Science.gov

Sample records for quantum dot-labeled aptamer

  1. Quantum dot-labeled aptamer nanoprobes specifically targeting glioma cells

    NASA Astrophysics Data System (ADS)

    Chen, Xue-Chai; Deng, Yu-Lin; Lin, Yi; Pang, Dai-Wen; Qing, Hong; Qu, Feng; Xie, Hai-Yan

    2008-06-01

    Two new techniques, aptamer-based specific recognition and quantum dot (QD)-based fluorescence labeling, are becoming increasingly important in biosensing. In this study, these two techniques have been coupled together to construct a new kind of fluorescent QD-labeled aptamer (QD-Apt) nanoprobe by conjugating GBI-10 aptamer to the QD surface. GBI-10 is a single-stranded DNA (ssDNA) aptamer for tenascin-C, which distributes on the surface of glioma cells as a dominant extracellular matrix protein. The QD-Apt nanoprobe can recognize the tenascin-C on the human glioma cell surface, which will be helpful for the development of new convenient and sensitive in vitro diagnostic assays for glioma. The QD-Apt nanoprobe has particular features such as strong fluorescence, stability, monodispersity and uniformity. In addition, this probe preparation method is universal, so it is expected to provide a new type of stable nanoprobe for high-throughput and fast biosensing detection and bioimaging. New methods for real-time and dynamic tracking and imaging can be accordingly developed.

  2. Aptamer-mediated indirect quantum dot labeling and fluorescent imaging of target proteins in living cells

    NASA Astrophysics Data System (ADS)

    Liu, Jianbo; Zhang, Pengfei; Yang, Xiaohai; Wang, Kemin; Guo, Qiuping; Huang, Jin; Li, Wei

    2014-12-01

    Protein labeling for dynamic living cell imaging plays a significant role in basic biological research, as well as in clinical diagnostics and therapeutics. We have developed a novel strategy in which the dynamic visualization of proteins within living cells is achieved by using aptamers as mediators for indirect protein labeling of quantum dots (QDs). With this strategy, the target protein angiogenin was successfully labeled with fluorescent QDs in a minor intactness model, which was mediated by the aptamer AL6-B. Subsequent living cell imaging analyses indicated that the QDs nanoprobes were selectively bound to human umbilical vein endothelial cells, gradually internalized into the cytoplasm, and mostly localized in the lysosome organelle, indicating that the labeled protein retained high activity. Compared with traditional direct protein labeling methods, the proposed aptamer-mediated strategy is simple, inexpensive, and provides a highly selective, stable, and intact labeling platform that has shown great promise for future biomedical labeling and intracellular protein dynamic analyses.

  3. Lymph node mapping using quantum dot-labeled polymersomes.

    PubMed

    Bakalova, Rumiana; Zhelev, Zhivko; Nikolova, Biliana; Murayama, Shuhei; Lazarova, Desislava; Tsoneva, Iana; Aoki, Ichio

    2015-10-01

    The present study was designed to investigate whether poly-ion complex hollow vesicles (polymersomes), based on chemically-modified chitosan, are appropriate for lymph node mapping in the context of their application in the development of theranostic nanosized drug delivery systems (nano-DDS). The experiments were performed on Balb/c nude mice (colon cancer-grafted). The mice were subjected to anesthesia and quantum dot (QD(705))-labeled polymersomes (d-120 nm) were injected intravenously via the tail vein. The optical imaging was carried out on Maestro EX Imaging System (excitation filter: 435-480 nm; emission filter: 700 nm). A strong fluorescent signal, corresponding to QD(705) fluorescence, was detected in the lymph nodes, as well as in the tumor. A very weak fluorescent signal was found in the liver area. The half-life of QD(705)-labelled polymersomes was 6 ± 2 hours in the bloodstream and 11 ± 3 hours in the lymph nodes. The data suggest that polymersomes are very promising carriers for lymph node mapping using QD as a contrast agent. They are useful matrix for development of nano-formulations with theranostic capabilities.

  4. Real-time Imaging of Axonal Transport of Quantum Dot-labeled BDNF in Primary Neurons

    PubMed Central

    Zhao, Xiaobei; Zhou, Yue; Weissmiller, April M.; Pearn, Matthew L.; Mobley, William C.; Wu, Chengbiao

    2014-01-01

    BDNF plays an important role in several facets of neuronal survival, differentiation, and function. Structural and functional deficits in axons are increasingly viewed as an early feature of neurodegenerative diseases, including Alzheimer’s disease (AD) and Huntington’s disease (HD). As yet unclear is the mechanism(s) by which axonal injury is induced. We reported the development of a novel technique to produce biologically active, monobiotinylated BDNF (mBtBDNF) that can be used to trace axonal transport of BDNF. Quantum dot-labeled BDNF (QD-BDNF) was produced by conjugating quantum dot 655 to mBtBDNF. A microfluidic device was used to isolate axons from neuron cell bodies. Addition of QD-BDNF to the axonal compartment allowed live imaging of BDNF transport in axons. We demonstrated that QD-BDNF moved essentially exclusively retrogradely, with very few pauses, at a moving velocity of around 1.06 μm/sec. This system can be used to investigate mechanisms of disrupted axonal function in AD or HD, as well as other degenerative disorders. PMID:25286194

  5. Dual-Quantum-Dots-Labeled Lateral Flow Strip Rapidly Quantifies Procalcitonin and C-reactive Protein

    NASA Astrophysics Data System (ADS)

    Qi, XiaoPing; Huang, YunYe; Lin, ZhongShi; Xu, Liang; Yu, Hao

    2016-03-01

    In the article, a dual-quantum-dots-labeled (dual-QDs-labeled) lateral flow strip (LFS) method was developed for the simultaneous and rapid quantitative detection of procalcitonin (PCT) and C-reactive protein (CRP) in the blood. Two QD-antibody conjugates with different fluorescence emission spectra were produced and sprayed on the LFS to capture PCT and CRP in the blood. Furthermore, a double antibody sandwich method for PCT and, meanwhile, a competitive inhibition method for CRP were employed in the LFS. For PCT and CRP in serum assayed by the dual-QDs-labeled LFS, their detection sensitivities reached 0.1 and 1 ng/mL, respectively, and their linear quantitative detection ranges were from 0.3 to 200 ng/mL and from 50 to 250 μg/mL, respectively. There was little evidence that the PCT and CRP assays would be interfered with each other. The correlations for testing CRP and PCT in clinical samples were 99.75 and 97.02 %, respectively, between the dual-QDs-labeled LFS we developed and commercial methods. The rapid quantification of PCT and CRP on dual-QDs-labeled LFS is of great clinical value to distinguish inflammation, bacterial infection, or viral infection and to provide guidance for the use of antibiotics or other medicines.

  6. A Quick and Parallel Analytical Method Based on Quantum Dots Labeling for ToRCH-Related Antibodies

    NASA Astrophysics Data System (ADS)

    Yang, Hao; Guo, Qing; He, Rong; Li, Ding; Zhang, Xueqing; Bao, Chenchen; Hu, Hengyao; Cui, Daxiang

    2009-12-01

    Quantum dot is a special kind of nanomaterial composed of periodic groups of II-VI, III-V or IV-VI materials. Their high quantum yield, broad absorption with narrow photoluminescence spectra and high resistance to photobleaching, make them become a promising labeling substance in biological analysis. Here, we report a quick and parallel analytical method based on quantum dots for ToRCH-related antibodies including Toxoplasma gondii, Rubella virus, Cytomegalovirus and Herpes simplex virus type 1 (HSV1) and 2 (HSV2). Firstly, we fabricated the microarrays with the five kinds of ToRCH-related antigens and used CdTe quantum dots to label secondary antibody and then analyzed 100 specimens of randomly selected clinical sera from obstetric outpatients. The currently prevalent enzyme-linked immunosorbent assay (ELISA) kits were considered as “golden standard” for comparison. The results show that the quantum dots labeling-based ToRCH microarrays have comparable sensitivity and specificity with ELISA. Besides, the microarrays hold distinct advantages over ELISA test format in detection time, cost, operation and signal stability. Validated by the clinical assay, our quantum dots-based ToRCH microarrays have great potential in the detection of ToRCH-related pathogens.

  7. CdSe/ZnS Quantum Dots-Labeled Mesenchymal Stem Cells for Targeted Fluorescence Imaging of Pancreas Tissues and Therapy of Type 1 Diabetic Rats.

    PubMed

    Liu, Haoqi; Tang, Wei; Li, Chao; Lv, Pinlei; Wang, Zheng; Liu, Yanlei; Zhang, Cunlei; Bao, Yi; Chen, Haiyan; Meng, Xiangying; Song, Yan; Xia, Xiaoling; Pan, Fei; Cui, Daxiang; Shi, Yongquan

    2015-12-01

    Mesenchymal stem cells (MSCs) have been used for therapy of type 1 diabetes mellitus. However, the in vivo distribution and therapeutic effects of transplanted MSCs are not clarified well. Herein, we reported that CdSe/ZnS quantum dots-labeled MSCs were prepared for targeted fluorescence imaging and therapy of pancreas tissues in rat models with type 1 diabetes. CdSe/ZnS quantum dots were synthesized, their biocompatibility was evaluated, and then, the appropriate concentration of quantum dots was selected to label MSCs. CdSe/ZnS quantum dots-labeled MSCs were injected into mouse models with type 1 diabetes via tail vessel and then were observed by using the Bruker In-Vivo F PRO system, and the blood glucose levels were monitored for 8 weeks. Results showed that prepared CdSe/ZnS quantum dots owned good biocompatibility. Significant differences existed in distribution of quantum dots-labeled MSCs between normal control rats and diabetic rats (p < 0.05). The ratios of the fluorescence intensity (RFI) analysis showed an accumulation rate of MSCs in the pancreas of rats in the diabetes group which was about 32 %, while that in the normal control group rats was about 18 %. The blood glucose levels were also monitored for 8 weeks after quantum dots-labeled MSC injection. Statistical differences existed between the blood glucose levels of the diabetic rat control group and MSC-injected diabetic rat group (p < 0.01), and the MSC-injected diabetic rat group displayed lower blood glucose levels. In conclusion, CdSe/ZnS-labeled MSCs can target in vivo pancreas tissues in diabetic rats, and significantly reduce the blood glucose levels in diabetic rats, and own potential application in therapy of diabetic patients in the near future. PMID:26078050

  8. CdSe/ZnS Quantum Dots-Labeled Mesenchymal Stem Cells for Targeted Fluorescence Imaging of Pancreas Tissues and Therapy of Type 1 Diabetic Rats

    NASA Astrophysics Data System (ADS)

    Liu, Haoqi; Tang, Wei; Li, Chao; Lv, Pinlei; Wang, Zheng; Liu, Yanlei; Zhang, Cunlei; Bao, Yi; Chen, Haiyan; Meng, Xiangying; Song, Yan; Xia, Xiaoling; Pan, Fei; Cui, Daxiang; Shi, Yongquan

    2015-06-01

    Mesenchymal stem cells (MSCs) have been used for therapy of type 1 diabetes mellitus. However, the in vivo distribution and therapeutic effects of transplanted MSCs are not clarified well. Herein, we reported that CdSe/ZnS quantum dots-labeled MSCs were prepared for targeted fluorescence imaging and therapy of pancreas tissues in rat models with type 1 diabetes. CdSe/ZnS quantum dots were synthesized, their biocompatibility was evaluated, and then, the appropriate concentration of quantum dots was selected to label MSCs. CdSe/ZnS quantum dots-labeled MSCs were injected into mouse models with type 1 diabetes via tail vessel and then were observed by using the Bruker In-Vivo F PRO system, and the blood glucose levels were monitored for 8 weeks. Results showed that prepared CdSe/ZnS quantum dots owned good biocompatibility. Significant differences existed in distribution of quantum dots-labeled MSCs between normal control rats and diabetic rats ( p < 0.05). The ratios of the fluorescence intensity (RFI) analysis showed an accumulation rate of MSCs in the pancreas of rats in the diabetes group, and was about 32 %, while that in the normal control group rats was about 18 %. The blood glucose levels were also monitored for 8 weeks after quantum dots-labeled MSC injection. Statistical differences existed between the blood glucose levels of the diabetic rat control group and MSC-injected diabetic rat group ( p < 0.01), and the MSC-injected diabetic rat group displayed lower blood glucose levels. In conclusion, CdSe/ZnS-labeled MSCs can target in vivo pancreas tissues in diabetic rats, and significantly reduce the blood glucose levels in diabetic rats, and own potential application in therapy of diabetic patients in the near future.

  9. In vivo study of immunogenicity and kinetic characteristics of a quantum dot-labelled baculovirus.

    PubMed

    Wang, Meng; Zheng, Zhenhua; Meng, Jin; Wang, Han; He, Man; Zhang, Fuxian; Liu, Yan; Hu, Bin; He, Zike; Hu, Qinxue; Wang, Hanzhong

    2015-09-01

    Nanomaterials conjugated with biomacromolecules, including viruses, have great potential for in vivo applications. Therefore, it is important to evaluate the safety of nanoparticle-conjugated macromolecule biomaterials (Nano-mbio). Although a number of studies have assessed the risks of nanoparticles and macromolecule biomaterials in living bodies, only a few of them investigated Nano-mbios. Here we evaluated the in vivo safety profile of a quantum dot-conjugated baculovirus (Bq), a promising new Nano-mbio, in mice. Each animal was injected twice intraperitoneally with 50 μg virus protein labelled with around 3*10(-5)nmol conjugated qds. Control animals were injected with PBS, quantum dots, baculovirus, or a mixture of quantum dots and baculovirus. Blood, tissues and body weight were analysed at a series of time points following both the first and the second injections. It turned out that the appearance and behaviour of the mice injected with Bq were similar to those injected with baculovirus alone. However, combination of baculovirus and quantum dot (conjugated or simply mixed) significantly induced stronger adaptive immune responses, and lead to a faster accumulation and longer existence of Cd in the kidneys. Thus, despite the fact that both quantum dot and baculovirus have been claimed to be safe in vivo, applications of Bq in vivo should be cautious. To our knowledge, this is the first study examining the interaction between a nanoparticle-conjugated virus and a living body from a safety perspective, providing a basis for in vivo application of other Nano-mbios.

  10. Single molecule resolution of the antimicrobial action of quantum dot-labeled sushi peptide on live bacteria

    PubMed Central

    Leptihn, Sebastian; Har, Jia Yi; Chen, Jianzhu; Ho, Bow; Wohland, Thorsten; Ding, Jeak Ling

    2009-01-01

    Background Antimicrobial peptides are found in all kingdoms of life. During the evolution of multicellular organisms, antimicrobial peptides were established as key elements of innate immunity. Most antimicrobial peptides are thought to work by disrupting the integrity of cell membranes, causing pathogen death. As antimicrobial peptides target the membrane structure, pathogens can only acquire resistance by a fundamental change in membrane composition. Hence, the evolution of pathogen resistance has been a slow process. Therefore antimicrobial peptides are valuable alternatives to classical antibiotics against which multiple drug-resistant bacteria have emerged. For potential therapeutic applications as antibiotics a thorough knowledge of their mechanism of action is essential. Despite the increasingly comprehensive understanding of the biochemical properties of these peptides, the actual mechanism by which antimicrobial peptides lyse microbes is controversial. Results Here we investigate how Sushi 1, an antimicrobial peptide derived from the horseshoe crab (Carcinoscorpius rotundicauda), induces lysis of Gram-negative bacteria. To follow the entire process of antimicrobial action, we performed a variety of experiments including transmission electron microscopy and fluorescence correlation spectroscopy as well as single molecule tracking of quantum dot-labeled antimicrobial peptides on live bacteria. Since in vitro measurements do not necessarily correlate with the in vivo action of a peptide we developed a novel fluorescent live bacteria lysis assay. Using fully functional nanoparticle-labeled Sushi 1, we observed the process of antimicrobial action at the single-molecule level. Conclusion Recently the hypothesis that many antimicrobial peptides act on internal targets to kill the bacterium has been discussed. Here, we demonstrate that the target sites of Sushi 1 are outer and inner membranes and are not cytosolic. Further, our findings suggest four successive

  11. Correlative fluorescence and electron microscopy of quantum dot labeled proteins on whole cells in liquid.

    PubMed

    Peckys, Diana B; Dukes, Madeline J; de Jonge, Niels

    2014-01-01

    Correlative fluorescence microscopy and scanning transmission electron microscopy (STEM) of cells fully immersed in liquid is a new methodology with many application areas. Proteins, in live cells immobilized on microchips, are labeled with fluorescent quantum dot (QD) nanoparticles. In this protocol, the epidermal growth factor receptor (EGFR) is labeled. The cells are fixed after a selected labeling time, for example, 5 min as needed to form EGFR dimers. The microchip with cells is then imaged with fluorescence microscopy. Thereafter, the microchip with the labeled cells and one with a spacer are assembled in a special microfluidic device and imaged with STEM.

  12. Visualizing Quantum Dot Labeled ORAI1 Proteins in Intact Cells Via Correlative Light and Electron Microscopy.

    PubMed

    Peckys, Diana B; Alansary, Dalia; Niemeyer, Barbara A; de Jonge, Niels

    2016-08-01

    ORAI1 proteins are ion channel subunits and the essential pore-forming units of the calcium release-activated calcium channel complex essential for T-cell activation and many other cellular processes. In this study, we used environmental scanning electron microscopy (ESEM) with scanning transmission electron microscopy (STEM) detection to image plasma membrane expressed ORAI1 proteins in whole Jurkat T cells in the liquid state. Utilizing a stably transfected Jurkat T cell clone expressing human ORAI1 with an extracellular human influenza hemagglutinin (HA) tag we investigated if liquid-phase STEM can be applied to detect recombinant surface expressed protein. Streptavidin coated quantum dots were coupled in a one-to-one stoichiometry to ORAI1 proteins detected by biotinylated anti-HA fragmented antibody fragments. High-resolution electron microscopic images revealed the individual label locations from which protein pair distances were determined. These data were analyzed using the pair correlation function and, in addition, an analysis of cluster size and frequency was performed. ORAI1 was found to be present in hexamers in a small fraction only, and ORAI1 resided mostly in monomers and dimers.

  13. Identification of quantum dots labeled metallothionein by fast scanning laser-induced breakdown spectroscopy

    NASA Astrophysics Data System (ADS)

    Konecna, Marie; Novotny, Karel; Krizkova, Sona; Blazkova, Iva; Kopel, Pavel; Kaiser, Jozef; Hodek, Petr; Kizek, Rene; Adam, Vojtech

    2014-11-01

    The technique described in this paper allows detection of quantum dots (QDs) specifically deposited on the polystyrene surface by laser-induced breakdown spectroscopy (LIBS). Using LIBS, the distribution of QDs or their conjugates with biomolecules deposited on the surface can be observed, regardless of the fact if they exhibit fluorescence or not. QDs deposited on the specific surface of polystyrene microplate in the form of spots are detected by determination of the metal included in the QDs structure. Cd-containing QDs (CdS, CdTe) stabilized with mercaptopropionic (MPA) or mercaptosuccinic (MSA) acid, respectively, alone or in the form of conjugates with metallothionein (MT) biomolecule are determined by using the 508.58 nm Cd emission line. The observed absolute detection limit for Cd in CdTe QDs conjugates with MT in one spot was 3 ng Cd. Due to the high sensitivity of this technique, the immunoanalysis in combination with LIBS was also investigated. Cd spatial distribution in sandwich immunoassay was detected.

  14. Assembly, characterization, and delivery of quantum dot labeled biotinylated lipid particles.

    PubMed

    Sigot, Valeria

    2014-01-01

    Lipid nanoparticles composed of mixtures of PEGylated-lipids; cationic and neutral lipids prepared by detergent dialysis can encapsulate biological active molecules and show considerable potential as systemic therapeutic agents. Addition of biotinylated lipids to this formulation allows surface modification of these particles with a suitable ligand or probe conjugated to streptavidin for specific cell targeting. Monitoring long circulating particles and cellular uptake requires stable and bright fluorescent probes. Quantum dots (QDs) constitute a relatively new class of fluorescent probes that overcome the limitations of organic fluorophores in biological imaging applications. Here, a protocol for the encapsulation of QD655 (red) in biotinylated lipid particles (BLPs) prepared by a detergent dialysis technique is presented followed by characterization of the loaded liposomal vehicles. Then, a protocol for BLPs surface modification via biotin-streptavidin linkage with preformed complexes of ligand-QD525 (green) for specific cell targeting of the nanoparticle is detailed. Conditions for cell binding and uptake of two colors QD labeled BLPs as well as basic microscopic settings for confocal live cell imaging are described. PMID:25103804

  15. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    PubMed

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs.

  16. Quantum dot labeling based on near-field optical imaging of CD44 molecules.

    PubMed

    Chen, Jianan; Pei, Yin; Chen, Zhengwei; Cai, Jiye

    2010-04-01

    The lateral organization of membrane proteins and lipids domains has a direct impact on many cellular processes, but generally these domains are too small to be resolved by diffraction-limited resolution of fluorescence microscopy. Here, we use quantum dot (QD) labeling based on near-field optical imaging, to study the nanoscale organization of hyaluronan receptor CD44 molecules of fixed mesenchymal stem cells (MSCs) in air, with a optical resolution down to 50 nm. The photostability and high luminance of QD evidently improve the signal-to-noise ratio and reproducibility of near-field optical data. Importantly, the blinking-intensity analysis was proposed to identify single QD, providing a calibration to relate intensity to numbers of antibody for the first time. Additionally, the fluorescence-topographic imaging enables us to investigate the topographic location pattern. Our results demonstrate that CD44 molecules on MSCs are enriched into nanosized domain and they predominantly locate on the peak of the membrane protrusions, which may contribute to clarify the underlying mechanism of functions ascribed to these molecules.

  17. Single molecule tracking of quantum dot-labeled mRNAs in a cell nucleus

    SciTech Connect

    Ishihama, Yo; Funatsu, Takashi

    2009-03-27

    Single particle tracking (SPT) is a powerful technique for studying mRNA dynamics in cells. Although SPT of mRNA has been performed by labeling mRNA with fluorescent dyes or proteins, observation of mRNA for long durations with high temporal resolution has been difficult due to weak fluorescence and rapid photobleaching. Using quantum dots (QDs), we succeeded in observing the movement of individual mRNAs for more than 60 s, with a temporal resolution of 30 ms. Intronless and truncated ftz mRNA, synthesized in vitro and labeled with QDs, was microinjected into the nuclei of Cos7 cells. Almost all mRNAs were in motion, and statistical analyses revealed anomalous diffusion between barriers, with a microscopic diffusion coefficient of 0.12 {mu}m{sup 2}/s and a macroscopic diffusion coefficient of 0.025 {mu}m{sup 2}/s. Diffusion of mRNA was observed in interchromatin regions but not in histone2B-GFP-labeled chromatin regions. These results provide direct evidence of channeled mRNA diffusion in interchromatin regions.

  18. Quantum dot labeling and tracking of cultured limbal epithelial cell transplants in-vitro

    PubMed Central

    Genicio, Nuria; Paramo, Juan Gallo; Shortt, Alex J.

    2015-01-01

    PURPOSE Cultured human limbal epithelial cells (HLEC) have shown promise in the treatment of limbal stem cell deficiency but little is known about their survival, behaviour and long-term fate post transplantation. The aim of this research was to evaluate, in-vitro, quantum dot (QDot) technology as a tool for tracking transplanted HLEC. METHODS In-vitro cultured HLEC were labeled with Qdot nanocrystals. Toxicity was assessed using live-dead assays. The effect on HLEC function was assessed using colony forming efficiency assays and expression of CK3, P63alpha and ABCG2. Sheets of cultured HLEC labeled with Qdot nanocrystals were transplanted onto decellularised human corneo-scleral rims in an organ culture model and observed to investigate the behaviour of transplanted cells. RESULTS Qdot labeling had no detrimental effect on HLEC viability or function in-vitro. Proliferation resulted in a gradual reduction in Qdot signal but sufficient signal was present to allow tracking of cells through multiple generations. Cells labeled with Qdots could be reliably detected and observed using confocal microscopy for at least 2 weeks post transplantation in our organ culture model. In addition it was possible to label and observe epithelial cells in intact human corneas using the Rostock corneal module adapted for use with the Heidelberg HRA. CONCLUSIONS This work demonstrates that Qdots combined with existing clinical equipment could be used to track HLEC for up to 2 weeks post transplantation, however, our model does not permit the assessment of cell labeling beyond 2 weeks. Further characterisation in in-vivo models are required. PMID:26024089

  19. Magnetic Electrochemical Immunoassays with Quantum Dot Labels for Detection of Phosphorylated Acetylcholinesterase in Plasma

    SciTech Connect

    Wang, Hua; Wang, Jun; Timchalk, Charles; Lin, Yuehe

    2008-11-01

    A new magnetic electrochemical immunoassay has been developed as a tool for biomonitoring exposures to organophosphate (OP) compounds, e.g., insecticides and chemical nerve agents, by directly detecting organophosphorylated acetylcholinesterase (OP-AChE). This immunoassay uniquely incorporates highly efficient magnetic separation with ultrasensitive square wave voltammetry (SWV) analysis with quantum dots (QDs) as labels. A pair of antibodies was used to achieve the specific recognition of OP-AChE that was prepared with paraoxon as an OP model agent. Antiphosphoserine polyclonal antibodies were anchored on amorphous magnetic particles preferably chosen to capture OP-AChE from the sample matrixes by binding their phosphoserine moieties that were exposed through unfolding the protein adducts. This was validated by electrochemical examinations and enzyme-linked immunosorbent assays. Furthermore, antihuman AChE monoclonal antibodies were labeled with cadmium-source QDs to selectively recognize the captured OP-AChE, as characterized by transmission electron microscopy. The subsequent electrochemical SWV analysis of the cadmium component released by acid from the coupled QDs was conducted on disposable screen-printed electrodes. Experimental results indicated that the SWV-based immunoassays could yield a linear response over a broad concentration range of 0.3-300 ng/mL OP-AChE in human plasma with a detection limit of 0.15 ng/mL. Such a novel electrochemical immunoassay holds great promise as a simple, selective, sensitive, and field-deployable tool for the effective biomonitoring and diagnosis of potential exposures to nerve agents and pesticides.

  20. A CCD-based reader combined with CdS quantum dot-labeled lateral flow strips for ultrasensitive quantitative detection of CagA

    NASA Astrophysics Data System (ADS)

    Gui, Chen; Wang, Kan; Li, Chao; Dai, Xuan; Cui, Daxiang

    2014-02-01

    Immunochromatographic assays are widely used to detect many analytes. CagA is proved to be associated closely with initiation of gastric carcinoma. Here, we reported that a charge-coupled device (CCD)-based test strip reader combined with CdS quantum dot-labeled lateral flow strips for quantitative detection of CagA was developed, which used 365-nm ultraviolet LED as the excitation light source, and captured the test strip images through an acquisition module. Then, the captured image was transferred to the computer and was processed by a software system. A revised weighted threshold histogram equalization (WTHE) image processing algorithm was applied to analyze the result. CdS quantum dot-labeled lateral flow strips for detection of CagA were prepared. One hundred sera samples from clinical patients with gastric cancer and healthy people were prepared for detection, which demonstrated that the device could realize rapid, stable, and point-of-care detection, with a sensitivity of 20 pg/mL.

  1. Simultaneous Quantitative Detection of Helicobacter Pylori Based on a Rapid and Sensitive Testing Platform using Quantum Dots-Labeled Immunochromatiographic Test Strips.

    PubMed

    Zheng, Yu; Wang, Kan; Zhang, Jingjing; Qin, Weijian; Yan, Xinyu; Shen, Guangxia; Gao, Guo; Pan, Fei; Cui, Daxiang

    2016-12-01

    Quantum dots-labeled urea-enzyme antibody-based rapid immunochromatographic test strips have been developed as quantitative fluorescence point-of-care tests (POCTs) to detect helicobacter pylori. Presented in this study is a new test strip reader designed to run on tablet personal computers (PCs), which is portable for outdoor detection even without an alternating current (AC) power supply. A Wi-Fi module was integrated into the reader to improve its portability. Patient information was loaded by a barcode scanner, and an application designed to run on tablet PCs was developed to handle the acquired images. A vision algorithm called Kmeans was used for picture processing. Different concentrations of various human blood samples were tested to evaluate the stability and accuracy of the fabricated device. Results demonstrate that the reader can provide an easy, rapid, simultaneous, quantitative detection for helicobacter pylori. The proposed test strip reader has a lighter weight than existing detection readers, and it can run for long durations without an AC power supply, thus verifying that it possesses advantages for outdoor detection. Given its fast detection speed and high accuracy, the proposed reader combined with quantum dots-labeled test strips is suitable for POCTs and owns great potential in applications such as screening patients with infection of helicobacter pylori, etc. in near future. PMID:26842795

  2. Simultaneous Quantitative Detection of Helicobacter Pylori Based on a Rapid and Sensitive Testing Platform using Quantum Dots-Labeled Immunochromatiographic Test Strips.

    PubMed

    Zheng, Yu; Wang, Kan; Zhang, Jingjing; Qin, Weijian; Yan, Xinyu; Shen, Guangxia; Gao, Guo; Pan, Fei; Cui, Daxiang

    2016-12-01

    Quantum dots-labeled urea-enzyme antibody-based rapid immunochromatographic test strips have been developed as quantitative fluorescence point-of-care tests (POCTs) to detect helicobacter pylori. Presented in this study is a new test strip reader designed to run on tablet personal computers (PCs), which is portable for outdoor detection even without an alternating current (AC) power supply. A Wi-Fi module was integrated into the reader to improve its portability. Patient information was loaded by a barcode scanner, and an application designed to run on tablet PCs was developed to handle the acquired images. A vision algorithm called Kmeans was used for picture processing. Different concentrations of various human blood samples were tested to evaluate the stability and accuracy of the fabricated device. Results demonstrate that the reader can provide an easy, rapid, simultaneous, quantitative detection for helicobacter pylori. The proposed test strip reader has a lighter weight than existing detection readers, and it can run for long durations without an AC power supply, thus verifying that it possesses advantages for outdoor detection. Given its fast detection speed and high accuracy, the proposed reader combined with quantum dots-labeled test strips is suitable for POCTs and owns great potential in applications such as screening patients with infection of helicobacter pylori, etc. in near future.

  3. Simultaneous Quantitative Detection of Helicobacter Pylori Based on a Rapid and Sensitive Testing Platform using Quantum Dots-Labeled Immunochromatiographic Test Strips

    NASA Astrophysics Data System (ADS)

    Zheng, Yu; Wang, Kan; Zhang, Jingjing; Qin, Weijian; Yan, Xinyu; Shen, Guangxia; Gao, Guo; Pan, Fei; Cui, Daxiang

    2016-02-01

    Quantum dots-labeled urea-enzyme antibody-based rapid immunochromatographic test strips have been developed as quantitative fluorescence point-of-care tests (POCTs) to detect helicobacter pylori. Presented in this study is a new test strip reader designed to run on tablet personal computers (PCs), which is portable for outdoor detection even without an alternating current (AC) power supply. A Wi-Fi module was integrated into the reader to improve its portability. Patient information was loaded by a barcode scanner, and an application designed to run on tablet PCs was developed to handle the acquired images. A vision algorithm called Kmeans was used for picture processing. Different concentrations of various human blood samples were tested to evaluate the stability and accuracy of the fabricated device. Results demonstrate that the reader can provide an easy, rapid, simultaneous, quantitative detection for helicobacter pylori. The proposed test strip reader has a lighter weight than existing detection readers, and it can run for long durations without an AC power supply, thus verifying that it possesses advantages for outdoor detection. Given its fast detection speed and high accuracy, the proposed reader combined with quantum dots-labeled test strips is suitable for POCTs and owns great potential in applications such as screening patients with infection of helicobacter pylori, etc. in near future.

  4. A CCD-based reader combined with CdS quantum dot-labeled lateral flow strips for ultrasensitive quantitative detection of CagA

    PubMed Central

    2014-01-01

    Immunochromatographic assays are widely used to detect many analytes. CagA is proved to be associated closely with initiation of gastric carcinoma. Here, we reported that a charge-coupled device (CCD)-based test strip reader combined with CdS quantum dot-labeled lateral flow strips for quantitative detection of CagA was developed, which used 365-nm ultraviolet LED as the excitation light source, and captured the test strip images through an acquisition module. Then, the captured image was transferred to the computer and was processed by a software system. A revised weighted threshold histogram equalization (WTHE) image processing algorithm was applied to analyze the result. CdS quantum dot-labeled lateral flow strips for detection of CagA were prepared. One hundred sera samples from clinical patients with gastric cancer and healthy people were prepared for detection, which demonstrated that the device could realize rapid, stable, and point-of-care detection, with a sensitivity of 20 pg/mL. PMID:24495570

  5. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4

    NASA Astrophysics Data System (ADS)

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

    2016-03-01

    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

  6. CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4.

    PubMed

    Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

    2016-12-01

    Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future. PMID:26969591

  7. Microfluidic beads-based immunosensor for sensitive detection of cancer biomarker proteins using multienzyme-nanoparticle amplification and quantum dots labels.

    PubMed

    Zhang, He; Liu, Lian; Fu, Xin; Zhu, Zhenjun

    2013-04-15

    This study reports the development of a microfluidic beads-based immunosensor for sensitive detection of cancer biomarker α-fetoprotein (AFP) that uses multienzyme-nanoparticle amplification and quantum dots labels. This method utilizes microbeads functionalized with the capture antibodies (Ab₁) and modified electron rich proteins as sensing platform that was fabricated within a microfluidic channel, and uses gold nanoparticles (AuNPs) functionalized with the horseradish peroxidase (HRP) and the detection antibodies (Ab₂) as label. Greatly enhanced sensitivity for the cancer biomarker is based on a dual signal amplification strategy: first, the large surface area of Au nanoparticle carrier allows several binding events of HRP on each nanosphere. Enhanced sensitivity was achieved by introducing the multi-HRP-antibody functionalized AuNPs onto the surface of microbeads through "sandwich" immunoreactions and subsequently multiple biotin moieties could be deposited onto the surface of beads resulted from the oxidation of biotin-tyramine by hydrogen peroxide. Streptavidin-labeled quantum dots were then allowed to bind to the deposited biotin moieties and displayed the signal. Secondly, enhanced mass transport capability inherent from microfluidics leads to higher capture efficiency of targets because continuous flow within micro-channel delivers fresh analyte solution to the reaction site which maintains a high concentration gradient differential to enhance mass transport. Based on the dual signal amplification strategy, the developed microfluidic bead-based immunosensor could discriminate as low as 0.2 pg mL⁻¹ AFP in 10 μL of undiluted calf serum (0.2 fg/chip), and showed a 500-fold increase in detection limit compared to the off-chip test and 50-fold increase in detection limit compared to microfluidic beads-based immunoassay using single label HRP-Ab₂. The immunosensor showed acceptable repeatability and reproducibility. This microfluidic beads

  8. Correlative fluorescence and scanning transmission electron microscopy of quantum dot-labeled proteins on whole cells in liquid.

    PubMed

    Peckys, Diana B; Bandmann, Vera; de Jonge, Niels

    2014-01-01

    Correlative fluorescence microscopy combined with scanning transmission electron microscopy (STEM) of cells fully immersed in liquid is a new methodology with many application areas. Proteins, in live cells immobilized on microchips, are labeled with fluorescent quantum dot nanoparticles. In this protocol, the epidermal growth factor receptor (EGFR) is labeled. The cells are fixed after a selected labeling time, for example, 5 min as needed to form EGFR dimers. The microchip with cells is then imaged with fluorescence microscopy. Thereafter, STEM can be accomplished in two ways. The microchip with the labeled cells and one microchip with a spacer are assembled into a special microfluidic device and imaged with dedicated high-voltage STEM. Alternatively, thin edges of cells can be studied with environmental scanning electron microscopy with a STEM detector, by placing a microchip with cells in a cooled wet environment.

  9. Combining atomic force and fluorescence microscopy for analysis of quantum-dot labeled protein-DNA complexes.

    PubMed

    Ebenstein, Yuval; Gassman, Natalie; Kim, Soohong; Weiss, Shimon

    2009-01-01

    Atomic force microscopy (AFM) and fluorescence microscopy are widely used for the study of protein-DNA interactions. While AFM excels in its ability to elucidate structural detail and spatial arrangement, it lacks the ability to distinguish between similarly sized objects in a complex system. This information is readily accessible to optical imaging techniques via site-specific fluorescent labels, which enable the direct detection and identification of multiple components simultaneously. Here, we show how the utilization of semiconductor quantum dots (QDs), serving as contrast agents for both AFM topography and fluorescence imaging, facilitates the combination of both imaging techniques, and with the addition of a flow based DNA extension method for sample deposition, results in a powerful tool for the study of protein-DNA complexes. We demonstrate the inherent advantages of this novel combination of techniques by imaging individual RNA polymerases (RNAP) on T7 genomic DNA.

  10. Directly interrogating single quantum dot labelled UvrA2 molecules on DNA tightropes using an optically trapped nanoprobe

    PubMed Central

    Simons, Michelle; Pollard, Mark R.; Hughes, Craig D.; Ward, Andrew D.; Van Houten, Bennett; Towrie, Mike; Botchway, Stan W.; Parker, Anthony W.; Kad, Neil M.

    2015-01-01

    In this study we describe a new methodology to physically probe individual complexes formed between proteins and DNA. By combining nanoscale, high speed physical force measurement with sensitive fluorescence imaging we investigate the complex formed between the prokaryotic DNA repair protein UvrA2 and DNA. This approach uses a triangular, optically-trapped “nanoprobe” with a nanometer scale tip protruding from one vertex. By scanning this tip along a single DNA strand suspended between surface-bound micron-scale beads, quantum-dot tagged UvrA2 molecules bound to these ‘”DNA tightropes” can be mechanically interrogated. Encounters with UvrA2 led to deflections of the whole nanoprobe structure, which were converted to resistive force. A force histogram from all 144 detected interactions generated a bimodal distribution centered on 2.6 and 8.1 pN, possibly reflecting the asymmetry of UvrA2’s binding to DNA. These observations successfully demonstrate the use of a highly controllable purpose-designed and built synthetic nanoprobe combined with fluorescence imaging to study protein-DNA interactions at the single molecule level. PMID:26691010

  11. Correlative Fluorescence Microscopy and Scanning Transmission Electron Microscopy of Quantum Dot Labeled Proteins in Whole Cells in Liquid

    PubMed Central

    Dukes, Madeline J.; Peckys, Diana B.; de Jonge, Niels

    2010-01-01

    Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7 × 12 nm were visible in a 5 μm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs. PMID:20550177

  12. Comparative conventional- and quantum dot-labeling strategies for LPS binding site detection in Arabidopsis thaliana mesophyll protoplasts

    PubMed Central

    Mgcina, Londiwe S.; Dubery, Ian A.; Piater, Lizelle A.

    2015-01-01

    Lipopolysaccharide (LPS) from Gram-negative bacteria is recognized as a microbe-associated molecular pattern (MAMP) and not only induces an innate immune response in plants, but also stimulates the development of characteristic defense responses. However, identification and characterization of a cell surface LPS-receptor/binding site, as described in mammals, remains elusive in plants. As an amphiphilic, macromolecular lipoglycan, intact LPS potentially contains three MAMP-active regions, represented by the O-polysaccharide chain, the core and the lipid A. Binding site studies with intact labeled LPS were conducted in Arabidopsis thaliana protoplasts and quantified using flow cytometry fluorescence changes. Quantum dots (Qdots), which allow non-covalent, hydrophobic labeling were used as a novel strategy in this study and compared to covalent, hydrophilic labeling with Alexa 488. Affinity for LPS-binding sites was clearly demonstrated by concentration-, temperature-, and time-dependent increases in protoplast fluorescence following treatment with the labeled LPS. Moreover, this induced fluorescence increase was convincingly reduced following pre-treatment with excess unlabeled LPS, thereby indicating reversibility of LPS binding. Inhibition of the binding process is also reported using endo- and exocytosis inhibitors. Here, we present evidence for the anticipated presence of LPS-specific binding sites in Arabidopsis protoplasts, and furthermore propose Qdots as a more sensitive LPS-labeling strategy in comparison to the conventional Alexa 488 hydrazide label for binding studies. PMID:26029233

  13. Correlative fluorescence microscopy and scanning transmission electron microscopy of quantum-dot-labeled proteins in whole cells in liquid.

    PubMed

    Dukes, Madeline J; Peckys, Diana B; de Jonge, Niels

    2010-07-27

    Correlative fluorescence microscopy and transmission electron microscopy (TEM) is a state-of-the-art microscopy methodology to study cellular function, combining the functionality of light microscopy with the high resolution of electron microscopy. However, this technique involves complex sample preparation procedures due to its need for either thin sections or frozen samples for TEM imaging. Here, we introduce a novel correlative approach capable of imaging whole eukaryotic cells in liquid with fluorescence microscopy and with scanning transmission electron microscopy (STEM); there is no additional sample preparation necessary for the electron microscopy. Quantum dots (QDs) were bound to epidermal growth factor (EGF) receptors of COS7 fibroblast cells. Fixed whole cells in saline water were imaged with fluorescence microscopy and subsequently with STEM. The STEM images were correlated with fluorescence images of the same cellular regions. QDs of dimensions 7x12 nm were visible in a 5 microm thick layer of saline water, consistent with calculations. A spatial resolution of 3 nm was achieved on the QDs.

  14. Clathrin-Mediated Endocytosis in Living Host Cells Visualized through Quantum Dot Labeling of Infectious Hematopoietic Necrosis Virus▿†

    PubMed Central

    Liu, Haibin; Liu, Yi; Liu, Shulin; Pang, Dai-Wen; Xiao, Gengfu

    2011-01-01

    Infectious hematopoietic necrosis virus (IHNV) is an important fish pathogen that infects both wild and cultured salmonids. As a species of the genus Novirhabdovirus, IHNV is a valuable model system for exploring the host entry mechanisms of rhabdoviruses. In this study, quantum dots (QDs) were used as fluorescent labels for sensitive, long-term tracking of IHNV entry. Using live-cell fluorescence microscopy, we found that IHNV is internalized through clathrin-coated pits after the virus binds to host cell membranes. Pretreatment of host cells with chlorpromazine, a drug that blocks clathrin-mediated endocytosis, and clathrin light chain (LCa) depletion using RNA interference both resulted in a marked reduction in viral entry. We also visualized transport of the virus via the cytoskeleton (i.e., actin filaments and microtubules) in real time. Actin polymerization is involved in the transport of endocytic vesicles into the cytosol, whereas microtubules are required for the trafficking of clathrin-coated vesicles to early endosomes, late endosomes, and lysosomes. Disrupting the host cell cytoskeleton with cytochalasin D or nocodazole significantly impaired IHNV infectivity. Furthermore, infection was significantly affected by pretreating the host cells with bafilomycin A1, a compound that inhibits the acidification of endosomes and lysosomes. Strong colocalizations of IHNV with endosomes indicated that the virus is internalized into these membrane-bound compartments. This is the first report in which QD labeling is used to visualize the dynamic interactions between viruses and endocytic structures; the results presented demonstrate that IHNV enters host cells via clathrin-mediated endocytic, cytoskeleton-dependent, and low-pH-dependent pathways. PMID:21525360

  15. Dual-colored graphene quantum dots-labeled nanoprobes/graphene oxide: functional carbon materials for respective and simultaneous detection of DNA and thrombin

    NASA Astrophysics Data System (ADS)

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Chen, Jian Rong; Feng, Hui

    2014-10-01

    Convenient and simultaneous detection of multiple biomarkers such as DNA and proteins with biocompatible materials and good analytical performance still remains a challenge. Herein, we report the respective and simultaneous detection of DNA and bovine α-thrombin (thrombin) entirely based on biocompatible carbon materials through a specially designed fluorescence on-off-on process. Colorful fluorescence, high emission efficiency, good photostability and excellent compatibility enables graphene quantum dots (GQDs) as the best choice for fluorophores in bioprobes, and thus two-colored GQDs as labeling fluorophores were chemically bonded with specific oligonucleotide sequence and aptamer to prepare two probes targeting the DNA and thrombin, respectively. Each probe can be assembled on the graphene oxide (GO) platform spontaneously by π-π stacking and electrostatic attraction; as a result, fast electron transfer in the assembly efficiently quenches the fluorescence of probe. The presence of DNA or thrombin can trigger the self-recognition between capturing a nucleotide sequence and its target DNA or between thrombin and its aptamer due to their specific hybridization and duplex DNA structures or the formation of apatamer-substrate complex, which is taken advantage of in order to achieve a separate quantitative analysis of DNA and thrombin. A dual-functional biosensor for simultaneous detection of DNA and thrombin was also constructed by self-assembly of two probes with distinct colors and GO platform, and was further evaluated with the presence of various concentrations of DNA and thrombin. Both biosensors serving as a general detection model for multiple species exhibit outstanding analytical performance, and are expected to be applied in vivo because of the excellent biocompatibility of their used materials.

  16. Sensitive Bioanalysis Based on in-Situ Droplet Anodic Stripping Voltammetric Detection of CdS Quantum Dots Label after Enhanced Cathodic Preconcentration.

    PubMed

    Qin, Xiaoli; Wang, Linchun; Xie, Qingji

    2016-01-01

    We report a protocol of CdS-labeled sandwich-type amperometric bioanalysis with high sensitivity, on the basis of simultaneous chemical-dissolution/cathodic-enrichment of the CdS quantum dot biolabel and anodic stripping voltammetry (ASV) detection of Cd directly on the bioelectrode. We added a microliter droplet of 0.1 M aqueous HNO₃ to dissolve CdS on the bioelectrode and simultaneously achieved the potentiostatic cathodic preconcentration of Cd by starting the potentiostatic operation before HNO₃ addition, which can largely increase the ASV signal. Our protocol was used for immunoanalysis and aptamer-based bioanalysis of several proteins, giving limits of detection of 4.5 fg·mL(-1) for human immunoglobulin G, 3.0 fg·mL(-1) for human carcinoembryonic antigen (CEA), 4.9 fg·mL(-1) for human α-fetoprotein (AFP), and 0.9 fM for thrombin, which are better than many reported results. The simultaneous and sensitive analysis of CEA and AFP at two screen-printed carbon electrodes was also conducted by our protocol. PMID:27563894

  17. Sensitive Bioanalysis Based on in-Situ Droplet Anodic Stripping Voltammetric Detection of CdS Quantum Dots Label after Enhanced Cathodic Preconcentration

    PubMed Central

    Qin, Xiaoli; Wang, Linchun; Xie, Qingji

    2016-01-01

    We report a protocol of CdS-labeled sandwich-type amperometric bioanalysis with high sensitivity, on the basis of simultaneous chemical-dissolution/cathodic-enrichment of the CdS quantum dot biolabel and anodic stripping voltammetry (ASV) detection of Cd directly on the bioelectrode. We added a microliter droplet of 0.1 M aqueous HNO3 to dissolve CdS on the bioelectrode and simultaneously achieved the potentiostatic cathodic preconcentration of Cd by starting the potentiostatic operation before HNO3 addition, which can largely increase the ASV signal. Our protocol was used for immunoanalysis and aptamer-based bioanalysis of several proteins, giving limits of detection of 4.5 fg·mL−1 for human immunoglobulin G, 3.0 fg·mL−1 for human carcinoembryonic antigen (CEA), 4.9 fg·mL−1 for human α-fetoprotein (AFP), and 0.9 fM for thrombin, which are better than many reported results. The simultaneous and sensitive analysis of CEA and AFP at two screen-printed carbon electrodes was also conducted by our protocol. PMID:27563894

  18. Aptamer-conjugated dendrimer-modified quantum dots for glioblastoma cells imaging

    NASA Astrophysics Data System (ADS)

    Li, Zhiming; Huang, Peng; He, Rong; Zhang, Xiaomin; Bao, Chenchen; Ren, Qiushi; Cui, Daxiang

    2009-09-01

    Targeted quantum dots have shown potential as a platform for development of cancer imaging. Aptamers have recently been demonstrated as ideal candidates for molecular targeting applications. In present work, polyamidoamine dendrimers were used to modify surface of quantum dots and improve their solubility in water solution. Then, dendrimer-modified quantum dots were conjugated with DNA aptamer, GBI-10, can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. The dendrimer-modified quantum dots exhibit water-soluble, high quantum yield, and good biocompatibility. Aptamer-conjugated quantum dots can specifically target U251 human glioblastoma cells. High-performance aptamer-conjugated dendrimers modified quantum dot-based nanoprobes have great potential in application such as cancer imaging.

  19. One-pot synthesis of quantum dot-labeled hydrophilic molecularly imprinted polymer nanoparticles for direct optosensing of folic acid in real, undiluted biological samples.

    PubMed

    Yang, Yaqiong; Wang, Zhengzheng; Niu, Hui; Zhang, Huiqi

    2016-12-15

    A facile and efficient one-pot approach for the synthesis of quantum dot (QD)-labeled hydrophilic molecularly imprinted polymer (MIP) nanoparticles for direct optosensing of folic acid (FA) in the undiluted bovine and porcine serums is described. Hydrophilic macromolecular chain transfer agent-mediated reversible addition-fragmentation chain transfer (RAFT) precipitation polymerization was used to implement the molecular imprinting of FA in the presence of CdTe quantum dots (QDs). The resulting FA-imprinted polymer nanoparticles with surface-grafted hydrophilic poly(glyceryl monomethacrylate) brushes and QDs labeling not only showed outstanding specific molecular recognition toward FA in biological samples, but also exhibited good photostability, rapid binding kinetics, and obvious template binding-induced fluorescence quenching. These characteristics make them a useful fluorescent chemosensor for directly and selectively optosensing FA in the undiluted bovine and porcine serums, with its limit of detection being 0.025μM and average recoveries ranging from 98% to 102%, even in the presence of several interfering compounds. This advanced fluorescent MIP chemosensor is highly promising for rapid quantification of FA in such applications as clinical diagnostics and food analysis. PMID:27453986

  20. Microfabricated tin-film electrodes for protein and DNA sensing based on stripping voltammetric detection of Cd(II) released from quantum dots labels.

    PubMed

    Kokkinos, Christos; Economou, Anastasios; Petrou, Panagiota S; Kakabakos, Sotirios E

    2013-11-19

    A novel disposable microfabricated tin-film electrochemical sensor was developed for the detection of proteins and DNA. The sensor was fabricated on a silicon wafer through photolithography to define the sensor geometry followed by tin sputtering. A sandwich-type immunoassay with biotinylated reporter antibody was employed for the determination of prostate-specific antigen (PSA) in human serum samples. For the detection of C533G mutation of the RET gene, biotinylated oligonucleotide probes were used. The biotinylated biomolecular probes were labeled with streptavidin (STV)-conjugated CdSe/ZnS quantum dots (QDs); quantification of the analytes was performed through acidic dissolution of the QDs and stripping voltammetric detection of the Cd(II) released. The proposed QD-based electrochemical sensor overcomes the limitations of existing voltammetric sensors and provides a mercury-free sensing platform with scope for mass-production and further potential for application in clinical diagnostics.

  1. Signal-on Protein Detection via Dye Translocation between Aptamer and Quantum Dot.

    PubMed

    Lao, Yeh-Hsing; Chi, Chun-Wei; Friedrich, Sarah M; Peck, Konan; Wang, Tza-Huei; Leong, Kam W; Chen, Lin-Chi

    2016-05-18

    A unique interaction between the cyanine dye and negatively charged quantum dot is used to construct a signal-on biaptameric quantum dot (QD) Förster resonance energy transfer (FRET) beacon for protein detection and distinct aptamer characterization. The beacon comprises a pair of aptamers, one intercalated with the cyanine dye (YOYO-3) and the other conjugated to a negatively charged, carboxyl-QD. When the target protein is present, structural folding and sandwich association of the two aptamers take place. As a consequence, YOYO-3 is displaced from the folded aptamer and transferred to the unblocked QD surface to yield a target concentration-dependent FRET signal. As a proof-of-principle, we demonstrate the detection of thrombin ranging from nanomolar to submicromolar concentrations and confirm the dye translocation using cylindrical illumination confocal spectroscopy (CICS). The proposed beacon provides a simple, rapid, signal-on FRET detection for protein as well as a potential platform for distinct aptamer screening.

  2. Aptamer-based single-molecule imaging of insulin receptors in living cells

    NASA Astrophysics Data System (ADS)

    Chang, Minhyeok; Kwon, Mijin; Kim, Sooran; Yunn, Na-Oh; Kim, Daehyung; Ryu, Sung Ho; Lee, Jong-Bong

    2014-05-01

    We present a single-molecule imaging platform that quantitatively explores the spatiotemporal dynamics of individual insulin receptors in living cells. Modified DNA aptamers that specifically recognize insulin receptors (IRs) with a high affinity were selected through the SELEX process. Using quantum dot-labeled aptamers, we successfully imaged and analyzed the diffusive motions of individual IRs in the plasma membranes of a variety of cell lines (HIR, HEK293, HepG2). We further explored the cholesterol-dependent movement of IRs to address whether cholesterol depletion interferes with IRs and found that cholesterol depletion of the plasma membrane by methyl-β-cyclodextrin reduces the mobility of IRs. The aptamer-based single-molecule imaging of IRs will provide better understanding of insulin signal transduction through the dynamics study of IRs in the plasma membrane.

  3. Biomedical Applications of Quantum Dots, Nucleic Acid-Based Aptamers, and Nanostructures in Biosensors.

    PubMed

    Meshik, Xenia; Farid, Sidra; Choi, Min; Lan, Yi; Mukherjee, Souvik; Datta, Debopam; Dutta, Mitra; Stroscio, Michael A

    2015-01-01

    This review is a survey of the biomedical applications of semiconductor quantum dots, nucleic acid-based aptamers, and nanosensors as molecular biosensors. It focuses on the detection of analytes in biomedical applications using (1) advances in molecular beacons incorporating semiconductor quantum dots and nanoscale quenching elements; (2) aptamer-based nanosensors on a variety of platforms, including graphene; (3) Raman scattering and surface-enhanced Raman scattering (SERS) using nanostructures for enhanced SERS spectra of biomolecules, including aptamers; and (4) the electrical and optical properties of nanostructures incorporated into molecular beacons and aptamer-based nanosensors. Research done at the University of Illinois at Chicago (UIC) is highlighted throughout since it emphasizes the specific approaches taken by the bioengineering department at UIC.

  4. Signal-on Protein Detection via Dye Translocation between Aptamer and Quantum Dot.

    PubMed

    Lao, Yeh-Hsing; Chi, Chun-Wei; Friedrich, Sarah M; Peck, Konan; Wang, Tza-Huei; Leong, Kam W; Chen, Lin-Chi

    2016-05-18

    A unique interaction between the cyanine dye and negatively charged quantum dot is used to construct a signal-on biaptameric quantum dot (QD) Förster resonance energy transfer (FRET) beacon for protein detection and distinct aptamer characterization. The beacon comprises a pair of aptamers, one intercalated with the cyanine dye (YOYO-3) and the other conjugated to a negatively charged, carboxyl-QD. When the target protein is present, structural folding and sandwich association of the two aptamers take place. As a consequence, YOYO-3 is displaced from the folded aptamer and transferred to the unblocked QD surface to yield a target concentration-dependent FRET signal. As a proof-of-principle, we demonstrate the detection of thrombin ranging from nanomolar to submicromolar concentrations and confirm the dye translocation using cylindrical illumination confocal spectroscopy (CICS). The proposed beacon provides a simple, rapid, signal-on FRET detection for protein as well as a potential platform for distinct aptamer screening. PMID:27101438

  5. Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: A universal strategy for ratiometric detection of organophosphorus pesticides.

    PubMed

    Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu

    2016-01-01

    Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences.

  6. Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: A universal strategy for ratiometric detection of organophosphorus pesticides.

    PubMed

    Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu

    2016-01-01

    Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences. PMID:26695234

  7. Highly sensitive detection of leukemia cells based on aptamer and quantum dots.

    PubMed

    Yu, Yating; Duan, Siliang; He, Jian; Liang, Wei; Su, Jing; Zhu, Jianmeng; Hu, Nan; Zhao, Yongxiang; Lu, Xiaoling

    2016-08-01

    Detection of leukemia at the early stage with high sensitivity is a significant clinical challenge for clinicians. In the present study, we developed a sensitive detector consisting of the product of oligonucleotides hybridized with semiconductor quantum dots (QDs) to generate a stronger fluorescent signal so that leukemic cells can be captured. In the present study, a biotin-modified Sgc8 aptamer was used to identify CCRF-CEM cells, and then biotin-appended QDs were labeled with the aptamer via streptavidin and biotin amplification interactions. We described the complex as QDs-bsb-apt. CEM and Ramos cells were used to assess the specificity and sensitivity of the novel complex. These results revealed that the complex could be more effective in diagnosing leukemia at the early stage. In conclusion, an innovative structure based on aptamer and QDs for leukemia diagnosis was provided. It has the potential to image tumor cells in vitro or in vivo and to realize the early diagnosis of disease. Furthermore, it may be used to provide guidance for clinicians to implement individualized patient therapy. PMID:27375197

  8. A microfluidic biosensor using graphene oxide and aptamer-functionalized quantum dots for peanut allergen detection.

    PubMed

    Weng, Xuan; Neethirajan, Suresh

    2016-11-15

    The increasing prevalence of food allergies and the intake of packing foods in the past two decades urge the need for more rapid, accurate, and sensitive assays to detect potential allergens in food in order to control the allergen content. Most of the commercial analytical tools for allergen detection rely on immunoassays such as ELISA. As far as disadvantages, ELISA can be time-consuming and expensive. Biosensors appear as a suitable alternative for the detection of allergens because they are rapid, highly sensitive, selective, less expensive, environmentally friendly, and easy to handle. In this study, we developed a microfluidic system integrated with a quantum dots (Qdots) aptamer functionalized graphene oxide (GO) nano-biosensor for simple, rapid, and sensitive food allergen detection. The biosensor utilized Qdots-aptamer-GO complexes as probes to undergo conformational change upon interaction with the food allergens, resulting in fluorescence changes due to the fluorescence quenching and recovering properties of GO by adsorption and desorption of aptamer-conjugated Qdots. This one-step 'turn on' homogenous assay in a ready-to-use microfluidic chip took ~10min to achieve a quantitative detection of Ara h 1, one of the major allergens appearing in peanuts. The results suggested this system had remarkable sensitivity and selectivity. The integration of a microfluidics platform in a homemade miniaturized optical analyzer provides a promising way for the rapid, cost-effective, and accurate on-site determination of food allergens. This biosensor can also be extended to the detection of other food allergens with a selection of corresponding aptamers. PMID:27240012

  9. Optical detection of lead and potassium ions using a quantum-dot-based aptamer nanosensor.

    PubMed

    Meshik, Xenia; Xu, Ke; Dutta, Mitra; Stroscio, Michael A

    2014-06-01

    Quantum-dot (QD) based nanosensors can be used to detect a wide range of molecules. This study examined a nanosensor comprised of thrombin binding aptamer (TBA) with 700NC InGaP QD on the 5 (') terminus and an Au nanoparticle quencher on the 3 (') terminus. Both K(+) and Pb(2+) bind to TBA, resulting in a conformational change that brings the Au quencher closer to the QD. Photoluminescence measurements indicated a decrease in fluorescence corresponding to an increase in either K(+) or Pb(2+) concentration. For healthy blood serum K(+) concentrations (3.5-5 mM), the beacon exhibited 15-17% quenching efficiency. Pb(2+) concentration of 0.48 μM, the threshold for toxicity in serum, yielded 14% quenching. The beacon's ability to detect changes in ion levels in a critical range of concentrations can make it an effective diagnostic tool.

  10. Supersandwich cytosensor for selective and ultrasensitive detection of cancer cells using aptamer-DNA concatamer-quantum dots probes.

    PubMed

    Liu, Hongying; Xu, Shouming; He, Zhimei; Deng, Anping; Zhu, Jun-Jie

    2013-03-19

    In this work, a signal amplification supersandwich strategy was developed for highly selective and sensitive detection of cancer cells using aptamer-DNA concatamer-quantum dots (QDs) probes. First of all, electrode materials denoted as MWCNTs@PDA@AuNPs were fabricated by multiwall carbon nanotubes (MWCNTs), gold nanoparticles (AuNPs), and polydopamine (PDA) using a layer-by-layer technique. Then, the prepared bases as matrices were applied to bind concanavalin A (Con A), resulting in high stability, bioactivity, and capability for cell capture. Meanwhile, aptamer-DNA concatamer-QDs were designed via DNA hybridization followed by covalent assembling, which incorporated the specific recognition of the aptamer with the signal amplification of the DNA concatamer and QDs. With aptamer-DNA concatamer-QDs as recognizing probes, the model cancer cells (CCRF-CEM cells) were detected using a MWCNTs@PDA@AuNPs modified electrode with trapped Con A by means of fluorescence and electrochemical methods. The proposed supersandwich cytosensor showed high sensitivity with the detection limit of 50 cells mL(-1). More importantly, it could distinguish cancer cells from normal cells, which indicated the promising applications of our method in clinical diagnosis and treatment of cancers.

  11. Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold

    PubMed Central

    Bruno, John G.

    2014-01-01

    Preliminary studies aimed at improving the sensitivity of foodborne pathogen detection via lateral flow (LF) test strips by use of high affinity DNA aptamers for capture and reporter functions when coupled to red-emitting quantum dots (Qdot 655) are reported. A variety of DNA aptamers developed against Escherichia coli, Listeria monocytogenes, and Salmonella enterica were paired in capture and reporter combinations to determine which yielded the strongest detection of their cognate bacteria using a colloidal gold screening system. Several promising sandwich combinations were identified for each of the three bacterial LF strip systems. The best E. coli aptamer-LF system was further studied and yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. These LODs were reduced to ~300–600 bacterial cells per test respectively by switching to a Qdot 655 aptamer-LF system. Novel aspects of these assays such as the use of high levels of detergents to avoid quantum dot agglutination and enhance migration in analytical membranes, identification of optimal analytical membrane types, UV-immobilization of capture aptamers, and novel dual biotin/digoxigenin-end labeled aptamer streptavidin-colloidal gold or -Qdot 655 conjugates plus anti-digoxigenin antibody control lines are also discussed. In general, this work provides proof-of-principle for highly sensitive aptamer-Qdot LF strip assays for rapid foodborne pathogen detection. PMID:25437803

  12. Quantum-dot/aptamer-based ultrasensitive multi-analyte electrochemical biosensor.

    PubMed

    Hansen, Jacob A; Wang, Joseph; Kawde, Abdel-Nasser; Xiang, Yun; Gothelf, Kurt V; Collins, Greg

    2006-02-22

    The coupling of aptamers with the coding and amplification features of inorganic nanocrystals is shown for the first time to offer a highly sensitive and selective simultaneous bioelectronic detection of several protein targets. This is accomplished in a single-step displacement assay in connection to a self-assembled monolayer of several thiolated aptamers conjugated to proteins carrying different inorganic nanocrystals. Electrochemical stripping detection of the nondisplaced nanocrystal tracers results in a remarkably low (attomole) detection limit, that is, significantly lower than those of existing aptamer biosensors. The new device offers great promise for measuring a large panel of disease markers present at ultralow levels during early stages of the disease progress.

  13. A quantum dot-aptamer beacon using a DNA intercalating dye as the FRET reporter: application to label-free thrombin detection.

    PubMed

    Chi, Chun-Wei; Lao, Yeh-Hsing; Li, Yi-Shan; Chen, Lin-Chi

    2011-03-15

    A new quantum dot (QD)-aptamer (apt) beacon that acts by folding-induced dissociation of a DNA intercalating dye, BOBO-3(B), is demonstrated with label-free thrombin detection. The beacon, denoted as QD-apt:B, is constructed by (1) coupling of a single-stranded thrombin aptamer to Qdot 565 via EDC/Sulfo-NHS chemistry and (2) staining the duplex regions of the aptamer on QD with excess BOBO-3 before thrombin binding. When mixing a thrombin sample with QD-apt:B, BOBO-3 is competed away from the beacon due to target-induced aptamer folding, which then causes a decrease in QD fluorescence resonance energy transfer (FRET)-mediated BOBO-3 emission and achieves thrombin quantitation. In this work, the effects of Mg(2+), coupling time, and aptamer type on the beacon's performances are investigated and discussed thoroughly with various methods, including transmission electron microscopy (TEM), dynamic light scattering (DLS), and two-color differential gel electrophoresis. Using the best aptamer beacon (HTQ37), we attain highly specific and wide-range detection (from nM to μM) of thrombin in buffer, and the beacon can sense nM-range thrombin in 15% diluted serum. Compared to the reported QD aptamer assays, our method is advantageous from the aspect of using a simple sensory unit design without losing the detection sensitivity. Therefore, we consider the QD-apt:B beacon a potential alternative to immuno-reagents and an effective tool to study nucleic acid folding on QD as well.

  14. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    PubMed Central

    Ozer, Abdullah; Pagano, John M; Lis, John T

    2014-01-01

    Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future. PMID:25093707

  15. A homogeneous and "off-on" fluorescence aptamer-based assay for chloramphenicol using vesicle quantum dot-gold colloid composite probes.

    PubMed

    Miao, Yang-Bao; Ren, Hong-Xia; Gan, Ning; Zhou, You; Cao, Yuting; Li, Tianhua; Chen, Yinji

    2016-07-27

    In this work, a novel homogeneous and signal "off-on" aptamer based fluorescence assay was successfully developed to detect chloramphenicol (CAP) residues in food based on the fluorescence resonance energy transfer (FRET). The vesicle nanotracer was prepared through labeling single stranded DNA binding protein (SSB) on limposome-CdSe/ZnS quantum dot (SSB/L-QD) complexes. It was worth mentioning that the signal tracer (SSB/L-QD) with vesicle shape, which was fabricated being encapsulated with a number of quantum dots and SSB. The nanotracer has excellent signal amplification effects. The vesicle composite probe was formed by combining aptamer labeled nano-gold (Au-Apt) and SSB/L-QD. Which based on SSB's specific affinity towards aptamer. This probe can't emit fluoresce which is in "off" state because the signal from SSB/L-QD as donor can be quenched by the Au-aptas acceptor. When CAP was added in the composite probe solution, the aptamer on the Au-Apt can be preferentially bounded with CAP then release from the composite probe, which can turn the "off" signal of SSB/L-QD tracer into "on" state. The assay indicates excellent linear response to CAP from 0.001 nM to 10 nM and detection limit down to 0.3 pM. The vesicle probes with size of 88 nm have strong signal amplification. Because a larger number of QDs can be labeled inside the double phosphorus lipid membrane. Besides, it was employed to detect CAP residues in the milk samples with results being agreed well with those from ELISA, verifying its accuracy and reliability. PMID:27251948

  16. Aptamer Microarrays

    SciTech Connect

    Angel-Syrett, Heather; Collett, Jim; Ellington, Andrew D.

    2009-01-02

    In vitro selection can yield specific, high-affinity aptamers. We and others have devised methods for the automated selection of aptamers, and have begun to use these reagents for the construction of arrays. Arrayed aptamers have proven to be almost as sensitive as their solution phase counterparts, and when ganged together can provide both specific and general diagnostic signals for proteins and other analytes. We describe here technical details regarding the production and processing of aptamer microarrays, including blocking, washing, drying, and scanning. We will also discuss the challenges involved in developing standardized and reproducible methods for binding and quantitating protein targets. While signals from fluorescent analytes or sandwiches are typically captured, it has proven possible for immobilized aptamers to be uniquely coupled to amplification methods not available to protein reagents, thus allowing for protein-binding signals to be greatly amplified. Into the future, many of the biosensor methods described in this book can potentially be adapted to array formats, thus further expanding the utility of and applications for aptamer arrays.

  17. Direct Synthesis of Water-Soluble Aptamer-Ag2 S Quantum Dots at Ambient Temperature for Specific Imaging and Photothermal Therapy of Cancer.

    PubMed

    Gao, Jingwen; Wu, Chuanli; Deng, Dan; Wu, Ping; Cai, Chenxin

    2016-09-01

    Water-soluble Ag2 S near-infrared (NIR) fluorescent quantum dots (QDs) are directly synthesized at ambient temperature for specific cancer imaging and photothermal therapy (PTT) using a designed aptamer (Apt43) as template, which consists of the following two fragments: an aptamer S2.2 sequence for specifically recognizing the cancer cells and an 18-cytosine (18-C) extending spacer for growing Ag2 S QDs. The synthesized Ag2 S QDs (Apt43-Ag2 S QDs), which exhibit strong absorption and fluorescence emission in the NIR region and high photothermal conversion capabilities, can specifically recognize MCF-7 cells (human breast cancer cells) and are usable as a highly intensified imaging agent for cancer diagnosis. Moreover, they can be applied as photothermal agents for the in vitro killing of MCF-7 cells and the in vivo ablation of tumors, which were constructed on the bodies of nude mice. MCF-7 cells almost quantitatively die after they are incubated with the QDs (at 100 μg mL(-1) ) for 2 h and irradiated under an 808 nm laser at a power density of 1.0 W cm(-2) for 10 min. The tumors on the nude mice can also be effectively ablated without regrowth during the period of observation (at least 20 d) after PTT. PMID:27391840

  18. Aptamer-based fluorescent screening assay for acetamiprid via inner filter effect of gold nanoparticles on the fluorescence of CdTe quantum dots.

    PubMed

    Guo, Jiajia; Li, Ying; Wang, Luokai; Xu, Jingyue; Huang, Yanjun; Luo, Yeli; Shen, Fei; Sun, Chunyan; Meng, Rizeng

    2016-01-01

    This paper reports a novel aptamer-based fluorescent detection method for small molecules represented by acetamiprid based on the specific binding of aptamers with acetamiprid, and the inner filter effect (IFE) of gold nanoparticles (AuNPs) on the fluorescence of CdTe quantum dots (CdTe QDs). When CdTe QDs were mixed with AuNPs, the fluorescence of CdTe QDs was significantly quenched via IFE. The IFE efficiency could be readily modulated by the absorption and the aggregation state of AuNPs. The presence of salt could easily induce the aggregation of AuNPs, resulting in the fluorescence recovery of the quenched QDs. Acetamiprid-binding aptamer (ABA) could adsorb on the negatively charged AuNPs through the coordination interaction to protect AuNPs from salt-induced aggregation, so the fluorescence of CdTe QDs would be quenched by the IFE of AuNPs. However, the specific binding of ABA with acetamiprid could release the ABA from the surfaces of AuNPs and decrease the salt tolerance of AuNPs, so the IFE-decreased fluorescence of CdTe QDs was regained with the presence of acetamiprid, and the fluorescence enhancement efficiency was driven by the concentration of acetamiprid. Based on this principle, the aptamer-based fluorescent method for acetamiprid has been established and optimized. The assay exhibited excellent selectivity towards acetamiprid over its analogues and other pesticides which may coexist with acetamiprid. Under the optimum experiment conditions, the established method could be applied for the determination of acetamiprid with a wide linear range from 0.05 to 1.0 μM, and a low detection limit of 7.29 nM (3σ). Furthermore, this IFE-based method has been successfully utilized to detect acetamiprid in six types of vegetables, and the results were in full agreement with those from HPLC and LC-MS. The proposed method displays remarkable advantages of high sensitivity, rapid analysis, excellent selectivity, and would be suitable for the practical application

  19. Aptamer photoregulation in vivo

    PubMed Central

    Li, Lele; Tong, Rong; Chu, Hunghao; Wang, Weiping; Langer, Robert; Kohane, Daniel S.

    2014-01-01

    The in vivo application of aptamers as therapeutics could be improved by enhancing target-specific accumulation while minimizing off-target uptake. We designed a light-triggered system that permits spatiotemporal regulation of aptamer activity in vitro and in vivo. Cell binding by the aptamer was prevented by hybridizing the aptamer to a photo-labile complementary oligonucleotide. Upon irradiation at the tumor site, the aptamer was liberated, leading to prolonged intratumoral retention. The relative distribution of the aptamer to the liver and kidney was also significantly decreased, compared to that of the free aptamer. PMID:25404344

  20. A new strategy for the detection of adenosine triphosphate by aptamer/quantum dot biosensor based on chemiluminescence resonance energy transfer.

    PubMed

    Zhou, Zi-Ming; Yu, Yong; Zhao, Yuan-Di

    2012-09-21

    We designed an aptasensor for the detection of adenosine triphosphate (ATP) based on chemiluminescence resonance energy transfer (CRET). An adenosine aptamer was cut into two pieces of ssDNA, which were attached to quantum dots (QDs) and horse radish peroxidase (HRP), respectively. They could reassemble into specific structures in the presence of ATP and then decrease the distance of HRP and QDs. ATP detection can be easily realized according to the fluorescent intensity of QDs, which is excited by CRET between luminol and QDs. Results show that the concentration of ATP is linear relation with the fluorescent intensity of the peak of QDs emission and the linear range for the linear equation is from 50 μM to 231 μM and the detection limit was 185 nM. When the concentration of ATP was 2 mM, the efficiency of CRET is 13.6%. Good specificity for ATP had been demonstrated compared to thymidine triphosphate (TTP), cytidine triphosphate (CTP) and guanosine triphosphate (GTP), when 1 mM of each was added, respectively. This method needs no external light source and can avoid autofluorescence and photobleaching, and ATP can be detected selectively, specifically, and sensitively in a low micromolar range, which means that the strategy reported here can be applicable to the detection of several other target molecules. PMID:22832507

  1. Aptamers in Therapeutics.

    PubMed

    Parashar, Abhishek

    2016-06-01

    Aptamers are single strand DNA or RNA molecules, selected by an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to various advantages of aptamers such as high temperature stability, animal free, cost effective production and its high affinity and selectivity for its target make them attractive alternatives to monoclonal antibody for use in diagnostic and therapeutic purposes. Aptamer has been generated against vesicular endothelial growth factor 165 involved in age related macular degeneracy. Macugen was the first FDA approved aptamer based drug that was commercialized. Later other aptamers were also developed against blood clotting proteins, cancer proteins, antibody E, agents involved in diabetes nephropathy, autoantibodies involved in autoimmune disorders, etc. Aptamers have also been developed against viruses and could work with other antiviral agents in treating infections. PMID:27504277

  2. Aptamers in Therapeutics

    PubMed Central

    2016-01-01

    Aptamers are single strand DNA or RNA molecules, selected by an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to various advantages of aptamers such as high temperature stability, animal free, cost effective production and its high affinity and selectivity for its target make them attractive alternatives to monoclonal antibody for use in diagnostic and therapeutic purposes. Aptamer has been generated against vesicular endothelial growth factor 165 involved in age related macular degeneracy. Macugen was the first FDA approved aptamer based drug that was commercialized. Later other aptamers were also developed against blood clotting proteins, cancer proteins, antibody E, agents involved in diabetes nephropathy, autoantibodies involved in autoimmune disorders, etc. Aptamers have also been developed against viruses and could work with other antiviral agents in treating infections. PMID:27504277

  3. Aptamer-Functionalized Nano-Biosensors

    PubMed Central

    Chiu, Tai-Chia; Huang, Chih-Ching

    2009-01-01

    Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs), metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs). We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused. PMID:22303178

  4. Analytical applications of aptamers

    NASA Astrophysics Data System (ADS)

    Tombelli, S.; Minunni, M.; Mascini, M.

    2007-05-01

    Aptamers are single stranded DNA or RNA ligands which can be selected for different targets starting from a library of molecules containing randomly created sequences. Aptamers have been selected to bind very different targets, from proteins to small organic dyes. Aptamers are proposed as alternatives to antibodies as biorecognition elements in analytical devices with ever increasing frequency. This in order to satisfy the demand for quick, cheap, simple and highly reproducible analytical devices, especially for protein detection in the medical field or for the detection of smaller molecules in environmental and food analysis. In our recent experience, DNA and RNA aptamers, specific for three different proteins (Tat, IgE and thrombin), have been exploited as bio-recognition elements to develop specific biosensors (aptasensors). These recognition elements have been coupled to piezoelectric quartz crystals and surface plasmon resonance (SPR) devices as transducers where the aptamers have been immobilized on the gold surface of the crystals electrodes or on SPR chips, respectively.

  5. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    PubMed Central

    Opazo, Felipe; Eiden, Laura; Hansen, Line; Rohrbach, Falk; Wengel, Jesper; Kjems, Jørgen; Mayer, Günter

    2015-01-01

    Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications. PMID:26325628

  6. Aptamers against pathogenic microorganisms

    PubMed Central

    Davydova, Anna; Vorobjeva, Maria; Pyshnyi, Dmitrii; Altman, Sidney; Vlassov, Valentin; Venyaminova, Alya

    2016-01-01

    Abstract An important current issue of modern molecular medicine and biotechnology is the search for new approaches to early diagnostic assays and adequate therapy of infectious diseases. One of the promising solutions to this problem might be a development of nucleic acid aptamers capable of interacting specifically with bacteria, protozoa, and viruses. Such aptamers can be used for the specific recognition of infectious agents as well as for blocking of their functions. The present review summarizes various modern SELEX techniques used in this field, and of several currently identified aptamers against viral particles and unicellular organisms, and their applications. The prospects of applying nucleic acid aptamers for the development of novel detection systems and antibacterial and antiviral drugs are discussed. PMID:26258445

  7. Advancements in Aptamer Discovery Technologies.

    PubMed

    Gotrik, Michael R; Feagin, Trevor A; Csordas, Andrew T; Nakamoto, Margaret A; Soh, H Tom

    2016-09-20

    Affinity reagents that specifically bind to their target molecules are invaluable tools in nearly every field of modern biomedicine. Nucleic acid-based aptamers offer many advantages in this domain, because they are chemically synthesized, stable, and economical. Despite these compelling features, aptamers are currently not widely used in comparison to antibodies. This is primarily because conventional aptamer-discovery techniques such as SELEX are time-consuming and labor-intensive and often fail to produce aptamers with comparable binding performance to antibodies. This Account describes a body of work from our laboratory in developing advanced methods for consistently producing high-performance aptamers with higher efficiency, fewer resources, and, most importantly, a greater probability of success. We describe our efforts in systematically transforming each major step of the aptamer discovery process: selection, analysis, and characterization. To improve selection, we have developed microfluidic devices (M-SELEX) that enable discovery of high-affinity aptamers after a minimal number of selection rounds by precisely controlling the target concentration and washing stringency. In terms of improving aptamer pool analysis, our group was the first to use high-throughput sequencing (HTS) for the discovery of new aptamers. We showed that tracking the enrichment trajectory of individual aptamer sequences enables the identification of high-performing aptamers without requiring full convergence of the selected aptamer pool. HTS is now widely used for aptamer discovery, and open-source software has become available to facilitate analysis. To improve binding characterization, we used HTS data to design custom aptamer arrays to measure the affinity and specificity of up to ∼10(4) DNA aptamers in parallel as a means to rapidly discover high-quality aptamers. Most recently, our efforts have culminated in the invention of the "particle display" (PD) screening system, which

  8. Advancements in Aptamer Discovery Technologies.

    PubMed

    Gotrik, Michael R; Feagin, Trevor A; Csordas, Andrew T; Nakamoto, Margaret A; Soh, H Tom

    2016-09-20

    Affinity reagents that specifically bind to their target molecules are invaluable tools in nearly every field of modern biomedicine. Nucleic acid-based aptamers offer many advantages in this domain, because they are chemically synthesized, stable, and economical. Despite these compelling features, aptamers are currently not widely used in comparison to antibodies. This is primarily because conventional aptamer-discovery techniques such as SELEX are time-consuming and labor-intensive and often fail to produce aptamers with comparable binding performance to antibodies. This Account describes a body of work from our laboratory in developing advanced methods for consistently producing high-performance aptamers with higher efficiency, fewer resources, and, most importantly, a greater probability of success. We describe our efforts in systematically transforming each major step of the aptamer discovery process: selection, analysis, and characterization. To improve selection, we have developed microfluidic devices (M-SELEX) that enable discovery of high-affinity aptamers after a minimal number of selection rounds by precisely controlling the target concentration and washing stringency. In terms of improving aptamer pool analysis, our group was the first to use high-throughput sequencing (HTS) for the discovery of new aptamers. We showed that tracking the enrichment trajectory of individual aptamer sequences enables the identification of high-performing aptamers without requiring full convergence of the selected aptamer pool. HTS is now widely used for aptamer discovery, and open-source software has become available to facilitate analysis. To improve binding characterization, we used HTS data to design custom aptamer arrays to measure the affinity and specificity of up to ∼10(4) DNA aptamers in parallel as a means to rapidly discover high-quality aptamers. Most recently, our efforts have culminated in the invention of the "particle display" (PD) screening system, which

  9. Analysis and Identification of Aptamer-Compound Interactions with a Maximum Relevance Minimum Redundancy and Nearest Neighbor Algorithm

    PubMed Central

    Wang, ShaoPeng; Zhang, Yu-Hang; Lu, Jing; Cui, Weiren; Hu, Jerry; Cai, Yu-Dong

    2016-01-01

    The development of biochemistry and molecular biology has revealed an increasingly important role of compounds in several biological processes. Like the aptamer-protein interaction, aptamer-compound interaction attracts increasing attention. However, it is time-consuming to select proper aptamers against compounds using traditional methods, such as exponential enrichment. Thus, there is an urgent need to design effective computational methods for searching effective aptamers against compounds. This study attempted to extract important features for aptamer-compound interactions using feature selection methods, such as Maximum Relevance Minimum Redundancy, as well as incremental feature selection. Each aptamer-compound pair was represented by properties derived from the aptamer and compound, including frequencies of single nucleotides and dinucleotides for the aptamer, as well as the constitutional, electrostatic, quantum-chemical, and space conformational descriptors of the compounds. As a result, some important features were obtained. To confirm the importance of the obtained features, we further discussed the associations between them and aptamer-compound interactions. Simultaneously, an optimal prediction model based on the nearest neighbor algorithm was built to identify aptamer-compound interactions, which has the potential to be a useful tool for the identification of novel aptamer-compound interactions. The program is available upon the request. PMID:26955638

  10. Engineering new aptamer geometries for electrochemical aptamer-based sensors

    NASA Astrophysics Data System (ADS)

    White, Ryan J.; Plaxco, Kevin W.

    2009-05-01

    Electrochemical aptamer-based sensors (E-AB sensors) represent a promising new approach to the detection of small molecules. E-AB sensors comprise an aptamer that is attached at one end to an electrode surface. The distal end of the aptamer probed is modified with an electroactive redox marker for signal transduction. Herein we report on the optimization of a cocaine-detecting E-AB sensor via optimization of the geometry of the aptamer. We explore two new aptamer architectures, one in which we concatenate three cocaine aptamers into a poly-aptamer and a second in which we divide the cocaine aptamer into pieces connected via an unstructured, 60-thymine linker. Both of these structures are designed such that the reporting redox tag will be located farther from the electrode in the unfolded, target-free conformation. Consistent with this, we find that signal gains of these two constructs are two to three times higher than that of the original E-AB architecture. Likewise all three architectures are selective enough to deploy directly in complex sample matrices, such as undiluted whole blood, with all three sensors successfully detecting the presence of cocaine. The findings in this ongoing study should be of value in future efforts to optimize the signaling of electrochemical aptamer-based sensors.

  11. Peptide Aptamers: Development and Applications

    PubMed Central

    Reverdatto, Sergey; Burz, David S.; Shekhtman, Alexander

    2015-01-01

    Peptide aptamers are small combinatorial proteins that are selected to bind to specific sites on their target molecules. Peptide aptamers consist of short, 5-20 amino acid residues long sequences, typically embedded as a loop within a stable protein scaffold. Various peptide aptamer scaffolds and in vitro and in vivo selection techniques are reviewed with emphasis on specific biomedical, bioimaging, and bioanalytical applications. PMID:25866267

  12. Aptamers: versatile molecular recognition probes for cancer detection

    PubMed Central

    Sun, Hongguang; Tan, Weihong; Zu, Youli

    2015-01-01

    In the past two decades, aptamers have emerged as a novel class of molecular recognition probes comprising uniquely-folded short RNA or single-stranded DNA oligonucleotides that bind to their cognate targets with high specificity and affinity. Aptamers, often referred to as “chemical antibodies”, possess several highly desirable features for clinical use. They can be chemically synthesized and are easily conjugated to a wide range of reporters for different applications, and are able to rapidly penetrate tissues. These advantages significantly enhance their clinical applicability, and render them excellent alternatives to antibody-based probes in cancer diagnostics and therapeutics. Aptamer probes based on fluorescence, colorimetry, magnetism, electrochemistry, and in conjunction with nanomaterials (e.g., nanoparticles, quantum dots, single-walled carbon nanotubes, and magnetic nanoparticles) have provided novel ultrasensitive cancer diagnostic strategies and assays. Furthermore, promising aptamer targeted-multimodal tumor imaging probes have been recently developed in conjunction with fluorescence, positron emission tomography (PET), single-photon emission computed tomography (SPECT), and magnetic resonance imaging (MRI). The capabilities of the aptamer-based platforms described herein underscore the great potential they hold for the future of cancer detection. In this review, we highlight the most prominent recent developments in this rapidly advancing field. PMID:26618445

  13. Molecular Diagnostic and Drug Delivery Agents based on Aptamer-Nanomaterial Conjugates

    PubMed Central

    Lee, Jung Heon; Yigit, Mehmet V.; Mazumdar, Debapriya; Lu, Yi

    2010-01-01

    Recent progress in an emerging area of designing aptamer and nanomaterial conjugates as molecular diagnostic and drug delivery agents in biomedical applications is summarized. Aptamers specific for a wide range of targets are first introduced and compared to antibodies. Methods of integrating these aptamers with a variety of nanomaterials, such as gold nanoparticles, quantum dots, carbon nanotubes, and superparamagnetic iron oxide nanoparticles, each with unique optical, magnetic, and electrochemical properties, are reviewed. Applications of these systems as fluorescent, colorimetric, magnetic resonance imaging, and electrochemical sensors in medical diagnostics are given, along with new applications as smart drug delivery agents. PMID:20338204

  14. Assays for aptamer-based platforms.

    PubMed

    Citartan, Marimuthu; Gopinath, Subash C B; Tominaga, Junji; Tan, Soo-Choon; Tang, Thean-Hock

    2012-04-15

    Aptamers are single stranded DNA or RNA oligonucleotides that have high affinity and specificity towards a wide range of target molecules. Aptamers have low molecular weight, amenable to chemical modifications and exhibit stability undeterred by repetitive denaturation and renaturation. Owing to these indispensable advantages, aptamers have been implemented as molecular recognition element as alternative to antibodies in various assays for diagnostics. By amalgamating with a number of methods that can provide information on the aptamer-target complex formation, aptamers have become the elemental tool for numerous biosensor developments. In this review, administration of aptamers in applications involving assays of fluorescence, electrochemistry, nano-label and nano-constructs are discussed. Although detection strategies are different for various aptamer-based assays, the core of the design strategies is similar towards reporting the presence of specific target binding to the corresponding aptamers. It is prognosticated that aptamers will find even broader applications with the development of new methods of transducing aptamer target binding.

  15. Applications of aptamers as sensors.

    PubMed

    Cho, Eun Jeong; Lee, Joo-Woon; Ellington, Andrew D

    2009-01-01

    Aptamers are ligand-binding nucleic acids whose affinities and selectivities can rival those of antibodies. They have been adapted to analytical applications not only as alternatives to antibodies, but as unique reagents in their own right. In particular, aptamers can be readily site-specifically modified during chemical or enzymatic synthesis to incorporate particular reporters, linkers, or other moieties. Also, aptamer secondary structures can be engineered to undergo analyte-dependent conformational changes, which, in concert with the ability to specifically place chemical agents, opens up a wealth of possible signal transduction schemas, irrespective of whether the detection modality is optical, electrochemical, or mass based. Finally, because aptamers are nucleic acids, they are readily adapted to sequence- (and hence signal-) amplification methods. However, application of aptamers without a basic knowledge of their biochemistry or technical requirements can cause serious analytical difficulties.

  16. Electronic aptamer-based sensors.

    PubMed

    Willner, Itamar; Zayats, Maya

    2007-01-01

    The selection of aptamers-nucleic acids that specifically bind low-molecular-weight substrates or proteins-by the SELEX (systematic evolution of ligands by exponential enrichment) procedure has attracted recent efforts directed to the development of new specific recognition units. In particular, extensive activities have been directed to the application of aptamers as versatile materials for the design of biosensors. The Minireview summarizes the recent accomplishments in developing electronic aptamer-based sensors (aptasensors), which include electrochemical, field-effect transistor, and microgravimetric quartz crystal microbalance sensors, and describes methods to develop amplified aptasensor devices and label-free aptasensors.

  17. Aptamers for Targeted Drug Delivery

    PubMed Central

    Ray, Partha; White, Rebekah R.

    2010-01-01

    Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX). SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery. PMID:27713328

  18. Aptamers for Targeted Drug Delivery

    PubMed Central

    Ray, Partha; White, Rebekah R.

    2010-01-01

    Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX). SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  19. Displacement enzyme linked aptamer assay.

    PubMed

    Baldrich, Eva; Acero, Josep Lluis; Reekmans, Gunter; Laureyn, Wim; O'Sullivan, Ciara K

    2005-08-01

    Immense effort has been placed on the realization of immunoassays exploiting displacement of a suboptimum target, due to the ease of use and applicability to immunochromatographic strips and immunosensors. Most of the efforts reported to date focus on the use of a suboptimal target that is displaceable by the target toward which the antibody has higher affinity. Limited success has been achieved due to difficulty in obtaining suboptimal targets to which the antibody has enough affinity to bind while at the same time having lower levels of affinity in comparison to the target to facilitate displacement. Aptamers are synthetic oligonucleotides specifically selected to bind a certain target. Thanks to their high affinity and sensitivity, aptamers appear as alternative candidates to antibodies for analytical devices and several enzyme-linked aptamer assays and aptasensors have been reported. Aptamers, in contrast to antibodies, require the formation of a three-dimensional structure for target binding and can thus be anticipated to have a much higher affinity for binding its target rather than a modified form of the target (e.g., enzyme-labeled target). This phenomenon can be exploited for the development of a displacement assay, using enzyme-labeled target as a suboptimal displaceable molecule. Here, we report the first demonstration of the exploitation of an aptamer in an extremely rapid and highly sensitive displacement assay. Surface plasmon resonance studies demonstrated the thrombin-binding aptamer to have a lower affinity for enzyme-labeled thrombin than unmodified thrombin, with respective K(D) of 1.1 x 10(-8) and 2.9 x 10(-9) M. The assay is extremely rapid, requiring only 10 min for completion, and exhibits a detection limit lower than that obtainable with competitive enzyme-linked aptamer assays and comparable to that of hybrid aptamer-antibody assays. Optimal storage conditions for precoated microtiter plates (consisting of coated aptamer and captured

  20. Methods for Improving Aptamer Binding Affinity.

    PubMed

    Hasegawa, Hijiri; Savory, Nasa; Abe, Koichi; Ikebukuro, Kazunori

    2016-01-01

    Aptamers are single stranded oligonucleotides that bind a wide range of biological targets. Although aptamers can be isolated from pools of random sequence oligonucleotides using affinity-based selection, aptamers with high affinities are not always obtained. Therefore, further refinement of aptamers is required to achieve desired binding affinities. The optimization of primary sequences and stabilization of aptamer conformations are the main approaches to refining the binding properties of aptamers. In particular, sequence optimization using combined in silico sequence recombinations and in vitro functional evaluations is effective for the improvement of binding affinities, however, the binding affinities of aptamers are limited by the low hydrophobicity of nucleic acids. Accordingly, introduction of hydrophobic moieties into aptamers expands the diversity of interactions between aptamers and targets. Moreover, construction of multivalent aptamers by connecting aptamers that recognize distinct epitopes is an attractive approach to substantial increases in binding affinity. In addition, binding affinities can be tuned by optimizing the scaffolds of multivalent constructs. In this review, we summarize the various techniques for improving the binding affinities of aptamers. PMID:27043498

  1. A Highly Selective and Sensitive Fluorescence Detection Method of Glyphosate Based on an Immune Reaction Strategy of Carbon Dot Labeled Antibody and Antigen Magnetic Beads.

    PubMed

    Wang, Duo; Lin, Bixia; Cao, Yujuan; Guo, Manli; Yu, Ying

    2016-08-01

    A sensitive fluorescence detection method for glyphosate (GLY) was established based on immune reaction. First, carbon dot labeled antibodies (lgG-CDs) which were able to specifically identify glyphosate were prepared with the environmentally friendly carbon dots (CDs) and glyphosate antibody (lgG). lgG-CDs could be used to in situ visualize the distribution of glyphosate in plant tissues. In order to eliminate the effects of excess lgG-CDs on the determination of GLY, antigen magnetic beads Fe3O4-GLY based on magnetic nanoparticles Fe3O4 and glyphosate were constructed and utilized to couple with the excess lgG-CDs. After magnetic separation to remove antigen magnetic beads, there was a linear relationship between the fluorescence intensity of lgG-CDs and the logarithmic concentration of glyphosate in the range of 0.01-80 μg/mL with a detection limit of 8 ng/mL. The method was used for the detection of glyphosate in Pearl River water, tea, and soil samples with satisfactory recovery ratio between 87.4% and 103.7%. PMID:27403652

  2. A Highly Selective and Sensitive Fluorescence Detection Method of Glyphosate Based on an Immune Reaction Strategy of Carbon Dot Labeled Antibody and Antigen Magnetic Beads.

    PubMed

    Wang, Duo; Lin, Bixia; Cao, Yujuan; Guo, Manli; Yu, Ying

    2016-08-01

    A sensitive fluorescence detection method for glyphosate (GLY) was established based on immune reaction. First, carbon dot labeled antibodies (lgG-CDs) which were able to specifically identify glyphosate were prepared with the environmentally friendly carbon dots (CDs) and glyphosate antibody (lgG). lgG-CDs could be used to in situ visualize the distribution of glyphosate in plant tissues. In order to eliminate the effects of excess lgG-CDs on the determination of GLY, antigen magnetic beads Fe3O4-GLY based on magnetic nanoparticles Fe3O4 and glyphosate were constructed and utilized to couple with the excess lgG-CDs. After magnetic separation to remove antigen magnetic beads, there was a linear relationship between the fluorescence intensity of lgG-CDs and the logarithmic concentration of glyphosate in the range of 0.01-80 μg/mL with a detection limit of 8 ng/mL. The method was used for the detection of glyphosate in Pearl River water, tea, and soil samples with satisfactory recovery ratio between 87.4% and 103.7%.

  3. STED nanoscopy with fluorescent quantum dots

    PubMed Central

    Hanne, Janina; Falk, Henning J.; Görlitz, Frederik; Hoyer, Patrick; Engelhardt, Johann; Sahl, Steffen J.; Hell, Stefan W.

    2015-01-01

    The widely popular class of quantum-dot molecular labels could so far not be utilized as standard fluorescent probes in STED (stimulated emission depletion) nanoscopy. This is because broad quantum-dot excitation spectra extend deeply into the spectral bands used for STED, thus compromising the transient fluorescence silencing required for attaining super-resolution. Here we report the discovery that STED nanoscopy of several red-emitting commercially available quantum dots is in fact successfully realized by the increasingly popular 775 nm STED laser light. A resolution of presently ∼50 nm is demonstrated for single quantum dots, and sub-diffraction resolution is further shown for imaging of quantum-dot-labelled vimentin filaments in fibroblasts. The high quantum-dot photostability enables repeated STED recordings with >1,000 frames. In addition, we have evidence that the tendency of quantum-dot labels to blink is largely suppressed by combined action of excitation and STED beams. Quantum-dot STED significantly expands the realm of application of STED nanoscopy, and, given the high stability of these probes, holds promise for extended time-lapse imaging. PMID:25980788

  4. STED nanoscopy with fluorescent quantum dots

    NASA Astrophysics Data System (ADS)

    Hanne, Janina; Falk, Henning J.; Görlitz, Frederik; Hoyer, Patrick; Engelhardt, Johann; Sahl, Steffen J.; Hell, Stefan W.

    2015-05-01

    The widely popular class of quantum-dot molecular labels could so far not be utilized as standard fluorescent probes in STED (stimulated emission depletion) nanoscopy. This is because broad quantum-dot excitation spectra extend deeply into the spectral bands used for STED, thus compromising the transient fluorescence silencing required for attaining super-resolution. Here we report the discovery that STED nanoscopy of several red-emitting commercially available quantum dots is in fact successfully realized by the increasingly popular 775 nm STED laser light. A resolution of presently ~50 nm is demonstrated for single quantum dots, and sub-diffraction resolution is further shown for imaging of quantum-dot-labelled vimentin filaments in fibroblasts. The high quantum-dot photostability enables repeated STED recordings with >1,000 frames. In addition, we have evidence that the tendency of quantum-dot labels to blink is largely suppressed by combined action of excitation and STED beams. Quantum-dot STED significantly expands the realm of application of STED nanoscopy, and, given the high stability of these probes, holds promise for extended time-lapse imaging.

  5. STED nanoscopy with fluorescent quantum dots.

    PubMed

    Hanne, Janina; Falk, Henning J; Görlitz, Frederik; Hoyer, Patrick; Engelhardt, Johann; Sahl, Steffen J; Hell, Stefan W

    2015-05-18

    The widely popular class of quantum-dot molecular labels could so far not be utilized as standard fluorescent probes in STED (stimulated emission depletion) nanoscopy. This is because broad quantum-dot excitation spectra extend deeply into the spectral bands used for STED, thus compromising the transient fluorescence silencing required for attaining super-resolution. Here we report the discovery that STED nanoscopy of several red-emitting commercially available quantum dots is in fact successfully realized by the increasingly popular 775 nm STED laser light. A resolution of presently ∼ 50 nm is demonstrated for single quantum dots, and sub-diffraction resolution is further shown for imaging of quantum-dot-labelled vimentin filaments in fibroblasts. The high quantum-dot photostability enables repeated STED recordings with >1,000 frames. In addition, we have evidence that the tendency of quantum-dot labels to blink is largely suppressed by combined action of excitation and STED beams. Quantum-dot STED significantly expands the realm of application of STED nanoscopy, and, given the high stability of these probes, holds promise for extended time-lapse imaging.

  6. Adhesion through single peptide aptamers

    PubMed Central

    Aubin-Tam, Marie-Eve; Appleyard, David C.; Ferrari, Enrico; Garbin, Valeria; Fadiran, Oluwatimilehin O.; Kunkel, Jacquelyn; Lang, Matthew J.

    2014-01-01

    Aptamer and antibody mediated adhesion is central to biological function and valuable in the engineering of “lab on a chip” devices. Single molecule force spectroscopy using optical tweezers enables direct non-equilibrium measurement of these non-covalent interactions for three peptide aptamers selected for glass, polystyrene, and carbon nanotubes. A comprehensive examination of the strong attachment between anti-fluorescein 4-4-20 and fluorescein was also carried out using the same assay. Bond lifetime, barrier width, and free energy of activation are extracted from unbinding histogram data using three single molecule pulling models. The evaluated aptamers appear to adhere stronger than the fluorescein antibody under no- and low-load conditions, yet weaker than antibodies at loads above ~25pN. Comparison to force spectroscopy data of other biological linkages shows the diversity of load dependent binding and provides insight into linkages used in biological processes and those designed for engineered systems. PMID:20795685

  7. Strategies for the discovery of therapeutic Aptamers

    PubMed Central

    Yang, Xianbin; Li, Na; Gorenstein, David G.

    2010-01-01

    Importance of the field Therapeutic aptamers are synthetic, structured oligonucleotides that bind to a very broad range of targets with high affinity and specificity. They are an emerging class of targeting ligand that show great promise for treating a number of diseases. A series of aptamers currently in various stages of clinical development highlights the potential of aptamers for therapeutic applications. Area covered in this review This review will cover in vitro selection of oligonucleotide ligands, called aptamers, from a combinatorial library using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process as well as the other known strategies for finding aptamers against various targets. What the reader will gain Readers will gain an understanding of the highly useful strategies for successful aptamer discovery. They may also be able combine two or more of the presented strategies for their aptamer discovery projects. Take home message Although many processes are available for discovering aptamers, it is not trivial to discover an aptamer candidate that is ready to move toward pharmaceutical drug development. It is also apparent that there have been relatively few therapeutic advances and clinical trials undertaken due to the small number of companies that participate in aptamer development. PMID:21359096

  8. Investigating the malleability of RNA aptamers

    SciTech Connect

    Ilgu, Muslum; Wang, Tianjiao; Lamm, Monica H.; Nilsen-Hamilton, Marit

    2013-03-25

    Aptamers are short, single-stranded nucleic acids with structures that frequently change upon ligand binding and are sensitive to the ionic environment. To achieve facile application of aptamers in controlling cellular activities, a better understanding is needed of aptamer ligand binding parameters, structures, intramolecular mobilities and how these structures adapt to different ionic environments with consequent effects on their ligand binding characteristics.The paper discusses the integration of biochemical analysis with NMR spectroscopy and computational modeling to explore the relation between ligand binding and structural malleability of some well-studied aptamers. Several methods for determining aptamer binding affinity and specificity are discussed, including isothermal titration calorimetry, steady state fluorescence of 2-aminopurine substituted aptamers, and dye displacement assays. Also considered are aspects of molecular dynamics simulations specific to aptamers including adding ions and simulating aptamer structure in the absence of ligand when NMR spectroscopy or X-ray crystallography structures of the unoccupied aptamer are not available. We focus specifically on RNA aptamers that bind small molecule ligands as would be applied in sensors or integrated into riboswitches such as to measure the products of metabolic activity.

  9. Trends in aptamer selection methods and applications.

    PubMed

    Yüce, Meral; Ullah, Naimat; Budak, Hikmet

    2015-08-21

    Aptamers are target specific ssDNA, RNA or peptide sequences generated by an in vitro selection and amplification method called SELEX (Systematic Evolution of Ligands by EXponential Enrichment), which involves repetitive cycles of binding, recovery and amplification steps. Aptamers have the ability to bind with a variety of targets such as drugs, proteins, heavy metals, and pathogens with high specificity and selectivity. Aptamers are similar to monoclonal antibodies regarding their binding affinities, but they offer a number of advantages over the existing antibody-based detection methods, which make the aptamers promising diagnostic and therapeutic tools for future biomedical and analytical applications. The aim of this review article is to provide an overview of the recent advancements in aptamer screening methods along with a concise description of the major application areas of aptamers including biomarker discovery, diagnostics, imaging and nanotechnology. PMID:26114391

  10. Aptamers in virology: recent advances and challenges.

    PubMed

    Binning, Jennifer M; Leung, Daisy W; Amarasinghe, Gaya K

    2012-01-01

    Aptamers generated from randomized libraries of nucleic acids have found utility in a wide variety of fields and in the clinic. Aptamers can be used to target both intracellular and extracellular components, including small molecules, proteins, cells, and viruses. With recent technological developments in stringent selection and rapid isolation strategies, it is likely that aptamers will continue to make an impact as useful tools and reagents. Although many recently developed aptamers are intended for use as therapeutic and diagnostic agents, use of aptamers for basic research, including target validation, remains an active area with high potential to impact our understanding of molecular mechanisms and for drug discovery. In this brief review, we will discuss recent aptamer discoveries, their potential role in structural virology, as well as challenges and future prospects.

  11. Aptamer-conjugated nanomaterials and their applications.

    PubMed

    Yang, Liu; Zhang, Xiaobing; Ye, Mao; Jiang, Jianhui; Yang, Ronghua; Fu, Ting; Chen, Yan; Wang, Kemin; Liu, Chen; Tan, Weihong

    2011-11-01

    The combination of aptamers with novel nanomaterials, including nanomaterial-based aptamer bioconjugates has attracted considerable interest and has led to a wide variety of applications. In this review, we discuss how a variety of nanomaterials, including gold, silica and magnetic nanoparticles, as well as carbon nanotubes, hydrogels, liposomes and micelles, have been used to functionalize aptamers for a variety of applications. These aptamer functionalized materials have led to advances in amplified biosensing, cancer cell-specific recognition, high-efficiency separation, and targeted drug delivery. PMID:22016112

  12. Aptamer-based modulation of blood coagulation.

    PubMed

    Mayer, G; Rohrbach, F; Pötzsch, B; Müller, J

    2011-11-01

    Nucleic acid based aptamers are single-stranded oligonucleotide ligands isolated from random libraries by an in-vitro selection procedure. Through the formation of unique three-dimensional structures, aptamers are able to selectively interact with a variety of target molecules and are therefore also promising candidates for the development of anticoagulant drugs. While thrombin represents the most prominent enzymatic target in this field, also aptamers directed against other coagulation proteins and proteases have been identified with some currently being tested in clinical trials. In this review, we summarize recent developments in the design and evaluation of aptamers for anticoagulant therapy and research.

  13. Aptamer-conjugated nanomaterials and their applications

    PubMed Central

    Yang, Liu; Ye, Mao; Yang, Ronghua; Fu, Ting; Chen, Yan; Wang, Kemin

    2011-01-01

    The combination of aptamers with novel nanomaterials, including nanomaterial-based aptamer bioconjugates. has attracted considerable interest and has led to a wide variety of applications. In this review, we discuss how a variety of nanomaterials, including gold, silica and magnetic nanoparticles, as well as carbon nanotubes, hydrogels, liposomes and micelles, have been used to functionalize aptamers for a variety of applications. These aptamer functionalized materials have led to advances in amplified biosensing, cancer cell-specific recognition, high-efficiency separation, and targeted drug delivery. PMID:22016112

  14. DNA Aptamer Technology for Personalized Medicine

    PubMed Central

    Xing, Hang; Hwang, Kevin; Li, Ji; Torabi, Seyed-Fakhreddin; Lu, Yi

    2014-01-01

    This review highlights recent progress in developing DNA aptamers for personalized medicine, with more focus on in vivo studies for potential clinical applications. Examples include design of aptamers in combination with DNA nanostructures, nanomaterials, or microfluidic devices as diagnostic probes or therapeutic agents for cancers and other diseases. The use of aptamers as targeting agents in drug delivery is also covered. The advantages and future directions of such DNA aptamer-based technology for the continued development of personalized medicine are discussed. PMID:24791224

  15. Detection of biomolecule by aptamer beacon.

    PubMed

    Nishihira, Akifumi; Ozaki, Hiroaki; Wakabayashi, Masayuki; Kuwahara, Masayasu; Sawai, Hiroaki

    2004-01-01

    Labeled oligodeoxyribonucleotide bearing fluorescent dyes at both ends and aptamer sequence for adenosine 5'-monophosphate (AMP) was synthesized. Fluorescence spectra of labeled aptamer were not so much different between with and without AMP. This result suggests the binding of AMP didn't cause the global structural change to the aptamer. Therefore, we used short complementary DNA (SCD) as an assistant DNA, which is an unmodified 11mer and have a complementary sequence of 5'-region of the labeled aptamer. In the presence of SCD, the fluorescence intensities decrease with increasing the concentration of AMP compared with a change in absence of SCD.

  16. Aptamers and riboswitches: perspectives in biotechnology.

    PubMed

    Weigand, Julia E; Suess, Beatrix

    2009-11-01

    Aptamers are short, single stranded nucleic acids which bind a wide range of different ligands with extraordinary high binding affinity and specificity. The steadily increasing number of aptamers is accompanied by an expanding range of applications in biotechnology. We will describe new developments in the field including the use of aptamers for conditional gene regulation and as biosensors. In addition, we will discuss the potential of aptamers as tags to visualize RNA and protein distribution in living cells and as therapeutics. Furthermore, we will consider biotechnological applications of riboswitches for gene regulation and as drug target. PMID:19756582

  17. Development of naturally selected and molecularly engineered intrachain and competitive FRET-aptamers and aptamer beacons.

    PubMed

    Bruno, John G; Zuniga, Miguel A; Carrillo, Maria P; Phillips, Taylor

    2011-08-01

    Several different approaches have been taken to development of homogeneous fluorescent aptamer assays including end-labeled beacons and signaling aptamers which are intrinsically quenched by nucleotides. Two new strategies dubbed "intrachain" and "competitive" FRET-aptamer assays are summarized in this review. Intrachain and competitive FRET-aptamers can be engineered on the molecular level through a series exploratory experiments involving prior knowledge of aptamer secondary or tertiary structures and hypotheses about aptamer conformational changes. However, there is an intrinsic risk of altering aptamer affinity or specificity associated with chemical modifications of an aptamer. Natural selection methods for FRET-aptamers have also been devised to potentially obviate the chemical modification problem. The naturally selected aptamers are subjected to fluorophore (F)- and or quencher (Q)-conjugated nucleotide triphosphate (NTP) incorporation by polymerase chain reaction (PCR) with permissive polymerases such as Deep Vent exo-, but still demonstrate sensitive and specific assay performance despite modified bases, because they are ultimately selected after decoration with F and Q. This paper summarizes work in this area and presents some new examples of the engineered and naturally selected FRET-aptamers for detection of vitamin D.

  18. Monitoring Intact Viruses Using Aptamers

    PubMed Central

    Kumar, Penmetcha K. R.

    2016-01-01

    Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review. PMID:27527230

  19. Monitoring Intact Viruses Using Aptamers.

    PubMed

    Kumar, Penmetcha K R

    2016-01-01

    Viral diagnosis and surveillance are necessary steps in containing the spread of viral diseases, and they help in the deployment of appropriate therapeutic interventions. In the past, the commonly employed viral detection methods were either cell-culture or molecule-level assays. Most of these assays are laborious and expensive, require special facilities, and provide a slow diagnosis. To circumvent these limitations, biosensor-based approaches are becoming attractive, especially after the successful commercialization of glucose and other biosensors. In the present article, I have reviewed the current progress using the biosensor approach for detecting intact viruses. At the time of writing this review, three types of bioreceptor surfaces (antibody-, glycan-, and aptamer-based) have been explored on different sensing platforms for detecting intact viruses. Among these bioreceptors, aptamer-based sensors have been increasingly explored for detecting intact viruses using surface plasmon resonance (SPR) and other platforms. Special emphasis is placed on the aptamer-based SPR platform in the present review. PMID:27527230

  20. Post-SELEX optimization of aptamers.

    PubMed

    Gao, Shunxiang; Zheng, Xin; Jiao, Binghua; Wang, Lianghua

    2016-07-01

    Aptamers are functional single-stranded DNA or RNA oligonucleotides, selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment), which can fold into stable unique three-dimensional structures that bind their target ligands with high affinity and specificity. Although aptamers show a number of favorable advantages such as better stability and easier modification when compared with the properties of antibodies, only a handful of aptamers have entered clinical trials and only one, pegaptanib, has received US Food and Drug Administration approval for clinical use. The main reasons that limit the practical application of aptamers are insufficient nuclease stability, bioavailability, thermal stability, or even affinity. Some aptamers obtained from modified libraries show better properties; however, polymerase amplification of nucleic acids containing non-natural bases is currently a primary drawback of the SELEX process. This review focuses on several post-SELEX optimization strategies of aptamers identified in recent years. We describe four common methods in detail: truncation, chemical modification, bivalent or multivalent aptamer construction, and mutagenesis. We believe that these optimization strategies should improve one or more specific properties of aptamers, and the type of feature(s) selected for improvement will be dependent on the application purpose. PMID:27173394

  1. Post-SELEX optimization of aptamers.

    PubMed

    Gao, Shunxiang; Zheng, Xin; Jiao, Binghua; Wang, Lianghua

    2016-07-01

    Aptamers are functional single-stranded DNA or RNA oligonucleotides, selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment), which can fold into stable unique three-dimensional structures that bind their target ligands with high affinity and specificity. Although aptamers show a number of favorable advantages such as better stability and easier modification when compared with the properties of antibodies, only a handful of aptamers have entered clinical trials and only one, pegaptanib, has received US Food and Drug Administration approval for clinical use. The main reasons that limit the practical application of aptamers are insufficient nuclease stability, bioavailability, thermal stability, or even affinity. Some aptamers obtained from modified libraries show better properties; however, polymerase amplification of nucleic acids containing non-natural bases is currently a primary drawback of the SELEX process. This review focuses on several post-SELEX optimization strategies of aptamers identified in recent years. We describe four common methods in detail: truncation, chemical modification, bivalent or multivalent aptamer construction, and mutagenesis. We believe that these optimization strategies should improve one or more specific properties of aptamers, and the type of feature(s) selected for improvement will be dependent on the application purpose.

  2. Aptamer Selection Technology and Recent Advances

    PubMed Central

    Blind, Michael; Blank, Michael

    2015-01-01

    Over the last decade, aptamers have begun to find their way from basic research to diverse commercial applications. The development of diagnostics is even more widespread than clinical applications because aptamers do not have to be extensively modified to enhance their in vivo stability and pharmacokinetics in diagnostic assays. The increasing attention has propelled the technical progress of the in vitro selection technology (SELEX) to enhance the efficiency of developing aptamers for commercially interesting targets. This review highlights recent progress in the technical steps of a SELEX experiment with a focus on high-throughput next-generation sequencing and bioinformatics. Achievements have been made in the optimization of aptamer libraries, separation schemes, amplification of the selected libraries and the identification of aptamer sequences from enriched libraries.

  3. Using Aptamers for Cancer Biomarker Discovery

    PubMed Central

    Chang, Yun Min; Donovan, Michael J.; Tan, Weihong

    2013-01-01

    Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment) SELEX and cell-based SELEX (cell-SELEX). Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics. PMID:23401749

  4. Aptamers: molecular tools for analytical applications.

    PubMed

    Mairal, Teresa; Ozalp, Veli Cengiz; Lozano Sánchez, Pablo; Mir, Mònica; Katakis, Ioanis; O'Sullivan, Ciara K

    2008-02-01

    Aptamers are artificial nucleic acid ligands, specifically generated against certain targets, such as amino acids, drugs, proteins or other molecules. In nature they exist as a nucleic acid based genetic regulatory element called a riboswitch. For generation of artificial ligands, they are isolated from combinatorial libraries of synthetic nucleic acid by exponential enrichment, via an in vitro iterative process of adsorption, recovery and reamplification known as systematic evolution of ligands by exponential enrichment (SELEX). Thanks to their unique characteristics and chemical structure, aptamers offer themselves as ideal candidates for use in analytical devices and techniques. Recent progress in the aptamer selection and incorporation of aptamers into molecular beacon structures will ensure the application of aptamers for functional and quantitative proteomics and high-throughput screening for drug discovery, as well as in various analytical applications. The properties of aptamers as well as recent developments in improved, time-efficient methods for their selection and stabilization are outlined. The use of these powerful molecular tools for analysis and the advantages they offer over existing affinity biocomponents are discussed. Finally the evolving use of aptamers in specific analytical applications such as chromatography, ELISA-type assays, biosensors and affinity PCR as well as current avenues of research and future perspectives conclude this review.

  5. Aptamers: molecular tools for analytical applications.

    PubMed

    Mairal, Teresa; Ozalp, Veli Cengiz; Lozano Sánchez, Pablo; Mir, Mònica; Katakis, Ioanis; O'Sullivan, Ciara K

    2008-02-01

    Aptamers are artificial nucleic acid ligands, specifically generated against certain targets, such as amino acids, drugs, proteins or other molecules. In nature they exist as a nucleic acid based genetic regulatory element called a riboswitch. For generation of artificial ligands, they are isolated from combinatorial libraries of synthetic nucleic acid by exponential enrichment, via an in vitro iterative process of adsorption, recovery and reamplification known as systematic evolution of ligands by exponential enrichment (SELEX). Thanks to their unique characteristics and chemical structure, aptamers offer themselves as ideal candidates for use in analytical devices and techniques. Recent progress in the aptamer selection and incorporation of aptamers into molecular beacon structures will ensure the application of aptamers for functional and quantitative proteomics and high-throughput screening for drug discovery, as well as in various analytical applications. The properties of aptamers as well as recent developments in improved, time-efficient methods for their selection and stabilization are outlined. The use of these powerful molecular tools for analysis and the advantages they offer over existing affinity biocomponents are discussed. Finally the evolving use of aptamers in specific analytical applications such as chromatography, ELISA-type assays, biosensors and affinity PCR as well as current avenues of research and future perspectives conclude this review. PMID:17581746

  6. Design strategies for aptamer-based biosensors.

    PubMed

    Han, Kun; Liang, Zhiqiang; Zhou, Nandi

    2010-01-01

    Aptamers have been widely used as recognition elements for biosensor construction, especially in the detection of proteins or small molecule targets, and regarded as promising alternatives for antibodies in bioassay areas. In this review, we present an overview of reported design strategies for the fabrication of biosensors and classify them into four basic modes: target-induced structure switching mode, sandwich or sandwich-like mode, target-induced dissociation/displacement mode and competitive replacement mode. In view of the unprecedented advantages brought about by aptamers and smart design strategies, aptamer-based biosensors are expected to be one of the most promising devices in bioassay related applications.

  7. [DNA aptamers selection for breast cancer].

    PubMed

    Zamay, G S; Belayanina, I V; Zamay, A S; Komarova, M A; Krat, A V; Eremina, E N; Zukov, R A; Sokolov, A E; Zamay, T N

    2016-05-01

    A method of selection of DNA aptamers to breast tumor tissue based on the use of postoperative material has been developed. Breast cancer tissues were used as the positive target; the negative targets included benign tumor tissue, adjacent healthy tissues, breast tissues from mastopathy patients, and also tissues of other types of malignant tumors. During selection a pool of DNA aptamers demonstrating selective binding to breast cancer cells and tissues and insignificant binding to breast benign tissues has been obtained. These DNA aptamers can be used for identification of protein markers, breast cancer diagnostics, and targeted delivery of anticancer drugs.

  8. Direct selection of RNA beacon aptamers.

    PubMed

    Morse, Daniel P

    2007-07-20

    A method for the direct selection of RNA molecules that can be easily converted into beacon aptamers is presented. Beacon aptamers are fluorescently labeled nucleic acids that signal the presence of a specific ligand through changes in fluorescence intensity. Typically, ligand binding causes an increase in fluorescence intensity by inducing a conformational change that separates a fluorophore/quencher pair. The method presented here simultaneously selects for ligand binding and induction of an appropriate conformational change. The method was tested by selecting RNA molecules that can detect the aminoglycoside antibiotic tobramycin. After 14 rounds of selection, two sequence families emerged. Upon conversion into beacon aptamers, representatives of the two selected sequence families specifically detected tobramycin, while a negative control RNA that did not survive the selection protocol did not function as a tobramycin beacon aptamer.

  9. Electrochemical Approaches to Aptamer-Based Sensing

    NASA Astrophysics Data System (ADS)

    Xiao, Yi; Plaxco, Kevin W.

    Motivated by the potential convenience of electronic detection, a wide range of electrochemical, aptamer-based sensors have been reported since the first was described only in 2005. Although many of these are simply electrochemical, aptamer-based equivalents of traditional immunochemical approaches (e.g., sandwich and competition assays employing electroactive signaling moieties), others exploit the unusual physical properties of aptamers, properties that render them uniquely well suited for application to impedance and folding-based electrochemical sensors. In particular, the ability of electrode-bound aptamers to undergo reversible, binding-induced folding provides a robust, reagentless means of transducing target binding into an electronic signal that is largely impervious to nonspecific signals arising from contaminants. This capability enables the direct detection of specific proteins at physiologically relevant, picomolar concentrations in blood serum and other complex, contaminant-ridden sample matrices.

  10. Aptamers: A Feasible Technology in Cancer Immunotherapy.

    PubMed

    Soldevilla, M M; Villanueva, H; Pastor, F

    2016-01-01

    Aptamers are single-chained RNA or DNA oligonucleotides (ODNs) with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy.

  11. Aptamers: A Feasible Technology in Cancer Immunotherapy

    PubMed Central

    Villanueva, H.; Pastor, F.

    2016-01-01

    Aptamers are single-chained RNA or DNA oligonucleotides (ODNs) with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy. PMID:27413756

  12. Aptamers and their Applications in Nanomedicine

    PubMed Central

    Sun, Hongguang; Zu, Youli

    2015-01-01

    Aptamers are composed of short RNA or single-stranded DNA sequences that, when folded into their unique three-dimensional conformation, can specifically bind to their cognate targets with high specificity and affinity. Although functionally similar to protein antibodies, oligonucleotide aptamers offer several advantages over protein antibodies in biomedical and clinical applications. Additionally, through the enhanced permeability and retention (EPR) effect, nanomedicines can improve the therapeutic index of a treatment and reduce side effects by enhancing accumulation at the disease site. However, this EPR effect is “passive targeting” to tumors and thus, may not be an ideal approach for targeted cancer therapy. To construct ligand-directed “active targeting” nano-based delivery systems, aptamer technology has been widely studied. The aptamer-equipped nanomedicines have been tested for in vitro diagnosis, in vivo imaging, targeted cancer therapy, theranostic approaches, sub-cellular molecule detection, food safety, and environment monitoring. This review will focus on the development of aptamer-conjugated nanomedicines and their application for in vivo imaging, targeted therapy, and theranostics. In some applications, aptamers can also be used as drug carriers or ON/OFF switches. Herein, some outstanding therapeutic approaches are also discussed on a case-by-case basis, such as an “on-command” release system and a combinational therapy strategy. PMID:25677591

  13. Structural computational modeling of RNA aptamers

    PubMed Central

    Xu, Xiaojun; Dickey, David D.; Chen, Shi-Jie; Giangrande, Paloma H.

    2016-01-01

    RNA aptamers represent an emerging class of biologics that can be easily adapted for personalized and precision medicine. Several therapeutic aptamers with desirable binding and functional properties have been developed and evaluated in preclinical studies over the past 25 years. However, for the majority of these aptamers, their clinical potential has yet to be realized. A significant hurdle to the clinical adoption of this novel class of biologicals is the limited information on their secondary and tertiary structure. Knowledge of the RNA’s structure would greatly facilitate and expedite the post-selection optimization steps required for translation, including truncation (to reduce costs of manufacturing), chemical modification (to enhance stability and improve safety) and chemical conjugation (to improve drug properties for combinatorial therapy). Here we describe a structural computational modeling methodology that when coupled to a standard functional assay, can be used to determine key sequence and structural motifs of an RNA aptamer. We applied this methodology to enable the truncation of an aptamer to prostate specific membrane antigen (PSMA) with great potential for targeted therapy that had failed previous truncation attempts. This methodology can be easily applied to optimize other aptamers with therapeutic potential. PMID:26972787

  14. From selection hits to clinical leads: progress in aptamer discovery

    PubMed Central

    Maier, Keith E; Levy, Matthew

    2016-01-01

    Aptamers were discovered more than 25 years ago, yet only one has been approved by the US Food and Drug Administration to date. With some noteworthy advances in their chemical design and the enzymes we use to make them, aptamers and aptamer-based therapeutics have seen a resurgence in interest. New aptamer drugs are being approved for clinical evaluation, and it is certain that we will see increasingly more aptamers and aptamer-like drugs in the future. In this review, we will discuss the production of aptamers with an emphasis on the advances and modifications that enabled early aptamers to succeed in clinical trials as well as those that are likely to be important for future generations of these drugs. PMID:27088106

  15. Aptamer beacons for the direct detection of proteins.

    PubMed

    Hamaguchi, N; Ellington, A; Stanton, M

    2001-07-15

    We have designed a new class of molecules, which we term aptamer beacons, for detecting a wide range of ligands. Similar to molecular beacons, aptamer beacons can adopt two or more conformations, one of which allows ligand binding. A fluorescence-quenching pair is used to report changes in conformation induced by ligand binding. An anti-thrombin aptamer was engineered into an aptamer beacon by adding nucleotides to the 5'-end which are complementary to nucleotides at the 3'-end of the aptamer. In the absence of thrombin, the added nucleotides will form a duplex with the 3'-end, forcing the aptamer beacon into a stem-loop structure. In the presence of thrombin, the aptamer beacon forms the ligand-binding structure. This conformational change causes a change in the distance between a fluorophore attached to the 5'-end and a quencher attached to the 3'-end. Aptamer beacon can be a sensitive tool for detecting proteins and other chemical compounds.

  16. Adenosine Triphosphate-Triggered Release of Macromolecular and Nanoparticle Loads from Aptamer/DNA-Cross-Linked Microcapsules.

    PubMed

    Liao, Wei-Ching; Lu, Chun-Hua; Hartmann, Raimo; Wang, Fuan; Sohn, Yang Sung; Parak, Wolfgang J; Willner, Itamar

    2015-09-22

    The synthesis of stimuli-responsive DNA microcapsules acting as carriers for different payloads, and being dissociated through the formation of aptamer-ligand complexes is described. Specifically, stimuli-responsive anti-adenosine triphosphate (ATP) aptamer-cross-linked DNA-stabilized microcapsules loaded with tetramethylrhodamine-modified dextran (TMR-D), CdSe/ZnS quantum dots (QDs), or microperoxidase-11 (MP-11) are presented. In the presence of ATP as trigger, the microcapsules are dissociated through the formation of aptamer-ATP complexes, resulting in the release of the respective loads. Selective unlocking of the capsules is demonstrated, and CTP, GTP, or TTP do not unlock the pores. The ATP-triggered release of MP-11 from the microcapsules enables the MP-11-catalyzed oxidation of Amplex UltraRed by H2O2 to the fluorescent product resorufin. PMID:26266334

  17. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  18. A systematic approach to evolve aptamers with new specificities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aptamers are single-stranded nucleic acids with high affinities and specificities for the targets against which they are selected. Both features, along with an ability to be integrated into a large variety of sensors, make possible a wide-range of aptamer applications. However, changing aptamer sp...

  19. RNA aptamers: from basic science towards therapy.

    PubMed

    Ulrich, H

    2006-01-01

    The SELEX technique (systematic evolution of ligands by exponential enrichment) provides a powerful tool for the in vitro selection of nucleic acid ligands (aptamers) from combinatorial oligonucleotide libraries against a target molecule. In the beginning of the technique's use, RNA molecules were identified that bind to proteins that naturally interact with nucleic acids or to small organic molecules. In the following years, the use of the SELEX technique was extended to isolate oligonucleotide ligands (aptamers) for a wide range of proteins of importance for therapy and diagnostics, such as growth factors and cell surface antigens. These oligonucleotides bind their targets with similar affinities and specificities as antibodies do. The in vitro selection of oligonucleotides with enzymatic activity, denominated aptazymes, allows the direct transduction of molecular recognition to catalysis. Recently, the use of in vitro selection methods to isolate protein inhibitors has been extended to complex targets, such as membrane-bound receptors, and even entire cells. RNA aptamers have also been expressed in living cells. These aptamers, also called intramers, can be used to dissect intracellular signal transduction pathways. The utility of RNA aptamers for in vivo experiments, as well as for diagnostic and therapeutic purposes, is considerably enhanced by chemical modifications, such as substitutions of the 2'-OH groups of the ribose backbone in order to provide resistance against enzymatic degradation in biological fluids. In an alternative approach, Spiegelmers are identified through in vitro selection of an unmodified D-RNA molecule against a mirror-image (i.e. a D-peptide) of a selection target, followed by synthesis of the unnatural nuclease-resistant L-configuration of the RNA aptamer that recognizes the natural configuration of its selection target (i.e. a L-peptide). Recently, nuclease-resistant inhibitory RNA aptamers have been developed against a great variety

  20. The brighter side of soils: quantum dots track organic nitrogen through fungi and plants.

    PubMed

    Whiteside, Matthew D; Treseder, Kathleen K; Atsatt, Peter R

    2009-01-01

    Soil microorganisms mediate many nutrient transformations that are central in terrestrial cycling of carbon and nitrogen. However, uptake of organic nutrients by microorganisms is difficult to study in natural systems. We assessed quantum dots (fluorescent nanoscale semiconductors) as a new tool to observe uptake and translocation of organic nitrogen by fungi and plants. We conjugated quantum dots to the amino groups of glycine, arginine, and chitosan and incubated them with Penicillium fungi (a saprotroph) and annual bluegrass (Poa annua) inoculated with arbuscular mycorrhizal fungi. As experimental controls, we incubated fungi and bluegrass samples with substrate-free quantum dots as well as unbound quantum dot substrate mixtures. Penicillium fungi, annual bluegrass, and arbuscular mycorrhizal fungi all showed uptake and translocation of quantum dot-labeled organic nitrogen, but no uptake of quantum dot controls. Additionally, we observed quantum dot-labeled organic nitrogen within soil hyphae, plant roots, and plant shoots using field imaging techniques. This experiment is one of the first to demonstrate direct uptake of organic nitrogen by arbuscular mycorrhizal fungi. PMID:19294917

  1. The brighter side of soils: quantum dots track organic nitrogen through fungi and plants.

    PubMed

    Whiteside, Matthew D; Treseder, Kathleen K; Atsatt, Peter R

    2009-01-01

    Soil microorganisms mediate many nutrient transformations that are central in terrestrial cycling of carbon and nitrogen. However, uptake of organic nutrients by microorganisms is difficult to study in natural systems. We assessed quantum dots (fluorescent nanoscale semiconductors) as a new tool to observe uptake and translocation of organic nitrogen by fungi and plants. We conjugated quantum dots to the amino groups of glycine, arginine, and chitosan and incubated them with Penicillium fungi (a saprotroph) and annual bluegrass (Poa annua) inoculated with arbuscular mycorrhizal fungi. As experimental controls, we incubated fungi and bluegrass samples with substrate-free quantum dots as well as unbound quantum dot substrate mixtures. Penicillium fungi, annual bluegrass, and arbuscular mycorrhizal fungi all showed uptake and translocation of quantum dot-labeled organic nitrogen, but no uptake of quantum dot controls. Additionally, we observed quantum dot-labeled organic nitrogen within soil hyphae, plant roots, and plant shoots using field imaging techniques. This experiment is one of the first to demonstrate direct uptake of organic nitrogen by arbuscular mycorrhizal fungi.

  2. Thrombin–aptamer recognition: a revealed ambiguity

    PubMed Central

    Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena

    2011-01-01

    Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the aptamer conformation and the interactions with the protein molecule. TBA is rapidly processed by nucleases. To improve the properties of TBA, a number of modified analogs have been produced. In particular, a modified TBA containing a 5′-5′ polarity inversion site, mTBA, has higher stability and higher affinity toward thrombin with respect to TBA, although it has a lower inhibitory activity. We present the crystal structure of the thrombin–mTBA complex at 2.15-Å resolution; the resulting model eventually provides a clear picture of thrombin–aptamers interaction, and also highlights the structural bases of the different properties of TBA and mTBA. Our findings open the way for a rational design of modified aptamers with improved potency as anticoagulant drugs. PMID:21715374

  3. RNA aptamer inhibitors of a restriction endonuclease

    PubMed Central

    Mondragón, Estefanía; Maher, L. James

    2015-01-01

    Restriction endonucleases (REases) recognize and cleave short palindromic DNA sequences, protecting bacterial cells against bacteriophage infection by attacking foreign DNA. We are interested in the potential of folded RNA to mimic DNA, a concept that might be applied to inhibition of DNA-binding proteins. As a model system, we sought RNA aptamers against the REases BamHI, PacI and KpnI using systematic evolution of ligands by exponential enrichment (SELEX). After 20 rounds of selection under different stringent conditions, we identified the 10 most enriched RNA aptamers for each REase. Aptamers were screened for binding and specificity, and assayed for REase inhibition. We obtained eight high-affinity (Kd ∼12-30 nM) selective competitive inhibitors (IC50 ∼20-150 nM) for KpnI. Predicted RNA secondary structures were confirmed by in-line attack assay and a 38-nt derivative of the best anti-KpnI aptamer was sufficient for inhibition. These competitive inhibitors presumably act as KpnI binding site analogs, but lack the primary consensus KpnI cleavage sequence and are not cleaved by KpnI, making their potential mode of DNA mimicry fascinating. Anti-REase RNA aptamers could have value in studies of REase mechanism and may give clues to a code for designing RNAs that competitively inhibit DNA binding proteins including transcription factors. PMID:26184872

  4. Aptamers against prion proteins and prions.

    PubMed

    Gilch, Sabine; Schätzl, Hermann M

    2009-08-01

    Prion diseases are fatal neurodegenerative and infectious disorders of humans and animals, characterized by structural transition of the host-encoded cellular prion protein (PrP(c)) into the aberrantly folded pathologic isoform PrP(Sc). RNA, DNA or peptide aptamers are classes of molecules which can be selected from complex combinatorial libraries for high affinity and specific binding to prion proteins and which might therefore be useful in diagnosis and therapy of prion diseases. Nucleic acid aptamers, which can be chemically synthesized, stabilized and immobilized, appear more suitable for diagnostic purposes, allowing use of PrP(Sc) as selection target. Peptide aptamers facilitate appropriate intracellular expression, targeting and re-routing without losing their binding properties to PrP, a requirement for potential therapeutic gene transfer experiments in vivo. Elucidation of structural properties of peptide aptamers might be used as basis for rational drug design, providing another attractive application of peptide aptamers in the search for effective anti-prion strategies.

  5. Cell-Specific Aptamer-Mediated Targeted Drug Delivery

    PubMed Central

    Zhou, Jiehua

    2011-01-01

    Nucleic acid aptamers are in vitro-selected small, single-stranded DNA or RNA oligonucleotides that can specifically recognize their target on the basis of their unique 3-dimensional structures. Recent advances in the development of escort aptamers to deliver and enhance the efficacy of other therapeutic agents have drawn enthusiasm in exploiting cell-type-specific aptamers as drug delivery vehicles. This review mainly focuses on the recent developments of aptamer-mediated targeted delivery systems. We also place particular emphasis on aptamers evolved against cell membrane receptors and possibilities for translation to clinical applications. PMID:21182455

  6. Challenges and Opportunities in the Development of Aptamers for TNFα.

    PubMed

    Nübel, Claudia; Appel, Bettina; Hospach, Ingeborg; Mai, Michaela; Krasteva, Nadejda; Nelles, Gabriele; Petruschka, Lothar; Müller, Sabine

    2016-06-01

    RNA aptamers for tumor necrosis factor-alpha (TNFα), for which functionality was demonstrated in L929 cells, show only little affinity for the protein in vitro. Detailed investigation of the aptamer-protein interaction by surface plasmon resonance and quartz crystal microbalance analysis revealed that affinity is not the only crucial parameter for efficacy and functionality of those aptamers. Instead, the sensitive equilibrium of the monomeric and homotrimeric form of soluble TNFα decides on aptamer binding. Our results show that the field of application and the source of TNFα have to be carefully defined before selection of aptamer sequences. PMID:26922730

  7. Function and dynamics of aptamers: A case study on the malachite green aptamer

    SciTech Connect

    Wang, Tianjiao

    2008-01-01

    Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH- is sterically excluded from the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD

  8. Aptamer nanomedicine for cancer therapeutics: barriers and potential for translation.

    PubMed

    Lao, Yeh-Hsing; Phua, Kyle K L; Leong, Kam W

    2015-03-24

    Aptamer nanomedicine, including therapeutic aptamers and aptamer nanocomplexes, is beginning to fulfill its potential in both clinical trials and preclinical studies. Especially in oncology, aptamer nanomedicine may perform better than conventional or antibody-based chemotherapeutics due to specificity compared to the former and stability compared to the latter. Many proof-of-concept studies on applying aptamers to drug delivery, gene therapy, and cancer imaging have shown promising efficacy and impressive safety in vivo toward translation. Yet, there remains ample room for improvement and critical barriers to be addressed. In this review, we will first introduce the recent progress in clinical trials of aptamer nanomedicine, followed by a discussion of the barriers at the design and in vivo application stages. We will then highlight recent advances and engineering strategies proposed to tackle these barriers. Aptamer cancer nanomedicine has the potential to address one of the most important healthcare issues of the society.

  9. Facile supermolecular aptamer inhibitors of L-selectin.

    PubMed

    Chang, Elizabeth K; Eckert, Mark A; Ali, M Monsur; Riazifar, Hamidreza; Pone, Egest J; Liu, Linan; Zhao, Weian

    2015-01-01

    Multivalent interactions occur frequently in nature, where they mediate high-affinity interactions between cells, proteins, or molecules. Here, we report on a method to generate multivalent aptamers (Multi-Aptamers) that target L-selectin function using rolling circle amplification (RCA). We find that the L-selectin Multi-Aptamers have increased affinity compared to the monovalent aptamer, are specific to L-selectin, and are capable of inhibiting interactions with endogenous ligands. In addition, the Multi-Aptamers efficiently inhibit L-selectin mediated dynamic adhesion in vitro and homing to secondary lymphoid tissues in vivo. Importantly, our method of generating multivalent materials using RCA avoids many of the challenges associated with current multivalent materials in that the Multi-Aptamers are high affinity, easily produced and modified, and biocompatible. We anticipate that the Multi-Aptamers can serve as a platform technology to modulate diverse cellular processes. PMID:25826688

  10. Modulating the Substrate Selectivity of DNA Aptamers Using Surfactants.

    PubMed

    Peterson, Amberlyn M; Jahnke, Frank M; Heemstra, Jennifer M

    2015-11-01

    Nucleic acid aptamers have a number of advantages compared to antibodies, including greater ease of production and increased thermal stability. We hypothesized that aptamers may also be capable of functioning in the presence of high concentrations of surfactants, which readily denature antibodies and other protein-based affinity reagents. Here we report the first systematic investigation into the compatibility of DNA aptamers with surfactants. We find that neutral and anionic surfactants have only a minor impact on the ability of aptamers to fold and bind hydrophilic target molecules. Additionally, we demonstrate that surfactants can be utilized to modulate the substrate binding preferences of aptamers, likely due to the sequestration of hydrophobic target molecules within micelles. The compatibility of aptamers with commonly used surfactants is anticipated to expand their scope of potential applications, and the ability to modulate the substrate binding preferences of aptamers using a simple additive provides a novel route to increasing their selectivity in analytical applications.

  11. DNA-Aptamer Targeting Vimentin for Tumor Therapy In Vivo

    PubMed Central

    Zamay, Tatyana N.; Kolovskaya, Olga S.; Glazyrin, Yury E.; Zamay, Galina S.; Kuznetsova, Svetlana A.; Spivak, Ekaterina A.; Wehbe, Mohamed; Savitskaya, Anna G.; Zubkova, Olga A.; Kadkina, Anastasia; Wang, Xiaoyan; Muharemagic, Darija; Dubynina, Anna; Sheina, Yuliya; Salmina, Alla B.; Berezovski, Maxim V.

    2014-01-01

    In recent years, new prospects for the use of nucleic acids as anticancer drugs have been discovered. Aptamers for intracellular targets can regulate cellular functions and cause cell death or proliferation. However, intracellular aptamers have limited use for therapeutic applications due to their low bioavailability. In this work, we selected DNA aptamers to cell organelles and nucleus of cancer cells, and showed that an aptamer NAS-24 binds to vimentin and causes apoptosis of mouse ascites adenocarcinoma cells in vitro and in vivo. To deliver the aptamer NAS-24 inside cells, natural polysaccharide arabinogalactan was used as a carrier reagent. The mixture of arabinogalactan and NAS-24 was injected intraperitonealy for 5 days into mice with adenocarcinoma and inhibited adenocarcinoma growth more effectively than free arabinogalactan or the aptamer alone. The use of aptamers to intracellular targets together with arabinogalactan becomes a promising approach for anticancer therapy. PMID:24410722

  12. Generation of aptamer for biosensing applications

    NASA Astrophysics Data System (ADS)

    Gopinath, Subash C. B.; Hashim, U.; Arshad, M. K. Md.; Ruslinda, A. R.

    2016-07-01

    Systematic evolution of ligands by exponential enrichment (SELEX), an in vitro strategy which involves generation of aptamer. Aptamer is an artificial antibody, behave very similar to antibody and several instances reported to be better than antibodies. In this study, an attempt has been made to generate aptamer against factor IX, a potential candidate involve in human blood coagulation cascade. Totally, 10 selection cycles have been performed and molecules from 10th cycle have shown higher binding affinity with factor IX as 56 and 68% against the factor IX concentrations of 100 and 200 nM, respectively. With these higher binding affinities, it is clear that these molecules have higher potential for sensing applications.

  13. Nucleic Acid Aptamers for Living Cell Analysis

    NASA Astrophysics Data System (ADS)

    Xiong, Xiangling; Lv, Yifan; Chen, Tao; Zhang, Xiaobing; Wang, Kemin; Tan, Weihong

    2014-06-01

    Cells as the building blocks of life determine the basic functions and properties of a living organism. Understanding the structure and components of a cell aids in the elucidation of its biological functions. Moreover, knowledge of the similarities and differences between diseased and healthy cells is essential to understanding pathological mechanisms, identifying diagnostic markers, and designing therapeutic molecules. However, monitoring the structures and activities of a living cell remains a challenging task in bioanalytical and life science research. To meet the requirements of this task, aptamers, as “chemical antibodies,” have become increasingly powerful tools for cellular analysis. This article reviews recent advances in the development of nucleic acid aptamers in the areas of cell membrane analysis, cell detection and isolation, real-time monitoring of cell secretion, and intracellular delivery and analysis with living cell models. Limitations of aptamers and possible solutions are also discussed.

  14. An aptamer beacon responsive to botulinum toxins.

    PubMed

    Bruno, John G; Richarte, Alicia M; Carrillo, Maria P; Edge, Allison

    2012-01-15

    Sixty candidate DNA aptamers were developed against botulinum neurotoxin (BoNT) type A light chain (LC) from ten rounds of selection, resulting in several identical sequences. Secondary structures of the identical aptamers were compared to structures of previously reported BoNT A DNA aptamers. A series of ten candidate loop structures were selected from this comparison as potential binding pockets and aptamer beacons. These candidate beacons were synthesized with 5'-TYE 665 and 3'-Iowa Black quencher labels for comparison of fluorescence levels as a function of BoNT A LC concentration. Only three of the ten candidates exhibited any fluorescence response to increasing levels of BoNT A LC. However, of the two most responsive candidates, one represented a subset loop of the larger more intensely fluorescent double-looped structure, designated Beacon 10. This beacon yielded a lower limit of detection of 1 ng/mL in buffer using a spectrofluorometer and a portable handheld fluorometer, but also responded substantially to BoNT A, B, E holotoxins and heavy or light chain components even in a dilute soil suspension, but not in 50% human serum. Beacon 10 did not respond strongly to a variety of other divergent peptides, suggesting that it is relatively specific to the level of botulinum toxins and is only useful for environmental testing. Beacon 10 also shared short sequence segments with other published BoNT aptamer DNA sequences, suggesting that these may be points of physical contact between the aptamers and BoNTs.

  15. RNA Fluorescence with Light-Up Aptamers.

    PubMed

    Ouellet, Jonathan

    2016-01-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way. PMID:27446908

  16. Aptamer-based biosensors: biomedical applications.

    PubMed

    Deisingh, A K

    2006-01-01

    This chapter considers the use of aptamer-based biosensors (generally termed 'aptasensors') in various biomedical applications. A comparison of antibodies and aptamers is made with respect to their use in the development of biosensors. A brief introduction to biosensor design and theory is provided to illustrate the principles of the field. Various transduction approaches, viz. optical, fluorescence, acoustic wave and electrochemical, are discussed. Specific biomedical applications described include RNA folding, high-throughput screening of drugs, use as receptors for measuring biological concentrations, detection of platelet-derived growth factor, protein binding and detection of HIV-1 Tat protein.

  17. RNA Fluorescence with Light-Up Aptamers

    PubMed Central

    Ouellet, Jonathan

    2016-01-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way. PMID:27446908

  18. RNA fluorescence with light-up aptamers

    NASA Astrophysics Data System (ADS)

    Ouellet, Jonathan

    2016-06-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way.

  19. Aptamers in Affinity Separations: Stationary Separation

    NASA Astrophysics Data System (ADS)

    Ravelet, Corinne; Peyrin, Eric

    The use of DNA or RNA aptamers as tools in analytical chemistry is a very promising field of research because of their capabilities to bind specifically the target molecules with an affinity similar to that of antibodies. Notably, they appear to be of great interest as target-specific ligands for the separation and capture of various analytes in affinity chromatography and related affinity-based methods such as magnetic bead technology. In this chapter, the recent developments of these aptamer-based separation/capture approaches are addressed.

  20. DNA module platform for developing colorimetric aptamer sensors.

    PubMed

    Tomita, Yasuyuki; Morita, Yuji; Suga, Hiroaki; Fujiwara, Daisuke

    2016-01-01

    Here we present a DNA module platform for developing simple aptamer sensors based on a microarray format combined with secondary structure prediction in silico. The platform comprises four parts: (i) aptamer, (ii) joint module, (iii) terminal stem, and (iv) a DNAzyme that catalyzes a redox reaction controlled by a structural change induced by aptamer/target binding. First, we developed a joint module, capable of sensing a conformational change in the aptamer region, that was linked to the signal transmission activity of a DNAzyme as the reporter in a concentration-dependent manner with the AMP aptamer. This module design was then used to generate an arginine sensor simply by replacing the AMP aptamer region with a previously reported arginine aptamer. Using this DNA module platform, we were also able to customize a microarray containing >10,000 sequences designed by in silico secondary structure prediction and successfully identify a new aptamer against patulin. Our results show that the DNA module platform can be used to readily devise sensors based on known aptamers as well as create new aptamer sensors by array-based screening. PMID:27286805

  1. Structure and Sequence Search on Aptamer-Protein Docking

    NASA Astrophysics Data System (ADS)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  2. Quantifying Aptamer-Protein Binding via Thermofluorimetric Analysis

    PubMed Central

    Hu, Juan; Kim, Joonyul; Easley, Christopher J.

    2015-01-01

    Effective aptamer-based protein assays require coupling to a quantitative reporter of aptamer-protein binding. Typically, this involves a direct optical or electrochemical readout of DNA hybridization or an amplification step coupled to the readout. However, method development is often hampered by the multiplicity of aptamer-target binding mechanisms, which can interfere with the hybridization step. As a simpler and more generalizable readout of aptamer-protein binding, we report that thermofluorimetric analysis (TFA) can be used to quantitatively assay protein levels. Sub-nanomolar detection (0.74 nM) of platelet-derived growth factor (PDGF) with its corresponding aptamer is shown as a test case. In the presence of various DNA intercalating dyes, protein-bound aptamers exhibit a change in fluorescence intensity compared to the intercalated, unbound aptamer. This allows thermal resolution of bound and unbound aptamers using fluorescence melting analysis (−dF/dT curves). Remarkably, the homogeneous optical method allows subtraction of autofluorescence in human serum, giving PDGF detection limits of 1.8 and 10.7 nM in serum diluted 1:7 and 1:3, respectively. We have thus demonstrated that bound and unbound aptamers can be thermally resolved in a homogeneous format using a simple qPCR instrument—even in human serum. The simplicity of this approach provides an important step toward a robust, generalizable readout of aptamer-protein binding. PMID:26366207

  3. Kinetic optimization of a protein-responsive aptamer beacon.

    PubMed

    Hall, Bradley; Cater, Sean; Levy, Matt; Ellington, Andrew D

    2009-08-15

    Aptamers have been utilized as biosensors because they can be readily adapted to sensor platforms and signal transduction schemes through both rational design and selection. One highly generalizable scheme for the generation of the so-called aptamer beacons involves denaturing the aptamer with antisense oligonucleotides. For example, rational design methods have been utilized to adapt anti-thrombin aptamers to function as biosensors by hybridizing an antisense oligonucleotide containing a quencher to the aptamer containing a fluorescent label. In the presence of thrombin, the binding equilibrium is shifted, the antisense oligonucleotide dissociates, and the beacon lights up. By changing the affinity of the antisense oligonucleotide for the aptamer beacon, it has proven possible to change the extent of activation of the beacon. More importantly, modulating interactions between the antisense oligonucleotide and the aptamer strongly influences the kinetics of activation. Comparisons across multiple, designed aptamer beacons indicate that there is a strong inverse correlation between the thermodynamics of hybridization and the speed of activation, a finding that should prove to be generally useful in the design of future biosensors. By pre-organizing the thrombin-binding quadruplex within the aptamer the speed of response can be greatly increased. By integrating these various interactions, we were ultimately able to design aptamer beacons that were activated by threefold within 1 min of the addition of thrombin.

  4. Absolute quantification of cell-bound DNA aptamers during SELEX.

    PubMed

    Avci-Adali, Meltem; Wilhelm, Nadja; Perle, Nadja; Stoll, Heidi; Schlensak, Christian; Wendel, Hans P

    2013-04-01

    In the fields of diagnosis, imaging, regenerative medicine, and drug targeting, aptamers are promising nucleic acid ligands for specific recognition and binding of whole living cells. These aptamers are selected by a combinatorial chemistry technique called cell-SELEX (Systematic Evolution of Ligands by EXponential enrichment). During this iterative procedure of in vitro selection and enzymatic amplification, the enrichment of cell binding aptamers is generally monitored by flow cytometry. This method needs the use of fluorophore-labeled oligonucleotides for detection and allows only the relative evaluation of the aptamer binding compared with the control. Here, we describe the development and validation of a new quantitative real time polymerase chain reaction (qPCR) method for the absolute determination of cell bound aptamers during cell-SELEX. The method is based on SYBR Green I real-time PCR technology and uses an aptamer standard curve to determine the accurate aptamer amount on cells after the incubations. Lysates of cells with bound aptamers were used to identify the absolute amount of aptamers on cells. This method is highly sensitive and allows the detection of very small quantities of aptamers in cell lysate samples. The lower detection limit is 20 fg. The established qPCR method can be used as an additional monitoring tool during cell-SELEX to determine the enrichment of cell binding aptamers on cells, whereby the absolute quantity is determined. Furthermore, the contamination of the amplified aptamer pool with by-products can be prevented by prior determination of bound aptamer amount on cells. PMID:23405949

  5. Translation and Clinical Development of Antithrombotic Aptamers.

    PubMed

    Nimjee, Shahid M; Povsic, Thomas J; Sullenger, Bruce A; Becker, Richard C

    2016-06-01

    Thrombosis is a necessary physiological process to protect the body from uncontrolled bleeding. Pathological thrombus formation can lead to devastating clinical events including heart attack, stroke, deep vein thrombosis, pulmonary embolism, and disseminated intravascular coagulation. Numerous drugs have been developed to inhibit thrombosis. These have been targeted to coagulation factors along with proteins and receptors that activate platelets. While these drugs are effective at preventing blood clotting, their major side effect is inadvertent hemorrhage that can result in significant morbidity and mortality. There exists a need for anticoagulants that are not only effective at preventing thrombosis but can also be readily reversed. Aptamers offer a potential solution, representing a new class of drug agents that can be isolated to any protein and where antidote oligonucleotides can be designed based on the sequence of the aptamer. We present a summary of the anticoagulant and antithrombotic aptamers that have been identified and their stage of development and comment on the future of aptamer-based drug development to treat thrombosis. PMID:26882082

  6. In silico selection of RNA aptamers

    PubMed Central

    Chushak, Yaroslav; Stone, Morley O.

    2009-01-01

    In vitro selection of RNA aptamers that bind to a specific ligand usually begins with a random pool of RNA sequences. We propose a computational approach for designing a starting pool of RNA sequences for the selection of RNA aptamers for specific analyte binding. Our approach consists of three steps: (i) selection of RNA sequences based on their secondary structure, (ii) generating a library of three-dimensional (3D) structures of RNA molecules and (iii) high-throughput virtual screening of this library to select aptamers with binding affinity to a desired small molecule. We developed a set of criteria that allows one to select a sequence with potential binding affinity from a pool of random sequences and developed a protocol for RNA 3D structure prediction. As verification, we tested the performance of in silico selection on a set of six known aptamer–ligand complexes. The structures of the native sequences for the ligands in the testing set were among the top 5% of the selected structures. The proposed approach reduces the RNA sequences search space by four to five orders of magnitude—significantly accelerating the experimental screening and selection of high-affinity aptamers. PMID:19465396

  7. Electrochemical biosensors using aptamers for theranostics.

    PubMed

    Abe, Koichi; Yoshida, Wataru; Ikebukuro, Kazunori

    2014-01-01

    Theranostics, a new term consisting of the words "therapy" and "diagnostics," represents the concept of selecting specific patients for appropriate drug administration using diagnostics. For the development of a molecular targeting drug, the theranostics approach is effective. Therefore, the market for molecular diagnostics is likely to grow at an extraordinary rate over the next 10 years. In this review, we focus on aptamer-based electrochemical biosensors for theranostics. Aptamers are molecular recognition elements that can bind to various target molecules from small compounds to proteins with affinities and specificities comparable to those of antibodies. Inasmuch as various molecules would be targeted for analysis using theranostics, aptamer-based biosensors would be an attractive format because they can be developed for various molecules using the same sensing format. Although a diverse sensing system can be constructed, we focus on electrochemical biosensors in this review because they can measure biomarkers rapidly in a miniaturized sensing system with low cost, such as blood glucose sensors. We summarize the sensing systems of aptamer-based electrochemical biosensors and discuss their advantages for theranostics.

  8. Aptamers : The New Frontier In Drug Development?

    PubMed Central

    CARLSON, BOB

    2007-01-01

    Often called chemical antibodies, aptamers are poised to take on the monoclonal antibodies in therapeutics, diagnostics, and drug development. Stability, low toxicity and immunogenicity, and, perhaps, a higher safety profile – not to mention low-cost advantages – are drawing the attention of big pharma and biotech. PMID:23372509

  9. Aptamer-based electrochemical sensors that are not based on the target binding-induced conformational change of aptamers.

    PubMed

    Lu, Ying; Zhu, Ningning; Yu, Ping; Mao, Lanqun

    2008-09-01

    This study describes a new kind of aptamer-based electrochemical sensor that is not based on the target binding-induced conformational change of the aptamers by using a 15-mer thrombin-binding aptamer (5'-GGTTGGTGTGGTTGG-3') as the model oligonucleotide. The sensors are developed by first self-assembling the aptamer (i.e. a thrombin-binding aptamer) onto an Au electrode and then hybridizing the assembled aptamer with a ferrocene (Fc)-labeled short aptamer-complementary DNA oligonucleotide to form an electroactive double-stranded DNA (ds-DNA) oligonucleotide onto the Au electrode. The binding of the target (i.e. thrombin) towards the aptamer essentially destroys the Watson-Crick helix structure of the ds-DNA oligonucleotide assembled onto the electrode and leads to the dissociation of the Fc-labeled short complementary DNA oligonucleotide from the electrode surface to the solution, resulting in a decrease in the current signal obtained at the electrode, which can be used for the determination of the target. With the thrombin-binding aptamer as the model oligonucleotide, the current decrease obtained with the aptamer-based electrochemical sensors is linear with the concentration of thrombin within the concentration range from 0 to 10 nM (DeltaI/nA = 6.7C(thrombin)/nM + 2.8, gamma = 0.975). Unlike most kinds of existing aptamer-based electrochemical sensor, the electrochemical aptasensors demonstrated here are not based on the conformational change of the aptamers induced by the specific target binding. Moreover, the aptasensors are essentially label-free and are very responsive toward the targets. This study may pave a facile and general way to the development of aptamer-based electrochemical sensors.

  10. Nucleic Acid Aptamers: Research Tools in Disease Diagnostics and Therapeutics

    PubMed Central

    Yadava, Pramod K.

    2014-01-01

    Aptamers are short sequences of nucleic acid (DNA or RNA) or peptide molecules which adopt a conformation and bind cognate ligands with high affinity and specificity in a manner akin to antibody-antigen interactions. It has been globally acknowledged that aptamers promise a plethora of diagnostic and therapeutic applications. Although use of nucleic acid aptamers as targeted therapeutics or mediators of targeted drug delivery is a relatively new avenue of research, one aptamer-based drug “Macugen” is FDA approved and a series of aptamer-based drugs are in clinical pipelines. The present review discusses the aspects of design, unique properties, applications, and development of different aptamers to aid in cancer diagnosis, prevention, and/or treatment under defined conditions. PMID:25050359

  11. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    NASA Astrophysics Data System (ADS)

    Ruscito, Annamaria; DeRosa, Maria

    2016-05-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  12. Computer-aided design of aptamers for cytochrome p450.

    PubMed

    Shcherbinin, Dmitrii S; Gnedenko, Oksana V; Khmeleva, Svetlana A; Usanov, Sergey A; Gilep, Andrei A; Yantsevich, Aliaksei V; Shkel, Tatsiana V; Yushkevich, Ivan V; Radko, Sergey P; Ivanov, Alexis S; Veselovsky, Alexander V; Archakov, Alexander I

    2015-08-01

    Aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with high affinity and specificity. Usually, they are experimentally selected using the SELEX method. Here, we describe an approach toward the in silico selection of aptamers for proteins. This approach involves three steps: finding a potential binding site, designing the recognition and structural parts of the aptamers and evaluating the experimental affinity. Using this approach, a set of 15-mer aptamers for cytochrome P450 51A1 was designed using docking and molecular dynamics simulation. An experimental evaluation of the synthesized aptamers using SPR biosensor showed that these aptamers interact with cytochrome P450 51A1 with Kd values in the range of 10(-6)-10(-7) M. PMID:26166326

  13. Development and Optimization of a Thrombin Sandwich Aptamer Microarray

    PubMed Central

    Meneghello, Anna; Sosic, Alice; Antognoli, Agnese; Cretaio, Erica; Gatto, Barbara

    2012-01-01

    A sandwich microarray employing two distinct aptamers for human thrombin has been optimized for the detection of subnanomolar concentrations of the protein. The aptamer microarray demonstrates high specificity for thrombin, proving that a two-site binding assay with the TBA1 aptamer as capture layer and the TBA2 aptamer as detection layer can ensure great specificity at times and conditions compatible with standard routine analysis of biological samples. Aptamer microarray sensitivity was evaluated directly by fluorescent analysis employing Cy5-labeled TBA2 and indirectly by the use of TBA2-biotin followed by detection with fluorescent streptavidin. Sub-nanomolar LODs were reached in all cases and in the presence of serum, demonstrating that the optimized aptamer microarray can identify thrombin by a low-cost, sensitive and specific method.

  14. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers

    PubMed Central

    Yu, Yuanyuan; Liang, Chao; Lv, Quanxia; Li, Defang; Xu, Xuegong; Liu, Baoqin; Lu, Aiping; Zhang, Ge

    2016-01-01

    Monoclonal antibodies are the dominant agents used in inhibition of biological target molecules for disease therapeutics, but there are concerns of immunogenicity, production, cost and stability. Oligonucleotide aptamers have comparable affinity and specificity to targets with monoclonal antibodies whilst they have minimal immunogenicity, high production, low cost and high stability, thus are promising inhibitors to rival antibodies for disease therapy. In this review, we will compare the detailed advantages and disadvantages of antibodies and aptamers in therapeutic applications and summarize recent progress in aptamer selection and modification approaches. We will present therapeutic oligonucleotide aptamers in preclinical studies for skeletal diseases and further discuss oligonucleotide aptamers in different stages of clinical evaluation for various disease therapies including macular degeneration, cancer, inflammation and coagulation to highlight the bright commercial future and potential challenges of therapeutic oligonucleotide aptamers. PMID:26978355

  15. Inhibition of thrombin activity with DNA-aptamers.

    PubMed

    Dobrovolsky, A B; Titaeva, E V; Khaspekova, S G; Spiridonova, V A; Kopylov, A M; Mazurov, A V

    2009-07-01

    The effects of two DNA aptamers (oligonucleotides) 15TBA and 31TBA (15- and 31-mer thrombin-binding aptamers, respectively) on thrombin activity were studied. Both aptamers added to human plasma dose-dependently increased thrombin time (fibrin formation upon exposure to exogenous thrombin), prothrombin time (clotting activation by the extrinsic pathway), and activated partial thromboplastin time (clotting activation by the intrinsic pathway). At the same time, these aptamers did not modify amidolytic activity of thrombin evaluated by cleavage of synthetic chromogenic substrate. Aptamers also inhibited thrombin-induced human platelet aggregation. The inhibitory effects of 31TBA manifested at lower concentrations than those of 15TBA in all tests. These data indicate that the studied antithrombin DNA aptamers effectively suppress its two key reactions, fibrin formation and stimulation of platelet aggregation, without modifying active center of the thrombin molecule. PMID:19902090

  16. Chimeric aptamers in cancer cell-targeted drug delivery

    PubMed Central

    Kanwar, Jagat R; Roy, Kislay; Kanwar, Rupinder K

    2011-01-01

    Aptamers are single-stranded structured oligonucleotides (DNA or RNA) that can bind to a wide range of targets ("apatopes") with high affinity and specificity. These nucleic acid ligands, generated from pools of random-sequence by an in vitro selection process referred to as systematic evolution of ligands by exponential enrichment (SELEX), have now been identified as excellent tools for chemical biology, therapeutic delivery, diagnosis, research, and monitoring therapy in real-time imaging. Today, aptamers represent an interesting class of modern Pharmaceuticals which with their low immunogenic potential mimic extend many of the properties of monoclonal antibodies in diagnostics, research, and therapeutics. More recently, chimeric aptamer approach employing many different possible types of chimerization strategies has generated more stable and efficient chimeric aptamers with aptamer-aptamer, aptamer-nonaptamer biomacromolecules (siRNAs, proteins) and aptamer-nanoparticle chimeras. These chimeric aptamers when conjugated with various biomacromolecules like locked nucleic acid (LNA) to potentiate their stability, biodistribution, and targeting efficiency, have facilitated the accurate targeting in preclinical trials. We developed LNA-aptamer (anti-nucleolin and EpCAM) complexes which were loaded in iron-saturated bovine lactofeerin (Fe-blf)-coated dopamine modified surface of superparamagnetic iron oxide (Fe3O4) nanoparticles (SPIONs). This complex was used to deliver the specific aptamers in tumor cells in a co-culture model of normal and cancer cells. This review focuses on the chimeric aptamers, currently in development that are likely to find future practical applications in concert with other therapeutic molecules and modalities. PMID:21955150

  17. Aptamers and the RNA world, past and present.

    PubMed

    Gold, Larry; Janjic, Nebojsa; Jarvis, Thale; Schneider, Dan; Walker, Jeffrey J; Wilcox, Sheri K; Zichi, Dom

    2012-03-01

    Aptamers and the SELEX process were discovered over two decades ago. These discoveries have spawned a productive academic and commercial industry. The collective results provide insights into biology, past and present, through an in vitro evolutionary exploration of the nature of nucleic acids and their potential roles in ancient life. Aptamers have helped usher in an RNA renaissance. Here we explore some of the evolution of the aptamer field and the insights it has provided for conceptualizing an RNA world, from its nascence to our current endeavor employing aptamers in human proteomics to discover biomarkers of health and disease. PMID:21441582

  18. β-Conglutin dual aptamers binding distinct aptatopes.

    PubMed

    Jauset Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; Schubert, Thomas; Künne, Stefan; Mayer, Günter; O'Sullivan, Ciara K

    2016-01-01

    An aptamer was previously selected against the anaphylactic allergen β-conglutin (β-CBA I), which was subsequently truncated to an 11-mer and the affinity improved by two orders of magnitude. The work reported here details the selection and characterisation of a second aptamer (β-CBA II) selected against a second aptatope on the β-conglutin target. The affinity of this second aptamer was similar to that of the 11-mer, and its affinity was confirmed by three different techniques at three independent laboratories. This β-CBA II aptamer in combination with the previously selected β-CBA I was then exploited to a dual-aptamer approach. The specific and simultaneous binding of the dual aptamer (β-CBA I and β-CBA II) to different sites of β-conglutin was confirmed using both microscale thermophoresis and surface plasmon resonance where β-CBA II serves as the primary capturing aptamer and β-CBA I or the truncated β-CBA I (11-mer) as the secondary signalling aptamer, which can be further exploited in enzyme-linked aptamer assays and aptasensors.

  19. Exploring the sequence space of a DNA aptamer using microarrays

    PubMed Central

    Katilius, Evaldas; Flores, Carole; Woodbury, Neal W.

    2007-01-01

    The relationship between sequence and binding properties of an aptamer for immunoglobulin E (IgE) was investigated using custom DNA microarrays. Single, double and some triple mutations of the aptamer sequence were created to evaluate the importance of specific base composition on aptamer binding. The majority of the positions in the aptamer sequence were found to be immutable, with changes at these positions resulting in more than a 100-fold decrease in binding affinity. Improvements in binding were observed by altering the stem region of the aptamer, suggesting that it plays a significant role in binding. Results obtained for the various mutations were used to estimate the information content and the probability of finding a functional aptamer sequence by selection from a random library. For the IgE-binding aptamer, this probability is on the order of 10−10 to 10−9. Results obtained for the double and triple mutations also show that there are no compensatory mutations within the space defined by those mutations. Apparently, at least for this particular aptamer, the functional sequence space can be represented as a rugged landscape with sharp peaks defined by highly constrained base compositions. This makes the rational optimization of aptamer sequences using step-wise mutagenesis approaches very challenging. PMID:17981839

  20. Aptamers and the RNA World, Past and Present

    PubMed Central

    Gold, Larry; Janjic, Nebojsa; Jarvis, Thale; Schneider, Dan; Walker, Jeffrey J.; Wilcox, Sheri K.; Zichi, Dom

    2012-01-01

    Summary Aptamers and the SELEX process were discovered over two decades ago. These discoveries have spawned a productive academic and commercial industry. The collective results provide insights into biology, past and present, through an in vitro evolutionary exploration of the nature of nucleic acids and their potential roles in ancient life. Aptamers have helped usher in an RNA renaissance. Here we explore some of the evolution of the aptamer field and the insights it has provided for conceptualizing an RNA world, from its nascence to our current endeavor employing aptamers in human proteomics to discover biomarkers of health and disease. PMID:21441582

  1. Inhibition of Cell Proliferation by an Anti-EGFR Aptamer

    PubMed Central

    Li, Na; Nguyen, Hong Hanh; Byrom, Michelle; Ellington, Andrew D.

    2011-01-01

    Aptamers continue to receive interest as potential therapeutic agents for the treatment of diseases, including cancer. In order to determine whether aptamers might eventually prove to be as useful as other clinical biopolymers, such as antibodies, we selected aptamers against an important clinical target, human epidermal growth factor receptor (hEGFR). The initial selection yielded only a single clone that could bind to hEGFR, but further mutation and optimization yielded a family of tight-binding aptamers. One of the selected aptamers, E07, bound tightly to the wild-type receptor (Kd = 2.4 nM). This aptamer can compete with EGF for binding, binds to a novel epitope on EGFR, and also binds a deletion mutant, EGFRvIII, that is commonly found in breast and lung cancers, and especially in grade IV glioblastoma multiforme, a cancer which has for the most part proved unresponsive to current therapies. The aptamer binds to cells expressing EGFR, blocks receptor autophosphorylation, and prevents proliferation of tumor cells in three-dimensional matrices. In short, the aptamer is a promising candidate for further development as an anti-tumor therapeutic. In addition, Aptamer E07 is readily internalized into EGFR-expressing cells, raising the possibility that it might be used to escort other anti-tumor or contrast agents. PMID:21687663

  2. β-Conglutin dual aptamers binding distinct aptatopes.

    PubMed

    Jauset Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; Schubert, Thomas; Künne, Stefan; Mayer, Günter; O'Sullivan, Ciara K

    2016-01-01

    An aptamer was previously selected against the anaphylactic allergen β-conglutin (β-CBA I), which was subsequently truncated to an 11-mer and the affinity improved by two orders of magnitude. The work reported here details the selection and characterisation of a second aptamer (β-CBA II) selected against a second aptatope on the β-conglutin target. The affinity of this second aptamer was similar to that of the 11-mer, and its affinity was confirmed by three different techniques at three independent laboratories. This β-CBA II aptamer in combination with the previously selected β-CBA I was then exploited to a dual-aptamer approach. The specific and simultaneous binding of the dual aptamer (β-CBA I and β-CBA II) to different sites of β-conglutin was confirmed using both microscale thermophoresis and surface plasmon resonance where β-CBA II serves as the primary capturing aptamer and β-CBA I or the truncated β-CBA I (11-mer) as the secondary signalling aptamer, which can be further exploited in enzyme-linked aptamer assays and aptasensors. PMID:26586159

  3. Cell-targeting aptamers act as intracellular delivery vehicles.

    PubMed

    Gopinath, Subash C B; Lakshmipriya, Thangavel; Chen, Yeng; Arshad, M K Md; Kerishnan, Jesinda P; Ruslinda, A R; Al-Douri, Yarub; Voon, C H; Hashim, Uda

    2016-08-01

    Aptamers are single-stranded nucleic acids or peptides identified from a randomized combinatorial library through specific interaction with the target of interest. Targets can be of any size, from small molecules to whole cells, attesting to the versatility of aptamers for binding a wide range of targets. Aptamers show drug properties that are analogous to antibodies, with high specificity and affinity to their target molecules. Aptamers can penetrate disease-causing microbial and mammalian cells. Generated aptamers that target surface biomarkers act as cell-targeting agents and intracellular delivery vehicles. Within this context, the "cell-internalizing aptamers" are widely investigated via the process of cell uptake with selective binding during in vivo systematic evolution of ligands by exponential enrichment (SELEX) or by cell-internalization SELEX, which targets cell surface antigens to be receptors. These internalizing aptamers are highly preferable for the localization and functional analyses of multiple targets. In this overview, we discuss the ways by which internalizing aptamers are generated and their successful applications. Furthermore, theranostic approaches featuring cell-internalized aptamers are discussed with the purpose of analyzing and diagnosing disease-causing pathogens.

  4. Current Progress of RNA Aptamer-Based Therapeutics

    PubMed Central

    Zhou, Jiehua; Bobbin, Maggie L.; Burnett, John C.; Rossi, John J.

    2012-01-01

    Aptamers are single-stranded nucleic acids that specifically recognize and bind tightly to their cognate targets due to their stable three-dimensional structure. Nucleic acid aptamers have been developed for various applications, including diagnostics, molecular imaging, biomarker discovery, target validation, therapeutics, and drug delivery. Due to their high specificity and binding affinity, aptamers directly block or interrupt the functions of target proteins making them promising therapeutic agents for the treatment of human maladies. Additionally, aptamers that bind to cell surface proteins are well suited for the targeted delivery of other therapeutics, such as conjugated small interfering RNAs (siRNA) that induce RNA interference (RNAi). Thus, aptamer-siRNA chimeras may offer dual-functions, in which the aptamer inhibits a receptor function, while the siRNA internalizes into the cell to target a specific mRNA. This review focuses on the current progress and therapeutic potential of RNA aptamers, including the use of cell-internalizing aptamers as cell-type specific delivery vehicles for targeted RNAi. In particular, we discuss emerging aptamer-based therapeutics that provide unique clinical opportunities for the treatment various cancers and neurological diseases. PMID:23130020

  5. Aptamers in hematological malignancies and their potential therapeutic implications.

    PubMed

    Ouyang, Wanyan; Yu, Ziqiang; Zhao, Xiaohong; Lu, Shiyun; Wang, Zhi

    2016-10-01

    Aptamers are short DNA/RNA oligonucleotides selected by the process called Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Due to their functional similarity to monoclonal antibodies with some superior characters, such as high specificity and affinity, flexible modification and stability, and lack of toxicity and immunogenicity, they are promising alternative and complementary targeted therapy for hematologic malignancies. The trends in aptamer technology including production, selection, modifications are briefly discussed in this review. The key aspect is to illustrate aptamers against cancer cells in hematologic malignancies especially those that have entered clinical trials. We also discuss some challenges remain in the application of aptamers. PMID:27637356

  6. Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes

    DOEpatents

    Lu, Yi; Liu, Juewen

    2011-11-15

    The present invention provides aptamer- and nucleic acid enzyme-based systems for simultaneously determining the presence and optionally the concentration of multiple analytes in a sample. Methods of utilizing the system and kits that include the sensor components are also provided. The system includes a first reactive polynucleotide that reacts to a first analyte; a second reactive polynucleotide that reacts to a second analyte; a third polynucleotide; a fourth polynucleotide; a first particle, coupled to the third polynucleotide; a second particle, coupled to the fourth polynucleotide; and at least one quencher, for quenching emissions of the first and second quantum dots, coupled to the first and second reactive polynucleotides. The first particle includes a quantum dot having a first emission wavelength. The second particle includes a second quantum dot having a second emission wavelength different from the first emission wavelength. The third polynucleotide and the fourth polynucleotide are different.

  7. Replacing antibodies with aptamers in lateral flow immunoassay.

    PubMed

    Chen, Ailiang; Yang, Shuming

    2015-09-15

    Aptamers have been identified against various targets as a type of chemical or nucleic acid ligand by systematic evolution of ligands by exponential enrichment (SELEX) with high sensitivity and specificity. Aptamers show remarkable advantages over antibodies due to the nucleic acid nature and target-induced structure-switching properties and are widely used to design various fluorescent, electrochemical, or colorimetric biosensors. However, the practical applications of aptamer-based sensing and diagnostics are still lagging behind those of antibody-based tests. Lateral flow immunoassay (LFIA) represents a well established and appropriate technology among rapid assays because of its low cost and user-friendliness. The antibody-based platform is utilized to detect numerous targets, but it is always hampered by the antibody preparation time, antibody stability, and effect of modification on the antibody. Seeking alternatives to antibodies is an area of active research and is of tremendous importance. Aptamers are receiving increasing attention in lateral flow applications because of a number of important potential performance advantages. We speculate that aptamer-based LFIA may be one of the first platforms for commercial use of aptamer-based diagnosis. This review first gives an introduction to aptamer including the selection process SELEX with its focus on aptamer advantages over antibodies, and then depicts LFIA with its focus on aptamer opportunities in LFIA over antibodies. Furthermore, we summarize the recent advances in the development of aptamer-based lateral flow biosensing assays with the aim to provide a general guide for the design of aptamer-based lateral flow biosensing assays.

  8. Modified DNA aptamers against sweet agent aspartame.

    PubMed

    Saitoh, Hiroshi; Nakamura, Akiko; Kuwahara, Masayasu; Ozaki, Hiroaki; Sawai, Hiroaki

    2002-01-01

    We obtained a modified DNA aptamer against sweetener, aspartame, by in vitro selection method. The modified DNA was prepared from dATP, dGTP, dCTP and a modified dTTP bearing a terminal amino group at C-5 position in place of thymidine by PCR using a hyper thermophilic DNA polymerase, KOD Dash DNA polymerase. The synthetic 102-mer DNA with a 60-mer random region was used as an initial template for the PCR. The PCR-amplified modified DNA library was applied to an aspartame-agarose column, and then the bound modified DNA was eluted from the column for the affinity chromatography selection. Repeating the procedure, we selected the modified DNA aptamer against aspartame.

  9. Modern affinity reagents: Recombinant antibodies and aptamers.

    PubMed

    Groff, Katherine; Brown, Jeffrey; Clippinger, Amy J

    2015-12-01

    Affinity reagents are essential tools in both basic and applied research; however, there is a growing concern about the reproducibility of animal-derived monoclonal antibodies. The need for higher quality affinity reagents has prompted the development of methods that provide scientific, economic, and time-saving advantages and do not require the use of animals. This review describes two types of affinity reagents, recombinant antibodies and aptamers, which are non-animal technologies that can replace the use of animal-derived monoclonal antibodies. Recombinant antibodies are protein-based reagents, while aptamers are nucleic-acid-based. In light of the scientific advantages of these technologies, this review also discusses ways to gain momentum in the use of modern affinity reagents, including an update to the 1999 National Academy of Sciences monoclonal antibody production report and federal incentives for recombinant antibody and aptamer efforts. In the long-term, these efforts have the potential to improve the overall quality and decrease the cost of scientific research.

  10. Harnessing aptamers for electrochemical detection of endotoxin.

    PubMed

    Kim, Sung-Eun; Su, Wenqiong; Cho, MiSuk; Lee, Youngkwan; Choe, Woo-Seok

    2012-05-01

    Lipopolysaccharide (LPS), also known as endotoxin, triggers a fatal septic shock; therefore, fast and accurate detection of LPS from a complex milieu is of primary importance. Several LPS affinity binders have been reported so far but few of them have proved their efficacy in developing electrochemical sensors capable of selectively detecting LPS from crude biological liquors. In this study, we identified 10 different single-stranded DNA aptamers showing specific affinity to LPS with dissociation constants (K(d)) in the nanomolar range using a NECEEM-based non-SELEX method. Based on the sequence and secondary structure analysis of the LPS binding aptamers, an aptamer exhibiting the highest affinity to LPS (i.e., B2) was selected to construct an impedance biosensor on a gold surface. The developed electrochemical aptasensor showed excellent sensitivity and specificity in the linear detection range from 0.01 to 1 ng/mL of LPS with significantly reduced detection time compared with the traditional Limulus amoebocyte lysate (LAL) assay. PMID:22370280

  11. Identification of RNA aptamers with riboswitching properties.

    PubMed

    Schneider, Christopher; Suess, Beatrix

    2016-03-15

    During the past years customized gene network design has become of tremendous interest among various disciplines in life science. The identification of artificial genetic elements sensitive to internal or external stimuli constitutes the foundation for the design and realization of conditional gene expression systems. Typically, strategies involving selection or screening steps are employed alongside approaches focusing on rational design to select for the desired functionality of a given element. Here we present a fluorescence-based in vivo screening approach that combines an initial in vitro selection with subsequent extensive screening steps and a final rational design to identify RNA based regulators in baker's yeast. These artificial RNA regulators, termed synthetic riboswitches, are derived from RNA aptamers. Our method allows for the separation of aptamers featuring the potential to be transformed into a riboswitch from those inherently unable to confer control over gene expression. The system may be applied to virtually all existing aptamer-ligand pairs and as such presents a powerful means to enhance the setup of switchable genetic circuits. PMID:26672481

  12. A selective adenosine sensor derived from a triplex DNA aptamer.

    PubMed

    Patel, Mayurbhai; Dutta, Avishek; Huang, Haidong

    2011-07-01

    The aim of this study is to develop a selective adenosine aptamer sensor using a rational approach. Unlike traditional RNA aptamers developed from SELEX, duplex DNA containing an abasic site can function as a general scaffold to rationally design aptamers for small aromatic molecules. We discovered that abasic site-containing triplex DNA can also function as an aptamer and provide better affinity than duplex DNA aptamers. A novel adenosine aptamer sensor was designed using such a triplex. The aptamer is modified with furano-dU in the binding site to sense the binding. The sensor bound adenosine has a dissociation constant of 400 nM, more than tenfold stronger than the adenosine aptamer developed from SELEX. The binding quenched furano-dU fluorescence by 40%. It was also demonstrated in this study that this sensor is selective for adenosine over uridine, cytidine, guanosine, ATP, and AMP. The detection limit of this sensor is about 50 nM. The sensor can be used to quantify adenosine concentrations between 50 nM and 2 μM. PMID:21547431

  13. Aptamers as Both Drugs and Drug-Carriers

    PubMed Central

    Ashrafuzzaman, Md.

    2014-01-01

    Aptamers are short nucleic acid oligos. They may serve as both drugs and drug-carriers. Their use as diagnostic tools is also evident. They can be generated using various experimental, theoretical, and computational techniques. The systematic evolution of ligands by exponential enrichment which uses iterative screening of nucleic acid libraries is a popular experimental technique. Theory inspired methodology entropy-based seed-and-grow strategy that designs aptamer templates to bind specifically to targets is another one. Aptamers are predicted to be highly useful in producing general drugs and theranostic drugs occasionally for certain diseases like cancer, Alzheimer's disease, and so on. They bind to various targets like lipids, nucleic acids, proteins, small organic compounds, and even entire organisms. Aptamers may also serve as drug-carriers or nanoparticles helping drugs to get released in specific target regions. Due to better target specific physical binding properties aptamers cause less off-target toxicity effects. Therefore, search for aptamer based drugs, drug-carriers, and even diagnostic tools is expanding fast. The biophysical properties in relation to the target specific binding phenomena of aptamers, energetics behind the aptamer transport of drugs, and the consequent biological implications will be discussed. This review will open up avenues leading to novel drug discovery and drug delivery. PMID:25295268

  14. Fit for the Eye: Aptamers in Ocular Disorders

    PubMed Central

    Drolet, Daniel W.; Green, Louis S.; Gold, Larry

    2016-01-01

    For any new class of therapeutics, there are certain types of indications that represent a natural fit. For nucleic acid ligands in general, and aptamers in particular, the eye has historically been an attractive site for therapeutic intervention. In this review, we recount the discovery and early development of three aptamers designated for use in ophthalmology, one approved (Macugen), and two in late-stage development (Fovista and Zimura). Every one of these molecules was originally intended for other indications. Key improvements in technology, specifically with regard to libraries used for in vitro selection and subsequent chemical optimization of aptamers, have played an important role in allowing the identification of development candidates with suitable properties. The lessons learned from the selection of these molecules are valuable for informing us about the many remaining opportunities for aptamer-based therapeutics in ophthalmology as well as for identifying additional indications for which aptamers as a class of therapeutics have distinct advantages. PMID:26757406

  15. Generating Cell Targeting Aptamers for Nanotheranostics Using Cell-SELEX

    PubMed Central

    Lyu, Yifan; Chen, Guang; Shangguan, Dihua; Zhang, Liqin; Wan, Shuo; Wu, Yuan; Zhang, Hui; Duan, Lian; Liu, Chao; You, Mingxu; Wang, Jie; Tan, Weihong

    2016-01-01

    Detecting and understanding changes in cell conditions on the molecular level is of great importance for the accurate diagnosis and timely therapy of diseases. Cell-based SELEX (Systematic Evolution of Ligands by EXponential enrichment), a foundational technology used to generate highly-specific, cell-targeting aptamers, has been increasingly employed in studies of molecular medicine, including biomarker discovery and early diagnosis/targeting therapy of cancer. In this review, we begin with a mechanical description of the cell-SELEX process, covering aptamer selection, identification and identification, and aptamer characterization; following this introduction is a comprehensive discussion of the potential for aptamers as targeting moieties in the construction of various nanotheranostics. Challenges and prospects for cell-SELEX and aptamer-based nanotheranostic are also discussed. PMID:27375791

  16. Aptamer Microarrays—Current Status and Future Prospects

    PubMed Central

    Witt, Martin; Walter, Johanna-Gabriela; Stahl, Frank

    2015-01-01

    Microarray technologies are state of the art in biological research, which requires fast genome, proteome and transcriptome analysis technologies. Often antibodies are applied in protein microarrays as proteomic tools. Since the generation of antibodies against toxic targets or small molecules including organic compounds remains challenging the use of antibodies may be limited in this context. In contrast to this, aptamer microarrays provide alternative techniques to circumvent these limitations. In this article we review the latest developments in aptamer microarray technology. We discuss similarities and differences between DNA and aptamer microarrays and shed light on the post synthesis immobilization of aptamers including corresponding effects on the microarray performance. Finally, we highlight current limitations and future prospects of aptamer microarray technology.

  17. Aptamer Microarrays—Current Status and Future Prospects

    PubMed Central

    Witt, Martin; Walter, Johanna-Gabriela; Stahl, Frank

    2015-01-01

    Microarray technologies are state of the art in biological research, which requires fast genome, proteome and transcriptome analysis technologies. Often antibodies are applied in protein microarrays as proteomic tools. Since the generation of antibodies against toxic targets or small molecules including organic compounds remains challenging the use of antibodies may be limited in this context. In contrast to this, aptamer microarrays provide alternative techniques to circumvent these limitations. In this article we review the latest developments in aptamer microarray technology. We discuss similarities and differences between DNA and aptamer microarrays and shed light on the post synthesis immobilization of aptamers including corresponding effects on the microarray performance. Finally, we highlight current limitations and future prospects of aptamer microarray technology. PMID:27600216

  18. Embracing proteins: structural themes in aptamer-protein complexes.

    PubMed

    Gelinas, Amy D; Davies, Douglas R; Janjic, Nebojsa

    2016-02-01

    Understanding the structural rules that govern specific, high-affinity binding characteristic of aptamer-protein interactions is important in view of the increasing use of aptamers across many applications. From the modest number of 16 aptamer-protein structures currently available, trends are emerging. The flexible phosphodiester backbone allows folding into precise three-dimensional structures using known nucleic acid motifs as scaffolds that orient specific functional groups for target recognition. Still, completely novel motifs essential for structure and function are found in modified aptamers with diversity-enhancing side chains. Aptamers and antibodies, two classes of macromolecules used as affinity reagents with entirely different backbones and composition, recognize protein epitopes of similar size and with comparably high shape complementarity. PMID:26919170

  19. A novel electrochemical detection method for aptamer biosensors.

    PubMed

    Bang, Gyeong Sook; Cho, Suhyeong; Kim, Byung-Gee

    2005-12-15

    A beacon aptamer-based biosensor for the detection of thrombin was developed using electrochemical transduction method. Gold surface was modified with a beacon aptamer covalently linked at 5'-terminus with a linker containing a primary aliphatic amine. Methylene blue (MB) was intercalated into the beacon sequence, and used as an electrochemical marker. When the beacon aptamer immobilized on gold surface encounters thrombin, the hairpin forming beacon aptamer is conformationally changed to release the intercalated MB, resulting a decrease in electrical current intensity in voltamogram. The peak signal of the MB is clearly decreased by the binding of thrombin onto the beacon aptamer. The linear range of the signal was observed between 0 and 50.8 nM of thrombin with 0.999 correlation factor. This method was able to linearly and selectively detect thrombin with a detection limit of 11 nM.

  20. In vivo SELEX for Identification of Brain-penetrating Aptamers

    PubMed Central

    Cheng, Congsheng; Chen, Yong Hong; Lennox, Kim A; Behlke, Mark A; Davidson, Beverly L

    2013-01-01

    The physiological barriers of the brain impair drug delivery for treatment of many neurological disorders. One delivery approach that has not been investigated for their ability to penetrate the brain is RNA-based aptamers. These molecules can impart delivery to peripheral tissues and circulating immune cells, where they act as ligand mimics or can be modified to carry payloads. We developed a library of aptamers and an in vivo evolution protocol to determine whether specific aptamers could be identified that would home to the brain after injection into the peripheral vasculature. Unlike biopanning with recombinant bacteriophage libraries, we found that the aptamer library employed here required more than 15 rounds of in vivo selection for convergence to specific sequences. The aptamer species identified through this approach bound to brain capillary endothelia and penetrated into the parenchyma. The methods described may find general utility for targeting various payloads to the brain. PMID:23299833

  1. Cell-type Specific Aptamer and Aptamer-siRNA Conjugates for Targeted HIV-1 Therapy

    PubMed Central

    Zhou, Jiehua; Rossi, John

    2014-01-01

    Human immunodeficiency virus (HIV) is a virus that causes acquired immunodeficiency syndrome (AIDS), a chronic and incurable disease of the human immune system. As the standard of care for the patients with HIV-1, current highly active antiretroviral treatment (HAART) has been therapeutically effective in the majority of patients; however, it is not curative, and HAART is intolerable due to server side effects. Therefore, nucleic acid-based therapeutics, such as antisense oligonucleotide, ribozyme, mRNA, RNAi-based therapeutics, aptamer, etc., have been actively developed as alternative or adjuvant agents for those chemical antiviral drugs in order to surmount those drawbacks. The combinatorial use of various antiviral nucleic acids could be more efficacious in blocking viral replication and preventing the emergence of resistant variants. In this regard, RNA interference (RNAi) can function as a gene-specific therapeutic option for controlling HIV-1 replication. Another type of therapeutic nucleic acid – aptamers – shows promise as a new and potent class of anti-HIV agent and can additionally function as a cell-type-specific delivery vehicle for targeted RNAi. The combined use of small interfering RNA (siRNAs) and aptamers could effectively block viral replication and prevent the emergence of resistant variants. The present review offers a brief overview of the use of cell-type specific aptamer and aptamer-siRNA conjugates development in our group for the treatment of HIV-1. Their potentials for targeted delivering RNAi therapeutics (e.g. siRNA) and suppressing HIV-1 replication in vitro and in humanized animal model will be highlighted here. PMID:25118114

  2. Identification of Epithelial Ovarian Tumor-Specific Aptamers

    PubMed Central

    Benedetto, Gregory; Hamp, Timothy J.; Wesselman, Peter J.

    2015-01-01

    Ovarian cancer is often diagnosed in late stages with few treatment options and poor long-term prognosis. New clinical tools for early detection of ovarian malignancies will significantly help reduce mortality and improve current long-term survival rates. The objective of this work was to identify ovarian tumor-specific single-stranded DNA aptamers that bind to malignant ovarian tumor cells and internalize with high affinity and specificity. Aptamers can identify unique tumor biomarkers, can aid in early detection and diagnosis of neoplastic disorders, and can be functionalized by conjugation to small molecules. To identify aptamers from random single-stranded DNA pools (60 bases long), we used whole Cell-SELEX (systematic evolution of ligands by exponential enrichment) to enrich and isolate tumor-specific aptamers that bind to tumor-specific receptors in their native state on the cell surface. Next-Generation sequencing identified seven novel aptamers and detailed analyses of three are described. Aptamers bound to, and were internalized by, target Caov-3 cell populations, but not nontarget nonmalignant ovarian epithelial HOSE 6-3 cells or multiple other epithelial tumor cell lines. Furthermore, aptamers showed unique binding affinities with apparent dissociation constants (Kd) measuring in the submicromolar range supporting their physiological relevance and potential use in clinical applications. PMID:25894736

  3. Structural basis for recognition of Co2+ by RNA aptamers.

    PubMed

    Wrzesinski, Jan; Jóźwiakowski, Stanisław K

    2008-04-01

    Co(2+) binding RNA aptamers were chosen as research models to reveal the structural basis underlying the recognition of Co(2+) by RNA, with the application of two distinct methods. Using the nucleotide analog interference mapping assay, we found strong interference effects after incorporation of the 7-deaza guanosine phosphorotioate analog into the RNA chain at equivalent positions G27 and G28 in aptamer no. 18 and G25 and G26 in aptamer no. 20. The results obtained by nucleotide analog interference mapping suggest that these guanine bases are crucial for the creation of Co(2+) binding sites and that they appear to be involved in the coordination of the ion to the exposed N7 atom of the tandem guanines. Additionally, most 7-deaza guanosine phosphorotioate and 7-deaza adenosine phosphorotioate interferences were located in the common motifs: loop E-like in aptamer no. 18 and kissing dimer in aptamer no. 20. We also found that purine-rich stretches containing guanines with the highest interference values were the targets for hybridization of 6-mers, which are members of the semi-random oligodeoxyribonucleotide library in both aptamers. It transpired that DNA oligomer directed RNase H digestions are sensitive to Co(2+) and, at an elevated metal ion concentration, the hybridization of oligomers to aptamer targets is inhibited, probably due to higher stability and complexity of the RNA structure. PMID:18312410

  4. Efficient suppression of biofilm formation by a nucleic acid aptamer.

    PubMed

    Ning, Yi; Cheng, Lijuan; Ling, Min; Feng, Xinru; Chen, Lingli; Wu, Minxi; Deng, Le

    2015-08-01

    Biofilms are microbial communities that are attached to a solid surface using extracellular polymeric substances. Motility and initial attachment mediated by flagella are required for biofilm formation. Therefore, blocking the motility of flagella is a potential strategy to inhibit biofilm formation. In this study, single-stranded DNA aptamers specific to the Salmonella choleraesuis were selected after 14 cycles of the systematic evolution of ligands by exponential enrichment. Among the selected aptamers, the aptamer 3 showed the highest affinity for S. choleraesuis with a dissociation constant (Kd) of 41 ± 2 nM. Aptamer 3, conjugated with magnetic beads, was then used to capture its binding target on the bacteria. After mass spectrometry and specific binding analysis, the flagellin was identified as the target captured by aptamer 3. Furthermore, inhibition experiments, inverted microscopy and atomic force microscopy demonstrated that aptamer 3 was able to control the biofilm formation and promote the inhibitory effect of an antibiotic on bacterial biofilms. Single-stranded DNA aptamers therefore have great potential as inhibitors of biofilm formation.

  5. Aptamer-based sensing of β-casomorphin-7.

    PubMed

    Parashar, Abhishek; Rajput, Yudhishthir S; Sharma, Rajan

    2015-03-18

    β-Casomorphin-7 (BCM-7), a seven amino acid peptide, is released during digestion of β-casein A1 variant of milk which is speculated to be associated with certain diseases. Fifteen ssDNA aptamers having high affinity toward BCM-7 were identified from a 72 nt long random library after ten rounds of systematic evolution of ligands by exponential enrichment. Dissociation constant values of selected aptamers were in the range of 7.7-156.7 nM. Seq6 aptamer exhibited the lowest Kd value. Nine aptamers were evaluated for their binding toward BCM-7, BCM-9A1, and BCM-9A2 peptides, and binding was variable. SeqU5 exhibited the lowest binding with BCM-9A1 and BCM-9A2. Aptamer-coated gold nanoparticles (GNPs) resulted in color change of GNPs in the presence of BCM-7, thereby establishing recognition of BCM-7 by aptamers. The enzyme-linked aptamer-sorbent assay (ELASA) was evaluated as an assay of BCM-7 in biological fluids. BCM-7-peroxidase competed with BCM-7 in ELASA, performed with BCM-7 solution and BCM-7 spiked urine pretreated with urease, plasma, and β-casein digest samples. PMID:25712869

  6. Aptamers: Active Targeting Ligands for Cancer Diagnosis and Therapy

    PubMed Central

    Wu, Xu; Chen, Jiao; Wu, Min; Zhao, Julia Xiaojun

    2015-01-01

    Aptamers, including DNA, RNA and peptide aptamers, are a group of promising recognition units that can specifically bind to target molecules and cells. Due to their excellent specificity and high affinity to targets, aptamers have attracted great attention in various fields in which selective recognition units are required. They have been used in biosensing, drug delivery, disease diagnosis and therapy (especially for cancer treatment). In this review, we summarized recent applications of DNA and RNA aptamers in cancer theranostics. The specific binding ability of aptamers to cancer-related markers and cancer cells ensured their high performance for early diagnosis of cancer. Meanwhile, the efficient targeting ability of aptamers to cancer cells and tissues provided a promising way to deliver imaging agents and drugs for cancer imaging and therapy. Furthermore, with the development of nanoscience and nanotechnology, the conjugation of aptamers with functional nanomaterials paved an exciting way for the fabrication of theranostic agents for different types of cancers, which might be a powerful tool for cancer treatment. PMID:25699094

  7. Applications of Aptamers in Targeted Imaging: State of the Art

    PubMed Central

    Dougherty, Casey A.; Cai, Weibo; Hong, Hao

    2015-01-01

    Aptamers are single-stranded oligonucleotides with high affinity and specificity to the target molecules or cells, thus they can serve as an important category of molecular targeting ligand. Since their discove1y, aptamers have been rapidly translated into clinical practice. The strong target affinity/selectivity, cost-effectivity, chemical versatility and safety of aptamers are superior to traditional peptides- or proteins-based ligands which make them unique choices for molecular imaging. Therefore, aptamers are considered to be extremely useful to guide various imaging contrast agents to the target tissues or cells for optical, magnetic resonance, nuclear, computed tomography, ultra sound and multimodality imaging. This review aims to provide an overview of aptamers' advantages as targeting ligands and their application in targeted imaging. Further research in synthesis of new types of aptamers and their conjugation with new categories of contrast agents is required to develop clinically translatable aptamer-based imaging agents which will eventually result in improved patient care. PMID:25866268

  8. Aptamer-Gated Nanoparticles for Smart Drug Delivery

    PubMed Central

    Ozalp, Veli Cengiz; Eyidogan, Fusun; Oktem, Huseyin Avni

    2011-01-01

    Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.

  9. Selection of an aptamer against mouse GP2 by SELEX.

    PubMed

    Hanazato, Misaho; Nakato, Gaku; Nishikawa, Fumiko; Hase, Koji; Nishikawa, Satoshi; Ohno, Hiroshi

    2014-01-01

    Microfold (M) cells are intestinal epithelial cells specialized for sampling and transport of luminal antigens to gut-associated lymphoid tissue for initiation of both mucosal and systemic immune responses. Therefore, M-cell targeted vaccination has the potential to be a better immunization strategy. Glycoprotein 2 (GP2), an antigen uptake receptor for FimH(+) bacteria on M cells, can be a good target for this purpose. Aptamers are oligonucleotides that bind to a variety of target molecules with high specificity and affinity. Together with its low toxic feature, aptamers serves as a tool of molecular-targeted delivery. In this study, we used Systematic Evolution of Ligands by EXponential enrichment (SELEX) to isolate aptamers specific to murine GP2 (mGP2). After ten rounds of SELEX, eleven different aptamer sequences were selected. Among them, the most frequently appeared sequence (~60%) were aptamer NO. 1 (Apt1), and the second most (~7%) were aptamer NO. 5 (Apt5). In vitro binding experiment confirmed that only Apt1 and Apt5 specifically bound to mGP2 among eleven aptamers initially selected. Apt1 showed the strongest affinity with mGP2, with the Kd value of 110±2.6 nM evaluated by BIACORE. Binding assays with mutants of Apt1 suggest that, in addition to the loop structure, the nucleotide sequence, AAAUA, in the loop is important for binding to mGP2. Furthermore, this aptamer was able to bind to mGP2 expressed on the cell surface. These results suggest that this mGP2-specific aptamer could serve as a valuable tool for testing M-cell-targeted vaccine delivery in the murine model system. PMID:24334484

  10. Aptamer modification improves the adenoviral transduction of malignant glioma cells.

    PubMed

    Chen, Hao; Zheng, Xiaojing; Di, BingYan; Wang, Dongyang; Zhang, Yaling; Xia, Haibin; Mao, Qinwen

    2013-12-01

    Adenovirus has shown increasing promise in the gene-viral therapy for glioblastoma, a treatment strategy that relies on the delivery of viruses or transgenes into tumor cells. However, targeting of adenovirus to human glioblastoma remains a challenge due to the low expression level of coxsackie and adenovirus receptor (CAR) in glioma cells. Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity to a target molecule, and are good candidates for targeted imaging and therapy. In this study, to construct an aptamer-modified Ad5, we first genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer to the modified Ad through avidin–biotin binding. The aptamers used in this study includes AS1411 and GBI-10. The former is a DNA aptamer that can bind to nucleolin, a nuclear matrix protein found on the surface of cancer cells. The latter is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. To examine if aptamer-modification of the hexon protein could improve the adenoviral transduction efficiency, a glioblastoma cell line, U251, was transduced with aptamer-modified Ads. The transduction efficiency of AS1411- or GBI-10-modified Ad was approximately 4.1-fold or 5.2-fold higher than that of the control. The data indicated that aptamer modified adenovirus would be a useful tool for cancer gene therapy.

  11. Ligand binding by the tandem glycine riboswitch depends on aptamer dimerization but not double ligand occupancy

    PubMed Central

    Ruff, Karen M.

    2014-01-01

    The glycine riboswitch predominantly exists as a tandem structure, with two adjacent, homologous ligand-binding domains (aptamers), followed by a single expression platform. The recent identification of a leader helix, the inclusion of which eliminates cooperativity between the aptamers, has reopened the debate over the purpose of the tandem structure of the glycine riboswitch. An equilibrium dialysis-based assay was combined with binding-site mutations to monitor glycine binding in each ligand-binding site independently to understand the role of each aptamer in glycine binding and riboswitch tertiary interactions. A series of mutations disrupting the dimer interface was used to probe how dimerization impacts ligand binding by the tandem glycine riboswitch. While the wild-type tandem riboswitch binds two glycine equivalents, one for each aptamer, both individual aptamers are capable of binding glycine when the other aptamer is unoccupied. Intriguingly, glycine binding by aptamer-1 is more sensitive to dimerization than glycine binding by aptamer-2 in the context of the tandem riboswitch. However, monomeric aptamer-2 shows dramatically weakened glycine-binding affinity. In addition, dimerization of the two aptamers in trans is dependent on glycine binding in at least one aptamer. We propose a revised model for tandem riboswitch function that is consistent with these results, wherein ligand binding in aptamer-1 is linked to aptamer dimerization and stabilizes the P1 stem of aptamer-2, which controls the expression platform. PMID:25246650

  12. Aptamer-conjugated nanomaterials for bioanalysis and biotechnology applications

    NASA Astrophysics Data System (ADS)

    Chen, Tao; Shukoor, Mohammed Ibrahim; Chen, Yan; Yuan, Quan; Zhu, Zhi; Zhao, Zilong; Gulbakan, Basri; Tan, Weihong

    2011-02-01

    In recent years, nanomaterials have captured the attention of scientists from a wide spectrum of domains. With their unique properties, nanomaterials offer great promise for numerous applications, ranging from catalysis to energy harvesting and information technology. Functionalized with the desired biomolecules, nanomaterials can also be utilized for many biomedical applications. This paper summarizes recent achievements in the use of aptamer-conjugated nanomaterials for bioanalysis and biotechnology applications. First, we discuss the features and properties of aptamers and then illustrate the use of aptamer-conjugated nanomaterials as sensing platforms and delivery vehicles, emphasizing how such integration can result in enhanced sensitivity and selectivity.

  13. Aptamer-based electrochemical biosensor for Botulinum neurotoxin.

    PubMed

    Wei, Fang; Ho, Chih-Ming

    2009-04-01

    We have developed an aptamer-based electrochemical sensor for detection of Botulinum neurotoxin, where steric hindrance is applied to achieve specific signal amplification via conformational change of the aptamer. The incubation time and potassium concentration of the reaction buffer were found to be key parameters affecting the sensitivity of detection of the recognition of Botulinum neurotoxin by the aptamer. Under optimized experimental conditions, a high signal-to-noise ratio was obtained within 24 h with a limit of detection (LOD) of 40 pg/ml by two standard deviation cutoffs above the noise level.

  14. Aptamer-Based Screens of Human Body Fluids for Biomarkers

    PubMed Central

    Albaba, Dania; Soomro, Sanam; Mohan, Chandra

    2015-01-01

    In recent years, aptamers have come to replace antibodies in high throughput multiplexed experiments. The aptamer-based biomarker screening technology, which kicked off in 2010, is capable of interrogating thousands of proteins in a very small sample volume. With this new technology, researchers hope to find clinically appropriate biomarkers for a myriad of illnesses by screening human body fluids. In this work, we have reviewed a total of eight studies utilizing aptamer-based biomarker screens of human body fluids, and have highlighted novel protein biomarkers discovered. PMID:27600232

  15. Aptamers as a novel tool for diagnostics and therapy.

    PubMed

    Kadioglu, Onat; Malczyk, Anna Helena; Greten, Henry Johannes; Efferth, Thomas

    2015-04-01

    Aptamers are short single-stranded DNA or RNA oligonucleotides that are capable of binding small molecules, proteins, or nucleotides with high specificity. They show a stable conformation and high binding affinity for their target molecules. There are numerous applications for aptamers in biotechnology, molecular diagnostics and targeted therapy of diseases. Their production is cheap, and they generally display lower immunogenicity than monoclonal antibodies. In the present review, we give an introduction to the preparation of aptamers and provide examples for their use in biotechnology, diagnostics and therapy of diseases. PMID:25637166

  16. Aptamer-Based Screens of Human Body Fluids for Biomarkers

    PubMed Central

    Albaba, Dania; Soomro, Sanam; Mohan, Chandra

    2015-01-01

    In recent years, aptamers have come to replace antibodies in high throughput multiplexed experiments. The aptamer-based biomarker screening technology, which kicked off in 2010, is capable of interrogating thousands of proteins in a very small sample volume. With this new technology, researchers hope to find clinically appropriate biomarkers for a myriad of illnesses by screening human body fluids. In this work, we have reviewed a total of eight studies utilizing aptamer-based biomarker screens of human body fluids, and have highlighted novel protein biomarkers discovered.

  17. Graphene- and aptamer-based electrochemical biosensor.

    PubMed

    Xu, Ke; Meshik, Xenia; Nichols, Barbara M; Zakar, Eugene; Dutta, Mitra; Stroscio, Michael A

    2014-05-23

    This study investigated the effectiveness of a graphene- and aptamer-based field-effect-transistor-like (FET-like) sensor in detecting lead and potassium ions. The sensor consists of a graphene-covered Si/SiO2 wafer with thrombin binding aptamer (TBA) attached to the graphene layer and terminated by a methylene blue (MB) molecule. K(+) and Pb(2+) both bind to TBA and cause a conformational change, which results in MB moving closer to the graphene surface and donating an electron. Thus, the abundance of K(+) and Pb(2+) can be determined by monitoring the current across the source and drain channel. Device transfer curves were obtained with ambipolar field effect observed. Current readings were taken for K(+) concentrations of 100 μM to 50 mM and Pb(2+) concentrations of 10 μM to 10 mM. As expected, I d decreased as ion concentration increased. In addition, there was a negative shift in V Dirac in response to increased ion concentration.

  18. Facile characterization of aptamer kinetic and equilibrium binding properties using surface plasmon resonance

    PubMed Central

    Chang, Andrew L.; McKeague, Maureen; Smolke, Christina D.

    2015-01-01

    Nucleic acid aptamers find widespread use as targeting and sensing agents in nature and biotechnology. Their ability to bind an extensive range of molecular targets, including small molecules, proteins, and ions, with high affinity and specificity enables their use in diverse diagnostic, therapeutic, imaging, and gene-regulatory applications. Here, we describe methods for characterizing aptamer kinetic and equilibrium binding properties using a surface plasmon resonance-based platform. This aptamer characterization platform is broadly useful for studying aptamer–ligand interactions, comparing aptamer properties, screening functional aptamers during in vitro selection processes, and prototyping aptamers for integration into nucleic acid devices. PMID:25432760

  19. Designing Anti-Influenza Aptamers: Novel Quantitative Structure Activity Relationship Approach Gives Insights into Aptamer – Virus Interaction

    PubMed Central

    Musafia, Boaz; Oren-Banaroya, Rony; Noiman, Silvia

    2014-01-01

    This study describes the development of aptamers as a therapy against influenza virus infection. Aptamers are oligonucleotides (like ssDNA or RNA) that are capable of binding to a variety of molecular targets with high affinity and specificity. We have studied the ssDNA aptamer BV02, which was designed to inhibit influenza infection by targeting the hemagglutinin viral protein, a protein that facilitates the first stage of the virus’ infection. While testing other aptamers and during lead optimization, we realized that the dominant characteristics that determine the aptamer’s binding to the influenza virus may not necessarily be sequence-specific, as with other known aptamers, but rather depend on general 2D structural motifs. We adopted QSAR (quantitative structure activity relationship) tool and developed computational algorithm that correlate six calculated structural and physicochemical properties to the aptamers’ binding affinity to the virus. The QSAR study provided us with a predictive tool of the binding potential of an aptamer to the influenza virus. The correlation between the calculated and actual binding was R2 = 0.702 for the training set, and R2 = 0.66 for the independent test set. Moreover, in the test set the model’s sensitivity was 89%, and the specificity was 87%, in selecting aptamers with enhanced viral binding. The most important properties that positively correlated with the aptamer’s binding were the aptamer length, 2D-loops and repeating sequences of C nucleotides. Based on the structure-activity study, we have managed to produce aptamers having viral affinity that was more than 20 times higher than that of the original BV02 aptamer. Further testing of influenza infection in cell culture and animal models yielded aptamers with 10 to 15 times greater anti-viral activity than the BV02 aptamer. Our insights concerning the mechanism of action and the structural and physicochemical properties that govern the interaction with the

  20. Luminescent Quantum Dots as Ultrasensitive Biological Labels

    NASA Astrophysics Data System (ADS)

    Nie, Shuming

    2000-03-01

    Highly luminescent semiconductor quantum dots have been covalently coupled to biological molecules for use in ultrasensitive biological detection. This new class of luminescent labels is considerably brighter and more resistant againt photobleaching in comparison with organic dyes. Quantum dots labeled with the protein transferrin undergo receptor-mediated endocytosis (RME) in cultured HeLa cells, and those dots that were conjugated to immunomolecules recognize specific antibodies or antigens. In addition, we show that DNA functionalized quantum dots can be used to target specific genes by hybridization. We expect that quantum dot bioconjugates will have a broad range of biological applications, such as ligand-receptor interactions, real-time monitoring of molecular trafficking inside living cells, multicolor fluorescence in-situ hybridization (FISH), high-sensitivity detection in miniaturized devices (e.g., DNA chips), and fluorescent tagging of combinatorial chemical libraries. A potential clinical application is the use of quantum dots for ultrasensitive viral RNA detection, in which as low as 100 copies of hepatitis C and HIV viruses per ml blood should be detected.

  1. The development of quantum dot calibration beads and quantitative multicolor bioassays in flow cytometry and microscopy.

    PubMed

    Wu, Yang; Campos, Samuel K; Lopez, Gabriel P; Ozbun, Michelle A; Sklar, Larry A; Buranda, Tione

    2007-05-15

    The use of fluorescence calibration beads has been the hallmark of quantitative flow cytometry. It has enabled the direct comparison of interlaboratory data as well as quality control in clinical flow cytometry. In this article, we describe a simple method for producing color-generalizable calibration beads based on streptavidin functionalized quantum dots. Based on their broad absorption spectra and relatively narrow emission, which is tunable on the basis of dot size, quantum dot calibration beads can be made for any fluorophore that matches their emission color. In an earlier publication, we characterized the spectroscopic properties of commercial streptavidin functionalized dots (Invitrogen). Here we describe the molecular assembly of these dots on biotinylated beads. The law of mass action is used to readily define the site densities of the dots on the beads. The applicability of these beads is tested against the industry standard, namely commercial fluorescein calibration beads. The utility of the calibration beads is also extended to the characterization surface densities of dot-labeled epidermal growth factor ligands as well as quantitative indicators of the binding of dot-labeled virus particles to cells.

  2. Aptamer based electrochemical sensors for emerging environmental pollutants

    NASA Astrophysics Data System (ADS)

    Hayat, Akhtar; Marty, Jean Louis

    2014-06-01

    Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide) as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.

  3. Aptamer based electrochemical sensors for emerging environmental pollutants

    PubMed Central

    Hayat, Akhtar; Marty, Jean L.

    2014-01-01

    Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide) as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants. PMID:25019067

  4. Aptamer Oligonucleotides: Novel Potential Therapeutic Agents in Autoimmune Disease.

    PubMed

    Li, Weibin; Lan, Xiaopeng

    2015-08-01

    Aptamers are single-stranded deoxyribonucleic acid or ribonucleic acid oligonucleotides generated in vitro based on affinity for certain target molecules by a process known as Systematic Evolution of Ligands by Exponential Enrichment. Aptamers can bind their target molecules with high specificity and selectivity by means of structure compatibility, stacking of aromatic rings, electrostatic and van der Waals interactions, and hydrogen bonding. With several advantages over monoclonal antibodies and other conventional small-molecule therapeutics, such as high specificity and affinity, negligible batch to batch variation, flexible modification and stability, lack of toxicity and low immunogenicity, aptamers are becoming promising novel diagnostic and therapeutic agents. This review focuses on the development of aptamers as potential therapeutics for autoimmune diseases, including diabetes mellitus, multiple sclerosis, rheumatoid arthritis, myasthenia gravis, and systemic lupus erythematosus. PMID:25993618

  5. Aptamers: A promising chemical antibody for cancer therapy

    PubMed Central

    Zhou, Gang; Wilson, George; Hebbard, Lionel; Duan, Wei; Liddle, Christopher; George, Jacob; Qiao, Liang

    2016-01-01

    Aptamers, also known as chemical antibodies, are single-stranded nucleic acid oligonucleotides which bind to their targets with high specificity and affinity. They are typically selected by repetitive in vitro process termed systematic evolution of ligands by exponential enrichment (SELEX). Owing to their excellent properties compared to conventional antibodies, notably their smaller physical size and lower immunogenicity and toxicity, aptamers have recently emerged as a new class of agents to deliver therapeutic drugs to cancer cells by targeting specific cancer-associated hallmarks. Aptamers can also be structurally modified to make them more flexible in order to conjugate other agents such as nano-materials and therapeutic RNA agents, thus extending their applications for cancer therapy. This review presents the current knowledge on the practical applications of aptamers in the treatment of a variety of cancers. PMID:26863567

  6. Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

    PubMed

    Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

    2014-11-01

    A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer. PMID:25187086

  7. DNA Aptamers Selectively Target Leishmania infantum H2A Protein

    PubMed Central

    Martín, M. Elena; García-Hernández, Marta; García-Recio, Eva M.; Gómez-Chacón, Gerónimo F.; Sánchez-López, Marta; González, Víctor M.

    2013-01-01

    Parasites of the genus Leishmania produce leishmaniasis which affects millions people around the world. Understanding the molecular characteristics of the parasite can increase the knowledge about the mechanisms underlying disease development and progression. Thus, the study of the molecular features of histones has been considered of particular interest because Leishmania does not condense the chromatin during mitosis and, consequently, a different role for these proteins in the biology of the parasite can be expected. Furthermore, the sequence divergences in the amino and in the carboxy-terminal domains of the kinetoplastid core histones convert them in potential diagnostic and/or therapeutics targets. Aptamers are oligonucleotide ligands that are selected in vitro by their affinity and specificity for the target as a consequence of the particular tertiary structure that they are able to acquire depending on their sequence. Development of high-affinity molecules with the ability to recognize specifically Leishmania histones is essential for the progress of this kind of study. Two aptamers which specifically recognize Leishmania infantum H2A histone were cloned from a previously obtained ssDNA enriched population. These aptamers were sequenced and subjected to an in silico analysis. ELONA, slot blot and Western blot were performed to establish aptamer affinity and specificity for LiH2A histone and ELONA assays using peptides corresponding to overlapped sequences of LiH2A were made mapping the aptamers:LiH2A interaction. As “proofs of concept”, aptamers were used to determine the number of parasites in an ELONA platform and to purify LiH2A from complex mixtures. The aptamers showed different secondary structures among them; however, both of them were able to recognize the same peptides located in a side of the protein. In addition, we demonstrate that these aptamers are useful for LiH2A identification and also may be of potential application as diagnostic

  8. HAPIscreen, a method for high-throughput aptamer identification

    PubMed Central

    2011-01-01

    Background Aptamers are oligonucleotides displaying specific binding properties for a predetermined target. They are selected from libraries of randomly synthesized candidates through an in vitro selection process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment) alternating selection and amplification steps. SELEX is followed by cloning and sequencing of the enriched pool of oligonucleotides to enable comparison of the selected sequences. The most represented candidates are then synthesized and their binding properties are individually evaluated thus leading to the identification of aptamers. These post-selection steps are time consuming and introduce a bias to the expense of poorly amplified binders that might be of high affinity and are consequently underrepresented. A method that would circumvent these limitations would be highly valuable. Results We describe a novel homogeneous solution-based method for screening large populations of oligonucleotide candidates generated from SELEX. This approach, based on the AlphaScreen® technology, is carried out on the exclusive basis of the binding properties of the selected candidates without the needs of performing a priori sequencing. It therefore enables the functional identification of high affinity aptamers. We validated the HAPIscreen (High throughput APtamer Identification screen) methodology using aptamers targeted to RNA hairpins, previously identified in our laboratory. We then screened pools of candidates issued from SELEX rounds in a 384 well microplate format and identify new RNA aptamers to pre-microRNAs. Conclusions HAPIscreen, an Alphascreen®-based methodology for the identification of aptamers is faster and less biased than current procedures based on sequence comparison of selected oligonucleotides and sampling binding properties of few individuals. Moreover this methodology allows for screening larger number of candidates. Used here for selecting anti-premiR aptamers, HAPIscreen

  9. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  10. Aptamers Binding to c-Met Inhibiting Tumor Cell Migration.

    PubMed

    Piater, Birgit; Doerner, Achim; Guenther, Ralf; Kolmar, Harald; Hock, Bjoern

    2015-01-01

    The human receptor tyrosine kinase c-Met plays an important role in the control of critical cellular processes. Since c-Met is frequently over expressed or deregulated in human malignancies, blocking its activation is of special interest for therapy. In normal conditions, the c-Met receptor is activated by its bivalent ligand hepatocyte growth factor (HGF). Also bivalent antibodies can activate the receptor by cross linking, limiting therapeutic applications. We report the generation of the RNA aptamer CLN64 containing 2'-fluoro pyrimidine modifications by systematic evolution of ligands by exponential enrichment (SELEX). CLN64 and a previously described single-stranded DNA (ssDNA) aptamer CLN3 exhibited high specificities and affinities to recombinant and cellular expressed c-Met. Both aptamers effectively inhibited HGF-dependent c-Met activation, signaling and cell migration. We showed that these aptamers did not induce c-Met activation, revealing an advantage over bivalent therapeutic molecules. Both aptamers were shown to bind overlapping epitopes but only CLN3 competed with HGF binding to cMet. In addition to their therapeutic and diagnostic potential, CLN3 and CLN64 aptamers exhibit valuable tools to further understand the structural and functional basis for c-Met activation or inhibition by synthetic ligands and their interplay with HGF binding. PMID:26658271

  11. APTAMER-BASED SERRS SENSOR FOR THROMBIN DETECTION

    SciTech Connect

    Cho, H; Baker, B R; Wachsmann-Hogiu, S; Pagba, C V; Laurence, T A; Lane, S M; Lee, L P; Tok, J B

    2008-07-02

    We describe an aptamer-based Surface Enhanced Resonance Raman Scattering (SERRS) sensor with high sensitivity, specificity, and stability for the detection of a coagulation protein, human a-thrombin. The sensor achieves high sensitivity and a limit of detection of 100 pM by monitoring the SERRS signal change upon the single step of thrombin binding to immobilized thrombin binding aptamer. The selectivity of the sensor is demonstrated by the specific discrimination of thrombin from other protein analytes. The specific recognition and binding of thrombin by the thrombin binding aptamer is essential to the mechanism of the aptamer-based sensor, as shown through measurements using negative control oligonucleotides. In addition, the sensor can detect 1 nM thrombin in the presence of complex biofluids, such as 10% fetal calf serum, demonstrating that the immobilized, 5{prime}-capped, 3{prime}-capped aptamer is sufficiently robust for clinical diagnostic applications. Furthermore, the proposed sensor may be implemented for multiplexed detection using different aptamer-Raman probe complexes.

  12. CD28 Aptamers as Powerful Immune Response Modulators

    PubMed Central

    Pastor, Fernando; Soldevilla, Mario M; Villanueva, Helena; Kolonias, Despina; Inoges, Susana; de Cerio, Ascensión L; Kandzia, Romy; Klimyuk, Victor; Gleba, Yuri; Gilboa, Eli; Bendandi, Maurizio

    2013-01-01

    CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7), precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist) to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy. PMID:23756353

  13. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation.

    PubMed

    Kim, Jinho; Olsen, Timothy R; Zhu, Jing; Hilton, John P; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  14. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  15. Hybridization-based aptamer labeling using complementary oligonucleotide platform for PET and optical imaging.

    PubMed

    Park, Jun Young; Lee, Tae Sup; Song, In Ho; Cho, Ye Lim; Chae, Ju Ri; Yun, Mijin; Kang, Hyungu; Lee, Jung Hwan; Lim, Jong Hoon; Cho, Won Gil; Kang, Won Jun

    2016-09-01

    Aptamers are promising next-generation ligands used in molecular imaging and theragnosis. Aptamers are synthetic nucleic acids that can be held together with complementary sequences by base-pair hybridization. In this study, the complementary oligonucleotide (cODN) hybridization-based aptamer conjugation platform was developed to use aptamers as the molecular imaging agent. The cODN was pre-labeled with fluorescent dye or radioisotope and hybridized with a matched sequence containing aptamers in aqueous conditions. The cODN platform-hybridized aptamers exhibited good serum stability and specific binding affinity towards target cancer cells both in vitro and in vivo. These results suggest that the newly designed aptamer conjugation platform offers great potential for the versatile application of aptamers as molecular imaging agents. PMID:27258484

  16. Aptamer-initiated on-particle template-independent enzymatic polymerization (aptamer-OTEP) for electrochemical analysis of tumor biomarkers.

    PubMed

    Wang, Pengjuan; Wan, Ying; Deng, Shengyuan; Yang, Shulin; Su, Yan; Fan, Chunhai; Aldalbahi, Ali; Zuo, Xiaolei

    2016-12-15

    Herein, an aptamer-initiated on-particle template-independent enzymatic polymerization (aptamer-OTEP) strategy for electrochemical aptasensor (E-aptasensor) is developed for analysis of cancer biomarker carcino-embryonic antigen (CEA). A pair of DNA aptamers is employed which can be specifically bond with CEA simultaneously. One of the aptamer is thiolated at 3'-terminal and immobilized onto the gold electrode as a capture probe, while the other one has a thiol group at its 5'-terminal and is modified onto the gold nanoparticles surface to form a nanoprobe. In the present of target, the two aptamers can "sandwich" the target, thus the nanoprobe is attached to the electrode. Then terminal deoxynucleotidyl transferase (TdT) is employed to catalyze the incorporation of biotin labeled dNTPs into the 3'-OH terminals of the DNA aptamer on the nanoprobe. The as-generated long DNA oligo tentacles allow specific binding of numerous avidin modified horseradish peroxidase (Av-HRP), resulting in tens of thousands of HRP catalyzed reduction of hydrogen peroxide and sharply increasing electrochemical signals. Taking advantage of the enzyme based nucleic acid amplification and nanoprobe, this strategy is demonstrated to possess the outstanding amplification efficiency. PMID:27448543

  17. Predicting the Uncertain Future of Aptamer-Based Diagnostics and Therapeutics.

    PubMed

    Bruno, John G

    2015-01-01

    Despite the great promise of nucleic acid aptamers in the areas of diagnostics and therapeutics for their facile in vitro development, lack of immunogenicity and other desirable properties, few truly successful aptamer-based products exist in the clinical or other markets. Core reasons for these commercial deficiencies probably stem from industrial commitment to antibodies including a huge financial investment in humanized monoclonal antibodies and a general ignorance about aptamers and their performance among the research and development community. Given the early failures of some strong commercial efforts to gain government approval and bring aptamer-based products to market, it may seem that aptamers are doomed to take a backseat to antibodies forever. However, the key advantages of aptamers over antibodies coupled with niche market needs that only aptamers can fill and more recent published data still point to a bright commercial future for aptamers in areas such as infectious disease and cancer diagnostics and therapeutics. As more researchers and entrepreneurs become familiar with aptamers, it seems inevitable that aptamers will at least be considered for expanded roles in diagnostics and therapeutics. This review also examines new aptamer modifications and attempts to predict new aptamer applications that could revolutionize biomedical technology in the future and lead to marketed products. PMID:25913927

  18. Importance of rigorous in vitro evaluation of prospective cell binding aptamers.

    PubMed

    Avci-Adali, Meltem; Mludek, Katherina; Perle, Nadja; Stoll, Heidi; Schlensak, Christian; Wendel, Hans P

    2014-08-01

    Hitherto, several aptamers have been selected against cell surface molecules. The use of these aptamers for in vivo applications requires the prior in-depth in vitro evaluation of cell specific binding. Here, we demonstrate the in vitro tests, which are imperatively necessary to evaluate aptamers prior to in vivo applications. Exemplarily, the target binding of a chemically synthesized model aptamer containing phosphorothioate linkages was tested after the induction of the target protein expression on the cell surface by using flow cytometry. Furthermore, different cell types were used to compare the binding of the aptamer. Different single stranded DNA oligonucleotides were selected as negative controls to evaluate sequence specific binding of the aptamer to the cells. In further experiments, the aptamer binding to the target cells was determined in a mixture containing human plasma and peripheral blood cells to simulate the binding of the aptamer to target cells in human whole blood. In this study, we demonstrated the compelling necessity of the in vitro binding tests with the selected aptamers using target and non-target cells, the use of appropriate nonsense aptamers to validate the sequence specific binding of aptamers, and the evaluation of target binding in human plasma containing blood proteins and cells. Thus, we recommend the use of described methods to validate the target specific binding of newly selected aptamers prior to in vivo applications.

  19. Aptamer-based competitive electrochemical biosensor for brevetoxin-2.

    PubMed

    Eissa, Shimaa; Siaj, Mohamed; Zourob, Mohammed

    2015-07-15

    Brevetoxins (BTXs) are very potent marine neurotoxins that increased in geographical distribution in the past decade causing the illness clinically described as neurological shellfish poisoning (NSP). The ethical problems as well as the technical difficulties associated with the currently employed analysis methods for marine toxins are encouraging the research for suitable alternatives to be applied in a regulatory monitoring regime. Here, we report an electrochemical biosensor platform for BTX-2 detection utilising aptamer as specific receptor. Using in vitro selection, high affinity DNA aptamers to BTX-2 were successfully selected for the first time from a large pool of random sequences. The binding of BTX-2 to aptamer pools/clones was monitored using fluorescence and electrochemical impedance spectroscopy (EIS). The aptamer BT10 exhibited the highest binding affinity to BTX-2, with a dissociation constant of 42nM. The effects of the incubation time, pH and metal ions concentrations on the aptamer-toxin binding were studied. The aptamer BT10 was used to construct a label-free competitive impedimetric biosensor for BTX-2 achieving a detection limit of 106pg/ml. We observed a high degree of cross reactivity of the selected aptamer to the two similar congeners, BTX-2 and -3, whereas no cross reactivity to other marine toxins was obtained. Moreover, the aptasensor was applied for the detection of BTX-2 in spiked shellfish extract showing a very high recovery percentage. We believe that the proposed aptasensor will facilitate the routine detection of BTX-2 in food samples.

  20. Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus.

    PubMed

    Abbaspour, Abdolkarim; Norouz-Sarvestani, Fatemeh; Noori, Abolhassan; Soltani, Noushin

    2015-06-15

    Staphylococcus aureus (S. aureus) is one of the most important human pathogens and causes numerous illnesses. In this study, we report a sensitive and highly selective dual-aptamer-based sandwich immunosensor for the detection of S. aureus. In this bioassay system, a biotinylated primary anti-S.aureus aptamer was immobilized on streptavidin coated magnetic beads (MB), which serves as a capture probe. A secondary anti-S.aureus aptamer was conjugated to silver nanoparticles (Apt-AgNP) that sensitively reports the detection of the target. In the presence of target bacterium, an Apt/S.aureus/apt-AgNP sandwich complex is formed on the MB surface and the electrochemical signal of AgNPs followed through anodic stripping voltammetry. The proposed sandwich assay benefits from advantageous of a sandwich assay for increased specificity, MB as carriers of affinity ligands for solution-phase recognition and fast magnetic separation, AgNPs for signal amplification, and an electrochemical stripping voltammetry read-out as a simple and sensitive detection. The electrochemical immunosensor shows an extended dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL (S/N=3). Furthermore, the possible interference of other analog bacteria was studied. To assess the general applicability of this sensor, we investigated the quantification of S. aureus in real water samples. The results were compared to the experimental results obtained from a plate counting method, which demonstrated an acceptable consistency.

  1. Structural basis for discriminatory recognition of Plasmodium lactate dehydrogenase by a DNA aptamer.

    PubMed

    Cheung, Yee-Wai; Kwok, Jane; Law, Alan W L; Watt, Rory M; Kotaka, Masayo; Tanner, Julian A

    2013-10-01

    DNA aptamers have significant potential as diagnostic and therapeutic agents, but the paucity of DNA aptamer-target structures limits understanding of their molecular binding mechanisms. Here, we report a distorted hairpin structure of a DNA aptamer in complex with an important diagnostic target for malaria: Plasmodium falciparum lactate dehydrogenase (PfLDH). Aptamers selected from a DNA library were highly specific and discriminatory for Plasmodium as opposed to human lactate dehydrogenase because of a counterselection strategy used during selection. Isothermal titration calorimetry revealed aptamer binding to PfLDH with a dissociation constant of 42 nM and 2:1 protein:aptamer molar stoichiometry. Dissociation constants derived from electrophoretic mobility shift assays and surface plasmon resonance experiments were consistent. The aptamer:protein complex crystal structure was solved at 2.1-Å resolution, revealing two aptamers bind per PfLDH tetramer. The aptamers showed a unique distorted hairpin structure in complex with PfLDH, displaying a Watson-Crick base-paired stem together with two distinct loops each with one base flipped out by specific interactions with PfLDH. Aptamer binding specificity is dictated by extensive interactions of one of the aptamer loops with a PfLDH loop that is absent in human lactate dehydrogenase. We conjugated the aptamer to gold nanoparticles and demonstrated specificity of colorimetric detection of PfLDH over human lactate dehydrogenase. This unique distorted hairpin aptamer complex provides a perspective on aptamer-mediated molecular recognition and may guide rational design of better aptamers for malaria diagnostics.

  2. Aptamer-Based Technologies in Foodborne Pathogen Detection

    PubMed Central

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  3. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing

    PubMed Central

    Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E.; Scheller, Frieder W.

    2016-01-01

    Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either “evolution in the test tube” of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the “biological” degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application. PMID:27438862

  4. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    PubMed

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  5. Aptamers in Diagnostics and Treatment of Viral Infections

    PubMed Central

    Wandtke, Tomasz; Woźniak, Joanna; Kopiński, Piotr

    2015-01-01

    Aptamers are in vitro selected DNA or RNA molecules that are capable of binding a wide range of nucleic and non-nucleic acid molecules with high affinity and specificity. They have been conducted through the process known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment). It serves to reach specificity and considerable affinity to target molecules, including those of viral origin, both proteins and nucleic acids. Properties of aptamers allow detecting virus infected cells or viruses themselves and make them competitive to monoclonal antibodies. Specific aptamers can be used to interfere in each stage of the viral replication cycle and also inhibit its penetration into cells. Many current studies have reported possible application of aptamers as a treatment or diagnostic tool in viral infections, e.g., HIV (Human Immunodeficiency Virus), HBV (Hepatitis B Virus), HCV (Hepatitis C Virus), SARS (Severe Acute Respiratory Syndrome), H5N1 avian influenza and recently spread Ebola. This review presents current developments of using aptamers in the diagnostics and treatment of viral diseases. PMID:25690797

  6. DNA and RNA aptamers as modulators of protein function.

    PubMed

    Ulrich, Henning

    2005-03-01

    The SELEX technique (systematic evolution of ligands by exponential enrichment) is a combinatorial library approach in which DNA or RNA molecules are selected by their ability to bind their protein targets with high affinity and specificity. The isolated molecules are referred to as aptamers (from aptus = Latin "to fit"). First, RNA and DNA aptamers were identified that bind to proteins naturally interacting with nucleic acids, or to small organic molecules such as ATP. In the following years, the use of the SELEX technique was extended to isolate oligonucleotide ligands for a wide range of proteins of importance for therapy, and diagnostics. Since these RNA and DNA molecules bind their targets with similar affinities as antibodies, and are able to distinguish between isotypes of an enzyme, aptamers have been also called synthetic antibodies. Recently, the use of in vitro selection methods to isolate protein inhibitors has been extended to complex targets, such as receptors that are only functional in their membrane-bound form, cells, and trypanosomes. RNA aptamers have been expressed in living cells where they inhibit a protein implicated in intracellular signal transduction. The utility of aptamers for in vivo experiments, and diagnostic and therapeutic purposes, is considerably enhanced by introducing chemical modifications into the oligonucleotides to provide resistance against enzymatic degradation in body fluids. Recently, such inhibitors have been evolved for a great variety of targets, including receptors, growth factors, and adhesion molecules implicated in disease. Furthermore, some results were already obtained in animal models and clinical trials. PMID:16787315

  7. Aptamer-Based Technologies in Foodborne Pathogen Detection

    PubMed Central

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome. PMID:27672383

  8. Reagentless, Structure-Switching, Electrochemical Aptamer-Based Sensors

    NASA Astrophysics Data System (ADS)

    Schoukroun-Barnes, Lauren R.; Macazo, Florika C.; Gutierrez, Brenda; Lottermoser, Justine; Liu, Juan; White, Ryan J.

    2016-06-01

    The development of structure-switching, electrochemical, aptamer-based sensors over the past ˜10 years has led to a variety of reagentless sensors capable of analytical detection in a range of sample matrices. The crux of this methodology is the coupling of target-induced conformation changes of a redox-labeled aptamer with electrochemical detection of the resulting altered charge transfer rate between the redox molecule and electrode surface. Using aptamer recognition expands the highly sensitive detection ability of electrochemistry to a range of previously inaccessible analytes. In this review, we focus on the methods of sensor fabrication and how sensor signaling is affected by fabrication parameters. We then discuss recent studies addressing the fundamentals of sensor signaling as well as quantitative characterization of the analytical performance of electrochemical aptamer-based sensors. Although the limits of detection of reported electrochemical aptamer-based sensors do not often reach that of gold-standard methods such as enzyme-linked immunosorbent assays, the operational convenience of the sensor platform enables exciting analytical applications that we address. Using illustrative examples, we highlight recent advances in the field that impact important areas of analytical chemistry. Finally, we discuss the challenges and prospects for this class of sensors.

  9. Acousto-microfluidics for screening of ssDNA aptamer.

    PubMed

    Park, Jee-Woong; Lee, Su Jin; Ren, Shuo; Lee, Sangwook; Kim, Soyoun; Laurell, Thomas

    2016-01-01

    We demonstrate a new screening method for obtaining a prostate-specific antigen (PSA) binding aptamer based on an acoustofluidic separation (acoustophoreis) technique. Since acoustophoresis provides simultaneous washing and separation in a continuous flow mode, we efficiently obtained a PSA binding aptamer that shows high affinity without any additional washing step, which is necessary in other screening methods. In addition, next-generation sequencing (NGS) was applied to accelerate the identification of the screened ssDNA pool, improving the selecting process of the aptamer candidate based on the frequency ranking of the sequences. After the 8(th) round of the acoustophoretic systematic evolution of ligands by exponential enrichment (SELEX) and following sequence analysis with NGS, 7 PSA binding ssDNA aptamer-candidates were obtained and characterized with surface plasmon resonance (SPR) for affinity and specificity. As a result of the new SELEX method with PSA as the model target protein, the best PSA binding aptamer showed specific binding to PSA with a dissociation constant (Kd) of 0.7 nM. PMID:27272884

  10. Reagentless, Structure-Switching, Electrochemical Aptamer-Based Sensors.

    PubMed

    Schoukroun-Barnes, Lauren R; Macazo, Florika C; Gutierrez, Brenda; Lottermoser, Justine; Liu, Juan; White, Ryan J

    2016-06-12

    The development of structure-switching, electrochemical, aptamer-based sensors over the past ∼10 years has led to a variety of reagentless sensors capable of analytical detection in a range of sample matrices. The crux of this methodology is the coupling of target-induced conformation changes of a redox-labeled aptamer with electrochemical detection of the resulting altered charge transfer rate between the redox molecule and electrode surface. Using aptamer recognition expands the highly sensitive detection ability of electrochemistry to a range of previously inaccessible analytes. In this review, we focus on the methods of sensor fabrication and how sensor signaling is affected by fabrication parameters. We then discuss recent studies addressing the fundamentals of sensor signaling as well as quantitative characterization of the analytical performance of electrochemical aptamer-based sensors. Although the limits of detection of reported electrochemical aptamer-based sensors do not often reach that of gold-standard methods such as enzyme-linked immunosorbent assays, the operational convenience of the sensor platform enables exciting analytical applications that we address. Using illustrative examples, we highlight recent advances in the field that impact important areas of analytical chemistry. Finally, we discuss the challenges and prospects for this class of sensors.

  11. Isolation of an Aptamer that Binds Specifically to E. coli

    PubMed Central

    Cleto, Fernanda; Krieger, Marco Aurélio; Cardoso, Josiane

    2016-01-01

    Escherichia coli is a bacterial species found ubiquitously in the intestinal flora of animals, although pathogenic variants cause major public health problems. Aptamers are short oligonucleotides that bind to targets with high affinity and specificity, and have great potential for use in diagnostics and therapy. We used cell-based Systematic Evolution of Ligands by EXponential enrichment (cell-SELEX) to isolate four single stranded DNA (ssDNA) aptamers that bind strongly to E. coli cells (ATCC generic strain 25922), with Kd values in the nanomolar range. Fluorescently labeled aptamers label the surface of E. coli cells, as viewed by fluorescent microscopy. Specificity tests with twelve different bacterial species showed that one of the aptamers–called P12-31—is highly specific for E. coli. Importantly, this aptamer binds to Meningitis/sepsis associated E. coli (MNEC) clinical isolates, and is the first aptamer described with potential for use in the diagnosis of MNEC-borne pathologies. PMID:27104834

  12. Targeting Insulin Receptor with a Novel Internalizing Aptamer

    PubMed Central

    Iaboni, Margherita; Fontanella, Raffaela; Rienzo, Anna; Capuozzo, Maria; Nuzzo, Silvia; Santamaria, Gianluca; Catuogno, Silvia; Condorelli, Gerolama; de Franciscis, Vittorio; Esposito, Carla Lucia

    2016-01-01

    Nucleic acid-based aptamers are emerging as therapeutic antagonists of disease-associated proteins such as receptor tyrosine kinases. They are selected by an in vitro combinatorial chemistry approach, named Systematic Evolution of Ligands by Exponential enrichment (SELEX), and thanks to their small size and unique chemical characteristics, they possess several advantages over antibodies as diagnostics and therapeutics. In addition, aptamers that rapidly internalize into target cells hold as well great potential for their in vivo use as delivery tools of secondary therapeutic agents. Here, we describe a nuclease resistant RNA aptamer, named GL56, which specifically recognizes the insulin receptor (IR). Isolated by a cell-based SELEX method that allows enrichment for internalizing aptamers, GL56 rapidly internalizes into target cells and is able to discriminate IR from the highly homologous insulin-like growth factor receptor 1. Notably, when applied to IR expressing cancer cells, the aptamer inhibits IR dependent signaling. Given the growing interest in the insulin receptor as target for cancer treatment, GL56 reveals a novel molecule with great translational potential as inhibitor and delivery tool for IR-dependent cancers. PMID:27648925

  13. Acousto-microfluidics for screening of ssDNA aptamer

    PubMed Central

    Park, Jee-Woong; Lee, Su Jin; Ren, Shuo; Lee, Sangwook; Kim, Soyoun; Laurell, Thomas

    2016-01-01

    We demonstrate a new screening method for obtaining a prostate-specific antigen (PSA) binding aptamer based on an acoustofluidic separation (acoustophoreis) technique. Since acoustophoresis provides simultaneous washing and separation in a continuous flow mode, we efficiently obtained a PSA binding aptamer that shows high affinity without any additional washing step, which is necessary in other screening methods. In addition, next-generation sequencing (NGS) was applied to accelerate the identification of the screened ssDNA pool, improving the selecting process of the aptamer candidate based on the frequency ranking of the sequences. After the 8th round of the acoustophoretic systematic evolution of ligands by exponential enrichment (SELEX) and following sequence analysis with NGS, 7 PSA binding ssDNA aptamer-candidates were obtained and characterized with surface plasmon resonance (SPR) for affinity and specificity. As a result of the new SELEX method with PSA as the model target protein, the best PSA binding aptamer showed specific binding to PSA with a dissociation constant (Kd) of 0.7 nM. PMID:27272884

  14. DNA Aptamers against the Lup an 1 Food Allergen

    PubMed Central

    Nadal, Pedro; Pinto, Alessandro; Svobodova, Marketa; Canela, Nuria; O'Sullivan, Ciara K.

    2012-01-01

    Using in vitro selection, high affinity DNA aptamers to the food allergen Lup an 1, ß-conglutin, were selected from a pool of DNA, 93 bases in length, containing a randomised sequence of 49 bases. ß-conglutin was purified from lupin flour and chemically crosslinked to carboxylated magnetic beads. Peptide mass fingerprinting was used to confirm the presence of the ß-conglutin. Single stranded DNA was generated from the randomised pool using T7 Gene 6 Exonuclease and was subsequently incubated with the magnetic beads and the captured DNA was released and amplified prior to a further round of Systematic Evolution of Ligands by Exponential Enrichment (SELEX). Evolution was monitored using enzyme linked oligonucleotide assay and surface plasmon resonance. Once a plateau in evolution was reached, the isolated DNA sequences were cloned and sequenced. The consensus motif was identified via alignment of the sequences and the affinities of these sequences for immobilised ß-conglutin were determined using surface plasmon resonance. The selected aptamer was demonstrated to be highly specific, showing no cross-reactivity with other flour ingredients or with other conglutin fractions of lupin. The secondary structures of the selected aptamers were predicted using m-fold. Finally, the functionality of the selected aptamers was demonstrated using a competitive assay for the quantitative detection of ß-conglutin. . Future work will focus on structure elucidation and truncation of the selected sequences to generate a smaller aptamer for application to the analysis of the Lup an 1 allergen in foodstuffs. PMID:22529997

  15. Targeting Insulin Receptor with a Novel Internalizing Aptamer.

    PubMed

    Iaboni, Margherita; Fontanella, Raffaela; Rienzo, Anna; Capuozzo, Maria; Nuzzo, Silvia; Santamaria, Gianluca; Catuogno, Silvia; Condorelli, Gerolama; de Franciscis, Vittorio; Esposito, Carla Lucia

    2016-09-20

    Nucleic acid-based aptamers are emerging as therapeutic antagonists of disease-associated proteins such as receptor tyrosine kinases. They are selected by an in vitro combinatorial chemistry approach, named Systematic Evolution of Ligands by Exponential enrichment (SELEX), and thanks to their small size and unique chemical characteristics, they possess several advantages over antibodies as diagnostics and therapeutics. In addition, aptamers that rapidly internalize into target cells hold as well great potential for their in vivo use as delivery tools of secondary therapeutic agents. Here, we describe a nuclease resistant RNA aptamer, named GL56, which specifically recognizes the insulin receptor (IR). Isolated by a cell-based SELEX method that allows enrichment for internalizing aptamers, GL56 rapidly internalizes into target cells and is able to discriminate IR from the highly homologous insulin-like growth factor receptor 1. Notably, when applied to IR expressing cancer cells, the aptamer inhibits IR dependent signaling. Given the growing interest in the insulin receptor as target for cancer treatment, GL56 reveals a novel molecule with great translational potential as inhibitor and delivery tool for IR-dependent cancers.

  16. Micropatterning of Aptamer Beacons to Create Cytokine-Sensing Surfaces.

    PubMed

    Tuleuova, Nazgul; Revzin, Alexander

    2010-12-01

    Aptamer beacons are DNA or RNA probes that bind proteins or small molecules of interest and emit signal directly upon interaction with the target analyte. This paper describes micropatterning of aptamer beacons for detection of IFN-γ-an important inflammatory cytokine. The beacon consisted of a fluorophore-labeled aptamer strand hybridized with a shorter, quencher-carrying complementary strand. Cytokine molecules were expected to displace quenching strands of the beacon, disrupting FRET effect and resulting in fluorescence signal. The glass substrate was first micropatterned with poly(ethylene glycol) (PEG) hydrogel microwells (35 μm diameter individual wells) so as to define sites for attachment of beacon molecules. PEG microwell arrays were then incubated with avidin followed by biotin-aptamer-fluorophore constructs. Subsequent incubation with quencher-carrying complementary strands resulted in formation of DNA duplex and caused quenching of fluorescence due to FRET effect. When exposed to IFN-γ, microwells changed fluorescence from low (quencher hybridized with fluorophore-carrying strand) to high (quenching strand displaced by cytokine molecules). The fluorescence signal was confined to microwells, was changing in real-time and was dependent on the concentration of IFN-γ. In the future, we plan to co-localize aptamer beacons and cells on micropatterned surfaces in order to monitor in real-time cytokine secretion from immune cells in microwells.

  17. Targeting Insulin Receptor with a Novel Internalizing Aptamer.

    PubMed

    Iaboni, Margherita; Fontanella, Raffaela; Rienzo, Anna; Capuozzo, Maria; Nuzzo, Silvia; Santamaria, Gianluca; Catuogno, Silvia; Condorelli, Gerolama; de Franciscis, Vittorio; Esposito, Carla Lucia

    2016-01-01

    Nucleic acid-based aptamers are emerging as therapeutic antagonists of disease-associated proteins such as receptor tyrosine kinases. They are selected by an in vitro combinatorial chemistry approach, named Systematic Evolution of Ligands by Exponential enrichment (SELEX), and thanks to their small size and unique chemical characteristics, they possess several advantages over antibodies as diagnostics and therapeutics. In addition, aptamers that rapidly internalize into target cells hold as well great potential for their in vivo use as delivery tools of secondary therapeutic agents. Here, we describe a nuclease resistant RNA aptamer, named GL56, which specifically recognizes the insulin receptor (IR). Isolated by a cell-based SELEX method that allows enrichment for internalizing aptamers, GL56 rapidly internalizes into target cells and is able to discriminate IR from the highly homologous insulin-like growth factor receptor 1. Notably, when applied to IR expressing cancer cells, the aptamer inhibits IR dependent signaling. Given the growing interest in the insulin receptor as target for cancer treatment, GL56 reveals a novel molecule with great translational potential as inhibitor and delivery tool for IR-dependent cancers. PMID:27648925

  18. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    PubMed

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome. PMID:27672383

  19. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing.

    PubMed

    Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E; Scheller, Frieder W

    2016-01-01

    Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either "evolution in the test tube" of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the "biological" degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application. PMID:27438862

  20. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics

    PubMed Central

    2012-01-01

    Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761

  1. Aptamers as radiopharmaceuticals for nuclear imaging and therapy.

    PubMed

    Gijs, Marlies; Aerts, An; Impens, Nathalie; Baatout, Sarah; Luxen, André

    2016-04-01

    Today, radiopharmaceuticals belong to the standard instrumentation of nuclear medicine, both in the context of diagnosis and therapy. The majority of radiopharmaceuticals consist of targeting biomolecules which are designed to interact with a disease-related molecular target. A plethora of targeting biomolecules of radiopharmaceuticals exists, including antibodies, antibody fragments, proteins, peptides and nucleic acids. Nucleic acids have some significant advantages relative to proteinaceous biomolecules in terms of size, production, modifications, possible targets and immunogenicity. In particular, aptamers (non-coding, synthetic, single-stranded DNA or RNA oligonucleotides) are of interest because they can bind a molecular target with high affinity and specificity. At present, few aptamers have been investigated preclinically for imaging and therapeutic applications. In this review, we describe the use of aptamers as targeting biomolecules of radiopharmaceuticals. We also discuss the chemical modifications which are needed to turn aptamers into valuable (radio-)pharmaceuticals, as well as the different radiolabeling strategies that can be used to radiolabel oligonucleotides and, in particular, aptamers. PMID:26746572

  2. Aptamer stationary phase for protein capture in affinity capillary chromatography.

    PubMed

    Connor, Adam C; McGown, Linda B

    2006-04-14

    The thrombin-binding DNA aptamer was used with thrombin as a model system to investigate protein capture using aptamer stationary phases in affinity capillary chromatography. The aptamer was covalently attached to the inner surface of a bare fused-silica glass capillary to serve as the stationary phase. Proteins were loaded onto the capillary via an applied pressure. The capillary was then washed to remove unbound and non-specifically associated proteins. Finally, the bound protein was released and eluted using 20 mM Tris buffer containing 8 M urea, pH 7.3, at 50 degrees C. Eluate was collected after each step (load, wash and elute) and relative amounts of protein each were compared using fluorescence spectroscopy. The identity of the protein in the collections was confirmed using matrix assisted laser desorption ionization-time-of-flight (MALDI-TOF) mass spectrometry. The experiment was repeated for thrombin on a bare (unmodified) capillary and a capillary coated with a scrambled-sequence, non-G-quartet forming oligonucleotide that does not bind with thrombin. The results show that the aptamer stationary phase captures approximately three times as much thrombin as the control columns. The experiment was also repeated using human serum albumin (HSA) alone and in an equimolar mixture with thrombin. HSA was not retained on the aptamer capillary, nor did it affect the capture of thrombin from the mixture.

  3. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes.

    PubMed

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon

    2015-06-15

    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics.

  4. Recent Progress in Aptamer-Based Functional Probes for Bioanalysis and Biomedicine.

    PubMed

    Zhang, Huimin; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong

    2016-07-11

    Nucleic acid aptamers are short synthetic DNA or RNA sequences that can bind to a wide range of targets with high affinity and specificity. In recent years, aptamers have attracted increasing research interest due to their unique features of high binding affinity and specificity, small size, excellent chemical stability, easy chemical synthesis, facile modification, and minimal immunogenicity. These properties make aptamers ideal recognition ligands for bioanalysis, disease diagnosis, and cancer therapy. This review highlights the recent progress in aptamer selection and the latest applications of aptamer-based functional probes in the fields of bioanalysis and biomedicine.

  5. Superior Performance of Aptamer in Tumor Penetration over Antibody: Implication of Aptamer-Based Theranostics in Solid Tumors

    PubMed Central

    Xiang, Dongxi; Zheng, Conglong; Zhou, Shu-Feng; Qiao, Shuxi; Tran, Phuong Ha-Lien; Pu, Chunwen; Li, Yong; Kong, Lingxue; Kouzani, Abbas Z.; Lin, Jia; Liu, Ke; Li, Lianhong; Shigdar, Sarah; Duan, Wei

    2015-01-01

    Insufficient penetration of therapeutic agents into tumor tissues results in inadequate drug distribution and lower intracellular concentration of drugs, leading to the increase of drug resistance and resultant failure of cancer treatment. Targeted drug delivery to solid tumors followed by complete drug penetration and durable retention will significantly improve clinical outcomes of cancer therapy. Monoclonal antibodies have been commonly used in clinic for cancer treatment, but their limitation of penetrating into tumor tissues still remains because of their large size. Aptamers, as “chemical antibodies”, are 15-20 times smaller than antibodies. To explore whether aptamers are superior to antibodies in terms of tumor penetration, we carried out the first comprehensive study to compare the performance of an EpCAM aptamer with an EpCAM antibody in theranostic applications. Penetration and retention were studied in in vitro three-dimensional tumorspheres, in vivo live animal imaging and mouse colorectal cancer xenograft model. We found that the EpCAM aptamer can not only effectively penetrate into the tumorsphere cores but can also be retained by tumor sphere cells for at least 24 h, while limited tumor penetration by EpCAM antibody was observed after 4 h incubation. As observed from in vivo live animal imaging, EpCAM aptamers displayed a maximum tumor uptake at around 10 min followed by a rapid clearance after 80 min, while the signal of peak uptake and disappearance of antibody appeared at 3 h and 6 h after intravenous injection, respectively. The signal of PEGylated EpCAM aptamers in xenograft tumors was sustained for 26 h, which was 4.3-fold longer than that of the EpCAM antibody. Consistently, there were 1.67-fold and 6.6-fold higher accumulation of PEGylated aptamer in xenograft tumors than that of antibody, at 3 h and 24 h after intravenous administration, respectively. In addition, the aptamer achieved at least a 4-time better tumor penetration in

  6. DNA Aptamers against Taiwan Banded Krait α-Bungarotoxin Recognize Taiwan Cobra Cardiotoxins

    PubMed Central

    Chen, Ying-Jung; Tsai, Chia-Yu; Hu, Wan-Ping; Chang, Long-Sen

    2016-01-01

    Bungarus multicinctus α-bungarotoxin (α-Bgt) and Naja atra cardiotoxins (CTXs) share a common structural scaffold, and their tertiary structures adopt three-fingered loop motifs. Four DNA aptamers against α-Bgt have been reported previously. Given that the binding of aptamers with targeted proteins depends on structural complementarity, in this study, we investigated whether DNA aptamers against α-Bgt could also recognize CTXs. It was found that N. atra cardiotoxin 3 (CTX3) reduced the electrophoretic mobility of aptamers against α-Bgt. Analysis of the changes in the fluorescence intensity of carboxyfluorescein-labeled aptamers upon binding toxin molecules revealed that CTX3 and α-Bgt could bind the tested aptamers. Moreover, the aptamers inhibited the membrane-damaging activity and cytotoxicity of CTX3. In addition to CTX3, other N. atra CTX isotoxins also bound to the aptamer against α-Bgt. Taken together, our data indicate that aptamers against α-Bgt show cross-reactivity with CTXs. The findings that aptamers against α-Bgt also suppress the biological activities of CTX3 highlight the potential utility of aptamers in regard to the broad inhibition of snake venom three-fingered proteins. PMID:26959062

  7. Aptamer-based therapeutics: new approaches to combat human viral diseases.

    PubMed

    Shum, Ka-To; Zhou, Jiehua; Rossi, John J

    2013-11-25

    Viruses replicate inside the cells of an organism and continuously evolve to contend with an ever-changing environment. Many life-threatening diseases, such as AIDS, SARS, hepatitis and some cancers, are caused by viruses. Because viruses have small genome sizes and high mutability, there is currently a lack of and an urgent need for effective treatment for many viral pathogens. One approach that has recently received much attention is aptamer-based therapeutics. Aptamer technology has high target specificity and versatility, i.e., any viral proteins could potentially be targeted. Consequently, new aptamer-based therapeutics have the potential to lead a revolution in the development of anti-infective drugs. Additionally, aptamers can potentially bind any targets and any pathogen that is theoretically amenable to rapid targeting, making aptamers invaluable tools for treating a wide range of diseases. This review will provide a broad, comprehensive overview of viral therapies that use aptamers. The aptamer selection process will be described, followed by an explanation of the potential for treating virus infection by aptamers. Recent progress and prospective use of aptamers against a large variety of human viruses, such as HIV-1, HCV, HBV, SCoV, Rabies virus, HPV, HSV and influenza virus, with particular focus on clinical development of aptamers will also be described. Finally, we will discuss the challenges of advancing antiviral aptamer therapeutics and prospects for future success.

  8. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    PubMed

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food.

  9. Aptamer-Based Therapeutics: New Approaches to Combat Human Viral Diseases

    PubMed Central

    Shum, Ka-To; Zhou, Jiehua; Rossi, John J.

    2013-01-01

    Viruses replicate inside the cells of an organism and continuously evolve to contend with an ever-changing environment. Many life-threatening diseases, such as AIDS, SARS, hepatitis and some cancers, are caused by viruses. Because viruses have small genome sizes and high mutability, there is currently a lack of and an urgent need for effective treatment for many viral pathogens. One approach that has recently received much attention is aptamer-based therapeutics. Aptamer technology has high target specificity and versatility, i.e., any viral proteins could potentially be targeted. Consequently, new aptamer-based therapeutics have the potential to lead a revolution in the development of anti-infective drugs. Additionally, aptamers can potentially bind any targets and any pathogen that is theoretically amenable to rapid targeting, making aptamers invaluable tools for treating a wide range of diseases. This review will provide a broad, comprehensive overview of viral therapies that use aptamers. The aptamer selection process will be described, followed by an explanation of the potential for treating virus infection by aptamers. Recent progress and prospective use of aptamers against a large variety of human viruses, such as HIV-1, HCV, HBV, SCoV, Rabies virus, HPV, HSV and influenza virus, with particular focus on clinical development of aptamers will also be described. Finally, we will discuss the challenges of advancing antiviral aptamer therapeutics and prospects for future success. PMID:24287493

  10. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    PubMed

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food. PMID:27612649

  11. Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems

    PubMed Central

    Jiang, Feng; Liu, Biao; Lu, Jun; Li, Fangfei; Li, Defang; Liang, Chao; Dang, Lei; Liu, Jin; He, Bing; Atik Badshah, Shaikh; Lu, Cheng; He, Xiaojuan; Guo, Baosheng; Zhang, Xiao-Bing; Tan, Weihong; Lu, Aiping; Zhang, Ge

    2015-01-01

    Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX), are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems. PMID:26473828

  12. Affinity hydrogels for controlled protein release using nucleic acid aptamers and complementary oligonucleotides.

    PubMed

    Soontornworajit, Boonchoy; Zhou, Jing; Snipes, Matthew P; Battig, Mark R; Wang, Yong

    2011-10-01

    Biomaterials for the precise control of protein release are important to the development of new strategies for treating human diseases. This study aimed to fundamentally understand aptamer--protein dissociation triggered by complementary oligonucleotides, and to apply this understanding to develop affinity hydrogels for controlled protein release. The results showed that the oligonucleotide tails of the aptamers played a critical role in inducing intermolecular hybridization and triggering aptamer--protein dissociation. In addition, the attachment of the oligonucleotide tails to the aptamers and the increase of hybridizing length could produce a synergistic effect on the dissociation of bound proteins from their aptamers. More importantly, pegylated complementary oligonucleotides could successfully trigger protein release from the aptamer-functionalized hydrogels at multiple time points. Based on these results, it is believed that aptamer-functionalized hydrogels and complementary oligonucleotides hold great potential of controlling the release of protein drugs to treat human diseases.

  13. Improved Aptamers for the Diagnosis and Potential Treatment of HER2-Positive Cancer

    PubMed Central

    Gijs, Marlies; Penner, Gregory; Blackler, Garth B.; Impens, Nathalie R.E.N.; Baatout, Sarah; Luxen, André; Aerts, An M.

    2016-01-01

    Aptamers provide a potential source of alternative targeting molecules for existing antibody diagnostics and therapeutics. In this work, we selected novel DNA aptamers targeting the HER2 receptor by an adherent whole-cell SELEX approach. Individual aptamers were identified by next generation sequencing and bioinformatics analysis. Two aptamers, HeA2_1 and HeA2_3, were shown to bind the HER2 protein with affinities in the nanomolar range. In addition, both aptamers were able to bind with high specificity to HER2-overexpressing cells and HER2-positive tumor tissue samples. Furthermore, we demonstrated that aptamer HeA2_3 is being internalized into cancer cells and has an inhibitory effect on cancer cell growth and viability. In the end, we selected novel DNA aptamers with great potential for the diagnosis and possible treatment of HER2-positive cancer. PMID:27213406

  14. Enhancing aptamer function and stability via in vitro selection using modified nucleic acids.

    PubMed

    Meek, Kirsten N; Rangel, Alexandra E; Heemstra, Jennifer M

    2016-08-15

    Nucleic acid aptamers have emerged as a promising alternative to antibodies for use as recognition elements in therapeutics, bioimaging, and analytical applications. A key benefit that aptamers possess relative to antibodies is their ability to be chemically synthesized. This advantage, coupled with the broad range of modified nucleotide building blocks that can be constructed using chemical synthesis, has enabled the discovery and development of modified aptamers having extraordinary affinity, specificity, and biostability. Early efforts to generate modified aptamers focused on selection of a native DNA or RNA aptamer, followed by post-selection trial-and-error testing of modifications. However, recent advances in polymerase engineering and templated nucleic acid synthesis have enabled the direct selection of aptamers having modified backbones and nucleobases. This review will discuss these technological advances and highlight the improvements in aptamer function that have been realized through in vitro selection of non-natural nucleic acids.

  15. Probing the coagulation pathway with aptamers identifies combinations that synergistically inhibit blood clot formation.

    PubMed

    Bompiani, Kristin M; Lohrmann, Jens L; Pitoc, George A; Frederiksen, James W; Mackensen, George B; Sullenger, Bruce A

    2014-08-14

    Coordinated enzymatic reactions regulate blood clot generation. To explore the contributions of various coagulation enzymes in this process, we utilized a panel of aptamers against factors VIIa, IXa, Xa, and prothrombin. Each aptamer dose-dependently inhibited clot formation, yet none was able to completely impede this process in highly procoagulant settings. However, several combinations of two aptamers synergistically impaired clot formation. One extremely potent aptamer combination was able to maintain human blood fluidity even during extracorporeal circulation, a highly procoagulant setting encountered during cardiopulmonary bypass surgery. Moreover, this aptamer cocktail could be rapidly reversed with antidotes to restore normal hemostasis, indicating that even highly potent aptamer combinations can be rapidly controlled. These studies highlight the potential utility of using sets of aptamers to probe the functions of proteins in molecular pathways for research and therapeutic ends.

  16. Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay.

    PubMed

    Tang, Xuemin; Zheng, Jiang; Yan, Qinpi; Li, Zhongbao; Li, Yubao

    2013-06-01

    Aptamers against inactive Vibrio alginolyticus were selected from an 82-nt ssDNA random library by systematic evolution of ligands by exponential enrichment. After 15 rounds of selection, the final pool of aptamers was highly specific for inactivated V. alginolyticus and had a dissociation constant of 27.5 ± 9.2 nM. Using these aptamers and PCR, V. alginolyticus could be detected at 100 cells/ml. Sequencing of the final pool of aptamers revealed that some sequences, termed high-frequency aptamers, appeared more than once; these may be of practical application. All sequences obtained were divided into nine families according to their homology tree, some conserved sequences were also found in each of the six families. One sequence was found in significant proportions of the aptamers, suggesting that this conserved sequence might be important for forming the three-dimensional aptamer structure.

  17. Enhancing aptamer function and stability via in vitro selection using modified nucleic acids.

    PubMed

    Meek, Kirsten N; Rangel, Alexandra E; Heemstra, Jennifer M

    2016-08-15

    Nucleic acid aptamers have emerged as a promising alternative to antibodies for use as recognition elements in therapeutics, bioimaging, and analytical applications. A key benefit that aptamers possess relative to antibodies is their ability to be chemically synthesized. This advantage, coupled with the broad range of modified nucleotide building blocks that can be constructed using chemical synthesis, has enabled the discovery and development of modified aptamers having extraordinary affinity, specificity, and biostability. Early efforts to generate modified aptamers focused on selection of a native DNA or RNA aptamer, followed by post-selection trial-and-error testing of modifications. However, recent advances in polymerase engineering and templated nucleic acid synthesis have enabled the direct selection of aptamers having modified backbones and nucleobases. This review will discuss these technological advances and highlight the improvements in aptamer function that have been realized through in vitro selection of non-natural nucleic acids. PMID:27012179

  18. Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems.

    PubMed

    Jiang, Feng; Liu, Biao; Lu, Jun; Li, Fangfei; Li, Defang; Liang, Chao; Dang, Lei; Liu, Jin; He, Bing; Badshah, Shaikh Atik; Lu, Cheng; He, Xiaojuan; Guo, Baosheng; Zhang, Xiao-Bing; Tan, Weihong; Lu, Aiping; Zhang, Ge

    2015-01-01

    Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX), are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems.

  19. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors.

  20. DNA Aptamer Based Nanodrugs: Molecular Engineering for Efficiency

    PubMed Central

    Cansiz, Sena; Zhang, Liqin; Wu, Cuichen; Wu, Yuan; Teng, I-Ting; Hou, Weijia; Wang, Yanyue; Wan, Shuo; Cai, Ren; Jin, Chen; Liu, Qiaoling; Tan, Weihong

    2015-01-01

    In the past two decades, the study of cancer therapy has gradually advanced to the “Nano” era. Numerous novel nanomaterials armed with unique physical properties have been introduced into biomedical research. At the same time, functional nucleic acid molecules, especially aptamers, have aroused broad attention from the biomedical community. Benefiting from the advancement of molecular engineering strategies, it is now feasible to combine the cancer specific recognition capability of aptamers with various other special functions of nanomaterials to develop cancer specific drugs at the nanoscale. Nanodrugs are now offering an unprecedented opportunity to achieve the goal of efficient targeted delivery as well as controlled release. This review highlights some achievements of multiple aptamer-based nanodrug systems which have emerged in recent years, including studies in the infant stage of “proof-of-concept”. PMID:26177853

  1. Selective Targeting to Glioma with Nucleic Acid Aptamers

    PubMed Central

    Aptekar, Shraddha; Arora, Mohit; Lawrence, Clare Louise; Lea, Robert William; Ashton, Katherine; Dawson, Tim; Alder, Jane Elizabeth; Shaw, Lisa

    2015-01-01

    Malignant glioma is characterised by a rapid growth rate and high capacity for invasive infiltration to surrounding brain tissue; hence, diagnosis and treatment is difficult and patient survival is poor. Aptamers contribute a promising and unique technology for the in vitro imaging of live cells and tissues, with a potentially bright future in clinical diagnostics and therapeutics for malignant glioma. The binding selectivity, uptake capacity and binding target of two DNA aptamers, SA43 and SA44, were investigated in glioma cells and patient tissues. The binding assay showed that SA43 and SA44 bound with strong affinity (Kd, 21.56 ± 4.60 nM and Kd, 21.11 ± 3.30 nM respectively) to the target U87MG cells. Quantitative analysis by flow cytometry showed that the aptamers were able to actively internalise in U87MG and 1321N1 glioma cells compared to the non-cancerous and non-glioma cell types. Confocal microscopy confirmed staining in the cytoplasm, and co-localisation studies with endoplasmic reticulum, Golgi apparatus and lysosomal markers suggested internalisation and compartmentalisation within the endomembrane system. Both aptamers selectively bound to Ku 70 and Ku 80 DNA repair proteins as determined by aptoprecipitation (AP) followed by mass spectrometry analysis and confirmation by Western blot. In addition, aptohistochemical (AHC) staining on paraffin embedded, formalin fixed patient tissues revealed that the binding selectivity was significantly higher for SA43 aptamer in glioma tissues (grade I, II, III and IV) compared to the non-cancerous tissues, whereas SA44 did not show selectivity towards glioma tissues. The results indicate that SA43 aptamer can differentiate between glioma and non-cancerous cells and tissues and therefore, shows promise for histological diagnosis of glioma. PMID:26252900

  2. Massively Parallel Interrogation of Aptamer Sequence, Structure and Function

    SciTech Connect

    Fischer, N O; Tok, J B; Tarasow, T M

    2008-02-08

    Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  3. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    SciTech Connect

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  4. Computational modeling of peptide-aptamer binding.

    PubMed

    Rhinehardt, Kristen L; Mohan, Ram V; Srinivas, Goundla

    2015-01-01

    Evolution is the progressive process that holds each living creature in its grasp. From strands of DNA evolution shapes life with response to our ever-changing environment and time. It is the continued study of this most primitive process that has led to the advancement of modern biology. The success and failure in the reading, processing, replication, and expression of genetic code and its resulting biomolecules keep the delicate balance of life. Investigations into these fundamental processes continue to make headlines as science continues to explore smaller scale interactions with increasing complexity. New applications and advanced understanding of DNA, RNA, peptides, and proteins are pushing technology and science forward and together. Today the addition of computers and advances in science has led to the fields of computational biology and chemistry. Through these computational advances it is now possible not only to quantify the end results but also visualize, analyze, and fully understand mechanisms by gaining deeper insights. The biomolecular motion that exists governing the physical and chemical phenomena can now be analyzed with the advent of computational modeling. Ever-increasing computational power combined with efficient algorithms and components are further expanding the fidelity and scope of such modeling and simulations. This chapter discusses computational methods that apply biological processes, in particular computational modeling of peptide-aptamer binding.

  5. Selection and Biosensor Application of Aptamers for Small Molecules

    PubMed Central

    Pfeiffer, Franziska; Mayer, Günter

    2016-01-01

    Small molecules play a major role in the human body and as drugs, toxins, and chemicals. Tools to detect and quantify them are therefore in high demand. This review will give an overview about aptamers interacting with small molecules and their selection. We discuss the current state of the field, including advantages as well as problems associated with their use and possible solutions to tackle these. We then discuss different kinds of small molecule aptamer-based sensors described in literature and their applications, ranging from detecting drinking water contaminations to RNA imaging. PMID:27379229

  6. Aptamer-based viability impedimetric sensor for viruses.

    PubMed

    Labib, Mahmoud; Zamay, Anna S; Muharemagic, Darija; Chechik, Alexey V; Bell, John C; Berezovski, Maxim V

    2012-02-21

    The development of aptamer-based viability impedimetric sensor for viruses (AptaVISens-V) is presented. Highly specific DNA aptamers to intact vaccinia virus were selected using cell-SELEX technique and integrated into impedimetric sensors via self-assembly onto a gold microelectrode. Remarkably, this aptasensor is highly selective and can successfully detect viable vaccinia virus particles (down to 60 virions in a microliter) and distinguish them from nonviable viruses in a label-free electrochemical assay format. It also opens a new venue for the development of a variety of viability sensors for detection of many microorganisms and spores.

  7. A Versatile Approach Towards Nucleobase-Modified Aptamers.

    PubMed

    Tolle, Fabian; Brändle, Gerhard M; Matzner, Daniel; Mayer, Günter

    2015-09-01

    A novel and versatile method has been developed for modular expansion of the chemical space of nucleic acid libraries, thus enabling the generation of nucleobase-modified aptamers with unprecedented recognition properties. Reintroduction of the modification after enzymatic replication gives broad access to many chemical modifications. This wide applicability, which is not limited to a single modification, will rapidly advance the application of in vitro selection approaches beyond what is currently feasible and enable the generation of aptamers to many targets that have so far not been addressable. PMID:26224087

  8. Preliminary Development of a DNA Aptamer-Magnetic Bead Capture Electrochemiluminescence Sandwich Assay for Brain Natriuretic Peptide

    PubMed Central

    Bruno, John G.; Richarte, Alicia M.; Phillips, Taylor

    2014-01-01

    Fifty-two candidate DNA aptamer sequences were selected for binding to the cardiovascular biomarker B-type or brain natriuretic peptide (BNP). Candidate aptamers were screened to rank their relative affinities against BNP by an aptamer-based ELISA-like aptamer microplate assay (ELASA). The highest affinity aptamers from ELASA screening were also paired in all possible combinations and screened for electrochemiluminescence (ECL) assay potential in capture aptamer-magnetic bead and ruthenium trisbipyridine (Ru(bpy)32+)-reporter aptamer sandwich formats. The top ECL sandwich combinations utilized the same aptamer pair in either capture or reporting roles with nanogram to low picogram per mL levels of detection even in 50% human serum. ECL assay sensitivity and linearity even in 50% human serum suggest that the aptamer-based assay is at least comparable to other reported immunoassays for BNP. PMID:24764602

  9. Facile Discovery of Cell-Surface Protein Targets of Cancer Cell Aptamers.

    PubMed

    Bing, Tao; Shangguan, Dihua; Wang, Yinsheng

    2015-10-01

    Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from nonspecific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin α4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.

  10. A Highlight of Recent Advances in Aptamer Technology and Its Application.

    PubMed

    Sun, Hongguang; Zu, Youli

    2015-06-30

    Aptamers and SELEX (systematic evolution of ligands by exponential enrichment) technology have gained increasing attention over the past 25 years. Despite their functional similarity to protein antibodies, oligonucleotide aptamers have many unique properties that are suitable for clinical applications and industrialization. Aptamers may be superior to antibodies in fields such as biomarker discovery, in vitro and in vivo diagnosis, precisely controlled drug release, and targeted therapy. However, aptamer commercialization has not occurred as quickly as expected, and few aptamer-based products have yet successfully entered clinical and industrial use. Thus, it is important to critically review some technical barriers of aptamer and SELEX technology per se that may impede aptamer development and application. To date, how to rapidly obtain aptamers with superior bioavailability over antibodies remains the key issue. In this review, we discuss different chemical and structural modification strategies aimed to enhance aptamer bioavailability. We also discuss improvements to SELEX process steps to shorten the selection period and improve the SELEX process success rate. Applications in which aptamers are particularly suited and perform differently or superior to antibodies are briefly introduced.

  11. Identification of an Aptamer Binding to Human Osteogenic-Induced Progenitor Cells

    PubMed Central

    Niederlaender, Jan; Aicher, Wilhelm K.; Reinert, Siegmar; Schweizer, Ernst; Wendel, Hans-Peter; Alexander, Dorothea

    2013-01-01

    The aim of this study was to generate a specific aptamer against human jaw periosteal cells (JPCs) for tissue engineering applications in oral and maxillofacial surgery. This aptamer should serve as a capture molecule to enrich or even purify osteogenic progenitor cells from JPCs or from adult stem cells of other sources. Using systematic evolution of ligands by exponential enrichment (SELEX), we generated the first aptamer to specifically bind to human osteogenically induced JPCs. We did not detect any binding of the aptamer to undifferentiated JPCs, adipogenically and chondrogenically induced JPCs, or to any other cell line tested. However, similar binding patterns of the identified aptamer 74 were detected with mesenchymal stromal cells (MSCs) derived from placental tissue and bone marrow. After cell sorting, we analyzed the expression of osteogenic marker genes in the aptamer 74-positive and aptamer 74-negative fractions and detected no significant differences. Additionally, the analysis of the mineralization capacity revealed a slight tendency for the aptamer positive fraction to have a higher osteogenic potential. In terms of proliferation, JPCs growing in aptamer-coated wells showed increased proliferation rates compared with the controls. Herein, we report the development of an innovative approach for tissue engineering applications. Further studies should be conducted to modify and improve the specificity of the generated aptamer. PMID:23289534

  12. Influence of ionic strength, pH and aptamer configuration for binding affinity to thrombin.

    PubMed

    Hianik, Tibor; Ostatná, Veronika; Sonlajtnerova, Michaela; Grman, Igor

    2007-01-01

    We used the methods of electrochemical indicators and the quartz crystal microbalance (QCM) for detection of thrombin-aptamer interactions. We analyzed how the method of immobilization of aptamer to a solid support, the aptamer configuration as well as variation in ionic strength and pH will affect the binding of thrombin to the aptamer. The immobilization of aptamer by means of avidin-biotin technology revealed best results in sensitivity in comparison with immobilization utilizing dendrimers of first generation and in comparison with chemisorption of aptamer to a gold surface. Linear and molecular beacon aptamers of similar structure of binding site revealed similar binding properties to thrombin. Increased concentration of NaCl resulted in weakening of the binding of thrombin to the aptamers, probably due to shielding effect of Na(+) ions. The binding of the thrombin to the aptamer depends on electrolyte pH, which is presumably connected with maintaining the three dimensional aptamer configuration, optimal for binding the protein.

  13. DNA aptamer raised against advanced glycation end products inhibits melanoma growth in nude mice.

    PubMed

    Ojima, Ayako; Matsui, Takanori; Maeda, Sayaka; Takeuchi, Masayoshi; Inoue, Hiroyoshi; Higashimoto, Yuichiro; Yamagishi, Sho-ichi

    2014-04-01

    Epidemiological studies have suggested that diabetes is associated with an increased risk of cancer. However, the underlying molecular mechanism remains unclear. We investigated here whether DNA aptamer directed against advanced glycation end products (AGE-aptamer) inhibited melanoma growth in nude mice. G361 melanoma cells were injected intradermally into the upper flank of athymic nude mice. Mice received continuous intraperitoneal infusion (0.136 μg/day) of either AGE-aptamer (n=9) or Control-aptamer (n=8) by an osmotic mini pump. Tumor volume was measured at 4-day interval, and G361 melanoma was excised at day 43 after the aptamer treatment. We further examined the effects of AGE-aptamer on proliferation of AGE-exposed endothelial cells and G361 cells. AGE-aptamer significantly inhibited the in vivo-tumor growth of G361 melanoma. Immunohistochemical and western blotting analyses of G361 melanoma revealed that AGE-aptamer decreased expression levels of proliferating nuclear antigen, CD31 and Mac-3, markers of endothelial cells and macrophages, respectively. AGE-aptamer significantly decreased the number of tumor-associated vessels. AGE, receptor for AGE (RAGE) and vascular endothelial growth factor levels were also reduced in AGE-aptamer-treated G361 melanoma. AGE-aptamer inhibited the AGE-induced proliferation and tube formation of endothelial cells as well as the growth of G361 cells in vitro. The present findings suggest that AGE-aptamer could inhibit the AGE-RAGE axis in G361 melanoma and resultantly suppress the tumor growth in nude mice by blocking the angiogenesis. AGE-aptamer might be a novel therapeutic strategy for preventing the progression of malignant melanoma in diabetes.

  14. Modified AS1411 Aptamer Suppresses Hepatocellular Carcinoma by Up-Regulating Galectin-14

    PubMed Central

    Lee, Jeong-Hoon; Lee, Dong Hyeon; Cho, Eun Ju; Yu, Su Jong; Kim, Yoon Jun; Kim, Jong In; Im, Jong Hun; Lee, Jung Hwan; Oh, Eun Ju; Yoon, Jung-Hwan

    2016-01-01

    Aptamers are small synthetic oligonucleotides that bind to target proteins with high specificity and affinity. AS1411 is an aptamer that binds to nucleolin, which is overexpressed in the cytoplasm and occurs on the surface of cancer cells. We investigated the therapeutic potential of aptamers in hepatocellular carcinoma (HCC) by evaluating anti-tumor effects and confirming the affinity and specificity of AS1411- and modified AS1411-aptamers in HCC cells. Cell growth was assessed using the MTS assay, and cell death signaling was explored by immunoblot analysis. Fluorescence-activated cell sorting was performed to evaluate the affinity and specificity of AS1411-aptamers in SNU-761 HCC cells. We investigated the in vivo effects of the AS1411-aptamer using BALB/c nude mice in a subcutaneous xenograft model with SNU-761 cells. Treatment with a modified AS1411-aptamer significantly decreased in vitro (under normoxic [P = 0.035] and hypoxic [P = 0.018] conditions) and in vivo (under normoxic conditions, P = 0.041) HCC cell proliferation compared to control aptamers. AS1411- and control aptamers failed to control HCC cell proliferation. However, AS1411- and the modified AS1411-aptamer did not induce caspase activation. Decrease in cell growth by AS1411 or modified AS1411 was not prevented by caspase or necrosis inhibitors. In a microarray, AS1411 significantly enhanced galectin-14 expression. Suppression of HCC cell proliferation by the modified AS1411-aptamer was attenuated by galectin-14 siRNA transfection. Modified AS1411-aptamer suppressed HCC cell growth in vitro and in vivo by up-regulating galectin-14 expressions. Modified AS1411-aptamers may have therapeutic potential as a novel targeted therapy for HCC. PMID:27494117

  15. Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles.

    PubMed

    Chang, Tianjun; Wang, Libo; Zhao, Kexu; Ge, Yu; He, Meng; Li, Gang

    2016-06-01

    Staphylococcus aureus is the top common pathogen causing infections and food poisoning. Identification of S. aureus is crucial for the disease diagnosis and regulation of food hygiene. Herein, we report an aptamer-AuNPs based method for duplex identification of S. aureus. Using AuNPs as an indicator, SA23, an aptamer against S. aureus, can well identify its target from Escherichia coli, Listeria monocytogenes and Pseudomonas aeruginosa. Furthermore, we find citrate-coated AuNPs can strongly bind to S. aureus, but not bind to Salmonella enterica and Proteus mirabilis, which leads to different color changes in salt solution. This colorimetric response is capable of distinguishing S. aureus from S. enteritidis and P. mirabilis. Thus, using the aptasensor and AuNPs together, S. aureus can be accurately identified from the common pathogens. This duplex identification system is a promising platform for simple visual identification of S. aureus. Additionally, in the aptasensing process, bacteria are incubated with aptamers and then be removed before the aptamers adding to AuNPs, which may avoid the interactions between bacteria and AuNPs. This strategy can be potentially applied in principle to detect other cells by AuNPs-based aptasensors.

  16. Single-Round Patterned DNA Library Microarray Aptamer Lead Identification

    PubMed Central

    Martin, Jennifer A.; Mirau, Peter A.; Chushak, Yaroslav; Chávez, Jorge L.; Naik, Rajesh R.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

    2015-01-01

    A method for identifying an aptamer in a single round was developed using custom DNA microarrays containing computationally derived patterned libraries incorporating no information on the sequences of previously reported thrombin binding aptamers. The DNA library was specifically designed to increase the probability of binding by enhancing structural complexity in a sequence-space confined environment, much like generating lead compounds in a combinatorial drug screening library. The sequence demonstrating the highest fluorescence intensity upon target addition was confirmed to bind the target molecule thrombin with specificity by surface plasmon resonance, and a novel imino proton NMR/2D NOESY combination was used to screen the structure for G-quartet formation. We propose that the lack of G-quartet structure in microarray-derived aptamers may highlight differences in binding mechanisms between surface-immobilized and solution based strategies. This proof-of-principle study highlights the use of a computational driven methodology to create a DNA library rather than a SELEX based approach. This work is beneficial to the biosensor field where aptamers selected by solution based evolution have proven challenging to retain binding function when immobilized on a surface. PMID:26075138

  17. Aptamer-based viability impedimetric sensor for bacteria.

    PubMed

    Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

    2012-11-01

    The development of an aptamer-based viability impedimetric sensor for bacteria (AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella typhimurium were selected via the cell-systematic evolution of ligands by exponential enrichment (SELEX) technique. Twelve rounds of selection were performed; each comprises a positive selection step against viable S. typhimurium and a negative selection step against heat killed S. typhimurium and a mixture of related pathogens, including Salmonella enteritidis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species specificity of the selected aptamers. The DNA sequence showing the highest binding affinity to the bacteria was further integrated into an impedimetric sensor via self-assembly onto a gold nanoparticle-modified screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. typhimurium down to 600 CFU mL(-1) (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based viability sensing of a variety of microorganisms, particularly viable but nonculturable (VBNC) bacteria, using a rapid, economic, and label-free electrochemical platform.

  18. Aptamer-based electrochemical biosensor for interferon gamma detection.

    PubMed

    Liu, Ying; Tuleouva, Nazgul; Ramanculov, Erlan; Revzin, Alexander

    2010-10-01

    In this paper, we describe the development of an electrochemical DNA aptamer-based biosensor for detection of interferon (IFN)-γ. A DNA hairpin containing IFN-γ-binding aptamer was thiolated, conjugated with methylene blue (MB) redox tag, and immobilized on a gold electrode by self-assembly. Binding of IFN-γ caused the aptamer hairpin to unfold, pushing MB redox molecules away from the electrode and decreasing electron-transfer efficiency. The change in redox current was quantified using square wave voltammetry (SWV) and was found to be highly sensitive to IFN-γ concentration. The limit of detection for optimized biosensor was 0.06 nM with linear response extending to 10 nM. This aptasensor was specific to IFN-γ in the presence of overabundant serum proteins. Importantly, the same aptasensor could be regenerated by disrupting aptamer-IFN-γ complex in urea buffer and reused multiple times. Unlike standard sandwich immunoassays, the aptasensor described here allowed one to detect IFN-γ binding directly without the need for multiple washing steps and reagents. An electrochemical biosensor for simple and sensitive detection of IFN-γ demonstrated in this paper will have future applications in immunology, cancer research, and infectious disease monitoring.

  19. Aptamer-based impedimetric sensor for bacterial typing.

    PubMed

    Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

    2012-10-01

    The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based typing of a variety of microorganisms using a rapid, economic, and label-free electrochemical platform.

  20. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications.

    PubMed

    Ruscito, Annamaria; DeRosa, Maria C

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  1. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    PubMed Central

    Ruscito, Annamaria; DeRosa, Maria C.

    2016-01-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then used in various applications. These applications range from therapeutic uses to biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is needed for the protection and wellbeing of humans and animals. However, the small molecular weights of these targets, including the drastic size difference between the target and the oligonucleotides, make it challenging to select, characterize, and apply aptamers for their detection. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed. PMID:27242994

  2. Selection of DNA aptamers that bind to four organophosphorus pesticides.

    PubMed

    Wang, Li; Liu, Xianjin; Zhang, Qiang; Zhang, Cunzheng; Liu, Yuan; Tu, Kang; Tu, Jian

    2012-05-01

    Single-stranded DNA (ssDNA) aptamers against four organophosphorus pesticides (phorate, profenofos, isocarbophos and omethoate) were simultaneously isolated from an immobilized random ssDNA library by systematic evolution of ligands by exponential enrichment (SELEX) technique. After 12 rounds of in vitro selection, five ssDNA aptamer candidates were selected and their binding affinities were identified by a novel method using a molecular beacon. Two of the five ssDNA sequences, SS2-55 and SS4-54, demonstrated higher affinities and specificities to the four organophosphorus pesticides. They were defined as broad-spectrum aptamers binding to four different targets and their simulated secondary structures showed highly distinct features with typical stem and loop structures. The dissociation constant of SS2-55 and SS4-54 binding to the four organophosphorus pesticides ranged from 0.8 to 2.5 μM. These aptamers offered application potential in the analysis and/or neutralization of the residues of the four organophosphorus pesticides.

  3. Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles.

    PubMed

    Chang, Tianjun; Wang, Libo; Zhao, Kexu; Ge, Yu; He, Meng; Li, Gang

    2016-06-01

    Staphylococcus aureus is the top common pathogen causing infections and food poisoning. Identification of S. aureus is crucial for the disease diagnosis and regulation of food hygiene. Herein, we report an aptamer-AuNPs based method for duplex identification of S. aureus. Using AuNPs as an indicator, SA23, an aptamer against S. aureus, can well identify its target from Escherichia coli, Listeria monocytogenes and Pseudomonas aeruginosa. Furthermore, we find citrate-coated AuNPs can strongly bind to S. aureus, but not bind to Salmonella enterica and Proteus mirabilis, which leads to different color changes in salt solution. This colorimetric response is capable of distinguishing S. aureus from S. enteritidis and P. mirabilis. Thus, using the aptasensor and AuNPs together, S. aureus can be accurately identified from the common pathogens. This duplex identification system is a promising platform for simple visual identification of S. aureus. Additionally, in the aptasensing process, bacteria are incubated with aptamers and then be removed before the aptamers adding to AuNPs, which may avoid the interactions between bacteria and AuNPs. This strategy can be potentially applied in principle to detect other cells by AuNPs-based aptasensors. PMID:27427591

  4. Selection of DNA aptamers that bind to four organophosphorus pesticides.

    PubMed

    Wang, Li; Liu, Xianjin; Zhang, Qiang; Zhang, Cunzheng; Liu, Yuan; Tu, Kang; Tu, Jian

    2012-05-01

    Single-stranded DNA (ssDNA) aptamers against four organophosphorus pesticides (phorate, profenofos, isocarbophos and omethoate) were simultaneously isolated from an immobilized random ssDNA library by systematic evolution of ligands by exponential enrichment (SELEX) technique. After 12 rounds of in vitro selection, five ssDNA aptamer candidates were selected and their binding affinities were identified by a novel method using a molecular beacon. Two of the five ssDNA sequences, SS2-55 and SS4-54, demonstrated higher affinities and specificities to the four organophosphorus pesticides. They were defined as broad-spectrum aptamers binding to four different targets and their simulated secondary structures showed highly distinct features with typical stem and loop structures. The dissociation constant of SS2-55 and SS4-54 binding to the four organophosphorus pesticides ranged from 0.8 to 2.5 μM. These aptamers offered application potential in the analysis and/or neutralization of the residues of the four organophosphorus pesticides. PMID:22261866

  5. Aptamer conjugated silver nanoparticles for the detection of interleukin 6

    NASA Astrophysics Data System (ADS)

    Locke, Andrea K.; Norwood, Nicole; Marks, Haley L.; Schechinger, Monika; Jackson, George W.; Graham, Duncan; Coté, Gerard L.

    2016-03-01

    The controlled assembly of plasmonic nanoparticles by a molecular binding event has emerged as a simple yet sensitive methodology for protein detection. Metallic nanoparticles (NPs) coated with functionalized aptamers can be utilized as biosensors by monitoring changes in particle optical properties, such as the LSPR shift and enhancement of the SERS spectra, in the presence of a target protein. Herein we test this method using two modified aptamers selected for the protein biomarker interleukin 6, an indicator of the dengue fever virus and other diseases including certain types of cancers, diabetes, and even arthritis. IL6 works by inducing an immunological response within the body that can be either anti-inflammatory or pro-inflammatory. The results show that the average hydrodynamic diameter of the NPs as measured by Dynamic Light Scattering was ~42 nm. After conjugation of the aptamers, the peak absorbance of the AgNPs shifted from 404 to 408 nm indicating a surface modification of the NPs due to the presence of the aptamer. Lastly, preliminary results were obtained showing an increase in SERS intensity occurs when the IL-6 protein was introduced to the conjugate solution but the assay will still need to be optimized in order for it to be able to monitor varying concentration changes within and across the desired range.

  6. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules

    PubMed Central

    Ahirwar, Rajesh; Nahar, Smita; Aggarwal, Shikha; Ramachandran, Srinivasan; Maiti, Souvik; Nahar, Pradip

    2016-01-01

    Aptamers, the chemical-antibody substitute to conventional antibodies, are primarily discovered through SELEX technology involving multi-round selections and enrichment. Circumventing conventional methodology, here we report an in silico selection of aptamers to estrogen receptor alpha (ERα) using RNA analogs of human estrogen response elements (EREs). The inverted repeat nature of ERE and the ability to form stable hairpins were used as criteria to obtain aptamer-alike sequences. Near-native RNA analogs of selected single stranded EREs were modelled and their likelihood to emerge as ERα aptamer was examined using AutoDock Vina, HADDOCK and PatchDock docking. These in silico predictions were validated by measuring the thermodynamic parameters of ERα -RNA interactions using isothermal titration calorimetry. Based on the in silico and in vitro results, we selected a candidate RNA (ERaptR4; 5′-GGGGUCAAGGUGACCCC-3′) having a binding constant (Ka) of 1.02 ± 0.1 × 108 M−1 as an ERα-aptamer. Target-specificity of the selected ERaptR4 aptamer was confirmed through cytochemistry and solid-phase immunoassays. Furthermore, stability analyses identified ERaptR4 resistant to serum and RNase A degradation in presence of ERα. Taken together, an efficient ERα-RNA aptamer is identified using a non-SELEX procedure of aptamer selection. The high-affinity and specificity can be utilized in detection of ERα in breast cancer and related diseases. PMID:26899418

  7. Anti-Transcription Factor RNA Aptamers as Potential Therapeutics

    PubMed Central

    Mondragón, Estefanía

    2016-01-01

    Transcription factors (TFs) are DNA-binding proteins that play critical roles in regulating gene expression. These proteins control all major cellular processes, including growth, development, and homeostasis. Because of their pivotal role, cells depend on proper TF function. It is, therefore, not surprising that TF deregulation is linked to disease. The therapeutic drug targeting of TFs has been proposed as a frontier in medicine. RNA aptamers make interesting candidates for TF modulation because of their unique characteristics. The products of in vitro selection, aptamers are short nucleic acids (DNA or RNA) that bind their targets with high affinity and specificity. Aptamers can be expressed on demand from transgenes and are intrinsically amenable to recognition by nucleic acid-binding proteins such as TFs. In this study, we review several natural prokaryotic and eukaryotic examples of RNAs that modulate the activity of TFs. These examples include 5S RNA, 6S RNA, 7SK, hepatitis delta virus-RNA (HDV-RNA), neuron restrictive silencer element (NRSE)-RNA, growth arrest-specific 5 (Gas5), steroid receptor RNA activator (SRA), trophoblast STAT utron (TSU), the 3′ untranslated region of caudal mRNA, and heat shock RNA-1 (HSR1). We then review examples of unnatural RNA aptamers selected to inhibit TFs nuclear factor-kappaB (NF-κB), TATA-binding protein (TBP), heat shock factor 1 (HSF1), and runt-related transcription factor 1 (RUNX1). The field of RNA aptamers for DNA-binding proteins continues to show promise. PMID:26509637

  8. Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery

    PubMed Central

    Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N.; Carter, Jeff; Dalby, Andrew B.; Eaton, Bruce E.; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R.; Kim, Nancy; Koch, Tad H.; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K.; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M.; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I.; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D.; Vrkljan, Mike; Walker, Jeffrey J.; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K.; Wolfson, Alexey; Wolk, Steven K.; Zhang, Chi; Zichi, Dom

    2010-01-01

    Background The interrogation of proteomes (“proteomics”) in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. Methodology/Principal Findings We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (∼100 fM–1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. Conclusions/Significance We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of

  9. Fabrication and characterization of RNA aptamer microarrays for the study of protein–aptamer interactions with SPR imaging

    PubMed Central

    Li, Yuan; Lee, Hye Jin; Corn, Robert M.

    2006-01-01

    RNA microarrays were created on chemically modified gold surfaces using a novel surface ligation methodology and employed in a series of surface plasmon resonance imaging (SPRI) measurements of DNA–RNA hybridization and RNA aptamer–protein binding. Various unmodified single-stranded RNA (ssRNA) oligonucleotides were ligated onto identical 5′-phosphate-terminated ssDNA microarray elements with a T4 RNA ligase surface reaction. A combination of ex situ polarization modulation FTIR measurements of the RNA monolayer and in situ SPRI measurements of DNA hybridization adsorption onto the surface were used to determine an ssRNA surface density of 4.0 × 1012 molecules/cm2 and a surface ligation efficiency of 85 ± 10%. The surface ligation methodology was then used to create a five-component RNA microarray of potential aptamers for the protein factor IXa (fIXa). The relative surface coverages of the different aptamers were determined through a novel enzymatic method that employed SPRI measurements of a surface RNase H hydrolysis reaction. SPRI measurements were then used to correctly identify the best aptamer to fIXa, which was previously determined from SELEX measurements. A Langmuir adsorption coefficient of 1.6 × 107 M−1 was determined for fIXa adsorption to this aptamer. Single-base variations from this sequence were shown to completely destroy the aptamer–fIXa binding interaction. PMID:17130155

  10. SELEX Modifications and Bioanalytical Techniques for Aptamer-Target Binding Characterization.

    PubMed

    Tan, Sze Y; Acquah, Caleb; Sidhu, Amandeep; Ongkudon, Clarence M; Yon, L S; Danquah, Michael K

    2016-11-01

    The quest to improve the detection of biomolecules and cells in health and life sciences has led to the discovery and characterization of various affinity bioprobes. Libraries of synthetic oligonucleotides (ssDNA/ssRNA) with randomized sequences are employed during Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to select highly specific affinity probes called aptamers. With much focus on the generation of aptamers for a variety of target molecules, conventional SELEX protocols have been modified to develop new and improved SELEX protocols yielding highly specific and stable aptamers. Various techniques have been used to analyze the binding interactions between aptamers and their cognate molecules with associated merits and limitations. This article comprehensively reviews research advancements in the generation of aptamers, analyses physicochemical conditions affecting their binding characteristics to cellular and biomolecular targets, and discusses various field applications of aptameric binding. Biophysical techniques employed in the characterization of the molecular and binding features of aptamers to their cognate targets are also discussed.

  11. In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies

    PubMed Central

    Filonov, Grigory S.; Kam, Christina W.; Song, Wenjiao; Jaffrey, Samie R.

    2015-01-01

    SUMMARY RNA aptamers can be expressed in cells to influence and image cellular processes. Aptamer folding is maintained by inserting the aptamers into highly structured RNA scaffolds. Here we show that commonly used RNA scaffolds exhibit unexpected instability and cleavage in bacterial and mammalian cells. Using an in-gel staining approach for rapid and simple detection of Spinach- or Broccoli-tagged RNAs in cells, we monitored the processing of RNAs tagged with scaffolded aptamers, revealing endonucleolytic cleavage, RNA instability and poor expression. We reengineered a natural three-way junction structure to generate an alternative scaffold that enables stable aptamer expression in cells. This scaffold was used to create cassettes containing up to four Broccoli units, markedly enhancing the brightness of mammalian cells expressing cassette-tagged RNAs. These experiments describe methods for screening RNA cleavage events in cells, and identify cell-compatible scaffolds that enable efficient tagging of RNAs with aptamers for cellular expression. PMID:26000751

  12. Combinatorial Library of Improved Peptide Aptamers, CLIPs to Inhibit RAGE Signal Transduction in Mammalian Cells

    PubMed Central

    Reverdatto, Sergey; Rai, Vivek; Xue, Jing; Burz, David S.; Schmidt, Ann Marie; Shekhtman, Alexander

    2013-01-01

    Peptide aptamers are small proteins containing a randomized peptide sequence embedded into a stable protein scaffold, such as Thioredoxin. We developed a robust method for building a Combinatorial Library of Improved Peptide aptamers (CLIPs) of high complexity, containing ≥3×1010 independent clones, to be used as a molecular tool in the study of biological pathways. The Thioredoxin scaffold was modified to increase solubility and eliminate aggregation of the peptide aptamers. The CLIPs was used in a yeast two-hybrid screen to identify peptide aptamers that bind to various domains of the Receptor for Advanced Glycation End products (RAGE). NMR spectroscopy was used to identify interaction surfaces between the peptide aptamers and RAGE domains. Cellular functional assays revealed that in addition to directly interfering with known binding sites, peptide aptamer binding distal to ligand sites also inhibits RAGE ligand-induced signal transduction. This finding underscores the potential of using CLIPs to select allosteric inhibitors of biological targets. PMID:23785412

  13. Chimeric nucleolin aptamer with survivin DNAzyme for cancer cell targeted delivery.

    PubMed

    Subramanian, Nithya; Kanwar, Jagat R; Akilandeswari, Balachandran; Kanwar, Rupinder K; Khetan, Vikas; Krishnakumar, Subramanian

    2015-04-25

    A chimeric aptamer-DNAzyme conjugate was generated for the first time using a nucleolin aptamer (NCL-APT) and survivin Dz (Sur_Dz) and exhibited the targeted killing of cancer cells. This proof of concept of using an aptamer for the delivery of DNAzyme can be applied to other cancer types to target survivin in cancer cells in a specific manner. PMID:25797393

  14. Aptamer-gelatin composite for a trigger release system mediated by oligonucleotide hybridization.

    PubMed

    Soontornworajit, Boonchoy; Srakaew, Prangkamol; Naramitpanich, Pajaree

    2014-01-01

    Nucleic acid aptamers not only specifically bind to their target proteins with high affinity but also form intermolecular hybridization with their complementary oligonucleotides (CO). The hybridization can interrupt aptamer/protein interaction due to the changes of aptamer secondary structure which rely on hybridization length and base-pairing positions. Herein we aim to use this unique property of the aptamers, when combined with gelatin to develop a novel composite with desirable protein release profiles. Platelet-derived growth factor-BB (PDGF-BB) and its aptamer were used as target molecules. Prior to performing the release study, the effects of CO on aptamer-protein interaction were observed by surface plasmon resonance (SPR). The SPR sensorgram indicated that the aptamer dissociated from the bounded proteins when it hybridized with the CO. The aptamer was then immobilized onto streptavidin coated polystyrene particles via biotin/streptavidin interaction. Then, PDGF-BB and aptamer functionalized particles were mixed with gelatin solution and cast as small pieces of composite. The success of the composite preparation was confirmed by flow cytometry and microscopy. PDGF-BB release at several time points was quantified by ELISA. The results showed that the aptamer-gelatin composite could slow the release rate of the proteins from the composite due to strong binding of proteins and aptamers. Once the CO was added to the system, the release rate was significantly enhanced because the aptamer hybridized with the CO and lost its active secondary structure. Therefore, the proteins were triggered to release out from the composite. This work suggests a promising strategy for controlling the release of bioactive molecules in medical treatments.

  15. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

    PubMed Central

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5’-end including the 5’-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer. PMID:26221730

  16. Functional-group specific aptamers indirectly recognizing compounds with alkyl amino group.

    PubMed

    Mei, Hongcheng; Bing, Tao; Yang, Xiaojuan; Qi, Cui; Chang, Tianjun; Liu, Xiangjun; Cao, Zehui; Shangguan, Dihua

    2012-09-01

    Aptamers are usually generated against a specific molecule. Their high selectivity makes them only suitable for studying specific targets. Since it is nearly impossible to generate aptamers for every molecule, it can be of great interest to select aptamers recognizing a common feature of a group of molecules in many applications. In this paper, we describe the selection of aptamers for indirect recognition of alkyl amino groups. Because amino groups are small and positive charged, we introduced a protection group, p-nitrobenzene sulfonyl (p-nosyl) to convert them into a form suitable for aptamer selection. Taking N(ε)-p-nosyl-L-lysine (PSL) as a target, we obtained a group of aptamers using the SELEX technique. Two optimized aptamers, M6b-M14 and M13a exhibit strong affinity to PSL with the K(d) values in the range of 2-5 μM. They also show strong affinity to other compounds containing p-nosyl-protected amino groups except those also possessing an α-carboxyl group. Both aptamers adopt an antiparallel G-quadruplex structure when binding to targets. An aptamer beacon based on M6b-M14 showed good selectivity toward the reaction mixture of p-nosyl-Cl and alkyl amino compounds, and could recognize lysine from amino acid mixtures indirectly, suggesting that aptamers against a common moiety of a certain type of molecules can potentially lead to many new applications. Through this study, we have demonstrated the ability to select aptamers for a specific part of an organic compound, and the chemical conversion approach may prove to be valuable for aptamer selection against molecules that are generally difficult for SELEX.

  17. Improvement of Electrochemical Response of Cocaine Sensors Based on DNA Aptamer by Heat Treatment.

    PubMed

    Arimoto, Satoshi; Shimono, Ken; Yasukawa, Tomoyuki; Mizutani, Fumio; Yoshioka, Toshihiko

    2016-01-01

    We report on a biosensor for cocaine based on the conformation change of DNA aptamer by capturing the cocaine molecules. The oxidation current of ferrocene conjugated on the terminal end of aptamer immobilized on an Au electrode increased with increasing cocaine concentration. The sensor response has been improved by a simple heat treatment after immobilization, since the aggregates of DNA aptamer generated during the immobilization step could be dissociated and rearranged on the electrode. PMID:27063722

  18. Aptamer-Functionalized Fluorescent Silica Nanoparticles for Highly Sensitive Detection of Leukemia Cells

    NASA Astrophysics Data System (ADS)

    Tan, Juntao; Yang, Nuo; Hu, Zixi; Su, Jing; Zhong, Jianhong; Yang, Yang; Yu, Yating; Zhu, Jianmeng; Xue, Dabin; Huang, Yingying; Lai, Zongqiang; Huang, Yong; Lu, Xiaoling; Zhao, Yongxiang

    2016-06-01

    A simple, highly sensitive method to detect leukemia cells has been developed based on aptamer-modified fluorescent silica nanoparticles (FSNPs). In this strategy, the amine-labeled Sgc8 aptamer was conjugated to carboxyl-modified FSNPs via amide coupling between amino and carboxyl groups. Sensitivity and specificity of Sgc8-FSNPs were assessed using flow cytometry and fluorescence microscopy. These results showed that Sgc8-FSNPs detected leukemia cells with high sensitivity and specificity. Aptamer-modified FSNPs hold promise for sensitive and specific detection of leukemia cells. Changing the aptamer may allow the FSNPs to detect other types of cancer cells.

  19. Evaluation of aptamers as molecular recognition elements for pathogens using capillary electrophoretic analysis

    NASA Astrophysics Data System (ADS)

    McMasters, Sun; Stratis-Cullum, Dimitra N.

    2006-10-01

    The biomolecular interactions between a fluorescently labeled aptamer and whole cell Campylobacter jejuni(C. jejuni) have been characterized using capillary electrophoresis with laser-induced fluorescence detection. From electrophoretic analysis, the bound complex forms, unbound aptamer, and cells were visualized. The relative binding affinity of the DNA aptamer with C. jejuni was compared with other food-borne pathogens including Escherichia coli O157:H7 and Salmonella typhimurium. Preliminary data suggests that this aptamer exhibits strong binding affinity towards C. jejuni with minimal cross reactivity over other food pathogens when equivalent cell concentrations were used.

  20. DNA Aptamer Raised Against AGEs Blocks the Progression of Experimental Diabetic Nephropathy

    PubMed Central

    Kaida, Yusuke; Fukami, Kei; Matsui, Takanori; Higashimoto, Yuichiro; Nishino, Yuri; Obara, Nana; Nakayama, Yosuke; Ando, Ryotaro; Toyonaga, Maki; Ueda, Seiji; Takeuchi, Masayoshi; Inoue, Hiroyoshi; Okuda, Seiya; Yamagishi, Sho-ichi

    2013-01-01

    Advanced glycation end products (AGEs) and their receptor (RAGE) play a role in diabetic nephropathy. We screened DNA aptamer directed against AGEs (AGEs-aptamer) in vitro and examined its effects on renal injury in KKAy/Ta mice, an animal model of type 2 diabetes. Eight-week-old male KKAy/Ta or C57BL/6J mice received continuous intraperitoneal infusion of AGEs- or control-aptamer for 8 weeks. AGEs-aptamer was detected and its level was increased in the kidney for at least 7 days. The elimination half-lives of AGEs-aptamer in the kidney were about 7 days. Compared with those in C57BL/6J mice, glomerular AGEs levels were significantly increased in KKAy/Ta mice, which were blocked by AGEs-aptamer. Urinary albumin and 8-hydroxy-2′-deoxy-guanosine levels were increased, and glomerular hypertrophy and enhanced extracellular matrix accumulation were observed in KKAy/Ta mice, all of which were prevented by AGEs-aptamer. Moreover, AGEs-aptamer significantly reduced gene expression of RAGE, monocyte chemoattractant protein-1, connective tissue growth factor, and type IV collagen both in the kidney of KKAy/Ta mice and in AGE-exposed human cultured mesangial cells. Our present data suggest that continuous administration of AGEs-aptamer could protect against experimental diabetic nephropathy by blocking the AGEs-RAGE axis and may be a feasible and promising therapeutic strategy for the treatment of diabetic nephropathy. PMID:23630304

  1. Development of structure switching aptamer assay for detection of aflatoxin M1 in milk sample.

    PubMed

    Sharma, Atul; Catanante, Gaëlle; Hayat, Akhtar; Istamboulie, Georges; Ben Rejeb, Ines; Bhand, Sunil; Marty, Jean Louis

    2016-09-01

    The discovery of in-vitro systematic evolution of ligands by exponential enrichment (SELEX) process has considerably broaden the utility of aptamer as bio-recognition element, providing the high binding affinity and specificity against the target analytes. Recent research has focused on the development of structure switching signaling aptamer assay, transducing the aptamer- target recognition event into an easily detectable signal. In this paper, we demonstrate the development of structure switching aptamer assay for determination of aflatoxin M1 (AFM1) employing the quenching-dequenching mechanism. Hybridization of fluorescein labelled anti-AFM1 aptamer (F-aptamer) with TAMRA labelled complementary sequences (Q-aptamer) brings the fluorophore and the quencher into close proximity, which results in maximum fluorescence quenching. On addition of AFM1, the target induced conformational formation of antiparallel G-quadruplex aptamer-AFM1 complex results in fluorescence recovery. Under optimized experimental conditions, the developed method showed the good linearity with limit of detection (LOD) at 5.0ngkg(-1) for AFM1. The specificity of the sensing platform was carefully investigated against aflatoxin B1 (AFB1) and ochratoxin A (OTA). The developed assay platform showed the high specificity towards AFM1. The practical application of the developed aptamer assay was verified for detection of AFM1 in spiked milk samples. Good recoveries were obtained in the range from 94.40% to 95.28% (n=3) from AFM1 spiked milk sample. PMID:27343575

  2. Robust aptamer sol-gel solid phase microextraction of very polar adenosine from human plasma.

    PubMed

    Mu, Li; Hu, Xiangang; Wen, Jianping; Zhou, Qixing

    2013-03-01

    Conventional solid phase microextraction (SPME) has a limited capacity to extract very polar analytes, such as adenosine. To solve this problem, aptamer conjugating sol-gel methodology was coupled with an SPME fiber. According to the authors' knowledge, this is the first reported use of aptamer SPME. The fiber of aptamer sol-gel SPME with a mesoporous structure has high porosity, large surface area, and small water contact angle. Rather than employing direct entrapment, covalent immobilization was the dominant method of aptamer loading in sol-gel. Aptamer sol-gel fiber captured a specified analyte from among the analog molecules, thereby, exhibiting an excellent selective property. Compared with commercial SPME fibers, this aptamer fiber was suitable for extracting adenosine, presenting an extraction efficiency higher than 20-fold. The values of repeatability and reproducibility expressed by relative standard deviation were low (9.4%). Interestingly, the sol-gel network enhanced the resistance of aptamer SPME to both nuclease and nonspecific proteins. Furthermore, the aptamer sol-gel fiber was applied in human plasma with LOQ 1.5 μg/L, which is an acceptable level. This fiber also demonstrates durability and regeneration over 20-cycles without significant loss of efficiency. Given the various targets (from metal ions to biomacromolecules and cells) of aptamers, this methodology will extend the multi-domain applications of SPME.

  3. Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.

    PubMed

    Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C

    2016-07-01

    Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed. PMID:27318356

  4. Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data

    PubMed Central

    Thiel, William H

    2016-01-01

    Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment). High-throughput sequencing (HTS) revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs.

  5. Aptamer-Functionalized Fluorescent Silica Nanoparticles for Highly Sensitive Detection of Leukemia Cells.

    PubMed

    Tan, Juntao; Yang, Nuo; Hu, Zixi; Su, Jing; Zhong, Jianhong; Yang, Yang; Yu, Yating; Zhu, Jianmeng; Xue, Dabin; Huang, Yingying; Lai, Zongqiang; Huang, Yong; Lu, Xiaoling; Zhao, Yongxiang

    2016-12-01

    A simple, highly sensitive method to detect leukemia cells has been developed based on aptamer-modified fluorescent silica nanoparticles (FSNPs). In this strategy, the amine-labeled Sgc8 aptamer was conjugated to carboxyl-modified FSNPs via amide coupling between amino and carboxyl groups. Sensitivity and specificity of Sgc8-FSNPs were assessed using flow cytometry and fluorescence microscopy. These results showed that Sgc8-FSNPs detected leukemia cells with high sensitivity and specificity. Aptamer-modified FSNPs hold promise for sensitive and specific detection of leukemia cells. Changing the aptamer may allow the FSNPs to detect other types of cancer cells. PMID:27299653

  6. Aptamers-in-liposomes for selective and multiplexed capture of small organic compounds.

    PubMed

    Kim, Yeon Seok; Niazi, Javed H; Chae, Yun Ju; Ko, U-Ri; Gu, Man Bock

    2011-08-01

    Small, organic, toxic compounds are not well eliminated by water-treatment systems and eventually become concentrated in the human body. In this study, liposomes are employed to house aptamers with their own binding buffer. When small, organic, toxic compounds in water pass through a liposome barrier, only the target molecules are captured by the DNA aptamers inside the liposomes. The capture efficiency is not high when DNA aptamers are used in tap water. When DNA aptamers in liposomes are used, the capture efficiency increases more than 80%. The simultaneous and selective elimination of target toxicants is successfully performed for tap-water samples containing toxicant mixtures. PMID:21748816

  7. High-throughput bead-based identification of structure-switching aptamer beacons.

    PubMed

    Trevino, Simon G; Levy, Matthew

    2014-09-01

    We describe a new platform to identify structure-switching DNA beacon aptamers, which detect small molecules in a specific manner. By clonally amplifying a DNA library designed to fluoresce in response to binding events onto microbeads, aptamer beacons can be selected by stringent fluorescence-assisted sorting. We validated this method by isolating known and novel anti-steroid aptamers from two separate DNA libraries that were structurally enriched with three-way junctions. Importantly, aptamers were retrieved in only a few (three) rounds of selection by this approach and did not require further optimization, significantly streamlining the process of beacon development.

  8. Aptamer beacons for visualization of endogenous protein HIV-1 reverse transcriptase in living cells.

    PubMed

    Liang, Yu; Zhang, Zhiping; Wei, Hongping; Hu, Qinxue; Deng, Jiaoyu; Guo, Deyin; Cui, Zongqiang; Zhang, Xian-En

    2011-10-15

    Direct visualization of endogenous proteins in living cells remains a challenge. Aptamer beacon is a promising technique to resolve this problem by combining the excellent protein binding specificity of the aptamer with the sensitive signal transduction mechanism of the molecular beacon. In this study, aptamer 93 del against HIV-1 reverse transcriptase (RT) was engineered into aptamer beacons to recognize and image HIV-1 RT. The constructed aptamer beacons could specifically bind to HIV-1 RT and the beacon-RT binding showed effective fluorescence signal transduction in homogeneous solution. In solutions with 1 μM of the aptamer beacon, the effective fluorescence signal increased with increasing concentration of HIV-1 RT from 0.5 μM to 5 μM. When the aptamer beacons were delivered into the living cells that transiently expressed HIV-1 RT, HIV-1 RT could be specifically labeled and imaged. The designed aptamer beacons were further successfully applied for RT imaging in HIV-1 integrated U1 cells. The method developed here may be extended to visualize many other endogenous proteins in living cells using appropriate aptamer beacons.

  9. Rationally manipulating aptamer binding affinities in a stem-loop molecular beacon.

    PubMed

    Armstrong, Rachel E; Strouse, Geoffrey F

    2014-10-15

    Single-stranded DNA sequences that are highly specific for a target ligand are called aptamers. While the incorporation of aptamer sequences into stem-loop molecular beacons has become an essential tool in optical biosensors, the design principles that determine the magnitude of binding affinity and its relationship to placement of the aptamer sequence in the stem-loop architecture are not well defined. By controlled placement of the aptamer along the loop region of the molecular beacon, it is observed that the binding affinity can be tuned over 4 orders of magnitude (1.3 nM - 203 μM) for the Huizenga and Szostak ATP DNA aptamer sequence. It is observed that the Kd is enhanced for the fully exposed sequence, with reduced binding affinity when the aptamer is part of the stem region of the beacon. Analysis of the ΔG values indicate a clear correlation between the aptamer hybridized length in the stem and its observed Kd. The use of a nanometal surface energy transfer probe method for monitoring ATP binding to the aptamer sequence allows the observation of negative cooperativity between the two ATP binding events. Maintenance of the high binding affinity of this ATP aptamer and the observation of two separate Kd's for ATP binding indicate NSET as an effective, nonmanipulative, optical method for tracking biomolecular changes.

  10. Electrical and Electron-Phonon Interactions in Graphene-Based Nanostructures and Aptamer-Based Electrical Sensors

    NASA Astrophysics Data System (ADS)

    Qian, Jun

    This research work contains two main parts: the theoretical study of confined phonon modes and electron states in confined graphene nanostructures; the experimental part including two topics about fabricating a graphene-FET aptamer-sensor for cocaine detection and the study of the electronic transport properties of dsDNA. In the theory part, we study the confined optical phonon modes in graphene nanoribbons (GNR) and rectangular graphene quantum dots (RGQD) by the elastic continuum model. The carrier states are studied by effective mass approximation. The phonon bottleneck effect is expected in general for RGQDs. The scattering rates are calculated for specific RGQDs with carefully chosen dimensions to fulfill the momentum and energy conservation conditions. In the experimental part, we have developed a combined technique of semiconductor processes and molecular biological protocols to fabricate a signal-off graphene-FET aptamer-sensor for cocaine. In addition, DNA transport properties were studied by STM on GNP-dsDNA-Au conjugates in atmospheric condition. The dsDNA-complexes exhibit as a slightly n-type semiconductor by simulated with a Landauer-type model. A geometrical model is proposed to explain the distinct I-V spectra.

  11. High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity

    PubMed Central

    Russo Krauss, Irene; Merlino, Antonello; Randazzo, Antonio; Novellino, Ettore; Mazzarella, Lelio; Sica, Filomena

    2012-01-01

    The G-quadruplex architecture is a peculiar structure adopted by guanine-rich oligonucleotidic sequences, and, in particular, by several aptamers, including the thrombin-binding aptamer (TBA) that has the highest inhibitory activity against human α-thrombin. A crucial role in determining structure, stability and biological properties of G-quadruplexes is played by ions. In the case of TBA, K+ ions cause an enhancement of the aptamer clotting inhibitory activity. A detailed picture of the interactions of TBA with the protein and with the ions is still lacking, despite the importance of this aptamer in biomedical field for detection and inhibition of α-thrombin. Here, we fill this gap by presenting a high-resolution crystallographic structural characterization of the thrombin–TBA complex formed in the presence of Na+ or K+ and a circular dichroism study of the structural stability of the aptamer both free and complexed with α-thrombin, in the presence of the two ionic species. The results indicate that the different effects exerted by Na+ and K+ on the inhibitory activity of TBA are related to a subtle perturbation of a few key interactions at the protein–aptamer interface. The present data, in combination with those previously obtained on the complex between α-thrombin and a modified aptamer, may allow the design of new TBA variants with a pharmacological performance enhancement. PMID:22669903

  12. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    SciTech Connect

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M.; Kraus, George A.; Nilsen-Hamilton, Marit

    2015-12-17

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. As a result, high background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.

  13. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells

    DOE PAGES

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M.; Kraus, George A.; Nilsen-Hamilton, Marit

    2015-12-17

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of “light-up” aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated twomore » light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. As a result, high background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.« less

  14. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells.

    PubMed

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M; Kraus, George A; Nilsen-Hamilton, Marit

    2016-04-01

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of "light-up" aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. High background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription.

  15. Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters.

    PubMed

    Akki, Spurti U; Werth, Charles J; Silverman, Scott K

    2015-08-18

    We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.

  16. Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters.

    PubMed

    Akki, Spurti U; Werth, Charles J; Silverman, Scott K

    2015-08-18

    We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters. PMID:26182235

  17. Light-up and FRET aptamer reporters; evaluating their applications for imaging transcription in eukaryotic cells.

    PubMed

    Ilgu, Muslum; Ray, Judhajeet; Bendickson, Lee; Wang, Tianjiao; Geraskin, Ivan M; Kraus, George A; Nilsen-Hamilton, Marit

    2016-04-01

    The regulation of RNA transcription is central to cellular function. Changes in gene expression drive differentiation and cellular responses to events such as injury. RNA trafficking can also have a large impact on protein expression and its localization. Thus, the ability to image RNA transcription and trafficking in real time and in living cells is a worthwhile goal that has been difficult to achieve. The availability of "light-up" aptamers that cause an increase in fluorescence of their ligands when bound by the aptamer have shown promise for reporting on RNA production and localization in vivo. Here we have investigated two light-up aptamers (the malachite green aptamer and the Spinach aptamers) for their suitabilities as reporters of RNA expression in vivo using two eukaryotic cell types, yeast and mammalian. Our analysis focused on the aptamer ligands, their contributions to background noise, and the impact of tandem aptamer strings on signal strength and ligand affinity. Whereas the background fluorescence is very low in vitro, this is not always true for cell imaging. Our results suggest the need for caution in using light-up aptamers as reporters for imaging RNA. In particular, images should be collected and analyzed by operators blinded to the sample identities. The appropriate control condition of ligand with the cells in the absence of aptamer expression must be included in each experiment. This control condition establishes that the specific interaction of ligand with aptamer, rather than nonspecific interactions with unknown cell elements, is responsible for the observed fluorescent signals. High background signals due to nonspecific interactions of aptamer ligands with cell components can be minimized by using IMAGEtags (Intracellular Multiaptamer GEnetic tags), which signal by FRET and are promising RNA reporters for imaging transcription. PMID:26707205

  18. Rupture of DNA aptamer: New insights from simulations

    SciTech Connect

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single molecule experiments.

  19. Using atomic force microscopy and surface plasmon resonance to detect specific interactions between ricin and anti-ricin aptamers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nucleic acid aptamers have been widely used as binding reagents for the label free detections of biomolecules. Compare to antibodies, aptamers have demonstrated advantages such as easy synthesis, low cost, and better stability. Therefore, aptamers can be integrated into various detection platforms ...

  20. Study of the binding mechanism between aptamer GO18-T-d and gonyautoxin 1/4 by molecular simulation.

    PubMed

    Gao, Shunxiang; Hu, Bo; Zheng, Xin; Liu, Dejing; Sun, Mingjuan; Qin, Jiaxiang; Zhou, Hao; Jiao, Binghua; Wang, Lianghua

    2016-08-24

    GTX1/4 can induce the formation of an antiparallel G-quadruplex structure in aptamer GO18-T-d and combine steadily in the groove at the top of the G-quadruplex structure. The complex structures and special induced fit mechanism between aptamer and small molecules provide a reference for aptamer development in molecular diagnostics and therapeutic application. PMID:27118106

  1. Spinach RNA aptamer detects lead (II) with high selectivity†

    PubMed Central

    DasGupta, Saurja; Shelke, Sandip A.; Li, Nan-sheng

    2015-01-01

    Spinach RNA aptamer contains a G-quadruplex motif that serves as a platform for binding and fluorescence activation of a GFP-like fluorophore. Here we show that Pb2+ induces formation of Spinach’s G-quadruplex and activates fluorescence with high selectivity and sensitivity. This device establishes the first example of an RNA-based sensor that provides a simple and inexpensive tool for Pb2+ detection. PMID:25940073

  2. Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo

    PubMed Central

    Farokhzad, Omid C.; Cheng, Jianjun; Teply, Benjamin A.; Sherifi, Ines; Jon, Sangyong; Kantoff, Philip W.; Richie, Jerome P.; Langer, Robert

    2006-01-01

    Targeted uptake of therapeutic nanoparticles in a cell-, tissue-, or disease-specific manner represents a potentially powerful technology. Using prostate cancer as a model, we report docetaxel (Dtxl)-encapsulated nanoparticles formulated with biocompatible and biodegradable poly(d,l-lactic-co-glycolic acid)-block-poly(ethylene glycol) (PLGA-b-PEG) copolymer and surface functionalized with the A10 2′-fluoropyrimidine RNA aptamers that recognize the extracellular domain of the prostate-specific membrane antigen (PSMA), a well characterized antigen expressed on the surface of prostate cancer cells. These Dtxl-encapsulated nanoparticle-aptamer bioconjugates (Dtxl-NP-Apt) bind to the PSMA protein expressed on the surface of LNCaP prostate epithelial cells and get taken up by these cells resulting in significantly enhanced in vitro cellular toxicity as compared with nontargeted nanoparticles that lack the PSMA aptamer (Dtxl-NP) (P < 0.0004). The Dtxl-NP-Apt bioconjugates also exhibit remarkable efficacy and reduced toxicity as measured by mean body weight loss (BWL) in vivo [body weight loss of 7.7 ± 4% vs. 18 ± 5% for Dtxl-NP-Apt vs. Dtxl-NP at nadir, respectively (mean ± SD); n = 7]. After a single intratumoral injection of Dtxl-NP-Apt bioconjugates, complete tumor reduction was observed in five of seven LNCaP xenograft nude mice (initial tumor volume of ≈300 mm3), and 100% of these animals survived our 109-day study. In contrast, two of seven mice in the Dtxl-NP group had complete tumor reduction with 109-day survivability of only 57%. Dtxl alone had a survivability of only 14%. Saline and nanoparticles without drug were similarly nonefficacious. This report demonstrates the potential utility of nanoparticle-aptamer bioconjugates for a therapeutic application. PMID:16606824

  3. Nucleotide Bias Observed with a Short SELEX RNA Aptamer Library

    PubMed Central

    Thiel, William H.; Bair, Thomas; Thiel, Kristina Wyatt; Dassie, Justin P.; Rockey, William M.; Howell, Craig A.; Liu, Xiuying Y.; Dupuy, Adam J.; Huang, Lingyan; Owczarzy, Richard; Behlke, Mark A.; McNamara, James O.

    2011-01-01

    Systematic evolution of ligands by exponential enrichment (SELEX) is a powerful in vitro selection process used for over 2 decades to identify oligonucleotide sequences (aptamers) with desired properties (usually high affinity for a protein target) from randomized nucleic acid libraries. In the case of RNA aptamers, several highly complex RNA libraries have been described with RNA sequences ranging from 71 to 81 nucleotides (nt) in length. In this study, we used high-throughput sequencing combined with bioinformatics analysis to thoroughly examine the nucleotide composition of the sequence pools derived from several selections that employed an RNA library (Sel2N20) with an abbreviated variable region. The Sel2N20 yields RNAs 51 nt in length, which unlike longer RNAs, are more amenable to large-scale chemical synthesis for therapeutic development. Our analysis revealed a consistent and early bias against inclusion of adenine, resulting in aptamers with lower predicted minimum free energies (ΔG) (higher structural stability). This bias was also observed in control, “nontargeted” selections in which the partition step (against the target) was omitted, suggesting that the bias occurred in 1 or more of the amplification and propagation steps of the SELEX process. PMID:21793789

  4. Electrochemical immunosensor with aptamer-based enzymatic amplification.

    PubMed

    Feng, Kejun; Kang, Yan; Zhao, Jing-Jin; Liu, Ya-Li; Jiang, Jian-Hui; Shen, Guo-Li; Yu, Ru-Qin

    2008-07-01

    An electrochemical immunosensor is reported by using aptamer-based enzymatic amplification with immunoglobulin E (IgE) as the model analyte. In this method, the IgE antibody is covalently immobilized as the capture probe on the gold electrode via a self-assembled monolayer of cysteamine. After the target is captured, the biotinylated anti-IgE aptamer is used as the detection probe. The specific interaction of streptavidin-conjugated alkaline phosphatase to the surface-bound biotinylated detection probe mediates a catalytic reaction of ascorbic acid 2-phosphate substrate to produce a reducing agent ascorbic acid. Then silver ions in the solution can be reduced, leading to the deposition of metallic silver on the electrode surface. The amount of deposited silver, which is determined by the amount of IgE target bound on the electrode surface, can be quantified using the stripping voltammetry. The results obtained demonstrated that the electrochemical immunosensor possesses high specificity and a wide dynamic range with a low detection limit that possibly arises from the combination of the highly specific aptamer and the highly sensitive stripping determination of enzymatically deposited silver.

  5. Organic additives stabilize RNA aptamer binding of malachite green.

    PubMed

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis.

  6. Bioactivity of 2′-deoxyinosine-incorporated aptamer AS1411

    PubMed Central

    Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

    2016-01-01

    Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2′-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2′-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2′-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2′-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2′-deoxyinosine moieties in interactive binding processes. PMID:27194215

  7. Bioactivity of 2'-deoxyinosine-incorporated aptamer AS1411.

    PubMed

    Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

    2016-05-19

    Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2'-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2'-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2'-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2'-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2'-deoxyinosine moieties in interactive binding processes.

  8. Organic additives stabilize RNA aptamer binding of malachite green.

    PubMed

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis. PMID:27591602

  9. Molecular aptamer beacons for real-time protein recognition.

    PubMed

    Li, Jianwei J; Fang, Xiaohong; Tan, Weihong

    2002-03-22

    One of the most pressing problems facing those attempting to understand the regulation of gene expression and translation is the necessity to monitor protein production in a variety of metabolic states. Thus far, there is no easy solution that will either identify or quantitate proteins in real time. Here we introduce a novel protein probe, molecular aptamer beacon (MAB), for real time protein recognition and quantitative analysis. The MAB combines the signal transduction mechanism of molecular beacons and the molecular recognition specificity of aptamers. An MAB based on a thrombin-binding aptamer was prepared as a model to demonstrate the feasibility. Significant fluorescent signal change was observed when MAB was bound to thrombin, which is attributed to a significant conformational change in MAB from a loose random coil to a compact unimolecular quadruplex. The MAB recognizes its target protein with high specificity and high sensitivity (112 picomolar thrombin concentration) in homogeneous solutions. Ratiometric imaging has been conducted with MAB labeled with two fluorophores, which makes it feasible for protein quantitation in living specimen. The unique properties of the MAB will enable the development of a class of protein probes for real time protein tracing in living specimen and for efficient biomedical diagnosis in homogeneous solutions.

  10. Conformationally selective RNA aptamers allosterically modulate the β2-adrenoceptor.

    PubMed

    Kahsai, Alem W; Wisler, James W; Lee, Jungmin; Ahn, Seungkirl; Cahill Iii, Thomas J; Dennison, S Moses; Staus, Dean P; Thomsen, Alex R B; Anasti, Kara M; Pani, Biswaranjan; Wingler, Laura M; Desai, Hemant; Bompiani, Kristin M; Strachan, Ryan T; Qin, Xiaoxia; Alam, S Munir; Sullenger, Bruce A; Lefkowitz, Robert J

    2016-09-01

    G-protein-coupled receptor (GPCR) ligands function by stabilizing multiple, functionally distinct receptor conformations. This property underlies the ability of 'biased agonists' to activate specific subsets of a given receptor's signaling profile. However, stabilizing distinct active GPCR conformations to enable structural characterization of mechanisms underlying GPCR activation remains difficult. These challenges have accentuated the need for receptor tools that allosterically stabilize and regulate receptor function through unique, previously unappreciated mechanisms. Here, using a highly diverse RNA library combined with advanced selection strategies involving state-of-the-art next-generation sequencing and bioinformatics analyses, we identify RNA aptamers that bind a prototypical GPCR, the β2-adrenoceptor (β2AR). Using biochemical, pharmacological, and biophysical approaches, we demonstrate that these aptamers bind with nanomolar affinity at defined surfaces of the receptor, allosterically stabilizing active, inactive, and ligand-specific receptor conformations. The discovery of RNA aptamers as allosteric GPCR modulators significantly expands the diversity of ligands available to study the structural and functional regulation of GPCRs. PMID:27398998

  11. Spatial recognition and mapping of proteins using DNA aptamers

    NASA Astrophysics Data System (ADS)

    Wang, Congzhou; Yadavalli, Vamsi K.

    2014-11-01

    Atomic force microscopy-based adhesion force measurements have emerged as a powerful tool for the biophysical analyses of biological systems. Such measurements can now be extended to detection and mapping of biomolecules on surfaces via integrated imaging and force spectroscopy techniques. Critical to these experiments is the choice of the biomolecular recognition probe. In this study, we demonstrate how oligonucleotide aptamers can be used as versatile probes to simultaneously image and spatially locate targets on surfaces. We focus on two structurally distinct proteins relevant to the clotting cascade—human α-thrombin and vascular endothelial growth factor. Via AFM-recognition mapping using specific DNA aptamers on a commercially available instrument, we show a clear consistency between height and force measurements obtained simultaneously. Importantly, we are able to observe changes in binding due to changes in the external microenvironment, which demonstrate the ability to study fluctuating biological systems in real time. The aptamer specificity and the ability to distinguish their targets are shown through positive and negative controls. It is therefore possible to generate high resolution maps to spatially and temporally identify proteins at the molecular level on complex surfaces.

  12. Polypeptide Functional Surface for the Aptamer Immobilization: Electrochemical Cocaine Biosensing.

    PubMed

    Bozokalfa, Guliz; Akbulut, Huseyin; Demir, Bilal; Guler, Emine; Gumus, Z Pınar; Odaci Demirkol, Dilek; Aldemir, Ebru; Yamada, Shuhei; Endo, Takeshi; Coskunol, Hakan; Timur, Suna; Yagci, Yusuf

    2016-04-01

    Electroanalytical technologies as a beneficial subject of modern analytical chemistry can play an important role for abused drug analysis which is crucial for both legal and social respects. This article reports a novel aptamer-based biosensing procedure for cocaine analysis by combining the advantages of aptamers as selective recognition elements with the well-known advantages of biosensor systems such as the possibility of miniaturization and automation, easy fabrication and modification, low cost, and sensitivity. In order to construct the aptasensor platform, first, polythiophene bearing polyalanine homopeptide side chains (PT-Pala) was electrochemically coated onto the surface of an electrode and then cocaine aptamer was attached to the polymer via covalent conjugation chemistry. The stepwise modification of the surface was confirmed by electrochemical characterization. The designed biosensing system was applied for the detection of cocaine and its metabolite, benzoylecgonine (BE), which exhibited a linear correlation in the range from 2.5 up to 10 nM and 0.5 up to 50 μM for cocaine and BE, respectively. In order to expand its practical application, the proposed method was successfully tested for the analysis of synthetic biological fluids. PMID:26928030

  13. DNA nanosensor based on biocompatible graphene quantum dots and carbon nanotubes.

    PubMed

    Qian, Zhao Sheng; Shan, Xiao Yue; Chai, Lu Jing; Ma, Juan Juan; Chen, Jian Rong; Feng, Hui

    2014-10-15

    An ultrasensitive nanosensor based on fluorescence resonance energy transfer (FRET) between biocompatible graphene quantum dots and carbon nanotubes for DNA detection was reported. We take advantage of good biocompatibility and strong fluorescence of graphene quantum dots, base pairing specificity of DNA and unique fluorescence resonance energy transfer between graphene quantum dots and carbon nanotubes to achieve the analysis of low concentrations of DNA. Graphene quantum dots with high quantum yield up to 0.20 were prepared and served as the fluorophore of DNA probe. FRET process between graphene quantum dots-labeled probe and oxidized carbon nanotubes is easily achieved due to their efficient self-assembly through specific π-π interaction. This nanosensor can distinguish complementary and mismatched nucleic acid sequences with high sensitivity and good reproducibility. The detection method based on this nanosensor possesses a broad linear span of up to 133.0 nM and ultralow detection limit of 0.4 nM. The constructed nanosensor is expected to be highly biocompatible because of all its components with excellent biocompatibility.

  14. Aptamer-functionalized porous phospholipid nanoshells for direct measurement of Hg(2+) in urine.

    PubMed

    Li, Zhen; Muhandiramlage, Thusitha P; Keogh, John P; Hall, Henry K; Aspinwall, Craig A

    2015-01-01

    A porous phospholipid nanoshell (PPN) sensor functionalized with a specific aptamer sensor agent was prepared for rapid detection of Hg(2+) in human urine with minimal sample preparation. Aptamer sensors provide an important class of optical transducers that can be readily and reproducibly synthesized. A key limitation of aptamer sensors, and many other optical sensors, is the potential of biofouling or biodegradation when used in complex biological matrices such as serum or urine, particularly when high levels of nucleases are present. We prepared Hg(2+)-responsive, PPN-encapsulated aptamer sensors that overcome these limitations. PPNs provide a protective barrier to encapsulate the aptamer sensor in an aqueous environment free of diffusional restrictions encountered with many polymer nanomaterials. The unique porous properties of the PPN membrane enable ready and rapid transfer of small molecular weight ions and molecules into the sensor interior while minimizing the macromolecular interactions between the transducer and degradants or interferents in the exterior milieu. Using Hg(2+)-responsive, PPN-encapsulated aptamer sensors, we were able to detect sub-100 ppb (chronic threshold limit from urine test) Hg(2+) in human urine with no sample preparation, whereas free aptamer sensors yielded inaccurate results due to interferences from the matrix. The PPN architecture provides a new platform for construction of aptamer-functionalized sensors that target low molecular weight species in complex matrices, beyond the Hg(2+) demonstrated here.

  15. Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins

    PubMed Central

    Challa, Sreerupa; Tzipori, Saul; Sheoran, Abhineet

    2014-01-01

    Infection with Shiga toxin- (Stx-) producing E. coli causes life threatening hemolytic uremic syndrome (HUS), a leading cause of acute renal failure in children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more firmly linked with the development of HUS. In the present study, selective evolution of ligands by exponential enrichment (SELEX) was used in an attempt to identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection, significant enrichment of aptamer pool was obtained against Stx2, but not against Stx1, using a RNA aptamer library containing 56 random nucleotides (N56). Characterization of individual aptamer sequences revealed that six unique RNA aptamers (mA/pC, mB/pA, mC, mD, pB, and pD) recognized Stx2 in a filter binding assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa cells in a flow cytometry assay. However, none of the aptamers neutralized Stx2-mediated cytotoxicity and death of HeLa cells. PMID:24839553

  16. Highly Multiplexed RNA Aptamer Selection using a Microplate-based Microcolumn Device

    PubMed Central

    Reinholt, Sarah J.; Ozer, Abdullah; Lis, John T.; Craighead, Harold G.

    2016-01-01

    We describe a multiplexed RNA aptamer selection to 19 different targets simultaneously using a microcolumn-based device, MEDUSA (Microplate-based Enrichment Device Used for the Selection of Aptamers), as well as a modified selection process, that significantly reduce the time and reagents needed for selections. We exploited MEDUSA’s reconfigurable design between parallel and serially-connected microcolumns to enable the use of just 2 aliquots of starting library, and its 96-well microplate compatibility to enable the continued use of high-throughput techniques in downstream processes. Our modified selection protocol allowed us to perform the equivalent of a 10-cycle selection in the time it takes for 4 traditional selection cycles. Several aptamers were discovered with nanomolar dissociation constants. Furthermore, aptamers were identified that not only bound with high affinity, but also acted as inhibitors to significantly reduce the activity of their target protein, mouse decapping exoribonuclease (DXO). The aptamers resisted DXO’s exoribonuclease activity, and in studies monitoring DXO’s degradation of a 30-nucleotide substrate, less than 1 μM of aptamer demonstrated significant inhibition of DXO activity. This aptamer selection method using MEDUSA helps to overcome some of the major challenges with traditional aptamer selections, and provides a platform for high-throughput selections that lends itself to process automation. PMID:27432610

  17. Aptamer-functionalized porous phospholipid nanoshells for direct measurement of Hg(2+) in urine.

    PubMed

    Li, Zhen; Muhandiramlage, Thusitha P; Keogh, John P; Hall, Henry K; Aspinwall, Craig A

    2015-01-01

    A porous phospholipid nanoshell (PPN) sensor functionalized with a specific aptamer sensor agent was prepared for rapid detection of Hg(2+) in human urine with minimal sample preparation. Aptamer sensors provide an important class of optical transducers that can be readily and reproducibly synthesized. A key limitation of aptamer sensors, and many other optical sensors, is the potential of biofouling or biodegradation when used in complex biological matrices such as serum or urine, particularly when high levels of nucleases are present. We prepared Hg(2+)-responsive, PPN-encapsulated aptamer sensors that overcome these limitations. PPNs provide a protective barrier to encapsulate the aptamer sensor in an aqueous environment free of diffusional restrictions encountered with many polymer nanomaterials. The unique porous properties of the PPN membrane enable ready and rapid transfer of small molecular weight ions and molecules into the sensor interior while minimizing the macromolecular interactions between the transducer and degradants or interferents in the exterior milieu. Using Hg(2+)-responsive, PPN-encapsulated aptamer sensors, we were able to detect sub-100 ppb (chronic threshold limit from urine test) Hg(2+) in human urine with no sample preparation, whereas free aptamer sensors yielded inaccurate results due to interferences from the matrix. The PPN architecture provides a new platform for construction of aptamer-functionalized sensors that target low molecular weight species in complex matrices, beyond the Hg(2+) demonstrated here. PMID:25326888

  18. Intracellular Expression of PAI-1 Specific Aptamers Alters Breast Cancer Cell Migration, Invasion and Angiogenesis

    PubMed Central

    Fortenberry, Yolanda M.; Brandal, Stephanie M.; Carpentier, Gilles; Hemani, Malvi; Pathak, Arvind P.

    2016-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is elevated in various cancers, where it has been shown to effect cell migration and invasion and angiogenesis. While, PAI-1 is a secreted protein, its intercellular levels are increased in cancer cells. Consequently, intracellular PAI-1 could contribute to cancer progression. While various small molecule inhibitors of PAI-1 are currently being investigated, none specifically target intracellular PAI-1. A class of inhibitors, termed aptamers, has been used effectively in several clinical applications. We previously generated RNA aptamers that target PAI-1 and demonstrated their ability to inhibit extracellular PAI-1. In the current study we explored the effect of these aptamers on intracellular PAI-1. We transiently transfected the PAI-1 specific aptamers into both MDA-MB-231 human breast cancer cells, and human umbilical vein endothelial cells (HUVECs) and studied their effects on cell migration, invasion and angiogenesis. Aptamer expressing MDA-MB-231 cells exhibited a decrease in cell migration and invasion. Additionally, intracellular PAI-1 and urokinase plasminogen activator (uPA) protein levels decreased, while the PAI-1/uPA complex increased. Moreover, a significant decrease in endothelial tube formation in HUVECs transfected with the aptamers was observed. In contrast, conditioned media from aptamer transfected MDA-MB-231 cells displayed a slight pro-angiogenic effect. Collectively, our study shows that expressing functional aptamers inside breast and endothelial cells is feasible and may exhibit therapeutic potential. PMID:27755560

  19. DNA aptamer beacon assay for C-telopeptide and handheld fluorometer to monitor bone resorption.

    PubMed

    Bruno, John Gordon; Carrillo, Maria P; Phillips, Taylor; Hanson, Douglas; Bohmann, Jonathan A

    2011-09-01

    A novel DNA aptamer beacon is described for quantification of a 26-amino acid C-telopeptide (CTx) of human type I bone collagen. One aptamer sequence and its reverse complement dominated the aptamer pool (31.6% of sequenced clones). Secondary structures of these aptamers were examined for potential binding pockets. Three-dimensional computer models which analyzed docking topologies and binding energies were in agreement with empirical fluorescence experiments used to select one candidate loop for beacon assay development. All loop structures from the aptamer finalists were end-labeled with TYE 665 and Iowa Black quencher for comparison of beacon fluorescence levels as a function of CTx concentration. The optimal beacon, designated CTx 2R-2h yielded a low ng/ml limit of detection using a commercially available handheld fluorometer. The CTx aptamer beacon bound full-length 26-amino acid CTx peptide, but not a shorter 8-amino acid segment of CTx peptide which is a common target for commercial CTx ELISA kits. The prototype assay was shown to detect CTx peptide from human urine after creatinine and urea were removed by size-exclusion chromatography to prevent nonspecific denaturing of the aptamer beacon. This work demonstrates the potential of aptamer beacons to be utilized for rapid and sensitive bone health monitoring in a handheld or point-of-care format.

  20. Aptamer-based detection of plasma proteins by an electrochemical assay coupled to magnetic beads.

    PubMed

    Centi, Sonia; Tombelli, Sara; Minunni, Maria; Mascini, Marco

    2007-02-15

    The DNA thrombin aptamer has been extensively investigated, and the coupling of this aptamer to different transduction principles has demonstrated the wide applicability of aptamers as bioreceptors in bioanalytical assays. The goal of this work was to design an aptamer-based sandwich assay with electrochemical detection for thrombin analysis in complex matrixes, using a simple target capturing step by aptamer-functionalized magnetic beads. The conditions for the aptamer immobilization and for the protein binding have been first optimized by surface plasmon resonance, and then transferred to the electrochemical-based assay performed onto screen-printed electrodes. The assay was then applied to the analysis of thrombin in buffer, spiked serum, and plasma and high sensitivity and specificity were found. Moreover, thrombin was generated in situ in plasma by the conversion of its precursor prothrombin, and the formation of thrombin was followed at different times. The concentrations detected by the electrochemical assay were in agreement with a simulation software that mimics the formation of thrombin over time (thrombogram). The proposed work demonstrates that the high specificity of aptamers together with the use of magnetic beads are the key features for aptamer-based analysis in complex matrixes, opening the possibility of a real application to diagnostics or medical investigation.

  1. Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

    SciTech Connect

    Lee, Young Ju; Lee, Seong-Wook

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Identification of RNA aptamer specific to AFP with high affinity. Black-Right-Pointing-Pointer Specific induction of HCC proliferation by AFP. Black-Right-Pointing-Pointer Efficient increase in oncogene expression by AFP. Black-Right-Pointing-Pointer Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. Black-Right-Pointing-Pointer Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K{sub D} of {approx}33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

  2. Toggled RNA Aptamers Against Aminoglycosides Allowing Facile Detection of Antibiotics Using Gold Nanoparticle Assays

    PubMed Central

    2012-01-01

    We have used systematic evolution of ligands by exponential enrichment (SELEX) to isolate RNA aptamers against aminoglycoside antibiotics. The SELEX rounds were toggled against four pairs of aminoglycosides with the goal of isolating reagents that recognize conserved structural features. The resulting aptamers bind both of their selection targets with nanomolar affinities. They also bind the less structurally related targets, although they show clear specificity for this class of antibiotics. We show that this lack of aminoglycoside specificity is a common property of aptamers previously selected against single compounds and described as “specific”. Broad target specificity aptamers would be ideal for sensors detecting the entire class of aminoglycosides. We have used ligand-induced aggregation of gold-nanoparticles coated with our aptamers as a rapid and sensitive assay for these compounds. In contrast to DNA aptamers, unmodified RNA aptamers cannot be used as the recognition ligand in this assay, whereas 2′-fluoro-pyrimidine derivatives work reliably. We discuss the possible application of these reagents as sensors for drug residues and the challenges for understanding the structural basis of aminoglycoside-aptamer recognition highlighted by the SELEX results. PMID:22793869

  3. Determining the elastic properties of aptamer-ricin single molecule multiple pathways

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ricin and an anti-ricin aptamer showed three stable binding conformations with their special chemomechanical properties. The elastic properties of the ricin-aptamer single-molecule interactions were investigated by the dynamic force spectroscopy (DFS). The worm-like-chain model and Hook’s law were ...

  4. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    PubMed Central

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-01-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays. PMID:26903199

  5. Following aptamer-ricin specific binding by single molecule recognition and force spectroscopy measurements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The atomic force microscope (AFM) recognition and dynamic force spectroscopy (DFS) experiments provide both morphology and interaction information of the aptamer and protein, which can be used for the future study on the thermodynamics and kinetics properties of ricin-aptamer/antibody interactions. ...

  6. AFBI assay – Aptamer Fluorescence Binding and Internalization assay for cultured adherent cells

    PubMed Central

    Thiel, William H.; Giangrande, Paloma H.

    2016-01-01

    The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process allows for the enrichment of DNA or RNA aptamers from a complex nucleic acid library that are specific for a target molecule. The SELEX process has been adapted from identifying aptamers in vitro using recombinant target protein to cell-based methodologies (Cell-SELEX), where the targets are expressed on the surface of cells. One major advantage of Cell-SELEX is that the target molecules are maintained in a native confirmation. Additionally, Cell-SELEX may be used to discover novel therapeutic biomarkers by performing selections on diseased versus healthy cells. However, a caveat to Cell-SELEX is that testing of single aptamers identified in the selection is laborious, time-consuming, and expensive. The most frequently used methods to screen for aptamer binding and internalization on cells are flow cytometry and quantitative PCR (qPCR). While flow cytometry can directly assess binding of a fluorescently-labeled aptamer to a target, it requires significant starting material and is not easily scalable. qPCR-based approaches are highly sensitive but have non-negligible experiment-to-experiment variability due to the number of sample processing steps. Herein we describe a cell-based aptamer fluorescence binding and internalization (AFBI) assay. This assay requires minimal reagents and has few experimental steps/manipulations, thereby allowing for rapid screening of many aptamers and conditions simultaneously and direct quantitation of aptamer binding and internalization. PMID:26972784

  7. Chemiluminescently labeled aptamers as the affinity probe for interaction analysis by capillary electrophoresis.

    PubMed

    Li, Hong-Yi; Deng, Qin-Pei; Zhang, De-Wen; Zhou, Ying-Lin; Zhang, Xin-Xiang

    2010-07-01

    Aptamers are nucleic acid oligonucleotides, which can recognize targets with high affinity and specificity. Fluorescently labeled aptamers have been used as affinity probes in CE for interaction analysis. In this study, a method of labeling aptamers chemiluminescently with isoluminol isothiocyanate (ILITC) through covalent bonds was proposed and realized. The ILITC-labeled aptamers were characterized by HPLC-MS and purified by HPLC. After desalination, the ILITC-labeled aptamers were employed as the affinity probe for interaction analysis in CE coupled with chemiluminescence detection (CE-CL) by interface of end column reaction mode, the apparatus of which was home-designed and setup. CE-CL experiment conditions, including buffer pH, concentrations of horseradish peroxidase and H(2)O(2), were optimized first. The system of thrombin and its 29-mer aptamer was chosen as the model. Binding parameters, namely the dissociation constant (K(d)) and the binding site number (n), were calculated. The K(d) obtained was 124.0+/-6.9 nM in agreement with the reported values. Thus, interaction analysis method based on chemiluminescently labeled aptamers as the affinity probe in CE-CL has been established. This method can be widely applied due to the ease and universality of the labeling method, simplicity of CE-CL apparatus and combination with aptamers for a wide range of targets.

  8. Aptamer-functionalized hydrogel diffraction gratings for the human thrombin detection.

    PubMed

    Wang, Xiaoqi; Wang, Xiaogong

    2013-07-01

    The aptamer-functionalized hydrogel diffraction gratings were successfully fabricated by incorporating an aptamer and its complementary sequence as crosslinking junctions in the network structure. The gratings showed a sensitive response to human thrombin as read out from the diffracted light.

  9. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    NASA Astrophysics Data System (ADS)

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-02-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.

  10. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    PubMed

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  11. Reversible regulation of aptamer activity with effector-responsive hairpin oligonucleotides.

    PubMed

    Li, Na

    2013-02-01

    Aptamers are oligonucleotides that can bind to various nonnucleic acid molecular targets in a high affinity and specificity. As an emerging class of therapeutic agents, aptamers offer an unparalleled advantage over other classes of therapeutic agents: the possibility to rationally regulate the therapeutic activity of aptamers. Most existing strategies for regulating the aptamer activity have a limited specificity and/or reversibility. Herein we report a simple, generic strategy to simultaneously achieve specificity and reversibility by exploiting the spontaneous conformational change of hairpin oligonucleotides upon the specific recognition of nucleic acid effectors. The effector-responsive hairpin oligonucleotide consists of a sensing loop that recognizes a particular nucleic acid effector, an aptamer stem that inhibits a certain therapeutic target, and an antidote stem that is complementary to the aptamer. Upon the introduction/removal of the effector, the hairpin oligonucleotide undergoes a conformational change that activates/deactivates the aptamer's inhibiting activity on the therapeutic target. This new strategy has been demonstrated with an anticoagulant aptamer that binds and inhibits human α-thrombin. PMID:22651934

  12. A reliable aptamer array prepared by repeating inkjet-spotting toward on-site measurement.

    PubMed

    Inoue, Suzuyo; Seyama, Michiko; Miura, Toru; Horiuchi, Tsutomu; Iwasaki, Yuzuru; Takahashi, Jun-Ichi; Hayashi, Katsuyoshi; Tamechika, Emi

    2016-11-15

    A preparation protocol is proposed for a reliable aptamer array utilizing an ink-jet spotter. We accumulated streptavidin and biotinylated-aptamer in this order on a biotinylated-polyethylene glycol-coated gold substrate to prepare an aptamer array. The aptamer array was prepared with an alternate spotting structure where each aptamer spot was placed between reference spots formed with blocking solution thus suppressing contamination from neighboring spots during the blocking and washing processes. Four aptamer spots were prepared in a small area of 1×4.8mm(2) with five reference spots made of blocking solution. We evaluated the thrombin binding ability of the spotted aptamer array using a multi-analysis surface plasmon resonance sensor. We prepared a disposable capillary-driven flow chip designed for on-site measurement (Miura et al., 2010) with our aptamer array and detected thrombin from phosphate-buffered saline at concentrations of 50ngmL(-1) and 1μgmL(-1) (equivalent to 1.35 and 27nM, respectively). A correlation was observed between the refractive index shift and thrombin concentration. This implies that our array preparation protocol meets the requirement for the preparation of a one-time-use chip for on-site measurement. PMID:27315520

  13. Nucleic acid aptamer-guided cancer therapeutics and diagnostics: the next generation of cancer medicine.

    PubMed

    Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Wang, Tao; Kouzani, Abbas Z; Zhou, Shu-Feng; Kong, Lingxue; Li, Yong; Pu, Chunwen; Duan, Wei

    2015-01-01

    Conventional anticancer therapies, such as chemo- and/or radio-therapy are often unable to completely eradicate cancers due to abnormal tumor microenvironment, as well as increased drug/radiation resistance. More effective therapeutic strategies for overcoming these obstacles are urgently in demand. Aptamers, as chemical antibodies that bind to targets with high affinity and specificity, are a promising new and novel agent for both cancer diagnostic and therapeutic applications. Aptamer-based cancer cell targeting facilitates the development of active targeting in which aptamer-mediated drug delivery could provide promising anticancer outcomes. This review is to update the current progress of aptamer-based cancer diagnosis and aptamer-mediated active targeting for cancer therapy in vivo, exploring the potential of this novel form of targeted cancer therapy.

  14. DNA nanostructure-decorated surfaces for enhanced aptamer-target binding and electrochemical cocaine sensors.

    PubMed

    Wen, Yanli; Pei, Hao; Wan, Ying; Su, Yan; Huang, Qing; Song, Shiping; Fan, Chunhai

    2011-10-01

    The sensitivity of aptamer-based electrochemical sensors is often limited by restricted target accessibility and surface-induced perturbation of the aptamer structure, which arise from imperfect packing of probes on the heterogeneous and locally crowded surface. In this study, we have developed an ultrasensitive and highly selective electrochemical aptamer-based cocaine sensor (EACS), based on a DNA nanotechnology-based sensing platform. We have found that the electrode surface decorated with an aptamer probe-pendant tetrahedral DNA nanostructure greatly facilitates cocaine-induced fusion of the split anticocaine aptamer. This novel design leads to a sensitive cocaine sensor with a remarkably low detection limit of 33 nM. It is also important that the tetrahedra-decorated surface is protein-resistant, which not only suits the enzyme-based signal amplification scheme employed in this work, but ensures high selectivity of this sensor when deployed in sera or other adulterated samples.

  15. Developing trends in aptamer-based biosensor devices and their applications.

    PubMed

    MacKay, Scott; Wishart, David; Xing, James Z; Chen, Jie

    2014-02-01

    Aptamers are, in general, easier to produce, easier to store and are able to bind to a wider variety of targets than antibodies. For these reasons, aptamers are gaining increasing popularity in environmental monitoring as well as disease detection and disease management applications. This review article examines the research and design of RNA and DNA aptamer based biosensor systems and applications as well as their potential for integration in effective biosensor devices. As single stranded DNA or RNA molecules that can bind to specific targets, aptamers are well suited for biomolecular recognition and sensing applications. Beyond being able to be designed for a near endless number of specific targets, aptamers can also be made which change their conformation in a predictable and consistent way upon binding. This can lead to many unique and effective detection methods using a variety of optical and electrochemical means.

  16. Detection and Characterization of Cancer Cells and Pathogenic Bacteria Using Aptamer-Based Nano-Conjugates

    PubMed Central

    Gedi, Vinayakumar; Kim, Young-Pil

    2014-01-01

    Detection and characterization of cells using aptamers and aptamer-conjugated nanoprobes has evolved a great deal over the past few decades. This evolution has been driven by the easy selection of aptamers via in vitro cell-SELEX, permitting sensitive discrimination between target and normal cells, which includes pathogenic prokaryotic and cancerous eukaryotic cells. Additionally, when the aptamer-based strategies are used in conjunction with nanomaterials, there is the potential for cell targeting and therapeutic effects with improved specificity and sensitivity. Here we review recent advances in aptamer-based nano-conjugates and their applications for detecting cancer cells and pathogenic bacteria. The multidisciplinary research utilized in this field will play an increasingly significant role in clinical medicine and drug discovery. PMID:25268922

  17. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: the Next Generation of Cancer Medicine

    PubMed Central

    Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Wang, Tao; Kouzani, Abbas Z.; Zhou, Shu-Feng; Kong, Lingxue; Li, Yong; Pu, Chunwen; Duan, Wei

    2015-01-01

    Conventional anticancer therapies, such as chemo- and/or radio-therapy are often unable to completely eradicate cancers due to abnormal tumor microenvironment, as well as increased drug/radiation resistance. More effective therapeutic strategies for overcoming these obstacles are urgently in demand. Aptamers, as chemical antibodies that bind to targets with high affinity and specificity, are a promising new and novel agent for both cancer diagnostic and therapeutic applications. Aptamer-based cancer cell targeting facilitates the development of active targeting in which aptamer-mediated drug delivery could provide promising anticancer outcomes. This review is to update the current progress of aptamer-based cancer diagnosis and aptamer-mediated active targeting for cancer therapy in vivo, exploring the potential of this novel form of targeted cancer therapy. PMID:25553096

  18. Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1.

    PubMed

    Huang, Yukun; Chen, Xiujuan; Duan, Nuo; Wu, Shijia; Wang, Zhouping; Wei, Xinlin; Wang, Yuanfeng

    2015-01-01

    Enterotoxins from pathogenic bacteria are known as the main reason that can cause the bacterial foodborne diseases. In this study, aptamers that bound to Staphylococcus aureus enterotoxin C1 (SEC1) with high affinity and selectivity were generated in vitro by twelve rounds of selection based on magnetic separation technology, with a low-level dissociation constant (Kd) value of 65.14 ± 11.64 nmol/L of aptamer C10. Aptamer-based quantification of SEC1 in the food sample by a graphene oxide (GO)-based method was implemented to investigate the potential of the aptamer against SEC1 with a limit of detection of 6 ng/mL. On the basis of this work, biosensors using the selected SEC1 aptamers as new molecular recognition elements could be applied for innovative determinations of SEC1.

  19. Biocompatible hydrogel membranes for the protection of RNA aptamer-based electrochemical sensors

    NASA Astrophysics Data System (ADS)

    Schoukroun-Barnes, Lauren R.; Wagan, Samiullah; Liu, Juan; Leach, Jennie B.; White, Ryan J.

    2013-05-01

    Electrochemical-aptamer based (E-AB) sensors represent a universal specific, selective, and sensitive sensing platform for the detection of small molecule targets. Their specific detection abilities are afforded by oligonucleotide (RNA or DNA) aptamers employed as electrode-bound biorecognition elements. Sensor signaling is predicated on bindinginduced changes in conformation and/or flexibility of the aptamer that is readily measurable electrochemically. While sensors fabricated using DNA aptamers can achieve specific and selective detection even in unadulterated sample matrices, such as blood serum, RNA-based sensors fail when challenged in the same sample matrix without significant sample pretreatment. This failure is at least partially a result of enzymatic degradation of the RNA sensing element. This degradation destroys the sensing aptamer inhibiting the quantitative measurement of the target analyte and thus limits the application of E-AB sensors constructed with RNA aptamer. To circumvent this, we demonstrate that a biocompatible hydrogel membrane protects the RNA aptamer sensor surface from enzymatic degradation for at least 3 hours - a remarkable improvement over the rapid (~minutes) degradation of unprotected sensors. To demonstrate this, we characterize the response of sensors fabricated with representative DNA and RNA aptamers directed against the aminoglycoside antibiotic, tobramycin in blood serum both protected and unprotected by a polyacrylamide membrane. Furthermore, we find encapsulation of the sensor surface with the hydrogel does not significantly impede the detection ability of aptamer-based sensors. This hydrogel-aptamer interface will thus likely prove useful for the long-term monitoring of therapeutics in complex biological media.

  20. Development of an aptamer beacon for detection of interferon-gamma.

    PubMed

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  1. In Situ Live Cell Sensing of Multiple Nucleotides Exploiting DNA/RNA Aptamers and Graphene Oxide Nanosheets

    SciTech Connect

    Wang, Ying; Li, Zhaohui; Weber, Thomas J.; Hu, Dehong; Lin, Chiann Tso; Li, Jinghong; Lin, Yuehe

    2013-07-23

    Adenosine-5’-triphosphate (ATP) and guanosine-5’-triphosphate (GTP) are primary energy resources and function coordinately for numerous reactions such as microtubule assembly, insulin secretion and ion channel regulation. We have developed a novel DNA/RNA aptamer- graphene oxide nanosheet (GO-nS) sensing platform that can selectively and simultaneously detect ATP and GTP in live cells. A fluorescent tag is covalently attached to aptamers and fluorescence is quenched upon binding of aptamer to the GO-nS. Fluorescently tagged aptamers that selectively bind ATP or GTP were isolated from an aptamer library and were adsorbed onto GO-nS. Upon incubation with targets (ATP and/or GTP), the aptamers readily dissociated from GO-nS and the fluorescent signal was recovered. By covalently attaching fluorophores, both ATP and GTP sensing aptamers could be exploited to simultaneously visualize aptamer dissociation in live cells. In addition, the GO-nS appear to be biocompatible and protect the adsorbed DNA/RNA aptamers from enzymatic cleavage. Our results support the application of aptamer/GO-nS as a sensing platform for nucleotides in living cells and have implications for the development of additional sensor platforms for other bio-molecules that show selective interactions with aptamers and other biomarkers.

  2. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications

    PubMed Central

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-01-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G–C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165. Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. PMID:27387284

  3. The effect of surface contact activation and temperature on plasma coagulation with an RNA aptamer directed against factor IXa.

    PubMed

    Krishnan, Anandi; Vogler, Erwin A; Sullenger, Bruce A; Becker, Richard C

    2013-01-01

    The anticoagulant properties of a novel RNA aptamer that binds FIXa depend collectively on the intensity of surface contact activation of human blood plasma, aptamer concentration, and its binding affinity for FIXa. Accordingly, anticoagulation efficiency of plasma containing any particular aptamer concentration is low when coagulation is strongly activated by hydrophilic surfaces compared to the anticoagulation efficiency in plasma that is weakly activated by hydrophobic surfaces. Anticoagulation efficiency is lower at hypothermic temperatures possibly because aptamer-FIXa binding decreases with decreasing temperatures. Experimental results demonstrating these trends are qualitatively interpreted in the context of a previously established model of anticoagulation efficiency of thrombin-binding DNA aptamers that exhibit anticoagulation properties similar to the FIXa aptamer. In principle, FIXa aptamer anticoagulants should be more efficient and therefore more clinically useful than thrombin-binding aptamers because aptamer binding to FIXa competes only with FX that is at much lower blood concentration than fibrinogen (FI) that competes with thrombin-binding aptamers. Our findings may have translatable relevance in the application of aptamer anticoagulants for clinical conditions in which blood is in direct contact with non-biological surfaces such as those encountered in cardiopulmonary bypass circuits. PMID:23054460

  4. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications.

    PubMed

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-09-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165. PMID:27387284

  5. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications.

    PubMed

    Kimoto, Michiko; Nakamura, Mana; Hirao, Ichiro

    2016-09-01

    A new technology, genetic alphabet expansion using artificial bases (unnatural bases), has created high-affinity DNA ligands (aptamers) that specifically bind to target proteins by ExSELEX (genetic alphabet Expansion for Systematic Evolution of Ligands by EXponential enrichment). We recently found that the unnatural-base DNA aptamers can be stabilized against nucleases, by introducing an extraordinarily stable, unique hairpin DNA (mini-hairpin DNA) and by reinforcing the stem region with G-C pairs. Here, to establish this aptamer generation method, we examined the stabilization of a high-affinity anti-VEGF165 unnatural-base DNA aptamer. The stabilized aptamers displayed significantly increased thermal and nuclease stabilities, and furthermore, exhibited higher affinity to the target. As compared to the well-known anti-VEGF165 RNA aptamer, pegaptanib (Macugen), our aptamers did not require calcium ions for binding to VEGF165 Biological experiments using cultured cells revealed that our stabilized aptamers efficiently inhibited the interaction between VEGF165 and its receptor, with the same or slightly higher efficiency than that of the pegaptanib RNA aptamer. The development of cost-effective and calcium ion-independent high-affinity anti-VEGF165 DNA aptamers encourages further progress in diagnostic and therapeutic applications. In addition, the stabilization process provided additional information about the key elements required for aptamer binding to VEGF165.

  6. Aptamer-targeted oligonucleotide theranostics: a smarter approach for brain delivery and the treatment of neurological diseases.

    PubMed

    Sriramoju, Bhasker; Kanwar, Rupinder; Veedu, Rakesh N; Kanwar, Jagat R

    2015-01-01

    Aptamers represent the novel class of oligonucleotides holding multiple applications in the area of biomedicine. The advancements introduced with the Systematic Evolution of Ligands by EXponential enrichment (SELEX) approach further eased the scope of producing modified aptamers within a short span yet retaining the properties of stability and applicability. In the recent times, aptamers were identified to have the potential for penetrating into the deep human crevices and thus can be utilized in addressing the issues of complex neurological disorders. Considering the specificity and stability enhancement by chemical modifications, aptamer-based nanotechnologies may have great potential for future therapeutics and diagnostics (theranostics). The research community has already witnessed success with the approval of macugen (an anti-vascular endothelial growth factor aptamer) for treating degenerating eye disease, and hopefully those that are in the clinical trials will soon be translated for human application. Herein, we have summarized the aptamer chemistry, aptamer-nanoconjugates and their applications against neurological diseases.

  7. Aptamers-based sandwich assay for silver-enhanced fluorescence multiplex detection.

    PubMed

    Wang, Ying; Li, Hui; Xu, Danke

    2016-01-28

    In this work, aptamers-modified silver nanoparticles (AgNPs) were prepared as capture substrate, and fluorescent dyes-modified aptamers were synthesized as detection probes. The sandwich assay was based on dual aptamers, which was aimed to accomplish the highly sensitive detection of single protein and multiplex detection of proteins on one-spot. We found that aptamers-modified AgNPs based microarray was much superior to the aptamer based microarray in fluorescence detection of proteins. The result shows that the detection limit of the sandwich assay using AgNPs probes for thrombin or platelet-derived growth factor-BB (PDGF-BB) is 80 or 8 times lower than that of aptamers used directly. For multiplex detection of proteins, the detection limit was 625 pM for PDGF-BB and 21 pM for thrombin respectively. The sandwich assay based on dual aptamers and AgNPs was sensitive and specific. PMID:26755149

  8. Rationally Designing Aptamer Sequences with Reduced Affinity for Controlled Sensor Performance

    PubMed Central

    Schoukroun-Barnes, Lauren R.; White, Ryan J.

    2015-01-01

    The relative ease of predicting the secondary structure of nucleic acid sequences lends itself to the design of sequences to perform desired functions. Here, we combine the utility of nucleic acid aptamers with predictable control over the secondary structure to rationally design sequences with controlled affinity towards a target analyte when employed as the recognition element in an electrochemical sensor. Specifically, we present a method to modify an existing high-gain aptamer sequence to create sequences that, when employed in an electrochemical, aptamer-based sensor, exhibit reduced affinity towards a small molecule analyte tobramycin. Sensors fabricated with the high-gain parent sequence saturate at concentrations much below the therapeutic window for tobramycin (7–18 µM). Accordingly, the rationale behind modifying this high-gain sequence to reduce binding affinity was to tune sensor performance for optimal sensitivity in the therapeutic window. Using secondary structure predictions and analysis of the NMR structure of an aminoglycoside RNA aptamer bound to tobramycin, we are able to successfully modify the aptamer sequence to tune the dissociation constants of electrochemical aptamer-based sensors between 0.17 and 3 µM. The guidelines we present represent a general strategy to lessening binding affinity of sensors employing aptamer-modified electrodes. PMID:25835184

  9. Aptamer-based surface plasmon resonance sensing of glycated human blood proteins

    NASA Astrophysics Data System (ADS)

    Reaver, Nathan G. F.; Zheng, Rui; Kim, Dong-Shik; Cameron, Brent D.

    2013-02-01

    The concentration ratio of glycated to non-glycated forms of various blood proteins can be used as a diagnostic measure in diabetes to determine a history of glycemic compliance. Depending on a protein's half-life in blood, compliance can be assessed from a few days to several months in the past, which can then be used to provide additional therapeutic guidance. Current glycated protein detection methods are limited in their ability to measure multiple proteins, and are susceptible to interference from other blood pathologies. In this study, we developed and characterized DNA aptamers for use in Surface Plasmon Resonance (SPR) sensors to assess the blood protein hemoglobin. The aptamers were developed by way of a modified Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process which selects DNA sequences that have a high binding affinity to a specific protein. DNA products resulting from this process are sequenced and identified aptamers are then synthesized. The SELEX process was performed to produce aptamers for a glycated form of hemoglobin. Equilibrium dissociation constants for the binding of the identified aptamer to glycated hemoglobin, hemoglobin, and fibrinogen were calculated from fitted Langmuir isotherms obtained through SPR. These constants were determined to be 94 nM, 147 nM, and 244 nM respectively. This aptamer can potentially be used to create a SPR aptamer based biosensor for detection of glycated hemoglobin, a technology that has the potential to deliver low-cost and immediate glycemic compliance assessment in either a clinical or home setting.

  10. A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches

    PubMed Central

    Bruno, John G.

    2013-01-01

    The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q) to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA) or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies. PMID:24276022

  11. Robust Suppression of HIV Replication by Intracellularly Expressed Reverse Transcriptase Aptamers Is Independent of Ribozyme Processing

    PubMed Central

    Lange, Margaret J; Sharma, Tarun K; Whatley, Angela S; Landon, Linda A; Tempesta, Michael A; Johnson, Marc C; Burke, Donald H

    2012-01-01

    RNA aptamers that bind human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT) also inhibit viral replication, making them attractive as therapeutic candidates and potential tools for dissecting viral pathogenesis. However, it is not well understood how aptamer-expression context and cellular RNA pathways govern aptamer accumulation and net antiviral bioactivity. Using a previously-described expression cassette in which aptamers were flanked by two “minimal core” hammerhead ribozymes, we observed only weak suppression of pseudotyped HIV. To evaluate the importance of the minimal ribozymes, we replaced them with extended, tertiary-stabilized hammerhead ribozymes with enhanced self-cleavage activity, in addition to noncleaving ribozymes with active site mutations. Both the active and inactive versions of the extended hammerhead ribozymes increased inhibition of pseudotyped virus, indicating that processing is not necessary for bioactivity. Clonal stable cell lines expressing aptamers from these modified constructs strongly suppressed infectious virus, and were more effective than minimal ribozymes at high viral multiplicity of infection (MOI). Tertiary stabilization greatly increased aptamer accumulation in viral and subcellular compartments, again regardless of self-cleavage capability. We therefore propose that the increased accumulation is responsible for increased suppression, that the bioactive form of the aptamer is one of the uncleaved or partially cleaved transcripts, and that tertiary stabilization increases transcript stability by reducing exonuclease degradation. PMID:22948672

  12. Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

    PubMed

    Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

    2015-08-01

    It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.

  13. Design and testing of aptamer-based electrochemical biosensors for proteins and small molecules.

    PubMed

    Cheng, Alan K H; Sen, Dipankar; Yu, Hua-Zhong

    2009-11-01

    The fabrication of aptamer-based electrochemical biosensors as an emerging technology has made the detection of small and macromolecular analytes easier, faster, and more suited for the ongoing transition from fundamental analytical science to the early detection of protein biomarkers. Aptamers are synthetic oligonucleotides that have undergone iterative rounds of in vitro selection for binding with high affinity to specific analytes of choice; a sensitive yet simple method to utilize aptamers as recognition entities for the development of biosensors is to transduce the signal electrochemically. In this review article, we attempt to summarize the state-of-the-art research progresses that have been published in recent years; in particular, we focus on the electrochemical biosensors that incorporate aptamers for sensing small organic molecules and proteins. Based on differences in the design of the DNA/RNA-modified electrodes, we classify aptamer-based electrochemical sensors into three categories, for which the analyte detection relies on: (a) configurational change, i.e., the analyte binding induces either an assembly or dissociation of the sensor construct; (b) conformational change, i.e., the analyte binding induces an alteration in the conformation (folding) of the surface immobilized aptamer strands; and (c) conductivity change, i.e., the analyte binding "switches on" the conductivity of the surface-bound aptamer-DNA constructs. In each section, we will discuss the performance of these novel biosensors with representative examples reported in recent literature.

  14. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    NASA Astrophysics Data System (ADS)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan

    2016-11-01

    Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  15. Nucleic Acid Aptamers as Potential Therapeutic and Diagnostic Agents for Lymphoma

    PubMed Central

    Shum, Ka-To; Zhou, Jiehua; Rossi, John J.

    2014-01-01

    Lymphomas are cancers that arise from white blood cells and usually present as solid tumors. Treatment of lymphoma often involves chemotherapy, and can also include radiotherapy and/or bone marrow transplantation. There is an un-questioned need for more effective therapies and diagnostic tool for lymphoma. Aptamers are single stranded DNA or RNA oligonucleotides whose three-dimensional structures are dictated by their sequences. The immense diversity in function and structure of nucleic acids enable numerous aptamers to be generated through an iterative in vitro selection technique known as Systematic Evolution of Ligands by EXponential enrichment (SELEX). Aptamers have several biochemical properties that make them attractive tools for use as potential diagnostic and pharmacologic agents. Isolated aptamers may directly inhibit the function of target proteins, or they can also be formulated for use as delivery agents for other therapeutic or imaging cargoes. More complex aptamer identification methods, using whole cancer cells (Cell-SELEX), may identify novel targets and aptamers to affect them. This review focuses on recent advances in the use of nucleic acid aptamers as diagnostic and therapeutic agents and as targeted delivery carriers that are relevant to lymphoma. Some representative examples are also discussed. PMID:25057429

  16. Arsenic removal from Vietnamese groundwater using the arsenic-binding DNA aptamer.

    PubMed

    Kim, Mina; Um, Hyun-Ju; Bang, Sunbaek; Lee, Sang-Hee; Oh, Suk-Jung; Han, Ji-Hye; Kim, Kyoung-Woong; Min, Jiho; Kim, Yang-Hoon

    2009-12-15

    Single-stranded DNA aptamers were generated from a random library to remove arsenic from Vietnamese groundwater. On the basis of significant arsenic contamination levels, three areas in Ha Nam province (Vinh Tru, Bo De, and Hoa Hau) and five areas near the Mekong River Delta (MR1-5) were selected as study areas. The aptamers were in vitro selected using an arsenic aptamer affinity column created by immobilizing arsenic on Affi-gel 10 resin. Quantitative analyses of the aptamer candidates Ars-1 to Ars-8 by surface plasmon resonance (SPR) revealed the Ars-3 aptamer to have the highest affinity to arsenate [(As(V)] and arsenite [As(III)] with a dissociation constant (K(d)) of 4.95 +/- 0.31 and 7.05 +/- 0.91 nM, respectively. The specific affinity interactions of the Ars-3 aptamer to arsenic were verified against other heavy metals. After obtaining successful removal results with a laboratory-prepared aqueous arsenic solution, Ars-3 was applied for removal of any arsenic present in the groundwater samples collected from the studied areas in Vietnam. Field results were also successful: various arsenic concentrations ranging from 28.1 to 739.2 microg/L were completely removed after 5 min of incubation with the arsenic-binding aptamer Ars-3.

  17. Enzymatic conjugation of multiple proteins on a DNA aptamer in a tail-specific manner.

    PubMed

    Takahara, Mari; Hayashi, Kounosuke; Goto, Masahiro; Kamiya, Noriho

    2016-06-01

    Conjugation of single-strand DNA aptamers and enzymes has been of great significance in bioanalytical and biomedical applications because of the unlimited functions provided by DNA aptamer direction. Therefore, we developed efficient tailing of a DNA aptamer, with end-specific conjugation of multiple enzymes, through enzymatic catalysis. Terminal deoxynucleotidyl transferase (TdT) added multiple Z-Gln-Gly (Z-QG) moieties to the 3'-end of a DNA aptamer via the addition of Z-QG-modified deoxyuridine triphosphate (Z-QG-dUTP) and deoxynucleoside triphosphates (dNTPs). The resultant (Z-QG)m -(dN)l-aptamer, whose Z-QGs with dN spacers served as stickers for microbial transglutaminase (MTG), were crosslinked between the Z-QGs on the DNA and a substrate peptide sequence containing lysine (K), fused to a recombinant enzyme (i.e. bacterial alkaline phosphatase; BAP) by MTG. The incorporation efficiency of Z-QG moieties on the aptamer tail and the subsequent conjugation efficiency with multiple enzyme molecules were dramatically altered by the presence of dNTPs, revealing that a combination of Z-QG-dUTP/dTTP comprised the best labeling efficiency and corresponding properties during analytical performance. Thus, a novel optimized platform for designing (BAP)n -(dT)l-DNA aptamers was demonstrated for the first time in this article, offering unique opportunities for tailoring new types of covalent protein-nucleic acid conjugates in a controllable way. PMID:27119459

  18. Light-up properties of complexes between thiazole orange-small molecule conjugates and aptamers.

    PubMed

    Pei, Renjun; Rothman, Jeffrey; Xie, Yuli; Stojanovic, Milan N

    2009-05-01

    The full understanding of dynamics of cellular processes hinges on the development of efficient and non-invasive labels for intracellular RNA species. Light-up aptamers binding fluorogenic ligands show promise as specific labels for RNA species containing those aptamers. Herein, we took advantage of existing, non-light-up aptamers against small molecules and demonstrated a new class of light-up probes in vitro. We synthesized two conjugates of thiazole orange dye to small molecules (GMP and AMP) and characterized in vitro their interactions with corresponding RNA aptamers. The conjugates preserved specific binding to aptamers while showing several 100-fold increase in fluorescence of the dye (the 'light-up' property). In the presence of free small molecules, conjugates can be displaced from aptamers serving also as fluorescent sensors. Our in vitro results provide the proof-of-concept that the small-molecule conjugates with light-up properties can serve as a general approach to label RNA sequences containing aptamers.

  19. Ultrasensitive detection of lead (II) based on fluorescent aptamer-functionalized carbon nanotubes.

    PubMed

    Taghdisi, Seyed Mohammad; Emrani, Somayeh Sarreshtehdar; Tabrizian, Kaveh; Ramezani, Mohammad; Abnous, Khalil; Emrani, Ahmad Sarreshtehdar

    2014-05-01

    Lead contamination is a serious environmental problem with toxic effects in human. Here, we developed a simple and sensitive sensing method employing ATTO 647N/aptamer-SWNT ensemble for detection of Pb(2+). This method is based on the super quenching capability of single-walled carbon nanotubes (SWNTs), high affinity of the aptamer toward Pb(2+) and different propensities of ATTO 647N-aptamer and ATTO 647N-aptamer/Pb(2+) complex for adsorption on SWNTs. In the absence of Pb(2+), the fluorescence of ATTO 647N-aptamer is efficiently quenched by SWNTs. Upon addition of Pb(2+), the aptamer binds to its target, leading to the formation of a G-quadruplex/Pb(2+) complex and does not interact with SWNTs and ATTO 647N-aptamer starts fluorescing. This sensor exhibited a high selectivity toward Pb(2+) and a limit of detection (LOD) as low as 0.42 nM was obtained. Also this sensor could be applied for detection of Pb(2+) ions in tap water and biological sample like serum with high sensitivity. PMID:24835552

  20. Application of capillary electrophoresis to the development and evaluation of aptamer affinity probes

    NASA Astrophysics Data System (ADS)

    Sooter, Letha J.; McMasters, Sun; Stratis-Cullum, Dimitra N.

    2007-09-01

    Nucleic acid aptamers can exhibit high binding affinities for a wide variety of targets and have received much attention as molecular recognition elements for enhanced biosensor performance. These aptamers recognize target molecules through a combination of conformational dependent non-covalent interactions in aqueous media which can be investigated using capillary electrophoresis-based methods. In this paper we report on the results of our studies of the relative binding affinity of Campylobacter jejuni aptamers using a capillary electrophoretic immunoassay. Our results show preferential binding to C. jejuni over other common food pathogen bacteria. Capillary electrophoresis can also be used to develop new aptamer recognition elements using an in vitro selection process known as systematic evolution of ligand by exponential enrichment (SELEX). Recently, this process has been adapted to use capillary electrophoresis in an attempt to shorten the overall selection process. This smart selection of nucleic acid aptamers from a large diversity of a combinatorial DNA library is under optimization for the development of aptamers which bind to Army-relevant targets. This paper will include a discussion of the establishment of CE-SELEX methods for the future development of smart aptamer probes.

  1. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering.

    PubMed

    Ardjomandi, N; Huth, J; Stamov, D R; Henrich, A; Klein, C; Wendel, H-P; Reinert, S; Alexander, D

    2016-10-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. PMID:27287122

  2. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering.

    PubMed

    Ardjomandi, N; Huth, J; Stamov, D R; Henrich, A; Klein, C; Wendel, H-P; Reinert, S; Alexander, D

    2016-10-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs.

  3. Complex formation with nucleic acids and aptamers alters the antigenic properties of platelet factor 4

    PubMed Central

    Jaax, Miriam E.; Krauel, Krystin; Marschall, Thomas; Brandt, Sven; Gansler, Julia; Fürll, Birgitt; Appel, Bettina; Fischer, Silvia; Block, Stephan; Helm, Christiane A.; Müller, Sabine; Preissner, Klaus T.

    2013-01-01

    The tight electrostatic binding of the chemokine platelet factor 4 (PF4) to polyanions induces heparin-induced thrombocytopenia, a prothrombotic adverse drug reaction caused by immunoglobulin G directed against PF4/polyanion complexes. This study demonstrates that nucleic acids, including aptamers, also bind to PF4 and enhance PF4 binding to platelets. Systematic assessment of RNA and DNA constructs, as well as 4 aptamers of different lengths and secondary structures, revealed that increasing length and double-stranded segments of nucleic acids augment complex formation with PF4, while single nucleotides or single-stranded polyA or polyC constructs do not. Aptamers were shown by circular dichroism spectroscopy to induce structural changes in PF4 that resemble those induced by heparin. Moreover, heparin-induced anti-human–PF4/heparin antibodies cross-reacted with human PF4/nucleic acid and PF4/aptamer complexes, as shown by an enzyme immunoassay and a functional platelet activation assay. Finally, administration of PF4/44mer–DNA protein C aptamer complexes in mice induced anti–PF4/aptamer antibodies, which cross-reacted with murine PF4/heparin complexes. These data indicate that the formation of anti-PF4/heparin antibodies in postoperative patients may be augmented by PF4/nucleic acid complexes. Moreover, administration of therapeutic aptamers has the potential to induce anti-PF4/polyanion antibodies and a prothrombotic diathesis. PMID:23673861

  4. Dual-colour imaging of RNAs using quencher- and fluorophore-binding aptamers.

    PubMed

    Arora, Ankita; Sunbul, Murat; Jäschke, Andres

    2015-12-01

    In order to gain deeper insight into the functions and dynamics of RNA in cells, the development of methods for imaging multiple RNAs simultaneously is of paramount importance. Here, we describe a modular approach to image RNA in living cells using an RNA aptamer that binds to dinitroaniline, an efficient general contact quencher. Dinitroaniline quenches the fluorescence of different fluorophores when directly conjugated to them via ethylene glycol linkers by forming a non-fluorescent intramolecular complex. Since the binding of the RNA aptamer to the quencher destroys the fluorophore-quencher complex, fluorescence increases dramatically upon binding. Using this principle, a series of fluorophores were turned into fluorescent turn-on probes by conjugating them to dinitroaniline. These probes ranged from fluorescein-dinitroaniline (green) to TexasRed-dinitroaniline (red) spanning across the visible spectrum. The dinitroaniline-binding aptamer (DNB) was generated by in vitro selection, and was found to bind all probes, leading to fluorescence increase in vitro and in living cells. When expressed in E. coli, the DNB aptamer could be labelled and visualized with different-coloured fluorophores and therefore it can be used as a genetically encoded tag to image target RNAs. Furthermore, combining contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA aptamer) and SRB-2 aptamers (a fluorophore-binding RNA aptamer) allowed dual-colour imaging of two different fluorescence-enhancing RNA tags in living cells, opening new avenues for studying RNA co-localization and trafficking.

  5. Antibody- and aptamer-strategies for GvHD prevention

    PubMed Central

    Oelkrug, Christopher; Sack, Ulrich; Boldt, Andreas; Nascimento, Isis C; Ulrich, Henning; Fricke, Stephan

    2015-01-01

    Prevention of Graft-versus-Host-Disease (GvHD) by preserved Graft-versus-Leukaemia (GvL) effect is one of the major obstacles following allogeneic haematopoietic stem cell transplantation. Currently used drugs are associated with side effects and were not able to separate GvHD from the GvL-effect because of general T-cell suppression. This review focuses on murine models for GvHD and currently available treatment options involving antibodies and applications for the therapeutic use of aptamers as well as strategies for targeting immune responses by allogenic antigens. PMID:25353670

  6. Imaging gene expression in real-time using aptamers

    SciTech Connect

    Shin, Ilchung

    2012-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  7. Imaging gene expression in real-time using aptamers

    SciTech Connect

    Shin, Il Chung

    2011-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  8. Aptamer-Nanoparticle Assembly for Logic-Based Detection

    PubMed Central

    Shukoor, Mohammed I.; Altman, Meghan O.; Han, Da; Bayrac, Abdullah Tahir; Ocsoy, Ismail; Zhu, Zhi; Tan, Weihong

    2012-01-01

    In this work, gold nanoparticles perform Boolean logic operations in response to two proangiogenic targets important in cancer diagnosis and treatment: PDGF and VEGF. In the absence of protein target, gold nanoparticles are initially dispersed as a red solution, addition of target proteins causes nanoparticle aggregation, turning the solution blue, as well as the release of dye-labelled aptamer probes which causes an increase of fluorescence. These outputs constitute an AND or OR gate for simultaneous protein detection. We believe this logic-gate-based detection system will become the basis for novel rapid, cheap, and reliable sensors for diagnostic applications. PMID:22650355

  9. Reversible Aptamer-Au Plasmon Rulers for Secreted Single Molecules.

    PubMed

    Lee, Somin Eunice; Chen, Qian; Bhat, Ramray; Petkiewicz, Shayne; Smith, Jessica M; Ferry, Vivian E; Correia, Ana Luisa; Alivisatos, A Paul; Bissell, Mina J

    2015-07-01

    Plasmon rulers, consisting of pairs of gold nanoparticles, allow single-molecule analysis without photobleaching or blinking; however, current plasmon rulers are irreversible, restricting detection to only single events. Here, we present a reversible plasmon ruler, comprised of coupled gold nanoparticles linked by a single aptamer, capable of binding individual secreted molecules with high specificity. We show that the binding of target secreted molecules to the reversible plasmon ruler is characterized by single-molecule sensitivity, high specificity, and reversibility. Such reversible plasmon rulers should enable dynamic and adaptive live-cell measurement of secreted single molecules in their local microenvironment.

  10. Reversible Aptamer-Au Plasmon Rulers for Secreted Single Molecules

    DOE PAGES

    Lee, Somin Eunice; Chen, Qian; Bhat, Ramray; Petkiewicz, Shayne; Smith, Jessica M.; Ferry, Vivian E.; Correia, Ana Luisa; Alivisatos, A. Paul; Bissell, Mina J.

    2015-06-03

    Plasmon rulers, consisting of pairs of gold nanoparticles, allow single-molecule analysis without photobleaching or blinking; however, current plasmon rulers are irreversible, restricting detection to only single events. Here, we present a reversible plasmon ruler, comprised of coupled gold nanoparticles linked by a single aptamer, capable of binding individual secreted molecules with high specificity. We show that the binding of target secreted molecules to the reversible plasmon ruler is characterized by single-molecule sensitivity, high specificity, and reversibility. Lastly, such reversible plasmon rulers should enable dynamic and adaptive live-cell measurement of secreted single molecules in their local microenvironment.

  11. Surface plasmon resonance imaging (SPRi) for analysis of DNA aptamer:β-conglutin interactions.

    PubMed

    Jauset Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; O'Sullivan, Ciara K

    2016-03-15

    Surface plasmon resonance imaging (SPRi) is a label-free detection method that offers a suitable and reliable platform for the real time monitoring of biomolecular interactions. In the work reported here, SPRi was used to evaluate the affinity and specificity of three different aptamers selected against the Lup an 1 anaphylactic allergen β-conglutin (β-conglutin binding aptamers I and II (β-CBA I and β-CBA II)), as well as an 11-mer truncated version of β-CBA I. Thiol modified aptamers were immobilised on a gold substrate through a self-assembling process and the use of different blocking strategies to prevent non-specific binding were evaluated. Dissociation constants of 20, 13 and 1 nM were determined for β-CBA I, β-CBA II and the 11-mer truncated aptamer, respectively. The three aptamers were then studied in various different sandwich formats and the β-CBA I/11-mer and β-CBA II were observed to bind to different aptatopes on the target protein. Each of the aptamers were then used either as surface immobilised aptamer, or as reporter aptamer, and added with the protein target β-conglutin in either a sequential of simultaneous manner, and the changes in SPR signal monitored. The preferred approach for formation of a sandwich aptacomplex was with immobilised β-CBA II, followed by addition of pre-incubated β-conglutin and 11-mer, whilst addition of the 11-mer following addition of the β-conglutin, resulted in displacement of the bound target. The ability to provide parallel qualitative and quantitative detection establishes SPRi as a powerful tool for the study of immobilised aptamer-target interactions. PMID:26515644

  12. Recognition of Bungarus multicinctus Venom by a DNA Aptamer against β-Bungarotoxin

    PubMed Central

    Ye, Fengping; Zheng, Ying; Wang, Xi; Tan, Xiaolong; Zhang, Tao; Xin, Wenwen; Wang, Jie; Huang, Yong; Fan, Quanshui; Wang, Jinglin

    2014-01-01

    Antibody-based technology is the main method for diagnosis and treatment of snake bite envenoming currently. However, the development of an antibody, polyclonal or monoclonal, is a complicated and costly procedure. Aptamers are single stranded oligonucleotides that recognize specific targets such as proteins and have shown great potential over the years as diagnostic and therapeutic agents. In contrast to antibodies, aptamers can be selected in vitro without immunization of animals, and synthesized chemically with extreme accuracy, low cost and high degree of purity. In this study we firstly report on the identification of DNA aptamers that bind to β-bungarotoxin (β-BuTx), a neurotoxin from the venom of Bungarus multicinctus. A plate-SELEX method was used for the selection of β-BuTx specific aptamers. After 10 rounds of selection, four aptamer candidates were obtained, with the dissociation constant ranged from 65.9 nM to 995 nM measured by fluorescence spectroscopy. Competitive binding assays using both the fluorescently labeled and unlabeled aptamers revealed that the four aptamers bound to the same binding site of β-BuTx. The best binder, βB-1, bound specifically to β-BuTx, but not to BSA, casein or α-Bungarotoxin. Moreover, electrophoretic mobility shift assay and enzyme-linked aptamer assay demonstrated that βB-1 could discriminate B. multicinctus venom from other snake venoms tested. The results suggest that aptamer βB-1 can serve as a useful tool for the design and development of drugs and diagnostic tests for β-BuTx poisoning and B. multicinctus bites. PMID:25144237

  13. DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX.

    PubMed

    Bitaraf, F S; Rasooli, I; Mousavi Gargari, S L

    2016-03-01

    Haemophilus influenzae type b (Hib) causes acute bacterial meningitis (ABM) in children, with a mortality rate of about 3-6 % of the affected patients. ABM can lead to death during a period of hours to several days and, hence, rapid and early detection of the infection is crucial. Aptamers, the short single-stranded DNA or RNA with high affinity to target molecules, are selected by a high-flux screening technique known as in vitro screening and systematic evolution of ligands by exponential enrichment technology (SELEX). In this study, whole-cell SELEX was applied for the selection of target-specific aptamers with high affinity to Hib. ssDNA aptamers prepared by lambda exonuclease were incubated with the target cells (Hib). The aptameric binding rate to Hib was characterized for binding affinity after seven SELEX rounds by flow cytometry. The aptamers with higher binding affinity were cloned. Four of 68 aptamer clones were selected for sequencing. The dissociation constant (Kd) of the high-affinity aptamer clones 45 and 63 were 47.10 and 28.46 pM, respectively. These aptamers did not bind to other bacterial species, including the seven meningitis-causing bacteria. They showed distinct affinity to various H. influenzae strains only. These aptamers showed the highest affinity to Hib and the lowest affinity to H. influenzae type c and to other meningitis-causing bacteria. Clone 63 could detect Hib in patients' cerebrospinal fluid (CSF) samples at 60 colony-forming units (CFU)/mL. The results indicate applicability of the aptamers for rapid and early detection of infections brought about by Hib.

  14. Aptamer contained triple-helix molecular switch for rapid fluorescent sensing of acetamiprid.

    PubMed

    Liu, Xin; Li, Ying; Liang, Jing; Zhu, Wenyue; Xu, Jingyue; Su, Ruifang; Yuan, Lei; Sun, Chunyan

    2016-11-01

    In this study, an aptamer-based fluorescent sensing platform using triple-helix molecular switch (THMS) was developed for the pesticide screening represented by acetamiprid. The THMS was composed of two tailored DNA probes: a label-free central target specific aptamer sequence flanked by two arm segments acting as a recognition probe; a hairpin-shaped structure oligonucleotide serving as a signal transduction probe (STP), labeled with a fluorophore and a quencher at the 3' and 5'-end, respectively. In the absence of acetamiprid, complementary bindings of two arm segments of the aptamers with the loop sequence of STP enforce the formation of THMS with the "open" configuration of STP, and the fluorescence of THMS is on. In the presence of target acetamiprid, the aptamer-target binding results in the formation of a structured aptamer/target complex, which disassembles the THMS and releases the STP. The free STP is folded to a stem loop structure, and the fluorescence is quenched. The quenched fluorescence intensity was proportional to the concentration of acetamiprid in the range from 100 to 1200nM, with the limit of detection (LOD) as low as 9.12nM. In addition, this THMS-based method has been successfully used to test and quantify acetamiprid in Chinese cabbage with satisfactory recoveries, and the results were in full agreement with those from LC-MS. The aptamer-based THMS presents distinct advantages, including high stability, remarkable sensitivity, and preservation of the affinity and specificity of the original aptamer. Most importantly, this strategy is convenient and generalizable by virtue of altering the aptamer sequence without changing the triple-helix structure. So, it is expected that this aptamer-based fluorescent assay could be extensively applied in the field of food safety inspection.

  15. Aptamer contained triple-helix molecular switch for rapid fluorescent sensing of acetamiprid.

    PubMed

    Liu, Xin; Li, Ying; Liang, Jing; Zhu, Wenyue; Xu, Jingyue; Su, Ruifang; Yuan, Lei; Sun, Chunyan

    2016-11-01

    In this study, an aptamer-based fluorescent sensing platform using triple-helix molecular switch (THMS) was developed for the pesticide screening represented by acetamiprid. The THMS was composed of two tailored DNA probes: a label-free central target specific aptamer sequence flanked by two arm segments acting as a recognition probe; a hairpin-shaped structure oligonucleotide serving as a signal transduction probe (STP), labeled with a fluorophore and a quencher at the 3' and 5'-end, respectively. In the absence of acetamiprid, complementary bindings of two arm segments of the aptamers with the loop sequence of STP enforce the formation of THMS with the "open" configuration of STP, and the fluorescence of THMS is on. In the presence of target acetamiprid, the aptamer-target binding results in the formation of a structured aptamer/target complex, which disassembles the THMS and releases the STP. The free STP is folded to a stem loop structure, and the fluorescence is quenched. The quenched fluorescence intensity was proportional to the concentration of acetamiprid in the range from 100 to 1200nM, with the limit of detection (LOD) as low as 9.12nM. In addition, this THMS-based method has been successfully used to test and quantify acetamiprid in Chinese cabbage with satisfactory recoveries, and the results were in full agreement with those from LC-MS. The aptamer-based THMS presents distinct advantages, including high stability, remarkable sensitivity, and preservation of the affinity and specificity of the original aptamer. Most importantly, this strategy is convenient and generalizable by virtue of altering the aptamer sequence without changing the triple-helix structure. So, it is expected that this aptamer-based fluorescent assay could be extensively applied in the field of food safety inspection. PMID:27591592

  16. Architecture of high-affinity unnatural-base DNA aptamers toward pharmaceutical applications.

    PubMed

    Matsunaga, Ken-ichiro; Kimoto, Michiko; Hanson, Charlotte; Sanford, Michael; Young, Howard A; Hirao, Ichiro

    2015-01-01

    We present a remodeling method for high-affinity unnatural-base DNA aptamers to augment their thermal stability and nuclease resistance, for use as drug candidates targeting specific proteins. Introducing a unique mini-hairpin DNA provides robust stability to unnatural-base DNA aptamers generated by SELEX using genetic alphabet expansion, without reducing their high affinity. By this method, >80% of the remodeled DNA aptamer targeting interferon-γ (KD of 33 pM) survived in human serum at 37 °C after 3 days under our experimental conditions, and sustainably inhibited the biological activity of interferon-γ. PMID:26690672

  17. Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

    PubMed

    Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

    2014-06-10

    Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

  18. Aptamers and methods for their in vitro selection and uses thereof

    DOEpatents

    Doyle, Sharon A.; Murphy, Michael B.

    2012-01-31

    The present method is an improved in vitro selection protocol that relies on magnetic separations for DNA aptamer production that is relatively easy and scalable without the need for expensive robotics. The ability of aptamers selected by this method to recognize and bind their target protein with high affinity and specificity, and detail their uses in a number of assays is also described. Specific TTF1 and His6 aptamers were selected using the method described, and shown to be useful for enzyme-linked assays, Western blots, and affinity purification.

  19. Aptamers and methods for their in vitro selection and uses thereof

    DOEpatents

    Doyle, Sharon A.; Murphy, Michael B.

    2008-02-12

    The present method is an improved in vitro selection protocol that relies on magnetic separations for DNA aptamer production that is relatively easy and scalable without the need for expensive robotics. The ability of aptamers selected by this method to recognize and bind their target protein with high affinity and specificity, and detail their uses in a number of assays is also described. Specific TTF1 and His6 aptamers were selected using the method described, and shown to be useful for enzyme-linked assays, Western blots, and affinity purification.

  20. Electrochemical Impedance Spectroscopic Sensing of Methamphetamine by a Specific Aptamer

    PubMed Central

    Ebrahimi, Mohsen; Johari-Ahar, Mohammad; Hamzeiy, Hossein; Barar, Jaleh; Mashinchian, Omid; Omidi, Yadollah

    2012-01-01

    Introduction Electrochemical impedance spectroscopy (EIS) is a simple and highly sensitive technique that can be used for evaluation of the aptamer-target interaction even in a label-free approach. Methods To pursue the effectiveness of EIS, in the current study, the folding properties of specific aptamer for methamphetamine (METH) (i.e., aptaMETH) were evaluated in the presence of METH and amphetamine (Amph). Folded and unfolded aptaMETH was mounted on the gold electrode surface and the electron charge transfer was measured by EIS. Results The Ret of methamphetamine-aptaMETH was significantly increased in comparison with other folding conditions, indicating specific detection of METH by aptaMETH. Conclusion Based on these findings, methamphetamine-aptaMETH on the gold electrode surface displayed the most interfacial electrode resistance and thus the most folding situation. This clearly indicates that the aptaMETH can profoundly and specifically pinpoint METH; as a result we suggest utilization of this methodology for fast and cost-effective identification of METH. PMID:23678446

  1. Determination of endotoxin through an aptamer-based impedance biosensor.

    PubMed

    Su, Wenqiong; Lin, Meng; Lee, Hyuck; Cho, MiSuk; Choe, Woo-Seok; Lee, Youngkwan

    2012-02-15

    Lipopolysaccharide (LPS) often referred to endotoxin is an undesirable impurity frequently entrained with various recombinant protein therapeutics and plasmid DNA (pDNA) vaccines of bacterial origin. The inherent toxicities (e.g. fever, hypotension, shock and death) of LPS render its early and sensitive detection essential for several biological assays and/or parenteral administrations of biotherapeutics. In this study, an electrochemical biosensor using an LPS specific single stranded DNA (ssDNA) aptamer as a probe was developed. Amine-terminated aptamer exhibiting high affinity (K(d)=11.9 nM) to LPS was immobilized on a gold electrode using 3-mercaptopropionic acid (MPA) as a linker. Each step of the modification process was characterized by cyclic voltammetry (CV) and electrochemical impendence spectroscopy (EIS). A good linear relationship of the changes in the charge-transfer resistance (ΔR(et)) and the logarithmic value of LPS concentration was demonstrated in a broad dynamic detection range of 0.001-1 ng/ml. Furthermore, the aptasensor showed a high selectivity to LPS despite the presence of pDNA, RNA and bovine serum albumin (BSA) and could be regenerated in low pH condition, offering a promising option for detecting LPS often present in a complex milieu.

  2. Harnessing Aptamers to Overcome Challenges in Gluten Detection

    PubMed Central

    Miranda-Castro, Rebeca; de-los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J.; Lobo-Castañón, María Jesús

    2016-01-01

    Celiac disease is a lifelong autoimmune disorder triggered by foods containing gluten, the storage protein in wheat, rye, and barley. The rapidly escalating number of patients diagnosed with this disease poses a great challenge to both food industry and authorities to guarantee food safety for all. Therefore, intensive efforts are being made to establish minimal disease-eliciting doses of gluten and consequently to improve gluten-free labeling. These efforts depend to a high degree on the availability of methods capable of detecting the protein in food samples at levels as low as possible. Current analytical approaches rely on the use of antibodies as selective recognition elements. With limited sensitivity, these methods exhibit some deficiencies that compromise the accuracy of the obtained results. Aptamers provide an ideal alternative for designing biosensors for fast and selective measurement of gluten in foods. This article highlights the challenges in gluten detection, the current status of the use of aptamers for solving this problem, and what remains to be done to move these systems into commercial applications. PMID:27104578

  3. A Selective Na(+) Aptamer Dissected by Sensitized Tb(3+) Luminescence.

    PubMed

    Zhou, Wenhu; Ding, Jinsong; Liu, Juewen

    2016-08-17

    A previous study of two RNA-cleaving DNAzymes, NaA43 and Ce13d, revealed the possibility of a common Na(+) aptamer motif. Because Na(+) binding to DNA is a fundamental biochemical problem, the interaction between Ce13d and Na(+) was studied in detail by using sensitized Tb(3+) luminescence spectroscopy. Na(+) displaces Tb(3+) from the DNAzyme, and thus quenches the emission from Tb(3+) . The overall requirement for Na(+) binding includes the hairpin and the highly conserved 16-nucleotide loop in the enzyme strand, along with a few unpaired nucleotides in the substrate. Mutation studies indicate good correlation between Na(+) binding and cleavage activity, thus suggesting a critical role of Na(+) binding for the enzyme activity. Ce13d displayed a Kd of ∼20 mm with Na(+) (other monovalent cations: 40-60 mm). The Kd values for other metal ions are mainly due to non-specific competition. With a single nucleotide mutation, the specific Na(+) binding was lost. Another mutant improved Kd to 8 mm with Na(+) . This study has demonstrated a Na(+) aptamer with important biological implications and analytical applications. It has also defined the structural requirements for Na(+) binding and produced an improved mutant. PMID:27238890

  4. Determination of endotoxin through an aptamer-based impedance biosensor.

    PubMed

    Su, Wenqiong; Lin, Meng; Lee, Hyuck; Cho, MiSuk; Choe, Woo-Seok; Lee, Youngkwan

    2012-02-15

    Lipopolysaccharide (LPS) often referred to endotoxin is an undesirable impurity frequently entrained with various recombinant protein therapeutics and plasmid DNA (pDNA) vaccines of bacterial origin. The inherent toxicities (e.g. fever, hypotension, shock and death) of LPS render its early and sensitive detection essential for several biological assays and/or parenteral administrations of biotherapeutics. In this study, an electrochemical biosensor using an LPS specific single stranded DNA (ssDNA) aptamer as a probe was developed. Amine-terminated aptamer exhibiting high affinity (K(d)=11.9 nM) to LPS was immobilized on a gold electrode using 3-mercaptopropionic acid (MPA) as a linker. Each step of the modification process was characterized by cyclic voltammetry (CV) and electrochemical impendence spectroscopy (EIS). A good linear relationship of the changes in the charge-transfer resistance (ΔR(et)) and the logarithmic value of LPS concentration was demonstrated in a broad dynamic detection range of 0.001-1 ng/ml. Furthermore, the aptasensor showed a high selectivity to LPS despite the presence of pDNA, RNA and bovine serum albumin (BSA) and could be regenerated in low pH condition, offering a promising option for detecting LPS often present in a complex milieu. PMID:22182428

  5. A Novel Quantum Dots-Based Point of Care Test for Syphilis

    NASA Astrophysics Data System (ADS)

    Yang, Hao; Li, Ding; He, Rong; Guo, Qin; Wang, Kan; Zhang, Xueqing; Huang, Peng; Cui, Daxiang

    2010-05-01

    One-step lateral flow test is recommended as the first line screening of syphilis for primary healthcare settings in developing countries. However, it generally shows low sensitivity. We describe here the development of a novel fluorescent POC (Point Of Care) test method to be used for screening for syphilis. The method was designed to combine the rapidness of lateral flow test and sensitiveness of fluorescent method. 50 syphilis-positive specimens and 50 healthy specimens conformed by Treponema pallidum particle agglutination (TPPA) were tested with Quantum Dot-labeled and colloidal gold-labeled lateral flow test strips, respectively. The results showed that both sensitivity and specificity of the quantum dots-based method reached up to 100% (95% confidence interval [CI], 91-100%), while those of the colloidal gold-based method were 82% (95% CI, 68-91%) and 100% (95% CI, 91-100%), respectively. In addition, the naked-eye detection limit of quantum dot-based method could achieve 2 ng/ml of anti-TP47 polyclonal antibodies purified by affinity chromatography with TP47 antigen, which was tenfold higher than that of colloidal gold-based method. In conclusion, the quantum dots were found to be suitable for labels of lateral flow test strip. Its ease of use, sensitiveness and low cost make it well-suited for population-based on-the-site syphilis screening.

  6. Thermodynamics and kinetics of adaptive binding in the malachite green RNA aptamer.

    PubMed

    Da Costa, Jason B; Andreiev, Aurelia I; Dieckmann, Thorsten

    2013-09-24

    Adaptive binding, the ability of molecules to fold themselves around the structure of a ligand and thereby incorporating it into their three-dimensional fold, is a key feature of most RNA aptamers. The malachite green aptamer (MGA) has been shown to bind several closely related triphenyl dyes with planar and nonplanar structures in this manner. Competitive binding studies using isothermal titration calorimetry and stopped flow kinetics have been conducted with the aim of understanding the adaptive nature of RNA-ligand interaction. The results of these studies reveal that binding of one ligand can reduce the ability of the aptamer pocket to adapt to another ligand, even if this second ligand has a significantly higher affinity to the free aptamer. A similar effect is observed in the presence of Mg(2+) ions which stabilize the binding pocket in a more ligand bound-like conformation.

  7. Integrated microfluidic device using a single universal aptamer to detect multiple types of influenza viruses.

    PubMed

    Wang, Chih-Hung; Chang, Chih-Peng; Lee, Gwo-Bin

    2016-12-15

    DNA aptamers that can bind specific molecular targets have great potential as probes for microbial diagnostic applications. However, aptamers may change their conformation under different operating conditions, thus affecting their affinity and specificity towards the target molecules. In this study, a new integrated microfluidic system was developed that exploited the predictable change in conformation of a single universal influenza aptamer exposed to differing ion concentrations in order to detect multiple types of the influenza virus. Furthermore, the fluorescent-labeled universal aptamer used in this system could distinguish and detect three different influenza viruses (influenza A H1N1, H3N2, and influenza B) at the same time in 20min and therefore has great potential for point-of-care applications requiring rapid diagnosis of influenza viruses.

  8. Fluorescence polarization biosensor based on an aptamer enzymatic cleavage protection strategy.

    PubMed

    Kidd, Anthony; Guieu, Valérie; Perrier, Sandrine; Ravelet, Corinne; Peyrin, Eric

    2011-12-01

    A novel fluorescence polarization (FP) aptasensing platform based on target-induced aptamer enzymatic cleavage protection is reported. The method relies on the FP analysis of the phosphodiesterase I mediated size variation of a dye-labeled aptamer. The tyrosinamide/antityrosinamide DNA aptamer couple was firstly tested as a model system to establish the proof-of-concept. In the absence of the target, the labeled aptamer was enzymatically cleaved into small DNA fragments, leading to a low FP signal. Upon tyrosinamide binding, the DNA substrate was partially protected against the enzymatic attack, leading to an increase in the fluorescence anisotropy response as a result of the higher average molecular volume of the weakly digested probe. The method was subsequently applied to two other systems, i.e., for the detection of ochratoxin A and adenosine. Such an approach was found to combine simplicity and general applicability features. PMID:21975602

  9. Single-Stranded DNA Aptamers against Pathogens and Toxins: Identification and Biosensing Applications

    PubMed Central

    Hong, Ka Lok; Sooter, Letha J.

    2015-01-01

    Molecular recognition elements (MREs) can be short sequences of single-stranded DNA, RNA, small peptides, or antibody fragments. They can bind to user-defined targets with high affinity and specificity. There has been an increasing interest in the identification and application of nucleic acid molecular recognition elements, commonly known as aptamers, since they were first described in 1990 by the Gold and Szostak laboratories. A large number of target specific nucleic acids MREs and their applications are currently in the literature. This review first describes the general methodologies used in identifying single-stranded DNA (ssDNA) aptamers. It then summarizes advancements in the identification and biosensing application of ssDNA aptamers specific for bacteria, viruses, their associated molecules, and selected chemical toxins. Lastly, an overview of the basic principles of ssDNA aptamer-based biosensors is discussed. PMID:26199940

  10. Label-free aptamer-based electrochemical impedance biosensor for 17β-estradiol.

    PubMed

    Lin, Zhenyu; Chen, Lifen; Zhang, Guiyun; Liu, Qida; Qiu, Bin; Cai, Zongwei; Chen, Guonan

    2012-02-21

    A novel aptamer-based label-free electrochemical impedance spectroscopy biosensor for 17β-estradiol has been fabricated. The aptamers were firstly immobilized on the gold electrode through Au-S interaction; the aptamer probe was then bound with the addition of 17β-estradiol to form the estradiol/aptamer complex on the electrode surface. This leads to a significantly larger interfacial electron transfer resistance than that without the addition of 17β-estradiol. The change in the resistance had a linear relationship with 17β-estradiol concentration in the range of 1.0 × 10(-8) to 1.0 × 10(-11) mol L(-1), with a detection limit of 2.0 × 10(-12) mol L(-1). The biosensor showed high selectivity to 17β-estradiol and good stability. The designed biosensor has been applied to detect 17β-estradiol in human urine with satisfactory results.

  11. Rational design of a structure-switching DNA aptamer for potassium ions

    PubMed Central

    Catherine, Andrew T.; Shishido, Stephanie N.; Robbins-Welty, Gregg A.; Diegelman-Parente, Amy

    2014-01-01

    Structure-switching molecules provide a unique means for analyte detection, generating a response to analyte concentration through a binding-specific conformational change between non-binding and binding-competent states. While most ligand-binding molecules are not structure switching by default, many can be engineered to be so through the introduction of an alternative non-binding (and thus non-signalling) conformation. This population-shift mechanism is particularly effective with oligonucleotides and has led to the creation of structure-switching aptamers for many target ligands. Here, we report the rational design of structure-switching DNA aptamers, based on the thrombin binding aptamer (TBA), that bind potassium with affinities that bridge the gap between previously reported weak-binding and strong-binding aptamers. We also demonstrate a correlation between the free energy of the experimentally determined binding affinity for potassium and the computationally estimated free energy of the alternative (non-binding) structure. PMID:25352996

  12. [Atomic force microscopy fishing of gp120 on immobilized aptamer and its mass spectrometry identification].

    PubMed

    Bukharina, N S; Ivanov, Yu D; Pleshakova, T O; Frantsuzov, P A; Andreeva, E Yu; Kaysheva, A L; Izotov, A A; Pavlova, T I; Ziborov, V S; Radko, S P; Archakov, A I

    2015-01-01

    A method of atomic force microscopy-based fishing (AFM fishing) has been developed for protein detection in the analyte solution using a chip with an immobilized aptamer. This method is based on the biospecific fishing of a target protein from a bulk solution onto the small AFM chip area with the immobilized aptamer to this protein used as the molecular probe. Such aptamer-based approach allows to increase an AFM image contrast compared to the antibody-based approach. Mass spectrometry analysis used after the biospecific fishing to identify the target protein on the AFM chip has proved complex formation. Use of the AFM chip with the immobilized aptamer avoids interference of the antibody and target protein peaks in a mass spectrum.

  13. Identification of DNA Aptamers toward Epithelial Cell Adhesion Molecule via Cell-SELEX

    PubMed Central

    Kim, Ji Won; Kim, Eun Young; Kim, Sun Young; Byun, Sang Kyung; Lee, Dasom; Oh, Kyoung-Jin; Kim, Won Kon; Han, Baek Soo; Chi, Seung-Wook; Lee, Sang Chul; Bae, Kwang-Hee

    2014-01-01

    The epithelial cell adhesion molecule (EpCAM, also known as CD326) is a transmembrane glycoprotein that is specifically detected in most adenocarcinomas and cancer stem cells. In this study, we performed a Cell systematic evolution of ligands by exponential enrichment (SELEX) experiment to isolate the aptamers against EpCAM. After seven round of Cell SELEX, we identified several aptamer candidates. Among the selected aptamers, EP166 specifically binds to cells expressing EpCAM with an equilibrium dissociation constant (Kd) in a micromolar range. On the other hand, it did not bind to negative control cells. Moreover, EP166 binds to J1ES cells, a mouse embryonic stem cell line. Therefore, the isolated aptamers against EpCAM could be used as a stem cell marker or in other applications in both stem cell and cancer studies. PMID:25266702

  14. Investigation of low-energy proton effects on aptamer performance for astrobiological applications.

    PubMed

    Baqué, M; Le Postollec, A; Ravelet, C; Peyrin, E; Coussot, G; Desvignes, I; Incerti, S; Moretto, P; Dobrijevic, M; Vandenabeele-Trambouze, O

    2011-04-01

    Biochips are promising instruments for the search for organic molecules in planetary environments. Nucleic acid aptamers are powerful affinity receptors known for their high affinity and specificity, and therefore are of great interest for space biochip development. A wide variety of aptamers have already been selected toward targets of astrobiological interest (from amino acids to microorganisms). We present a first study to test the resistance of these receptors to the constraints of the space environment. The emphasis is on the effect of cosmic rays on the molecular recognition properties of DNA aptamers. Experiments on beam-line facilities have been conducted with 2 MeV protons and fluences much higher than expected for a typical mission to Mars. Our results show that this irradiation process did not affect the performances of DNA aptamers as molecular recognition tools. PMID:21434764

  15. Efficient isolation and elution of cellular proteins using aptamer-mediated protein precipitation assay.

    PubMed

    Kim, Kiseok; Lee, SeungJin; Ryu, Sungho; Han, Dongil

    2014-05-23

    Protein precipitation is one of the most widely used methods for antigen detection and purification in biological research. We developed a reproducible aptamer-mediated magnetic protein precipitation method that is able to efficiently capture, purify and isolate the target proteins. We discovered DNA aptamers having individually high affinity and specificity against human epidermal growth factor receptor (EGFR) and human insulin receptor (INSR). Using aptamers and magnetic beads, we showed it is highly efficient technique to enrich endogenous proteins complex and is applicable to identify physiologically relevant protein-protein interactions with minimized nonspecific binding of proteins. The results presented here indicate that aptamers would be applicable as a useful and cost-effective tool to identify the presence of the particular target protein with their specific protein partners.

  16. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX

    PubMed Central

    Moosavian, Seyedeh Alia; Jaafari, Mahmoud Reza; Taghdisi, Seyed Mohammad; Mosaffa, Fatemeh; Badiee, Ali; Abnous, Khalil

    2015-01-01

    Objective(s): Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2) is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX). Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy. PMID:26221481

  17. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

    PubMed Central

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.

    2016-01-01

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622

  18. Aptamer-based label-free impedimetric biosensor for detection of progesterone.

    PubMed

    Contreras Jiménez, Gastón; Eissa, Shimaa; Ng, Andy; Alhadrami, Hani; Zourob, Mohammed; Siaj, Mohamed

    2015-01-20

    Rising progesterone (P4) levels in humans due to its overconsumption through hormonal therapy, food products, or drinking water can lead to many negative health effects. Thus, the simple and accurate assessment of P4 in both environmental and clinical samples is highly important to protect public health. In this work, we present the selection, identification, and characterization of ssDNA aptamers with high binding affinity to P4. The aptamers were selected in vitro from a single-stranded DNA library of 1.8 × 10(15) oligonucleotides showing dissociation constants (KD) in the low nanomolar range. The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fluorometric assay. Moreover, the aptamer P4G13 did not show cross-reactivity to analogues similar to progesterone such as 17β-estradiol (E2) and norethisterone (NET). An impedimetric aptasensor for progesterone was then fabricated based on the conformational change of P4G13 aptamer, immobilized on the gold electrode by self-assembly, upon binding to P4, which results in an increase in electron transfer resistance. Aptamer-complementary DNA (cDNA) oligonucleotides were tested to maximize the signal gain of the aptasensor after binding with progesterone. Significant signal enhancement was observed when the aptamer hybridized with a short complementary sequence at specific site was used instead of pure aptamer. This signal gain is likely due to the more significant conformational change of the aptamer-cDNA than the pure aptamer upon binding with P4, as confirmed by circular dichroism (CD) spectroscopy. The developed aptasensor exhibited a linear range for concentrations of P4 from 10 to 60 ng/mL with a detection limit of 0.90 ng/mL. Moreover, the aptasensor was applied in spiked tap water samples and showed good recovery percentages. The new selected progesterone aptamers can be exploited in further biosensing applications

  19. FRET-Aptamer Assays for Bone Marker Assessment, C-Telopeptide, Creatinine, and Vitamin D

    NASA Technical Reports Server (NTRS)

    Bruno, John G.

    2013-01-01

    Astronauts lose 1.0 to 1.5% of their bone mass per month on long-duration spaceflights. NASA wishes to monitor the bone loss onboard spacecraft to develop nutritional and exercise countermeasures, and make adjustments during long space missions. On Earth, the same technology could be used to monitor osteoporosis and its therapy. Aptamers bind to targets against which they are developed, much like antibodies. However, aptamers do not require animal hosts or cell culture and are therefore easier, faster, and less expensive to produce. In addition, aptamers sometimes exhibit greater affinity and specificity vs. comparable antibodies. In this work, fluorescent dyes and quenchers were added to the aptamers to enable pushbutton, one-step, bind-and-detect fluorescence resonance energy transfer (FRET) assays or tests that can be freeze-dried, rehydrated with body fluids, and used to quantitate bone loss of vitamin D levels with a handheld fluorometer in the spacecraft environment. This work generated specific, rapid, one-step FRET assays for the bone loss marker C-telopeptide (CTx) when extracted from urine, creatinine from urine, and vitamin D congeners in diluted serum. The assays were quantified in nanograms/mL using a handheld fluorometer connected to a laptop computer to convert the raw fluorescence values into concentrations of each analyte according to linear standard curves. DNA aptamers were selected and amplified for several rounds against a 26- amino acid form of CTx, creatinine, and vitamin D. The commonalities between loop structures were studied, and several common loop structures were converted into aptamer beacons with a fluorophore and quencher on each end. In theory, when the aptamer beacon binds its cognate target (CTx bone peptide, creatinine, or vitamin D), it is forced open and no longer quenched, so it gives off fluorescent light (when excited) in proportion to the amount of target present in a sample. This proportional increase in fluorescence is

  20. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

    PubMed Central

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

    2013-01-01

    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  1. Re-engineering aptamers to support reagentless, self-reporting electrochemical sensors.

    PubMed

    White, Ryan J; Rowe, Aaron A; Plaxco, Kevin W

    2010-03-01

    Electrochemical aptamer-based (E-AB) sensors have emerged as a promising and versatile new biosensor platform. Combining the generality and specificity of aptamer-ligand interactions with the selectivity and convenience of electrochemical readouts, this approach affords the detection of a wide variety of targets directly in complex, contaminant-ridden samples, such as whole blood, foodstuffs and crude soil extracts, without the need for exogenous reagents or washing steps. Signaling in this class of sensors is predicated on target-induced changes in the conformation of an electrode-bound probe aptamer that, in turn, changes the efficiency with which a covalently attached redox tag exchanges electrons with the interrogating electrode. Aptamer selection strategies, however, typically do not select for the conformation-switching architectures, and as such several approaches have been reported to date by which aptamers can be re-engineered such that they undergo the binding-induced switching required to support efficient E-AB signaling. Here, we systematically compare the merits of these re-engineering approaches using representative aptamers specific to the small molecule adenosine triphosphate and the protein human immunoglobulin E. We find that, while many aptamer architectures support E-AB signaling, the observed signal gain (relative change in signal upon target binding) varies by more than two orders of magnitude across the various constructs we have investigated (e.g., ranging from -10% to 200% for our ATP sensors). Optimization of the switching architecture is thus an important element in achieving maximum E-AB signal gain and we find that this optimal geometry is specific to the aptamer sequence upon which the sensor is built.

  2. Aptamer conjugated paclitaxel and magnetic fluid loaded fluorescently tagged PLGA nanoparticles for targeted cancer therapy

    NASA Astrophysics Data System (ADS)

    Aravind, Athulya; Nair, Remya; Raveendran, Sreejith; Veeranarayanan, Srivani; Nagaoka, Yutaka; Fukuda, Takahiro; Hasumura, Takahashi; Morimoto, Hisao; Yoshida, Yasuhiko; Maekawa, Toru; Sakthi Kumar, D.

    2013-10-01

    Controlled and targeted drug delivery is an essential criterion in cancer therapy to reduce the side effects caused by non-specific drug release and toxicity. Targeted chemotherapy, sustained drug release and optical imaging have been achieved using a multifunctional nanocarrier constructed from poly (D, L-lactide-co-glycolide) nanoparticles (PLGA NPs), an anticancer drug paclitaxel (PTX), a fluorescent dye Nile red (NR), magnetic fluid (MF) and aptamers (Apt, AS1411, anti-nucleolin aptamer). The magnetic fluid and paclitaxel loaded fluorescently labeled PLGA NPs (MF-PTX-NR-PLGA NPs) were synthesized by a single-emulsion technique/solvent evaporation method using a chemical cross linker bis (sulfosuccinimidyl) suberate (BS3) to enable binding of aptamer on to the surface of the nanoparticles. Targeting aptamers were then introduced to the particles through the reaction with the cross linker to target the nucleolin receptors over expressed on the cancer cell surface. Specific binding and uptake of the aptamer conjugated magnetic fluid loaded fluorescently tagged PLGA NPs (Apt-MF-NR-PLGA NPs) to the target cancer cells induced by aptamers was observed using confocal microscopy. Cytotoxicity assay conducted in two cell lines (L929 and MCF-7) confirmed that targeted MCF-7 cancer cells were killed while control cells were unharmed. In addition, aptamer mediated delivery resulting in enhanced binding and uptake to the target cancer cells exhibited increased therapeutic effect of the drug. Moreover, these aptamer conjugated magnetic polymer vehicles apart from actively transporting drugs into specifically targeted tumor regions can also be used to induce hyperthermia or for facilitating magnetic guiding of particles to the tumor regions.

  3. Aptamers as targeting delivery devices or anti-cancer drugs for fighting tumors.

    PubMed

    Scaggiante, Bruna; Dapas, Barbara; Farra, Rossella; Grassi, Mario; Pozzato, Gabriele; Giansante, Carlo; Fiotti, Nicola; Tamai, Elisa; Tonon, Federica; Grassi, Gabriele

    2013-06-01

    Aptamer researches applied to the treatment of human cancers have increased since their discovery in 1990. This is due to different factors including: 1) the technical possibility to select, by SELEX-based procedures, specific aptamers targeting virtually any given molecule, 2) the aptamer favorable bio-activity in vivo, 3) the low production costs and 4) the ease synthesis and storage for the marketing. In the field of cancer treatments, aptamers have been studied as tumor-specific agents driving drugs into cancer cells; additionally they have been used as anti-neoplastic agents, able to inhibit tumor cell growth and dissemination when administered alone or in combination with conventional anti-neoplastic drugs. Aptamers are gaining an increased interest for pharmaceutical companies and some of them are under clinical evaluation trials. In this review we update the findings about the use of aptamers as "escort" molecules able to drive drugs into the cells and as antineoplastic drugs. Current anti-neoplastic treatments suffer from the intrinsic toxicity related to the un-specific targeting of both normal and tumorigenic proliferating cells. The aptamers could be useful to improve: 1) the selective targeting of molecules essential for the viability and expansion of tumor cells and/or the selective driving of chemotherapies into tumor cells, thus resulting in higher effectiveness and lower systemic side-effects compared to conventional anti-neoplastic drugs alone and 2) to improve the therapeutic index of currently used chemotherapies. Even if some problems related to the in vivo stability and pharmacokinetic/dynamics of aptamers remain to be improved, their potential use in the treatment of different human cancers is getting closer and closer to a practical therapeutic use.

  4. Nucleic Acid Aptamers: An Emerging Tool for Biotechnology and Biomedical Sensing

    PubMed Central

    Ku, Ti-Hsuan; Zhang, Tiantian; Luo, Hua; Yen, Tony M.; Chen, Ping-Wei; Han, Yuanyuan; Lo, Yu-Hwa

    2015-01-01

    Detection of small molecules or proteins of living cells provides an exceptional opportunity to study genetic variations and functions, cellular behaviors, and various diseases including cancer and microbial infections. Our aim in this review is to give an overview of selected research activities related to nucleic acid-based aptamer techniques that have been reported in the past two decades. Limitations of aptamers and possible approaches to overcome these limitations are also discussed. PMID:26153774

  5. Cross-Protection of Influenza A Virus Infection by a DNA Aptamer Targeting the PA Endonuclease Domain

    PubMed Central

    Yuan, Shuofeng; Zhang, Naru; Singh, Kailash; Shuai, Huiping; Chu, Hin; Zhou, Jie; Chow, Billy K. C.

    2015-01-01

    Amino acid residues in the N-terminal of the PA subunit (PAN) of the influenza A virus polymerase play critical roles in endonuclease activity, protein stability, and viral RNA (vRNA) promoter binding. In addition, PAN is highly conserved among different subtypes of influenza virus, which suggests PAN to be a desired target in the development of anti-influenza agents. We selected DNA aptamers targeting the intact PA protein or the PAN domain of an H5N1 virus strain using systematic evolution of ligands by exponential enrichment (SELEX). The binding affinities of selected aptamers were measured, followed by an evaluation of in vitro endonuclease inhibitory activity. Next, the antiviral effects of enriched aptamers against influenza A virus infections were examined. A total of three aptamers targeting PA and six aptamers targeting PAN were selected. Our data demonstrated that all three PA-selected aptamers neither inhibited endonuclease activity nor exhibited antiviral efficacy, whereas four of the six PAN-selected aptamers inhibited both endonuclease activity and H5N1 virus infection. Among the four effective aptamers, one exhibited cross-protection against infections of H1N1, H5N1, H7N7, and H7N9 influenza viruses, with a 50% inhibitory concentration (IC50) of around 10 nM. Notably, this aptamer was identified at the 5th round but disappeared after the 10th round of selection, suggesting that the identification and evaluation of aptamers at early rounds of selection may be highly helpful for screening effective aptamers. Overall, our study provides novel insights for screening and developing effective aptamers for use as anti-influenza drugs. PMID:25918143

  6. In vitro selection of ssDNA aptamers using biotinylated target proteins.

    PubMed

    Mayer, Günter; Höver, Thomas

    2009-01-01

    Aptamers are single-stranded nucleic acids that bind specifically to a target molecule and thus often inhibit target-associated biological functions. Aptamers have been described for a series of target molecules including peptides, proteins, and even living cells. Besides RNA and 20-modified RNA molecules also ssDNA molecules can be subjected to in vitro selection protocols aiming at the enrichment of ssDNA aptamers. ssDNA aptamers can be selected using the SELEX procedure (systematic enrichment of ligands by exponential amplification) from libraries of randomized single-stranded DNA with a diversity of up to 10(16) different molecules. In repetitive selection cycles, the library is incubated with the target of choice and separation of non-binding sequences from bound sequences is achieved by distinct separation methods. The bound molecules are specifically eluted and amplified, thus representing the starting library for the next cycle. Thereby, an enriched population of aptamers is evolved. Here we describe a generalized in vitro selection experiment aiming at the enrichment of ssDNA aptamers using biotinylated target molecules. This procedure allows the application of streptavidin-biotin chemistry to separate bound from unbound DNA species during the selection process.

  7. DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin.

    PubMed

    Vivekananda, Jeevalatha; Salgado, Christi; Millenbaugh, Nancy J

    2014-02-14

    Staphylococcus aureus is a versatile pathogen capable of causing a broad spectrum of diseases ranging from superficial skin infections to life threatening conditions such as endocarditis, septicemia, pneumonia and toxic shock syndrome. In vitro and in vivo studies identified an exotoxin, α-toxin, as a major cause of S. aureus toxicity. Because S. aureus has rapidly evolved resistance to a number of antibiotics, including methicillin, it is important to identify new therapeutic strategies, other than antibiotics, for inhibiting the harmful effects of this pathogen. Aptamers are single-stranded DNA or RNA oligonucleotides with three-dimensional folded conformations that bind with high affinity and selectivity to targets and modulate their biological functions. The goal of this study was to isolate DNA aptamers that specifically inhibit the cytotoxic activity of α-toxin. After 10 rounds of Systematic Evolution of Ligands by EXponential Enrichment (SELEX), 49 potential anti-α-toxin aptamers were identified. In vitro neutralization assays demonstrated that 4 of these 49 aptamers, AT-27, AT-33, AT-36, and AT-49, significantly inhibited α-toxin-mediated cell death in Jurkat T cells. Furthermore, RT-PCR analysis revealed that α-toxin increased the transcription of the inflammatory cytokines TNF-α and IL-17 and that anti-α-toxin aptamers AT-33 and AT-36 inhibited the upregulation of these genes. Collectively, the data suggest the feasibility of generating functionally effective aptamers against α-toxin for treatment of S. aureus infections.

  8. Structure-affinity relationship of the cocaine-binding aptamer with quinine derivatives.

    PubMed

    Slavkovic, Sladjana; Altunisik, Merve; Reinstein, Oren; Johnson, Philip E

    2015-05-15

    In addition to binding its target molecule, cocaine, the cocaine-binding aptamer tightly binds the alkaloid quinine. In order to understand better how the cocaine-binding aptamer interacts with quinine we have used isothermal titration calorimetry-based binding experiments to study the interaction of the cocaine-binding aptamer to a series of structural analogs of quinine. As a basis for comparison we also investigated the binding of the cocaine-binding aptamer to a set of cocaine metabolites. The bicyclic aromatic ring on quinine is essential for tight affinity by the cocaine-binding aptamer with 6-methoxyquinoline alone being sufficient for tight binding while the aliphatic portion of quinine, quinuclidine, does not show detectable binding. Compounds with three fused aromatic rings are not bound by the aptamer. Having a methoxy group at the 6-position of the bicyclic ring is important for binding as substituting it with a hydrogen, an alcohol or an amino group all result in lower binding affinity. For all ligands that bind, association is driven by a negative enthalpy compensated by unfavorable binding entropy.

  9. DNA aptamers for selective identification and separation of flame retardant chemicals.

    PubMed

    Kim, Un-Jung; Kim, Byoung Chan

    2016-09-14

    Polybrominated diphenyl ethers (PBDEs) are group of chemicals which are representative persistent organic pollutants (POPs) and used as brominated flame retardants for many consumer products. PBDEs were phased out since 2009 but are still frequently observed in various environmental matrices and human body. Here, we report ssDNA aptamers which bind to BDE47, one of the PBDE congeners commonly found in various environmental matrices, and show affinity to other major tri-to hepta- BDE congeners. The PBDE specific aptamers were isolated from random library of ssDNA using Mag-SELEX. Two out of 15 sequences, based on their alignment and hairpin loop structures, were chosen to determine dissociation constant with BDE47 and showed from picomolar to nanomolar affinities (200 pM and 1.53 nM). The aptamers displayed high selectivity to the original target, BDE47, and implying general specificity to PBDE backbone with varying affinities to other congeners. Further, we showed that the use of two aptamers together could enhance the separation efficiency of BDE47 and other BDE congeners when dissolved in a solvent compared to use of single aptamer. These aptamers are expected to provide a tool for preliminary screening or quick separation of PBDEs in environmental samples prior to trace quantitative analysis.

  10. Probing high-affinity 11-mer DNA aptamer against Lup an 1 (β-conglutin).

    PubMed

    Nadal, P; Svobodova, M; Mairal, T; O'Sullivan, C K

    2013-11-01

    Aptamers are synthetic nucleic acids with great potential as analytical tools. However, the length of selected aptamers (typically 60-100 bases) can affect affinity, due to the presence of bases not required for interaction with the target, and therefore, the truncation of these selected sequences and identification of binding domains is a critical step to produce potent aptamers with higher affinities and specificities and lowered production costs. In this paper we report the truncation of an aptamer that specifically binds to β-conglutin (Lup an 1), an anaphylactic allergen. Through comparing the predicted secondary structures of the aptamers, a hairpin structure with a G-rich loop was determined to be the binding motif. The highest affinity was observed with a truncation resulting in an 11-mer sequence that had an apparent equilibrium dissociation constant (K D) of 1.7 × 10(-9) M. This 11-mer sequence was demonstrated to have high specificity for β-conglutin and showed no cross-reactivity to other lupin conglutins (α-, δ-, γ-conglutins) and closely related proteins such as gliadin. Finally, the structure of the truncated 11-mer aptamer was preliminarily elucidated, and the GQRS Mapper strongly predicted the presence of a G-quadruplex, which was subsequently corroborated using one-dimensional NMR, thus highlighting the stability of the truncated structure. PMID:24126837

  11. Sensor Based on Aptamer Folding to Detect Low-Molecular Weight Analytes.

    PubMed

    Osypova, Alina; Thakar, Dhruv; Dejeu, Jérôme; Bonnet, Hugues; Van der Heyden, Angéline; Dubacheva, Galina V; Richter, Ralf P; Defrancq, Eric; Spinelli, Nicolas; Coche-Guérente, Liliane; Labbé, Pierre

    2015-08-01

    Aptamers have emerged as promising biorecognition elements in the development of biosensors. The present work focuses on the application of quartz crystal microbalance with dissipation monitoring (QCM-D) for the enantioselective detection of a low molecular weight target molecule (less than 200 Da) by aptamer-based sensors. While QCM-D is a powerful technique for label-free, real-time characterization and quantification of molecular interactions at interfaces, the detection of small molecules interacting with immobilized receptors still remains a challenge. In the present study, we take advantage of the aptamer conformational changes upon the target binding that induces displacement of water acoustically coupled to the sensing layer. As a consequence, this phenomenon leads to a significant enhancement of the detection signal. The methodology is exemplified with the enantioselective recognition of a low molecular weight model compound, L-tyrosinamide (L-Tym). QCM-D monitoring of L-Tym interaction with the aptamer monolayer leads to an appreciable signal that can be further exploited for analytical purposes or thermodynamics studies. Furthermore, in situ combination of QCM-D with spectroscopic ellipsometry unambiguously demonstrates that the conformational change induces a nanometric decrease of the aptamer monolayer thickness. Since QCM-D is sensitive to the whole mass of the sensing layer including water that is acoustically coupled, a decrease in thickness of the highly hydrated aptamer layer induces a sizable release of water that can be easily detected by QCM-D. PMID:26122480

  12. A naturally occurring, noncanonical GTP aptamer made of simple tandem repeats.

    PubMed

    Curtis, Edward A; Liu, David R

    2014-01-01

    Recently, we used in vitro selection to identify a new class of naturally occurring GTP aptamer called the G motif. Here we report the discovery and characterization of a second class of naturally occurring GTP aptamer, the "CA motif." The primary sequence of this aptamer is unusual in that it consists entirely of tandem repeats of CA-rich motifs as short as three nucleotides. Several active variants of the CA motif aptamer lack the ability to form consecutive Watson-Crick base pairs in any register, while others consist of repeats containing only cytidine and adenosine residues, indicating that noncanonical interactions play important roles in its structure. The circular dichroism spectrum of the CA motif aptamer is distinct from that of A-form RNA and other major classes of nucleic acid structures. Bioinformatic searches indicate that the CA motif is absent from most archaeal and bacterial genomes, but occurs in at least 70 percent of approximately 400 eukaryotic genomes examined. These searches also uncovered several phylogenetically conserved examples of the CA motif in rodent (mouse and rat) genomes. Together, these results reveal the existence of a second class of naturally occurring GTP aptamer whose sequence requirements, like that of the G motif, are not consistent with those of a canonical secondary structure. They also indicate a new and unexpected potential biochemical activity of certain naturally occurring tandem repeats.

  13. Microfluidic chip system for the selection and enrichment of cell binding aptamers

    PubMed Central

    Stoll, Heidi; Kiessling, Heiko; Stelzle, Martin; Wendel, Hans Peter; Schütte, Julia; Hagmeyer, Britta; Avci-Adali, Meltem

    2015-01-01

    Aptamers are promising cell targeting ligands for several applications such as for the diagnosis, therapy, and drug delivery. Especially, in the field of regenerative medicine, stem cell specific aptamers have an enormous potential. Using the combinatorial chemistry process SELEX (Systematic Evolution of Ligands by Exponential enrichment), aptamers are selected from a huge oligonucleotide library consisting of approximately 1015 different oligonucleotides. Here, we developed a microfluidic chip system that can be used for the selection of cell specific aptamers. The major drawbacks of common cell-SELEX methods are the inefficient elimination of the unspecifically bound oligonucleotides from the cell surface and the unspecific binding/uptake of oligonucleotides by dead cells. To overcome these obstacles, a microfluidic device, which enables the simultaneous performance of dielectrophoresis and electrophoresis in the same device, was designed. Using this system, viable cells can be selectively assembled by dielectrophoresis between the electrodes and then incubated with the oligonucleotides. To reduce the rate of unspecifically bound sequences, electrophoretic fields can be applied in order to draw loosely bound oligonucleotides away from the cells. Furthermore, by increasing the flow rate in the chip during the iterative rounds of SELEX, the selection pressure can be improved and aptamers with higher affinities and specificities can be obtained. This new microfluidic device has a tremendous capability to improve the cell-SELEX procedure and to select highly specific aptamers. PMID:26180568

  14. Generation and characterization of quinolone-specific DNA aptamers suitable for water monitoring.

    PubMed

    Reinemann, C; Freiin von Fritsch, U; Rudolph, S; Strehlitz, B

    2016-03-15

    Quinolones are antibiotics that are accredited in human and veterinary medicine but are regularly used in high quantities also in industrial livestock farming. Since these compounds are often only incompletely metabolized, significant amounts contaminate the aquatic environment and negatively impact on a variety of different ecosystems. Although there is increasing awareness of problems caused by pharmaceutical pollution, available methods for the detection and elimination of numerous pharmaceutical residues are currently inefficient or expensive. While this also applies to antibiotics that may lead to multi-drug resistance in pathogenic bacteria, aptamer-based technologies potentially offer alternative approaches for sensitive and efficient monitoring of pharmaceutical micropollutants. Using the Capture-SELEX procedure, we here describe the selection of an aptamer pool with enhanced binding qualities for fluoroquinolones, a widely used group of antibiotics in both human and veterinary medicine. The selected aptamers were shown to detect various quinolones with high specificity, while specific binding activities to structurally unrelated drugs were not detectable. The quinolone-specific aptamers bound to ofloxacin, one of the most frequently prescribed fluoroquinolone, with high affinity (KD=0.1-56.9 nM). The functionality of quinolone-specific aptamers in real water samples was demonstrated in local tap water and in effluents of sewage plants. Together, our data suggest that these aptamers may be applicable as molecular receptors in biosensors or as catcher molecules in filter systems for improved monitoring and treatment of polluted water.

  15. A Microfluidic Love-Wave Biosensing Device for PSA Detection Based on an Aptamer Beacon Probe.

    PubMed

    Zhang, Feng; Li, Shuangming; Cao, Kang; Wang, Pengjuan; Su, Yan; Zhu, Xinhua; Wan, Ying

    2015-06-11

    A label-free and selective aptamer beacon-based Love-wave biosensing device was developed for prostate specific antigen (PSA) detection. The device consists of the following parts: LiTaO3 substrate with SiO2 film as wave guide layer, two set of inter-digital transducers (IDT), gold film for immobilization of the biorecongniton layer and a polydimethylsiloxane (PDMS) microfluidic channels. DNA aptamer, or "artificial antibody", was used as the specific biorecognition probe for PSA capture. Some nucleotides were added to the 3'-end of the aptamer to form a duplex with the 3'-end, turning the aptamer into an aptamer-beacon. Taking advantage of the selective target-induced assembly changes arising from the "aptamer beacon", highly selective and specific detection of PSA was achieved. Furthermore, PDMS microfluidic channels were designed and fabricated to realize automated quantitative sample injection. After optimization of the experimental conditions, the established device showed good performance for PSA detection between 10 ng/mL to 1 μg/mL, with a detection limit of 10 ng/mL. The proposed sensor might be a promising alternative for point of care diagnostics.

  16. Methods for Evaluating Cell-Specific, Cell-Internalizing RNA Aptamers

    PubMed Central

    Hernandez, Luiza I.; Flenker, Katie S.; Hernandez, Frank J.; Klingelhutz, Aloysius J.; II, James O. McNamara; Giangrande, Paloma H.

    2013-01-01

    Recent clinical trials of small interfering RNAs (siRNAs) highlight the need for robust delivery technologies that will facilitate the successful application of these therapeutics to humans. Arguably, cell targeting by conjugation to cell-specific ligands provides a viable solution to this problem. Synthetic RNA ligands (aptamers) represent an emerging class of pharmaceuticals with great potential for targeted therapeutic applications. For targeted delivery of siRNAs with aptamers, the aptamer-siRNA conjugate must be taken up by cells and reach the cytoplasm. To this end, we have developed cell-based selection approaches to isolate aptamers that internalize upon binding to their cognate receptor on the cell surface. Here we describe methods to monitor for cellular uptake of aptamers. These include: (1) antibody amplification microscopy, (2) microplate-based fluorescence assay, (3) a quantitative and ultrasensitive internalization method (“QUSIM”) and (4) a way to monitor for cytoplasmic delivery using the ribosome inactivating protein-based (RNA-RIP) assay. Collectively, these methods provide a toolset that can expedite the development of aptamer ligands to target and deliver therapeutic siRNAs in vivo. PMID:23894227

  17. Detection of Cryptosporidium parvum Oocysts on Fresh Produce Using DNA Aptamers

    PubMed Central

    Muharemagic, Darija; Sattar, Syed; Dixon, Brent R.; Berezovski, Maxim V.

    2015-01-01

    There are currently no standard methods for the detection of Cryptosporidium spp., or other protozoan parasites, in foods, and existing methods are often inadequate, with low and variable recovery efficiencies. Food testing is difficult due to the low concentrations of parasites, the difficulty in eluting parasites from some foods, the lack of enrichment methods, and the presence of PCR inhibitors. The main objectives of the present study were to obtain DNA aptamers binding to the oocyst wall of C. parvum, and to use the aptamers to detect the presence of this parasite in foods. DNA aptamers were selected against C. parvum oocysts using SELEX (Systematic Evolution of Ligands by EXponential enrichment). Ten rounds of selection led to the discovery of 14 aptamer clones with high affinities for C. parvum oocysts. For detecting parasite-bound aptamers, a simple electrochemical sensor was employed, which used a gold nanoparticle-modified screen-printed carbon electrode. This aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and the anti- C. parvum aptamer. Square wave voltammetry was employed to quantitate C. parvum in the range of 150 to 800 oocysts, with a detection limit of approximately 100 oocysts. The high sensitivity and specificity of the developed aptasensor suggests that this novel method is very promising for the detection and identification of C. parvum oocysts on spiked fresh fruits, as compared to conventional methods such as microscopy and PCR. PMID:26334529

  18. Inhibition of Receptor Signaling and of Glioblastoma-derived Tumor Growth by a Novel PDGFRβ Aptamer

    PubMed Central

    Camorani, Simona; Esposito, Carla L; Rienzo, Anna; Catuogno, Silvia; Iaboni, Margherita; Condorelli, Gerolama; de Franciscis, Vittorio; Cerchia, Laura

    2014-01-01

    Platelet-derived growth factor receptor β (PDGFRβ) is a cell-surface tyrosine kinase receptor implicated in several cellular processes including proliferation, migration, and angiogenesis. It represents a compelling therapeutic target in many human tumors, including glioma. A number of tyrosine kinase inhibitors under development as antitumor agents have been found to inhibit PDGFRβ. However, they are not selective as they present multiple tyrosine kinase targets. Here, we report a novel PDGFRβ-specific antagonist represented by a nuclease-resistant RNA-aptamer, named Gint4.T. This aptamer is able to specifically bind to the human PDGFRβ ectodomain (Kd: 9.6 nmol/l) causing a strong inhibition of ligand-dependent receptor activation and of downstream signaling in cell lines and primary cultures of human glioblastoma cells. Moreover, Gint4.T aptamer drastically inhibits cell migration and proliferation, induces differentiation, and blocks tumor growth in vivo. In addition, Gint4.T aptamer prevents PDGFRβ heterodimerization with and resultant transactivation of epidermal growth factor receptor. As a result, the combination of Gint4.T and an epidermal growth factor receptor–targeted aptamer is better at slowing tumor growth than either single aptamer alone. These findings reveal Gint4.T as a PDGFRβ-drug candidate with translational potential. PMID:24566984

  19. DNA aptamers for selective identification and separation of flame retardant chemicals.

    PubMed

    Kim, Un-Jung; Kim, Byoung Chan

    2016-09-14

    Polybrominated diphenyl ethers (PBDEs) are group of chemicals which are representative persistent organic pollutants (POPs) and used as brominated flame retardants for many consumer products. PBDEs were phased out since 2009 but are still frequently observed in various environmental matrices and human body. Here, we report ssDNA aptamers which bind to BDE47, one of the PBDE congeners commonly found in various environmental matrices, and show affinity to other major tri-to hepta- BDE congeners. The PBDE specific aptamers were isolated from random library of ssDNA using Mag-SELEX. Two out of 15 sequences, based on their alignment and hairpin loop structures, were chosen to determine dissociation constant with BDE47 and showed from picomolar to nanomolar affinities (200 pM and 1.53 nM). The aptamers displayed high selectivity to the original target, BDE47, and implying general specificity to PBDE backbone with varying affinities to other congeners. Further, we showed that the use of two aptamers together could enhance the separation efficiency of BDE47 and other BDE congeners when dissolved in a solvent compared to use of single aptamer. These aptamers are expected to provide a tool for preliminary screening or quick separation of PBDEs in environmental samples prior to trace quantitative analysis. PMID:27566357

  20. Sensor Based on Aptamer Folding to Detect Low-Molecular Weight Analytes.

    PubMed

    Osypova, Alina; Thakar, Dhruv; Dejeu, Jérôme; Bonnet, Hugues; Van der Heyden, Angéline; Dubacheva, Galina V; Richter, Ralf P; Defrancq, Eric; Spinelli, Nicolas; Coche-Guérente, Liliane; Labbé, Pierre

    2015-08-01

    Aptamers have emerged as promising biorecognition elements in the development of biosensors. The present work focuses on the application of quartz crystal microbalance with dissipation monitoring (QCM-D) for the enantioselective detection of a low molecular weight target molecule (less than 200 Da) by aptamer-based sensors. While QCM-D is a powerful technique for label-free, real-time characterization and quantification of molecular interactions at interfaces, the detection of small molecules interacting with immobilized receptors still remains a challenge. In the present study, we take advantage of the aptamer conformational changes upon the target binding that induces displacement of water acoustically coupled to the sensing layer. As a consequence, this phenomenon leads to a significant enhancement of the detection signal. The methodology is exemplified with the enantioselective recognition of a low molecular weight model compound, L-tyrosinamide (L-Tym). QCM-D monitoring of L-Tym interaction with the aptamer monolayer leads to an appreciable signal that can be further exploited for analytical purposes or thermodynamics studies. Furthermore, in situ combination of QCM-D with spectroscopic ellipsometry unambiguously demonstrates that the conformational change induces a nanometric decrease of the aptamer monolayer thickness. Since QCM-D is sensitive to the whole mass of the sensing layer including water that is acoustically coupled, a decrease in thickness of the highly hydrated aptamer layer induces a sizable release of water that can be easily detected by QCM-D.

  1. Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis

    SciTech Connect

    Chen, Fan; Zhou, Jing; Luo, Fengling; Mohammed, Al-Bayati; Zhang, Xiao-Lian . E-mail: zxl_65@163.com

    2007-06-08

    Worldwide, tuberculosis (TB) remains the most frequent and important infectious disease causing morbidity and death. One-third of the world's population is infected with Mycobacterium tuberculosis (MTB), the etiologic agent of TB. Because of the global health problems of TB, the development of potent new anti-TB drugs without cross-resistance with known antimycobacterial agents is urgently needed. In this study, we have applied a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process to identify a single aptamer (NK2) that binds to virulent strain M. tuberculosis (H37Rv) with high affinity and specificity. We have found that this aptamer improves CD4{sup +}T cells to produce IFN-{gamma} after binding to H37Rv. The different component between H37Rv and BCG was identified as some membrane protein. Moreover, the survival rates of mice challenged with i.v. H37Rv have been prolonged after treatment with single injection of aptamer NK2. The bacterial numbers were significantly lower in the spleen of mice treated with aptamer NK2. The histopathological examination of lung biopsy specimens showed lesser pulmonary alveolar fusion and swelling in the presence of the aptamer. These results suggest that aptamer NK2 has inhibitory effects on M. tuberculosis and can be used as antimycobacterial agent.

  2. Screening and Identification of ssDNA Aptamer for Human GP73

    PubMed Central

    Du, Jingchun; Hong, Jianming; Xu, Chun; Cai, Yuanyuan; Xiang, Bo; Zhou, Chengbo; Xu, Xia

    2015-01-01

    As one tumor marker of HCC, Golgi Protein 73 (GP73) is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens. PMID:26583119

  3. Selection and Characterization of an α6β4 Integrin blocking DNA Aptamer

    PubMed Central

    Berg, Katharina; Lange, Tobias; Mittelberger, Florian; Schumacher, Udo; Hahn, Ulrich

    2016-01-01

    The heterodimeric laminin receptor α6β4 integrin plays a central role in the promotion of tumor cell growth, invasion, and organotropic metastasis. As an overproduction of the integrin is often linked to a poor prognosis, the inhibition of integrin α6β4 binding to laminin is of high therapeutical interest. Here, we report on the combination of a cell-systematic evolution of ligands by exponential enrichment and a bead-based selection resulting in the first aptamer inhibiting the interaction between α6β4 integrin and laminin-332. This Integrin α6β4-specific DNA Aptamer (IDA) inhibits the adhesion of prostate cancer cells (PC-3) to laminin-332 with an IC50 value of 149 nmol/l. The Kd value concerning the aptamer's interaction with PC-3 cells amounts to 137 nmol/l. Further characterization showed specificity to α6 integrins and a half-life in murine blood plasma of 6 hours. Two truncated versions of the aptamer retained their binding capacity, but lost their ability to inhibit the interaction between laminin-332 and PC-3 cells. Confocal laser scanning microscope studies revealed that the aptamer was internalized into PC-3-cells. Therefore, in addition to the adhesion-blocking function of this aptamer, IDA could also be applied for the delivery of siRNA, microRNA or toxins to cancer cells presenting the integrin α6β4. PMID:26978578

  4. Oligonucleotide aptamer-drug conjugates for targeted therapy of acute myeloid leukemia

    PubMed Central

    Zhao, Nianxi; Pei, Sung-Nan; Qi, Jianjun; Zeng, Zihua; Iyer, Swaminathan P.; Pei, Lin; Tung, Ching-Hsuan; Zu, Youli

    2015-01-01

    Oligonucleotide aptamers can specifically bind biomarkers on cancer cells and can be readily chemically modified with different functional molecules for personalized medicine. To target acute myeloid leukemia (AML) cells, we developed a single-strand DNA aptamer specific for the biomarker CD117, which is highly expressed on AML cells. Sequence alignment revealed that the aptamer contained a G-rich core region with a well-conserved functional G-quadruplex structure. Functional assays demonstrated that this synthetic aptamer was able to specifically precipitate CD117 proteins from cell lysates, selectively bound cultured and patient primary AML cells with high affinity (Kd < 5 nM), and was specifically internalized into CD117-expressing cells. For targeted AML treatment, aptamer-drug conjugates were fabricated by chemical synthesis of aptamer (Apt) with methotrexate (MTX), a central drug used in AML chemotherapy regimens. The formed Apt-MTX conjugates specifically inhibited AML cell growth, triggered cell apoptosis, and induced cell cycle arrest in G1 phase. Importantly, Apt-MTX had little effect on CD117-negative cells under the same treatment conditions. Moreover, exposure of patient marrow specimens to Apt-MTX resulted in selective growth inhibition of primary AML cells and had no toxicity to off-target background normal marrow cells within the same specimens. These findings indicate the potential clinical value of Apt-MTX for targeted AML therapy with minimal to no side effects in patients, and also open an avenue to chemical synthesis of new, targeted biotherapeutics. PMID:26204224

  5. Structure-affinity relationship of the cocaine-binding aptamer with quinine derivatives.

    PubMed

    Slavkovic, Sladjana; Altunisik, Merve; Reinstein, Oren; Johnson, Philip E

    2015-05-15

    In addition to binding its target molecule, cocaine, the cocaine-binding aptamer tightly binds the alkaloid quinine. In order to understand better how the cocaine-binding aptamer interacts with quinine we have used isothermal titration calorimetry-based binding experiments to study the interaction of the cocaine-binding aptamer to a series of structural analogs of quinine. As a basis for comparison we also investigated the binding of the cocaine-binding aptamer to a set of cocaine metabolites. The bicyclic aromatic ring on quinine is essential for tight affinity by the cocaine-binding aptamer with 6-methoxyquinoline alone being sufficient for tight binding while the aliphatic portion of quinine, quinuclidine, does not show detectable binding. Compounds with three fused aromatic rings are not bound by the aptamer. Having a methoxy group at the 6-position of the bicyclic ring is important for binding as substituting it with a hydrogen, an alcohol or an amino group all result in lower binding affinity. For all ligands that bind, association is driven by a negative enthalpy compensated by unfavorable binding entropy. PMID:25858454

  6. Recent Progress in Nucleic Acid Aptamer-Based Biosensors and Bioassays

    PubMed Central

    Mok, Wendy; Li, Yingfu

    2008-01-01

    As the key constituents of the genetic code, the importance of nucleic acids to life has long been appreciated. Despite being composed of only four structurally similar nucleotides, single-stranded nucleic acids, as in single-stranded DNAs and RNAs, can fold into distinct three-dimensional shapes due to specific intramolecular interactions and carry out functions beyond serving as templates for protein synthesis. These functional nucleic acids (FNAs) can catalyze chemical reactions, regulate gene expression, and recognize target molecules. Aptamers, whose name is derived from the Latin word aptus meaning “to fit”, are oligonucleotides that can bind their target ligands with high affinity and specificity. Since aptamers exist in nature but can also be artificially isolated from pools of random nucleic acids through a process called in vitro selection, they can potentially bind a diverse array of compounds. In this review, we will discuss the research that is being done to develop aptamers against various biomolecules, the progress in engineering biosensors by coupling aptamers to signal transducers, and the prospect of employing these sensors for a range of chemical and biological applications. Advances in aptamer technology emphasizes that nucleic acids are not only the fundamental molecules of life, they can also serve as research tools to enhance our understanding of life. The possibility of using aptamer-based tools in drug discovery and the identification of infectious agents can ultimately augment our quality of life.

  7. Screening and Identification of ssDNA Aptamer for Human GP73.

    PubMed

    Du, Jingchun; Hong, Jianming; Xu, Chun; Cai, Yuanyuan; Xiang, Bo; Zhou, Chengbo; Xu, Xia

    2015-01-01

    As one tumor marker of HCC, Golgi Protein 73 (GP73) is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens.

  8. Generation and characterization of quinolone-specific DNA aptamers suitable for water monitoring.

    PubMed

    Reinemann, C; Freiin von Fritsch, U; Rudolph, S; Strehlitz, B

    2016-03-15

    Quinolones are antibiotics that are accredited in human and veterinary medicine but are regularly used in high quantities also in industrial livestock farming. Since these compounds are often only incompletely metabolized, significant amounts contaminate the aquatic environment and negatively impact on a variety of different ecosystems. Although there is increasing awareness of problems caused by pharmaceutical pollution, available methods for the detection and elimination of numerous pharmaceutical residues are currently inefficient or expensive. While this also applies to antibiotics that may lead to multi-drug resistance in pathogenic bacteria, aptamer-based technologies potentially offer alternative approaches for sensitive and efficient monitoring of pharmaceutical micropollutants. Using the Capture-SELEX procedure, we here describe the selection of an aptamer pool with enhanced binding qualities for fluoroquinolones, a widely used group of antibiotics in both human and veterinary medicine. The selected aptamers were shown to detect various quinolones with high specificity, while specific binding activities to structurally unrelated drugs were not detectable. The quinolone-specific aptamers bound to ofloxacin, one of the most frequently prescribed fluoroquinolone, with high affinity (KD=0.1-56.9 nM). The functionality of quinolone-specific aptamers in real water samples was demonstrated in local tap water and in effluents of sewage plants. Together, our data suggest that these aptamers may be applicable as molecular receptors in biosensors or as catcher molecules in filter systems for improved monitoring and treatment of polluted water. PMID:26547431

  9. Large scale analysis of the mutational landscape in HT-SELEX improves aptamer discovery

    PubMed Central

    Hoinka, Jan; Berezhnoy, Alexey; Dao, Phuong; Sauna, Zuben E.; Gilboa, Eli; Przytycka, Teresa M.

    2015-01-01

    High-Throughput (HT) SELEX combines SELEX (Systematic Evolution of Ligands by EXponential Enrichment), a method for aptamer discovery, with massively parallel sequencing technologies. This emerging technology provides data for a global analysis of the selection process and for simultaneous discovery of a large number of candidates but currently lacks dedicated computational approaches for their analysis. To close this gap, we developed novel in-silico methods to analyze HT-SELEX data and utilized them to study the emergence of polymerase errors during HT-SELEX. Rather than considering these errors as a nuisance, we demonstrated their utility for guiding aptamer discovery. Our approach builds on two main advancements in aptamer analysis: AptaMut—a novel technique allowing for the identification of polymerase errors conferring an improved binding affinity relative to the ‘parent’ sequence and AptaCluster—an aptamer clustering algorithm which is to our best knowledge, the only currently available tool capable of efficiently clustering entire aptamer pools. We applied these methods to an HT-SELEX experiment developing aptamers against Interleukin 10 receptor alpha chain (IL-10RA) and experimentally confirmed our predictions thus validating our computational methods. PMID:25870409

  10. A Microfluidic Love-Wave Biosensing Device for PSA Detection Based on an Aptamer Beacon Probe

    PubMed Central

    Zhang, Feng; Li, Shuangming; Cao, Kang; Wang, Pengjuan; Su, Yan; Zhu, Xinhua; Wan, Ying

    2015-01-01

    A label-free and selective aptamer beacon-based Love-wave biosensing device was developed for prostate specific antigen (PSA) detection. The device consists of the following parts: LiTaO3 substrate with SiO2 film as wave guide layer, two set of inter-digital transducers (IDT), gold film for immobilization of the biorecongniton layer and a polydimethylsiloxane (PDMS) microfluidic channels. DNA aptamer, or “artificial antibody”, was used as the specific biorecognition probe for PSA capture. Some nucleotides were added to the 3'-end of the aptamer to form a duplex with the 3'-end, turning the aptamer into an aptamer-beacon. Taking advantage of the selective target-induced assembly changes arising from the “aptamer beacon”, highly selective and specific detection of PSA was achieved. Furthermore, PDMS microfluidic channels were designed and fabricated to realize automated quantitative sample injection. After optimization of the experimental conditions, the established device showed good performance for PSA detection between 10 ng/mL to 1 μg/mL, with a detection limit of 10 ng/mL. The proposed sensor might be a promising alternative for point of care diagnostics. PMID:26110408

  11. Engineering Signaling Aptamers That Rely on Kinetic Rather Than Equilibrium Competition.

    PubMed

    Du, Yan; Zhen, Shu Jun; Li, Bingling; Byrom, Michelle; Jiang, Yu Sherry; Ellington, Andrew D

    2016-02-16

    During the past decade, aptasensors have largely been designed on the basis of the notion that ligand-modulated equilibration between aptamer conformations could be exploited for sensing. One implementation of this strategy has been to denature the aptamer with an antisense oligonucleotide, wait for dissociation of the antisense oligonucleotide, and stabilize the folded, signaling conformer with a ligand. However, there is a large kinetic barrier associated with releasing the oligonucleotide from the aptamer to again obtain an active, binding conformation. If the length of the antisense oligonucleotide is decreased to make dissociation from the aptamer more favorable, higher background signals are observed. To improve the general methodology for developing aptasensors, we have developed a novel and robust strategy for aptasensor design in which an oligonucleotide kinetically competes with the ligand for binding rather than having to be released from a stable duplex. While the oligonucleotide can induce conformational change, it initially chooses between the aptamer and a molecular beacon (MB), a process that does not require a lengthy pre-equilibration. Using an anti-ricin aptamer as a starting point, we developed a "competitive" aptasensor with a measured limit of detection (LOD) of 30 nM with an optical readout and as low as 3 nM for ricin toxin A-chain (RTA) detection on an electrochemical platform.

  12. A novel reconfigurable optical biosensor based on DNA aptamers and a DNA molecular beacon.

    PubMed

    Buranachai, Chittanon; Thavarungkul, Panote; Kanatharana, Proespichaya

    2012-11-01

    In order to alter a typical molecular aptamer beacon (MAB) to detect a different analyte there is currently a need to change the whole sensor unit including the expensive labeling fluorophores. In this work a DNA-based reconfigurable molecular aptamer beacon was developed. It is composed of two parts: a variable part and a constant part. The variable part comprises an aptamer strand and its complementary strand while the constant part is an oligonucleotide doubly labeled with a Förster Resonance Energy Transfer (FRET) pair and the two parts become joined via DNA hybridization. The sensor exists in two conformations: a folded (high FRET) and an unfolded (low FRET) in the absence and presence of the aptamer-target binding respectively. This sensor can be reconfigured by washing away the aptamer and the complementary strand using proper complementary strands, called washers. As a proof of the principle, a sensor that bound the enzyme thrombin, an analyte with a strong binding, was first constructed and then reconfigured to bind adenosine, selected as an analyte with a weak binding. We believe that the design is of universal use applicable to many types of aptamers.

  13. Biosensor-based on-site explosives detection using aptamers as recognition elements.

    PubMed

    Ehrentreich-Förster, Eva; Orgel, Dagmar; Krause-Griep, Andrea; Cech, Birgit; Erdmann, Volker A; Bier, Frank; Scheller, F W; Rimmele, Martina

    2008-07-01

    Reliable observation, detection and characterisation of polluted soil are of major concern in regions with military activities in order to prepare efficient decontamination. Flexible on-site analysis may be facilitated by biosensor devices. With use of fibre-optic evanescent field techniques, it has been shown that immunoaffinity reactions can be used to determine explosives sensitively. Besides antibodies as molecular recognition elements, high-affinity nucleic acids (aptamers) can be employed. Aptamers are synthetically generated and highly efficient binding molecules that can be derived for any ligand, including small organic molecules like drugs, explosives or derivatives thereof. In this paper we describe the development of specific aptamers detecting the explosives molecule TNT. The aptamers are used as a sensitive capture molecule in a fibre-optic biosensor. In addition, through the biosensor measurements the aptamers could be characterised. The advantages of the aptamer biosensor include its robustness, its ability to discriminate between different explosives molecules while being insensitive to other chemical entities in natural soil and its potential to be incorporated into a portable device. Results can be obtained within minutes. The measurement is equally useful for soil that has been contaminated for a long time and for urgent hazardous spills.

  14. Capturing Single Molecules of Immunoglobulin and Ricin with an Aptamer-Encoded Glass Nanopore

    PubMed Central

    Ding, Shu; Gao, Changlu; Gu, Li-Qun

    2010-01-01

    Nanopore-based single-molecule biosensors have been extensively studied. Protein pores that have receptors attached to them are target-selective, but their real-time applications are limited by the fragility of the lipid membrane into which the protein pores are embedded. Synthetic nanopores are more stable and provide flexible pore sizes, but the selectivity is low when detecting in the translocation mode. In spite of modifications with probing molecules, such as antibodies, to potentiate specific targeting, these nanopores fail to bind individual target molecules. Distinguishing between binding and translocation blocks remains unsolved. Here, we propose an aptamer-encoded nanopore that overcomes these challenges. Aptamers are well-known probing oligonucleotides that have high sensitivity and selectivity. In contrast to antibodies, aptamers are much smaller than their targets, rendering target blockades in the nanopore much more distinguishable. We used aptamer-encoded nanopores to detect single molecules of immunoglobulin E and the bioterrorist agent ricin, sequentially captured by the immobilized aptamer in the sensing zone of the pore. The functional nanopore also probed sequence-dependent aptamer-protein interactions. These findings will facilitate the development of a universal nanopore for multitarget detection. PMID:19627120

  15. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    PubMed

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  16. Thrombin-linked aptamer assay for detection of platelet derived growth factor BB on magnetic beads in a sandwich format.

    PubMed

    Guo, Limin; Zhao, Qiang

    2016-09-01

    Here we describe a thrombin-linked aptamer assay (TLAA) for protein by using thrombin as an enzyme label, harnessing enzyme activity of thrombin and aptamer affinity binding. TLAA converts detection of specific target proteins to the detection of thrombin by using a DNA sequence that consists of two aptamers with the first aptamer binding to the specific target protein and the second aptamer binding to thrombin. Through the affinity binding, the thrombin enzyme is labeled on the protein target, and thrombin catalyzes the hydrolysis of small peptide substrate into product, generating signals for quantification. As a proof of principle, we show a sandwich TLAA for platelet derived growth factor BB (PDGF-BB) by using anti-PDGF-BB antibody coated on magnetic beads and an oligonucleotide containing the aptamer for PDGF-BB and the aptamer for thrombin. The binding of PDGF-BB to both the antibody and the aptamer results in labeling the complex with thrombin. We achieved detection of PDGF-BB at 16 pM. This TLAA contributes a new application of thrombin and its aptamer in bioanalysis, and shows potentials in assay developments. PMID:27343590

  17. Selection and characterization of novel DNA aptamers specifically recognized by Singapore grouper iridovirus-infected fish cells.

    PubMed

    Li, Pengfei; Wei, Shina; Zhou, Lingli; Yang, Min; Yu, Yepin; Wei, Jingguang; Jiang, Guohua; Qin, Qiwei

    2015-11-01

    Singapore grouper iridovirus (SGIV) is a major viral pathogen of grouper aquaculture, and has caused heavy economic losses in China and South-east Asia. In this study, we generated four ssDNA aptamers against SGIV-infected grouper spleen (GS) cells using SELEX (systematic evolution of ligands by exponential enrichment) technology. Four aptamers exhibited high affinity to SGIV-infected GS cells, in particular the Q2 aptamer. Q2 had a binding affinity of 12.09 nM, the highest of the four aptamers. These aptamers also recognized SGIV-infected tissues with high levels of specificity. Protease treatment and flow cytometry analysis of SGIV-infected cells revealed that the target molecules of the Q3, Q4 and Q5 aptamers were trypsin-sensitive proteins, whilst the target molecules of Q2 might be membrane lipids or surface proteins that were not trypsin-sensitive. The generated aptamers appeared to inhibit SGIV infection in vitro. Aptamer Q2 conferred the highest levels of protection against SGIV and was able to inhibit SGIV infection in a dose-dependent manner. In addition, Q2 was efficiently internalized by SGIV-infected GS cells and localized at the viral assembly sites. Our results demonstrated that the four novel aptamers we generated were specific for SGIV-infected cells and could potentially be applied as rapid molecular diagnostic test reagents or therapeutic drugs targeting SGIV.

  18. Identification and Characterization of an eIF4e DNA Aptamer That Inhibits Proliferation With High Throughput Sequencing

    PubMed Central

    Guo, Wei Mei; Kong, Kiat Whye; Brown, Christopher John; Quah, Soo Tng; Yeo, Hui Ling; Hoon, Shawn; Seow, Yiqi

    2014-01-01

    Development of DNA aptamer screens that are both simple and informative can increase the success rate of DNA aptamer selection and induce greater adoption. High eIF4e levels contribute to malignancies, thus eIF4e presents itself as a valuable target for DNA aptamer-based inhibition screen. Here, we demonstrate a method for the rapid selection of looped DNA aptamers against eIF4e by combining negative selection and purification in a single step, followed by characterization with high throughput sequencing. The resulting aptamers show functional binding to eIF4e and inhibit translation initiation in biochemical assays. When transfected into cells, eIF4e aptamers cause a dramatic loss of cell proliferation in tumor cells as seen with eIF4e knockdown with antisense oligonucleotides, shRNAs, and siRNAs, hinting at therapeutic possibilities. With the large data set provided by high throughput sequencing, we demonstrate that selection happens in waves and that sequencing data can be used to infer aptamer structure. Lastly, we show that ligation of looped aptamers can enhance their functional effects. These results demonstrate a rapid protocol to screen and optimize aptamers against macromolecules of interest. PMID:25514650

  19. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    PubMed Central

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5′-end also contributes essentially to the aptameric function. PMID:27650576

  20. Pharmacokinetics of a Cholesterol-conjugated Aptamer Against the Hepatitis C Virus (HCV) NS5B Protein

    PubMed Central

    Lee, Chang Ho; Lee, Soo-Han; Kim, Ji Hyun; Noh, Yook-Hwan; Noh, Gyu-Jeong; Lee, Seong-Wook

    2015-01-01

    Hepatitis C virus (HCV) is the major cause of progressive liver disease such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Previously, we reported that a 29 nucleotide-long 2'-F pyrimidine modified RNA aptamer against the HCV nonstructural protein 5B efficiently inhibited HCV replication and suppressed HCV infectious virus particle formation in a cell culture system. In this study, we modified this aptamer through conjugation of cholesterol for in vivo availability. This cholesterol-conjugated aptamer (chol-aptamer) efficiently entered the cell and inhibited HCV RNA replication, without any alteration in gene expression profiling including innate immune response-related genes. Moreover, systemic administration of the chol-aptamer was well tolerated without any abnormalities in mice. To evaluate the pharmacokinetics of the chol-aptamer in vivo, dose proportionality, bioavailability, and pharmacokinetic parameters were evaluated by noncompartmental analyses in normal BALB/c mice. Population analysis was performed using nonlinear mixed effects modeling. Moreover, the pharmacokinetics of two different routes (intravenous, IV, versus intraperitoneal, IP) were compared. Cholesterol conjugation showed dose proportionality, extended the time that the aptamer was in the plasma, and enhanced aptamer exposure to the body. Noticeably, the IV route was more suitable than the IP route due to the chol-aptamer remaining in the plasma for a longer period of time. PMID:26440598

  1. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis.

    PubMed

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure.

  2. Aptamer RA36 inhibits of human, rabbit, and rat plasma coagulation activated with thrombin or snake venom coagulases.

    PubMed

    Savchik, E Yu; Kalinina, T B; Drozd, N N; Makarov, V A; Zav'yalova, E G; Lapsheva, E N; Mudrik, N N; Babij, A V; Pavlova, G V; Golovin, A V; Kopylov, A M

    2013-11-01

    RA36 DNA aptamer is a direct anticoagulant prolonging clotting time of human, rabbit, and rat plasma in the thrombin time test. Anticoagulant activity of RA36 is lower than that of recombinant hirudin. During inhibition of human plasma clotting activated with echitox (coagulase from Echis multisquamatus venom), the aptamer presumably binds to meisothrombin exosite I. The sensitivity of human plasma to the aptamer 5-fold surpasses that of rat plasma. Analysis of RA36 binding to coagulase of Agkistrodon halys venom (ancistron) is required for proving the effect of aptamer on polymerization of human fibrinogen. PMID:24319726

  3. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    PubMed

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function. PMID:27650576

  4. Inhibition of cell adhesion by anti–P-selectin aptamer: a new potential therapeutic agent for sickle cell disease

    PubMed Central

    Gutsaeva, Diana R.; Parkerson, James B.; Yerigenahally, Shobha D.; Kurz, Jeffrey C.; Schaub, Robert G.; Ikuta, Tohru

    2011-01-01

    Adhesive interactions between circulating sickle red blood cells (RBCs), leukocytes, and endothelial cells are major pathophysiologic events in sickle cell disease (SCD). To develop new therapeutics that efficiently inhibit adhesive interactions, we generated an anti–P-selectin aptamer and examined its effects on cell adhesion using knockout-transgenic SCD model mice. Aptamers, single-stranded oligonucleotides that bind molecular targets with high affinity and specificity, are emerging as new therapeutics for cardiovascular and hematologic disorders. In vitro studies found that the anti–P-selectin aptamer exhibits high specificity to mouse P-selectin but not other selectins. SCD mice were injected with the anti–P-selectin aptamer, and cell adhesion was observed under hypoxia. The anti–P-selectin aptamer inhibited the adhesion of sickle RBCs and leukocytes to endothelial cells by 90% and 80%, respectively. The anti–P-selectin aptamer also increased microvascular flow velocities and reduced the leukocyte rolling flux. SCD mice treated with the anti–P-selectin aptamer demonstrated a reduced mortality rate associated with the experimental procedures compared with control mice. These results demonstrate that anti–P-selectin aptamer efficiently inhibits the adhesion of both sickle RBCs and leukocytes to endothelial cells in SCD model mice, suggesting a critical role for P-selectin in cell adhesion. Anti–P-selectin aptamer may be useful as a novel therapeutic agent for SCD. PMID:20926770

  5. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis

    PubMed Central

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P.

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure. PMID:25140011

  6. Development of a fluorescent enzyme-linked DNA aptamer-magnetic bead sandwich assay and portable fluorometer for sensitive and rapid leishmania detection in sandflies.

    PubMed

    Bruno, John G; Richarte, Alicia M; Phillips, Taylor; Savage, Alissa A; Sivils, Jeffrey C; Greis, Alex; Mayo, Michael W

    2014-01-01

    A fluorescent peroxidase-linked DNA aptamer-magnetic bead sandwich assay is described which detects as little as 100 ng of soluble protein extracted from Leishmania major promastigotes with a high molarity chaotropic salt. Lessons learned during development of the assay are described and elucidate the pros and cons of using fluorescent dyes or nanoparticles and quantum dots versus a more consistent peroxidase-linked Amplex Ultra Red (AUR; similar to resazurin) fluorescence version of the assay. While all versions of the assays were highly sensitive, the AUR-based version exhibited lower variability between tests. We hypothesize that the AUR version of this assay is more consistent, especially at low analyte levels, because the fluorescent product of AUR is liberated into bulk solution and readily detectable while fluorophores attached to the reporter aptamer might occasionally be hidden behind magnetic beads near the detection limit. Conversely, fluorophores could be quenched by nearby beads or other proximal fluorophores on the high end of analyte concentration, if packed into a small area after magnetic collection when an enzyme-linked system is not used. A highly portable and rechargeable battery-operated fluorometer with on board computer and color touchscreen is also described which can be used for rapid (<1 h) and sensitive detection of Leishmania promastigote protein extracts (∼ 100 ng per sample) in buffer or sandfly homogenates for mapping of L. major parasite geographic distributions in wild sandfly populations.

  7. Secondary error analysis: The evaluation of analyst dot labeling

    NASA Technical Reports Server (NTRS)

    Havens, K. A. (Principal Investigator)

    1978-01-01

    The author has identified the following significant results. From this examination of 25 test segments using Al labeling and ground truth labeling, the PCC on type 1 dots was found to be signficantly better for both types of ground truth labeled procedures than the PCC obtained using Al labeling. No significant difference in the PCC was found for type 2 dots. However, in all three treatments, the type 2 dots included pixels which fell on boundaries or were mixed pixels. This accounted for all PCC2 values being equally low. The proportion estimates achieved in these classifications showed no significant differences between procedures.

  8. Aptamer-Mediated Delivery of Chemotherapy to Pancreatic Cancer Cells

    PubMed Central

    Ray, Partha; Cheek, Marcus A.; Sharaf, Mariam L.; Li, Na; Ellington, Andrew D.; Sullenger, Bruce A.; Shaw, Barbara Ramsay

    2012-01-01

    Gemcitabine is a nucleoside analog that is currently the best available single-agent chemotherapeutic drug for pancreatic cancer. However, efficacy is limited by our inability to deliver sufficient active metabolite into cancer cells without toxic effects on normal tissues. Targeted delivery of gemcitabine into cancer cells could maximize effectiveness and concurrently minimize toxic side effects by reducing uptake into normal cells. Most pancreatic cancers overexpress epidermal growth factor receptor (EGFR), a trans-membrane receptor tyrosine kinase. We utilized a nuclease resistant RNA aptamer that binds and is internalized by EGFR on pancreatic cancer cells to deliver gemcitabine-containing polymers into EGFR-expressing cells and inhibit cell proliferation in vitro. This approach to cell type–specific therapy can be adapted to other targets and to other types of therapeutic cargo. PMID:23030589

  9. Highly efficient inhibition of human immunodeficiency virus type 1 reverse transcriptase by aptamers functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Shiang, Yen-Chun; Ou, Chung-Mao; Chen, Shih-Ju; Ou, Ting-Yu; Lin, Han-Jia; Huang, Chih-Ching; Chang, Huan-Tsung

    2013-03-01

    We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45-Au NPs shows inhibitory efficiency in the retroviral replication cycle with a decreasing infectivity (40.2%).We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45

  10. Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP

    PubMed Central

    Guerra-Pérez, Natalia; Ramos, Edurne; García-Hernández, Marta; Pinto, Celia; Soto, Manuel; Martín, M. Elena; González, Víctor M.

    2015-01-01

    Summary A poly (A)-binding protein from Leishmania infantum (LiPABP) has been recently cloned and characterized in our laboratory. Although this protein shows a very high homology with PABPs from other eukaryotic organisms including mammals and other parasites, exist divergences along the sequence that convert them in potential diagnostic markers and/or therapeutics targets. Aptamers are oligonucleotide ligands that are selected in vitro by their affinity and specificity for the target as a consequence of the particular tertiary structure that they are able to acquire depending on their sequence. Development of high-affinity molecules with the ability to recognize specifically Leishmania proteins is essential for the progress of this kind of study. Results We have selected a ssDNA aptamer population against a recombinant 6xHIS–LiPABP protein (rLiPABP) that is able to recognize the target with a low Kd. Cloning, sequencing and in silico analysis of the aptamers obtained from the population yielded three aptamers (ApPABP#3, ApPABP#7 and ApPABP#11) that significantly bound to PABP with higher affinity than the naïve population. These aptamers were analyzed by ELONA and slot blot to establish affinity and specificity for rLiPABP. Results demonstrated that the three aptamers have high affinity and specificity for the target and that they are able to detect an endogenous LiPABP (eLiPABP) protein amount corresponding to 2500 L. infantum promastigotes in a significant manner. The functional analysis of the aptamers also revealed that ApPABP#11 disrupts the binding of both Myc-LiPABP and eLiPABP to poly (A) in vitro. On the other hand, these aptamers are able to bind and purify LiPABP from complex mixes. Conclusion Results presented here demonstrate that aptamers represent new reagents for characterization of LiPABP and that they can affect LiPABP activity. At this respect, the use of these aptamers as therapeutic tool affecting the physiological role of PABP has to be

  11. Selection of a high-affinity and in vivo bioactive ssDNA aptamer against angiotensin II peptide.

    PubMed

    Heiat, Mohammad; Ranjbar, Reza; Latifi, Ali Mohammad; Rasaee, Mohammad Javad

    2016-08-01

    Unique features of aptamers have attracted interests for a broad range of applications. Aptamers are able to specifically bind to targets and inhibit their functions. This study, aimed to isolate the high affinity ssDNA aptamers against bio-regulator peptide angiotensin II (Ang II) and investigate their bioactivity in cellular and animal models. To isolate ssDNA aptamers, 12 rounds of affinity chromatography SELEX (Systematic Evolution of Ligands by EXponential enrichment) procedure were carried out. The SPR (surface plasmon resonance) and ELONA (enzyme linked oligonucleotide assay) analysis were used to determine the affinity and specificity of aptamers. The ability of selected aptamers to inhibit the proliferative effect of Ang II on human aortic vascular smooth muscle cells (HA-VSMCs) and their performance on Wistar rat urinary system and serum electrolyte levels were investigated. Two full-length aptamers (FLC112 and FLC125) with high affinity of respectively 7.52±2.44E-10 and 5.87±1.3E-9M were isolated against Ang II. The core regions of these aptamers (CRC112 and CRC125) also showed affinity of 5.33±1.15E-9 and 4.11±1.09E-9M. In vitro analysis revealed that FLC112 and FLC125 can inhibit the proliferative effect of Ang II on HA-VSMCs (P<0.05). They also significantly reduced the serum sodium level and increased the urine volume (P<0.05). The core regions of aptamers did not show high inhibitory potential against Ang II. It can be a spotlight that ssDNA aptamers have high potential for blocking Ang II. In conclusion, it appears that the researches focusing on high affinity and bioactive aptamers may lead to excellent results in blocking Ang II activity. PMID:27298205

  12. RAID3 - An interleukin-6 receptor-binding aptamer with post-selective modification-resistant affinity

    PubMed Central

    Mittelberger, Florian; Meyer, Cindy; Waetzig, Georg H; Zacharias, Martin; Valentini, Erica; Svergun, Dmitri I; Berg, Katharina; Lorenzen, Inken; Grötzinger, Joachim; Rose-John, Stefan; Hahn, Ulrich

    2015-01-01

    Aptamers are an emerging class of highly specific targeting ligands. They can be selected in vitro for a large variety of targets, ranging from small molecules to whole cells. Most aptamers selected are nucleic acid-based, allowing chemical synthesis and easy modification. Although their properties make them interesting drug candidates for a broad spectrum of applications and an interesting alternative to antibodies or fusion proteins, they are not yet broadly used. One major drawback of aptamers is their susceptibility to abundant serum nucleases, resulting in their fast degradation in biological fluids. Using modified nucleic acids has become a common strategy to overcome these disadvantages, greatly increasing their half-life under cell culture conditions or even in vivo. Whereas pre-selective modifications of the initial library for aptamer selection are relatively easy to obtain, post-selective modifications of already selected aptamers are still generally very labor-intensive and often compromise the aptamers ability to bind its target molecule. Here we report the selection, characterization and post-selective modification of a 34 nucleotide (nt) RNA aptamer for a non-dominant, novel target site (domain 3) of the interleukin-6 receptor (IL-6R). We performed structural analyses and investigated the affinity of the aptamer to the membrane-bound and soluble forms (sIL-6R) of the IL-6R. Further, we performed structural analyses of the aptamer in solution using small-angle X-ray scattering and determined its overall shape and oligomeric state. Post-selective exchange of all pyrimidines against their 2′-fluoro analogs increased the aptamers stability significantly without compromising its affinity for the target protein. The resulting modified aptamer could be shortened to its minimal binding motif without loss of affinity. PMID:26383776

  13. The expression platform and the aptamer: cooperativity between Mg2+ and ligand in the SAM-I riboswitch

    PubMed Central

    Hennelly, Scott P.; Novikova, Irina V.; Sanbonmatsu, Karissa Y.

    2013-01-01

    Riboswitch operation involves the complex interplay between the aptamer domain and the expression platform. During transcription, these two domains compete against each other for shared sequence. In this study, we explore the cooperative effects of ligand binding and Magnesium interactions in the SAM-I riboswitch in the context of aptamer collapse and anti-terminator formation. Overall, our studies show the apo-aptamer acts as (i) a pre-organized aptamer competent to bind ligand and undergo structural collapse and (ii) a conformation that is more accessible to anti-terminator formation. We show that both Mg2+ ions and SAM are required for a collapse transition to occur. We then use competition between the aptamer and expression platform for shared sequence to characterize the stability of the collapsed aptamer. We find that SAM and Mg2+ interactions in the aptamer are highly cooperative in maintaining switch polarity (i.e. aptamer ‘off-state’ versus anti-terminator ‘on-state’). We further show that the aptamer off-state is preferentially stabilized by Mg2+ and similar divalent ions. Furthermore, the functional switching assay was used to select for phosphorothioate interference, and identifies potential magnesium chelation sites while characterizing their coordinated role with SAM in aptamer stabilization. In addition, we find that Mg2+ interactions with the apo-aptamer are required for the full formation of the anti-terminator structure, and that higher concentrations of Mg2+ (>4 mM) shift the equilibrium toward the anti-terminator on-state even in the presence of SAM. PMID:23258703

  14. Hi-Fi SELEX: A High-Fidelity Digital-PCR Based Therapeutic Aptamer Discovery Platform.

    PubMed

    Ouellet, Eric; Foley, Jonathan H; Conway, Edward M; Haynes, Charles

    2015-08-01

    Current technologies for aptamer discovery typically leverage the systematic evolution of ligands by exponential enrichment (SELEX) concept by recursively panning semi-combinatorial ssDNA or RNA libraries against a molecular target. The expectation is that this iterative selection process will be sufficiently stringent to identify a candidate pool of specific high-affinity aptamers. However, failure of this process to yield promising aptamers is common, due in part to (i) limitations in library designs, (ii) retention of non-specific aptamers during screening rounds, (iii) excessive accumulation of amplification artifacts, and (iv) the use of screening criteria (binding affinity) that does not reflect therapeutic activity. We report a new selection platform, High-Fidelity (Hi-Fi) SELEX, that introduces fixed-region blocking elements to safeguard the functional diversity of the library. The chemistry of the target-display surface and the composition of the equilibration solvent are engineered to strongly inhibit non-specific retention of aptamers. Partition efficiencies approaching 10(6) are thereby realized. Retained members are amplified in Hi-Fi SELEX by digital PCR in a manner that ensures both elimination of amplification artifacts and stoichiometric conversion of amplicons into the single-stranded library required for the next selection round. Improvements to aptamer selections are first demonstrated using human α-thrombin as the target. Three clinical targets (human factors IXa, X, and D) are then subjected to Hi-Fi SELEX. For each, rapid enrichment of ssDNA aptamers offering an order-nM mean equilibrium dissociation constant (Kd) is achieved within three selection rounds, as quantified by a new label-free qPCR assay reported here. Therapeutic candidates against factor D are identified.

  15. Neutralizing DNA Aptamers against Swine Influenza H3N2 Viruses

    PubMed Central

    Wongphatcharachai, Manoosak; Wang, Ping; Enomoto, Shinichiro; Webby, Richard J.; Gramer, Marie R.; Amonsin, Alongkorn

    2013-01-01

    Triple reassortant influenza A viruses (IAVs) of swine, particularly the North American H3N2 subtype, circulate in swine herds and may reassort and result in the emergence of novel zoonotic strains. Current diagnostic tools rely on isolation of the viruses, followed by serotyping by hemagglutination or genome sequencing, both of which can be expensive and time-consuming. Thus, novel subtype-specific ligands and methods are needed for rapid testing and subtyping of IAVs in the field. To address this need, we selected DNA aptamers against the recombinant HA protein from swine IAV H3 cluster IV using systematic evolution of ligands by exponential enrichment (SELEX). Four candidate aptamers (HA68, HA7, HA2a, and HA2b) were identified and characterized. The dissociation constants (Kd) of aptamers HA68, HA7, HA2a, and HA2b against recombinant H3 protein were 7.1, 22.3, 16.0, and 3.7 nM, respectively. The binding site of HA68 to H3 was identified to be between nucleotide residues 8 and 40. All aptamers inhibited H3 hemagglutination. HA68 was highly specific to all four lineages within the North American H3N2 subtype. Further, the other three aptamers specifically identified live viruses belonging to the phylogenetic clusters I, II/III, and IV especially the virus that closely related to the recent H3N2 variant (H3N2v). Aptamer HA68 was also able to bind and detect H3N2v isolated from recent human cases. In conclusion, we provide subtype-specific aptamers against H3N2 IAVs of swine that can now be used in rapid detection and typing protocols for field applications. PMID:23077124

  16. [Resonance scattering spectral detection of trace K+ by aptamer-modified nanogold probe].

    PubMed

    Liu, Qing-ye; Fan, Yan-yan; Li, Ting-sheng; Liang, Ai-hui; Jiang, Zhi-liang

    2010-11-01

    In pH 7.0 Na2HPO4-NaH2PO4 buffer solution, nanogold particles interacted with the aptamer to form a stable aptamer-nanogold complex that was not aggregation by NaCl. At 80 degrees C, K+ and aptamer folded to form a stable G-quadruplex that released nanogold particles, the uncombined nanogold particles aggregated to large nanogold clusters that caused the increase in resonance scattering (RS) intensity at 563 nm in high concentration of NaCl, and the laser scattering showed that the average diameter was 120 nm. In the present paper, the resonance scattering spectral characteristics of K+ -ssDNA1-Au, K+ -ssDNA2-Au and K+ -aptamer-Au systems were investigated, and the structural changes of aptamer were studied by circular dichroism spectral technology. Effects of pH value, NaCl concentration, nanogold concentration, aptamer concentration, and the reactation temperature and time on the resonance scattering intensity were considered in detail. The influence of coexistent substances on the determination of K+ was investigated, result showed that the common heavy metal ions such as Cu2+, Mg2+, Pb2+, Ca2+, Al3+, Zn2+ and Fe3+ do not interfere with the determination, and the method has good selectivity. Under the conditions selected, a 0. 67-3 350 micromol x L(-1) K+ can be detected by the aptamer-nanogold RS assay, with a detection limit of 0.3 micromol x L(-1) K+, regression equation deltaI = 0.167c-0.7, and a coefficient of 0.9932. The method was used for analysis of K+ in serum sample with the results consistent with the ion-selective electrode method.

  17. Targeting hepatocellular carcinoma with aptamer-functionalized PLGA/PLA-PEG nanoparticles

    NASA Astrophysics Data System (ADS)

    Weigum, Shannon E.; Sutton, Melissa; Barnes, Eugenia; Miller, Sarah; Betancourt, Tania

    2014-08-01

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, particularly in regions where chronic Hepatitis B and C infections are common. Nanoparticle assemblies that incorporate high-affinity aptamers which specifically bind malignant hepatocellular carcinoma cells could be useful for targeted drug delivery or enhancing contrast with existing ablation therapies. The in vitro interactions of a tumor-specific aptamer, TLS11a, were characterized in a hepatoma cell line via live-cell fluorescence imaging, SDS-PAGE and Western Blotting techniques. Cell surface binding of the aptamer-AlexaFluor®546 conjugate was found to occur within 20 minutes of initial exposure, followed by internalization and localization to late endosomes or lysosomes using a pH-sensitive LysoSensor™ Green dye and confocal microscopy. Aptamer-functionalized polymer nanoparticles containing poly(lactic-co-glycolic acid) (PLGA) and poly(lactide)-b-poly(ethylene glycol) (PLA-PEG) were then prepared by nanoprecipitation and passively loaded with the chemotherapeutic agent, doxorubicin, yielding spherical nanoparticles approximately 50 nm in diameter. Targeted drug delivery and cytotoxicity was assessed using live/dead fluorescent dyes and a MTT colorimetric viability assay with elevated levels of cell death found in cultures treated with either the aptamer-coated and uncoated polymer nanoparticles. Identification and characterization of the cell surface protein epitope(s) recognized by the TLS11a aptamer are ongoing along with nanoparticle optimization, but these preliminary studies support continued investigation of this aptamer and functionalized nanoparticle conjugates for targeted labeling and drug delivery within malignant hepatocellular carcinomas.

  18. Hi-Fi SELEX: A High-Fidelity Digital-PCR Based Therapeutic Aptamer Discovery Platform.

    PubMed

    Ouellet, Eric; Foley, Jonathan H; Conway, Edward M; Haynes, Charles

    2015-08-01

    Current technologies for aptamer discovery typically leverage the systematic evolution of ligands by exponential enrichment (SELEX) concept by recursively panning semi-combinatorial ssDNA or RNA libraries against a molecular target. The expectation is that this iterative selection process will be sufficiently stringent to identify a candidate pool of specific high-affinity aptamers. However, failure of this process to yield promising aptamers is common, due in part to (i) limitations in library designs, (ii) retention of non-specific aptamers during screening rounds, (iii) excessive accumulation of amplification artifacts, and (iv) the use of screening criteria (binding affinity) that does not reflect therapeutic activity. We report a new selection platform, High-Fidelity (Hi-Fi) SELEX, that introduces fixed-region blocking elements to safeguard the functional diversity of the library. The chemistry of the target-display surface and the composition of the equilibration solvent are engineered to strongly inhibit non-specific retention of aptamers. Partition efficiencies approaching 10(6) are thereby realized. Retained members are amplified in Hi-Fi SELEX by digital PCR in a manner that ensures both elimination of amplification artifacts and stoichiometric conversion of amplicons into the single-stranded library required for the next selection round. Improvements to aptamer selections are first demonstrated using human α-thrombin as the target. Three clinical targets (human factors IXa, X, and D) are then subjected to Hi-Fi SELEX. For each, rapid enrichment of ssDNA aptamers offering an order-nM mean equilibrium dissociation constant (Kd) is achieved within three selection rounds, as quantified by a new label-free qPCR assay reported here. Therapeutic candidates against factor D are identified. PMID:25727321

  19. Blocking interaction of viral gp120 and CD4-expressing T cells by single-stranded DNA aptamers

    PubMed Central

    Zhao, Nianxi; Pei, Sung-nan; Parekh, Parag; Salazar, Eric; Zu, Youli

    2014-01-01

    To investigate the potential clinical application of aptamers to prevention of HIV infection, single- stranded DNA (ssDNA) aptamers specific for CD4 were developed using the systematic evolution of ligands by exponential enrichment approach and next generation sequencing. In contrast to RNA-based aptamers, the developed ssDNA aptamers were stable in human serum up to 12 hr. Cell binding assays revealed that the aptamers specifically targeted CD4-expressing cells with high binding affinity (Kd=1.59 nM), a concentration within the range required for therapeutic application. Importantly, the aptamers selectively bound CD4 on human cells and disrupted the interaction of viral gp120 to CD4 receptors, which is a prerequisite step of HIV-1 infection. Functional studies showed that the aptamer polymers significantly blocked binding of viral gp120 to CD4-expressing cells by up to 70% inhibition. These findings provide a new approach to prevent HIV-1 transmission using oligonucleotide aptamers. PMID:24661998

  20. Isolation of Foreign Material-Free Endothelial Progenitor Cells Using CD31 Aptamer and Therapeutic Application for Ischemic Injury

    PubMed Central

    Heo, Soon Chul; Kwon, Yang Woo; Choi, Eun Jung; Bae, Kwang-Hee; Suh, Dong-Soo; Kim, Seung-Chul; Han, Seungmin; Haam, Seungjoo; Jung, Jongha; Kim, Kiseok; Ryu, Sung Ho; Kim, Jae Ho

    2015-01-01

    Endothelial progenitor cells (EPCs) can be isolated from human bone marrow or peripheral blood and reportedly contribute to neovascularization. Aptamers are 40-120-mer nucleotides that bind to a specific target molecule, as antibodies do. To utilize apatmers for isolation of EPCs, in the present study, we successfully generated aptamers that recognize human CD31, an endothelial cell marker. CD31 aptamers bound to human umbilical cord blood-derived EPCs and showed specific interaction with human CD31, but not with mouse CD31. However, CD31 aptamers showed non-specific interaction with CD31-negative 293FT cells and addition of polyanionic competitor dextran sulfate eliminated non-specific interaction without affecting cell viability. From the mixture of EPCs and 293FT cells, CD31 aptamers successfully isolated EPCs with 97.6% purity and 94.2% yield, comparable to those from antibody isolation. In addition, isolated EPCs were decoupled from CD31 aptamers with a brief treatment of high concentration dextran sulfate. EPCs isolated with CD31 aptamers and subsequently decoupled from CD31 aptamers were functional and enhanced the restoration of blood flow when transplanted into a murine hindlimb ischemia model. In this study, we demonstrated isolation of foreign material-free EPCs, which can be utilized as a universal protocol in preparation of cells for therapeutic transplantation. PMID:26148001

  1. Enhancing the analytical performance of electrochemical RNA aptamer-based sensors for sensitive detection of aminoglycoside antibiotics.

    PubMed

    Schoukroun-Barnes, Lauren R; Wagan, Samiullah; Wagan, Samuillah; White, Ryan J

    2014-01-21

    Folding-based electrochemical sensors utilizing structure-switching aptamers are specific, selective, sensitive, and widely applicable to the detection of a variety of target analytes. The specificity is achieved by the binding properties of an electrode-bound RNA or DNA aptamer biorecognition element. Signaling in this class of sensors arises from changes in electron transfer efficiency upon target-induced changes in the conformation/flexibility of the aptamer probe. These changes can be readily monitored electrochemically. Because of this signaling mechanism, there are several approaches to maximizing the analytical attributes (i.e., sensitivity, limit of detection, and observed binding affinity) of the aptamer sensor. Here, we present a systematic study of several approaches, including electrochemical interrogation parameters and biomolecular engineering of the aptamer sequence, to develop a sensor for the detection of aminoglycoside antibiotics. Specifically, through a combination of optimizing the electrochemical signal and engineering the parent 26-nucleotide RNA aptamer sequence to undergo larger conformation changes, we develop several improved sensors. These sensors exhibit binding affinities ranging from 220 nM to 42 μM, as much as a 100-fold improved limit of detection in comparison to previously reported sensors, and a variety of linear ranges including the therapeutic window for tobramycin. These data demonstrate that rational engineering of the aptamer structure to create large conformation changes upon target binding leads to improved sensor performance. We believe that the sensor design guidelines outlined here represent a general strategy for developing new aptamer folding-based electrochemical sensors.

  2. Probing the biophysical interaction between Neocarzinostatin toxin and EpCAM RNA aptamer.

    PubMed

    Athyala, Prasanna Kumar; Kanwar, Jagat Rakesh; Alameen, Mohamed; Kanwar, Rupinder Kaur; Krishnakumar, Subramanian; Watson, Jon; Vetrivel, Umashankar; Narayanan, Janakiraman

    2016-01-01

    Neocarzinostatin (NCS) a potent DNA-damaging, anti-tumor toxin extracted from Streptomyces carzinostaticus that recognizes double-stranded DNA bulge and induces DNA damage. 2 Fluoro (2F) Modified EpCAM RNA aptamer is a 23-mer that targets EpCAM protein, expressed on the surface of epithelial tumor cells. Understanding the interaction between NCS and the ligand is important for carrying out the targeted tumor therapy. In this study, we have investigated the biophysical interactions between NCS and 2-fluro Modified EpCAM RNA aptamer using Circular Dichroism (CD) and Infra-Red (IR) spectroscopy. The aromatic amino acid residues spanning the β sheets of NCS are found to participate in intermolecular interactions with 2 F Modified EpCAM RNA aptamer. In-silico modeling and simulation studies corroborate with CD spectra data. Furthermore, it reinforces the involvement of C and D1 strand of NCS in intermolecular interactions with EpCAM RNA aptamer. This the first report on interactions involved in the stabilization of NCS-EpCAM aptamer complex and will aid in the development of therapeutic modalities towards targeted cancer therapy. PMID:26642954

  3. Aptamer-integrated DNA nanostructures for biosensing, bioimaging and cancer therapy.

    PubMed

    Meng, Hong-Min; Liu, Hui; Kuai, Hailan; Peng, Ruizi; Mo, Liuting; Zhang, Xiao-Bing

    2016-05-01

    The combination of nanostructures with biomolecules leading to the generation of functional nanosystems holds great promise for biotechnological and biomedical applications. As a naturally occurring biomacromolecule, DNA exhibits excellent biocompatibility and programmability. Also, scalable synthesis can be readily realized through automated instruments. Such unique properties, together with Watson-Crick base-pairing interactions, make DNA a particularly promising candidate to be used as a building block material for a wide variety of nanostructures. In the past few decades, various DNA nanostructures have been developed, including one-, two- and three-dimensional nanomaterials. Aptamers are single-stranded DNA or RNA molecules selected by Systematic Evolution of Ligands by Exponential Enrichment (SELEX), with specific recognition abilities to their targets. Therefore, integrating aptamers into DNA nanostructures results in powerful tools for biosensing and bioimaging applications. Furthermore, owing to their high loading capability, aptamer-modified DNA nanostructures have also been altered to play the role of drug nanocarriers for in vivo applications and targeted cancer therapy. In this review, we summarize recent progress in the design of aptamers and related DNA molecule-integrated DNA nanostructures as well as their applications in biosensing, bioimaging and cancer therapy. To begin with, we first introduce the SELEX technology. Subsequently, the methodologies for the preparation of aptamer-integrated DNA nanostructures are presented. Then, we highlight their applications in biosensing and bioimaging for various targets, as well as targeted cancer therapy applications. Finally, we discuss several challenges and further opportunities in this emerging field. PMID:26954935

  4. Agonistic aptamer to the insulin receptor leads to biased signaling and functional selectivity through allosteric modulation.

    PubMed

    Yunn, Na-Oh; Koh, Ara; Han, Seungmin; Lim, Jong Hun; Park, Sehoon; Lee, Jiyoun; Kim, Eui; Jang, Sung Key; Berggren, Per-Olof; Ryu, Sung Ho

    2015-09-18

    Due to their high affinity and specificity, aptamers have been widely used as effective inhibitors in clinical applications. However, the ability to activate protein function through aptamer-protein interaction has not been well-elucidated. To investigate their potential as target-specific agonists, we used SELEX to generate aptamers to the insulin receptor (IR) and identified an agonistic aptamer named IR-A48 that specifically binds to IR, but not to IGF-1 receptor. Despite its capacity to stimulate IR autophosphorylation, similar to insulin, we found that IR-A48 not only binds to an allosteric site distinct from the insulin binding site, but also preferentially induces Y1150 phosphorylation in the IR kinase domain. Moreover, Y1150-biased phosphorylation induced by IR-A48 selectively activates specific signaling pathways downstream of IR. In contrast to insulin-mediated activation of IR, IR-A48 binding has little effect on the MAPK pathway and proliferation of cancer cells. Instead, AKT S473 phosphorylation is highly stimulated by IR-A48, resulting in increased glucose uptake both in vitro and in vivo. Here, we present IR-A48 as a biased agonist able to selectively induce the metabolic activity of IR through allosteric binding. Furthermore, our study also suggests that aptamers can be a promising tool for developing artificial biased agonists to targeted receptors. PMID:26245346

  5. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. PMID:21530479

  6. Aptamer-MIP hybrid receptor for highly sensitive electrochemical detection of prostate specific antigen.

    PubMed

    Jolly, Pawan; Tamboli, Vibha; Harniman, Robert L; Estrela, Pedro; Allender, Chris J; Bowen, Jenna L

    2016-01-15

    This study reports the design and evaluation of a new synthetic receptor sensor based on the amalgamation of biomolecular recognition elements and molecular imprinting to overcome some of the challenges faced by conventional protein imprinting. A thiolated DNA aptamer with established affinity for prostate specific antigen (PSA) was complexed with PSA prior to being immobilised on the surface of a gold electrode. Controlled electropolymerisation of dopamine around the complex served to both entrap the complex, holding the aptamer in, or near to, it's binding conformation, and to localise the PSA binding sites at the sensor surface. Following removal of PSA, it was proposed that the molecularly imprinted polymer (MIP) cavity would act synergistically with the embedded aptamer to form a hybrid receptor (apta-MIP), displaying recognition properties superior to that of aptamer alone. Electrochemical impedance spectroscopy (EIS) was used to evaluate subsequent rebinding of PSA to the apta-MIP surface. The apta-MIP sensor showed high sensitivity with a linear response from 100pg/ml to 100ng/ml of PSA and a limit of detection of 1pg/ml, which was three-fold higher than aptamer alone sensor for PSA. Furthermore, the sensor demonstrated low cross-reactivity with a homologous protein (human Kallikrein 2) and low response to human serum albumin (HSA), suggesting possible resilience to the non-specific binding of serum proteins.

  7. Microarrays as Model Biosensor Platforms to Investigate the Structure and Affinity of Aptamers

    PubMed Central

    Martin, Jennifer A.; Chushak, Yaroslav; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

    2016-01-01

    Immobilization of nucleic acid aptamer recognition elements selected free in solution onto the surface of biosensor platforms has proven challenging. This study investigated the binding of multiple aptamer/target pairs immobilized on a commercially available microarray as a model system mimicking biosensor applications. The results indicate a minimum distance (linker length) from the surface and thymine nucleobase linker provides reproducible binding across varying conditions. An indirect labeling method, where the target was labeled with a biotin followed by a brief Cy3-streptavidin incubation, provided a higher signal-to-noise ratio and over two orders of magnitude improvement in limit of detection, compared to direct Cy3-protein labeling. We also showed that the affinities of the aptamer/target interaction can change between direct and indirect labeling and conditions to optimize for the highest fluorescence intensity will increase the sensitivity of the assay but will not change the overall affinity. Additionally, some sequences which did not initially bind demonstrated binding when conditions were optimized. These results, in combination with studies demonstrating enhanced binding in nonselection buffers, provided insights into the structure and affinity of aptamers critical for biosensor applications and allowed for generalizations in starting conditions for researchers wishing to investigate aptamers on a microarray surface. PMID:27042344

  8. Inhibiting heat shock factor 1 in human cancer cells with a potent RNA aptamer.

    PubMed

    Salamanca, H Hans; Antonyak, Marc A; Cerione, Richard A; Shi, Hua; Lis, John T

    2014-01-01

    Heat shock factor 1 (HSF1) is a master regulator that coordinates chaperone protein expression to enhance cellular survival in the face of heat stress. In cancer cells, HSF1 drives a transcriptional program distinct from heat shock to promote metastasis and cell survival. Its strong association with the malignant phenotype implies that HSF1 antagonists may have general and effective utilities in cancer therapy. For this purpose, we had identified an avid RNA aptamer for HSF1 that is portable among different model organisms. Extending our previous work in yeast and Drosophila, here we report the activity of this aptamer in human cancer cell lines. When delivered into cells using a synthetic gene and strong promoter, this aptamer was able to prevent HSF1 from binding to its DNA regulation elements. At the cellular level, expression of this aptamer induced apoptosis and abolished the colony-forming capability of cancer cells. At the molecular level, it reduced chaperones and attenuated the activation of the MAPK signaling pathway. Collectively, these data demonstrate the advantage of aptamers in drug target validation and support the hypothesis that HSF1 DNA binding activity is a potential target for controlling oncogenic transformation and neoplastic growth.

  9. Serum inverts and improves the fluorescence response of an aptamer beacon to various vitamin D analytes.

    PubMed

    Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Edge, Allison

    2012-01-01

    A dominant aptamer loop structure from a library of nearly 100 candidate aptamer sequences developed against immobilized 25-hydroxyvitamin D(3) (calcidiol) was converted into a 5'-TYE 665 and 3'-Iowa black-labelled aptamer beacon. The aptamer beacon exhibited a mild 'lights on' reaction in buffer as a function of increasing concentrations of several vitamin D analogues and metabolites, with a limit of detection of approximately 200 ng/mL, and was not specific for any particular congener. In 10% or 50% human serum, the same aptamer beacon inverted its fluorescence behaviour to become a more intense 'lights off' reaction with an improved limit of detection in the range 4-16 ng/mL. We hypothesized that this drastic change in fluorescence behaviour was due to the presence of creatinine and urea in serum, which might destabilize the quenched beacon, causing an increase in fluorescence followed by decreasing fluorescence as a function of vitamin D concentrations that may bind and quench increasingly greater fractions of the denatured beacons. However, the results of several control experiments in the presence of physiological or greater concentrations of creatinine and urea, alone or combined in buffer, failed to produce the beacon fluorescence inversion. Other possible mechanistic hypotheses are also discussed.

  10. Heterogeneous Electrochemical Aptamer-Based Sensor Surfaces for Controlled Sensor Response.

    PubMed

    Schoukroun-Barnes, Lauren R; Glaser, Ethan P; White, Ryan J

    2015-06-16

    Structure-switching sensors utilize recognition elements that undergo a conformation change upon target binding that is converted into a quantitative signal. Electrochemical, aptamer-based sensors achieve detection of analytes through a conformation change in an electrode-bound, oligonucleotide aptamer by measuring changes in electron transfer efficiencies. The analytical performance of these sensors is related to the magnitude of the conformation change of the aptamer. The goal of the present work is to develop a general method to predictably tune the analytical performance (sensitivity and linear range) of electrochemical, aptamer-based sensors by utilizing a mixture of rationally designed aptamer sequences that are specific for the same target but with different affinities on the same electrode surface. To demonstrate control over sensor performance, we developed heterogeneous sensors for two representative small molecule targets (adenosine triphosphate and tobramycin). We demonstrate that mixtures of modified sequences can be used to tune the affinity, dynamic range, and sensitivity of the resulting sensors predicted by a bi-Langmuir-type isotherm.

  11. A hairpin aptamer-based electrochemical biosensing platform for the sensitive detection of proteins.

    PubMed

    Wu, Zai-Sheng; Zheng, Fan; Shen, Guo-Li; Yu, Ru-Qin

    2009-05-01

    An aptamer-based electrochemical sensing platform for the direct protein detection has been developed using IgE and a specifically designed aptamer with hairpin structure as the model analyte and probe sequence, respectively. In the absence of IgE, the aptamer immobilized on an electrode surface forms a large hairpin due to the hybridization of the two complementary arm sequences, and peak currents of redox species dissolved in solution can be achieved. However, the target protein binding can not only cause the increase of the dielectric layer but also trigger the significant conformational switching of the aptamer due to the opening of the designed hairpin structure that pushes the biomolecule layer/electrolyte interface away from the electrode surface, suppressing substantially the electron transfer (eT) and resulting in a strong detection signal. The detection limit of 3.6x10(-11)M and linear response range of 5.4x10(-11) to 3.6x10(-8)M are achieved without any amplifier. The selectivity is confirmed by interference test. More importantly, an innovative concept of adapting intelligently a surface-confined aptamer sequence is introduced, and the limitations of the conventional electrochemical aptasensors have been overcome. The proposed sensing scheme is expected to become a promising strategy for the detection of proteins and other biomacromolecules.

  12. Screening and development of DNA aptamers as capture probes for colorimetric detection of patulin.

    PubMed

    Wu, Shijia; Duan, Nuo; Zhang, Weixiao; Zhao, Sen; Wang, Zhouping

    2016-09-01

    Patulin (PAT) is a kind of mycotoxin that has serious harmful impacts on both food quality and human health. A high-affinity ssDNA aptamer that specifically binds to patulin was generated using systemic evolution of ligands by exponential enrichment (SELEX) assisted by graphene oxide (GO). After 15 rounds of positive and negative selection, a highly enriched ssDNA pool was sequenced and the representative sequences were subjected to binding assays to evaluate their affinity and specificity. Of the eight aptamer candidates tested, the sequence PAT-11 bound to patulin with high affinity and excellent selectivity with a dissociation constant (Kd) of 21.83 ± 5.022 nM. The selected aptamer, PAT-11, was subsequently used as a recognition element to develop a detection method for patulin based on an enzyme-chromogenic substrate system. The colorimetric aptasensor exhibited a linear range from 50 to 2500 pg mL(-1), and the limit of detection was found to be 48 pg mL(-1). The results indicated that GO-SELEX technology was appropriate for the screening of aptamers against small-molecule toxins, offering a promising application for aptamer-based biosensors. PMID:27318239

  13. Prostate-specific RNA aptamer: promising nucleic acid antibody-like cancer detection

    PubMed Central

    Marangoni, Karina; Neves, Adriana F.; Rocha, Rafael M.; Faria, Paulo R.; Alves, Patrícia T.; Souza, Aline G.; Fujimura, Patrícia T.; Santos, Fabiana A. A.; Araújo, Thaise G.; Ward, Laura S.; Goulart, Luiz R.

    2015-01-01

    We described the selection of a novel nucleic acid antibody-like prostate cancer (PCa) that specifically binds to the single-stranded DNA molecule from a 277-nt fragment that may have been partially paired and bound to the PCA3 RNA conformational structure. PCA3-277 aptamer ligands were obtained, and the best binding molecule, named CG3, was synthesized for validation. Aiming to prove its diagnostic utility, we used an apta-qPCR assay with CG3-aptamer conjugated to magnetic beads to capture PCA3 transcripts, which were amplified 97-fold and 7-fold higher than conventional qPCR in blood and tissue, respectively. Histopathologic analysis of 161 prostate biopsies arranged in a TMA and marked with biotin-labeled CG3-aptamer showed moderate staining in both cytoplasm and nucleus of PCa samples; in contrast, benign prostatic hyperplasia (BPH) samples presented strong nuclear staining (78% of the cases). No staining was observed in stromal cells. In addition, using an apta-qPCR, we demonstrated that CG3-aptamer specifically recognizes the conformational PCA3-277 molecule and at least three other transcript variants, indicating that long non-coding RNA (lncRNA) is processed after transcription. We suggest that CG3-aptamer may be a useful PCa diagnostic tool. In addition, this molecule may be used in drug design and drug delivery for PCa therapy. PMID:26174796

  14. Agonistic aptamer to the insulin receptor leads to biased signaling and functional selectivity through allosteric modulation

    PubMed Central

    Yunn, Na-Oh; Koh, Ara; Han, Seungmin; Lim, Jong Hun; Park, Sehoon; Lee, Jiyoun; Kim, Eui; Jang, Sung Key; Berggren, Per-Olof; Ryu, Sung Ho

    2015-01-01

    Due to their high affinity and specificity, aptamers have been widely used as effective inhibitors in clinical applications. However, the ability to activate protein function through aptamer-protein interaction has not been well-elucidated. To investigate their potential as target-specific agonists, we used SELEX to generate aptamers to the insulin receptor (IR) and identified an agonistic aptamer named IR-A48 that specifically binds to IR, but not to IGF-1 receptor. Despite its capacity to stimulate IR autophosphorylation, similar to insulin, we found that IR-A48 not only binds to an allosteric site distinct from the insulin binding site, but also preferentially induces Y1150 phosphorylation in the IR kinase domain. Moreover, Y1150-biased phosphorylation induced by