for logic sensing applications where multiple target molecules were present. High-throughput fluorescence imagings that enabled the simultaneous processing of many samples by using the combinatorial logic gates were realized. The developed logic gates may find applications in further development of DNA circuits and advanced sensors for the identification of multiple targets in complex chemical environments.

  20. Imaging gene expression in real-time using aptamers

    SciTech Connect

    Shin, Il Chung

    2011-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  1. Imaging gene expression in real-time using aptamers

    SciTech Connect

    Shin, Ilchung

    2012-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  2. Reversible Aptamer-Au Plasmon Rulers for Secreted Single Molecules

    DOE PAGES

    Lee, Somin Eunice; Chen, Qian; Bhat, Ramray; ...

    2015-06-03

    Plasmon rulers, consisting of pairs of gold nanoparticles, allow single-molecule analysis without photobleaching or blinking; however, current plasmon rulers are irreversible, restricting detection to only single events. Here, we present a reversible plasmon ruler, comprised of coupled gold nanoparticles linked by a single aptamer, capable of binding individual secreted molecules with high specificity. We show that the binding of target secreted molecules to the reversible plasmon ruler is characterized by single-molecule sensitivity, high specificity, and reversibility. Lastly, such reversible plasmon rulers should enable dynamic and adaptive live-cell measurement of secreted single molecules in their local microenvironment.

  3. Aptamer contained triple-helix molecular switch for rapid fluorescent sensing of acetamiprid.

    PubMed

    Liu, Xin; Li, Ying; Liang, Jing; Zhu, Wenyue; Xu, Jingyue; Su, Ruifang; Yuan, Lei; Sun, Chunyan

    2016-11-01

    In this study, an aptamer-based fluorescent sensing platform using triple-helix molecular switch (THMS) was developed for the pesticide screening represented by acetamiprid. The THMS was composed of two tailored DNA probes: a label-free central target specific aptamer sequence flanked by two arm segments acting as a recognition probe; a hairpin-shaped structure oligonucleotide serving as a signal transduction probe (STP), labeled with a fluorophore and a quencher at the 3' and 5'-end, respectively. In the absence of acetamiprid, complementary bindings of two arm segments of the aptamers with the loop sequence of STP enforce the formation of THMS with the "open" configuration of STP, and the fluorescence of THMS is on. In the presence of target acetamiprid, the aptamer-target binding results in the formation of a structured aptamer/target complex, which disassembles the THMS and releases the STP. The free STP is folded to a stem loop structure, and the fluorescence is quenched. The quenched fluorescence intensity was proportional to the concentration of acetamiprid in the range from 100 to 1200nM, with the limit of detection (LOD) as low as 9.12nM. In addition, this THMS-based method has been successfully used to test and quantify acetamiprid in Chinese cabbage with satisfactory recoveries, and the results were in full agreement with those from LC-MS. The aptamer-based THMS presents distinct advantages, including high stability, remarkable sensitivity, and preservation of the affinity and specificity of the original aptamer. Most importantly, this strategy is convenient and generalizable by virtue of altering the aptamer sequence without changing the triple-helix structure. So, it is expected that this aptamer-based fluorescent assay could be extensively applied in the field of food safety inspection.

  4. In vitro selection, characterization, and biosensing application of high-affinity cylindrospermopsin-targeting aptamers.

    PubMed

    Elshafey, Reda; Siaj, Mohamed; Zourob, Mohammed

    2014-09-16

    Contamination of freshwater with cyanotoxin cylindrospermopsin (CYN) represents a significant global concern for public health. The sensitive detection of CYN is necessary to effectively manage and control the treatment of water resources. Here we report a novel, highly sensitive label-free aptasensor for CYN analysis, using aptamers as specific receptors. We have selected the DNA aptamers from a diverse random library using the in vitro screening SELEX approach. The aptamers exhibited high affinity for CYN with Kd of nanomolar range. One aptamer exhibited conformational change upon CYN recognition (CD analysis) and was used to fabricate the label-free impedimetric aptasensor for CYN. A self-assembled monolayer from a disulfide-derivatized aptamer was formed on a gold electrode to fabricate the aptasensor. Upon CYN capturing to the aptasensor surface, a marked drop in the electron transfer resistance was obtained, which was used as the principle of detection of CYN. This resulted from the aptamer's conformational change induced by CYN recognition. The present aptasensor could detect CYN with the limit of detection as low as 100 pM and a wide linear range of 0.1 to 80 nM. When mounted on the gold surface, the aptamer exhibited a lower dissociation constant for CYN than that observed in the fluorescence assay, implying that the anchoring of the aptamer on the Au surface improved its affinity to CYN. Moreover, the aptasensor showed high specificity toward other coexistent cyanobacterial toxins of microcystin-LR and Anatoxin-a. Further biosensor designs will be generated using those aptamers for simple and sensitive CYN monitoring.

  5. Evaluation of antithrombotic activity of thrombin DNA aptamers by a murine thrombosis model.

    PubMed

    Zavyalova, Elena; Samoylenkova, Nadezhda; Revishchin, Alexander; Golovin, Andrey; Pavlova, Galina; Kopylov, Alexey

    2014-01-01

    Aptamers are nucleic acid based molecular recognition elements with a high potential for the theranostics. Some of the aptamers are under development for therapeutic applications as promising antithrombotic agents; and G-quadruplex DNA aptamers, which directly inhibit the thrombin activity, are among them. RA-36, the 31-meric DNA aptamer, consists of two thrombin binding pharmacophores joined with the thymine linker. It has been shown earlier that RA-36 directly inhibits thrombin in the reaction of fibrinogen hydrolysis, and also it inhibits plasma and blood coagulation. Studies of both inhibitory and anticoagulation effects had indicated rather high species specificity of the aptamer. Further R&D of RA-36 requires exploring its efficiency in vivo. Therefore the development of a robust and adequate animal model for effective physiological studies of aptamers is in high current demand. This work is devoted to in vivo study of the antithrombotic effect of RA-36 aptamer. A murine model of thrombosis has been applied to reveal a lag and even prevention of thrombus formation when RA-36 was intravenous bolus injected in high doses of 1.4-7.1 µmol/kg (14-70 mg/kg). A comparative study of RA-36 aptamer and bivalirudin reveals that both direct thrombin inhibitors have similar antithrombotic effects for the murine model of thrombosis; though in vitro bivalirudin has anticoagulation activity several times higher compared to RA-36. The results indicate that both RA-36 aptamer and bivalirudin are direct thrombin inhibitors of different potency, but possible interactions of the thrombin-inhibitor complex with other components of blood coagulation cascade level the physiological effects for both inhibitors.

  6. Evaluation of Antithrombotic Activity of Thrombin DNA Aptamers by a Murine Thrombosis Model

    PubMed Central

    Zavyalova, Elena; Samoylenkova, Nadezhda; Revishchin, Alexander; Golovin, Andrey; Pavlova, Galina; Kopylov, Alexey

    2014-01-01

    Aptamers are nucleic acid based molecular recognition elements with a high potential for the theranostics. Some of the aptamers are under development for therapeutic applications as promising antithrombotic agents; and G-quadruplex DNA aptamers, which directly inhibit the thrombin activity, are among them. RA-36, the 31-meric DNA aptamer, consists of two thrombin binding pharmacophores joined with the thymine linker. It has been shown earlier that RA-36 directly inhibits thrombin in the reaction of fibrinogen hydrolysis, and also it inhibits plasma and blood coagulation. Studies of both inhibitory and anticoagulation effects had indicated rather high species specificity of the aptamer. Further R&D of RA-36 requires exploring its efficiency in vivo. Therefore the development of a robust and adequate animal model for effective physiological studies of aptamers is in high current demand. This work is devoted to in vivo study of the antithrombotic effect of RA-36 aptamer. A murine model of thrombosis has been applied to reveal a lag and even prevention of thrombus formation when RA-36 was intravenous bolus injected in high doses of 1.4–7.1 µmol/kg (14–70 mg/kg). A comparative study of RA-36 aptamer and bivalirudin reveals that both direct thrombin inhibitors have similar antithrombotic effects for the murine model of thrombosis; though in vitro bivalirudin has anticoagulation activity several times higher compared to RA-36. The results indicate that both RA-36 aptamer and bivalirudin are direct thrombin inhibitors of different potency, but possible interactions of the thrombin-inhibitor complex with other components of blood coagulation cascade level the physiological effects for both inhibitors. PMID:25192011

  7. Protein-Binding RNA Aptamers Affect Molecular Interactions Distantly from Their Binding Sites

    PubMed Central

    Dupont, Daniel M.; Thuesen, Cathrine K.; Bøtkjær, Kenneth A.; Behrens, Manja A.; Dam, Karen; Sørensen, Hans P.; Pedersen, Jan S.; Ploug, Michael; Jensen, Jan K.; Andreasen, Peter A.

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126) with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site. PMID:25793507

  8. Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST).

    PubMed

    Entzian, Clemens; Schubert, Thomas

    2016-03-15

    Aptamers are potent and versatile binding molecules recognizing various classes of target molecules. Even challenging targets such as small molecules can be identified and bound by aptamers. Studying the interaction between aptamers and drugs, antibiotics or metabolites in detail is however difficult due to the lack of sophisticated analysis methods. Basic binding parameters of these small molecule-aptamer interactions such as binding affinity, stoichiometry and thermodynamics are elaborately to access using the state of the art technologies. The innovative MicroScale Thermophoresis (MST) is a novel, rapid and precise method to characterize these small molecule-aptamer interactions in solution at microliter scale. The technology is based on the movement of molecules through temperature gradients, a physical effect referred to as thermophoresis. The thermophoretic movement of a molecule depends - besides on its size - on charge and hydration shell. Upon the interaction of a small molecule and an aptamer, at least one of these parameters is altered, leading to a change in the movement behavior, which can be used to quantify molecular interactions independent of the size of the target molecule. The MST offers free choice of buffers, even measurements in complex bioliquids are possible. The dynamic affinity range covers the pM to mM range and is therefore perfectly suited to analyze small molecule-aptamer interactions. This section describes a protocol how quantitative binding parameters for aptamer-small molecule interactions can be obtained by MST. This is demonstrated by mapping down the binding site of the well-known ATP aptamer DH25.42 to a specific region at the adenine of the ATP molecule.

  9. Aptamers and methods for their in vitro selection and uses thereof

    SciTech Connect

    Doyle, Sharon A; Murphy, Michael B

    2012-01-31

    The present method is an improved in vitro selection protocol that relies on magnetic separations for DNA aptamer production that is relatively easy and scalable without the need for expensive robotics. The ability of aptamers selected by this method to recognize and bind their target protein with high affinity and specificity, and detail their uses in a number of assays is also described. Specific TTF1 and His6 aptamers were selected using the method described, and shown to be useful for enzyme-linked assays, Western blots, and affinity purification.

  10. Aptamers and methods for their in vitro selection and uses thereof

    DOEpatents

    Doyle, Sharon A.; Murphy, Michael B.

    2008-02-12

    The present method is an improved in vitro selection protocol that relies on magnetic separations for DNA aptamer production that is relatively easy and scalable without the need for expensive robotics. The ability of aptamers selected by this method to recognize and bind their target protein with high affinity and specificity, and detail their uses in a number of assays is also described. Specific TTF1 and His6 aptamers were selected using the method described, and shown to be useful for enzyme-linked assays, Western blots, and affinity purification.

  11. Targeting Two Coagulation Cascade Proteases with a Bivalent Aptamer Yields a Potent and Antidote-Controllable Anticoagulant

    PubMed Central

    Soule, Erin E.; Bompiani, Kristin M.; Woodruff, Rebecca S.

    2016-01-01

    Potent and rapid-onset anticoagulation is required for several clinical settings, including cardiopulmonary bypass surgery. In addition, because anticoagulation is associated with increased bleeding following surgery, the ability to rapidly reverse such robust anticoagulation is also important. Previously, we observed that no single aptamer was as potent as heparin for anticoagulating blood. However, we discovered that combinations of two aptamers were as potent as heparin. Herein, we sought to combine two individual anticoagulant aptamers into a single bivalent RNA molecule in an effort to generate a single molecule that retained the potent anticoagulant activity of the combination of individual aptamers. We created four bivalent aptamers that can inhibit Factor X/Xa and prothrombin/thrombin and anticoagulate plasma, as well as the combination of individual aptamers. Detailed characterization of the shortest bivalent aptamer indicates that each aptamer retains full binding and functional activity when presented in the bivalent context. Finally, reversal of this bivalent aptamer with a single antidote was explored, and anticoagulant activity could be rapidly turned off in a dose-dependent manner. These studies demonstrate that bivalent anticoagulant aptamers represent a novel and potent approach to actively and reversibly control coagulation. PMID:26584417

  12. Targeting Two Coagulation Cascade Proteases with a Bivalent Aptamer Yields a Potent and Antidote-Controllable Anticoagulant.

    PubMed

    Soule, Erin E; Bompiani, Kristin M; Woodruff, Rebecca S; Sullenger, Bruce A

    2016-02-01

    Potent and rapid-onset anticoagulation is required for several clinical settings, including cardiopulmonary bypass surgery. In addition, because anticoagulation is associated with increased bleeding following surgery, the ability to rapidly reverse such robust anticoagulation is also important. Previously, we observed that no single aptamer was as potent as heparin for anticoagulating blood. However, we discovered that combinations of two aptamers were as potent as heparin. Herein, we sought to combine two individual anticoagulant aptamers into a single bivalent RNA molecule in an effort to generate a single molecule that retained the potent anticoagulant activity of the combination of individual aptamers. We created four bivalent aptamers that can inhibit Factor X/Xa and prothrombin/thrombin and anticoagulate plasma, as well as the combination of individual aptamers. Detailed characterization of the shortest bivalent aptamer indicates that each aptamer retains full binding and functional activity when presented in the bivalent context. Finally, reversal of this bivalent aptamer with a single antidote was explored, and anticoagulant activity could be rapidly turned off in a dose-dependent manner. These studies demonstrate that bivalent anticoagulant aptamers represent a novel and potent approach to actively and reversibly control coagulation.

  13. Screening and Initial Binding Assessment of Fumonisin B1 Aptamers

    PubMed Central

    McKeague, Maureen; Bradley, Charlotte R.; De Girolamo, Annalisa; Visconti, Angelo; Miller, J. David; DeRosa, Maria C.

    2010-01-01

    Fumonisins are mycotoxins produced by Fusarium verticillioides and F. proliferatum, fungi that are ubiquitous in corn (maize). Insect damage and some other environmental conditions result in the accumulation of fumonisins in corn-based products worldwide. Current methods of fumonisin detection rely on the use of immunoaffinity columns and high-performance liquid chromatography (HPLC). The use of aptamers offers a good alternative to the use of antibodies in fumonisin cleanup and detection due to lower costs and improved stability. Aptamers are single-stranded oligonucleotides that are selected using Systematic Evolution of Ligands by EXponential enrichment (SELEX) for their ability to bind to targets with high affinity and specificity. Sequences obtained after 18 rounds of SELEX were screened for their ability to bind to fumonisin B1. Six unique sequences were obtained, each showing improved binding to fumonisin B1 compared to controls. Sequence FB1 39 binds to fumonisin with a dissociation constant of 100 ± 30 nM and shows potential for use in fumonisin biosensors and solid phase extraction columns. PMID:21614178

  14. Harnessing Aptamers to Overcome Challenges in Gluten Detection.

    PubMed

    Miranda-Castro, Rebeca; de-los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

    2016-04-20

    Celiac disease is a lifelong autoimmune disorder triggered by foods containing gluten, the storage protein in wheat, rye, and barley. The rapidly escalating number of patients diagnosed with this disease poses a great challenge to both food industry and authorities to guarantee food safety for all. Therefore, intensive efforts are being made to establish minimal disease-eliciting doses of gluten and consequently to improve gluten-free labeling. These efforts depend to a high degree on the availability of methods capable of detecting the protein in food samples at levels as low as possible. Current analytical approaches rely on the use of antibodies as selective recognition elements. With limited sensitivity, these methods exhibit some deficiencies that compromise the accuracy of the obtained results. Aptamers provide an ideal alternative for designing biosensors for fast and selective measurement of gluten in foods. This article highlights the challenges in gluten detection, the current status of the use of aptamers for solving this problem, and what remains to be done to move these systems into commercial applications.

  15. Smooth Muscle Cell–targeted RNA Aptamer Inhibits Neointimal Formation

    PubMed Central

    Thiel, William H; Esposito, Carla L; Dickey, David D; Dassie, Justin P; Long, Matthew E; Adam, Joshua; Streeter, Jennifer; Schickling, Brandon; Takapoo, Maysam; Flenker, Katie S; Klesney-Tait, Julia; Franciscis, Vittorio de; Miller, Francis J; Giangrande, Paloma H

    2016-01-01

    Inhibition of vascular smooth muscle cell (VSMC) proliferation by drug eluting stents has markedly reduced intimal hyperplasia and subsequent in-stent restenosis. However, the effects of antiproliferative drugs on endothelial cells (EC) contribute to delayed re-endothelialization and late stent thrombosis. Cell-targeted therapies to inhibit VSMC remodeling while maintaining EC health are necessary to allow vascular healing while preventing restenosis. We describe an RNA aptamer (Apt 14) that functions as a smart drug by preferentially targeting VSMCs as compared to ECs and other myocytes. Furthermore, Apt 14 inhibits phosphatidylinositol 3-kinase/protein kinase-B (PI3K/Akt) and VSMC migration in response to multiple agonists by a mechanism that involves inhibition of platelet-derived growth factor receptor (PDGFR)-β phosphorylation. In a murine model of carotid injury, treatment of vessels with Apt 14 reduces neointimal formation to levels similar to those observed with paclitaxel. Importantly, we confirm that Apt 14 cross-reacts with rodent and human VSMCs, exhibits a half-life of ~300 hours in human serum, and does not elicit immune activation of human peripheral blood mononuclear cells. We describe a VSMC-targeted RNA aptamer that blocks cell migration and inhibits intimal formation. These findings provide the foundation for the translation of cell-targeted RNA therapeutics to vascular disease. PMID:26732878

  16. Harnessing Aptamers to Overcome Challenges in Gluten Detection

    PubMed Central

    Miranda-Castro, Rebeca; de-los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J.; Lobo-Castañón, María Jesús

    2016-01-01

    Celiac disease is a lifelong autoimmune disorder triggered by foods containing gluten, the storage protein in wheat, rye, and barley. The rapidly escalating number of patients diagnosed with this disease poses a great challenge to both food industry and authorities to guarantee food safety for all. Therefore, intensive efforts are being made to establish minimal disease-eliciting doses of gluten and consequently to improve gluten-free labeling. These efforts depend to a high degree on the availability of methods capable of detecting the protein in food samples at levels as low as possible. Current analytical approaches rely on the use of antibodies as selective recognition elements. With limited sensitivity, these methods exhibit some deficiencies that compromise the accuracy of the obtained results. Aptamers provide an ideal alternative for designing biosensors for fast and selective measurement of gluten in foods. This article highlights the challenges in gluten detection, the current status of the use of aptamers for solving this problem, and what remains to be done to move these systems into commercial applications. PMID:27104578

  17. Electrochemical Impedance Spectroscopic Sensing of Methamphetamine by a Specific Aptamer

    PubMed Central

    Ebrahimi, Mohsen; Johari-Ahar, Mohammad; Hamzeiy, Hossein; Barar, Jaleh; Mashinchian, Omid; Omidi, Yadollah

    2012-01-01

    Introduction Electrochemical impedance spectroscopy (EIS) is a simple and highly sensitive technique that can be used for evaluation of the aptamer-target interaction even in a label-free approach. Methods To pursue the effectiveness of EIS, in the current study, the folding properties of specific aptamer for methamphetamine (METH) (i.e., aptaMETH) were evaluated in the presence of METH and amphetamine (Amph). Folded and unfolded aptaMETH was mounted on the gold electrode surface and the electron charge transfer was measured by EIS. Results The Ret of methamphetamine-aptaMETH was significantly increased in comparison with other folding conditions, indicating specific detection of METH by aptaMETH. Conclusion Based on these findings, methamphetamine-aptaMETH on the gold electrode surface displayed the most interfacial electrode resistance and thus the most folding situation. This clearly indicates that the aptaMETH can profoundly and specifically pinpoint METH; as a result we suggest utilization of this methodology for fast and cost-effective identification of METH. PMID:23678446

  18. Development of an aptamer-conjugated fluorescent nanoprobe for MMP2

    NASA Astrophysics Data System (ADS)

    Han, Myoung-Eun; Baek, Sungmin; Kim, Hyun-Jung; Lee, Jung Hwan; Ryu, Sung-Ho; Oh, Sae-Ock

    2014-03-01

    Matrix metalloproteinase 2 (MMP2) plays critical roles in various diseases, such as atherosclerosis and cancer, and has been suggested to contribute to the instability of atherosclerotic plaque. To visualize MMP2 in pathologic tissues, we developed an aptamer targeting MMP2 protein by performing eight rounds of modified DNA systematic evolution of ligands by exponential enrichment (SELEX). The aptamer showed high affinity for MMP2 ( K d = 5.59 nM), precipitated MMP2, and detected MMP2 protein in pathological tissues such as atherosclerotic plaque and gastric cancer tissues. Furthermore, a MMP2 aptamer-conjugated fluorescent nanoprobe successfully visualized atherosclerotic plaques in apolipoprotein E (ApoE) knockout mice. These results suggest that the devised MMP2 aptamer could be useful for the development of various diagnostic tools.

  19. Catch-and-Release of Target Cells Using Aptamer-Conjugated Electroactive Zwitterionic Oligopeptide SAM

    PubMed Central

    Enomoto, Junko; Kageyama, Tatsuto; Osaki, Tatsuya; Bonalumi, Flavia; Marchese, Francesca; Gautieri, Alfonso; Bianchi, Elena; Dubini, Gabriele; Arrigoni, Chiara; Moretti, Matteo; Fukuda, Junji

    2017-01-01

    Nucleic acid aptamers possess attractive features such as specific molecular recognition, high-affinity binding, and rapid acquisition and replication, which could be feasible components for separating specific cells from other cell types. This study demonstrates that aptamers conjugated to an oligopeptide self-assembled monolayer (SAM) can be used to selectively trap human hepatic cancer cells from cell mixtures containing normal human hepatocytes or human fibroblasts. Molecular dynamics calculations have been performed to understand how the configurations of the aptamers are related to the experimental results of selective cell capture. We further demonstrate that the captured hepatic cancer cells can be detached and collected along with electrochemical desorption of the oligopeptide SAM, and by repeating these catch-and-release processes, target cells can be enriched. This combination of capture with aptamers and detachment with electrochemical reactions is a promising tool in various research fields ranging from basic cancer research to tissue engineering applications. PMID:28266533

  20. Aptamers: novel diagnostic and therapeutic tools for diabetes mellitus and metabolic diseases.

    PubMed

    Hu, Jingping; Ye, Mao; Zhou, Zhiguang

    2017-03-01

    Diabetes mellitus is one of the most common chronic diseases that threatens human health in worldwide populations. Despite enormous efforts invested in the study of diabetes mellitus, the development of precise diagnoses and treatments for this disease remains difficult due to the limitations of current techniques. Therefore, new methods are currently being developed. Aptamers are oligonucleotides that bind to specific target molecules and have been widely applied as diagnostic and therapeutic tools. In recent years, aptamers have been utilized in the study of diabetes mellitus and metabolic diseases. In this review, we highlight recent developments and new perspectives on aptamers in the field of diabetes mellitus and other metabolic diseases. Aptamers could potentially provide the means for efficient diagnoses and therapies against diabetes mellitus.

  1. Efficient isolation and elution of cellular proteins using aptamer-mediated protein precipitation assay.

    PubMed

    Kim, Kiseok; Lee, SeungJin; Ryu, Sungho; Han, Dongil

    2014-05-23

    Protein precipitation is one of the most widely used methods for antigen detection and purification in biological research. We developed a reproducible aptamer-mediated magnetic protein precipitation method that is able to efficiently capture, purify and isolate the target proteins. We discovered DNA aptamers having individually high affinity and specificity against human epidermal growth factor receptor (EGFR) and human insulin receptor (INSR). Using aptamers and magnetic beads, we showed it is highly efficient technique to enrich endogenous proteins complex and is applicable to identify physiologically relevant protein-protein interactions with minimized nonspecific binding of proteins. The results presented here indicate that aptamers would be applicable as a useful and cost-effective tool to identify the presence of the particular target protein with their specific protein partners.

  2. Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers

    PubMed Central

    Pica, Andrea; Russo Krauss, Irene; Parente, Valeria; Tateishi-Karimata, Hisae; Nagatoishi, Satoru; Tsumoto, Kouhei; Sugimoto, Naoki; Sica, Filomena

    2017-01-01

    Aptamers directed against human thrombin can selectively bind to two different exosites on the protein surface. The simultaneous use of two DNA aptamers, HD1 and HD22, directed to exosite I and exosite II respectively, is a very powerful approach to exploit their combined affinity. Indeed, strategies to link HD1 and HD22 together have been proposed in order to create a single bivalent molecule with an enhanced ability to control thrombin activity. In this work, the crystal structures of two ternary complexes, in which thrombin is sandwiched between two DNA aptamers, are presented and discussed. The structures shed light on the cross talk between the two exosites. The through-bond effects are particularly evident at exosite II, with net consequences on the HD22 structure. Moreover, thermodynamic data on the binding of the two aptamers are also reported and analyzed. PMID:27899589

  3. Rational design of a structure-switching DNA aptamer for potassium ions

    PubMed Central

    Catherine, Andrew T.; Shishido, Stephanie N.; Robbins-Welty, Gregg A.; Diegelman-Parente, Amy

    2014-01-01

    Structure-switching molecules provide a unique means for analyte detection, generating a response to analyte concentration through a binding-specific conformational change between non-binding and binding-competent states. While most ligand-binding molecules are not structure switching by default, many can be engineered to be so through the introduction of an alternative non-binding (and thus non-signalling) conformation. This population-shift mechanism is particularly effective with oligonucleotides and has led to the creation of structure-switching aptamers for many target ligands. Here, we report the rational design of structure-switching DNA aptamers, based on the thrombin binding aptamer (TBA), that bind potassium with affinities that bridge the gap between previously reported weak-binding and strong-binding aptamers. We also demonstrate a correlation between the free energy of the experimentally determined binding affinity for potassium and the computationally estimated free energy of the alternative (non-binding) structure. PMID:25352996

  4. Thermodynamics and kinetics of adaptive binding in the malachite green RNA aptamer.

    PubMed

    Da Costa, Jason B; Andreiev, Aurelia I; Dieckmann, Thorsten

    2013-09-24

    Adaptive binding, the ability of molecules to fold themselves around the structure of a ligand and thereby incorporating it into their three-dimensional fold, is a key feature of most RNA aptamers. The malachite green aptamer (MGA) has been shown to bind several closely related triphenyl dyes with planar and nonplanar structures in this manner. Competitive binding studies using isothermal titration calorimetry and stopped flow kinetics have been conducted with the aim of understanding the adaptive nature of RNA-ligand interaction. The results of these studies reveal that binding of one ligand can reduce the ability of the aptamer pocket to adapt to another ligand, even if this second ligand has a significantly higher affinity to the free aptamer. A similar effect is observed in the presence of Mg(2+) ions which stabilize the binding pocket in a more ligand bound-like conformation.

  5. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    PubMed Central

    Hong, Ka Lok; Sooter, Letha J.

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  6. Catch-and-Release of Target Cells Using Aptamer-Conjugated Electroactive Zwitterionic Oligopeptide SAM.

    PubMed

    Enomoto, Junko; Kageyama, Tatsuto; Osaki, Tatsuya; Bonalumi, Flavia; Marchese, Francesca; Gautieri, Alfonso; Bianchi, Elena; Dubini, Gabriele; Arrigoni, Chiara; Moretti, Matteo; Fukuda, Junji

    2017-03-07

    Nucleic acid aptamers possess attractive features such as specific molecular recognition, high-affinity binding, and rapid acquisition and replication, which could be feasible components for separating specific cells from other cell types. This study demonstrates that aptamers conjugated to an oligopeptide self-assembled monolayer (SAM) can be used to selectively trap human hepatic cancer cells from cell mixtures containing normal human hepatocytes or human fibroblasts. Molecular dynamics calculations have been performed to understand how the configurations of the aptamers are related to the experimental results of selective cell capture. We further demonstrate that the captured hepatic cancer cells can be detached and collected along with electrochemical desorption of the oligopeptide SAM, and by repeating these catch-and-release processes, target cells can be enriched. This combination of capture with aptamers and detachment with electrochemical reactions is a promising tool in various research fields ranging from basic cancer research to tissue engineering applications.

  7. High efficiency binding aptamers for a wide range of sepsis bacterial agents.

    PubMed

    Graziani, Ana Cláudia; Stets, Maria Isabel; Lopes, Ana Luisa Kalb; Schluga, Pedro Henrique Caires; Marton, Soledad; Mendes, Ieda Ferreira; Andrade, Antero Silva Ribeiro de; Krieger, Marco Aurélio; Cardoso, Josiane

    2017-01-24

    Sepsis is a major health problem worldwide, with an extremely high rate of morbidity and mortality, partly due to delayed diagnosis during early disease. Currently, sepsis diagnosis requires bacterial culturing of blood samples over several days, while PCR-based molecular diagnosis methods are faster, but lack sensitivity. The use of biosensors containing nucleic acid aptamers that bind targets with high affinity and specificity could accelerate sepsis diagnosis. Previously, we used Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to develop the aptamers Antibac1 and Antibac2, targeting the ubiquitous bacterial peptidoglycan. Here, we show that these aptamers bind to four Gram-positive and seven Gram-negative bacterial sepsis agents with high binding efficiency. Thus, these aptamers could be used in combination as biological recognition elements in the development of biosensors that are an alternative to rapid bacteria detection, since they could provide culture and amplification-free tests for rapid clinical sepsis diagnosis.

  8. Through-bond effects in the ternary complexes of thrombin sandwiched by two DNA aptamers.

    PubMed

    Pica, Andrea; Russo Krauss, Irene; Parente, Valeria; Tateishi-Karimata, Hisae; Nagatoishi, Satoru; Tsumoto, Kouhei; Sugimoto, Naoki; Sica, Filomena

    2017-01-09

    Aptamers directed against human thrombin can selectively bind to two different exosites on the protein surface. The simultaneous use of two DNA aptamers, HD1 and HD22, directed to exosite I and exosite II respectively, is a very powerful approach to exploit their combined affinity. Indeed, strategies to link HD1 and HD22 together have been proposed in order to create a single bivalent molecule with an enhanced ability to control thrombin activity. In this work, the crystal structures of two ternary complexes, in which thrombin is sandwiched between two DNA aptamers, are presented and discussed. The structures shed light on the cross talk between the two exosites. The through-bond effects are particularly evident at exosite II, with net consequences on the HD22 structure. Moreover, thermodynamic data on the binding of the two aptamers are also reported and analyzed.

  9. The application of a modified nucleotide in aptamer selection: novel thrombin aptamers containing 5-(1-pentynyl)-2'-deoxyuridine.

    PubMed Central

    Latham, J A; Johnson, R; Toole, J J

    1994-01-01

    Combinatorial libraries of nucleic acids are developing into novel sources for lead compounds in drug development. In order to diversify the pool of ss DNA sequences, we have used a modified nucleotide, 5-(1-pentynyl)-2'-deoxyuridine, in place of thymidine in a random nucleic acid library and screened this library against human thrombin. Previously, we described this screening method to identify a novel structural inhibitor (an aptamer) of the coagulation protease thrombin (Bock, L. et. al. (1992) Nature 355 564-566). Using the modified nucleic acid library, we have now isolated a second pool of thrombin inhibitors with strikingly different sequence composition compared to the selection using natural bases. This second class of aptamers is dependent on the presence of the modified nucleotide for protein binding and clotting inhibition. Our method represents a potential strategy to enhance the diversity of libraries for in vitro selection, and thereby increasing the utility of this technique in the identification of molecules with novel biochemical properties. Images PMID:7519769

  10. Synthesis, characterization and in vitro activity of thrombin-binding DNA aptamers with triazole internucleotide linkages.

    PubMed

    Varizhuk, Anna M; Tsvetkov, Vladimir B; Tatarinova, Olga N; Kaluzhny, Dmitry N; Florentiev, Vladimir L; Timofeev, Edward N; Shchyolkina, Anna K; Borisova, Olga F; Smirnov, Igor P; Grokhovsky, Sergei L; Aseychev, Anton V; Pozmogova, Galina E

    2013-09-01

    A series of DNA aptamers bearing triazole internucleotide linkages that bind to thrombin was synthesized. The novel aptamers are structurally analogous to the well-known thrombin-inhibiting G-quadruplexes TBA15 and TBA31. The secondary structure stability, binding affinity for thrombin and anticoagulant effects of the triazole-modified aptamers were measured. A modification in the central loop of the aptamer quadruplex resulted in increased nuclease resistance and an inhibition efficiency similar to that of TBA15. The likely aptamer-thrombin binding mode was determined by molecular dynamics simulations. Due to their relatively high activity and the increased resistance to nuclease digestion imparted by the triazole internucleotide linkages, the novel aptamers are a promising alternative to known DNA-based anticoagulant agents.

  11. Comparison of the ‘Chemical’ and ‘Structural’ Approaches to the Optimization of the Thrombin-Binding Aptamer

    PubMed Central

    Tatarinova, Olga; Tsvetkov, Vladimir; Basmanov, Dmitry; Barinov, Nikolay; Smirnov, Igor; Timofeev, Edward; Kaluzhny, Dmitry; Chuvilin, Andrey; Klinov, Dmitry; Varizhuk, Anna; Pozmogova, Galina

    2014-01-01

    Noncanonically structured DNA aptamers to thrombin were examined. Two different approaches were used to improve stability, binding affinity and biological activity of a known thrombin-binding aptamer. These approaches are chemical modification and the addition of a duplex module to the aptamer core structure. Several chemically modified aptamers and the duplex-bearing ones were all studied under the same conditions by a set of widely known and some relatively new methods. A number of the thrombin-binding aptamer analogs have demonstrated improved characteristics. Most importantly, the study allowed us to compare directly the two approaches to aptamer optimization and to analyze their relative advantages and disadvantages as well as their potential in drug design and fundamental studies. PMID:24586736

  12. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

    PubMed Central

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.

    2016-01-01

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622

  13. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly.

    PubMed

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S L; Cheung, Yee-Wai; Kinghorn, Andrew B; Dirkzwager, Roderick M; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A; Heddle, Jonathan G

    2016-02-19

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology.

  14. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies.

    PubMed

    Lipi, Farhana; Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N

    2016-12-01

    Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries.

  15. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies

    PubMed Central

    Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N.

    2016-01-01

    ABSTRACT Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries. PMID:27715478

  16. FRET-Aptamer Assays for Bone Marker Assessment, C-Telopeptide, Creatinine, and Vitamin D

    NASA Technical Reports Server (NTRS)

    Bruno, John G.

    2013-01-01

    Astronauts lose 1.0 to 1.5% of their bone mass per month on long-duration spaceflights. NASA wishes to monitor the bone loss onboard spacecraft to develop nutritional and exercise countermeasures, and make adjustments during long space missions. On Earth, the same technology could be used to monitor osteoporosis and its therapy. Aptamers bind to targets against which they are developed, much like antibodies. However, aptamers do not require animal hosts or cell culture and are therefore easier, faster, and less expensive to produce. In addition, aptamers sometimes exhibit greater affinity and specificity vs. comparable antibodies. In this work, fluorescent dyes and quenchers were added to the aptamers to enable pushbutton, one-step, bind-and-detect fluorescence resonance energy transfer (FRET) assays or tests that can be freeze-dried, rehydrated with body fluids, and used to quantitate bone loss of vitamin D levels with a handheld fluorometer in the spacecraft environment. This work generated specific, rapid, one-step FRET assays for the bone loss marker C-telopeptide (CTx) when extracted from urine, creatinine from urine, and vitamin D congeners in diluted serum. The assays were quantified in nanograms/mL using a handheld fluorometer connected to a laptop computer to convert the raw fluorescence values into concentrations of each analyte according to linear standard curves. DNA aptamers were selected and amplified for several rounds against a 26- amino acid form of CTx, creatinine, and vitamin D. The commonalities between loop structures were studied, and several common loop structures were converted into aptamer beacons with a fluorophore and quencher on each end. In theory, when the aptamer beacon binds its cognate target (CTx bone peptide, creatinine, or vitamin D), it is forced open and no longer quenched, so it gives off fluorescent light (when excited) in proportion to the amount of target present in a sample. This proportional increase in fluorescence is

  17. Aptamers generated from cell-SELEX for molecular medicine: a chemical biology approach.

    PubMed

    Fang, Xiaohong; Tan, Weihong

    2010-01-19

    Molecular medicine is an emerging field focused on understanding the molecular basis of diseases and translating this information into strategies for diagnosis and therapy. This approach could lead to personalized medical treatments. Currently, our ability to understand human diseases at the molecular level is limited by the lack of molecular tools to identify and characterize the distinct molecular features of the disease state, especially for diseases such as cancer. Among the new tools being developed by researchers including chemists, engineers, and other scientists is a new class of nucleic acid probes called aptamers, which are ssDNA/RNA molecules selected to target a wide range of molecules and even cells. In this Account, we will focus on the use of aptamers, generated from cell-based selections, as a novel molecular tool for cancer research. Cancers originate from mutations of human genes. These genetic alterations result in molecular changes to diseased cells, which, in turn, lead to changes in cell morphology and physiology. For decades, clinicians have diagnosed cancers primarily based on the morphology of tumor cells or tissues. However, this method does not always give an accurate diagnosis and does not allow clinicians to effectively assess the complex molecular alterations that are predictive of cancer progression. As genomics and proteomics do not yet allow a full access to this molecular knowledge, aptamer probes represent one effective and practical avenue toward this goal. One special feature of aptamers is that we can isolate them by selection against cancer cells without prior knowledge of the number and arrangement of proteins on the cellular surface. These probes can identify molecular differences between normal and tumor cells and can discriminate among tumor cells of different classifications, at different disease stages, or from different patients. This Account summarizes our recent efforts to develop aptamers through cell-SELEX for the

  18. Detection of human immunodeficiency virus type 1 (HIV-1) Tat protein by aptamer-based biosensors

    NASA Astrophysics Data System (ADS)

    Hashim, Uda; Fatin, M. F.; Ruslinda, A. R.; Gopinath, Subash C. B.; Uda, M. N. A.

    2017-03-01

    A study was conducted to detect the human immunodeficiency virus (HIV-1) Tat protein using interdigitated electrodes. The measurements and images of the IDEs' finger gaps and the images of chitosan-carbon nanotubes deposited on top of the interdigitated electrodes were taken using the Scanning Electron Microscope. The detection of HIV-1 Tat protein was done using split aptamers and aptamer tail. Biosensors were chosen as diagnostic equipment due to their rapid diagnostic capabilities.

  19. Nucleic Acid Aptamers: An Emerging Tool for Biotechnology and Biomedical Sensing

    PubMed Central

    Ku, Ti-Hsuan; Zhang, Tiantian; Luo, Hua; Yen, Tony M.; Chen, Ping-Wei; Han, Yuanyuan; Lo, Yu-Hwa

    2015-01-01

    Detection of small molecules or proteins of living cells provides an exceptional opportunity to study genetic variations and functions, cellular behaviors, and various diseases including cancer and microbial infections. Our aim in this review is to give an overview of selected research activities related to nucleic acid-based aptamer techniques that have been reported in the past two decades. Limitations of aptamers and possible approaches to overcome these limitations are also discussed. PMID:26153774

  20. Selective Fluorogenic Sensing of As(III) Using Aptamer-Capped Nanomaterials.

    PubMed

    Oroval, Mar; Coll, Carmen; Bernardos, Andrea; Marcos, María D; Martínez-Máñez, Ramón; Shchukin, Dmitry G; Sancenón, Félix

    2017-04-05

    Organic-inorganic hybrid nanomaterials offer extremely valuable tools for monitoring many types of analytes in solution. Within this framework, aptamer-based nanomaterials for heavy metal detection are still very scarce. Herein, a novel sensing nanoprobe for the selective and sensitive detection of As(III) based on the combination of aptamers with mesoporous silica nanoparticles has been developed. The efficiency of the sensor is demonstrated in environmental conditions, showing a great potential in As(III) monitoring assays.

  1. A modular tyrosine kinase deoxyribozyme with discrete aptamer and catalyst domains.

    PubMed

    Dokukin, Victor; Silverman, Scott K

    2014-08-25

    We assess the utility of integrating a predetermined aptamer DNA module adjacent to a random catalytic DNA region for identifying new deoxyribozymes by in vitro selection. By placing a known ATP aptamer next to an N40 random region, an explicitly modular DNA catalyst for tyrosine side chain phosphorylation is identified. The results have implications for broader identification of deoxyribozymes that function with small-molecule substrates.

  2. In vitro selection of a peptide aptamer that changes fluorescence in response to verotoxin.

    PubMed

    Manandhar, Yasodha; Bahadur, K C Tara; Wang, Wei; Uzawa, Takanori; Aigaki, Toshiro; Ito, Yoshihiro

    2015-03-01

    A peptide aptamer that changes fluorescence upon binding to verotoxin was selected in vitro using ribosome display with a tRNA carrying an environment-sensitive fluorescent probe. The aptamer specifically bound to verotoxin with a dissociation constant (K d) of 3.94 ± 1.6 µM, and the fluorescence decreased by 78% as the verotoxin concentration was increased. The selected peptide can be used for detection of verotoxin.

  3. Aptamer conjugated paclitaxel and magnetic fluid loaded fluorescently tagged PLGA nanoparticles for targeted cancer therapy

    NASA Astrophysics Data System (ADS)

    Aravind, Athulya; Nair, Remya; Raveendran, Sreejith; Veeranarayanan, Srivani; Nagaoka, Yutaka; Fukuda, Takahiro; Hasumura, Takahashi; Morimoto, Hisao; Yoshida, Yasuhiko; Maekawa, Toru; Sakthi Kumar, D.

    2013-10-01

    Controlled and targeted drug delivery is an essential criterion in cancer therapy to reduce the side effects caused by non-specific drug release and toxicity. Targeted chemotherapy, sustained drug release and optical imaging have been achieved using a multifunctional nanocarrier constructed from poly (D, L-lactide-co-glycolide) nanoparticles (PLGA NPs), an anticancer drug paclitaxel (PTX), a fluorescent dye Nile red (NR), magnetic fluid (MF) and aptamers (Apt, AS1411, anti-nucleolin aptamer). The magnetic fluid and paclitaxel loaded fluorescently labeled PLGA NPs (MF-PTX-NR-PLGA NPs) were synthesized by a single-emulsion technique/solvent evaporation method using a chemical cross linker bis (sulfosuccinimidyl) suberate (BS3) to enable binding of aptamer on to the surface of the nanoparticles. Targeting aptamers were then introduced to the particles through the reaction with the cross linker to target the nucleolin receptors over expressed on the cancer cell surface. Specific binding and uptake of the aptamer conjugated magnetic fluid loaded fluorescently tagged PLGA NPs (Apt-MF-NR-PLGA NPs) to the target cancer cells induced by aptamers was observed using confocal microscopy. Cytotoxicity assay conducted in two cell lines (L929 and MCF-7) confirmed that targeted MCF-7 cancer cells were killed while control cells were unharmed. In addition, aptamer mediated delivery resulting in enhanced binding and uptake to the target cancer cells exhibited increased therapeutic effect of the drug. Moreover, these aptamer conjugated magnetic polymer vehicles apart from actively transporting drugs into specifically targeted tumor regions can also be used to induce hyperthermia or for facilitating magnetic guiding of particles to the tumor regions.

  4. Targeted delivery of doxorubicin to breast cancer cells by aptamer functionalized DOTAP/DOPE liposomes.

    PubMed

    Song, Xingli; Ren, Yi; Zhang, Jing; Wang, Gang; Han, Xuedong; Zheng, Wei; Zhen, Linlin

    2015-10-01

    Doxorubicin is used to treat numerous types of tumors including breast cancer, yet dose-associated toxicities limit its clinical application. Here, we demonstrated a novel strategy by which to deliver doxorubicin to breast cancer cells by conjugating cancer cell-specific single-strand DNA aptamers with doxorubicin-encapsulated DOTAP:DOPE nanoparticles (NPs). We utilizing a whole-cell-SELEX strategy, and 4T1 cells with high invasive and metastatic potential were used as target cells, while non-invasive and non-metastatic 67NR cells were used as subtractive cells. Ten potential aptamers were generated after multi-pool selection. Studies on the selected aptamers revealed that SRZ1 had the highest and specific binding affinity to 4T1 cells. Then we developed SRZ1 aptamer-carried DOTAP:DOPE-DOX NPs. In vitro uptake results which were conducted by FACS indicated that the aptamer significantly promoted the uptake efficiency of DOTAP:DOPE-DOX NPs by 4T1 cells. ATPlite assay was performed to test 4T1, 67NR and NMuMG cell viability after treatment with free doxorubicin, DOTAP:DOPE-DOX particles and aptamer‑loaded DOTAP:DOPE-DOX particles. As expected, the aptamers effectively enhanced accumulation of doxorubicin in the 4T1 tumor tissues as determined by in vivo mouse body images and biodistribution analysis. Consistent with the in vitro findings, aptamer-conjugated doxorubicin-loaded DOTAP:DOPE particles markedly suppressed tumor growth and significantly increased the survival rate of 4T1 tumor-bearing mice. These studies demonstrated that aptamer SRZ1 could be a promising molecule for chemotherapeutic drug targeting deliver.

  5. Highly sensitive detection of 25-HydroxyvitaminD3 by using a target-induced displacement of aptamer.

    PubMed

    Lee, Bang Hyun; Nguyen, Van Thuan; Gu, Man Bock

    2017-02-15

    For the prevention of 25-HydroxyvitaminD3 deficiency, in this study, aptamers which can bind to 25-HydroxyvitaminD3 with high specificity and affinity, were successfully developed by using immobilization-free, graphene oxide-based systemic evolution of ligands by exponential enrichment (GO-SELEX) method. The 9 sequences including VDBA14 aptamer were obtained out of 16 aptamer candidates, based on the specificity and affinity of the aptamers confirmed by both the gold nanoparticles (AuNPs)-based colorimetric assay and the isothermal titration calorimetry (ITC) method. Among them, the aptamer, VDBA14, developed in this study was found to show a great affinity to 25-HydroxyvitaminD3, with 11nM of its Kd value. Moreover, the circular dichroism (CD) analysis data indicated the target-induced displacement of the aptamer VDBA14clearly. In addition, this target-induced change of the aptamer was also confirmed again by conducting two different experimental formats, the use of streptavidin-coated 96-well plates and the use of magnetic beads. The results clearly indicated that the structure of VDBA14 aptamer was changed upon the binding of the target, 25-HydroxyvitaminD3, and so the indicator sequences (partially complementary to the aptamer sequence) tagged with an enzyme as a signaling molecule could be de-hybridized from the aptamer. Finally, the limit of detection for vitamin D based on AuNPs-based colorimetric assay using VDBA14 aptamer was found to be 1µM. All these results were taken together, the aptamer which was developed could play an exquisite role in the fields of early medical diagnosis of vitamin D deficiency with accurate, rapid and simple analytical method.

  6. Detection of lead (II) with a "turn-on" fluorescent biosensor based on energy transfer from CdSe/ZnS quantum dots to graphene oxide.

    PubMed

    Li, Ming; Zhou, Xuejiao; Guo, Shouwu; Wu, Nianqiang

    2013-05-15

    Graphene oxide (GO) sheets are mixed with the aptamer-functionalized CdSe/ZnS quantum dots (QDs). Consequently, the aptamer-conjugated QDs bind to the GO sheets to form a GO/aptamer-QD ensemble, which enables the energy transfer from the QDs to the GO sheets, quenching the fluorescence of QDs. The GO/aptamer-QD ensemble assay acts as a "turn-on" fluorescent sensor for Pb(2+) detection. When Pb(2+) ions are present in the assay, the interaction of Pb(2+) with the aptamer induces a conformational change in the aptamer, leading to the formation of a G-quadruplex/Pb(2+) complex. As a result, the QDs that are linked to the G-quadruplex/Pb(2+) complex are detached from the GO sheet, which "turns on" the fluorescence of the QDs. This sensor exhibits a limit of detection of 90pM and excellent selectivity toward Pb(2+) over a wide range of metal ions. The experiments have provided direct evidence that the fluorescence of QDs is quenched by GO via the nano-metal surface energy transfer (NSET) mechanism rather than the conventional Förster resonance energy transfer (FRET) process.

  7. Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis

    SciTech Connect

    Chen, Fan; Zhou, Jing; Luo, Fengling; Mohammed, Al-Bayati; Zhang, Xiao-Lian . E-mail: zxl_65@163.com

    2007-06-08

    Worldwide, tuberculosis (TB) remains the most frequent and important infectious disease causing morbidity and death. One-third of the world's population is infected with Mycobacterium tuberculosis (MTB), the etiologic agent of TB. Because of the global health problems of TB, the development of potent new anti-TB drugs without cross-resistance with known antimycobacterial agents is urgently needed. In this study, we have applied a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process to identify a single aptamer (NK2) that binds to virulent strain M. tuberculosis (H37Rv) with high affinity and specificity. We have found that this aptamer improves CD4{sup +}T cells to produce IFN-{gamma} after binding to H37Rv. The different component between H37Rv and BCG was identified as some membrane protein. Moreover, the survival rates of mice challenged with i.v. H37Rv have been prolonged after treatment with single injection of aptamer NK2. The bacterial numbers were significantly lower in the spleen of mice treated with aptamer NK2. The histopathological examination of lung biopsy specimens showed lesser pulmonary alveolar fusion and swelling in the presence of the aptamer. These results suggest that aptamer NK2 has inhibitory effects on M. tuberculosis and can be used as antimycobacterial agent.

  8. A Microfluidic Love-Wave Biosensing Device for PSA Detection Based on an Aptamer Beacon Probe.

    PubMed

    Zhang, Feng; Li, Shuangming; Cao, Kang; Wang, Pengjuan; Su, Yan; Zhu, Xinhua; Wan, Ying

    2015-06-11

    A label-free and selective aptamer beacon-based Love-wave biosensing device was developed for prostate specific antigen (PSA) detection. The device consists of the following parts: LiTaO3 substrate with SiO2 film as wave guide layer, two set of inter-digital transducers (IDT), gold film for immobilization of the biorecongniton layer and a polydimethylsiloxane (PDMS) microfluidic channels. DNA aptamer, or "artificial antibody", was used as the specific biorecognition probe for PSA capture. Some nucleotides were added to the 3'-end of the aptamer to form a duplex with the 3'-end, turning the aptamer into an aptamer-beacon. Taking advantage of the selective target-induced assembly changes arising from the "aptamer beacon", highly selective and specific detection of PSA was achieved. Furthermore, PDMS microfluidic channels were designed and fabricated to realize automated quantitative sample injection. After optimization of the experimental conditions, the established device showed good performance for PSA detection between 10 ng/mL to 1 μg/mL, with a detection limit of 10 ng/mL. The proposed sensor might be a promising alternative for point of care diagnostics.

  9. An RNA aptamer that interferes with the DNA binding of the HSF transcription activator.

    PubMed

    Zhao, Xiaoching; Shi, Hua; Sevilimedu, Aarti; Liachko, Nicole; Nelson, Hillary C M; Lis, John T

    2006-01-01

    Heat shock factor (HSF) is a conserved and highly potent transcription activator. It is involved in a wide variety of important biological processes including the stress response and specific steps in normal development. Reagents that interfere with HSF function would be useful for both basic studies and practical applications. We selected an RNA aptamer that binds to HSF with high specificity. Deletion analysis defined the minimal binding motif of this aptamer to be two stems and one stem-loop joined by a three-way junction. This RNA aptamer interferes with normal interaction of HSF with its DNA element, which is a key regulatory step for HSF function. The DNA-binding domain plus a flanking linker region on the HSF (DL) is essential for the RNA binding. Additionally, this aptamer inhibits HSF-induced transcription in vitro in the complex milieu of a whole cell extract. In contrast to the previously characterized NF-kappaB aptamer, the HSF aptamer does not simply mimic DNA binding, but rather binds to HSF in a manner distinct from DNA binding to HSF.

  10. Electrochemiluminescence aptasensor for adenosine triphosphate detection using host-guest recognition between metallocyclodextrin complex and aptamer.

    PubMed

    Chen, Hong; Chen, Qiong; Zhao, Yingying; Zhang, Fan; Yang, Fan; Tang, Jie; He, Pingang

    2014-04-01

    A sensitive and label-free electrochemiluminescence (ECL) aptasensor for the detection of adenosine triphosphate (ATP) was successfully designed using host-guest recognition between a metallocyclodextrin complex, i.e., tris(bipyridine)ruthenium(II)-β-cyclodextrin [tris(bpyRu)-β-CD], and an ATP-binding aptamer. In the protocol, the NH2-terminated aptamer was immobilized on a glassy carbon electrode (GCE) by a coupling interaction. After host-guest recognition between tris(bpyRu)-β-CD and aptamer, the tris(bpyRu)-β-CD/aptamer/GCE produced a strong ECL signal as a result of the photoactive properties of tris(bpyRu)-β-CD. However, in the presence of ATP, the ATP/aptamer complex was formed preferentially, which restricted host-guest recognition, and therefore less tris(bpyRu)-β-CD was attached to the GCE surface, resulting in an obvious decrease in the ECL intensity. Under optimal determination conditions, an excellent logarithmic linear relationship between the ECL decrease and ATP concentration was obtained in the range 10.0-0.05 nM, with a detection limit of 0.01 nM at the S/N ratio of 3. The proposed ECL-based ATP aptasensor exhibited high sensitivity and selectivity, without time-consuming signal-labeling procedures, and is considered to be a promising model for detection of aptamer-specific targets.

  11. Screening of DNA aptamer against mouse prion protein by competitive selection.

    PubMed

    Ogasawara, Daisuke; Hasegawa, Hijiri; Kaneko, Kiyotoshi; Sode, Koji; Ikebukuro, Kazunori

    2007-01-01

    Prion disease is a neurodegenerative disorder, in which the normal prion protein (PrP) changes structurally into an abnormal form and accumulates in the brain. There is a great demand for the development of a viable approach to diagnosis and therapy. Not only has the ligand against PrP been used for diagnosis, but it has also become a promising tool for therapy, as an antibody. Aptamers are a novel type of ligand composed of nucleic acids. DNA aptamers in particular have many advantages over antibodies. Therefore, we tried to isolate the DNA aptamer for mouse PrP. We developed a competitive selection method and tried to screen the DNA aptamer with it. In the fourth round of selection, several clones of the aptamer with an affinity to PrP were enriched, and clone 4-9 showed the highest affinity of all. The investigation by aptamer blotting and Western blotting showed that clone 4-9 was specifically able to recognize both alpha-PrP and beta-PrP. Moreover, it was indicated that clone 4-9 could recognize the flexible region of the N-terminal domain of PrP. These characteristics suggest that clone 4-9 might be a useful tool in prion-disease diagnosis and research.

  12. Electrical Stimulus Controlled Binding/Unbinding of Human Thrombin-Aptamer Complex

    PubMed Central

    Gosai, Agnivo; Ma, Xiao; Balasubramanian, Ganesh; Shrotriya, Pranav

    2016-01-01

    The binding/unbinding of the human thrombin and its 15-mer single stranded DNA aptamer, under the application of external stimulus in the form of electrostatic potential/electric field, is investigated by a combination of continuum analysis and atomistic molecular dynamics simulation. In agreement with the experiments that demonstrate the influence of electrostatic potential on the thrombin/aptamer complex, our computations show that the application of positive electric field successfully unbinds the thrombin from the aptamer. Results from umbrella sampling simulations reveal that there is a decrease in the free energy of binding between the thrombin and aptamer in presence of positive electric fields. Hydrogen bonding and non-bonded interaction energies, and hence the free energy of binding, between the thrombin and its aptamer reduce as the applied electric field is shifted from negative to positive values. Our analyses demonstrate that application of electrical stimulus modifies the molecular interactions within the complex and consequently, electrical field can be used to modulate the association between the thrombin and its aptamer. PMID:27874042

  13. Morph-X-Select: Morphology-based tissue aptamer selection for ovarian cancer biomarker discovery

    PubMed Central

    Wang, Hongyu; Li, Xin; Volk, David E.; Lokesh, Ganesh L.-R.; Elizondo-Riojas, Miguel-Angel; Li, Li; Nick, Alpa M.; Sood, Anil K.; Rosenblatt, Kevin P.; Gorenstein, David G.

    2016-01-01

    High affinity aptamer-based biomarker discovery has the advantage of simultaneously discovering an aptamer affinity reagent and its target biomarker protein. Here, we demonstrate a morphology-based tissue aptamer selection method that enables us to use tissue sections from individual patients and identify high-affinity aptamers and their associated target proteins in a systematic and accurate way. We created a combinatorial DNA aptamer library that has been modified with thiophosphate substitutions of the phosphate ester backbone at selected 5′dA positions for enhanced nuclease resistance and targeting. Based on morphological assessment, we used image-directed laser microdissection (LMD) to dissect regions of interest bound with the thioaptamer (TA) library and further identified target proteins for the selected TAs. We have successfully identified and characterized the lead candidate TA, V5, as a vimentin-specific sequence that has shown specific binding to tumor vasculature of human ovarian tissue and human microvascular endothelial cells. This new Morph-X-Select method allows us to select high-affinity aptamers and their associated target proteins in a specific and accurate way, and could be used for personalized biomarker discovery to improve medical decision-making and to facilitate the development of targeted therapies to achieve more favorable outcomes. PMID:27839510

  14. Selection and Characterization of an α6β4 Integrin blocking DNA Aptamer

    PubMed Central

    Berg, Katharina; Lange, Tobias; Mittelberger, Florian; Schumacher, Udo; Hahn, Ulrich

    2016-01-01

    The heterodimeric laminin receptor α6β4 integrin plays a central role in the promotion of tumor cell growth, invasion, and organotropic metastasis. As an overproduction of the integrin is often linked to a poor prognosis, the inhibition of integrin α6β4 binding to laminin is of high therapeutical interest. Here, we report on the combination of a cell-systematic evolution of ligands by exponential enrichment and a bead-based selection resulting in the first aptamer inhibiting the interaction between α6β4 integrin and laminin-332. This Integrin α6β4-specific DNA Aptamer (IDA) inhibits the adhesion of prostate cancer cells (PC-3) to laminin-332 with an IC50 value of 149 nmol/l. The Kd value concerning the aptamer's interaction with PC-3 cells amounts to 137 nmol/l. Further characterization showed specificity to α6 integrins and a half-life in murine blood plasma of 6 hours. Two truncated versions of the aptamer retained their binding capacity, but lost their ability to inhibit the interaction between laminin-332 and PC-3 cells. Confocal laser scanning microscope studies revealed that the aptamer was internalized into PC-3-cells. Therefore, in addition to the adhesion-blocking function of this aptamer, IDA could also be applied for the delivery of siRNA, microRNA or toxins to cancer cells presenting the integrin α6β4. PMID:26978578

  15. An ssDNA library immobilized SELEX technique for selection of an aptamer against ractopamine.

    PubMed

    Duan, Nuo; Gong, Wenhui; Wu, Shijia; Wang, Zhouping

    2017-04-08

    An improved SELEX technique was developed for selecting aptamers against ractopamine (RAC) by immobilizing ssDNA library on the magnetic beads. After sixteen selection rounds, a highly enriched ssDNA pool was sequenced and nine families were grouped according to their homology and secondary structures analysis. One representative aptamer candidate from each family was picked out for binding affinity identification by graphene oxide (GO) adsorption platform. The aptamer RAC-6 was demonstrated as the optimal aptamer with high specificity and dissociation constant (Kd) value of 54.22 ± 8.02 nM. To prove the potential application of aptamer RAC-6 in the quantitative determination of RAC, a fluorescent bioassay with aptamer RAC-6 was developed. The linear range for RAC was from 0.10 ng/mL to 100 ng/mL and the limit of detection was as low as 0.04 ng/mL. Furthermore, the method was validated for the analysis of RAC spiked real samples, and the recoveries were between 82.57% and 104.65%.

  16. APTAMER DELIVERY OF siRNA, RADIOPHARMACEUTICS AND chemotherapy agents IN CANCER.

    PubMed

    de Almeida, Carlos E B; Alves, Lais Nascimento; Paulino, Enrique T; Cabral-Neto, Januário Bispo; Missailidis, Sotiris

    2017-03-31

    Aptamers are oligonucleotide reagents with high affinity and specificity, which among other therapeutic and diagnostic applications have the capability of acting as delivery agents. Thus, aptamers are capable of carrying small molecules, nanoparticles, radiopharmaceuticals or fluorescent agents as well as nucleic acid therapeutics specifically to their target cells. In most cases, the molecules may possess interesting therapeutic properties, but their lack of specificity for a particular cell type, or ability to internalise in such a cell, hinders their clinical development, or cause unwanted side effects. Thus, chemotherapy or radiotherapy agents, famous for their side effects, can be coupled to aptamers for specific delivery. Equally, siRNA have great therapeutic potential and specificity, but one of their shortcomings remain the delivery and internalisation into cells. Various methodologies have been proposed to date, including aptamers, to resolve this problem. Therapeutic or imaging reagents benefit from the adaptability and ease of chemical manipulation of aptamers, their high affinity for the specific marker of a cell type, and their internalisation ability via cell mediated endocytosis. In this review paper, we explore the potential of the aptamers as delivery agents and offer an update on current status and latest advancements.

  17. Use of Aptamers as Diagnostics Tools and Antiviral Agents for Human Viruses

    PubMed Central

    González, Víctor M.; Martín, M. Elena; Fernández, Gerónimo; García-Sacristán, Ana

    2016-01-01

    Appropriate diagnosis is the key factor for treatment of viral diseases. Time is the most important factor in rapidly developing and epidemiologically dangerous diseases, such as influenza, Ebola and SARS. Chronic viral diseases such as HIV-1 or HCV are asymptomatic or oligosymptomatic and the therapeutic success mainly depends on early detection of the infective agent. Over the last years, aptamer technology has been used in a wide range of diagnostic and therapeutic applications and, concretely, several strategies are currently being explored using aptamers against virus proteins. From a diagnostics point of view, aptamers are being designed as a bio-recognition element in diagnostic systems to detect viral proteins either in the blood (serum or plasma) or into infected cells. Another potential use of aptamers is for therapeutics of viral infections, interfering in the interaction between the virus and the host using aptamers targeting host-cell matrix receptors, or attacking the virus intracellularly, targeting proteins implicated in the viral replication cycle. In this paper, we review how aptamers working against viral proteins are discovered, with a focus on recent advances that improve the aptamers’ properties as a real tool for viral infection detection and treatment. PMID:27999271

  18. Large scale analysis of the mutational landscape in HT-SELEX improves aptamer discovery

    PubMed Central

    Hoinka, Jan; Berezhnoy, Alexey; Dao, Phuong; Sauna, Zuben E.; Gilboa, Eli; Przytycka, Teresa M.

    2015-01-01

    High-Throughput (HT) SELEX combines SELEX (Systematic Evolution of Ligands by EXponential Enrichment), a method for aptamer discovery, with massively parallel sequencing technologies. This emerging technology provides data for a global analysis of the selection process and for simultaneous discovery of a large number of candidates but currently lacks dedicated computational approaches for their analysis. To close this gap, we developed novel in-silico methods to analyze HT-SELEX data and utilized them to study the emergence of polymerase errors during HT-SELEX. Rather than considering these errors as a nuisance, we demonstrated their utility for guiding aptamer discovery. Our approach builds on two main advancements in aptamer analysis: AptaMut—a novel technique allowing for the identification of polymerase errors conferring an improved binding affinity relative to the ‘parent’ sequence and AptaCluster—an aptamer clustering algorithm which is to our best knowledge, the only currently available tool capable of efficiently clustering entire aptamer pools. We applied these methods to an HT-SELEX experiment developing aptamers against Interleukin 10 receptor alpha chain (IL-10RA) and experimentally confirmed our predictions thus validating our computational methods. PMID:25870409

  19. Nucleic Acid Aptamers: New Methods for Selection, Stabilization, and Application in Biomedical Science

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2013-01-01

    The adoption of oligonucleotide aptamer is well on the rise, serving an ever increasing demand for versatility in biomedical field. Through the SELEX (Systematic Evolution of Ligands by EXponential enrichment), aptamer that can bind to specific target with high affinity and specificity can be obtained. Aptamers are single-stranded nucleic acid molecules that can fold into complex threedimensional structures, forming binding pockets and clefts for the specific recognition and tight binding of any given molecular target. Recently, aptamers have attracted much attention because they not only have all of the advantages of antibodies, but also have unique merits such as thermal stability, ease of synthesis, reversibility, and little immunogenicity. The advent of novel technologies is revolutionizing aptamer applications. Aptamers can be easily modified by various chemical reactions to introduce functional groups and/or nucleotide extensions. They can also be conjugated to therapeutic molecules such as drugs, drug containing carriers, toxins, or photosensitizers. Here, we discuss new SELEX strategies and stabilization methods as well as applications in drug delivery and molecular imaging. PMID:24404332

  20. Generation and characterization of quinolone-specific DNA aptamers suitable for water monitoring.

    PubMed

    Reinemann, C; Freiin von Fritsch, U; Rudolph, S; Strehlitz, B

    2016-03-15

    Quinolones are antibiotics that are accredited in human and veterinary medicine but are regularly used in high quantities also in industrial livestock farming. Since these compounds are often only incompletely metabolized, significant amounts contaminate the aquatic environment and negatively impact on a variety of different ecosystems. Although there is increasing awareness of problems caused by pharmaceutical pollution, available methods for the detection and elimination of numerous pharmaceutical residues are currently inefficient or expensive. While this also applies to antibiotics that may lead to multi-drug resistance in pathogenic bacteria, aptamer-based technologies potentially offer alternative approaches for sensitive and efficient monitoring of pharmaceutical micropollutants. Using the Capture-SELEX procedure, we here describe the selection of an aptamer pool with enhanced binding qualities for fluoroquinolones, a widely used group of antibiotics in both human and veterinary medicine. The selected aptamers were shown to detect various quinolones with high specificity, while specific binding activities to structurally unrelated drugs were not detectable. The quinolone-specific aptamers bound to ofloxacin, one of the most frequently prescribed fluoroquinolone, with high affinity (KD=0.1-56.9 nM). The functionality of quinolone-specific aptamers in real water samples was demonstrated in local tap water and in effluents of sewage plants. Together, our data suggest that these aptamers may be applicable as molecular receptors in biosensors or as catcher molecules in filter systems for improved monitoring and treatment of polluted water.

  1. Plasmonic aptamer-gold nanoparticle sensors for small molecule fingerprint identification.

    PubMed

    Chávez, Jorge L; Leny, Juliann K; Witt, Suzanne; Slusher, Grant M; Hagen, Joshua A; Kelley-Loughnane, Nancy

    2014-12-07

    The utilization of the plasmonic response of aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design cross-reactive arrays for fingerprint identification of small molecular targets was demonstrated for the first time. Four aptamers with different structural features previously selected to bind different targets were used in combination with AuNPs by adsorbing the DNA on the AuNPs surface. The optimized response of the Apt-AuNPs to the analytes showed that, depending on the specific aptamer used, target binding by the aptamer could result in an increase or decrease of Apt-AuNPs stability. These Apt-AuNPs showed the ability to recognize different analytes with different affinities, generating fingerprints that allowed unambiguous analyte identification with response times in less than fifteen minutes. Importantly, it was observed that it was not necessary to select an aptamer per analyte of interest to generate differentiable signatures, but a subset of aptamers could be used to identify a larger number of analytes. The data was analyzed using principal component analysis, showing efficient clustering of the different datasets for qualitative and quantitative identification. This work opens the door to using these Apt-AuNPs in point of care diagnostics applications where fast sensors with easy to read outputs are needed.

  2. Aptamer-Au NPs conjugates-enhanced SPR sensing for the ultrasensitive sandwich immunoassay.

    PubMed

    Wang, Jianlong; Munir, Ahsan; Li, Zhonghong; Zhou, H Susan

    2009-09-15

    The goal of this work is to explore the amplification effect of aptamer-gold nanoparticles (Au NPs) conjugates for ultrasensitive detection of large biomolecules by surface plasmon resonance (SPR). A novel sandwich immunoassay is designed to demonstrate the amplification effect of aptamer-Au NPs conjugates by using human immunoglobulin E (IgE) as model analyte. Human IgE, captured by immobilized goat anti-human IgE on SPR gold film, is sensitively detected by SPR spectroscopy with a lowest detection limit of 1 ng/ml after anti-human IgE aptamer-Au NPs conjugates is used as amplification reagent. Meanwhile, the non-specific adsorption of aptamer-Au NPs conjugates on goat anti-human IgE is confirmed by SPR spectroscopy and then it is minimized by treating aptamer-Au NPs conjugates with 6-mercaptohexan-1-ol (MCH). These results confirm that aptamer-Au NPs conjugates is a powerful sandwich element and an excellent amplification reagent for SPR-based sandwich immunoassay.

  3. A naturally occurring, noncanonical GTP aptamer made of simple tandem repeats

    PubMed Central

    Curtis, Edward A; Liu, David R

    2014-01-01

    Recently, we used in vitro selection to identify a new class of naturally occurring GTP aptamer called the G motif. Here we report the discovery and characterization of a second class of naturally occurring GTP aptamer, the “CA motif.” The primary sequence of this aptamer is unusual in that it consists entirely of tandem repeats of CA-rich motifs as short as three nucleotides. Several active variants of the CA motif aptamer lack the ability to form consecutive Watson-Crick base pairs in any register, while others consist of repeats containing only cytidine and adenosine residues, indicating that noncanonical interactions play important roles in its structure. The circular dichroism spectrum of the CA motif aptamer is distinct from that of A-form RNA and other major classes of nucleic acid structures. Bioinformatic searches indicate that the CA motif is absent from most archaeal and bacterial genomes, but occurs in at least 70 percent of approximately 400 eukaryotic genomes examined. These searches also uncovered several phylogenetically conserved examples of the CA motif in rodent (mouse and rat) genomes. Together, these results reveal the existence of a second class of naturally occurring GTP aptamer whose sequence requirements, like that of the G motif, are not consistent with those of a canonical secondary structure. They also indicate a new and unexpected potential biochemical activity of certain naturally occurring tandem repeats. PMID:24824832

  4. Electrical Stimulus Controlled Binding/Unbinding of Human Thrombin-Aptamer Complex

    NASA Astrophysics Data System (ADS)

    Gosai, Agnivo; Ma, Xiao; Balasubramanian, Ganesh; Shrotriya, Pranav

    2016-11-01

    The binding/unbinding of the human thrombin and its 15-mer single stranded DNA aptamer, under the application of external stimulus in the form of electrostatic potential/electric field, is investigated by a combination of continuum analysis and atomistic molecular dynamics simulation. In agreement with the experiments that demonstrate the influence of electrostatic potential on the thrombin/aptamer complex, our computations show that the application of positive electric field successfully unbinds the thrombin from the aptamer. Results from umbrella sampling simulations reveal that there is a decrease in the free energy of binding between the thrombin and aptamer in presence of positive electric fields. Hydrogen bonding and non-bonded interaction energies, and hence the free energy of binding, between the thrombin and its aptamer reduce as the applied electric field is shifted from negative to positive values. Our analyses demonstrate that application of electrical stimulus modifies the molecular interactions within the complex and consequently, electrical field can be used to modulate the association between the thrombin and its aptamer.

  5. Screening and Identification of ssDNA Aptamer for Human GP73

    PubMed Central

    Du, Jingchun; Hong, Jianming; Xu, Chun; Cai, Yuanyuan; Xiang, Bo; Zhou, Chengbo; Xu, Xia

    2015-01-01

    As one tumor marker of HCC, Golgi Protein 73 (GP73) is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens. PMID:26583119

  6. Aptamers Selected to Postoperative Lung Adenocarcinoma Detect Circulating Tumor Cells in Human Blood

    PubMed Central

    Zamay, Galina S; Kolovskaya, Olga S; Zamay, Tatiana N; Glazyrin, Yury E; Krat, Alexey V; Zubkova, Olga; Spivak, Ekaterina; Wehbe, Mohammed; Gargaun, Ana; Muharemagic, Darija; Komarova, Mariia; Grigorieva, Valentina; Savchenko, Andrey; Modestov, Andrey A; Berezovski, Maxim V; Zamay, Anna S

    2015-01-01

    Circulating tumor cells (CTCs) are rare cells and valuable clinical markers of prognosis of metastasis formation and prediction of patient survival. Most CTC analyses are based on the antibody-based detection of a few epithelial markers; therefore miss an important portion of mesenchymal cancer cells circulating in blood. In this work, we selected and identified DNA aptamers as specific affinity probes that bind to lung adenocarcinoma cells derived from postoperative tissues. The unique feature of our selection strategy is that aptamers are produced for lung cancer cell biomarkers in their native state and conformation without previous knowledge of the biomarkers. The aptamers did not bind to normal lung cells and lymphocytes, and had very low affinity to A549 lung adenocarcinoma culture. We applied these aptamers to detect CTCs, apoptotic bodies, and microemboli in clinical samples of peripheral blood of lung cancer and metastatic lung cancer patients. We identified aptamer-associated protein biomarkers for lung cancer such as vimentin, annexin A2, annexin A5, histone 2B, neutrophil defensin, and clusterin. Tumor-specific aptamers can be produced for individual patients and synthesized many times during anticancer therapy, thereby opening up the possibility of personalized diagnostics. PMID:26061649

  7. DNA aptamers for selective identification and separation of flame retardant chemicals.

    PubMed

    Kim, Un-Jung; Kim, Byoung Chan

    2016-09-14

    Polybrominated diphenyl ethers (PBDEs) are group of chemicals which are representative persistent organic pollutants (POPs) and used as brominated flame retardants for many consumer products. PBDEs were phased out since 2009 but are still frequently observed in various environmental matrices and human body. Here, we report ssDNA aptamers which bind to BDE47, one of the PBDE congeners commonly found in various environmental matrices, and show affinity to other major tri-to hepta- BDE congeners. The PBDE specific aptamers were isolated from random library of ssDNA using Mag-SELEX. Two out of 15 sequences, based on their alignment and hairpin loop structures, were chosen to determine dissociation constant with BDE47 and showed from picomolar to nanomolar affinities (200 pM and 1.53 nM). The aptamers displayed high selectivity to the original target, BDE47, and implying general specificity to PBDE backbone with varying affinities to other congeners. Further, we showed that the use of two aptamers together could enhance the separation efficiency of BDE47 and other BDE congeners when dissolved in a solvent compared to use of single aptamer. These aptamers are expected to provide a tool for preliminary screening or quick separation of PBDEs in environmental samples prior to trace quantitative analysis.

  8. Recent Progress in Nucleic Acid Aptamer-Based Biosensors and Bioassays

    PubMed Central

    Mok, Wendy; Li, Yingfu

    2008-01-01

    As the key constituents of the genetic code, the importance of nucleic acids to life has long been appreciated. Despite being composed of only four structurally similar nucleotides, single-stranded nucleic acids, as in single-stranded DNAs and RNAs, can fold into distinct three-dimensional shapes due to specific intramolecular interactions and carry out functions beyond serving as templates for protein synthesis. These functional nucleic acids (FNAs) can catalyze chemical reactions, regulate gene expression, and recognize target molecules. Aptamers, whose name is derived from the Latin word aptus meaning “to fit”, are oligonucleotides that can bind their target ligands with high affinity and specificity. Since aptamers exist in nature but can also be artificially isolated from pools of random nucleic acids through a process called in vitro selection, they can potentially bind a diverse array of compounds. In this review, we will discuss the research that is being done to develop aptamers against various biomolecules, the progress in engineering biosensors by coupling aptamers to signal transducers, and the prospect of employing these sensors for a range of chemical and biological applications. Advances in aptamer technology emphasizes that nucleic acids are not only the fundamental molecules of life, they can also serve as research tools to enhance our understanding of life. The possibility of using aptamer-based tools in drug discovery and the identification of infectious agents can ultimately augment our quality of life. PMID:27873915

  9. Selection of LNA-containing DNA aptamers against recombinant human CD73.

    PubMed

    Elle, Ida C; Karlsen, Kasper K; Terp, Mikkel G; Larsen, Niels; Nielsen, Ronni; Derbyshire, Nicola; Mandrup, Susanne; Ditzel, Henrik J; Wengel, Jesper

    2015-05-01

    LNA-containing DNA aptamers against CD73 (human ecto-5'-nucleotidase), a protein frequently overexpressed in solid tumours, were isolated by SELEX. A pre-defined stem-loop library, containing LNA in the forward primer region, was enriched with CD73 binding sequences through six rounds of SELEX with recombinant his-tagged CD73 immobilised on anti-his plates. Enriched pools isolated from rounds one, three and six were subjected to next-generation sequencing and analysed for enrichment using custom bioinformatics software. The software identified aptamer sequences via the primers and then performed several steps including sequence unification, clustering and alignment to identify enriched sequences. Three enriched sequences were synthesised for further analysis, two of which showed sequence similarities. These sequences exhibited binding to the recombinant CD73 with KD values of 10 nM and 3.5 nM when tested by surface plasmon resonance. Truncated variants of these aptamers and variants where the LNA nucleotides were substituted for the DNA equivalent also exhibited affinity for the recombinant CD73 in the low nanomolar range. In enzyme inhibition assays with recombinant CD73 the aptamer sequences were able to decrease the activity of the protein. However, the aptamers exhibited no binding to cellular CD73 by flow cytometry analysis likely since the epitope recognised by the aptamer was not available for binding on the cellular protein.

  10. Screening and Identification of DNA Aptamers to Tyramine Using in Vitro Selection and High-Throughput Sequencing.

    PubMed

    Valenzano, Stefania; De Girolamo, Annalisa; DeRosa, Maria C; McKeague, Maureen; Schena, Roberto; Catucci, Lucia; Pascale, Michelangelo

    2016-06-13

    Aptamers are synthetic single-stranded DNA or RNA sequences that can fold into tertiary structures allowing them to interact with and bind to targets with high affinity and specificity. This paper describes the first selection and identification of DNA aptamers able to recognize the biogenic amine tyramine. To successfully isolate aptamers to this challenging small molecule target, the SELEX methodology was adapted by combining a systematic strategy to increase the selection stringency and monitor enrichment success. As the benefits of applying high-throughput sequencing (HTS) in SELEX experiments is becoming more clear, this method was employed in combination with bioinformatics analysis to evaluate the utility of the selection strategy and to uncover new potential high affinity sequences. On the basis of the presence of consensus regions (sequence families) and family similarities (clusters), 15 putative aptamers to tyramine were identified. A recently described workflow approach to perform a primary screening and characterization of the aptamer candidates by microequilibrium dialysis and by microscale thermophoresis was next leveraged. These candidate aptamers exhibited dissociation constant (Kd) values in the range of 0.2-152 μM with aptamer Tyr_10 as the most promising one followed by aptamer Tyr_14. These aptamers could be used as promising molecular recognition tools for the development of inexpensive, robust and innovative biosensor platforms for the detection of tyramine in food and beverages.

  11. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    PubMed Central

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5′-end also contributes essentially to the aptameric function. PMID:27650576

  12. Aptamer to ErbB-2/HER2 enhances degradation of the target and inhibits tumorigenic growth

    PubMed Central

    Mahlknecht, Georg; Maron, Ruth; Mancini, Maicol; Schechter, Bilha; Sela, Michael; Yarden, Yosef

    2013-01-01

    Aptamers, oligonucleotides able to avidly bind cellular targets, are emerging as promising therapeutic agents, analogous to monoclonal antibodies. We selected from a DNA library an aptamer specifically recognizing human epidermal growth factor receptor 2 (ErbB-2/HER2), a receptor tyrosine kinase, which is overexpressed in a variety of human cancers, including breast and gastric tumors. Treatment of human gastric cancer cells with a trimeric version (42 nucleotides) of the selected aptamer (14 nucleotides) resulted in reduced cell growth in vitro, but a monomeric version was ineffective. Likewise, when treated with the trimeric aptamer, animals bearing tumor xenografts of human gastric origin reflected reduced rates of tumor growth. The antitumor effect of the aptamer was nearly twofold stronger than that of a monoclonal anti–ErbB-2/HER2 antibody. Consistent with aptamer-induced intracellular degradation of ErbB-2/HER2, incubation of gastric cancer cells with the trimeric aptamer promoted translocation of ErbB-2/HER2 from the cell surface to cytoplasmic puncta. This translocation was associated with a lysosomal hydrolase-dependent clearance of the ErbB-2/HER2 protein from cell extracts. We conclude that targeting ErbB-2/HER2 with DNA aptamers might retard the tumorigenic growth of gastric cancer by means of accelerating lysosomal degradation of the oncoprotein. This work exemplifies the potential pharmacological utility of aptamers directed at cell surface proteins, and it highlights an endocytosis-mediated mechanism of tumor inhibition. PMID:23630281

  13. A Novel PEGylation Method for Improving the Pharmacokinetic Properties of Anti-Interleukin-17A RNA Aptamers

    PubMed Central

    Otaki, Natsuki; Nagamine, Masakazu; Kayo, Tomoyoshi; Sasaki, Asako; Hiramoto, Shinsuke; Takahashi, Masayuki; Hota, Kuniyoshi; Sato, Hideaki; Yamazaki, Hiroaki

    2017-01-01

    The obstacles to the development of therapeutic aptamers for systemic inflammatory diseases, such as nuclease degradation and renal clearance, have not been fully overcome. Here, we report a novel PEGylation method, sbC-PEGylation, which improves the pharmacokinetic properties of RNA aptamers that act against interleukin-17A (IL-17A) in mice and monkeys. sbC-PEGylated aptamers were synthesized by coupling the symmetrical branching molecule 2-cyanoethyl-N,N-diisopropyl phosphoroamidite to the 5′ end of the aptamer, before conjugating two polyethylene glycol (PEG) molecules to the aptamer. Pharmacokinetic studies showed that compared with conventionally PEGylated aptamers, the sbC-PEGylated aptamer exhibited excellent stability in the blood circulation of mice and monkeys. In addition, one of the sbC-PEGylated aptamers, 17M-382, inhibited the interleukin-6 (IL-6) production induced by IL-17A in NIH3T3 cells in a concentration-dependent manner, and the half-maximal inhibitory concentration of sbC-PEGylated 17M-382 was two times lower than that of non-PEGylated 17M-382. Furthermore, the intraperitoneal administration of sbC-PEGylated 17M-382 significantly inhibited the IL-6 production induced by IL-17A in a mouse air pouch model. Our findings suggest that the novel PEGylation method described in this study, sbC-PEGylation, could be used to develop anti-IL-17A aptamers as a therapeutic option for systemic inflammatory disease. PMID:27827561

  14. A Novel PEGylation Method for Improving the Pharmacokinetic Properties of Anti-Interleukin-17A RNA Aptamers.

    PubMed

    Haruta, Kazuhiko; Otaki, Natsuki; Nagamine, Masakazu; Kayo, Tomoyoshi; Sasaki, Asako; Hiramoto, Shinsuke; Takahashi, Masayuki; Hota, Kuniyoshi; Sato, Hideaki; Yamazaki, Hiroaki

    2017-02-01

    The obstacles to the development of therapeutic aptamers for systemic inflammatory diseases, such as nuclease degradation and renal clearance, have not been fully overcome. Here, we report a novel PEGylation method, sbC-PEGylation, which improves the pharmacokinetic properties of RNA aptamers that act against interleukin-17A (IL-17A) in mice and monkeys. sbC-PEGylated aptamers were synthesized by coupling the symmetrical branching molecule 2-cyanoethyl-N,N-diisopropyl phosphoroamidite to the 5' end of the aptamer, before conjugating two polyethylene glycol (PEG) molecules to the aptamer. Pharmacokinetic studies showed that compared with conventionally PEGylated aptamers, the sbC-PEGylated aptamer exhibited excellent stability in the blood circulation of mice and monkeys. In addition, one of the sbC-PEGylated aptamers, 17M-382, inhibited the interleukin-6 (IL-6) production induced by IL-17A in NIH3T3 cells in a concentration-dependent manner, and the half-maximal inhibitory concentration of sbC-PEGylated 17M-382 was two times lower than that of non-PEGylated 17M-382. Furthermore, the intraperitoneal administration of sbC-PEGylated 17M-382 significantly inhibited the IL-6 production induced by IL-17A in a mouse air pouch model. Our findings suggest that the novel PEGylation method described in this study, sbC-PEGylation, could be used to develop anti-IL-17A aptamers as a therapeutic option for systemic inflammatory disease.

  15. A Novel Quantum Dots-Based Point of Care Test for Syphilis

    NASA Astrophysics Data System (ADS)

    Yang, Hao; Li, Ding; He, Rong; Guo, Qin; Wang, Kan; Zhang, Xueqing; Huang, Peng; Cui, Daxiang

    2010-05-01

    One-step lateral flow test is recommended as the first line screening of syphilis for primary healthcare settings in developing countries. However, it generally shows low sensitivity. We describe here the development of a novel fluorescent POC (Point Of Care) test method to be used for screening for syphilis. The method was designed to combine the rapidness of lateral flow test and sensitiveness of fluorescent method. 50 syphilis-positive specimens and 50 healthy specimens conformed by Treponema pallidum particle agglutination (TPPA) were tested with Quantum Dot-labeled and colloidal gold-labeled lateral flow test strips, respectively. The results showed that both sensitivity and specificity of the quantum dots-based method reached up to 100% (95% confidence interval [CI], 91-100%), while those of the colloidal gold-based method were 82% (95% CI, 68-91%) and 100% (95% CI, 91-100%), respectively. In addition, the naked-eye detection limit of quantum dot-based method could achieve 2 ng/ml of anti-TP47 polyclonal antibodies purified by affinity chromatography with TP47 antigen, which was tenfold higher than that of colloidal gold-based method. In conclusion, the quantum dots were found to be suitable for labels of lateral flow test strip. Its ease of use, sensitiveness and low cost make it well-suited for population-based on-the-site syphilis screening.

  16. Antibody-Conjugated Single Quantum Dot Tracking of Membrane Neurotransmitter Transporters in Primary Neuronal Cultures.

    PubMed

    Bailey, Danielle M; Kovtun, Oleg; Rosenthal, Sandra J

    2017-01-01

    Single particle tracking (SPT) experiments have provided the scientific community with invaluable single-molecule information about the dynamic regulation of individual receptors, transporters, kinases, lipids, and molecular motors. SPT is an alternative to ensemble averaging approaches, where heterogeneous modes of motion might be lost. Quantum dots (QDs) are excellent probes for SPT experiments due to their photostability, high brightness, and size-dependent, narrow emission spectra. In a typical QD-based SPT experiment, QDs are bound to the target of interest and imaged for seconds to minutes via fluorescence video microscopy. Single QD spots in individual frames are then linked to form trajectories that are analyzed to determine their mean square displacement, diffusion coefficient, confinement index, and instantaneous velocity. This chapter describes a generalizable protocol for the single particle tracking of membrane neurotransmitter transporters on cell membranes with either unmodified extracellular antibody probes and secondary antibody-conjugated quantum dots or biotinylated extracellular antibody probes and streptavidin-conjugated quantum dots in primary neuronal cultures. The neuronal cell culture, the biotinylation protocol and the quantum dot labeling procedures, as well as basic data analysis are discussed.

  17. A Novel Quantum Dots–Based Point of Care Test for Syphilis

    PubMed Central

    2010-01-01

    One-step lateral flow test is recommended as the first line screening of syphilis for primary healthcare settings in developing countries. However, it generally shows low sensitivity. We describe here the development of a novel fluorescent POC (Point Of Care) test method to be used for screening for syphilis. The method was designed to combine the rapidness of lateral flow test and sensitiveness of fluorescent method. 50 syphilis-positive specimens and 50 healthy specimens conformed by Treponema pallidum particle agglutination (TPPA) were tested with Quantum Dot-labeled and colloidal gold-labeled lateral flow test strips, respectively. The results showed that both sensitivity and specificity of the quantum dots–based method reached up to 100% (95% confidence interval [CI], 91–100%), while those of the colloidal gold-based method were 82% (95% CI, 68–91%) and 100% (95% CI, 91–100%), respectively. In addition, the naked-eye detection limit of quantum dot–based method could achieve 2 ng/ml of anti-TP47 polyclonal antibodies purified by affinity chromatography with TP47 antigen, which was tenfold higher than that of colloidal gold–based method. In conclusion, the quantum dots were found to be suitable for labels of lateral flow test strip. Its ease of use, sensitiveness and low cost make it well-suited for population-based on-the-site syphilis screening. PMID:20672123

  18. Aptamer-based fiber sensor for thrombin detection

    NASA Astrophysics Data System (ADS)

    Coelho, Luís; Marques Martins de Almeida, José Manuel; Santos, José Luís; da Silva Jorge, Pedro Alberto; Martins, Maria Cristina L.; Viegas, Diana; Queirós, Raquel B.

    2016-08-01

    The detection of thrombin based on aptamer binding is studied using two different optical fiber-based configurations: long period gratings coated with a thin layer of titanium dioxide and surface plasmon resonance devices in optical fibers coated with a multilayer of gold and titanium dioxide. These structures are functionalized and the performance to detect thrombin in the range 10 to 100 nM is compared in transmission mode. The sensitivity to the surrounding refractive index (RI) of the plasmonic device is higher than 3100 nm RIU-1 in the RI range 1.335 to 1.355, a factor of 20 greater than the sensitivity of the coated grating. The detection of 10 nM of thrombin was accomplished with a wavelength shift of 3.5 nm and a resolution of 0.54 nM.

  19. Aptamer-based cantilever array sensors for oxytetracycline detection.

    PubMed

    Hou, Hui; Bai, Xiaojing; Xing, Chunyan; Gu, Ningyu; Zhang, Bailin; Tang, Jilin

    2013-02-19

    We present a new method for specific detection of oxytetracycline (OTC) at nanomolar concentrations based on a microfabricated cantilever array. The sensing cantilevers in the array are functionalized with self-assembled monolayers (SAMs) of OTC-specific aptamer, which acts as a recognition molecule for OTC. While the reference cantilevers in the array are functionalized with 6-mercapto-1-hexanol SAMs to eliminate the influence of environmental disturbances. The cantilever sensor shows a good linear relationship between the deflection amplitude and the OTC concentration in the range of 1.0-100 nM. The detection limit of the cantilever array sensor is as low as 0.2 nM, which is comparable to some traditional methods. Other antibiotics such as doxycycline and tetracycline do not cause significant deflection of the cantilevers. It is demonstrated that the cantilever array sensors can be used as a powerful tool to detect drugs with high sensitivity and selectivity.

  20. Thermophoresis in nanoliter droplets to quantify aptamer binding.

    PubMed

    Seidel, Susanne A I; Markwardt, Niklas A; Lanzmich, Simon A; Braun, Dieter

    2014-07-21

    Biomolecule interactions are central to pharmacology and diagnostics. These interactions can be quantified by thermophoresis, the directed molecule movement along a temperature gradient. It is sensitive to binding induced changes in size, charge, or conformation. Established capillary measurements require at least 0.5 μL per sample. We cut down sample consumption by a factor of 50, using 10 nL droplets produced with acoustic droplet robotics (Labcyte). Droplets were stabilized in an oil-surfactant mix and locally heated with an IR laser. Temperature increase, Marangoni flow, and concentration distribution were analyzed by fluorescence microscopy and numerical simulation. In 10 nL droplets, we quantified AMP-aptamer affinity, cooperativity, and buffer dependence. Miniaturization and the 1536-well plate format make the method high-throughput and automation friendly. This promotes innovative applications for diagnostic assays in human serum or label-free drug discovery screening.

  1. Aptamer-Mediated Delivery of Chemotherapy to Pancreatic Cancer Cells

    PubMed Central

    Ray, Partha; Cheek, Marcus A.; Sharaf, Mariam L.; Li, Na; Ellington, Andrew D.; Sullenger, Bruce A.; Shaw, Barbara Ramsay

    2012-01-01

    Gemcitabine is a nucleoside analog that is currently the best available single-agent chemotherapeutic drug for pancreatic cancer. However, efficacy is limited by our inability to deliver sufficient active metabolite into cancer cells without toxic effects on normal tissues. Targeted delivery of gemcitabine into cancer cells could maximize effectiveness and concurrently minimize toxic side effects by reducing uptake into normal cells. Most pancreatic cancers overexpress epidermal growth factor receptor (EGFR), a trans-membrane receptor tyrosine kinase. We utilized a nuclease resistant RNA aptamer that binds and is internalized by EGFR on pancreatic cancer cells to deliver gemcitabine-containing polymers into EGFR-expressing cells and inhibit cell proliferation in vitro. This approach to cell type–specific therapy can be adapted to other targets and to other types of therapeutic cargo. PMID:23030589

  2. Highly efficient inhibition of human immunodeficiency virus type 1 reverse transcriptase by aptamers functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Shiang, Yen-Chun; Ou, Chung-Mao; Chen, Shih-Ju; Ou, Ting-Yu; Lin, Han-Jia; Huang, Chih-Ching; Chang, Huan-Tsung

    2013-03-01

    We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45-Au NPs shows inhibitory efficiency in the retroviral replication cycle with a decreasing infectivity (40.2%).We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45

  3. Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP

    PubMed Central

    Guerra-Pérez, Natalia; Ramos, Edurne; García-Hernández, Marta; Pinto, Celia; Soto, Manuel; Martín, M. Elena; González, Víctor M.

    2015-01-01

    Summary A poly (A)-binding protein from Leishmania infantum (LiPABP) has been recently cloned and characterized in our laboratory. Although this protein shows a very high homology with PABPs from other eukaryotic organisms including mammals and other parasites, exist divergences along the sequence that convert them in potential diagnostic markers and/or therapeutics targets. Aptamers are oligonucleotide ligands that are selected in vitro by their affinity and specificity for the target as a consequence of the particular tertiary structure that they are able to acquire depending on their sequence. Development of high-affinity molecules with the ability to recognize specifically Leishmania proteins is essential for the progress of this kind of study. Results We have selected a ssDNA aptamer population against a recombinant 6xHIS–LiPABP protein (rLiPABP) that is able to recognize the target with a low Kd. Cloning, sequencing and in silico analysis of the aptamers obtained from the population yielded three aptamers (ApPABP#3, ApPABP#7 and ApPABP#11) that significantly bound to PABP with higher affinity than the naïve population. These aptamers were analyzed by ELONA and slot blot to establish affinity and specificity for rLiPABP. Results demonstrated that the three aptamers have high affinity and specificity for the target and that they are able to detect an endogenous LiPABP (eLiPABP) protein amount corresponding to 2500 L. infantum promastigotes in a significant manner. The functional analysis of the aptamers also revealed that ApPABP#11 disrupts the binding of both Myc-LiPABP and eLiPABP to poly (A) in vitro. On the other hand, these aptamers are able to bind and purify LiPABP from complex mixes. Conclusion Results presented here demonstrate that aptamers represent new reagents for characterization of LiPABP and that they can affect LiPABP activity. At this respect, the use of these aptamers as therapeutic tool affecting the physiological role of PABP has to be

  4. Site-selective conjugation of an anticoagulant aptamer to recombinant albumins and maintenance of neonatal Fc receptor binding.

    PubMed

    Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia; Kuhlmann, Matthias; Cameron, Jason; Sørensen, Esben; Wengel, Jesper; Howard, Kenneth A

    2017-03-31

    Aptamers are an attractive molecular medicine that offers high target specificity. Nucleic acid-based aptamers however, are prone to nuclease degradation and rapid renal excretion that require blood circulatory half-life extension enabling technologies. The long circulatory half-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment of a factor IXa anticoagulant aptamer on aptamer functionality and FcRn engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Aptamer-albumin conjugates, connected covalently through a heterobifunctional succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate linker, were successfully prepared and purified by high performance liquid chromatography as confirmed by gel electrophoresis band-shift analysis and matrix-assisted laser desorption/ionization time of flight. Minimal reduction (~ 25%) in activity of WT-linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent aptamer-albumin conjugation, however, substantially compromised binding to FcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer interferometry. Binding could be rescued by aptamer conjugation to recombinant albumin engineered for higher FcRn affinity (HB) that exhibited an 8-fold affinity compared to WT alone. This work describes a novel albumin-based aptamer delivery system whose FcRn binding can be increased using a high binding engineered albumin.

  5. Riboswitch-Mediated Aptamer Binding for Imaging and Therapy (RABIT): A Novel Technique to Selectively Target an Intracellular Ligand Specific for Ovarian Cancer

    DTIC Science & Technology

    2013-10-01

    AD_________________ Award Number: TITLE: Riboswitch-Mediated Aptamer Binding for Imaging and...SUBTITLE Riboswitch-Mediated Aptamer Binding for Imaging and Therapy (RABIT): A Novel TTechnique to Selectively Target an Intracellular Ligand...ABSTRACT We have proposed to use a riboswitch to image or treat ovarian cancer. The riboswitch, attached to an EpCAM aptamer , will be transported

  6. Structural optimization of an aptamer generated from Ligand-Guided Selection (LIGS) resulted in high affinity variant toward mIgM expressed on Burkitt's lymphoma cell lines.

    PubMed

    Zümrüt, Hazan E; Batool, Sana; Van, Nabeela; George, Shanell; Bhandari, Sanam; Mallikaratchy, Prabodhika

    2017-03-28

    Aptamers are synthetic, short nucleic acid molecules capable of specific target recognition. Aptamers are selected using a screening method termed Systematic Evolution of Ligands by Exponential enrichment (SELEX). We recently have introduced a variant of SELEX called "Ligand-Guided-Selection" (LIGS) that allows the identification of specific aptamers against known cell-surface proteins. Utilizing LIGS, we introduced three specific aptamers against membrane-bound IgM (mIgM), which is the hallmark of B cells. Out of the three aptamers selected against mIgM, an aptamer termed R1, in particular, was found to be interesting due to its ability to recognize mIgM on target cells and then block anti-IgM antibodies binding their antigen. We systematically truncated parent aptamer R1 to design shorter variants with enhanced affinity. Importantly, herein we show that the specificity of the most optimized variant of R1 aptamer is similar to that of anti-IgM antibody, indicating that the specificity of the ligand utilized in selective elution of the aptamer determines the specificity of the LIGS-generated aptamer. Furthermore, we report that truncated variants of R1 are able to recognize mIgM-positive human B lymphoma BJAB cells at physiological temperature, demonstrating that LIGS-generated aptamers could be re-optimized into higher affinity variants. Collectively, these findings show the significance of LIGS in generating highly specific aptamers with potential applications in biomedicine.

  7. Protection of HIV neutralizing aptamers against rectal and vaginal nucleases: implications for RNA-based therapeutics.

    PubMed

    Moore, Michael D; Cookson, Jonathan; Coventry, Veronica K; Sproat, Brian; Rabe, Lorna; Cranston, Ross D; McGowan, Ian; James, William

    2011-01-28

    RNA-based drugs are an emerging class of therapeutics. They have the potential to regulate proteins, chromatin, as well as bind to specific proteins of interest in the form of aptamers. These aptamers are protected from nuclease attack by chemical modifications that enhance their stability for in vivo usage. However, nucleases are ubiquitous, and as we have yet to characterize the entire human microbiome it is likely that many nucleases are yet to be identified. Any novel, unusual enzymes present in vivo might reduce the efficacy of RNA-based therapeutics, even when they are chemically modified. We have previously identified an RNA-based aptamer capable of neutralizing a broad spectrum of clinical HIV-1 isolates and are developing it as a vaginal and rectal microbicide candidate. As a first step we addressed aptamer stability in the milieu of proteins present in these environments. Here we uncover a number of different nucleases that are able to rapidly degrade 2'-F-modified RNA. We demonstrate that the aptamer can be protected from the nuclease(s) present in the vaginal setting, without affecting its antiviral activity, by replacement of key positions with 2'-O-Me-modified nucleotides. Finally, we show that the aptamer can be protected from all nucleases present in both vaginal and rectal compartments using Zn(2+) cations. In conclusion we have derived a stable, antiviral RNA-based aptamer that could form the basis of a pre-exposure microbicide or be a valuable addition to the current tenofovir-based microbicide candidate undergoing clinical trials.

  8. Discrimination of recombinant from natural human growth hormone using DNA aptamers.

    PubMed

    Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Edge, Allison

    2011-04-01

    Detection of athletes who use synthetic human growth hormone (hGH; or somatotropin) to enhance physical strength and obtain an advantage in competitive sports is a formidable problem, as rhGH is virtually identical to the natural pituitary hormone. However, some post-translational and other modifications have been documented by chromatographic separation and mass spectrometry (MS) in a small percentage of rhGH. In the present work, development of DNA aptamers against research-grade rhGH and natural hGH with adsorption of the rhGH aptamers against natural hGH was shown to produce a small family of aptamer sequences that bound consistently with greater affinity to rhGH over a low nanogram-to-microgram range in ELISA-like microplate assays. This collection of rhGH discriminatory aptamer sequences shared some short sequence segments and secondary structural features. The top rhGH discriminatory aptamers also appeared to cross-react with human myoglobin and BSA but not with bone collagen peptides and an unrelated viral envelope peptide. The cross-reactivity results suggested several strings of up to five consecutive amino acids that might serve as common epitopes for aptamer binding. SDS-PAGE revealed that the rhGH existed largely as a 45-kDa dimer, and the natural hGH was almost exclusively monomeric. The existence of the rhGH dimer suggests that a discontinuous "bridge" epitope may exist on the rhGH, which spans the subunits, thereby accounting somewhat for the difference in detection. Overall, these results suggest that aptamers might be useful for routine, presumptive laboratory screening to identify athletes who are potentially cheating by administration of rhGH.

  9. Targeted therapy of hepatocellular carcinoma with aptamer-functionalized biodegradable nanoparticles

    NASA Astrophysics Data System (ADS)

    Weigum, Shannon; McIvor, Elizabeth; Munoz, Christopher; Feng, Richard; Cantu, Travis; Walsh, Kyle; Betancourt, Tania

    2016-11-01

    Hepatocellular carcinoma (HCC) is the most common form of liver cancer, occurring primarily in regions where viral hepatitis infections are common. Unfortunately, most HCC cases remain undiagnosed until late stages of the disease when patient outcome is poor, typically limiting survival from a few months to a year after initial diagnosis. In order to better care for HCC patients, new target-specific approaches are needed to improve early detection and therapeutic intervention. In this work, polymeric nanoparticles functionalized with a HCC-specific aptamer were examined as potential targeted drug delivery vehicles. Specifically, doxorubicin-loaded nanoparticles were prepared via nanoprecipitation of blends of poly(lactic-co-glycolic acid)- b-poly(ethylene glycol). These particles were further functionalized with the HCC-specific TLS11a aptamer. The in vitro interaction and therapeutic efficacy of the aptamer and aptamer-functionalized nanoparticles were characterized in a hepatoma cell line. Nanoparticles were found to be spherical in shape, roughly 100-125 nm in diameter, with a low polydispersity (≤0.2) and slightly negative surface potential. Doxorubicin was encapsulated within the particles at 40 % efficiency. Drug release was found to occur through anomalous transport influenced by diffusion and polymer relaxation, releasing 50 % doxorubicin in the first 10 h and full release occurring within 36 h. Confocal microscopy confirmed binding and attachment of aptamer-targeted nanoparticles to the cell surface of cultured HCC cells. Efficacy studies demonstrated a significant improvement in doxorubicin delivery and cell-killing capacity using the aptamer-functionalized, drug-loaded nanoparticles versus controls further supporting use of aptamer nanoparticles as a targeted drug delivery system for HCC tumors.

  10. Targeting hepatocellular carcinoma with aptamer-functionalized PLGA/PLA-PEG nanoparticles

    NASA Astrophysics Data System (ADS)

    Weigum, Shannon E.; Sutton, Melissa; Barnes, Eugenia; Miller, Sarah; Betancourt, Tania

    2014-08-01

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, particularly in regions where chronic Hepatitis B and C infections are common. Nanoparticle assemblies that incorporate high-affinity aptamers which specifically bind malignant hepatocellular carcinoma cells could be useful for targeted drug delivery or enhancing contrast with existing ablation therapies. The in vitro interactions of a tumor-specific aptamer, TLS11a, were characterized in a hepatoma cell line via live-cell fluorescence imaging, SDS-PAGE and Western Blotting techniques. Cell surface binding of the aptamer-AlexaFluor®546 conjugate was found to occur within 20 minutes of initial exposure, followed by internalization and localization to late endosomes or lysosomes using a pH-sensitive LysoSensor™ Green dye and confocal microscopy. Aptamer-functionalized polymer nanoparticles containing poly(lactic-co-glycolic acid) (PLGA) and poly(lactide)-b-poly(ethylene glycol) (PLA-PEG) were then prepared by nanoprecipitation and passively loaded with the chemotherapeutic agent, doxorubicin, yielding spherical nanoparticles approximately 50 nm in diameter. Targeted drug delivery and cytotoxicity was assessed using live/dead fluorescent dyes and a MTT colorimetric viability assay with elevated levels of cell death found in cultures treated with either the aptamer-coated and uncoated polymer nanoparticles. Identification and characterization of the cell surface protein epitope(s) recognized by the TLS11a aptamer are ongoing along with nanoparticle optimization, but these preliminary studies support continued investigation of this aptamer and functionalized nanoparticle conjugates for targeted labeling and drug delivery within malignant hepatocellular carcinomas.

  11. Hi-Fi SELEX: A High-Fidelity Digital-PCR Based Therapeutic Aptamer Discovery Platform.

    PubMed

    Ouellet, Eric; Foley, Jonathan H; Conway, Edward M; Haynes, Charles

    2015-08-01

    Current technologies for aptamer discovery typically leverage the systematic evolution of ligands by exponential enrichment (SELEX) concept by recursively panning semi-combinatorial ssDNA or RNA libraries against a molecular target. The expectation is that this iterative selection process will be sufficiently stringent to identify a candidate pool of specific high-affinity aptamers. However, failure of this process to yield promising aptamers is common, due in part to (i) limitations in library designs, (ii) retention of non-specific aptamers during screening rounds, (iii) excessive accumulation of amplification artifacts, and (iv) the use of screening criteria (binding affinity) that does not reflect therapeutic activity. We report a new selection platform, High-Fidelity (Hi-Fi) SELEX, that introduces fixed-region blocking elements to safeguard the functional diversity of the library. The chemistry of the target-display surface and the composition of the equilibration solvent are engineered to strongly inhibit non-specific retention of aptamers. Partition efficiencies approaching 10(6) are thereby realized. Retained members are amplified in Hi-Fi SELEX by digital PCR in a manner that ensures both elimination of amplification artifacts and stoichiometric conversion of amplicons into the single-stranded library required for the next selection round. Improvements to aptamer selections are first demonstrated using human α-thrombin as the target. Three clinical targets (human factors IXa, X, and D) are then subjected to Hi-Fi SELEX. For each, rapid enrichment of ssDNA aptamers offering an order-nM mean equilibrium dissociation constant (Kd) is achieved within three selection rounds, as quantified by a new label-free qPCR assay reported here. Therapeutic candidates against factor D are identified.

  12. Selection and Characterization of DNA Aptamers for Electrochemical Biosensing of Carbendazim.

    PubMed

    Eissa, Shimaa; Zourob, Mohammed

    2017-03-07

    This article reports a novel aptamer-based impedimetric detection of carbendazim, a commonly used benzimidazole fungicide in agriculture. High affinity and specificity DNA aptamers against carbendazim were successfully selected using systematic evolution of ligand by exponential enrichment (SELEX). The dissociation constants (Kds) of the selected DNA aptamers after 10 in vitro selection cycles were characterized using fluorescence-based assays showing values in the nanomolar range. The aptamer which showed the highest degree of affinity and conformation change was used to fabricate an electrochemical aptasensor via self-assembly of thiol-modified aptamer on gold electrodes. The aptasensor exploits the specific recognition of carbendazim by the aptamer immobilized on the gold surface which leads to conformational changes in the aptamer structure. This conformational change alters the access of a ferrocyanide/ferricyanide redox couple to the aptasensor surface. The aptasensor response is thus measured by following the increase in the electron transfer resistance of the redox couple using Faradaic electrochemical impedance spectroscopy. This method allowed a selective and sensitive label-free detection of carbendazim within a range of 10 pg/mL-10 ng/mL with a limit of detection of 8.2 pg/mL. The aptasensor did not show cross reactivity with other commonly used pesticides such as fenamiphos, isoproturon, atrazine, linuron, thiamethoxam, trifluralin, carbaryl, and methyl parathion. Moreover, the aptasensor has been applied in different spiked food matrixes showing high recovery percentages. We believe that the proposed aptasensor is a promising alternative to the currently used methods for carbendazim monitoring.

  13. Neutralizing DNA Aptamers against Swine Influenza H3N2 Viruses

    PubMed Central

    Wongphatcharachai, Manoosak; Wang, Ping; Enomoto, Shinichiro; Webby, Richard J.; Gramer, Marie R.; Amonsin, Alongkorn

    2013-01-01

    Triple reassortant influenza A viruses (IAVs) of swine, particularly the North American H3N2 subtype, circulate in swine herds and may reassort and result in the emergence of novel zoonotic strains. Current diagnostic tools rely on isolation of the viruses, followed by serotyping by hemagglutination or genome sequencing, both of which can be expensive and time-consuming. Thus, novel subtype-specific ligands and methods are needed for rapid testing and subtyping of IAVs in the field. To address this need, we selected DNA aptamers against the recombinant HA protein from swine IAV H3 cluster IV using systematic evolution of ligands by exponential enrichment (SELEX). Four candidate aptamers (HA68, HA7, HA2a, and HA2b) were identified and characterized. The dissociation constants (Kd) of aptamers HA68, HA7, HA2a, and HA2b against recombinant H3 protein were 7.1, 22.3, 16.0, and 3.7 nM, respectively. The binding site of HA68 to H3 was identified to be between nucleotide residues 8 and 40. All aptamers inhibited H3 hemagglutination. HA68 was highly specific to all four lineages within the North American H3N2 subtype. Further, the other three aptamers specifically identified live viruses belonging to the phylogenetic clusters I, II/III, and IV especially the virus that closely related to the recent H3N2 variant (H3N2v). Aptamer HA68 was also able to bind and detect H3N2v isolated from recent human cases. In conclusion, we provide subtype-specific aptamers against H3N2 IAVs of swine that can now be used in rapid detection and typing protocols for field applications. PMID:23077124

  14. Specific detection of tetanus toxoid using an aptamer-based matrix.

    PubMed

    Modh, Harshvardhan B; Bhadra, Ankan K; Patel, Kinjal A; Chaudhary, Rajeev K; Jain, Nishant K; Roy, Ipsita

    2016-11-20

    Batch-to-batch variation of therapeutic proteins produced by biological means requires rigorous monitoring at all stages of the production process. A large number of animals are employed for risk assessment of biologicals, which has low ethical and economic acceptability. Research is now focussed on the validation of in vitro and ex vivo tests to replace live challenges. Among in vitro methods, enzyme-linked immunosorbent assay (ELISA) is considered to be the gold standard for estimation of integrity of tetanus toxoid. ELISA utilizes antibodies for detection, which, because of their biological origin and limited modifiability, may have low stability and result in irreproducibility. We have developed a method using highly specific and selective RNA aptamers for detection of tetanus toxoid. Using displacement assay, we first identified aptamers which bind to different aptatopes on the surface of the toxoid. Pairs of these aptamers were employed as capture-detection ligands in a sandwich-ALISA (aptamer-linked immobilized sorbent assay) format. The binding efficiency was confirmed by the fluorescence intensity in each microtire plate well. Using aptamers alone, detection of tetanus toxoid was possible with the same level of sensitivity as antibody. Aptamers were also used in the capture ALISA format. Adjuvanted tetanus toxoid was subjected to accelerated stress testing, including thermal, mechanical and freeze-thawing stress conditions. The loss in antigenicity of the preparation determined by ALISA in each case was found to be similar to that determined by conventional ELISA. Thus, it is possible to replace antibodies with aptamers to develop a more robust detection tool for tetanus toxoid.

  15. Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials.

    PubMed

    Friedman, Adam D; Kim, Dongwook; Liu, Rihe

    2015-01-01

    When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2' modification. This study aims to develop a novel class of highly stable, 2'-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2'-F-dG, 2'-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2'-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and specifically deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials.

  16. Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX).

    PubMed

    Huang, Chao-June; Lin, Hsin-I; Shiesh, Shu-Chu; Lee, Gwo-Bin

    2010-03-15

    The systematic evolution of ligands by exponential enrichment (SELEX) is an experimental procedure that allows screening of given molecular targets by desired binding affinities from an initial random pool of oligonucleotides and oligomers. The final products of SELEX are usually referred as aptamers, which are recognized as promising molecules for a variety of biomedical applications. However, SELEX is an iterative process requiring multiple rounds of extraction and amplification that demands significant time and labor. Therefore, this study presents a novel, automatic, miniature SELEX platform. As a demonstration, the rapid screening of C-reactive protein (CRP) aptamers was performed. By utilizing microfluidic technologies and magnetic beads conjugated with CRP, aptamers with a high affinity to CRP were extracted from a random single-strand deoxyribonucleic acid (ssDNA) pool. These aptamers were further amplified by an on-chip polymerase chain reaction (PCR) process. After five consecutive extraction and amplification cycles, a specific aptamer with the highest affinity was screened automatically. The screened aptamers were used as a recognition molecule for the detection of CRP. The developed microsystem demonstrated fast screening of CRP aptamers and can be used as a powerful tool to select analyte-specific aptamers for biomedical applications.

  17. Aptamer Lateral Flow Assays for Ultrasensitive Detection of β-Conglutin Combining Recombinase Polymerase Amplification and Tailed Primers.

    PubMed

    Jauset-Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; McNeil, Calum; Keegan, Neil; El-Shahawi, Mohammad S; Bashammakh, Abdulaziz S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

    2016-11-01

    In this work, different methodologies were evaluated in search of robust, simple, rapid, ultrasensitive, and user-friendly lateral flow aptamer assays. In one approach, we developed a competitive based lateral flow aptamer assay, in which β-conglutin immobilized on the test line of a nitrocellulose membrane and β-conglutin in the test sample compete for binding to AuNP labeled aptamer. The control line exploits an immobilized DNA probe complementary to the labeled aptamer, forcing displacement of the aptamer from the β-conglutin-aptamer complex. In a second approach, the competition for aptamer binding takes place off-strip, and following competition, aptamer bound to the immobilized β-conglutin is eluted and used as a template for isothermal recombinase polymerase amplification, exploiting tailed primers, resulting in an amplicon of a duplex flanked by single stranded DNA tails. The amplicon is rapidly and quantitatively detected using a nucleic acid lateral flow with an immobilized capture probe and a gold nanoparticle labeled reporter probe. The competitive lateral flow is completed in just 5 min, achieving a detection limit of 55 pM (1.1 fmol), and the combined competitive-amplification lateral flow requires just 30 min, with a detection limit of 9 fM (0.17 amol).

  18. Codeine-binding RNA aptamers and rapid determination of their binding constants using a direct coupling surface plasmon resonance assay

    PubMed Central

    Win, Maung Nyan; Klein, Joshua S.; Smolke, Christina D.

    2006-01-01

    RNA aptamers that bind the opium alkaloid codeine were generated using an iterative in vitro selection process. The binding properties of these aptamers, including equilibrium and kinetic rate constants, were determined through a rapid, high-throughput approach using surface plasmon resonance (SPR) analysis to measure real-time binding. The approach involves direct coupling of the target small molecule onto a sensor chip without utilization of a carrier protein. Two highest binding aptamer sequences, FC5 and FC45 with Kd values of 2.50 and 4.00 μM, respectively, were extensively studied. Corresponding mini-aptamers for FC5 and FC45 were subsequently identified through the described direct coupling Biacore assays. These assays were also employed to confirm the proposed secondary structures of the mini-aptamers. Both aptamers exhibit high specificity to codeine over morphine, which differs from codeine by a methyl group. Finally, the direct coupling method was demonstrated to eliminate potential non-specific interactions that may be associated with indirect coupling methods in which protein linkers are commonly employed. Therefore, in addition to presenting the first RNA aptamers to a subclass of benzylisoquinoline alkaloid molecules, this work highlights a method for characterizing small molecule aptamers that is more robust, precise, rapid and high-throughput than other commonly employed techniques. PMID:17038331

  19. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.

    PubMed

    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi

    2016-08-10

    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates.

  20. Serum inverts and improves the fluorescence response of an aptamer beacon to various vitamin D analytes.

    PubMed

    Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Edge, Allison

    2012-01-01

    A dominant aptamer loop structure from a library of nearly 100 candidate aptamer sequences developed against immobilized 25-hydroxyvitamin D(3) (calcidiol) was converted into a 5'-TYE 665 and 3'-Iowa black-labelled aptamer beacon. The aptamer beacon exhibited a mild 'lights on' reaction in buffer as a function of increasing concentrations of several vitamin D analogues and metabolites, with a limit of detection of approximately 200 ng/mL, and was not specific for any particular congener. In 10% or 50% human serum, the same aptamer beacon inverted its fluorescence behaviour to become a more intense 'lights off' reaction with an improved limit of detection in the range 4-16 ng/mL. We hypothesized that this drastic change in fluorescence behaviour was due to the presence of creatinine and urea in serum, which might destabilize the quenched beacon, causing an increase in fluorescence followed by decreasing fluorescence as a function of vitamin D concentrations that may bind and quench increasingly greater fractions of the denatured beacons. However, the results of several control experiments in the presence of physiological or greater concentrations of creatinine and urea, alone or combined in buffer, failed to produce the beacon fluorescence inversion. Other possible mechanistic hypotheses are also discussed.

  1. Organophosphorus pesticides detection using broad-specific single-stranded DNA based fluorescence polarization aptamer assay.

    PubMed

    Zhang, Cunzheng; Wang, Li; Tu, Zhui; Sun, Xing; He, Qinghua; Lei, Zhaojing; Xu, Chongxin; Liu, Yuan; Zhang, Xiao; Yang, Jingyi; Liu, Xianjin; Xu, Yang

    2014-05-15

    An approach is developed to detect the organophosphorus pesticides via competitive binding to a recombinant broad-specificity DNA aptamer with a molecular beacon (MB), the binding of the MB to the aptamer results in the activation of a fluorescent signal, which can be measured for pesticide quantification. Aptamers selected via the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) were structurally modified and truncated to narrow down the binding region of the target, which indicated that loops of the aptamer contributed different functions for different chemical recognition. Thereafter, a variant fused by two different minimum functional structures, was clarified with broad specificity and increased affinity. Further molecular docking and molecular dynamics simulations was conducted to understand the molecular interaction between DNA structure and chemicals. 3D modeling revealed a hot spot area formed by 3 binding sites, forces including hydrogen bonds and van der Waals interactions appear to play a significant role in enabling and stabilizing the binding of chemicals. Finally, an engineered aptamer based approach for the detection of organophosphorus pesticides was successfully applied in a test using a real sample, the limit of quantification (LOQ) for phorate, profenofos, isocarbophos, and omethoate reached 19.2, 13.4, 17.2, and 23.4 nM (0.005 mg L(-1)), respectively.

  2. Double-functionalized gold nanoparticles with split aptamer for the detection of adenosine triphosphate.

    PubMed

    Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu

    2013-10-15

    A newly designed functionalization type for gold nanoparticles (AuNP) with split aptamer has been developed for the detection of adenosine triphosphate (ATP). The ATP aptamer was split into two parts with their 5' prime or 3' prime modified with thiol. Both the 5' SH and 3' SH modified strands for each split aptamer fragment were functionalized onto the same AuNP to construct double-functionalized AuNP-DNA conjugates. Thus, the split aptamer can be reassembled into intact folded structure in the presence of ATP molecule with two potential assembly types, which induces the assembly of AuNP-DNA conjugates. In this double-functionalized system, the traditional assembly type might facilitate another assembly type, which was found to give much higher LSPR change in the presence of ATP than the traditional assembly type, and improve the sensitivity for ATP detection. Time courses of the assemble processes with different assembly types, Mg(2+) concentrations, and aptamer fragments densities on AuNP were followed using the absorption ratio at 650 nm and 520 nm. ATP response with this newly designed system was investigated using absorption spectra and dynamic light scattering method.

  3. Electrical Detection of Cancer Biomarker using Aptamers with Nanogap Break-Junctions

    PubMed Central

    Ilyas, Azhar; Asghar, Waseem; Allen, Peter B.; Duhon, Holli; Ellington, Andrew D.; Iqbal, Samir M.

    2012-01-01

    Epidermal Growth Factor Receptor (EGFR) is a cell surface protein overexpressed in cancerous cells. It is known to be the most common oncongene. EGFR concentration also increases in the serum of cancer patients. The detection of small changes in the concentration of EGFR can be critical for early diagnosis, resulting in better treatment and improved survival rate of cancer patients. This article reports an RNA aptamer based approach to selectively capture EGFR protein and an electrical scheme for its detection. Pairs of gold electrodes with nanometer separation were made through confluence of focused ion beam scratching and electromigration. The aptamer was hybridized to a single stranded DNA molecule, which in turn was immobilized on SiO2 surface between the gold nanoelectrodes. The selectivity of the aptamer was demonstrated by using control chips with mutated non–selective aptamer and with no aptamer. Surface functionalization was characterized by optical detection and two orders of magnitude increase in direct current (DC) was measured when selective capture of EGFR occurred. This represents an electronic biosensor for the detection of proteins of interest for medical applications. PMID:22706642

  4. Inhibition of the foot-and-mouth disease virus subgenomic replicon by RNA aptamers

    PubMed Central

    Forrest, Sophie; Lear, Zoe; Herod, Morgan R.; Ryan, Martin; Rowlands, David J.

    2014-01-01

    We have previously documented the inhibitory activity of RNA aptamers to the RNA-dependent RNA polymerase of foot-and-mouth disease virus (3Dpol). Here we report their modification and use with a subgenomic replicon incorporating GFP (pGFP-PAC replicon), allowing replication to be monitored and quantified in real-time. GFP expression in transfected BHK-21 cells reached a maximum at approximately 8 h post-transfection, at which time change in morphology of the cells was consistent with a virus-induced cytopathic effect. However, transfection of replicon-bearing cells with a 3Dpol aptamer RNA resulted in inhibition of GFP expression and maintenance of normal cell morphology, whereas a control aptamer RNA had little effect. The inhibition was correlated with a reduction in 3Dpol (detected by immunoblotting) and shown to be dose dependent. The 3Dpol aptamers appeared to be more effective than 2′-C-methylcytidine (2′CMC). Aptamers to components of the replication complex are therefore useful molecular tools for studying viral replication and also have potential as diagnostic molecules in the future. PMID:25096816

  5. Aptamers provide superior stainings of cellular receptors studied under super-resolution microscopy

    PubMed Central

    Höbartner, Claudia

    2017-01-01

    Continuous improvements in imaging techniques are challenging biologists to search for more accurate methods to label cellular elements. This is particularly relevant for diffraction-unlimited fluorescence imaging, where the perceived resolution is affected by the size of the affinity probes. This is evident when antibodies, which are 10–15 nm in size, are used. Previously it has been suggested that RNA aptamers (~3 nm) can be used to detect cellular proteins under super-resolution imaging. However, a direct comparison between several aptamers and antibodies is needed, to clearly show the advantages and/or disadvantages of the different probes. Here we have conducted such a comparative study, by testing several aptamers and antibodies using stimulated emission depletion microscopy (STED). We have targeted three membrane receptors, EGFR, ErbB2 and Epha2, which are relevant to human health, and recycle between plasma membrane and intracellular organelles. Our results suggest that the aptamers can reveal more epitopes than most antibodies, thus providing a denser labeling of the stained structures. Moreover, this improves the overall quality of the information that can be extracted from the images. We conclude that aptamers could become useful fluorescent labeling tools for light microscopy and super-resolution imaging, and that their development for novel targets is imperative. PMID:28235049

  6. Inhibiting the intrinsic pathway of coagulation with a FXII-targeting RNA Aptamer

    PubMed Central

    Woodruff, R. S.; Xu, Y.; Layzer, J.; Wu, W.; Ogletreee, M.L.; Sullenger, B.A.

    2013-01-01

    Background Exposure of the plasma protein factor XII to an anionic surface generates activated factor XII that not only triggers the intrinsic pathway of blood coagulation through the activatio of factor XI, but also mediates various vascular responses through activation of the plasma contact system. While deficiencies of factor XII are not associated with excessive bleeding, thrombosis models in factor deficient animals have suggested that this protein contributes to stable thrombus formation. Therefore, factor XII has emerged as an attractive therapeutic target to treat or prevent pathological thrombosis formation without increasing the risk for hemorrhage. Objectives Utilizing an in vitro directed evolution and chemical biology approach, we sought to isolate a nuclease resistant RNA aptamer that binds specifically to factor XII and directly inhibits factor XII coagulant function. Methods and Results Herein, we describe the isolation and characterization of a high affinity RNA aptamer targeting factor XII/XIIa that dose dependently prolongs fibrin clot formation and thrombin generation in clinical coagulation assays. This aptamer functions as a potent anticoagulant by inhibiting the autoactivation of factor XII, as well as inhibiting intrinsic pathway activation (factor XI activation). However, the aptamer does not affect the factor XIIa-mediated activation of the proinflammatory kallikrein-kinin system (plasma kallikrein activation). Conclusions We have generated a specific and potent factor XII/XIIa aptamer anticoagulant that offers targeted inhibition of discrete macromolecular interactions involved in the activation of the intrinsic pathway of blood coagulation. PMID:23692437

  7. Inhibition of Japanese encephalitis virus (JEV) replication by specific RNA aptamer against JEV methyltransferase.

    PubMed

    Han, Seung Ryul; Lee, Seong-Wook

    2017-01-29

    Japanese encephalitis virus (JEV) is the most common etiological agent of epidemic viral encephalitis. JEV encodes a single methyltransferase (MTase) domain located at the N-terminal region of the viral nonstructural protein NS5. JEV MTase is essential for viral replication and specifically catalyzes methylation of the viral RNA cap, which occurs exclusively in the cytoplasm. Therefore, JEV MTase is a potential target for antiviral therapy. Here, we identified specific and avid RNA aptamer (Kd ∼ 12 nM) with modified 2'-O-methyl pyrimidines against JEV MTase. The RNA aptamer efficiently inhibited viral cap methylation activity of MTase and interfered with JEV production in cells. Moreover, we generated a 24-mer truncated aptamer that could specifically bind to JEV MTase with high affinity (Kd ∼16 nM). The 24-mer aptamer efficiently inhibited JEV production and replication in cells. Therefore, MTase-specific RNA aptamer might be useful as an anti-JEV agent.

  8. Microarrays as Model Biosensor Platforms to Investigate the Structure and Affinity of Aptamers

    PubMed Central

    Martin, Jennifer A.; Chushak, Yaroslav; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

    2016-01-01

    Immobilization of nucleic acid aptamer recognition elements selected free in solution onto the surface of biosensor platforms has proven challenging. This study investigated the binding of multiple aptamer/target pairs immobilized on a commercially available microarray as a model system mimicking biosensor applications. The results indicate a minimum distance (linker length) from the surface and thymine nucleobase linker provides reproducible binding across varying conditions. An indirect labeling method, where the target was labeled with a biotin followed by a brief Cy3-streptavidin incubation, provided a higher signal-to-noise ratio and over two orders of magnitude improvement in limit of detection, compared to direct Cy3-protein labeling. We also showed that the affinities of the aptamer/target interaction can change between direct and indirect labeling and conditions to optimize for the highest fluorescence intensity will increase the sensitivity of the assay but will not change the overall affinity. Additionally, some sequences which did not initially bind demonstrated binding when conditions were optimized. These results, in combination with studies demonstrating enhanced binding in nonselection buffers, provided insights into the structure and affinity of aptamers critical for biosensor applications and allowed for generalizations in starting conditions for researchers wishing to investigate aptamers on a microarray surface. PMID:27042344

  9. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

  10. Development of a Multiplex Sandwich Aptamer Microarray for the Detection of VEGF165 and Thrombin

    PubMed Central

    Sosic, Alice; Meneghello, Anna; Antognoli, Agnese; Cretaio, Erica; Gatto, Barbara

    2013-01-01

    In this work we have developed a multiplex microarray system capable of detecting VEGF165 and thrombin. We recently described a Sandwich Aptamer Microarray (SAM) for thrombin detection feasible for use in multiplex microarrays; here we describe a new aptasensor for VEGF165 detection employing Vap7 and VEa5, two DNA aptamers recognizing different sites of the protein. The aptamers were modified to be adapted to the solid phase platform of SAM and their capability to simultaneously recognize VEGF165 by forming a ternary complex was analyzed in solution. Having so defined the best tandem arrangement of modified aptamers, we set up the aptasensor for VEGF165, and finally analyzed the multiplex system with the two aptasensors for the simultaneous detection of VEGF165 and thrombin. The results indicate that each sandwich is specific, even when the two proteins are mixed. The system performance is consistent with the behavior evidenced by the biochemical analysis, which proves to be valuable to drive the evaluation and refinement of aptamers prior to or along the development of a detection platform. Since thrombin upregulates VEGF expression, the simultaneous recognition of these two proteins could be useful in the analysis of biomarkers in pathologies characterized by neo-angiogenesis. PMID:24097233

  11. Selection of DNA Aptamers against Glioblastoma Cells with High Affinity and Specificity

    PubMed Central

    Kang, Dezhi; Wang, Jiangjie; Zhang, Weiyun; Song, Yanling; Li, Xilan; Zou, Yuan; Zhu, Mingtao; Zhu, Zhi; Chen, Fuyong; Yang, Chaoyong James

    2012-01-01

    Background Glioblastoma is the most common and most lethal form of brain tumor in human. Unfortunately, there is still no effective therapy to this fatal disease and the median survival is generally less than one year from the time of diagnosis. Discovery of ligands that can bind specifically to this type of tumor cells will be of great significance to develop early molecular imaging, targeted delivery and guided surgery methods to battle this type of brain tumor. Methodology/Principal Findings We discovered two target-specific aptamers named GBM128 and GBM131 against cultured human glioblastoma cell line U118-MG after 30 rounds selection by a method called cell-based Systematic Evolution of Ligands by EXponential enrichment (cell-SELEX). These two aptamers have high affinity and specificity against target glioblastoma cells. They neither recognize normal astraglial cells, nor do they recognize other normal and cancer cell lines tested. Clinical tissues were also tested and the results showed that these two aptamers can bind to different clinical glioma tissues but not normal brain tissues. More importantly, binding affinity and selectivity of these two aptamers were retained in complicated biological environment. Conclusion/Significance The selected aptamers could be used to identify specific glioblastoma biomarkers. Methods of molecular imaging, targeted drug delivery, ligand guided surgery can be further developed based on these ligands for early detection, targeted therapy, and guided surgery of glioblastoma leading to effective treatment of glioblastoma. PMID:23056171

  12. Inhibition of Influenza Virus Replication by DNA Aptamers Targeting a Cellular Component of Translation Initiation

    PubMed Central

    Rodriguez, Paloma; Pérez-Morgado, M Isabel; Gonzalez, Víctor M; Martín, M Elena; Nieto, Amelia

    2016-01-01

    The genetic diversity of the influenza virus hinders the use of broad spectrum antiviral drugs and favors the appearance of resistant strains. Single-stranded DNA aptamers represent an innovative approach with potential application as antiviral compounds. The mRNAs of influenza virus possess a 5′cap structure and a 3′poly(A) tail that makes them structurally indistinguishable from cellular mRNAs. However, selective translation of viral mRNAs occurs in infected cells through a discriminatory mechanism, whereby viral polymerase and NS1 interact with components of the translation initiation complex, such as the eIF4GI and PABP1 proteins. We have studied the potential of two specific aptamers that recognize PABP1 (ApPABP7 and ApPABP11) to act as anti-influenza drugs. Both aptamers reduce viral genome expression and the production of infective influenza virus particles. The interaction of viral polymerase with the eIF4GI translation initiation factor is hindered by transfection of infected cells with both PABP1 aptamers, and ApPABP11 also inhibits the association of NS1 with PABP1 and eIF4GI. These results indicate that aptamers targeting the host factors that interact with viral proteins may potentially have a broad therapeutic spectrum, reducing the appearance of escape mutants and resistant subtypes. PMID:27070300

  13. Screening and development of DNA aptamers as capture probes for colorimetric detection of patulin.

    PubMed

    Wu, Shijia; Duan, Nuo; Zhang, Weixiao; Zhao, Sen; Wang, Zhouping

    2016-09-01

    Patulin (PAT) is a kind of mycotoxin that has serious harmful impacts on both food quality and human health. A high-affinity ssDNA aptamer that specifically binds to patulin was generated using systemic evolution of ligands by exponential enrichment (SELEX) assisted by graphene oxide (GO). After 15 rounds of positive and negative selection, a highly enriched ssDNA pool was sequenced and the representative sequences were subjected to binding assays to evaluate their affinity and specificity. Of the eight aptamer candidates tested, the sequence PAT-11 bound to patulin with high affinity and excellent selectivity with a dissociation constant (Kd) of 21.83 ± 5.022 nM. The selected aptamer, PAT-11, was subsequently used as a recognition element to develop a detection method for patulin based on an enzyme-chromogenic substrate system. The colorimetric aptasensor exhibited a linear range from 50 to 2500 pg mL(-1), and the limit of detection was found to be 48 pg mL(-1). The results indicated that GO-SELEX technology was appropriate for the screening of aptamers against small-molecule toxins, offering a promising application for aptamer-based biosensors.

  14. Agonistic aptamer to the insulin receptor leads to biased signaling and functional selectivity through allosteric modulation

    PubMed Central

    Yunn, Na-Oh; Koh, Ara; Han, Seungmin; Lim, Jong Hun; Park, Sehoon; Lee, Jiyoun; Kim, Eui; Jang, Sung Key; Berggren, Per-Olof; Ryu, Sung Ho

    2015-01-01

    Due to their high affinity and specificity, aptamers have been widely used as effective inhibitors in clinical applications. However, the ability to activate protein function through aptamer-protein interaction has not been well-elucidated. To investigate their potential as target-specific agonists, we used SELEX to generate aptamers to the insulin receptor (IR) and identified an agonistic aptamer named IR-A48 that specifically binds to IR, but not to IGF-1 receptor. Despite its capacity to stimulate IR autophosphorylation, similar to insulin, we found that IR-A48 not only binds to an allosteric site distinct from the insulin binding site, but also preferentially induces Y1150 phosphorylation in the IR kinase domain. Moreover, Y1150-biased phosphorylation induced by IR-A48 selectively activates specific signaling pathways downstream of IR. In contrast to insulin-mediated activation of IR, IR-A48 binding has little effect on the MAPK pathway and proliferation of cancer cells. Instead, AKT S473 phosphorylation is highly stimulated by IR-A48, resulting in increased glucose uptake both in vitro and in vivo. Here, we present IR-A48 as a biased agonist able to selectively induce the metabolic activity of IR through allosteric binding. Furthermore, our study also suggests that aptamers can be a promising tool for developing artificial biased agonists to targeted receptors. PMID:26245346

  15. Highly Sensitive Detection of Target Biomolecules on Cell Surface Using Gold Nanoparticle Conjugated with Aptamer Probe

    NASA Astrophysics Data System (ADS)

    Kim, Hyonchol; Terazono, Hideyuki; Hayashi, Masahito; Takei, Hiroyuki; Yasuda, Kenji

    2012-06-01

    A method of gold nanoparticle (Au NP) labeling with backscattered electron (BE) imaging of field emission scanning electron microscopy (FE-SEM) was applied for specific detection of target biomolecules on a cell surface. A single-stranded DNA aptamer, which specifically binds to the target molecule on a human acute lymphoblastic leukemia cell, was conjugated with a 20 nm Au NP and used as a probe to label its target molecule on the cell. The Au NP probe was incubated with the cell, and the interaction was confirmed using BE imaging of FE-SEM through direct counting of the number of Au NPs attached on the target cell surface. Specific Au NP-aptamer probes were observed on a single cell surface and their spatial distributions including submicron-order localizations were also clearly visualized, whereas the nonspecific aptamer probes were not observed on it. The aptamer probe can be potentially dislodged from the cell surface with treatment of nucleases, indicating that Au NP-conjugated aptamer probes can be used as sensitive and reversible probes to label target biomolecules on cells.

  16. Applications of High-Throughput Sequencing for In Vitro Selection and Characterization of Aptamers

    PubMed Central

    Nguyen Quang, Nam; Perret, Gérald; Ducongé, Frédéric

    2016-01-01

    Aptamers are identified through an iterative process of evolutionary selection starting from a random pool containing billions of sequences. Simultaneously to the amplification of high-affinity candidates, the diversity in the pool is exponentially reduced after several rounds of in vitro selection. Until now, cloning and Sanger sequencing of about 100 sequences was usually used to identify the enriched candidates. However, High-Throughput Sequencing (HTS) is now extensively used to replace such low throughput sequencing approaches. Providing a deeper analysis of the library, HTS is expected to accelerate the identification of aptamers as well as to identify aptamers with higher affinity. It is also expected that it can provide important information on the binding site of the aptamers. Nevertheless, HTS requires handling a large amount of data that is only possible through the development of new in silico methods. Here, this review presents these different strategies that have been recently developed to improve the identification and characterization of aptamers using HTS. PMID:27973417

  17. Turning an Aptamer into a Light-Switch Probe with a Single Bioconjugation

    PubMed Central

    2015-01-01

    We describe a method for transforming a structure-switching aptamer into a luminescent light-switch probe via a single conjugation. The methodology is demonstrated using a known aptamer for Hg2+ as a case study. This approach utilizes a lanthanide-based metallointercalator, Eu-DOTA-Phen, whose luminescence is quenched almost entirely and selectively by purines, but not at all by pyrimidines. This complex, therefore, does not luminesce while intercalated in dsDNA, but it is bright red when conjugated to a ssDNA that is terminated by several pyrimidines. In its design, the light-switch probe incorporates a structure-switching aptamer partially hybridized to its complementary strand. The lanthanide complex is conjugated to either strand via a stable amide bond. Binding of the analyte by the structure-switching aptamer releases the complementary strand. This release precludes intercalation of the intercalator in dsDNA, which switches on its luminescence. The resulting probe turns on 21-fold upon binding to its analyte. Moreover, the structure switching aptamer is highly selective, and the long luminescence lifetime of the probe readily enables time-gating experiments for removal of the background autofluorescence of the sample. PMID:25427946

  18. NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine.

    PubMed

    Duchardt-Ferner, Elke; Juen, Michael; Kreutz, Christoph; Wöhnert, Jens

    2017-04-01

    RNA aptamers are used in a wide range of biotechnological or biomedical applications. In many cases the high resolution structures of these aptamers in their ligand-complexes have revealed fundamental aspects of RNA folding and RNA small molecule interactions. Fluorescent RNA-ligand complexes in particular find applications as optical sensors or as endogenous fluorescent tags for RNA tracking in vivo. Structures of RNA aptamers and aptamer ligand complexes constitute the starting point for rational function directed optimization approaches. Here, we present the NMR resonance assignment of an RNA aptamer binding to the fluorescent ligand tetramethylrhodamine (TMR) in complex with the ligand 5-carboxy-tetramethylrhodamine (5-TAMRA) as a starting point for a high-resolution structure determination using NMR spectroscopy in solution.

  19. An inhibitory RNA aptamer against the lambda cI repressor shows transcriptional activator activity in vivo.

    PubMed

    Ohuchi, Shoji; Suess, Beatrix

    2017-04-13

    An RNA aptamer is one of the promising components for constructing artificial genetic circuits. In this study, we developed a transcriptional activator based on an RNA aptamer against one of the most frequently applied repressor proteins, lambda phage cI. In vitro selection (SELEX), followed by in vivo screening identified an RNA aptamer with the intended transcriptional activator activity from an RNA pool containing a 40-nucleotide long random region. Quantitative analysis showed 35-fold elevation of reporter expression upon aptamer expression. These results suggest that the diversity of artificial transcriptional activators can be extended by employing RNA aptamers against repressor proteins to broaden the tools available for constructing genetic circuits. This article is protected by copyright. All rights reserved.

  20. Structural basis for specific, high-affinity tetracycline binding by an in vitro evolved aptamer and artificial riboswitch.

    PubMed

    Xiao, Hong; Edwards, Thomas E; Ferré-D'Amaré, Adrian R

    2008-10-20

    The tetracycline aptamer is an in vitro selected RNA that binds to the antibiotic with the highest known affinity of an artificial RNA for a small molecule (Kd approximately 0.8 nM). It is one of few aptamers known to be capable of modulating gene expression in vivo. The 2.2 A resolution cocrystal structure of the aptamer reveals a pseudoknot-like fold formed by tertiary interactions between an 11 nucleotide loop and the minor groove of an irregular helix. Tetracycline binds within this interface as a magnesium ion chelate. The structure, together with previous biochemical and biophysical data, indicates that the aptamer undergoes localized folding concomitant with tetracycline binding. The three-helix junction, h-shaped architecture of this artificial RNA is more complex than those of most aptamers and is reminiscent of the structures of some natural riboswitches.

  1. Secondary error analysis: The evaluation of analyst dot labeling

    NASA Technical Reports Server (NTRS)

    Havens, K. A. (Principal Investigator)

    1978-01-01

    The author has identified the following significant results. From this examination of 25 test segments using Al labeling and ground truth labeling, the PCC on type 1 dots was found to be signficantly better for both types of ground truth labeled procedures than the PCC obtained using Al labeling. No significant difference in the PCC was found for type 2 dots. However, in all three treatments, the type 2 dots included pixels which fell on boundaries or were mixed pixels. This accounted for all PCC2 values being equally low. The proportion estimates achieved in these classifications showed no significant differences between procedures.

  2. DNA aptamers selection and characterization for development of label-free impedimetric aptasensor for neurotoxin anatoxin-a.

    PubMed

    Elshafey, Reda; Siaj, Mohamed; Zourob, Mohammed

    2015-06-15

    High affinity DNA aptamers against anatoxin-a (ATX), the smallest potent neurotoxin (Mol. Wt, 165.23 Da) were selected and identified in vitro using the systematic evolution of ligands by exponential enrichment (SELEX) approach. Aptamers with dissociation constants (Kd) of nanomolar range were isolated. The aptamer sequence of highest affinity was used to design a label-free impedance based aptasensor to assay ATX, for which there are no reported biosensors so far. The aptamer self assembled monolayer is formed on a gold electrode using the disulfide modified aptamer. The assembly process of the aptasensor was characterized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Upon ATX binding to the immobilized aptamer, a significant decrease in the electron-transfer resistance was observed as a result of the aptamer conformation change, which is used as the sensor signal. The aptasensor showed a limit of detection of 0.5 nM and a wide linear range for ATX concentrations between 1 nM and 100 nM. The Kd of anti-ATX aptamer was calculated by electrochemical methods as well as the fluorescence. Interestingly, the Kd that was calculated from the aptasensor signal showed a lower value implying that the anchoring of the aptamer on the Au surface enhanced its affinity to ATX. The ATX aptasensor showed high stability as well as high specificity against common cynaobacterial toxins. Further development of biosensors that use anatoxin-a binding aptamers as a new recognition receptors could provide potential alternatives to the traditional assays for fast and simple monitoring of anatoxin-a.

  3. Aptamer sensor for cocaine using minor groove binder based energy transfer.

    PubMed

    Zhou, Jinwen; Ellis, Amanda V; Kobus, Hilton; Voelcker, Nicolas H

    2012-03-16

    We report on an optical aptamer sensor for cocaine detection. The cocaine sensitive fluorescein isothiocyanate (FITC)-labeled aptamer underwent a conformational change from a partial single-stranded DNA with a short hairpin to a double-stranded T-junction in the presence of the target. The DNA minor groove binder Hoechst 33342 selectively bound to the double-stranded T-junction, bringing the dye within the Förster radius of FITC, and therefore initiating minor groove binder based energy transfer (MBET), and reporting on the presence of cocaine. The sensor showed a detection limit of 0.2 μM. The sensor was also implemented on a carboxy-functionalized polydimethylsiloxane (PDMS) surface by covalently immobilizing DNA aptamers. The ability of surface-bound cocaine detection is crucial for the development of microfluidic sensors.

  4. Photocaged G-Quadruplex DNAzyme and Aptamer by Post-Synthetic Modification on Phosphodiester Backbone.

    PubMed

    Feng, Mengli; Ruan, Zhiyuan; Shang, Jiachen; Xiao, Lu; Tong, Aijun; Xiang, Yu

    2017-02-15

    G-quadruplex-containing DNAzymes and aptamers are widely applied in many research fields because of their high stability and prominent activities versus the protein counterparts. In this work, G-quadruplex DNAs were equipped with photolabile groups to construct photocaged DNAzymes and aptamers. We incorporated TEEP-OH (thioether-enol phosphate, phenol substituted) into phosphodiester backbone of G-quadruplex DNA by a facile post-synthetic method to achieve efficient photocaging of their activities. Upon light irradiation, the peroxidase-mimicking activity of the caged G-quadruplex DNAzyme was activated, through the transformation of TEEP-OH into a native DNA phosphodiester without any artificial scar. Similarly, the caged G-quadruplex thrombin-binding aptamer also showed light-induced activation of thrombin inhibition activity. This method could serve as a general strategy to prepare photocaged G-quadruplex DNA with other activities for noninvasive control of their functions.

  5. DNA-duplex linker for AFM-SELEX of DNA aptamer against human serum albumin.

    PubMed

    Takenaka, Musashi; Okumura, Yuzo; Amino, Tomokazu; Miyachi, Yusuke; Ogino, Chiaki; Kondo, Akihiko

    2017-02-15

    DNA-duplex interactions in thymines and adenins are used as a linker for the novel methodology of Atomic Force Microscope-Systematic Evolution of Ligands by EXpotential enrichment (AFM-SELEX). This study used the hydrogen bonds in 10 mer of both thymines (T10) and adenines (A10). Initially, the interactive force in T10-A10 was measured by AFM, which returned an average interactive force of approximately 350pN. Based on this result, DNA aptamers against human serum albumin could be selected in the 4th round, and 15 different clones could be sequenced. The lowest dissociation constant of the selected aptamer was identified via surface plasmon resonance, and it proved to be identical to that of the commercial aptamer. Therefore, specific hydrogen bonds in DNA can be useful linkers for AFM-SELEX.

  6. Comparison of biodistribution profile of monoclonal antibodies nanoparticles and aptamers in rats with breast cancer.

    PubMed

    Cerqueira-Coutinho, Cristal; Missailidis, Sotiris; Alessandra-Perini, Jéssica; Machado, Daniel Escorsim; Perini, Jamila Alessandra; Santos-Oliveira, Ralph

    2017-05-01

    The use of monoclonal antibodies and aptamers is growing every single day, as the use of nanoparticle systems. Although most of the products are under investigation, there are a few commercialized products available at the market, for human consume. In this study, we have compared three formulations (aptamer anti-MUC1, monoclonal antibody - Trastuzumab and monoclonal antibodies nanoparticles - PLA/PVA/MMT trastuzumab) to identify their profile as also to understand their behavior into an alive biological system. In this direction the radiolabeling of the products were done and they were all tested in animals (in vivo) in two conditions: healthy rats and breast cancer induced animals. The results showed that the nanoparticle has the better biodistribution profile, followed by the aptamer. We conclude that more studies and a global effort to elucidate the biological behavior of drugs and especially nano-drugs are necessary.

  7. An 'activatable' aptamer-based fluorescence probe for the detection of HepG2 cells.

    PubMed

    Lai, Zongqiang; Tan, Juntao; Wan, Ruirong; Tan, Jie; Zhang, Zhenghua; Hu, Zixi; Li, Jieping; Yang, Wei; Wang, Yiwei; Jiang, Yafeng; He, Jian; Yang, Nuo; Lu, Xiaoling; Zhao, Yongxiang

    2017-05-01

    It is significant to develop a probe with sensitivity and specificity for the detection of cancer cells. The present study aimed to develop an 'activatable' aptamer-based fluorescence probe (AAFP) to detect cancer cells and frozen cancer tissue. This AAFP consisted of two fragments: aptamer TLS11a that targets HepG2 cells, and two short extending complementary DNA sequences with a 5'- and 3'-terminus that make the aptamer in hairpin structure a capable quencher to fluorophore. The ability of the AAFP to bind specifically to cancer cells was assessed using flow cytometry, fluorescence spectroscopy and fluorescence microscopy. Its ability to bind to frozen cancer tissue was assessed using fluorescence microscopy. As a result, in the absence of cancer cells, AAFP showed minimal fluorescence, reflecting auto-quenching. In the presence of cancer cells, however, AAFP showed a strong fluorescent signal. Therefore, this AAFP may be a promising tool for sensitive and specific detection of cancer.

  8. Aptamer selection for fishing of palladium ion using graphene oxide-adsorbed nanoparticles.

    PubMed

    Cho, Yea Seul; Lee, Eun Jeong; Lee, Gwan-Ho; Hah, Sang Soo

    2015-12-01

    A new aptamer selection method using graphene oxide (GO)-adsorbed nanoparticles (GO-adsorbed NPs) was employed for specific fishing of palladium ion. High affinity ssDNA aptamers were isolated through 13 rounds of selection and the capacity of the selected DNA aptamers for palladium ion uptake was measured, clarifying that DNA01 exhibits the highest affinity to palladium ion with a dissociation constant (Kd) of 4.60±1.17 μM. In addition, binding ability of DNA01 to palladium ion was verified against other metal ions, such as Li(+), Cs(+), Mg(2+), and Pt(2+). Results of the present study suggest that future modification of DNA01 may improve palladium ion-binding ability, leading to economic recovery of palladium from water solution.

  9. Nucleic acid aptamers as novel class of therapeutics to mitigate Alzheimer's disease pathology.

    PubMed

    Tannenberg, Rudi K; Shamaileh, Hadi Al; Lauridsen, Lasse H; Kanwar, Jagat R; Dodd, Peter R; Veedu, Rakesh N

    2013-05-01

    Deposition of amyloid-β (Aβ) peptides in the brain is a central event in the pathogenesis of Alzheimer's disease (AD), which makes Aβ peptides a crucial target for therapeutic intervention. Significant efforts have been made towards the development of ligands that bind to Aβ peptides with a goal of early detection of amyloid aggregation and the neutralization of Aβ toxicity. Short single-stranded oligonucleotide aptamers bind with high affinity and specificity to their targets. Aptamers that specifically bind to Aβ monomers, specifically the 40 and 42 amino acid species (Aβ(1-40) and Aβ(1- 42)), fibrils and plaques have a great potential for diagnostic applications and the treatment of AD. Herein, we review the aptamers that bind to the various forms of Aβ peptides for use in diagnosis and to inhibit plaque formation.

  10. A Universal Base in a Specific Role: Tuning up a Thrombin Aptamer with 5-Nitroindole

    PubMed Central

    Tsvetkov, Vladimir B.; Varizhuk, Anna M.; Pozmogova, Galina E.; Smirnov, Igor P.; Kolganova, Natalia A.; Timofeev, Edward N.

    2015-01-01

    In this study we describe new modified analogs of the thrombin binding aptamer (TBA) containing 5-nitroindole residues. It has been shown that all modified TBAs form an anti-parallel G-quadruplex structure and retain the ability to inhibit thrombin. The most advanced TBA variant (TBA-N8) has a substantially increased clotting time and two-fold lower IC50 value compared to the unmodified prototype. Molecular modelling studies suggest that the improved anticoagulant properties of TBA-N8 result from changes in the binding mode of the analog. A modified central loop in TBA-N8 is presumed to participate in the binding of the target protein. Studies of FAM labelled TBA and TBA-N8 showed an improved binding affinity of the modified aptamer and provided evidence of a direct interaction between the modified central loop and thrombin. Our findings have implications for the design of new aptamers with improved binding affinities.

  11. Microfabricated high-performance microwave impedance biosensors for detection of aptamer-protein interactions

    NASA Astrophysics Data System (ADS)

    Löhndorf, M.; Schlecht, U.; Gronewold, T. M. A.; Malavé, A.; Tewes, M.

    2005-12-01

    High-frequency impedance biosensors with nanometer gaps have been prepared for the detection of biomolecular interactions such as protein-antibody and protein-aptamer binding. The sensor principle is based on electrical impedance changes measured at 1.2 GHz due to changes of the effective dielectric constant within the 68 nm gaps between two gold electrodes. As a model system, the specific binding of the blood clotting factor human thrombin with different concentrations to its ribonucleic acid (RNA) α-thrombin aptamer, as well as the immobilization process of the RNA-aptamer, have been detected in real time. By using a similar 68 nm-gap sensor blocked with bovine serum albumin and a reference sensor with 10μm electrode spacing, signal changes due to variations of the bulk dielectric constant due to buffer/analyte solutions, and unspecific binding events have been analyzed.

  12. Entropy and Mg2+ control ligand affinity and specificity in the malachite green binding RNA aptamer.

    PubMed

    Bernard Da Costa, Jason; Dieckmann, Thorsten

    2011-07-01

    The binding of small molecule targets by RNA aptamers provides an excellent model to study the versatility of RNA function. The malachite green aptamer binds and recognizes its ligand via stacking and electrostatic interactions. The binding of the aptamer to its original selection target and three related molecules was determined by isothermal titration calorimetry, equilibrium dialysis, and fluorescence titration. The results reveal that the entropy of complex formation plays a large role in determining binding affinity and ligand specificity. These data combined with previous structural studies show that metal ions are required to stabilize the complexes with non-native ligands whereas the complex with the original selection target is stable at low salt and in the absence of divalent metal ions.

  13. Aptamer capturing of enzymes on magnetic beads to enhance assay specificity and sensitivity.

    PubMed

    Zhao, Qiang; Li, Xing-Fang; Le, X Chris

    2011-12-15

    Activity and specificity of enzyme molecules are important to enzymatic reactions and enzyme assays. We describe an aptamer capturing approach that improves the specificity and the sensitivity of enzyme detection. An aptamer recognizing the target enzyme molecule is conjugated on a magnetic bead, increasing the local concentration, and serves as an affinity probe to capture and separate minute amounts of the enzyme. The captured enzymes catalyze the subsequent conversion of fluorogenic substrate to fluorescent products, enabling a sensitive measure of the active enzyme. The feasibility of this technique is demonstrated through assays for human alpha thrombin and human neutrophil elastase (HNE), two important enzymes. Thrombin (2 fM) and 100 fM HNE can be detected. The incorporation of two binding events, substrate recognition and aptamer binding, greatly improves assay specificity. With its simplicity, this approach is applicable to biosensing and detection of disease biomarkers.

  14. RNA-based networks: using RNA aptamers and ribozymes as synthetic genetic devices.

    PubMed

    Weigand, Julia E; Wittmann, Alexander; Suess, Beatrix

    2012-01-01

    Within the last few years, a set of synthetic riboswitches has been engineered, which expands the toolbox of genetic regulatory devices. Small molecule binding aptamers have been used for the design of such riboswitches by insertion into untranslated regions of mRNAs, exploiting the fact that upon ligand binding the RNA structure interferes either with translation initiation or pre-mRNA splicing in yeast. In combination with self-cleaving ribozymes, aptamers have been used to modulate RNA stability. In this chapter, we discuss the applicability of different aptamers, ways to identify novel genetic devices, the pros and cons of various insertion sites and the application of allosteric ribozymes. Our expertise help to apply synthetic riboswitches to engineer complex genetic circuits.

  15. Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay

    PubMed Central

    Ausländer, Simon; Fuchs, David; Hürlemann, Samuel; Ausländer, David; Fussenegger, Martin

    2016-01-01

    Hammerhead ribozymes are self-cleaving RNA molecules capable of regulating gene expression in living cells. Their cleavage performance is strongly influenced by intra-molecular loop–loop interactions, a feature not readily accessible through modern prediction algorithms. Ribozyme engineering and efficient implementation of ribozyme-based genetic switches requires detailed knowledge of individual self-cleavage performances. By rational design, we devised fluorescent aptamer-ribozyme RNA architectures that allow for the real-time measurement of ribozyme self-cleavage activity in vitro. The engineered nucleic acid molecules implement a split Spinach aptamer sequence that is made accessible for strand displacement upon ribozyme self-cleavage, thereby complementing the fluorescent Spinach aptamer. This fully RNA-based ribozyme performance assay correlates ribozyme cleavage activity with Spinach fluorescence to provide a rapid and straightforward technology for the validation of loop–loop interactions in hammerhead ribozymes. PMID:26939886

  16. Ultrafast capillary electrophoresis isolation of DNA aptamer for the PCR amplification-based small analyte sensing.

    PubMed

    Fiore, Emmanuelle; Dausse, Eric; Dubouchaud, Hervé; Peyrin, Eric; Ravelet, Corinne

    2015-01-01

    Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR) amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization) of capillary electrophoresis (CE) and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s) was developed by designing a CE input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 μM.

  17. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    NASA Astrophysics Data System (ADS)

    Fiore, Emmanuelle; Dausse, Eric; Dubouchaud, Hervé; Peyrin, Eric; Ravelet, Corinne

    2015-08-01

    Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR) amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization) of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s) was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  18. Development of a panel of DNA Aptamers with High Affinity for Pancreatic Ductal Adenocarcinoma

    NASA Astrophysics Data System (ADS)

    Champanhac, Carole; Teng, I.-Ting; Cansiz, Sena; Zhang, Liqin; Wu, Xiaoqiu; Zhoa, Zilong; Fu, Ting; Tan, Weihong

    2015-11-01

    Pancreatic cancer costs nearly 40,000 lives in the U.S. each year and has one of the lowest survival rates among cancers. Effective treatment of pancreatic ductal adenocarcinoma is hindered by lack of a reliable biomarker. To address this challenge, aptamers were selected by cell-SELEX (Systematic Evolution of Ligands by EXponential enrichment) targeting human pancreatic ductal adenocarcinoma (PL45). Five promising aptamers presenting low Kd values and good specificity were generated. Among these five aptamers, one was tailored into a nanostructure carrying a high drug payload for specific drug delivery. The results show a viability of almost 80% for negative cells while only 50% of the target cells remained alive after 48 h incubation. These results lead to the conclusion that further research could reveal protein biomarkers specific to pancreatic adenocarcinoma, with probes available for early detection.

  19. An improved electrochemical aptasensor for chloramphenicol detection based on aptamer incorporated gelatine.

    PubMed

    Hamidi-Asl, Ezat; Dardenne, Freddy; Blust, Ronny; De Wael, Karolien

    2015-03-27

    Because of the biocompatible properties of gelatine and the good affinity of aptamers for their targets, the combination of aptamer and gelatine type B is reported as promising for the development of biosensing devices. Here, an aptamer for chloramphenicol (CAP) is mixed with different types of gelatine and dropped on the surface of disposable gold screen printed electrodes. The signal of the CAP reduction is investigated using differential pulse voltammetry. The diagnostic performance of the sensor is described and a detection limit of 1.83 × 10(-10) M is found. The selectivity and the stability of the aptasensor are studied and compared to those of other CAP sensors described in literature.

  20. An Improved Electrochemical Aptasensor for Chloramphenicol Detection Based on Aptamer Incorporated Gelatine

    PubMed Central

    Hamidi-Asl, Ezat; Dardenne, Freddy; Blust, Ronny; De Wael, Karolien

    2015-01-01

    Because of the biocompatible properties of gelatine and the good affinity of aptamers for their targets, the combination of aptamer and gelatine type B is reported as promising for the development of biosensing devices. Here, an aptamer for chloramphenicol (CAP) is mixed with different types of gelatine and dropped on the surface of disposable gold screen printed electrodes. The signal of the CAP reduction is investigated using differential pulse voltammetry. The diagnostic performance of the sensor is described and a detection limit of 1.83 × 10−10 M is found. The selectivity and the stability of the aptasensor are studied and compared to those of other CAP sensors described in literature. PMID:25825978

  1. A Universal Base in a Specific Role: Tuning up a Thrombin Aptamer with 5-Nitroindole

    NASA Astrophysics Data System (ADS)

    Tsvetkov, Vladimir B.; Varizhuk, Anna M.; Pozmogova, Galina E.; Smirnov, Igor P.; Kolganova, Natalia A.; Timofeev, Edward N.

    2015-11-01

    In this study we describe new modified analogs of the thrombin binding aptamer (TBA) containing 5-nitroindole residues. It has been shown that all modified TBAs form an anti-parallel G-quadruplex structure and retain the ability to inhibit thrombin. The most advanced TBA variant (TBA-N8) has a substantially increased clotting time and two-fold lower IC50 value compared to the unmodified prototype. Molecular modelling studies suggest that the improved anticoagulant properties of TBA-N8 result from changes in the binding mode of the analog. A modified central loop in TBA-N8 is presumed to participate in the binding of the target protein. Studies of FAM labelled TBA and TBA-N8 showed an improved binding affinity of the modified aptamer and provided evidence of a direct interaction between the modified central loop and thrombin. Our findings have implications for the design of new aptamers with improved binding affinities.

  2. Protein determination using graphene oxide-aptamer modified gold nanoparticles in combination with Tween 80.

    PubMed

    Gao, Li; Li, Qin; Li, Raoqi; Deng, Zebin; Brady, Brendan; Xia, Ni; Chen, Guimin; Zhou, Yang; Xia, Hengchuan; Chen, Keping; Shi, Haixia

    2016-10-19

    Recently, graphene oxide (GO) has shown superiority for disease detection arising from its unique physical and chemical properties. However, proteins adsorbed on the surface of GO prevent sensitivity improvement in fluorescence-based detection methods. In this paper, a label-free method based on aptamer modified gold nanoparticles (GNPs) combined with Tween 80 was shown to solve this problem using the detection of thrombin as an example. An aptamer was designed and bound to thrombin by changing its conformation. Tween 80 was used for rapid and reproducible synthesis of stable DNA-functionalized GNPs and prevented the thrombin from nonspecific binding to GO. Thrombin was detected with a limit of 0.68 pM by taking advantage of the efficient cross-linking effect of aptamer-GNPs to GO. The sensor was validated by determining thrombin concentration in human blood serum samples. The results indicate that this method has promising analytical application in medical diagnostic.

  3. Fluorescence-based strategies to investigate the structure and dynamics of aptamer-ligand complexes

    NASA Astrophysics Data System (ADS)

    Perez-Gonzalez, Cibran; Lafontaine, Daniel; Penedo, J.

    2016-08-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labelling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labelled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these

  4. Devices and approaches for generating specific high-affinity nucleic acid aptamers

    NASA Astrophysics Data System (ADS)

    Szeto, Kylan; Craighead, Harold G.

    2014-09-01

    High-affinity and highly specific antibody proteins have played a critical role in biological imaging, medical diagnostics, and therapeutics. Recently, a new class of molecules called aptamers has emerged as an alternative to antibodies. Aptamers are short nucleic acid molecules that can be generated and synthesized in vitro to bind to virtually any target in a wide range of environments. They are, in principal, less expensive and more reproducible than antibodies, and their versatility creates possibilities for new technologies. Aptamers are generated using libraries of nucleic acid molecules with random sequences that are subjected to affinity selections for binding to specific target molecules. This is commonly done through a process called Systematic Evolution of Ligands by EXponential enrichment, in which target-bound nucleic acids are isolated from the pool, amplified to high copy numbers, and then reselected against the desired target. This iterative process is continued until the highest affinity nucleic acid sequences dominate the enriched pool. Traditional selections require a dozen or more laborious cycles to isolate strongly binding aptamers, which can take months to complete and consume large quantities of reagents. However, new devices and insights from engineering and the physical sciences have contributed to a reduction in the time and effort needed to generate aptamers. As the demand for these new molecules increases, more efficient and sensitive selection technologies will be needed. These new technologies will need to use smaller samples, exploit a wider range of chemistries and techniques for manipulating binding, and integrate and automate the selection steps. Here, we review new methods and technologies that are being developed towards this goal, and we discuss their roles in accelerating the availability of novel aptamers.

  5. A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

    PubMed Central

    Martin, Jennifer A.; Smith, Joshua E.; Warren, Mercedes; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

    2015-01-01

    Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to

  6. On-chip synthesis of RNA aptamer microarrays for multiplexed protein biosensing with SPR imaging measurements.

    PubMed

    Chen, Yulin; Nakamoto, Kohei; Niwa, Osamu; Corn, Robert M

    2012-06-05

    Microarrays of RNA aptamers are fabricated in a one-step, multiplexed enzymatic synthesis on gold thin films in a microfluidic format and then employed in the detection of protein biomarkers with surface plasmon resonance imaging (SPRI) measurements. Single-stranded RNA (ssRNA) oligonucleotides are transcribed on-chip from double-stranded DNA (dsDNA) templates attached to microarray elements (denoted as generator elements) by the surface transcription reaction of T7 RNA polymerase. As they are synthesized, the ssRNA oligonucleotides diffuse in the microfluidic channel and are quickly captured by hybridization adsorption onto adjacent single-stranded DNA (ssDNA) microarray elements (denoted as detector elements) that contain a sequence complementary to 5'-end of the ssRNA. The RNA aptamers attached to these detector elements are subsequently used in SPRI measurements for the bioaffinity detection of protein biomarkers. The microfluidic generator-detector element format permits the simultaneous fabrication of multiple ssRNA oligonucleotides with different capture sequences that can hybridize simultaneously to distinct detector elements and thus create a multiplexed aptamer microarray. In an initial set of demonstration experiments, SPRI measurements are used to monitor the bioaffinity adsorption of human thrombin (hTh) and vascular endothelial growth factor (VEGF) proteins onto RNA aptamer microarrays fabricated in situ with this on-chip RNA polymerase synthesis methodology. Additional SPRI measurements of the hydrolysis and desorption of the surface-bound ssRNA aptamers with a surface RNase H are used to verify the capture of ssRNA with RNA-DNA surface hybridization onto the detector elements. The on-chip RNA synthesis described here is an elegant, one-step multiplexed methodology for the rapid and contamination-free fabrication of RNA aptamer microarrays for protein biosensing with SPRI.

  7. SERS active colloidal nanoparticles for the detection of small blood biomarkers using aptamers

    NASA Astrophysics Data System (ADS)

    Marks, Haley; Mabbott, Samuel; Jackson, George W.; Graham, Duncan; Cote, Gerard L.

    2015-03-01

    Functionalized colloidal nanoparticles for SERS serve as a promising multifunctional assay component for blood biomarker detection. Proper design of these nanoprobes through conjugation to spectral tags, protective polymers, and sensing ligands can provide experimental control over the sensitivity, range, reproducibility, particle stability, and integration with biorecognition assays. Additionally, the optical properties and degree of electromagnetic SERS signal enhancement can be altered and monitored through tuning the nanoparticle shape, size, material and the colloid's local surface plasmon resonance (LSPR). Aptamers, synthetic affinity ligands derived from nucleic acids, provide a number of advantages for biorecognition of small molecules and toxins with low immunogenicity. DNA aptamers are simpler and more economical to produce at large scale, are capable of greater specificity and affinity than antibodies, are easily tailored to specific functional groups, can be used to tune inter-particle distance and shift the LSPR, and their intrinsic negative charge can be utilized for additional particle stability.1,2 Herein, a "turn-off" competitive binding assay platform involving two different plasmonic nanoparticles for the detection of the toxin bisphenol A (BPA) using SERS is presented. A derivative of the toxin is immobilized onto a silver coated magnetic nanoparticle (Ag@MNP), and a second solid silver nanoparticle (AgNP) is functionalized with the BPA aptamer and a Raman reporter molecule (RRM). The capture (Ag@MNP) and probe (AgNP) particles are mixed and the aptamer binding interaction draws the nanoparticles closer together, forming an assembly that results in an increased SERS signal intensity. This aptamer mediated assembly of the two nanoparticles results in a 100x enhancement of the SERS signal intensity from the RRM. These pre-bound aptamer/nanoparticle conjugates were then exposed to BPA in free solution and the competitive binding event was monitored

  8. Fluorescence-Based Strategies to Investigate the Structure and Dynamics of Aptamer-Ligand Complexes

    PubMed Central

    Perez-Gonzalez, Cibran; Lafontaine, Daniel A.; Penedo, J. Carlos

    2016-01-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labeling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labeled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these

  9. An aptamer based competition assay for protein detection using CNT activated gold-interdigitated capacitor arrays.

    PubMed

    Qureshi, Anjum; Roci, Irena; Gurbuz, Yasar; Niazi, Javed H

    2012-04-15

    An aptamer can specifically bind to its target molecule, or hybridize with its complementary strand. A target bound aptamer complex has difficulty to hybridize with its complementary strand. It is possible to determine the concentration of target based on affinity separation system for the protein detection. Here, we exploited this property using C-reactive protein (CRP) specific RNA aptamers as probes that were immobilized by physical adsorption on carbon nanotubes (CNTs) activated gold interdigitated electrodes of capacitors. The selective binding ability of RNA aptamer with its target molecule was determined by change in capacitance after allowing competitive binding with CRP and complementary RNA (cRNA) strands in pure form and co-mixtures (CRP:cRNA=0:1, 1:0, 1:1, 1:2 and 2:1). The sensor showed significant capacitance change with pure forms of CRP/cRNA while responses reduced considerably in presence of CRP:cRNA in co-mixtures (1:1 and 1:2) because of the binding competition. At a critical CRP:cRNA ratio of 2:1, the capacitance response was dramatically lost because of the dissociation of adsorbed aptamers from the sensor surface to bind when excess CRP. Binding assays showed that the immobilized aptamers had strong affinity for cRNA (K(d)=1.98 μM) and CRP molecules (K(d)=2.4 μM) in pure forms, but low affinity for CRP:cRNA ratio of 2:1 (K(d)=8.58 μM). The dynamic detection range for CRP was determined to be 1-8 μM (0.58-4.6 μg/capacitor). The approach described in this study is a sensitive label-free method to detect proteins based on affinity separation of target molecules that can potentially be used for probing molecular interactions.

  10. A method for selecting structure-switching aptamers applied to a colorimetric gold nanoparticle assay.

    PubMed

    Martin, Jennifer A; Smith, Joshua E; Warren, Mercedes; Chávez, Jorge L; Hagen, Joshua A; Kelley-Loughnane, Nancy

    2015-02-28

    Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to

  11. Selection of aptamers specific for glycated hemoglobin and total hemoglobin using on-chip SELEX.

    PubMed

    Lin, Hsin-I; Wu, Ching-Chu; Yang, Ching-Hsuan; Chang, Ko-Wei; Lee, Gwo-Bin; Shiesh, Shu-Chu

    2015-01-21

    Blood glycated hemoglobin (HbA1c) levels reflecting average glucose concentrations over the past three months are fundamental for the diagnosis, monitoring, and risk assessment of diabetes. It has been hypothesized that aptamers, which are single-stranded DNAs or RNAs that demonstrate high affinity to a large variety of molecules ranging from small drugs, metabolites, or proteins, could be used for the measurement of HbA1c. Aptamers are selected through an in vitro process called systematic evolution of ligands by exponential enrichment (SELEX), and they can be chemically synthesized with high reproducibility at relatively low costs. This study therefore aimed to select HbA1c- and hemoglobin (Hb)-specific single-stranded DNA aptamers using an on-chip SELEX protocol. A microfluidic SELEX chip was developed to continuously and automatically carry out multiple rounds of SELEX to screen specific aptamers for HbA1c and Hb. HbA1c and Hb were first coated onto magnetic beads. Following several rounds of selection and enrichment with a randomized 40-mer DNA library, specific oligonucleotides were selected. The binding specificity and affinity were assessed by competitive and binding assays. Using the developed microfluidic system, the incubation and partitioning times were greatly decreased, and the entire process was shortened dramatically. Both HbA1c- and Hb-specific aptamers selected by the microfluidic system showed high specificity and affinity (dissociation constant, Kd = 7.6 ± 3.0 nM and 7.3 ± 2.2 nM for HbA1c and Hb, respectively). With further refinements in the assay, these aptamers may replace the conventional antibodies for in vitro diagnostics applications in the near future.

  12. An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria.

    PubMed

    Song, Min Young; Jurng, Jongsoo; Park, Young-Kwon; Kim, Byoung Chan

    2016-11-15

    We developed TiO2 particles conjugated with an Escherichia coli surface-specific ssDNA aptamer cocktail (composed of three different aptamers isolated from E. coli) for targeted and enhanced disinfection of E. coli. We examined the target-specific and enhanced inactivation of this composite (TiO2-Apc), which were compared to those of TiO2 conjugated with a single aptamer (one of the three different aptamers, TiO2-Aps) and non-modified TiO2. We found that TiO2-Apc enhanced the inactivation of targeted E. coli under UV irradiation compared to both the non-modified TiO2 and TiO2-Aps. A higher number of TiO2-Apc than TiO2-Aps particles was observed on the surface of E. coli. The amount of TiO2-Apc required to inactivate ∼99.9% of E. coli (10(6) CFU/ml) was 10 times lower than that of non-modified TiO2. The close proximity of functionalized particles with E. coli resulting from the interaction between the target surface and the aptamer induced the efficient and fast transfer of reactive oxygen species to the cells. In a mixed culture of different bacteria (E. coli and Staphylococcus epidermidis), TiO2-Apc enhanced the inactivation of only E. coli. Taken together, these results support the use of aptamer cocktail-conjugated TiO2 for improvement of the target-specific inactivation of bacteria.

  13. Highly Sensitive Colorimetric Detection of Ochratoxin A by a Label-Free Aptamer and Gold Nanoparticles

    PubMed Central

    Luan, Yunxia; Chen, Jiayi; Li, Cheng; Xie, Gang; Fu, Hailong; Ma, Zhihong; Lu, Anxiang

    2015-01-01

    A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OTA) was developed using a cationic polymer and gold nanoparticles (AuNPs). The OTA aptamer was used as a recognition element for the colorimetric detection of OTA based on the aggregation of AuNPs by the cationic polymer. By spectroscopic quantitative analysis, the colorimetric assay could detect OTA down to 0.009 ng/mL with high selectivity in the presence of other interfering toxins. This study offers a new alternative in visual detection methods that is rapid and sensitive for OTA detection. PMID:26690477

  14. Highly Sensitive Colorimetric Detection of Ochratoxin A by a Label-Free Aptamer and Gold Nanoparticles.

    PubMed

    Luan, Yunxia; Chen, Jiayi; Li, Cheng; Xie, Gang; Fu, Hailong; Ma, Zhihong; Lu, Anxiang

    2015-12-10

    A label-free aptamer-based assay for the highly sensitive and specific detection of Ochratoxin A (OTA) was developed using a cationic polymer and gold nanoparticles (AuNPs). The OTA aptamer was used as a recognition element for the colorimetric detection of OTA based on the aggregation of AuNPs by the cationic polymer. By spectroscopic quantitative analysis, the colorimetric assay could detect OTA down to 0.009 ng/mL with high selectivity in the presence of other interfering toxins. This study offers a new alternative in visual detection methods that is rapid and sensitive for OTA detection.

  15. Aptamer-Assisted Detection of the Altered Expression of Estrogen Receptor Alpha in Human Breast Cancer

    PubMed Central

    Ahirwar, Rajesh; Vellarikkal, Shamsudheen Karuthedath; Sett, Arghya; Sivasubbu, Sridhar; Scaria, Vinod; Bora, Utpal; Borthakur, Bibhuti Bhusan; Kataki, Amal Chandra; Sharma, Jagannath Dev; Nahar, Pradip

    2016-01-01

    An increase in the expression of estrogen receptors (ER) and the expanded population of ER-positive cells are two common phenotypes of breast cancer. Detection of the aberrantly expressed ERα in breast cancer is carried out using ERα-antibodies and radiolabelled ligands to make decisions about cancer treatment and targeted therapy. Capitalizing on the beneficial advantages of aptamer over the conventional antibody or radiolabelled ligand, we have identified a DNA aptamer that selectively binds and facilitates the detection of ERα in human breast cancer tissue sections. The aptamer is identified using the high throughput sequencing assisted SELEX screening. Biophysical characterization confirms the binding and formation of a thermodynamically stable complex between the identified DNA aptamer (ERaptD4) and ERα (Ka = 1.55±0.298×108 M-1; ΔH = 4.32×104±801.1 cal/mol; ΔS = -108 cal/mol/deg). Interestingly, the specificity measurements suggest that the ERaptD4 internalizes into ERα-positive breast cancer cells in a target-selective manner and localizes specifically in the nuclear region. To harness these characteristics of ERaptD4 for detection of ERα expression in breast cancer samples, we performed the aptamer-assisted histochemical analysis of ERα in tissue samples from breast cancer patients. The results were validated by performing the immunohistochemistry on same samples with an ERα-antibody. We found that the two methods agree strongly in assay output (kappa value = 0.930, p-value <0.05 for strong ERα positive and the ERα negative samples; kappa value = 0.823, p-value <0.05 for the weak/moderate ER+ve samples, n = 20). Further, the aptamer stain the ERα-positive cells in breast tissues without cross-reacting to ERα-deficient fibroblasts, adipocytes, or the inflammatory cells. Our results demonstrate a significant consistency in the aptamer-assisted detection of ERα in strong ERα positive, moderate ERα positive and ERα negative breast cancer

  16. Transition model for ricin-aptamer interactions with multiple pathways and energy barriers

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Xu, Bingqian

    2014-02-01

    We develop a transition model to interpret single-molecule ricin-aptamer interactions with multiple unbinding pathways and energy barriers measured by atomic force microscopy dynamic force spectroscopy. Molecular simulations establish the relationship between binding conformations and the corresponding unbinding pathways. Each unbinding pathway follows a Bell-Evans multiple-barrier model. Markov-type transition matrices are developed to analyze the redistribution of unbinding events among the pathways under different loading rates. Our study provides detailed information about complex behaviors in ricin-aptamer unbinding events.

  17. DNA Aptamers to Human Immunodeficiency Virus Reverse Transcriptase Selected by a Primer-Free SELEX Method: Characterization and Comparison with Other Aptamers

    PubMed Central

    Lai, Yi-Tak

    2012-01-01

    A 30-nucleotide DNA aptamer (5′-AGGAAGGCTTTAGGTCTGAGATCTCGGAAT-3′, denoted PF1) selected for high affinity to human immunodeficiency virus reverse transcriptase (HIV RT) using a primer-free SELEX (systematic evolution of ligands by exponential enrichment) method was characterized to determine features promoting tight binding. PF1's equilibrium dissociation constant for RT was ∼80 nM, over 10-fold lower than a random 30-mer. Changing the 2 terminal diguanosine repeats (underlined above) to diadenosine or dithymidine modestly decreased binding. Any changes to the 2 central diguanosines dramatically decreased binding. Binding was highly sensitive to length, with any truncations that deleted part of the 4 diguanosine motifs resulting in a 6-fold or more decrease in affinity. Even a construct with all the diguanosine motifs but lacking the 5′ terminal A and 3 nucleotides at the 3′ end showed ∼3-fold binding decrease. Changes to the nucleotides between the diguanosines, even those that did not alter PF1's low secondary structure (free energy of folding ΔG=−0.61 kcal/mol), dramatically decreased binding, suggesting sequence specificity. Despite the diguanosine motifs, circular dichroism (CD) spectra indicated that PF1 did not form a G-quartet. PF1 inhibited HIV RT synthesis with a half-maximal inhibitory value (IC50) of ∼60 nM. Larger, more structured RT DNA aptamers based on the HIV polypurine tract and those that formed G-quartets (denoted S4 and R1T) were more potent inhibitors, with IC50 values of ∼4 and ∼1 nM, respectively. An RNA pseudoknot aptamer (denoted 1.1) showed an IC50 near 4 nM. Competition binding assays with PF1 and several previously characterized RT aptamers indicated that they all bound at or near the primer–template pocket. These other more structured and typically larger aptamers bound more tightly than PF1 to RT based on filter binding assays. Results indicate that PF1 represents a new class of RT aptamers that are

  18. mRNA imaging in the chloroplast of Chlamydomonas reinhardtii using the light-up aptamer Spinach.

    PubMed

    Guzmán-Zapata, Daniel; Domínguez-Anaya, Yael; Macedo-Osorio, Karla S; Tovar-Aguilar, Andrea; Castrejón-Flores, José L; Durán-Figueroa, Noé V; Badillo-Corona, Jesús A

    2017-03-27

    Light-up aptamers are practical tools to image RNA localization in vivo. A now classical light-up aptamer system is the combination of the 3,5-difluoro-4-hydroxybenzylidene (DFHBI) fluorogen and the RNA aptamer Spinach, which has been successfully used in bacterial and mammalian cells. However, light-up aptamers have not been used in algae. Here, we show that a simple vector, carrying Spinach, transcriptionally fused to the aphA-6 gene, can be effectively used to generate a functional light-up aptamer in the chloroplast of C. reinhardtii. After incubation with DFHBI, lines expressing the aphA-6/Spinach mRNA were observed with laser confocal microscopy to evaluate the functionality of the light-up aptamer in the chloroplast of C. reinhardtii. Clear and strong fluorescence was localized to the chloroplast, in the form of discrete spots. There was no background fluorescence in the strain lacking Spinach. Light-up aptamers could be further engineered to image RNA or to develop genetically encoded biosensors in algae.

  19. Progress in Aptamer-Mediated Drug Delivery Vehicles for Cancer Targeting and Its Implications in Addressing Chemotherapeutic Challenges

    PubMed Central

    Zhu, Jie; Huang, He; Dong, Shiwu; Ge, Liang; Zhang, Yuan

    2014-01-01

    Aptamers are novel oligonucleotides with flexible three-dimensional configurations that recognize and bind to their cognate targets, including tumor surface receptors, in a high-affinity and highly specific manner. Because of their unique intrinsic properties, a variety of aptamer-mediated nanovehicles have been developed to directionally transport anti-cancer drugs to tumor sites to minimize systemic cytotoxicity and to enhance permeation by these tumoricidal agents. Despite advances in the selection and synthesis of aptamers and in the conjugation and self-assembly of nanotechnologies, current chemotherapy and drug delivery systems face great challenges. These challenges are due to the limitations of aptamers and vehicles and because of complicated tumor mechanisms, including heterogeneity, anti-cancer drug resistance, and hypoxia-induced aberrances. In this review, we will summarize current approaches utilizing tumor surface hallmarks and aptamers and their roles and mechanisms in therapeutic nanovehicles targeting tumors. Delivery forms include nanoparticles, nanotubes, nanogels, aptamer-drug conjugates, and novel molecular trains. Moreover, the obstacles posed by the aforementioned issues will be highlighted, and possible solutions will be acknowledged. Furthermore, future perspectives will be presented, including cutting-edge integration with RNA interference nanotechnology and personalized chemotherapy, which will facilitate innovative approaches to aptamer-based therapeutics. PMID:25057317

  20. Tumor cell-specific photothermal killing by SELEX-derived DNA aptamer-targeted gold nanorods

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Ramya; Lee, Alexander Sheng Wei; Yap, Lim Wei; Jans, David A.; Wagstaff, Kylie M.; Cheng, Wenlong

    2015-12-01

    Despite widespread availability of cytotoxic chemotherapeutic agents, the killing of tumour cells without affecting healthy surrounding tissue remains elusive, although recent developments in terms of plasmonic nanoparticles capable of photothermal killing have some promise. Here we describe novel DNA aptamer-tethered gold nanorods (GNRs) that act as efficient photothermal therapeutics against tumour cells, but not their isogenic normal cell counterparts. A modified Cell-SELEX process was developed to select a novel DNA aptamer (KW16-13) that specifically recognised and was internalised by cells of the MCF10CA1h human breast ductal carcinoma line but not by those of its isogenic normal counterpart (MCF10A). GNRs conjugated to KW16-13 were readily internalized by the MCF10CA1h tumour cells with minimal uptake by MCF10A normal cells. Upon near infrared (NIR) light irradiation, tumour cell death of >96%, could be effected, compared to <1% in the normal cells or cells incubated with GNRs alone, our KW16-13 aptamer-targeted GNRs thus showing >71-fold tumor cell death than GNRs-targeted with a previously described aptamer. This demonstrates the significant potential for aptamer functionalised-GNRs to be used effective and above all selective anti-cancer photothermal therapeutics.Despite widespread availability of cytotoxic chemotherapeutic agents, the killing of tumour cells without affecting healthy surrounding tissue remains elusive, although recent developments in terms of plasmonic nanoparticles capable of photothermal killing have some promise. Here we describe novel DNA aptamer-tethered gold nanorods (GNRs) that act as efficient photothermal therapeutics against tumour cells, but not their isogenic normal cell counterparts. A modified Cell-SELEX process was developed to select a novel DNA aptamer (KW16-13) that specifically recognised and was internalised by cells of the MCF10CA1h human breast ductal carcinoma line but not by those of its isogenic normal

  1. Enzymatic cleavage and mass amplification strategy for small molecule detection using aptamer-based fluorescence polarization biosensor.

    PubMed

    Kang, Liping; Yang, Bin; Zhang, Xiaobing; Cui, Liang; Meng, Hongmin; Mei, Lei; Wu, Cuichen; Ren, Songlei; Tan, Weihong

    2015-06-16

    Fluorescence polarization (FP) assays incorporated with fluorophore-labeled aptamers have attracted great interest in recent years. However, detecting small molecules through the use of FP assays still remains a challenge because small-molecule binding only results in negligible changes in the molecular weight of the fluorophore-labeled aptamer. To address this issue, we herein report a fluorescence polarization (FP) aptamer assay that incorporates a novel signal amplification strategy for highly sensitive detection of small molecules. In the absence of adenosine, our model target, free FAM-labeled aptamer can be digested by nuclease, resulting in the release of FAM-labeled nucleotide segments from the dT-biotin/streptavidin complex with weak background signal. However, in the presence of target, the FAM-labeled aptamer-target complex protects the FAM-labeled aptamer from nuclease cleavage, allowing streptavidin to act as a molar mass amplifier. The resulting increase in molecular mass and FP intensity of the aptamer-target complex provides improved sensitivity for concentration measurement. The probe could detect adenosine from 0.5 μM to 1000 μM, with a detection limit of 500 nM, showing that the sensitivity of the probe is superior to aptamer-based FP approaches previously reported for adenosine. Importantly, FP could resist environmental interferences, making it useful for complex biological samples without any tedious sample pretreatments. Our results demonstrate that this dual-amplified, aptamer-based strategy can be used to design fluorescence polarization probes for rapid, sensitive, and selective measurement of small molecules in complicated biological environment.

  2. Acyclic Identification of Aptamers for Human alpha-Thrombin Using Over-Represented Libraries and Deep Sequencing

    PubMed Central

    Kupakuwana, Gillian V.; Crill, James E.; McPike, Mark P.; Borer, Philip N.

    2011-01-01

    Background Aptamers are oligonucleotides that bind proteins and other targets with high affinity and selectivity. Twenty years ago elements of natural selection were adapted to in vitro selection in order to distinguish aptamers among randomized sequence libraries. The primary bottleneck in traditional aptamer discovery is multiple cycles of in vitro evolution. Methodology/Principal Findings We show that over-representation of sequences in aptamer libraries and deep sequencing enables acyclic identification of aptamers. We demonstrated this by isolating a known family of aptamers for human α-thrombin. Aptamers were found within a library containing an average of 56,000 copies of each possible randomized 15mer segment. The high affinity sequences were counted many times above the background in 2–6 million reads. Clustering analysis of sequences with more than 10 counts distinguished two sequence motifs with candidates at high abundance. Motif I contained the previously observed consensus 15mer, Thb1 (46,000 counts), and related variants with mostly G/T substitutions; secondary analysis showed that affinity for thrombin correlated with abundance (Kd = 12 nM for Thb1). The signal-to-noise ratio for this experiment was roughly 10,000∶1 for Thb1. Motif II was unrelated to Thb1 with the leading candidate (29,000 counts) being a novel aptamer against hexose sugars in the storage and elution buffers for Concanavilin A (Kd = 0.5 µM for α-methyl-mannoside); ConA was used to immobilize α-thrombin. Conclusions/Significance Over-representation together with deep sequencing can dramatically shorten the discovery process, distinguish aptamers having a wide range of affinity for the target, allow an exhaustive search of the sequence space within a simplified library, reduce the quantity of the target required, eliminate cycling artifacts, and should allow multiplexing of sequencing experiments and targets. PMID:21625587

  3. Quantum dot coating of baculoviral vectors enables visualization of transduced cells and tissues

    SciTech Connect

    Zhao, Ying; Lo, Seong Loong; Zheng, Yuangang; Lam, Dang Hoang; Wu, Chunxiao; Han, Ming Yong; Wang, Shu

    2013-04-26

    Highlights: •The use of quantum dot (QD)-labeled viral vectors for in vivo imaging is not well investigated. •A new method to label enveloped baculovirus with glutathione-capped CdTe QDs is developed. •The labeling enables the identification of transduced, cultured cells based on fluorescence. •The labeling also allows evaluation of viral transduction in a real-time manner in living mice. •The method has the potential to assess viral vector-based gene therapy protocols in future. -- Abstract: Imaging of transduced cells and tissues is valuable in developing gene transfer vectors and evaluating gene therapy efficacy. We report here a simple method to use bright and photostable quantum dots to label baculovirus, an emerging gene therapy vector. The labeling was achieved through the non-covalent interaction of glutathione-capped CdTe quantum dots with the virus envelope, without the use of chemical conjugation. The quantum dot labeling was nondestructive to viral transduction function and enabled the identification of baculoviral vector-transduced, living cells based on red fluorescence. When the labeled baculoviral vectors were injected intravenously or intraventricularly for in vivo delivery of a transgene into mice, quantum dot fluorescence signals allow us monitor whether or not the injected tissues were transduced. More importantly, using a dual-color whole-body imaging technology, we demonstrated that in vivo viral transduction could be evaluated in a real-time manner in living mice. Thus, our method of labeling a read-to-use gene delivery vector with quantum dots could be useful towards the improvement of vector design and will have the potential to assess baculovirus-based gene therapy protocols in future.

  4. In Vivo Selection Against Human Colorectal Cancer Xenografts Identifies an Aptamer That Targets RNA Helicase Protein DHX9

    PubMed Central

    Mi, Jing; Ray, Partha; Liu, Jenny; Kuan, Chien-Tsun; Xu, Jennifer; Hsu, David; Sullenger, Bruce A; White, Rebekah R; Clary, Bryan M

    2016-01-01

    The ability to selectively target disease-related tissues with molecules is critical to the design of effective therapeutic and diagnostic reagents. Recognizing the differences between the in vivo environment and in vitro conditions, we employed an in vivo selection strategy to identify RNA aptamers (targeting motifs) that could localize to tumor in situ. One of the selected molecules is an aptamer that binds to the protein DHX9, an RNA helicase that is known to be upregulated in colorectal cancer. Upon systemic administration, the aptamer preferentially localized to the nucleus of cancer cells in vivo and thus has the potential to be used for targeted delivery. PMID:27115840

  5. DNA-based aptamer fails as a simultaneous cancer targeting agent and drug delivery vehicle for a phenanthroline-based platinum(II) complex.

    PubMed

    McGinely, Nicola L; Plumb, Jane A; Wheate, Nial J

    2013-11-01

    The sgc8c aptamer is a 41-base DNA oligonucleotide that binds to leukaemia cells with high affinity and specificity. In this work we examined the utility of this aptamer as both a delivery vehicle and an active targeting agent for an inert platinum complex [(1,10-phenathroline)(ethylenediamine)platinum(II)](2+). The aptamer forms a stem-and-loop confirmation as determined by circular dichroism. This conformation is adopted in both water and phosphate buffered saline solutions. The metal complex binds through intercalation into the aptamer's double helical stem with a binding constant of approximately 4.3 × 10(4) M(-1). Binding of the metal complex to the aptamer had a significant effect on the aptamer's global conformation, and increased its melting temperature by 28°C possibly through lengthening and stiffening of the aptamer stem. The effect of the aptamer on the metal complex's cytotoxicity and cellular uptake was determined using in vitro assays with the target leukaemia cell line CCRF-CEM and the off-target ovarian cancer cell lines A2780 and A2780cp70. The aptamer has little inherent cytotoxicity and when used to deliver the metal complex results in a significant decrease in the metal complex's cytotoxicity and uptake. The reason(s) for the poor uptake and activity may be due to the change in aptamer conformation which affects its ability to recognise leukaemia cells.

  6. Peptide aptamers: The versatile role of specific protein function inhibitors in plant biotechnology.

    PubMed

    Colombo, Monica; Mizzotti, Chiara; Masiero, Simona; Kater, Martin M; Pesaresi, Paolo

    2015-11-01

    In recent years, peptide aptamers have emerged as novel molecular tools that have attracted the attention of researchers in various fields of basic and applied science, ranging from medicine to analytical chemistry. These artificial short peptides are able to specifically bind, track, and inhibit a given target molecule with high affinity, even molecules with poor immunogenicity or high toxicity, and represent a remarkable alternative to antibodies in many different applications. Their use is on the rise, driven mainly by the medical and pharmaceutical sector. Here we discuss the enormous potential of peptide aptamers in both basic and applied aspects of plant biotechnology and food safety. The different peptide aptamer selection methods available both in vivo and in vitro are introduced, and the most important possible applications in plant biotechnology are illustrated. In particular, we discuss the generation of broad-based virus resistance in crops, "reverse genetics" and aptasensors in bioassays for detecting contaminations in food and feed. Furthermore, we suggest an alternative to the transfer of peptide aptamers into plant cells via genetic transformation, based on the use of cell-penetrating peptides that overcome the limits imposed by both crop transformation and Genetically Modified Organism commercialization.

  7. Aptamer/Polydopamine Nanospheres Nanocomplex for in Situ Molecular Sensing in Living Cells.

    PubMed

    Qiang, Weibing; Hu, Hongting; Sun, Liang; Li, Hui; Xu, Danke

    2015-12-15

    A nanocomplex was developed for molecular sensing in living cells, based on the fluorophore-labeled aptamer and the polydopamine nanospheres (PDANS). Due to the interaction between ssDNA and PDANS, the aptamer was adsorbed onto the surface of PDANS forming the aptamer/PDANS nanocomplex, and the fluorescence was quenched by PDANS through Förster resonance energy transfer (FRET). In vitro assay, the introduction of adenosine triphosphate (ATP) led to the dissociation of the aptamer from the PDANS and the recovery of the fluorescence. The retained fluorescence of the nanocomplex was found to be linear with the concentration of ATP in the range of 0.01-2 mM, and the nanocomplex was highly selective toward ATP. For the strong protecting capability to nucleic acids from enzymatic cleavage and the excellent biocompatibility of PDANS, the nanocomplex was transported into cells and successfully realized "signal on" sensing of ATP in living cells; moreover, the nanocomplex could be employed for ATP semiquantification. This design provides a strategy to develop biosensors based on the polydopamine nanomaterials for intracellular molecules analysis. For the advantages of polydopamine, it would be an excellent candidate for many biological applications, such as gene and drug delivery, intracellular imaging, and in vivo monitoring.

  8. Ultrasensitive electrochemical aptasensor for thrombin based on the amplification of aptamer-AuNPs-HRP conjugates.

    PubMed

    Zhao, Jie; Zhang, Youyu; Li, Haitao; Wen, Yanqing; Fan, Xiaoyu; Lin, Fanbo; Tan, Liang; Yao, Shouzhuo

    2011-01-15

    Successful development of an ultrasensitive and highly specific electrochemical aptasensor for thrombin based on amplification of aptamer-gold nanoparticles-horseradish peroxidase (aptamer-AuNPs-HRP) conjugates was reported. In this electrochemical protocol, aptamer1 (Apt1) was immobilized on core/shell Fe(3)O(4)/Au magnetic nanoparticles (AuMNPs) and served as capture probe. Aptamer2 (Apt2) was dual labeled with AuNPs and HRP and used as detection probe. In the presence of thrombin, the sandwich format of AuMNPs-Apt1/thrombin/Apt2-AuNPs-HRP was fabricated. Remarkable signal amplification was realized by taking the advantage of AuNPs and catalytic reactions of HRP. Other proteins, such as human serum albumin, lysozyme, fibrinogen, and IgG did not show significant interference with the assay for thrombin. Linear response to thrombin concentration in the range of 0.1-60 pM and lower detection limit down to 30 fM (S/N=3) was obtained with the proposed method. This electrochemical aptasensor is simple, rapid (the whole detection period for a thrombin sample is less than 35 min), sensitive and highly specific, it shows promising potential in protein detection and disease diagnosis.

  9. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation.

    PubMed

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-08-11

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice.

  10. Enzyme-linked, aptamer-based, competitive biolayer interferometry biosensor for palytoxin.

    PubMed

    Gao, Shunxiang; Zheng, Xin; Hu, Bo; Sun, Mingjuan; Wu, Jihong; Jiao, Binghua; Wang, Lianghua

    2017-03-15

    In this study, we coupled biolayer interferometry (BLI) with competitive binding assay through an enzyme-linked aptamer and developed a real-time, ultra-sensitive, rapid quantitative method for detection of the marine biotoxin palytoxin. Horseradish peroxidase-labeled aptamers were used as biorecognition receptors to competitively bind with palytoxin, which was immobilized on the biosensor surface. The palytoxin: horseradish peroxidase-aptamer complex was then submerged in a 3,3'-diaminobenzidine solution, which resulted in formation of a precipitated polymeric product directly on the biosensor surface and a large change in the optical thickness of the biosensor layer. This change could obviously shift the interference pattern and generate a response profile on the BLI biosensor. The biosensor showed a broad linear range for palytoxin (200-700pg/mL) with a low detection limit (0.04pg/mL). Moreover, the biosensor was applied to the detection of palytoxin in spiked extracts and showed a high degree of selectivity for palytoxin, good reproducibility, and stability. This enzyme-linked, aptamer-based, competitive BLI biosensor offers a promising method for rapid and sensitive detection of palytoxin and other analytes.

  11. Fluorescence detection of adenosine triphosphate through an aptamer-molecular beacon multiple probe.

    PubMed

    Zeng, Xiaodan; Zhang, Xiaoling; Yang, Wen; Jia, Hongying; Li, Yamin

    2012-05-01

    An aptamer-molecular beacon (MB) multiple fluorescent probe for adenosine triphosphate (ATP) assay is proposed in this article. The ATP aptamer was used as a molecular recognition part, and an oligonucleotide (short strand, SS) partially complementary with the aptamer and an MB was used as the other part. In the presence of ATP, the aptamer bound with it, accompanied by the hybridization of MB and SS and the fluorescence recovering. Wherever there is only very weak fluorescence can be measured in the absence of ATP. Based on the relationship of recovering fluorescence and the concentration of ATP, a method for quantifying ATP has been developed. The fluorescence intensity was proportional