QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.
Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S
2009-07-01
Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.
Gene-specific cell labeling using MiMIC transposons
Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.
2015-01-01
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101
Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders
2017-09-11
The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad
2015-01-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567
Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad
2014-11-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.
White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M
2018-03-28
A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.
Guschinskaya, Natalia; Brunel, Romain; Tourte, Maxime; Lipscomb, Gina L; Adams, Michael W W; Oger, Philippe; Charpentier, Xavier
2016-11-08
Transposition mutagenesis is a powerful tool to identify the function of genes, reveal essential genes and generally to unravel the genetic basis of living organisms. However, transposon-mediated mutagenesis has only been successfully applied to a limited number of archaeal species and has never been reported in Thermococcales. Here, we report random insertion mutagenesis in the hyperthermophilic archaeon Pyrococcus furiosus. The strategy takes advantage of the natural transformability of derivatives of the P. furiosus COM1 strain and of in vitro Mariner-based transposition. A transposon bearing a genetic marker is randomly transposed in vitro in genomic DNA that is then used for natural transformation of P. furiosus. A small-scale transposition reaction routinely generates several hundred and up to two thousands transformants. Southern analysis and sequencing showed that the obtained mutants contain a single and random genomic insertion. Polyploidy has been reported in Thermococcales and P. furiosus is suspected of being polyploid. Yet, about half of the mutants obtained on the first selection are homozygous for the transposon insertion. Two rounds of isolation on selective medium were sufficient to obtain gene conversion in initially heterozygous mutants. This transposition mutagenesis strategy will greatly facilitate functional exploration of the Thermococcales genomes.
Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.
2011-01-01
We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007
Gladyshev, Eugene A; Arkhipova, Irina R
2009-12-15
Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.
Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.
2017-01-01
Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡
Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu
2009-01-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402
Genome-wide transposon mutagenesis in pathogenic Leptospira species.
Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu
2009-02-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Targeted gene insertion for molecular medicine.
Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán
2008-11-01
Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.
Efficient transformation and expression of gfp gene in Valsa mali var. mali.
Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai
2015-01-01
Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.
Cheng, Feixiong; Murray, James L; Zhao, Junfei; Sheng, Jinsong; Zhao, Zhongming; Rubin, Donald H
2016-09-01
Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap) host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase). Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B) identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline) that may be potential for antiviral indication (e.g. anti-Ebola). In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A
2018-01-01
In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.
Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W
2012-05-03
Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.
Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.
1997-01-01
We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831
Shimoda, Yoshikazu; Mitsui, Hisayuki; Kamimatsuse, Hiroko; Minamisawa, Kiwamu; Nishiyama, Eri; Ohtsubo, Yoshiyuki; Nagata, Yuji; Tsuda, Masataka; Shinpo, Sayaka; Watanabe, Akiko; Kohara, Mitsuyo; Yamada, Manabu; Nakamura, Yasukazu; Tabata, Satoshi; Sato, Shusei
2008-01-01
Rhizobia are nitrogen-fixing soil bacteria that establish endosymbiosis with some leguminous plants. The completion of several rhizobial genome sequences provides opportunities for genome-wide functional studies of the physiological roles of many rhizobial genes. In order to carry out genome-wide phenotypic screenings, we have constructed a large mutant library of the nitrogen-fixing symbiotic bacterium, Mesorhizobium loti, by transposon mutagenesis. Transposon insertion mutants were generated using the signature-tagged mutagenesis (STM) technique and a total of 29 330 independent mutants were obtained. Along with the collection of transposon mutants, we have determined the transposon insertion sites for 7892 clones, and confirmed insertions in 3680 non-redundant M. loti genes (50.5% of the total number of M. loti genes). Transposon insertions were randomly distributed throughout the M. loti genome without any bias toward G+C contents of insertion target sites and transposon plasmids used for the mutagenesis. We also show the utility of STM mutants by examining the specificity of signature tags and test screenings for growth- and nodulation-deficient mutants. This defined mutant library allows for genome-wide forward- and reverse-genetic functional studies of M. loti and will serve as an invaluable resource for researchers to further our understanding of rhizobial biology. PMID:18658183
Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A
2015-04-01
In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kim, Sihyeon; Lee, Se Jin; Nai, Yu-Shin; Yu, Jeong Seon; Lee, Mi Rong; Yang, Yi-Ting; Kim, Jae Su
2016-10-01
The bean bug, Riptortus pedestris, is a major agricultural pest that reduces crop quality and value. Chemical pesticides have contributed to pest management, but resistance to these chemicals has significantly limited their use. Alternative strategies with different modes of action, such as entomopathogenic fungi, are therefore of great interest. Herein, we explored how entomopathogenic fungi can potentially be used to control the bean bug and focused on identifying virulence-related genes. Beauveria bassiana (JEF isolates) were assayed against bean bugs under laboratory conditions. One isolate, JEF-007, showed >80 % virulence by both spray and contact exposure methods. Agrobacterium tumefaciens-mediated transformation (AtMT) of JEF-007 generated 249 random transformants, two of which (B1-06 and C1-49) showed significantly reduced virulence against Tenebrio molitor and R. pedestris immatures. Both species were used for rapid screening of virulence-reduced mutants. The two transformants had different morphologies, conidial production, and thermotolerance than the wild type. To determine the localization of the randomly inserted T-DNA, thermal asymmetric interlaced (TAIL) PCR was conducted and analysis of the two clones found multiple T-DNA insertions (two in B1-06 and three in C1-49). Genes encoding complex I intermediate-associated protein 30 (CIA30) and the autophagy protein (Atg22) were possibly disrupted by the T-DNA insertion and might be involved in the virulence. This work provides a strong platform for future functional genetic studies of bean bug-pathogenic B. bassiana. The genes putatively involved in fungal virulence should be experimentally validated by knockdown in future studies.
Gillen, K L; Hughes, K T
1991-01-01
The complex regulation of flagellin gene expression in Salmonella typhimurium was characterized in vivo by using lac transcriptional fusions to the two flagellin structural genes (fliC [H1] and fljB [H2]). Phase variation was measured as the rate of switching of flagellin gene expression. Switching frequencies varied from 1/500 per cell per generation to 1/10,000 per cell per generation depending on the particular insertion and the direction of switching. There is a 4- to 20-fold bias in favor of switching from the fljB(On) to the fljB(Off) orientation. Random Tn10dTc insertions were isolated which failed to express flagellin. While most of these insertions mapped to loci known to be required for flagellin expression, several new loci were identified. The presence of functional copies of all of the genes responsible for complete flagellar assembly, except the hook-associated proteins (flgK, flgL, and fliD gene products), were required for expression of the fliC or fljB flagellin genes. Two novel loci involved in negative regulation of fliC and fljB in fla mutant backgrounds were identified. One of these loci, designated the flgR locus, mapped to the flg operon at 23 min on the Salmonella linkage map. An flgR insertion mutation resulted in relief of repression of the fliC and fljB genes in all fla mutant backgrounds except for mutants in the positive regulatory loci (flhC, flhD, and fliA genes). PMID:1848842
[Observation on gene polymorphism of Rh blood group in Chinese Han nationality].
Lan, Jiong-Cai; Wang, Cong-Rong; Wei, Ya-Ming; Zhou, Hua-You; Cao, Qiong; Zhang, Yin-Ze; Jiang, KuReXi; Wu, Da-Lin; Liu, Zhong
2003-12-01
To observe the gene polymorphism of Rh blood group in unrelated random individuals and families for Chinese Han nationality, polymerase chain reaction-sequence specific primer (PCR-SSP) was used to amplify the Rh C/E gene, RhD gene, exons, intron 2 and 10, insert and Rh Box in 160 blood samples of RhD positive unrelated individuals and 71 samples of RhD negative unrelated individuals and 7 samples of families whose probands were RhD-negative. The results showed that RhD genes of RhD-negative individuals with C antigens were polymorphism, three forms were found for D exon including intact, partial deletion and complete deletion exons. Insert fragments and Rh Box were found in most cases of families whose probands were RhD-negative and its inheritance accorded with the Mendel's Law, and it did not affect the expression of RhD gene. "Normal" RhD exon 4 amplifying product was not found in all of the samples. It was concluded that gene structure of the RhD-negative in Chinese was polymorphism, intact, partial deletion and complete deletion exons were found in the individuals with C antigen and probably existed specific D (nf) Ce haplotype. The function of insert was uncertain. The Rh gene sequences of Chinese Han nationality are different from those of Caucasian and the Rh gene library based on Han nationality should be established.
Schwab, Stefan; Ramos, Humberto J; Souza, Emanuel M; Pedrosa, Fábio O; Yates, Marshall G; Chubatsu, Leda S; Rigo, Liu U
2007-05-01
Random mutagenesis using transposons with promoterless reporter genes has been widely used to examine differential gene expression patterns in bacteria. Using this approach, we have identified 26 genes of the endophytic nitrogen-fixing bacterium Herbaspirillum seropedicae regulated in response to ammonium content in the growth medium. These include nine genes involved in the transport of nitrogen compounds, such as the high-affinity ammonium transporter AmtB, and uptake systems for alternative nitrogen sources; nine genes coding for proteins responsible for restoring intracellular ammonium levels through enzymatic reactions, such as nitrogenase, amidase, and arginase; and a third group includes metabolic switch genes, coding for sensor kinases or transcription regulation factors, whose role in metabolism was previously unknown. Also, four genes identified were of unknown function. This paper describes their involvement in response to ammonium limitation. The results provide a preliminary profile of the metabolic response of Herbaspirillum seropedicae to ammonium stress.
2012-01-01
Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201
2011-01-01
Background The genome of a number of species of malaria parasites (Plasmodium spp.) has been sequenced in the hope of identifying new drug and vaccine targets. However, almost one-half of predicted Plasmodium genes are annotated as hypothetical and are difficult to analyse in bulk due to the inefficiency of current reverse genetic methodologies for Plasmodium. Recently, it has been shown that the transposase piggyBac integrates at random into the genome of the human malaria parasite P. falciparum offering the possibility to develop forward genetic screens to analyse Plasmodium gene function. This study reports the development and application of the piggyBac transposition system for the rodent malaria parasite P. berghei and the evaluation of its potential as a tool in forward genetic studies. P. berghei is the most frequently used malaria parasite model in gene function analysis since phenotype screens throughout the complete Plasmodium life cycle are possible both in vitro and in vivo. Results We demonstrate that piggyBac based gene inactivation and promoter-trapping is both easier and more efficient in P. berghei than in the human malaria parasite, P. falciparum. Random piggyBac-mediated insertion into genes was achieved after parasites were transfected with the piggyBac donor plasmid either when transposase was expressed either from a helper plasmid or a stably integrated gene in the genome. Characterization of more than 120 insertion sites demonstrated that more than 70 most likely affect gene expression classifying their protein products as non-essential for asexual blood stage development. The non-essential nature of two of these genes was confirmed by targeted gene deletion one of which encodes P41, an ortholog of a human malaria vaccine candidate. Importantly for future development of whole genome phenotypic screens the remobilization of the piggyBac element in parasites that stably express transposase was demonstrated. Conclusion These data demonstrate that piggyBac behaved as an efficient and random transposon in P. berghei. Remobilization of piggyBac element shows that with further development the piggyBac system can be an effective tool to generate random genome-wide mutation parasite libraries, for use in large-scale phenotype screens in vitro and in vivo. PMID:21418605
Vranckx, Lenard S.; Demeulemeester, Jonas; Debyser, Zeger
2016-01-01
The capacity to integrate transgenes into the host cell genome makes retroviral vectors an interesting tool for gene therapy. Although stable insertion resulted in successful correction of several monogenic disorders, it also accounts for insertional mutagenesis, a major setback in otherwise successful clinical gene therapy trials due to leukemia development in a subset of treated patients. Despite improvements in vector design, their use is still not risk-free. Lentiviral vector (LV) integration is directed into active transcription units by LEDGF/p75, a host-cell protein co-opted by the viral integrase. We engineered LEDGF/p75-based hybrid tethers in an effort to elicit a more random integration pattern to increase biosafety, and potentially reduce proto-oncogene activation. We therefore truncated LEDGF/p75 by deleting the N-terminal chromatin-reading PWWP-domain, and replaced this domain with alternative pan-chromatin binding peptides. Expression of these LEDGF-hybrids in LEDGF-depleted cells efficiently rescued LV transduction and resulted in LV integrations that distributed more randomly throughout the host-cell genome. In addition, when considering safe harbor criteria, LV integration sites for these LEDGF-hybrids distributed more safely compared to LEDGF/p75-mediated integration in wild-type cells. This approach should be broadly applicable to introduce therapeutic or suicide genes for cell therapy, such as patient-specific iPS cells. PMID:27788138
The loss-of-allele assay for ES cell screening and mouse genotyping.
Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M
2010-01-01
Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.
Identification of two integration sites in favor of transgene expression in Trichoderma reesei.
Qin, Lina; Jiang, Xianzhang; Dong, Zhiyang; Huang, Jianzhong; Chen, Xiuzhen
2018-01-01
The ascomycete fungus Trichoderma reesei was widely used as a biotechnological workhorse for production of cellulases and recombinant proteins due to its large capacity of protein secretion. Transgenesis by random integration of a gene of interest (GOI) into the genome of T. reesei can generate series of strains that express different levels of the indicated transgene. The insertion site of the GOI plays an important role in the ultimate production of the targeted proteins. However, so far no systematic studies have been made to identify transgene integration loci for optimal expression of the GOI in T. reesei . Currently, only the locus of exocellobiohydrolases I encoding gene ( cbh1) is widely used as a promising integration site to lead to high expression level of the GOI. No additional sites associated with efficient gene expression have been characterized. To search for gene integration sites that benefit for the secreted expression of GOI, the food-and-mouth disease virus 2A protein was applied for co-expression of an Aspergillus niger lipA gene and Discosoma sp. DsRed1 gene in T. reesei, by random integration of the expression cassette into the genome. We demonstrated that the fluorescent intensity of RFP (red fluorescent protein) inside of the cell was well correlated with the secreted lipase yields, based on which, we successfully developed a high-throughput screening method to screen strains with relatively higher secreted expression of the GOI (in this study, lipase). The copy number and the insertion sites of the transgene were investigated among the selected highly expressed strains. Eventually, in addition to cbh1 gene locus, two other genome insertion loci that efficiently facilitate gene expression in T. reesei were identified. We have successfully developed a high-throughput screening method to screen strains with optimal expression of the indicated secreted proteins in T. reesei . Moreover, we identified two optimal genome loci for transgene expression, which could provide new approach to modulate gene expression levels while retaining the indicated promoter and culture conditions.
Conidiogenesis-related DNA photolyase gene in Beauveria bassiana.
Lee, Se Jin; Lee, Mi Rong; Kim, Sihyeon; Kim, Jong Cheol; Park, So Eun; Shin, Tae Young; Kim, Jae Su
2018-03-01
Beauveria bassiana is an entomopathogenic fungi used in environmentally mindful pest management. Its main active ingredient, conidia, is commercially available as a fungal biopesticide. Many studies of conidia production have focused on how to optimize culture conditions for maximum productivity and stability against unfavorable abiotic factors. However, understanding of how conidiogenesis-related genes provide improved conidial production remains unclear. In this study, we focus on identifying conidiogenesis-related genes in B. bassiana ERL1170 using a random mutagenesis technique. Transformation of ERL1170 using restriction enzyme-mediated integration generated one morphologically different transformant, ERL1170-pABeG #163. The transformant was confirmed to represent B. bassiana, and the binary vector was successfully integrated into the genome of ERL1170. Compared to the wild type, transformant #163 showed very slow hyphal growth and within 6 days only produced <1 × 10 6 conidia/0.28 cm 2 agar block (wild type: 6.2 × 10 7 conidia/agar block). Transformant #163 also exhibited different morphology than the wild type, including thicker hyphae with some club-shaped parts. In contrast, the typical morphology of wild type B. bassiana exhibits thread-like hyphae and conidiophore structures and circular conidia. To determine the location of the randomly inserted DNA, we conducted thermal asymmetric interlaced (TAIL) PCR and Escherichia coli cloning to clearly sequence the disrupted region. We identified one colony (colony No. 7) with an insertion site identified as DNA photolyase. This was confirmed through a gene knock-out study. It is possible the gene that encodes for DNA photolyase was disrupted during the insertion process and might be involved in fungal conidiogenesis. This work serves as a platform for exploring the function of a variety of B. bassiana genes involved in pest management and their downstream processing. Copyright © 2018 Elsevier Inc. All rights reserved.
Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.
2011-01-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805
Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A
2011-03-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.
Szeverényi, I; Hodel, A; Arber, W; Olasz, F
1996-09-26
We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.
Ohno, S
1984-01-01
Three outstanding properties uniquely qualify repeats of base oligomers as the primordial coding sequences of all polypeptide chains. First, when compared with randomly generated base sequences in general, they are more likely to have long open reading frames. Second, periodical polypeptide chains specified by such repeats are more likely to assume either alpha-helical or beta-sheet secondary structures than are polypeptide chains of random sequence. Third, provided that the number of bases in the oligomeric unit is not a multiple of 3, these internally repetitious coding sequences are impervious to randomly sustained base substitutions, deletions, and insertions. This is because the recurring periodicity of their polypeptide chains is given by three consecutive copies of the oligomeric unit translated in three different reading frames. Accordingly, when one reading frame is open, the other two are automatically open as well, all three being capable of coding for polypeptide chains of identical periodicity. Under this circumstance, a frame shift due to the deletion or insertion of a number of bases that is not a multiple of 3 fails to alter the down-stream amino acid sequence, and even a base change causing premature chain-termination can silence only one of the three potential coding units. Newly arisen coding sequences in modern organisms are oligomeric repeats, and most of the older genes retain various vestiges of their original internal repetitions. Some of the genes (e.g., oncogenes) have even inherited the property of being impervious to randomly sustained base changes.
Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing
Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand
2013-01-01
Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038
Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming
2012-05-01
Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Cas9-Guide RNA Directed Genome Editing in Soybean[OPEN
Li, Zhongsen; Liu, Zhan-Bin; Xing, Aiqiu; Moon, Bryan P.; Koellhoffer, Jessica P.; Huang, Lingxia; Ward, R. Timothy; Clifton, Elizabeth; Falco, S. Carl; Cigan, A. Mark
2015-01-01
Recently discovered bacteria and archaea adaptive immune system consisting of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) endonuclease has been explored in targeted genome editing in different species. Streptococcus pyogenes Cas9-guide RNA (gRNA) was successfully applied to generate targeted mutagenesis, gene integration, and gene editing in soybean (Glycine max). Two genomic sites, DD20 and DD43 on chromosome 4, were mutagenized with frequencies of 59% and 76%, respectively. Sequencing randomly selected transgenic events confirmed that the genome modifications were specific to the Cas9-gRNA cleavage sites and consisted of small deletions or insertions. Targeted gene integrations through homology-directed recombination were detected by border-specific polymerase chain reaction analysis for both sites at callus stage, and one DD43 homology-directed recombination event was transmitted to T1 generation. T1 progenies of the integration event segregated according to Mendelian laws and clean homozygous T1 plants with the donor gene precisely inserted at the DD43 target site were obtained. The Cas9-gRNA system was also successfully applied to make a directed P178S mutation of acetolactate synthase1 gene through in planta gene editing. PMID:26294043
USDA-ARS?s Scientific Manuscript database
Bioluminescence is reported from 71 saprobic species of fungi from four, distant lineages in the order Agaricales. Analyses of the fungal luminescent chemistry shows that all four lineages share a functionally conserved substrate and luciferase, indicating that the bioluminescent pathway is likely c...
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Evolutionary transgenomics: prospects and challenges.
Correa, Raul; Baum, David A
2015-01-01
Many advances in our understanding of the genetic basis of species differences have arisen from transformation experiments, which allow us to study the effect of genes from one species (the donor) when placed in the genetic background of another species (the recipient). Such interspecies transformation experiments are usually focused on candidate genes - genes that, based on work in model systems, are suspected to be responsible for certain phenotypic differences between the donor and recipient species. We suggest that the high efficiency of transformation in a few plant species, most notably Arabidopsis thaliana, combined with the small size of typical plant genes and their cis-regulatory regions allow implementation of a screening strategy that does not depend upon a priori candidate gene identification. This approach, transgenomics, entails moving many large genomic inserts of a donor species into the wild type background of a recipient species and then screening for dominant phenotypic effects. As a proof of concept, we recently conducted a transgenomic screen that analyzed more than 1100 random, large genomic inserts of the Alabama gladecress Leavenworthia alabamica for dominant phenotypic effects in the A. thaliana background. This screen identified one insert that shortens fruit and decreases A. thaliana fertility. In this paper we discuss the principles of transgenomic screens and suggest methods to help minimize the frequencies of false positive and false negative results. We argue that, because transgenomics avoids committing in advance to candidate genes it has the potential to help us identify truly novel genes or cryptic functions of known genes. Given the valuable knowledge that is likely to be gained, we believe the time is ripe for the plant evolutionary community to invest in transgenomic screens, at least in the mustard family Brassicaceae where many species are amenable to efficient transformation.
Genome Editing-Enabled HTS Assays Expand Drug Target Pathways for Charcot–Marie–Tooth Disease
2015-01-01
Copy number variation resulting in excess PMP22 protein causes the peripheral neuropathy Charcot–Marie–Tooth disease, type 1A. To broadly interrogate chemically sensitive transcriptional pathways controlling PMP22 protein levels, we used the targeting precision of TALEN-mediated genome editing to embed reporters within the genetic locus harboring the Peripheral Myelin Protein 22 (Pmp22) gene. Using a Schwann cell line with constitutively high endogenous levels of Pmp22, we obtained allelic insertion of secreted bioluminescent reporters with sufficient signal to enable a 1536-well assay. Our findings from the quantitative high-throughput screening (qHTS) of several thousand drugs and clinically investigated compounds using this assay design both overlapped and expanded results from a previous assay using a randomly inserted reporter gene controlled by a single regulatory element of the Pmp22 gene. A key difference was the identification of a kinase-controlled inhibitory pathway of Pmp22 transcription revealed by the activity of the Protein kinase C (PKC)-modulator bryostatin. PMID:25188731
Transgenic breeding of anti-Bombyx mori L. nuclear polyhedrosis virus silkworm Bombyx mori.
Yang, Huijuan; Fan, Wei; Wei, Hao; Zhang, Jinwei; Zhou, Zhonghua; Li, Jianying; Lin, Jianrong; Ding, Nong; Zhong, Boxiong
2008-10-01
Silkworm strains resistant to Bombyx mori L. nuclear polyhedrosis virus were obtained through transgenic experiments. piggyBac transposon with an A3 promoter were randomly inserted into the silkworm, driving the enhanced green fluorescent protein (EGFP) reporter gene into the silkworm genome. Polymerase chain reaction results verified the insertion of the extraneous EGFP gene, and fluorescence microscopy showed that the EGFP was expressed in the midgut tissue. The morbidity ratio of the nuclear polyhedrosis decreased from 90% in the original silkworm strain to 66.7% in the transgenic silkworm strain. Compared with the resistance to the Bombyx mori L. nuclear polyhedrosis virus in the Qiufeng strain, which is commonly used in the production, there was an increase of 33 centesimal points in the transgenic silkworms. The antivirotic character in the Chunhua x Qiuyue strain, which was bred from a different transgenic family, was about 10 centesimal points higher than that in the Qiufeng x Baiyu, another crossbreed used in production. Our results indicated a good application value of the transposon-inserted mutation in the breeding of anti-BmNPV silkworm strain.
A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.
Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K
2011-10-01
A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Bressan, Fabiana Fernandes; Dos Santos Miranda, Moyses; Perecin, Felipe; De Bem, Tiago Henrique; Pereira, Flavia Thomaz Verechia; Russo-Carbolante, Elisa Maria; Alves, Daiani; Strauss, Bryan; Bajgelman, Marcio; Krieger, José Eduardo; Binelli, Mario; Meirelles, Flavio Vieira
2011-02-01
Animal cloning by nuclear transfer (NT) has made the production of transgenic animals using genetically modified donor cells possible and ensures the presence of the gene construct in the offspring. The identification of transgene insertion sites in donor cells before cloning may avoid the production of animals that carry undesirable characteristics due to positional effects. This article compares blastocyst development and competence to establish pregnancies of bovine cloned embryos reconstructed with lentivirus-mediated transgenic fibroblasts containing either random integration of a transgene (random integration group) or nuclear transfer derived transgenic fibroblasts with known transgene insertion sites submitted to recloning (recloned group). In the random integration group, eGFP-expressing bovine fetal fibroblasts were selected by fluorescence activated cell sorting (FACS) and used as nuclei donor cells for NT. In the recloned group, a fibroblast cell line derived from a transgenic cloned fetus was characterized regarding transgene insertion and submitted to recloning. The recloned group had higher blastocyst production (25.38 vs. 14.42%) and higher percentage of 30-day pregnancies (14.29 vs. 2.56%) when compared to the random integration group. Relative eGFP expression analysis in fibroblasts derived from each cloned embryo revealed more homogeneous expression in the recloned group. In conclusion, the use of cell lines recovered from transgenic fetuses after identification of the transgene integration site allowed for the production of cells and fetuses with stable transgene expression, and recloning may improve transgenic animal yields.
Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang
2016-05-01
Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Matsunaga, Taichi; Yamashita, Jun K
2014-02-07
Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.
Seo, Hogyu David; Lee, Daeyoup
2018-05-15
Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.
Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi
2016-07-01
Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
[The primary structure of a vaccine strain of tobacco mosaic virus V-69].
Shiian, A N; Mil'shina, N V; Snegireva, P B; Pukhal'skiĭ, V A
1994-12-01
A random set of cDNA fragments were synthesized on genomic RNA of TMV vaccine strain V-69, using random primers and reverse transcriptase. Following synthesis of double-stranded cDNA, they were cloned into the pUC-19 plasmid; and 28 clones were sequenced (insert size 100-500 bp). High nucleotide sequence homology of V-69 (more than 95%) was shown only with tomato strain TMV-L [1]. Sequenced clones represent 54% of the genome (50% of the replicase gene, 98% of the transport protein gene, and 60% of the coat protein gene). In this genome region, 24 base substitutions were revealed, as compared to the wild-type TMV-L sequence. Six base substitutions resulted in changes in corresponding amino acid codons. No substitutions coincided with those discovered in the related TMV vaccine strain L11A [2], while two substitutions in the replicase gene were identical to those found in TMV strain Lta1 [3], which is capable of overcoming protection in tomatoes with the resistance gene Tm-1.
USDA-ARS?s Scientific Manuscript database
Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...
Morimoto, Tomomi; Arii, Jun; Akashi, Hiroomi; Kawaguchi, Yasushi
2009-03-01
Information on sites in HSV genomes at which foreign gene(s) can be inserted without disrupting viral genes or affecting properties of the parental virus are important for basic research on HSV and development of HSV-based vectors for human therapy. The intergenic region between HSV-1 UL3 and UL4 genes has been reported to satisfy the requirements for such an insertion site. The UL3 and UL4 genes are oriented toward the intergenic region and, therefore, insertion of a foreign gene(s) into the region between the UL3 and UL4 polyadenylation signals should not disrupt any viral genes or transcriptional units. HSV-1 and HSV-2 each have more than 10 additional regions structurally similar to the intergenic region between UL3 and UL4. In the studies reported here, it has been demonstrated that insertion of a reporter gene expression cassette into several of the HSV-1 and HSV-2 intergenic regions has no effect on viral growth in cell culture or virulence in mice, suggesting that these multiple intergenic regions may be suitable HSV sites for insertion of foreign genes.
Silicheva, Margarita; Golovnin, Anton; Pomerantseva, Ekaterina; Parshikov, Aleksander; Georgiev, Pavel; Maksimenko, Oksana
2010-01-01
The white gene, which is responsible for eye pigmentation, is widely used to study position effects in Drosophila. As a result of insertion of P-element vectors containing mini-white without enhancers into random chromosomal sites, flies with different eye color phenotypes appear, which is usually explained by the influence of positive/negative regulatory elements located around the insertion site. We found that, in more than 70% of cases when mini-white expression was subject to positive position effects, deletion of the white promoter had no effect on eye pigmentation; in these cases, the transposon was inserted into the transcribed regions of genes. Therefore, transcription through the mini-white gene could be responsible for high levels of its expression in most of chromosomal sites. Consistently with this conclusion, transcriptional terminators proved to be efficient in protecting mini-white expression from positive position effects. On the other hand, the best characterized Drosophila gypsy insulator was poorly effective in terminating transcription and, as a consequence, only partially protected mini-white expression from these effects. Thus, to ensure maximum protection of a transgene from position effects, a perfect boundary/insulator element should combine three activities: to block enhancers, to provide a barrier between active and repressed chromatin, and to terminate transcription. PMID:19854952
Enshell-Seijffers, D; Smelyanski, L; Gershoni, J M
2001-05-15
Filamentous bacteriophages are particularly efficient for the expression and display of combinatorial random peptides. Two phage proteins are often employed for peptide display: the infectivity protein, PIII, and the major coat protein, PVIII. The use of PVIII typically requires the expression of two pVIII genes: the wild-type and the recombinant pVIII gene, to generate mosaic phages. 'Type 88' vectors contain two pVIII genes in one phage genome. In this study a novel 'type 88' expression vector has been rationally designed and constructed. Two factors were taken into account: the insertion site and the genetic stability of the second pVIII gene. It was found that selective deletion of recombinant genes was encountered when inserts were cloned into either of the two non-coding regions of the phage genome. The deletions were independent of recA yet required a functional F-episome. Transcription was also found to be a positive factor for deletion. Taking the above into account led to the generation of a novel vector, designated fth1, which can be used to express recombinant peptides as pVIII chimeric proteins in mosaic bacteriophages. The fth1 vector is not only genetically stable but also of high copy number and produces high titers of recombinant phages.
A novel helper phage enabling construction of genome-scale ORF-enriched phage display libraries.
Gupta, Amita; Shrivastava, Nimisha; Grover, Payal; Singh, Ajay; Mathur, Kapil; Verma, Vaishali; Kaur, Charanpreet; Chaudhary, Vijay K
2013-01-01
Phagemid-based expression of cloned genes fused to the gIIIP coding sequence and rescue using helper phages, such as VCSM13, has been used extensively for constructing large antibody phage display libraries. However, for randomly primed cDNA and gene fragment libraries, this system encounters reading frame problems wherein only one of 18 phages display the translated foreign peptide/protein fused to phagemid-encoded gIIIP. The elimination of phages carrying out-of-frame inserts is vital in order to improve the quality of phage display libraries. In this study, we designed a novel helper phage, AGM13, which carries trypsin-sensitive sites within the linker regions of gIIIP. This renders the phage highly sensitive to trypsin digestion, which abolishes its infectivity. For open reading frame (ORF) selection, the phagemid-borne phages are rescued using AGM13, so that clones with in-frame inserts express fusion proteins with phagemid-encoded trypsin-resistant gIIIP, which becomes incorporated into the phages along with a few copies of AGM13-encoded trypsin-sensitive gIIIP. In contrast, clones with out-of-frame inserts produce phages carrying only AGM13-encoded trypsin-sensitive gIIIP. Trypsin treatment of the phage population renders the phages with out-of-frame inserts non-infectious, whereas phages carrying in-frame inserts remain fully infectious and can hence be enriched by infection. This strategy was applied efficiently at a genome scale to generate an ORF-enriched whole genome fragment library from Mycobacterium tuberculosis, in which nearly 100% of the clones carried in-frame inserts after selection. The ORF-enriched libraries were successfully used for identification of linear and conformational epitopes for monoclonal antibodies specific to mycobacterial proteins.
Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan
Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less
Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.
Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia
2016-09-12
Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.
Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.
Behrens, R; Hayles, J; Nurse, P
2000-12-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.
Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames
Behrens, Ralf; Hayles, Jacky; Nurse, Paul
2000-01-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681
Meca-Cortés, Oscar; Guerra-Rebollo, Marta; Garrido, Cristina; Borrós, Salvador; Rubio, Nuria; Blanco, Jeronimo
2017-09-15
The use of non-viral procedures, together with CRISPR/Cas9 genome-editing technology, allows the insertion of single-copy therapeutic genes at pre-determined genomic sites, overcoming safety limitations resulting from random gene insertions of viral vectors with potential for genome damage. In this study, we demonstrate that combination of non-viral gene delivery and CRISPR/Cas9-mediated knockin via homology-directed repair can replace the use of viral vectors for the generation of genetically modified therapeutic cells. We custom-modified human adipose mesenchymal stem cells (hAMSCs), using electroporation as a transfection method and CRISPR/Cas9-mediated knockin for the introduction and stable expression of a 3 kb DNA fragment including the eGFP (selectable marker) and a variant of the herpes simplex virus 1 thymidine kinase genes (therapeutic gene), under the control of the human elongation factor 1 alpha promoter in exon 5 of the endogenous thymidine kinase 2 gene. Using a U87 glioma model in SCID mice, we show that the therapeutic capacity of the new CRISPR/Cas9-engineered hAMSCs is equivalent to that of therapeutic hAMSCs generated by introduction of the same therapeutic gene by transduction with a lentiviral vector previously published by our group. This strategy should be of general use to other applications requiring genetic modification of therapeutic cells. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Himar1 Transposon for Efficient Random Mutagenesis in Aggregatibacter actinomycetemcomitans
Ding, Qinfeng; Tan, Kai Soo
2017-01-01
Aggregatibacter actinomycetemcomitans is the primary etiological agent of aggressive periodontal disease. Identification of novel virulence factors at the genome-wide level is hindered by lack of efficient genetic tools to perform mutagenesis in this organism. The Himar1 mariner transposon is known to yield a random distribution of insertions in an organism’s genome with requirement for only a TA dinucleotide target and is independent of host-specific factors. However, the utility of this system in A. actinomycetemcomitans is unknown. In this study, we found that Himar1 transposon mutagenesis occurs at a high frequency (×10-4), and can be universally applied to wild-type A. actinomycetemcomitans strains of serotypes a, b, and c. The Himar1 transposon inserts were stably inherited in A. actinomycetemcomitans transconjugants in the absence of antibiotics. A library of 16,000 mutant colonies of A. actinomycetemcomitans was screened for reduced biofilm formation. Mutants with transposon inserts in genes encoding pilus, putative ion transporters, multidrug resistant proteins, transcription regulators and enzymes involved in the synthesis of extracellular polymeric substance, bacterial metabolism and stress response were discovered in this screen. Our results demonstrated the utility of the Himar1 mutagenesis system as a novel genetic tool for functional genomic analysis in A. actinomycetemcomitans. PMID:29018421
Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K
2016-12-07
Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.
Gene Function Analysis in the Ubiquitous Human Commensal and Pathogen Malassezia Genus
Ianiri, Giuseppe; Averette, Anna F.; Kingsbury, Joanne M.; Heitman, Joseph
2016-01-01
ABSTRACT The genus Malassezia includes 14 species that are found on the skin of humans and animals and are associated with a number of diseases. Recent genome sequencing projects have defined the gene content of all 14 species; however, to date, genetic manipulation has not been possible for any species within this genus. Here, we develop and then optimize molecular tools for the transformation of Malassezia furfur and Malassezia sympodialis using Agrobacterium tumefaciens delivery of transfer DNA (T-DNA) molecules. These T-DNAs can insert randomly into the genome. In the case of M. furfur, targeted gene replacements were also achieved via homologous recombination, enabling deletion of the ADE2 gene for purine biosynthesis and of the LAC2 gene predicted to be involved in melanin biosynthesis. Hence, the introduction of exogenous DNA and direct gene manipulation are feasible in Malassezia species. PMID:27899504
Construction of a filamentous phage display peptide library.
Fagerlund, Annette; Myrset, Astrid Hilde; Kulseth, Mari Ann
2014-01-01
The concept of phage display is based on insertion of random oligonucleotides at an appropriate location within a structural gene of a bacteriophage. The resulting phage will constitute a library of random peptides displayed on the surface of the bacteriophages, with the encoding genotype packaged within each phage particle. Using a phagemid/helper phage system, the random peptides are interspersed between wild-type coat proteins. Libraries of phage-expressed peptides may be used to search for novel peptide ligands to target proteins. The success of finding a peptide with a desired property in a given library is highly dependent on the diversity and quality of the library. The protocols in this chapter describe the construction of a high-diversity library of phagemid vector encoding fusions of the phage coat protein pVIII with random peptides, from which a phage library displaying random peptides can be prepared.
Forgie, Marie M; Greer, Danielle M; Kram, Jessica J F; Vander Wyst, Kiley B; Salvo, Nicole P; Siddiqui, Danish S
2016-03-01
Foley catheters are used for cervical ripening during induction of labor. Previous studies suggest that use of a stylette (a thin, rigid wire) to guide catheter insertion decreases insertion failure. However, stylette effects on insertion outcomes have been sparsely studied. The purpose of this study was to compare catheter insertion times, patient-assessed pain levels, and insertion failure rates between women who received a digitally placed Foley catheter for cervical ripening with the aid of a stylette and women who received the catheter without a stylette. We conducted a randomized clinical trial of women aged ≥ 18 years who presented for induction of labor. Inclusion criteria were singletons with intact membranes and cephalic presentation. Women received a computer-generated random assignment of a Foley catheter insertion with a stylette (treatment group, n = 62) or without a stylette (control group, n = 61). For all women, a standard insertion technique protocol was used. Three primary outcomes were of interest, including the following: (1) insertion time (total minutes to successful catheter placement), (2) patient-assessed pain level (0-10), and (3) failure rate of the randomly assigned insertion method. Treatment control differences were first examined using the Pearson's test of independence and the Student t test. Per outcome, we also constructed 4 regression models, each including the random effect of physician and fixed effects of stylette use with patient nulliparity, a history of vaginal delivery, cervical dilation at presentation, or postgraduate year of the performing resident physician. Women who received the Foley catheter with the stylette vs without the stylette did not differ by age, race/ethnicity, body mass index, or any of several other characteristics. Regression models revealed that insertion time, patient pain, and insertion failure were unrelated to stylette use, nulliparity, and history of vaginal delivery. However, overall insertion time and failure were significantly influenced by cervical dilation, with insertion time decreasing by 21% (95% confidence interval [CI], 5-34%) and odds of failure decreasing by 71% (odds ratio, 0.29; 95% CI, 0.10-0.86) per 1 cm dilation. Resident postgraduate year also significantly influenced insertion time, with greater time required of physicians with less experience. Mean insertion time was 51% (95% CI, 23-69%) shorter for fourth-year than second-year residents. Statistically nonsignificant but prominent patterns in outcomes were also observed, suggesting stylette use may lengthen the overall insertion procedure but minimize variability in pain levels and decrease insertion failure. The randomized trial suggests that, even after accounting for nulliparity, history of vaginal delivery, cervical dilation, and physician experience, Foley catheter insertions with and without a stylette are equivalent in insertion times, patient pain levels, and failure of catheter placement. Copyright © 2016 Elsevier Inc. All rights reserved.
Cancer gene discovery: exploiting insertional mutagenesis
Ranzani, Marco; Annunziato, Stefano; Adams, David J.; Montini, Eugenio
2013-01-01
Insertional mutagenesis has been utilized as a functional forward genetics screen for the identification of novel genes involved in the pathogenesis of human cancers. Different insertional mutagens have been successfully used to reveal new cancer genes. For example, retroviruses (RVs) are integrating viruses with the capacity to induce the deregulation of genes in the neighborhood of the insertion site. RVs have been employed for more than 30 years to identify cancer genes in the hematopoietic system and mammary gland. Similarly, another tool that has revolutionized cancer gene discovery is the cut-and-paste transposons. These DNA elements have been engineered to contain strong promoters and stop cassettes that may function to perturb gene expression upon integration proximal to genes. In addition, complex mouse models characterized by tissue-restricted activity of transposons have been developed to identify oncogenes and tumor suppressor genes that control the development of a wide range of solid tumor types, extending beyond those tissues accessible using RV-based approaches. Most recently, lentiviral vectors (LVs) have appeared on the scene for use in cancer gene screens. LVs are replication defective integrating vectors that have the advantage of being able to infect non-dividing cells, in a wide range of cell types and tissues. In this review, we describe the various insertional mutagens focusing on their advantages/limitations and we discuss the new and promising tools that will improve the insertional mutagenesis screens of the future. PMID:23928056
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. Comparison of hupA of E. coli and S. typhimurium revealed that the HU-2 proteins were identical and that there was high conservation of nucleotide sequences outside the coding frames of the genes. A 300-member genomic library of S. typhimurium was constructed by using random transposition of MudP, a specialized chimeric P22-Mu phage that packages chromosomal DNA unidirectionally from its insertion point. Oligonucleotide hybridization against the library identified one MudP insertion that lies within 28 kilobases of hupA; the MudP was 12% linked to purH at 90.5 min on the standard map. Plasmids expressing HU-2 had a surprising phenotype; they caused growth arrest when they were introduced into E. coli strains bearing a himA or hip mutation. These results suggest that IHF and HU have interactive roles in bacteria. Images PMID:3056912
Capel, Elena; Zomer, Aldert L.; Nussbaumer, Thomas; Bole, Christine; Izac, Brigitte; Frapy, Eric; Meyer, Julie; Bouzinba-Ségard, Haniaa; Bille, Emmanuelle; Jamet, Anne; Cavau, Anne; Letourneur, Franck; Bourdoulous, Sandrine; Rattei, Thomas; Coureuil, Mathieu
2016-01-01
ABSTRACT Neisseria meningitidis is a leading cause of bacterial meningitis and septicemia, affecting infants and adults worldwide. N. meningitidis is also a common inhabitant of the human nasopharynx and, as such, is highly adapted to its niche. During bacteremia, N. meningitidis gains access to the blood compartment, where it adheres to endothelial cells of blood vessels and causes dramatic vascular damage. Colonization of the nasopharyngeal niche and communication with the different human cell types is a major issue of the N. meningitidis life cycle that is poorly understood. Here, highly saturated random transposon insertion libraries of N. meningitidis were engineered, and the fitness of mutations during routine growth and that of colonization of endothelial and epithelial cells in a flow device were assessed in a transposon insertion site sequencing (Tn-seq) analysis. This allowed the identification of genes essential for bacterial growth and genes specifically required for host cell colonization. In addition, after having identified the small noncoding RNAs (sRNAs) located in intergenic regions, the phenotypes associated with mutations in those sRNAs were defined. A total of 383 genes and 8 intergenic regions containing sRNA candidates were identified to be essential for growth, while 288 genes and 33 intergenic regions containing sRNA candidates were found to be specifically required for host cell colonization. PMID:27486197
Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.
2013-01-01
High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sberro, Hila; Leavitt, Azita; Kiro, Ruth
Toxin-antitoxin (TA) modules, composed of a toxic protein and a counteracting antitoxin, play important roles in bacterial physiology. We examined the experimental insertion of 1.5 million genes from 388 microbial genomes into an Escherichia coli host using over 8.5 million random clones. This revealed hundreds of genes (toxins) that could only be cloned when the neighboring gene (antitoxin) was present on the same clone. Clustering of these genes revealed TA families widespread in bacterial genomes, some of which deviate from the classical characteristics previously described for such modules. Introduction of these genes into E. coli validated that the toxin toxicitymore » is mitigated by the antitoxin. Infection experiments with T7 phage showed that two of the new modules can provide resistance against phage. Moreover, our experiments revealed an 'anti-defense' protein in phage T7 that neutralizes phage resistance. Our results expose active fronts in the arms race between bacteria and phage.« less
Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.
2010-01-01
Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052
The insertional history of an active family of L1 retrotransposons in humans.
Boissinot, Stéphane; Entezam, Ali; Young, Lynn; Munson, Peter J; Furano, Anthony V
2004-07-01
As humans contain a currently active L1 (LINE-1) non-LTR retrotransposon family (Ta-1), the human genome database likely provides only a partial picture of Ta-1-generated diversity. We used a non-biased method to clone Ta-1 retrotransposon-containing loci from representatives of four ethnic populations. We obtained 277 distinct Ta-1 loci and identified an additional 67 loci in the human genome database. This collection represents approximately 90% of the Ta-1 population in the individuals examined and is thus more representative of the insertional history of Ta-1 than the human genome database, which lacked approximately 40% of our cloned Ta-1 elements. As both polymorphic and fixed Ta-1 elements are as abundant in the GC-poor genomic regions as in ancestral L1 elements, the enrichment of L1 elements in GC-poor areas is likely due to insertional bias rather than selection. Although the chromosomal distribution of Ta-1 inserts is generally a function of chromosomal length and gene density, chromosome 4 significantly deviates from this pattern and has been much more hospitable to Ta-1 insertions than any other chromosome. Also, the intra-chromosomal distribution of Ta-1 elements is not uniform. Ta-1 elements tend to cluster, and the maximal gaps between Ta-1 inserts are larger than would be expected from a model of uniform random insertion. Copyright 2004 Cold Spring Harbor Laboratory Press ISSN
cea-kil operon of the ColE1 plasmid.
Sabik, J F; Suit, J L; Luria, S E
1983-01-01
We isolated a series of Tn5 transposon insertion mutants and chemically induced mutants with mutations in the region of the ColE1 plasmid that includes the cea (colicin) and imm (immunity) genes. Bacterial cells harboring each of the mutant plasmids were tested for their response to the colicin-inducing agent mitomycin C. All insertion mutations within the cea gene failed to bring about cell killing after mitomycin C treatment. A cea- amber mutation exerted a polar effect on killing by mitomycin C. Two insertions beyond the cea gene but within or near the imm gene also prevented the lethal response to mitomycin C. These findings suggest the presence in the ColE1 plasmid of an operon containing the cea and kil genes whose product is needed for mitomycin C-induced lethality. Bacteria carrying ColE1 plasmids with Tn5 inserted within the cea gene produced serologically cross-reacting fragments of the colicin E1 molecule, the lengths of which were proportional to the distance between the insertion and the promoter end of the cea gene. Images PMID:6298187
Gene and enhancer trap tagging of vascular-expressed genes in poplar trees
Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan
2004-01-01
We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...
Quadros, Rolen M; Miura, Hiromi; Harms, Donald W; Akatsuka, Hisako; Sato, Takehito; Aida, Tomomi; Redder, Ronald; Richardson, Guy P; Inagaki, Yutaka; Sakai, Daisuke; Buckley, Shannon M; Seshacharyulu, Parthasarathy; Batra, Surinder K; Behlke, Mark A; Zeiner, Sarah A; Jacobi, Ashley M; Izu, Yayoi; Thoreson, Wallace B; Urness, Lisa D; Mansour, Suzanne L; Ohtsuka, Masato; Gurumurthy, Channabasavaiah B
2017-05-17
Conditional knockout mice and transgenic mice expressing recombinases, reporters, and inducible transcriptional activators are key for many genetic studies and comprise over 90% of mouse models created. Conditional knockout mice are generated using labor-intensive methods of homologous recombination in embryonic stem cells and are available for only ~25% of all mouse genes. Transgenic mice generated by random genomic insertion approaches pose problems of unreliable expression, and thus there is a need for targeted-insertion models. Although CRISPR-based strategies were reported to create conditional and targeted-insertion alleles via one-step delivery of targeting components directly to zygotes, these strategies are quite inefficient. Here we describe Easi-CRISPR (Efficient additions with ssDNA inserts-CRISPR), a targeting strategy in which long single-stranded DNA donors are injected with pre-assembled crRNA + tracrRNA + Cas9 ribonucleoprotein (ctRNP) complexes into mouse zygotes. We show for over a dozen loci that Easi-CRISPR generates correctly targeted conditional and insertion alleles in 8.5-100% of the resulting live offspring. Easi-CRISPR solves the major problem of animal genome engineering, namely the inefficiency of targeted DNA cassette insertion. The approach is robust, succeeding for all tested loci. It is versatile, generating both conditional and targeted insertion alleles. Finally, it is highly efficient, as treating an average of only 50 zygotes is sufficient to produce a correctly targeted allele in up to 100% of live offspring. Thus, Easi-CRISPR offers a comprehensive means of building large-scale Cre-LoxP animal resources.
Otsuka, Sachio; Saiki, Jun
2016-02-01
Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.
A non-canonical transferred DNA insertion at the BRI1 locus in Arabidopsis thaliana.
Zhao, Zhong; Zhu, Yan; Erhardt, Mathieu; Ruan, Ying; Shen, Wen-Hui
2009-04-01
Agrobacterium-mediated transformation is widely used in transgenic plant engineering and has been proven to be a powerful tool for insertional mutagenesis of the plant genome. The transferred DNA (T-DNA) from Agrobacterium is integrated into the plant genome through illegitimate recombination between the T-DNA and the plant DNA. Contrasting to the canonical insertion, here we report on a locus showing a complex mutation associated with T-DNA insertion at the BRI1 gene in Arabidopsis thaliana. We obtained a mutant line, named salade for its phenotype of dwarf stature and proliferating rosette. Molecular characterization of this mutant revealed that in addition to T-DNA a non-T-DNA-localized transposon from bacteria was inserted in the Arabidopsis genome and that a region of more than 11.5 kb of the Arabidopsis genome was deleted at the insertion site. The deleted region contains the brassinosteroid receptor gene BRI1 and the transcription factor gene WRKY13. Our finding reveals non-canonical T-DNA insertion, implicating horizontal gene transfer and cautioning the use of T-DNA as mutagen in transgenic research.
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Respiratory-deficient mutants of the unicellular green alga Chlamydomonas: a review.
Salinas, Thalia; Larosa, Véronique; Cardol, Pierre; Maréchal-Drouard, Laurence; Remacle, Claire
2014-05-01
Genetic manipulation of the unicellular green alga Chlamydomonas reinhardtii is straightforward. Nuclear genes can be interrupted by insertional mutagenesis or targeted by RNA interference whereas random or site-directed mutagenesis allows the introduction of mutations in the mitochondrial genome. This, combined with a screen that easily allows discriminating respiratory-deficient mutants, makes Chlamydomonas a model system of choice to study mitochondria biology in photosynthetic organisms. Since the first description of Chlamydomonas respiratory-deficient mutants in 1977 by random mutagenesis, many other mutants affected in mitochondrial components have been characterized. These respiratory-deficient mutants increased our knowledge on function and assembly of the respiratory enzyme complexes. More recently some of these mutants allowed the study of mitochondrial gene expression processes poorly understood in Chlamydomonas. In this review, we update the data concerning the respiratory components with a special focus on the assembly factors identified on other organisms. In addition, we make an inventory of different mitochondrial respiratory mutants that are inactivated either on mitochondrial or nuclear genes. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Idnurm, Alexander; Howlett, Barbara J.
2002-01-01
A pathogenicity gene has been identified in Leptosphaeria maculans, the ascomycetous fungus that causes blackleg disease of canola (Brassica napus). This gene encodes isocitrate lyase, a component of the glyoxylate cycle, and is essential for the successful colonization of B. napus. It was identified by a reverse genetics approach whereby a plasmid conferring hygromycin resistance was inserted randomly into the L. maculans genome. Twelve of 516 transformants tested had reduced pathogenicity on cotyledons of B. juncea and B. napus, and 1 of these 12 had a deletion of the isocitrate lyase gene, as well as an insertion of the hygromycin resistance gene. This mutant was unable to grow on fatty acids, including monolaurate, and the isocitrate lyase transcript was not detected. When the wild-type gene was reintroduced into the mutant, growth on monolaurate was restored and pathogenicity was partially restored. L. maculans isocitrate lyase is produced during infection of B. napus cotyledons, while the plant homologue is not. When 2.5% glucose was added to the inoculum of the isocitrate lyase mutant, lesions of sizes similar to those caused by wild-type isolate M1 developed on B. napus cotyledons. These findings suggest that the glyoxylate pathway is essential for disease development by this plant-pathogenic fungus, as has been shown recently for a fungal and bacterial pathogen of animals and a bacterial pathogen of plants. Involvement of the glyoxylate pathway in pathogenesis in animals and plants presents potential drug targets for control of diseases. PMID:12455691
Genome-scale engineering for systems and synthetic biology
Esvelt, Kevin M; Wang, Harris H
2013-01-01
Genome-modification technologies enable the rational engineering and perturbation of biological systems. Historically, these methods have been limited to gene insertions or mutations at random or at a few pre-defined locations across the genome. The handful of methods capable of targeted gene editing suffered from low efficiencies, significant labor costs, or both. Recent advances have dramatically expanded our ability to engineer cells in a directed and combinatorial manner. Here, we review current technologies and methodologies for genome-scale engineering, discuss the prospects for extending efficient genome modification to new hosts, and explore the implications of continued advances toward the development of flexibly programmable chasses, novel biochemistries, and safer organismal and ecological engineering. PMID:23340847
Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang
2015-01-01
Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. PMID:26133897
De novo insertion of an intron into the mammalian sex determining gene, SRY
O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall
1998-01-01
Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071
Watabe, Kazuyuki; Mimuro, Mamoru; Tsuchiya, Tohru
2014-11-01
Synechocystis sp. PCC 6803 (Synechocystis) is the first sequenced photosynthetic organism and has two advantages: natural transformation and light-activated heterotrophic growth. Such characteristics have mainly promoted reverse genetic analysis in this organism, however, to date approximately 50% of genes are still annotated as 'unknown protein' or 'hypothetical protein'. Therefore, forward genetic analysis is required for the identification of significant genes responsible for photosynthesis and other physiological phenomena among the genes of unknown function. The in vivo transposon mutagenesis system is one of the major methods for random mutagenesis. However, present in vivo transposon mutagenesis systems for cyanobacteria face problems such as relatively low frequency of transposition and repeated transposition in the host cells. In this study, we constructed vectors based on a mini-Tn5-derived vector that was designed to prevent repeated transposition. Our vectors carry a hyperactive transposase and optimized recognition sequence of transposase, which were reported to enhance frequency of transposition. Using the vector, we succeeded in highly frequent transposition (9×10(-3) per recipient cell) in Synechocystis. Transposon insertion sites of 10 randomly selected mutants indicated that the insertion sites spread throughout the genome with low sequence dependency. Furthermore, one of the 10 mutants exhibited the slow-growing phenotype, and the mutant was functionally complemented by using our expression vector. Our system also worked with another model cyanobacterium, Synechococcus elongatus PCC 7942, with high frequency. These results indicate that the developed system can be applied to the forward genetic analysis of a broad range of cyanobacteria. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Gowda, Malali
2016-01-01
Blast disease caused by the Magnaporthe species is a major factor affecting the productivity of rice, wheat and millets. This study was aimed at generating genomic information for rice and non-rice Magnaporthe isolates to understand the extent of genetic variation. We have sequenced the whole genome of the Magnaporthe isolates, infecting rice (leaf and neck), finger millet (leaf and neck), foxtail millet (leaf) and buffel grass (leaf). Rice and finger millet isolates infecting both leaf and neck tissues were sequenced, since the damage and yield loss caused due to neck blast is much higher as compared to leaf blast. The genome-wide comparison was carried out to study the variability in gene content, candidate effectors, repeat element distribution, genes involved in carbohydrate metabolism and SNPs. The analysis of repeat element footprints revealed some genes such as naringenin, 2-oxoglutarate 3-dioxygenase being targeted by Pot2 and Occan, in isolates from different host species. Some repeat insertions were host-specific while other insertions were randomly shared between isolates. The distributions of repeat elements, secretory proteins, CAZymes and SNPs showed significant variation across host-specific lineages of Magnaporthe indicating an independent genome evolution orchestrated by multiple genomic factors. PMID:27658241
Molecular mechanisms of retroviral integration site selection
Kvaratskhelia, Mamuka; Sharma, Amit; Larue, Ross C.; Serrao, Erik; Engelman, Alan
2014-01-01
Retroviral replication proceeds through an obligate integrated DNA provirus, making retroviral vectors attractive vehicles for human gene-therapy. Though most of the host cell genome is available for integration, the process of integration site selection is not random. Retroviruses differ in their choice of chromatin-associated features and also prefer particular nucleotide sequences at the point of insertion. Lentiviruses including HIV-1 preferentially integrate within the bodies of active genes, whereas the prototypical gammaretrovirus Moloney murine leukemia virus (MoMLV) favors strong enhancers and active gene promoter regions. Integration is catalyzed by the viral integrase protein, and recent research has demonstrated that HIV-1 and MoMLV targeting preferences are in large part guided by integrase-interacting host factors (LEDGF/p75 for HIV-1 and BET proteins for MoMLV) that tether viral intasomes to chromatin. In each case, the selectivity of epigenetic marks on histones recognized by the protein tether helps to determine the integration distribution. In contrast, nucleotide preferences at integration sites seem to be governed by the ability for the integrase protein to locally bend the DNA duplex for pairwise insertion of the viral DNA ends. We discuss approaches to alter integration site selection that could potentially improve the safety of retroviral vectors in the clinic. PMID:25147212
Jones, Alicia M; Atkinson, Joshua T; Silberg, Jonathan J
2017-01-01
Rearrangements that alter the order of a protein's sequence are used in the lab to study protein folding, improve activity, and build molecular switches. One of the simplest ways to rearrange a protein sequence is through random circular permutation, where native protein termini are linked together and new termini are created elsewhere through random backbone fission. Transposase mutagenesis has emerged as a simple way to generate libraries encoding different circularly permuted variants of proteins. With this approach, a synthetic transposon (called a permuteposon) is randomly inserted throughout a circularized gene to generate vectors that express different permuted variants of a protein. In this chapter, we outline the protocol for constructing combinatorial libraries of circularly permuted proteins using transposase mutagenesis, and we describe the different permuteposons that have been developed to facilitate library construction.
Singh, Rameet H; Thaxton, Lauren; Carr, Shannon; Leeman, Lawrence; Schneider, Emily; Espey, Eve
2016-11-01
To evaluate the effectiveness of inhaled nitrous oxide for pain management among nulliparous women undergoing intrauterine device (IUD) insertion. A double-blind, randomized controlled trial was conducted among nulliparous women aged 13-45years who underwent IUD insertion at a US center between October 1, 2013, and August 31, 2014. Using a computer-generated randomization sequence, participants were randomly assigned to inhale either oxygen (O 2 ) or a mixture of 50% nitrous oxide and 50% oxygen (N 2 O/O 2 ) through a nasal mask for 2minutes before insertion. Only the person administering the inhalation agent was aware of group assignment. The primary outcome was maximum pain assessed 2minutes after insertion via a 100-mm visual analog scale. Analyses were by intention to treat. Forty women were assigned to each group. Mean maximum pain score at the time of insertion was 54.3±24.8mm for the N 2 O/O 2 group and 55.3±20.9mm for the O 2 group (P=0.86). Adverse effects were reported for 6 (15%) women in the N 2 O/O 2 group and 7 (18%) in the O 2 group (P=0.32). N 2 O/O 2 did not reduce the pain of IUD insertion among nulliparous women. ClinicalTrials.gov: NCT02391714. Published by Elsevier Ireland Ltd.
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza
2015-02-01
To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.
Theodorou, Vassiliki; Kimm, Melanie A; Boer, Mandy; Wessels, Lodewyk; Theelen, Wendy; Jonkers, Jos; Hilkens, John
2007-06-01
We performed a high-throughput retroviral insertional mutagenesis screen in mouse mammary tumor virus (MMTV)-induced mammary tumors and identified 33 common insertion sites, of which 17 genes were previously not known to be associated with mammary cancer and 13 had not previously been linked to cancer in general. Although members of the Wnt and fibroblast growth factors (Fgf) families were frequently tagged, our exhaustive screening for MMTV insertion sites uncovered a new repertoire of candidate breast cancer oncogenes. We validated one of these genes, Rspo3, as an oncogene by overexpression in a p53-deficient mammary epithelial cell line. The human orthologs of the candidate oncogenes were frequently deregulated in human breast cancers and associated with several tumor parameters. Computational analysis of all MMTV-tagged genes uncovered specific gene families not previously associated with cancer and showed a significant overrepresentation of protein domains and signaling pathways mainly associated with development and growth factor signaling. Comparison of all tagged genes in MMTV and Moloney murine leukemia virus-induced malignancies showed that both viruses target mostly different genes that act predominantly in distinct pathways.
Okada, Kazuma; Wada, Masato; Moriya, Shigeki; Katayose, Yuichi; Fujisawa, Hiroko; Wu, Jianzhong; Kanamori, Hiroyuki; Kurita, Kanako; Sasaki, Harumi; Fujii, Hiroshi; Terakami, Shingo; Iwanami, Hiroshi; Yamamoto, Toshiya; Abe, Kazuyuki
2016-11-01
Determining the molecular mechanism of fruit tree architecture is important for tree management and fruit production. An apple mutant 'McIntosh Wijcik', which was discovered as a bud mutation from 'McIntosh', exhibits a columnar growth phenotype that is controlled by a single dominant gene, Co. In this study, the mutation and the Co gene were analyzed. Fine mapping narrowed the Co region to a 101 kb region. Sequence analysis of the Co region and the original wild-type co region identified an insertion mutation of an 8202 bp long terminal repeat (LTR) retroposon in the Co region. Segregation analysis using a DNA marker based on the insertion polymorphism showed that the LTR retroposon was closely associated with the columnar growth phenotype. RNA-seq and RT-PCR analysis identified a promising Co candidate gene (91071-gene) within the Co region that is specifically expressed in 'McIntosh Wijcik' but not in 'McIntosh'. The 91071-gene was located approximately 16 kb downstream of the insertion mutation and is predicted to encode a 2-oxoglutarate-dependent dioxygenase involved in an unknown reaction. Overexpression of the 91071-gene in transgenic tobaccos and apples resulted in phenotypes with short internodes, like columnar apples. These data suggested that the 8202 bp retroposon insertion in 'McIntosh Wijcik' is associated with the short internodes of the columnar growth phenotype via upregulated expression of the adjacent 91071-gene. Furthermore, the DNA marker based on the insertion polymorphism could be useful for the marker-assisted selection of columnar apples.
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p<0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434 (inlB), lmo0263 (inlH), lmo0543, lmo0057 (EsaA), lmo2563, lmo0453), caused enhanced biofilm formation in the bacterium at 15 °C. The remaining mutants harbored interruptions in 10 genetic loci previously associated with biofilm formation at higher temperatures, indicating some temperature driven differences in the formation of biofilm by L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
Sorting genomes by reciprocal translocations, insertions, and deletions.
Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying
2010-01-01
The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.
Knobloch, Johannes K.-M.; Nedelmann, Max; Kiel, Kathrin; Bartscht, Katrin; Horstkotte, Matthias A.; Dobinsky, Sabine; Rohde, Holger; Mack, Dietrich
2003-01-01
Transposon mutagenesis with the Enterococcus faecalis transposon Tn917 is a genetic approach frequently used to identify genes related with specific phenotypes in gram-positive bacteria. We established an arbitrary PCR for the rapid and easy identification of Tn917 insertion sites in Staphylococcus epidermidis with six independent, well-characterized biofilm-negative Tn917 transposon mutants, which were clustered in the icaADBC gene locus or harbor Tn917 in the regulatory gene rsbU. For all six of these mutants, short chromosomal DNA fragments flanking both transposon ends could be amplified. All fragments were sufficient to correctly identify the Tn917 insertion sites in the published S. epidermidis genomes. By using this technique, the Tn917 insertion sites of three not-yet-characterized biofilm-negative or nonmucoid mutants were identified. In the biofilm-negative and nonmucoid mutant M12, Tn917 is inserted into a gene homologous to the regulatory gene purR of Bacillus subtilis and Staphylococcus aureus. The Tn917 insertions of the nonmucoid but biofilm-positive mutants M16 and M20 are located in genes homologous to components of the phosphoenolpyruvate-sugar phosphotransferase system (PTS) of B. subtilis, S. aureus, and Staphylococcus carnosus, indicating an influence of the PTS on the mucoid phenotype in S. epidermidis. PMID:14532029
Kim, W; Whitman, W B
1999-01-01
To learn more about autotrophic growth of methanococci, we isolated nine conditional mutants of Methanococcus maripaludis after transformation of the wild type with a random library in pMEB.2, a suicide plasmid bearing the puromycin-resistance cassette pac. These mutants grew poorly in mineral medium and required acetate or complex organic supplements such as yeast extract for normal growth. One mutant, JJ104, was a leaky acetate auxotroph. A plasmid, pWDK104, was recovered from this mutant by electroporation of a plasmid preparation into Escherichia coli. Transformation of wild-type M. maripaludis with pWDK104 produced JJ104-1, a mutant with the same phenotype as JJ104, thus establishing that insertion of pWDK104 into the genome was responsible for the phenotype. pWDK104 contained portions of the methanococcal genes encoding an ABC transporter closely related to MJ1367-MJ1368 of M. jannaschii. Because high levels of molybdate, tungstate, and selenite restored growth to wild-type levels, this transporter may be specific for these oxyanions. A second acetate auxotroph, JJ117, had an absolute growth requirement for either acetate or cobalamin, and wild-type growth was observed only in the presence of both. Cobinamide, 5', 6'-dimethylbenzimidazole, and 2-aminopropanol did not replace cobalamin. This phenotype was correlated with tandem insertions in the genome but not single insertions and appeared to have resulted from an indirect effect on cobamide metabolism. Plasmids rescued from other mutants contained portions of ORFs denoted in M. jannaschii as endoglucanase (MJ0555), transketolase (MJ0681), thiamine biosynthetic protein thiI (MJ0931), and several hypothetical proteins (MJ1031, MJ0835, and MJ0835.1). PMID:10430573
[The Russian gene pool: gene geography of Alu-insertions (ACE, APOA1, B65, PV92 TPA25)].
Solov'eva, D S; Balanovskaia, E V; Kuznetsova, M A; Vasinskaia, O A; Frolova, S A; Pocheshkhova, E A; Evseeva, I V; Boldyreva, M N; Balanovskiĭ, O P
2010-01-01
The analysis of five Alu insertion loci (ACE, AP4OA1, B65, PV92, TPA25) has been carried out for the first time in 10 Russian populations (1088 individuals), covered all parts of historical area of the Russian ethnos. Depending on locus, Russian populations exhibit similarity with their western (European populations) or with the eastern (populations of the Ural region) neighbors. Considering frequencies of the studied Alu-insertions, Russian gene pool exhibits low variation: average difference between populations is d = 0.007, whereas on classical markers, mtDNA and Y chromosome heterogeneity of Russian gene pool is essentially higher (0.013, 0.033 and 0.142 respectively). Therefore, this set of five Alu insertions has lower variability on the intra-ethnic level. However in inter-ethnic comparisons the clear pattern was obtained: 13 Eastern European ethnic groups formed three clusters, according with their historical and geographical position--East Slavic, Caucasian and South Ural clusters. The obtained data confirms efficiency of using Alu insertions for studying genetic differentiation and history of a gene pool of the Eastern European populations.
Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi
2012-01-01
To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830
Friedrich, Mirco; Bergdolt, Christian; Haubruck, Patrick; Bruckner, Thomas; Kowalewski, Karl-Friedrich; Müller-Stich, Beat Peter; Tanner, Michael C; Nickel, Felix
2017-02-06
Chest tube insertion is a standard intervention for management of various injuries of the thorax. Quick and accurate execution facilitates efficient therapy without further complications. Here, we propose a new training concept comprised of e-learning elements as well as continuous rating using an objective structured assessment of technical skills (OSATS) tool. The study protocol is presented for a randomized trial to evaluate e-learning with app-based serious gaming for chest drain insertion. The proposed randomized trial will be carried out at the Department of Orthopedics and Traumatology at Heidelberg University in the context of regular curricular teaching for medical students (n = 90, 3rd to 6th year). The intervention group will use e-learning with the serious gaming app Touch Surgery (TM) for chest drain insertion, whereas the control group uses serious gaming for an unrelated procedure. Primary endpoint is operative performance of chest drain insertion in a porcine cadaveric model according to OSATS. The randomized trial will help determine the value of e-learning with the serious gaming app Touch Surgery (TM) for chest drain insertion by using the OSATS score. The study will improve surgical training for trauma situations. Trial Registration Number, DRKS00009994 . Registered on 27 May 2016.
Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio
2017-05-30
Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Naumer, Matthias; Ying, Ying; Michelfelder, Stefan; Reuter, Antje; Trepel, Martin; Müller, Oliver J; Kleinschmidt, Jürgen A
2012-05-01
Libraries based on the insertion of random peptide ligands into the capsid of adeno-associated virus type 2 (AAV2) have been widely used to improve the efficiency and selectivity of the AAV vector system. However, so far only libraries of 7-mer peptide ligands have been inserted at one well-characterized capsid position. Here, we expanded the combinatorial AAV2 display system to a panel of novel AAV libraries, displaying peptides of 5, 7, 12, 19, or 26 amino acids in length at capsid position 588 or displaying 7-mer peptides at position 453, the most prominently exposed region of the viral capsid. Library selections on two unrelated cell types-human coronary artery endothelial cells and rat cardiomyoblasts-revealed the isolation of cell type-characteristic peptides of different lengths mediating strongly improved target-cell transduction, except for the 26-mer peptide ligands. Characterization of vector selectivity by transduction of nontarget cells and comparative gene-transduction analysis using a panel of 44 human tumor cell lines revealed that insertion of different-length peptides allows targeting of distinct cellular receptors for cell entry with similar efficiency, but with different selectivity. The application of such novel AAV2 libraries broadens the spectrum of targetable receptors by capsid-modified AAV vectors and provides the opportunity to choose the best suited targeting ligand for a certain application from a number of different candidates.
Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G
2011-04-01
Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.
USDA-ARS?s Scientific Manuscript database
Newcastle disease virus (NDV), avian paramyxovirus type 1, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU), which potentially a...
Stable zymomonas mobilis xylose and arabinose fermenting strains
Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW
2008-04-08
The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.
Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.
2007-01-01
AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094
Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J
2007-10-01
AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .
Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar
2014-01-01
Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.
Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco
Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène
2007-01-01
The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058
McNaughton, Candace; Zhou, Chuan; Robert, Linda; Storrow, Alan; Kennedy, Robert
2009-08-01
We compare pain and anxiety associated with peripheral intravenous (IV) cannula insertion after pretreatment with no local anesthesia, 4% lidocaine cream, or subcutaneously injected, buffered 1% lidocaine. In a randomized, crossover design, 3 peripheral IVs were inserted in each of 70 medical students or nurses. In random order, insertion sites were pretreated with nothing, lidocaine cream, or injected, buffered lidocaine. After each IV insertion, subjects recorded pain, anxiety, and preference (as patient and provider) for each technique on a 10-point numeric rating scale. Higher scores indicated greater pain, anxiety, and preference. Median pain scores (interquartile range [IQR]) were 7 (4 to 8) without local anesthesia, 3 (2 to 5) with lidocaine cream, and 1 (1 to 2) with injected, buffered lidocaine. Median anxiety scores (IQR) were 4 (2 to 7) without local anesthesia, 2 (1 to 4) with lidocaine cream, and 2 (1 to 3) with injected, buffered lidocaine. There was no detectable difference in anxiety scores between lidocaine cream and injected, buffered lidocaine. Most IV placement attempts were successful, regardless of technique. Seventy percent of subjects indicated they would "always" request buffered lidocaine for peripheral IV insertion. In adult health care providers, pain and anxiety associated with peripheral IV insertion is significantly reduced by using topical lidocaine cream or injected, buffered lidocaine. Injected, buffered lidocaine reduces IV insertion pain more than lidocaine cream, without affecting success. Adults desire the use of local anesthetic techniques for IV insertion for themselves and for their patients.
Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco
2014-01-01
The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.
Meirik, Olav; Brache, Vivian; Orawan, Kiriwat; Habib, Ndema Abu; Schmidt, Johannes; Ortayli, Nuriye; Culwell, Kelly; Jackson, Emily; Ali, Moazzam
2013-01-01
Comparative data on etonogestrel and two-rod levonorgestrel contraceptive implants are lacking. A multicenter, open, parallel-group trial with random allocation of implants was performed. For every second implant user, an age-matched woman choosing an intrauterine device (IUD) (TCu380A) was admitted. Methods and data on implant/IUD insertion and 6-week follow-up are reported. A total of 2008 women were randomized to an implant, and 974 women were enrolled in the IUD group. Results from 997 etonogestrel implant users, 997 levonorgestrel implant users and 971 IUD users were analyzed. In the etonogestrel and levonorgestrel groups, respectively, mean insertion durations were 51 (SD 50.2) s and 88 (SD 60.8) s; complication rates at insertion were 0.8% and 0.2%; and at follow-up, 27.2% and 26.7% of women, respectively, had signs or symptoms at the insertion site. At follow-up within 6 weeks after insertion, all implants were in situ, while 2.1% of IUDs were expelled. Performance of etonogestrel and levonorgestrel implants at insertion and within the first 6 weeks is similar. Short-term (6 weeks) continuation rates appear higher for implants than TCu380A. Copyright © 2013 Elsevier Inc. All rights reserved.
Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra
2009-01-01
The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778
Ramp, Kristina; Skiba, Martin; Karger, Axel; Mettenleiter, Thomas C; Römer-Oberdörfer, Angela
2011-02-01
Members of the order Mononegavirales express their genes in a transcription gradient from 3' to 5'. To assess how this impacts on expression of a foreign transgene, the haemagglutinin (HA) of highly pathogenic avian influenza virus (HPAIV) A/chicken/Vietnam/P41/05 (subtype H5N1) was inserted between the phosphoprotein (P) and matrix protein (M), M and fusion protein (F), or F and haemagglutinin-neuraminidase protein (HN) genes of attenuated Newcastle disease virus (NDV) Clone 30. In addition, the gene encoding the neuraminidase of HPAIV A/duck/Vietnam/TG24-01/05 (subtype H5N1) was inserted into the NDV genome either alone or in combination with the HA gene. All recombinants replicated well in embryonated chicken eggs. The expression levels of HA-specific mRNA and protein were quantified by Northern blot analysis and mass spectrometry, with good correlation. HA expression levels differed only moderately and were highest in the recombinant carrying the HA insertion between the F and HN genes of NDV.
Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer
Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio
2013-01-01
Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173
Cornelis, P; Anjaiah, V; Koedam, N; Delfosse, P; Jacques, P; Thonart, P; Neirinckx, L
1992-07-01
Tn5 mutagenesis of different fluorescent pseudomonads was achieved by conjugational transfer of the suicide vector pSUP 10141. Pyoverdine negative (Pvd-) mutants were detected by the absence of fluorescence on King's B medium and by their inability to grow in the presence of the iron chelator EDDHA [ethylenediamine di(o-hydroxyphenylacetic acid)]. In P. fluorescens ATCC 17400 and three rhizosphere isolates (one P. putida and two P. fluorescens), the percentage of Pvd- mutants ranged between 0 and 0.54%. In a P. chlororaphis rhizosphere isolate, this percentage was higher (4%). In these mutants both of the Tn5 antibiotic resistances (Km and Tc) were stable and the transposon could be detected by hybridization. In Pvd- mutants of P. fluorescens ATCC 17400, the transposon was found to be inserted twice in the chromosome while single insertions were detected in the DNA of other, randomly tested mutants. In P. aeruginosa PAO1, where 13.1% of the mutants were Pvd-, both antibiotic resistances were rapidly lost and accordingly no transposon insertion could be detected by hybridization. However, the Pvd- phenotype was generally stable in these mutants. The plasmid pNK862 containing a mini-Tn10 transposon was introduced by electroporation into P. aeruginosa PAO1 and Kmr mutants were recovered, 89% of which were Pvd- and confirmed to be P. aeruginosa by PCR amplification of the P. aeruginosa lipoprotein gene. The mini-Tn10 insertions were also found to be unstable in PAO1.
Lester, Felicia; Kakaire, Othman; Byamugisha, Josaphat; Averbach, Sarah; Fortin, Jennifer; Maurer, Rie; Goldberg, Alisa
2015-03-01
To compare rates of Copper T380A intrauterine device (IUD) utilization and satisfaction with immediate versus delayed IUD insertion after cesarean delivery in Kampala, Uganda. This study was a randomized clinical trial of women undergoing cesarean section who desired an IUD in Kampala, Uganda. Participants were randomly assigned to IUD insertion at the time of cesarean delivery or 6weeks afterward. The primary outcome was IUD utilization at 6months after delivery. Among 68 women who underwent randomization, an IUD was inserted in 100% (34/34) of the women in the immediate insertion group and in 53% (18/34) in the delayed group. IUD use at 6 months was higher in the immediate insertion group (93% vs. 50% after delayed insertion; p<.0001). Infection and expulsion were rare and did not differ between groups. When we pooled both groups and looked at IUD users compared to nonusers, 91% (39/43) of IUD users were satisfied or very satisfied with their contraceptive method compared to 44% (11/25) of nonusers (p<.0001). Women who chose not to be in the study or had the IUD removed often did so because of perceived husband or community disapproval. The 6-month utilization of an IUD after immediate insertion was significantly higher than after delayed insertion without increased complications. Contraceptive satisfaction was significantly higher among IUD users than nonusers. Community and husband attitudes influence IUD utilization and continuation in Kampala, Uganda. This work is important because it shows the safety and efficacy of providing IUDs during cesarean section in a setting where access to any healthcare, including contraception, can be extremely limited outside of childbearing and the consequences of an unintended, closely spaced pregnancy after a cesarean section can be life threatening. Copyright © 2015 Elsevier Inc. All rights reserved.
Zhu, Li-Ping; Yue, Xin-Jing; Han, Kui; Li, Zhi-Feng; Zheng, Lian-Shuai; Yi, Xiu-Nan; Wang, Hai-Long; Zhang, You-Ming; Li, Yue-Zhong
2015-07-22
Exotic genes, especially clustered multiple-genes for a complex pathway, are normally integrated into chromosome for heterologous expression. The influences of insertion sites on heterologous expression and allotropic expressions of exotic genes on host remain mostly unclear. We compared the integration and expression efficiencies of single and multiple exotic genes that were inserted into Myxococcus xanthus genome by transposition and attB-site-directed recombination. While the site-directed integration had a rather stable chloramphenicol acetyl transferase (CAT) activity, the transposition produced varied CAT enzyme activities. We attempted to integrate the 56-kb gene cluster for the biosynthesis of antitumor polyketides epothilones into M. xanthus genome by site-direction but failed, which was determined to be due to the insertion size limitation at the attB site. The transposition technique produced many recombinants with varied production capabilities of epothilones, which, however, were not paralleled to the transcriptional characteristics of the local sites where the genes were integrated. Comparative transcriptomics analysis demonstrated that the allopatric integrations caused selective changes of host transcriptomes, leading to varied expressions of epothilone genes in different mutants. With the increase of insertion fragment size, transposition is a more practicable integration method for the expression of exotic genes. Allopatric integrations selectively change host transcriptomes, which lead to varied expression efficiencies of exotic genes.
NASA Technical Reports Server (NTRS)
Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.
2003-01-01
BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.
Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile
2007-07-01
A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.
Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus
Youderian, Philip; Hartzell, Patricia L.
2006-01-01
Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386
Cowett, Allison A; Ali, Rose; Cooper, Mary A; Evans, Mark; Conzuelo, Gabriel; Cremer, Miriam
2018-05-01
To compare the 6-month use rate of the etonogestrel implant placed immediately after dilation and evacuation (D&E) with placement 2-4 weeks postprocedure. This is a randomized controlled trial of women seeking abortion between 14 0/7 and 23 5/7 weeks of gestation and desiring the etonogestrel contraceptive implant at an urban family planning clinic. Participants were randomized to device insertion immediately after the D&E compared with delayed insertion in 2-4 weeks. The primary outcome was implant use rate at 6 months after insertion and was determined by follow-up phone interviews. Secondary outcomes included repeat pregnancy rates and method satisfaction. The sample size of 120 participants was calculated based on a power of 0.80 to demonstrate a 20% difference in implant use rates between groups assuming 40% of women overall are not using the device 6 months after the procedure. Between November 2015 and October 2016, 148 participants were enrolled. Seventy-three participants (49.3%) were randomized to and underwent immediate implant insertion after D&E. The remaining 75 (50.6%) were randomized to delayed insertion. There were no significant differences in sociodemographic characteristics between the groups. Placement rate was 100% in the immediate group compared with 42.7% in the delayed group (P<.01). At 6 months, 40 of 43 (93%) women from the immediate group who completed follow-up continued use of the implant, whereas 19 of 30 (63.3%) women from the delayed group who completed follow-up were using the device (P=.002). Follow-up rates were low at 58.9% in the immediate group compared with 40.0% in the delayed group. Women were more likely to be using the etonogestrel implant at 6 months after D&E if they underwent immediate compared with delayed insertion. The very high loss to follow-up rate makes it difficult to draw conclusions about acceptability of the device and pregnancy rates. ClinicalTrials.gov, 02037919.
Transposable elements contribute to activation of maize genes in response to abiotic stress.
Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M
2015-01-01
Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.
Barone, Antonio; Alfonsi, Fortunato; Derchi, Giacomo; Tonelli, Paolo; Toti, Paolo; Marchionni, Saverio; Covani, Ugo
2016-06-01
The insertion torque value has been extensively used as an indicator for implant primary stability, which is considered a determining parameter for the implants success. The primary goal of the present randomized clinical trial was to evaluate and compare the clinical outcome for implants placed with high insertion torque (between 50 Ncm and 100 Ncm) and regular insertion torque (within 50 Ncm) in healed ridges. Partially edentulous patients, missing one or more mandibular or maxillary teeth, having an adequate amount of bone, requiring implant placement, were randomized to receive Blossom CT implants with regular insertion torque (<50 Ncm) or CT implants with high insertion torque (≥50 Ncm). Implants were left to heal submerged for 3 months. Implants were restored with individualized abutments and cemented metal-ceramic crowns. Acquired measurements were: insertion torque values (IT), thickness of buccal bone plate after implant osteotomy preparation (BBT), marginal bone level (MBL), and facial soft tissue level (FST). All patients were followed 12 months after implant placement. One hundred sixteen implants were placed in one hundred sixteen patients and enrolled for the study. Fifty-eight implants were randomly allocated in regular-IT and high-IT groups with a mean insertion torque ranging from 20 Ncm to 50 Ncm and from 50 Ncm to 100 Ncm, respectively. Three implants failed, and another five implants showed at the 12-month evaluation a marginal bone loss (ΔMBL) greater than 1.5 mm, being considered unsuccessful. The findings suggested that implants inserted with high-IT (≥50 Ncm) in healed bone ridges showed more peri-implant bone remodeling and buccal soft tissue recession than implants inserted with a regular-IT (<50 Ncm). Moreover, sites with a thick buccal bone wall (≥1 mm) - after implant osteotomy site preparation - seemed to be less prone to buccal soft tissue recession after 12 months than sites with a thin buccal bone wall (<1 mm). © 2015 Wiley Periodicals, Inc.
2014-01-01
Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134
A Genetic Interaction Screen for Breast Cancer Progression Driver Genes
2013-06-01
analysis of genetic alterations in human breast cancers has revealed that individual tumors accumulate mutations in approximately ninety different genes ...cancer. We performed a screen to test the roles of seventy breast cancer mutated genes in mouse mammary tumorigenesis using the MMTV-PyVT mouse breast...cancer model and piggyBac insertional mutation strains. We found that insertional mutations in 23 genes altered the onset of tumor formation and four
Tn5099, a xylE promoter probe transposon for Streptomyces spp.
Hahn, D R; Solenberg, P J; Baltz, R H
1991-01-01
Tn5099, a promoter probe transposon for Streptomyces spp., was constructed by inserting a promoterless xylE gene and a hygromycin resistance gene into IS493. Tn5099 transposed into different sites in the Streptomyces griseofuscus genome, and the xylE reporter gene was expressed in some of the transposition mutants. Strains containing Tn5099 insertions that gave regulated expression of the xylE gene were identified. Images PMID:1653213
Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A
1987-01-15
The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.
Site-Specific Fat-1 Knock-In Enables Significant Decrease of n-6PUFAs/n-3PUFAs Ratio in Pigs
Li, Mengjing; Ouyang, Hongsheng; Yuan, Hongming; Li, Jianing; Xie, Zicong; Wang, Kankan; Yu, Tingting; Liu, Minghao; Chen, Xue; Tang, Xiaochun; Jiao, Huping; Pang, Daxin
2018-01-01
The fat-1 gene from Caenorhabditis elegans encodes a fatty acid desaturase which was widely studied due to its beneficial function of converting n-6 polyunsaturated fatty acids (n-6PUFAs) to n-3 polyunsaturated fatty acids (n-3PUFAs). To date, many fat-1 transgenic animals have been generated to study disease pathogenesis or improve meat quality. However, all of them were generated using a random integration method with variable transgene expression levels and the introduction of selectable marker genes often raise biosafety concern. To this end, we aimed to generate marker-free fat-1 transgenic pigs in a site-specific manner. The Rosa26 locus, first found in mouse embryonic stem cells, has become one of the most common sites for inserting transgenes due to its safe and ubiquitous expression. In our study, the fat-1 gene was inserted into porcine Rosa 26 (pRosa26) locus via Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas9) system. The Southern blot analysis of our knock-in pigs indicated a single copy of the fat-1 gene at the pRosa26 locus. Furthermore, this single-copy fat-1 gene supported satisfactory expression in a variety of tissues in F1 generation pigs. Importantly, the gas chromatography analysis indicated that these fat-1 knock-in pigs exhibited a significant increase in the level of n-3PUFAs, leading to an obvious decrease in the n-6PUFAs/n-3PUFAs ratio from 9.36 to 2.12 (***P < 0.0001). Altogether, our fat-1 knock-in pigs hold great promise for improving the nutritional value of pork and serving as an animal model to investigate therapeutic effects of n-3PUFAs on various diseases. PMID:29563188
Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar
2006-12-01
An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong
2010-12-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol
2010-01-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104
[Isolation and function of genes regulating aphB expression in Vibrio cholerae].
Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao
2012-02-04
We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.
Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil
2017-10-27
Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Julie Anne Roden, Branids Belt, Jason Barzel Ross, Thomas Tachibana, Joe Vargas, Mary Beth Mudgett
2004-11-23
The bacterial pathogen Xanthomonas campestris pv. vesicatoria (Xcv) uses a type III secretion system (TTSS) to translocate effector proteins into host plant cells. The TTSS is required for Xcv colonization, yet the identity of many proteins translocated through this apparatus is not known. We used a genetic screen to functionally identify Xcv TTSS effectors. A transposon 5 (Tn5)-based transposon construct including the coding sequence for the Xcv AvrBs2 effector devoid of its TTSS signal was randomly inserted into the Xcv genome. Insertion of the avrBs2 reporter gene into Xcv genes coding for proteins containing a functional TTSS signal peptide resultedmore » in the creation of chimeric TTSS effector::AvrBs2 fusion proteins. Xcv strains containing these fusions translocated the AvrBs2 reporter in a TTSS-dependent manner into resistant BS2 pepper cells during infection, activating the avrBs2-dependent hypersensitive response (HR). We isolated seven chimeric fusion proteins and designated the identified TTSS effectors as Xanthomonas outer proteins (Xops). Translocation of each Xop was confirmed by using the calmodulin-dependent adenylate cydase reporter assay. Three xop genes are Xanthomonas spp.-specific, whereas homologs for the rest are found in other phytopathogenic bacteria. XopF1 and XopF2 define an effector gene family in Xcv. XopN contains a eukaryotic protein fold repeat and is required for full Xcv pathogenicity in pepper and tomato. The translocated effectors identified in this work expand our knowledge of the diversity of proteins that Xcv uses to manipulate its hosts.« less
Identification of Cellular Proteins Required for Replication of Human Immunodeficiency Virus Type 1
Dziuba, Natallia; Ferguson, Monique R.; O'Brien, William A.; Sanchez, Anthony; Prussia, Andrew J.; McDonald, Natalie J.; Friedrich, Brian M.; Li, Guangyu; Shaw, Michael W.; Sheng, Jinsong; Hodge, Thomas W.; Rubin, Donald H.
2012-01-01
Abstract Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation. PMID:22404213
Identification of cellular proteins required for replication of human immunodeficiency virus type 1.
Dziuba, Natallia; Ferguson, Monique R; O'Brien, William A; Sanchez, Anthony; Prussia, Andrew J; McDonald, Natalie J; Friedrich, Brian M; Li, Guangyu; Shaw, Michael W; Sheng, Jinsong; Hodge, Thomas W; Rubin, Donald H; Murray, James L
2012-10-01
Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation.
Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A
2018-03-01
Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.
Dunn, R. C.; Laurie, C. C.
1995-01-01
Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Koo, Kyo Chul; Yoon, Jun-Ho; Park, No-Cheol; Lee, Hye Sun; Ahn, Hyun Kyu; Lee, Kwang Suk; Kim, Do Kyung; Cho, Kang Su; Chung, Byung Ha; Hong, Chang Hee
2018-06-01
Excessive bulking force during primary access of the ureteral access sheath may induce ureteral injury. We investigated the efficacy of preoperative α-blockade to reduce ureteral access sheath insertion force and determine the upper limit required to avoid ureteral injury. In this randomized controlled trial 135 patients from a single institution who had ureteropelvic junction or renal pelvis stones and were scheduled to undergo retrograde intrarenal surgery were prospectively enrolled from December 2015 to January 2017. Of the patients 41 and 42 were randomly assigned to the control and experimental groups, respectively. The experimental group received α-blockade preoperatively. The 21 patients who were pre-stented were assessed separately. We developed a homemade device to measure maximal ureteral access sheath insertion force. Our ureteral access sheath insertion force measurement device showed excellent reproducibility. Higher insertion velocity resulted in greater maximal sheath insertion force. Maximal insertion force in the α-blockade group was significantly lower than in the control group at the ureterovesical junction (p = 0.008) and the proximal ureter (p = 0.036). Maximal insertion force in the α-blockade group was comparable to that in pre-stented patients. Female patients and patients 70 years old or older showed a lower maximal ureteral access sheath insertion force than their counterparts. The rate of grade 2 or greater ureteral injury was lower in the α-blockade group than in controls (p = 0.038). No injury occurred in any case in which ureteral access sheath insertion force did not exceed 600 G. Preoperative α-blockade and slow sheath placement may reduce maximal ureteral access sheath insertion force. If the force exceeds 600 G, a smaller diameter sheath may be an alternative. Alternatively the procedure can be terminated and followed later by pre-stented retrograde intrarenal surgery. Copyright © 2018 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Nieminen, Mikko; Tuuri, Timo; Savilahti, Harri
2010-10-01
Human embryonic stem cells are pluripotent cells derived from early human embryo and retain a potential to differentiate into all adult cell types. They provide vast opportunities in cell replacement therapies and are expected to become significant tools in drug discovery as well as in the studies of cellular and developmental functions of human genes. The progress in applying different types of DNA recombination reactions for genome modification in a variety of eukaryotic cell types has provided means to utilize recombination-based strategies also in human embryonic stem cells. Homologous recombination-based methods, particularly those utilizing extended homologous regions and those employing zinc finger nucleases to boost genomic integration, have shown their usefulness in efficient genome modification. Site-specific recombination systems are potent genome modifiers, and they can be used to integrate DNA into loci that contain an appropriate recombination signal sequence, either naturally occurring or suitably pre-engineered. Non-homologous recombination can be used to generate random integrations in genomes relatively effortlessly, albeit with a moderate efficiency and precision. DNA transposition-based strategies offer substantially more efficient random strategies and provide means to generate single-copy insertions, thus potentiating the generation of genome-wide insertion libraries applicable in genetic screens. 2010 Elsevier Inc. All rights reserved.
2018-01-01
Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260
The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster
Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.
1993-01-01
A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264
Sinha, Rahul; Goyal, Pankaj; Grapputo, Alessandro
2011-01-01
Background Insertions of spliceosomal introns are very rare events during evolution of vertebrates and the mechanisms governing creation of novel intron(s) remain obscure. Largely, gene structures of melanocortin (MC) receptors are characterized by intron-less architecture. However, recently a few exceptions have been reported in some fishes. This warrants a systematic survey of MC receptors for understanding intron insertion events during vertebrate evolution. Methodology/Principal Findings We have compiled an extended list of MC receptors from different vertebrate genomes with variations in fishes. Notably, the closely linked MC2Rs and MC5Rs from a group of ray-finned fishes have three and one intron insertion(s), respectively, with conserved positions and intron phase. In both genes, one novel insertion was in the highly conserved DRY motif at the end of helix TM3. Further, the proto-splice site MAG↑R is maintained at intron insertion sites in these two genes. However, the orthologs of these receptors from zebrafish and tetrapods are intron-less, suggesting these introns are simultaneously created in selected fishes. Surprisingly, these novel introns are traceable only in four fish genomes. We found that these fish genomes are severely compacted after the separation from zebrafish. Furthermore, we also report novel intron insertions in P2Y receptors and in CHRM3. Finally, we report ultrasmall introns in MC2R genes from selected fishes. Conclusions/Significance The current repository of MC receptors illustrates that fishes have no MC3R ortholog. MC2R, MC5R, P2Y receptors and CHRM3 have novel intron insertions only in ray-finned fishes that underwent genome compaction. These receptors share one intron at an identical position suggestive of being inserted contemporaneously. In addition to repetitive elements, genome compaction is now believed to be a new hallmark that promotes intron insertions, as it requires rapid DNA breakage and subsequent repair processes to gain back normal functionality. PMID:21850219
Bellone, Rebecca R.; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L.; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J.; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L. A.; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A.
2013-01-01
Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ2=1022.00, p<<0.0005), and CSNB, testing 43 horses (χ2=43, p<<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder. PMID:24167615
Bellone, Rebecca R; Holl, Heather; Setaluri, Vijayasaradhi; Devi, Sulochana; Maddodi, Nityanand; Archer, Sheila; Sandmeyer, Lynne; Ludwig, Arne; Foerster, Daniel; Pruvost, Melanie; Reissmann, Monika; Bortfeldt, Ralf; Adelson, David L; Lim, Sim Lin; Nelson, Janelle; Haase, Bianca; Engensteiner, Martina; Leeb, Tosso; Forsyth, George; Mienaltowski, Michael J; Mahadevan, Padmanabhan; Hofreiter, Michael; Paijmans, Johanna L A; Gonzalez-Fortes, Gloria; Grahn, Bruce; Brooks, Samantha A
2013-01-01
Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ(2)=1022.00, p<0.0005), and CSNB, testing 43 horses (χ(2)=43, p<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder.
Ning, Shaoli; Zhao, Lihua; Xu, Lingjun; Huang, Yu; Pang, Yong; Huang, Dingjian
2016-01-01
To compare the effects between slow twisting needle insertion and tubing needle insertion. With cross-over design, 100 healthy young subjects (half male and half female) aged from 19 to 23 years were randomly divided into two groups by random digital table, 50 cases in each one. At the first stage, subjects in the group A were treated with slow twisting needle insertion while, subjects in,the group B were treated with tubing needle insertion. One week later, the procedure of second stage was performed alternately. The needle was inserted into Neiguan (PC 6) with two methods by one acupuncturist. The needle was retained for 5 min before removal. Five min before needle insertion as well as needle withdrawal and 30 min after needle withdrawal, ZXG-E automatic cardiovascular diagnostic apparatus was used to test cardiovascular function. At the tim of needle withdrawal, slow twisting needle insertion could improve effect work of kinetics (EWK), effective blood volume (BV) and reduce elastic expansion coefficient of blood vessel (FEK) and left ventricular spray blood impedance (VER), which was significantly different from tubing needle insertion (all P < 0.05). Thirty min after needle withdrawal, the differences of the indices of cardiovascular function between the two groups were not significant (all P > 0.05). The slow twisting needle insertion is significantly superior to tubing needle insertion on lowering vascular tension and VER, improving EWK and BV.
Analysis of metal tolerance in Rhizobium leguminosarum strains isolated from an ultramafic soil.
Rubio-Sanz, Laura; Brito, Belén; Palacios, Jose
2018-02-01
Natural habitats containing high amounts of heavy metals provide a valuable source of bacteria adapted to deal with metal toxicity. A functional analysis of the population of legume endosymbiotic bacteria in an ultramafic soil was undertaken by studying a collection of Rhizobium leguminosarum bv viciae (Rlv) isolates obtained using pea as trap plant. One of the isolates, Rlv UPM1137, was selected on the basis of its higher tolerance to nickel and cobalt and presence of inducible mechanisms for such tolerance. A random transposon mutagenesis of Rlv UPM1137 allowed the generation of 14 transposant derivatives with increased nickel sensitivity; five of these transposants were also more sensitive to cobalt. Sequencing of the insertion sites revealed that one of the transposants (D2250) was affected in a gene homologous to the cation diffusion facilitator gene dmeF first identified in the metal-resistant bacterium Cupriavidus metallidurans CH34. The symbiotic performance of D2250 and two other transposants bearing single transposon insertions was unaffected under high-metal conditions, suggesting that, in contrast to previous observations in other Rlv strain, metal tolerance in UPM1137 under symbiotic conditions might be supported by functional redundancy between several mechanisms. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Isaza, Maria P; Duncan, Matthew S; Kaplan, Jeffrey B; Kachlany, Scott C
2008-08-01
Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans is a pathogen that causes localized aggressive periodontitis and extraoral infections including infective endocarditis. Recently, we reported that A. actinomycetemcomitans is beta-hemolytic on certain growth media due to the production of leukotoxin (LtxA). Based on this observation and our ability to generate random transposon insertions in A. actinomycetemcomitans, we developed and carried out a rapid screen for LtxA mutants. Using PCR, we mapped several of the mutations to genes that are known or predicted to be required for LtxA production, including ltxA, ltxB, ltxD, and tdeA. In addition, we identified an insertion in a gene previously not recognized to be involved in LtxA biosynthesis, ptsH. ptsH encodes the protein HPr, a phosphocarrier protein that is part of the sugar phosphotransferase system. HPr results in the phosphorylation of other proteins and ultimately in the activation of adenylate cyclase and cyclic AMP (cAMP) production. The ptsH mutant showed only partial hemolysis on blood agar and did not produce LtxA. The phenotype was complemented by supplying wild-type ptsH in trans, and real-time PCR analysis showed that the ptsH mutant produced approximately 10-fold less ltxA mRNA than the wild-type strain. The levels of cAMP in the ptsH mutant were significantly lower than in the wild-type strain, and LtxA production could be restored by adding exogenous cAMP to the culture.
The carnegie protein trap library: a versatile tool for Drosophila developmental studies.
Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C
2007-03-01
Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.
Mensch, Julián; Lavagnino, Nicolás; Carreira, Valeria Paula; Massaldi, Ana; Hasson, Esteban; Fanara, Juan José
2008-01-01
Background Understanding the genetic architecture of ecologically relevant adaptive traits requires the contribution of developmental and evolutionary biology. The time to reach the age of reproduction is a complex life history trait commonly known as developmental time. In particular, in holometabolous insects that occupy ephemeral habitats, like fruit flies, the impact of developmental time on fitness is further exaggerated. The present work is one of the first systematic studies of the genetic basis of developmental time, in which we also evaluate the impact of environmental variation on the expression of the trait. Results We analyzed 179 co-isogenic single P[GT1]-element insertion lines of Drosophila melanogaster to identify novel genes affecting developmental time in flies reared at 25°C. Sixty percent of the lines showed a heterochronic phenotype, suggesting that a large number of genes affect this trait. Mutant lines for the genes Merlin and Karl showed the most extreme phenotypes exhibiting a developmental time reduction and increase, respectively, of over 2 days and 4 days relative to the control (a co-isogenic P-element insertion free line). In addition, a subset of 42 lines selected at random from the initial set of 179 lines was screened at 17°C. Interestingly, the gene-by-environment interaction accounted for 52% of total phenotypic variance. Plastic reaction norms were found for a large number of developmental time candidate genes. Conclusion We identified components of several integrated time-dependent pathways affecting egg-to-adult developmental time in Drosophila. At the same time, we also show that many heterochronic phenotypes may arise from changes in genes involved in several developmental mechanisms that do not explicitly control the timing of specific events. We also demonstrate that many developmental time genes have pleiotropic effects on several adult traits and that the action of most of them is sensitive to temperature during development. Taken together, our results stress the need to take into account the effect of environmental variation and the dynamics of gene interactions on the genetic architecture of this complex life-history trait. PMID:18687152
Genomic localization of the Z/EG transgene in the mouse genome.
Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel
2010-02-01
The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.
Matsunaga, James; Haake, David A.
2016-01-01
Pathogenic species of Leptospira are the causative agents of leptospirosis, a zoonotic disease that causes mortality and morbidity worldwide. The understanding of the virulence mechanisms of Leptospira spp is still at an early stage due to the limited number of genetic tools available for this microorganism. The development of random transposon mutagenesis in pathogenic strains a decade ago has contributed to the identification of several virulence factors. In this study, we used the transposon sequencing (Tn-Seq) technique, which combines transposon mutagenesis with massive parallel sequencing, to study the in vivo fitness of a pool of Leptospira interrogans mutants. We infected hamsters with a pool of 42 mutants (input pool), which included control mutants with insertions in four genes previously analyzed by virulence testing (loa22, ligB, flaA1, and lic20111) and 23 mutants with disrupted signal transduction genes. We quantified the mutants in different tissues (blood, kidney and liver) at 4 days post-challenge by high-throughput sequencing and compared the frequencies of mutants recovered from tissues to their frequencies in the input pool. Control mutants that were less fit in the Tn-Seq experiment were attenuated for virulence when tested separately in the hamster model of lethal leptospirosis. Control mutants with unaltered fitness were as virulent as the wild-type strain. We identified two mutants with the transposon inserted in the same putative adenylate/guanylate cyclase gene (lic12327) that had reduced in vivo fitness in blood, kidney and liver. Both lic12327 mutants were attenuated for virulence when tested individually in hamsters. Growth of the control mutants and lic12327 mutants in culture medium were similar to that of the wild-type strain. These results demonstrate the feasibility of screening large pools of L. interrogans transposon mutants for those with altered fitness, and potentially attenuated virulence, by transposon sequencing. PMID:27824878
Novel insertion in exon 5 of the TCOF1 gene in twin sisters with Treacher Collins syndrome.
Marszałek-Kruk, Bożena Anna; Wójcicki, Piotr; Smigiel, Robert; Trzeciak, Wiesław H
2012-08-01
Treacher Collins syndrome (TCS) is associated with an abnormal differentiation of the first and second pharyngeal arches during fetal development. This causes mostly craniofacial deformities, which require numerous corrective surgeries. TCS is an autosomal dominant disorder and it occurs in the general population at a frequency of 1 in 50,000 live births. The syndrome is caused by mutations in the TCOF1 gene, which encodes the serine/alanine-rich protein named Treacle. Over 120 mutations of the TCOF1 gene responsible for TCS have been described. About 70% of recognized mutations are deletions, which lead to a frame shift, formation of a termination codon, and shortening of the protein product of the gene. Herewith, a new heterozygotic insertion, c.484_668ins185bp, was described in two monozygotic twin sisters suffering from TCS. This mutation was absent in their father, brother, and uncle, indicating a de novo origin. The insertion causes a shift in the reading frame and premature termination of translation at 167 aa. The novel insertion is the longest ever found in the TCOF1 gene and the only one found among monozygotic twin sisters.
Sonoi, Norihiro; Maeda, Hiroshi; Murauchi, Toshimitsu; Yamamoto, Tadashi; Omori, Kazuhiro; Kokeguchi, Susumu; Naruishi, Koji; Takashiba, Shogo
2018-01-01
An insertion sequence, IS1598 (IsPg4) has been found in virulent strains of Porphyromonas gingivalis in a murine abscess model. The present study was performed to investigate the effects of genetic rearrangements by IS1598 on the phenotypic characteristics of the virulent strains. For this purpose, we searched for a common insertion site of IS1598 among the virulent strains. Through cloning and database search, a common insertion site was identified beside an nrdD-like gene in the virulent FDC 381, W83 and W50 strains. In this region, predicted promoters of the nrdD-like gene and IS1598 are located in tandem, and accumulation of nrdD-like gene mRNA was 5-fold higher in virulent strains (W83, W50, FDC 381) than avirulent strains (ATCC33277, SU63, SUNY1021, ESO59 without IS1598). The role of the nrdD-like gene in virulence of P. gingivalis was investigated by constructing a nrdD-deficient mutant. In the murine abscess model, the parental W83 strain produced necrotic abscesses, while the nrdD-deficient mutant had almost lost this ability. Insertion of IS1598 into the nrdD-like gene promoter region may be related to the phenotypic differences in virulence among P. gingivalis strains through upregulation of the expression of this gene.
Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes.
Wang, Bangmei; Li, Kunyu; Wang, Amy; Reiser, Michelle; Saunders, Thom; Lockey, Richard F; Wang, Jia-Wang
2015-10-01
The clustered regularly interspaced short palindromic repeat (CRISPR) gene editing technique, based on the non-homologous end-joining (NHEJ) repair pathway, has been used to generate gene knock-outs with variable sizes of small insertion/deletions with high efficiency. More precise genome editing, either the insertion or deletion of a desired fragment, can be done by combining the homology-directed-repair (HDR) pathway with CRISPR cleavage. However, HDR-mediated gene knock-in experiments are typically inefficient, and there have been no reports of successful gene knock-in with DNA fragments larger than 4 kb. Here, we describe the targeted insertion of large DNA fragments (7.4 and 5.8 kb) into the genomes of mouse embryonic stem (ES) cells and zygotes, respectively, using the CRISPR/HDR technique without NHEJ inhibitors. Our data show that CRISPR/HDR without NHEJ inhibitors can result in highly efficient gene knock-in, equivalent to CRISPR/HDR with NHEJ inhibitors. Although NHEJ is the dominant repair pathway associated with CRISPR-mediated double-strand breaks (DSBs), and biallelic gene knock-ins are common, NHEJ and biallelic gene knock-ins were not detected. Our results demonstrate that efficient targeted insertion of large DNA fragments without NHEJ inhibitors is possible, a result that should stimulate interest in understanding the mechanisms of high efficiency CRISPR targeting in general.
Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.
2017-01-01
M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507
Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons
2017-01-01
M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.
Yoshida, Asuka; Samal, Siba K.
2017-01-01
Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820
Yoshida, Asuka; Samal, Siba K
2017-01-01
Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.
A stochastic evolution model for residue Insertion-Deletion Independent from Substitution.
Lèbre, Sophie; Michel, Christian J
2010-12-01
We develop here a new class of stochastic models of gene evolution based on residue Insertion-Deletion Independent from Substitution (IDIS). Indeed, in contrast to all existing evolution models, insertions and deletions are modeled here by a concept in population dynamics. Therefore, they are not only independent from each other, but also independent from the substitution process. After a separate stochastic analysis of the substitution and the insertion-deletion processes, we obtain a matrix differential equation combining these two processes defining the IDIS model. By deriving a general solution, we give an analytical expression of the residue occurrence probability at evolution time t as a function of a substitution rate matrix, an insertion rate vector, a deletion rate and an initial residue probability vector. Various mathematical properties of the IDIS model in relation with time t are derived: time scale, time step, time inversion and sequence length. Particular expressions of the nucleotide occurrence probability at time t are given for classical substitution rate matrices in various biological contexts: equal insertion rate, insertion-deletion only and substitution only. All these expressions can be directly used for biological evolutionary applications. The IDIS model shows a strongly different stochastic behavior from the classical substitution only model when compared on a gene dataset. Indeed, by considering three processes of residue insertion, deletion and substitution independently from each other, it allows a more realistic representation of gene evolution and opens new directions and applications in this research field. Copyright © 2010 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Panicali, Dennis; Paoletti, Enzo
1982-08-01
We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.
Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A
2018-01-01
Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.
vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S
2018-06-01
In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.
Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.
Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J
2016-11-04
Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types, duplication ages and co-expression consequences.
Efficient gene editing in Corynebacterium glutamicum using the CRISPR/Cas9 system.
Peng, Feng; Wang, Xinyue; Sun, Yang; Dong, Guibin; Yang, Yankun; Liu, Xiuxia; Bai, Zhonghu
2017-11-14
Corynebacterium glutamicum (C. glutamicum) has traditionally been used as a microbial cell factory for the industrial production of many amino acids and other industrially important commodities. C. glutamicum has recently been established as a host for recombinant protein expression; however, some intrinsic disadvantages could be improved by genetic modification. Gene editing techniques, such as deletion, insertion, or replacement, are important tools for modifying chromosomes. In this research, we report a CRISPR/Cas9 system in C. glutamicum for rapid and efficient genome editing, including gene deletion and insertion. The system consists of two plasmids: one containing a target-specific guide RNA and a homologous sequence to a target gene, the other expressing Cas9 protein. With high efficiency (up to 100%), this system was used to disrupt the porB, mepA, clpX and Ncgl0911 genes, which affect the ability to express proteins. The porB- and mepA-deletion strains had enhanced expression of green fluorescent protein, compared with the wild-type stain. This system can also be used to engineer point mutations and gene insertions. In this study, we adapted the CRISPR/Cas9 system from S. pyogens to gene deletion, point mutations and insertion in C. glutamicum. Compared with published genome modification methods, methods based on the CRISPR/Cas9 system can rapidly and efficiently achieve genome editing. Our research provides a powerful tool for facilitating the study of gene function, metabolic pathways, and enhanced productivity in C. glutamicum.
A Novel Intergenic ETnII-β Insertion Mutation Causes Multiple Malformations in Polypodia Mice
Lehoczky, Jessica A.; Thomas, Peedikayil E.; Patrie, Kevin M.; Owens, Kailey M.; Villarreal, Lisa M.; Galbraith, Kenneth; Washburn, Joe; Johnson, Craig N.; Gavino, Bryant; Borowsky, Alexander D.; Millen, Kathleen J.; Wakenight, Paul; Law, William; Van Keuren, Margaret L.; Gavrilina, Galina; Hughes, Elizabeth D.; Saunders, Thomas L.; Brihn, Lesil; Nadeau, Joseph H.; Innis, Jeffrey W.
2013-01-01
Mouse early transposon insertions are responsible for ∼10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd), a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5′ LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development. PMID:24339789
An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.
Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S
2018-01-01
Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.
[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].
Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng
2014-05-01
To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.
Matsui, Toru; Nishino, Tomohiko
2016-12-01
Analytical conditions using chromo azurol S was validated for quantification of siderophore in aqueous samples, followed by the characterization of siderophore derived from newly isolated moderately halophilic bacteria. Conditions with good linearity between the absorbance and the siderophore concentration were obtained at a siderophore concentration less than 20 µM, in the wavelength range between 630 and 660 nm with developing time for at least 2 h. Of the halophilic bacteria isolated from Tunisian soil, Halomonas sp., namely strain 21a was selected as siderophore producing halophiles. The strain produced siderophore significantly in the absence of iron in minimal medium. Siderophore-deficient mutant, namely IIa10, of the strain 21a was obtained from gene disruptant library constructed using transposon complex by electroporation. Genomic sequence analysis of the mutant IIa10 revealed that the transposon-inserted gene was TonB-dependent receptor. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Contribution of transposable elements in the plant's genome.
Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad
2018-07-30
Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.
Tian, He; Chen, Hong-Yu; Gao, Bin; Yu, Shimeng; Liang, Jiale; Yang, Yi; Xie, Dan; Kang, Jinfeng; Ren, Tian-Ling; Zhang, Yuegang; Wong, H-S Philip
2013-02-13
In this paper, we employed Ramen spectroscopy to monitor oxygen movement at the electrode/oxide interface by inserting single-layer graphene (SLG). Raman area mapping and single-point measurements show noticeable changes in the D-band, G-band, and 2D-band signals of the SLG during consecutive electrical programming repeated for nine cycles. In addition, the inserted SLG enables the reduction of RESET current by 22 times and programming power consumption by 47 times. Collectively, our results show that monitoring the oxygen movement by Raman spectroscopy for a resistive random access memory (RRAM) is made possible by inserting a single-layer graphene at electrode/oxide interface. This may open up an important analysis tool for investigation of switching mechanism of RRAM.
The development of a cisgenic apple plant.
Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare
2011-07-20
Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.
... a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...
Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel
2006-11-01
The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.
Lo, Te-Wen; Pickle, Catherine S; Lin, Steven; Ralston, Edward J; Gurling, Mark; Schartner, Caitlin M; Bian, Qian; Doudna, Jennifer A; Meyer, Barbara J
2013-10-01
Exploitation of custom-designed nucleases to induce DNA double-strand breaks (DSBs) at genomic locations of choice has transformed our ability to edit genomes, regardless of their complexity. DSBs can trigger either error-prone repair pathways that induce random mutations at the break sites or precise homology-directed repair pathways that generate specific insertions or deletions guided by exogenously supplied DNA. Prior editing strategies using site-specific nucleases to modify the Caenorhabditis elegans genome achieved only the heritable disruption of endogenous loci through random mutagenesis by error-prone repair. Here we report highly effective strategies using TALE nucleases and RNA-guided CRISPR/Cas9 nucleases to induce error-prone repair and homology-directed repair to create heritable, precise insertion, deletion, or substitution of specific DNA sequences at targeted endogenous loci. Our robust strategies are effective across nematode species diverged by 300 million years, including necromenic nematodes (Pristionchus pacificus), male/female species (Caenorhabditis species 9), and hermaphroditic species (C. elegans). Thus, genome-editing tools now exist to transform nonmodel nematode species into genetically tractable model organisms. We demonstrate the utility of our broadly applicable genome-editing strategies by creating reagents generally useful to the nematode community and reagents specifically designed to explore the mechanism and evolution of X chromosome dosage compensation. By developing an efficient pipeline involving germline injection of nuclease mRNAs and single-stranded DNA templates, we engineered precise, heritable nucleotide changes both close to and far from DSBs to gain or lose genetic function, to tag proteins made from endogenous genes, and to excise entire loci through targeted FLP-FRT recombination.
Mueller, Cornelia Katharina; Thorwarth, Michael; Schultze-Mosgau, Stefan
2011-01-01
The structure of peri-implant soft tissue that is regenerated after flapless and flap surgery has been shown to differ. However, its underlying mechanisms are relatively unknown. The present study sought to identify differences in the inflammatory cell infiltration and expression of gene transcripts during transmucosal healing between the two approaches with two different implant designs. All mandibular premolars were removed from 12 minipigs. One month later, four implants (two NobelReplace Tapered Groovy and two NobelPerfect Groovy, Nobel Biocare) were placed in each quadrant. One quadrant was randomized to flapless insertion, while the other was chosen for flap surgery in each animal. Following 1, 2, 4, and 12 weeks of transmucosal implant healing, biopsy specimens were retrieved from the peri-implant soft tissue according to a standardized procedure to avoid crossover effects. Samples were subjected to a leukocyte count and a gene expression analysis. When the flapless placement technique was used, leukocyte influx in the peri-implant soft tissue was significantly smaller compared to open surgery for both implant designs. Gene expression analysis revealed significant overexpression of molecules associated with detoxification and reepithelialization in the flapless group. In contrast, myofibroblast-associated gene transcripts were significantly enriched in the flap surgery group. The present data indicate perpetuation of inflammatory reactions as well as increased fibrotic scar tissue deposition in the peri-implant area following implant placement by the flap approach. Flapless implant insertion results in less inflammation and early reepithelialization, providing the potential for the formation of a fully functioning as well as esthetically preferable peri-implant soft tissue collar.
McCracken, Allen; Locke, John
2014-01-01
Genes in multicellular organisms are expressed as part of a developmental program that is largely dependent on self-perpetuating higher-order chromatin states. The mechanism of establishing and maintaining these epigenetic events is well studied in Drosophila. The first known example of an epigenetic effect was that of (PEV) in Drosophila, which has been shown to be due to gene silencing via heterochromatin formation. We are investigating a process similar to Position Effect Variegation (PEV) using a mini-w transgene, called Pci, inserted in the upstream regulatory region of ci. The mini-white + transgene in Pci is expressed throughout the adult eye; however, when other P or KP elements are present, a variegated eye phenotype results indicating random w + silencing during development. This P element dependent silencing (PDS) can be modified by the haplo-suppressors/triplo-enhancers, Su(var)205 and Su(var)3–7, indicating that these heterochromatic modifiers also act dose dependently in PDS. Here we use a spontaneous derivative mutation of Pci called PciE1 (E1) that variegates like PDS in the absence of P elements, presumably due to an adjacent gypsy element insertion, to screen for second-site modifier mutations that enhance variable silencing of white + in E1. We isolated 7 mutations in CG8878, an essential gene, that enhance the E1 variegated phenotype. CG8878, a previously uncharacterized gene, potentially encodes a serine/threonine kinase whose closest Drosophila paralogue, ballchen (nhk-1), phosphorylates histones. These mutant alleles enhance both PDS at E1 and Position Effect Variegation (PEV) at wm4, indicating a previously unknown common silencing mechanism between the two. PMID:24614804
Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel
2008-10-01
Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.
The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.
Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix
2014-01-01
The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.
A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.
Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu
2015-05-01
Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Kalotra, V; Lall, M; Verma, I C; Kaur, A; Kaur, A
2018-03-01
HLA-G, a nonclassical class-Ib gene is mainly expressed on extravillous trophoblasts at the fetal-maternal interface. HLA-G molecule is considered to play an important role in maternal immune suppression during pregnancy. The 14 bp insertion/deletion polymorphism (rs66554220) in exon eight of the HLA-G gene influences HLA-G mRNA stability and isoform splicing patterns. In this study, 202 recurrent miscarriage (RM) women with two or more than two consecutive miscarriages, their 202 partners and 204 fertile control women with at least one live birth and no miscarriages were analyzed for 14 bp insertion/deletion polymorphism. Soluble HLA-G (sHLA-G) levels were also determined and compared between randomly selected 111 RM women and 111 control women using QAYEE-Bio ELISA kits. Student's t test and χ 2 test were used to depict the statistical differences. The results showed no significant differences for 14 bp allele and genotype frequencies between the study groups. However, our study showed a significant difference (P = .0107) for sHLA-G levels in RM women and control women. Furthermore, a significant difference (P = .0135) for sHLA-G levels in relation to +/-14 bp heterozygous genotype was seen between the two groups. The 14 bp allele sharing between the partners did not show any significant association with the number of miscarriages in RM couples. The association of 14 bp polymorphism and recurrent miscarriages was not significant in our study. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara
2018-06-01
Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.
Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed
2007-07-01
Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.
A High-Throughput Arabidopsis Reverse Genetics System
Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.
2002-01-01
A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722
Recombining overlapping BACs into a single larger BAC.
Kotzamanis, George; Huxley, Clare
2004-01-06
BAC clones containing entire mammalian genes including all the transcribed region and long range controlling elements are very useful for functional analysis. Sequenced BACs are available for most of the human and mouse genomes and in many cases these contain intact genes. However, large genes often span more than one BAC, and single BACs covering the entire region of interest are not available. Here we describe a system for linking two or more overlapping BACs into a single clone by homologous recombination. The method was used to link a 61-kb insert carrying the final 5 exons of the human CFTR gene onto a 160-kb BAC carrying the first 22 exons. Two rounds of homologous recombination were carried out in the EL350 strain of bacteria which can be induced for the Red genes. In the first round, the inserts of the two overlapping BACs were subcloned into modified BAC vectors using homologous recombination. In the second round, the BAC to be added was linearised with the very rare-cutting enzyme I-PpoI and electroporated into recombination efficient EL350 bacteria carrying the other BAC. Recombined BACs were identified by antibiotic selection and PCR screening and 10% of clones contained the correctly recombined 220-kb BAC. The system can be used to link the inserts from any overlapping BAC or PAC clones. The original orientation of the inserts is not important and desired regions of the inserts can be selected. The size limit for the fragments recombined may be larger than the 61 kb used here and multiple BACs in a contig could be combined by alternating use of the two pBACLink vectors. This system should be of use to many investigators wishing to carry out functional analysis on large mammalian genes which are not available in single BAC clones.
The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies
Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.
2007-01-01
Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782
A single gene mutation that increases maize seed weight
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giroux, M.J.; Shaw, J.; Hannah, L.C.
1996-06-11
The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less
Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F
2000-01-01
Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.
Evaluating Risks of Insertional Mutagenesis by DNA Transposons in Gene Therapy
Hackett, Perry B.; Largaespada, David A.; Switzer, Kirsten C.; Cooper, Laurence J.N.
2013-01-01
Investigational therapy can be successfully undertaken using viral- and non-viral-mediated ex vivo gene transfer. Indeed, recent clinical trials have established the potential for genetically modified T cells to improve and restore health. Recently the Sleeping Beauty (SB) transposon/transposase system has been applied in clinical trials to stably insert a chimeric antigen receptor (CAR) to redirect T-cell specificity. We discuss the context in which the SB system can be harnessed for gene therapy and describe the human application of SB-modified CAR+ T cells. We have focused on theoretical issues relating to insertional mutagenesis in the context of human genomes that are naturally subjected to remobilization of transposons and the experimental evidence over the last decade of employing SB transposons for defining genes that induce cancer. These findings are put into the context of the use of SB transposons in the treatment of human disease. PMID:23313630
Pelet, T; Curran, J; Kolakofsky, D
1991-01-01
The P gene of bovine parainfluenza virus 3 (bPIV3) contains two downstream overlapping ORFs, called V and D. By comparison with the mRNA editing sites of other paramyxoviruses, two editing sites were predicted for bPIV3; site a to express the D protein, and site b to express the V protein. Examination of the bPIV3 mRNAs, however, indicates that site b is non-functional whereas site a operates frequently. Insertions at site a give rise to both V and D protein mRNAs, because a very broad distribution of Gs is added when insertions occur. This broad distribution is very different from the editing sites of Sendai virus or SV5, where predominantly one form of edited mRNA containing either a one or two G insertion respectively is created, to access the single overlapping ORF of these viruses. A model is proposed to explain how paramyxoviruses control the range of G insertions on that fraction of the mRNAs where insertions occur. The bPIV3 P gene is unique as far as we know, in that a sizeable portion of the gene expresses all 3 reading frames as protein. bPIV3 apparently does this from a single editing site by removing the constraints which control the number of slippage rounds which take place. Images PMID:1846805
Mohammadi, Nabiallah; Adib, Minoo; Alsahebfosoul, Fereshteh; Kazemi, Mohammad; Etemadifar, Masoud
2016-01-15
Human Leukocyte Antigen G (HLA-G) gene polymorphism and expression rate have recently been suggested to have a potential role in susceptibility to Multiple Sclerosis (MS), a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system with unknown etiology. The aim of this study was to investigate the association of the frequency of HLA-G gene 14 bp insertion/deletion polymorphism and its plasma level with MS susceptibility. In this study, the HLA-G gene from 212 patients and 210 healthy individuals was amplified using real time PCR and screened for the 14 bp insertion/deletion polymorphism. In addition, HLA-G plasma levels of the patients were measured and compared to normal controls by ELISA method. Our results revealed that 14 bp insertion in HLA-G could result in lower plasma HLA-G level of the subjects, regardless of their health status and vice versa. Additionally, significant correlation of HLA-G genotype and its plasma level with MS susceptibility was observed. In conclusion, not only HLA-G 14 bp insertion/deletion polymorphism could be associated with expression rate of the HLA-G gene and its plasma level, but also could be considered as a risk factor for susceptibility to MS in our study population. Copyright © 2015 Elsevier B.V. All rights reserved.
Transposon tagging of genes for cell-cell interactions in Myxococcus xanthus.
Kalos, M; Zissler, J
1990-01-01
The prokaryote Myxococcus xanthus is a model for cell interactions important in multicellular behavior. We used the transposon TnphoA to specifically identify genes for cell-surface factors involved in cell interactions. From a library of 10,700 insertions of TnphoA, we isolated 36 that produced alkaline phosphatase activity. Three TnphoA insertions tagged cell motility genes, called cgl, which control the adventurous movement of cells. The products of the tagged cgl genes could function in trans upon other cells and were localized primarily in the cell envelope and extracellular space, consistent with TnphoA tagging genes for extracellular factors controlling motility. Images PMID:2172982
Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D
2018-04-30
The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.
Optical reprogramming with ultrashort femtosecond laser pulses
NASA Astrophysics Data System (ADS)
Uchugonova, Aisada; Breunig, Hans G.; Batista, Ana; König, Karsten
2015-03-01
The use of sub-15 femtosecond laser pulses in stem cell research is explored with particular emphasis on the optical reprogramming of somatic cells. The reprogramming of somatic cells into induced pluripotent stem (iPS) cells can be evoked through the ectopic expression of defined transcription factors. Conventional approaches utilize retro/lenti-viruses to deliver genes/transcription factors as well as to facilitate the integration of transcription factors into that of the host genome. However, the use of viruses may result in insertional mutations caused by the random integration of genes and as a result, this may limit the use within clinical applications due to the risk of the formation of cancer. In this study, a new approach is demonstrated in realizing non-viral reprogramming through the use of ultrashort laser pulses, to introduce transcription factors into the cell so as to generate iPS cells.
Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.
Wang, Limei; Beer, Steven V
2006-12-01
To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.
Flynn, Rowan; Grundmann, Alexander; Renz, Peter; Hänseler, Walther; James, William S.; Cowley, Sally A.; Moore, Michael D.
2015-01-01
Chronic granulomatous disease (CGD) is a rare genetic disease characterized by severe and persistent childhood infections. It is caused by the lack of an antipathogen oxidative burst, normally performed by phagocytic cells to contain and clear bacterial and fungal growth. Restoration of immune function can be achieved with heterologous bone marrow transplantation; however, autologous bone marrow transplantation would be a preferable option. Thus, a method is required to recapitulate the function of the diseased gene within the patient's own cells. Gene therapy approaches for CGD have employed randomly integrating viruses with concomitant issues of insertional mutagenesis, inaccurate gene dosage, and gene silencing. Here, we explore the potential of the recently described clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 site-specific nuclease system to encourage repair of the endogenous gene by enhancing the levels of homologous recombination. Using induced pluripotent stem cells derived from a CGD patient containing a single intronic mutation in the CYBB gene, we show that footprintless gene editing is a viable option to correct disease mutations. Gene correction results in restoration of oxidative burst function in iPS-derived phagocytes by reintroduction of a previously skipped exon in the cytochrome b-245 heavy chain (CYBB) protein. This study provides proof-of-principle for a gene therapy approach to CGD treatment using CRISPR-Cas9. PMID:26101162
Effects of Hematopoietic Lineage and Precursor Age on CML Disease Progression
2007-03-01
ABL gene was inserted is bi-cistronic and contains the gene encoding green fluorescence protein (GFP) in addition to BCR-ABL, we were able to assess...ribosome entry site (IRES) enhanced green fluorescent protein (EGFP) or 5’ LTR-driven IRES EGFP for 24-36 hours; We received the BCR-ABL construct...from our collaborator, Dr. Owen Witte. This gene was then inserted into a murine retrovirus. We then prepared stocks of retrovirus to be used for
Transposon integration enhances expression of stress response genes.
Feng, Gang; Leem, Young-Eun; Levin, Henry L
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.
Transposon integration enhances expression of stress response genes
Feng, Gang; Leem, Young-Eun; Levin, Henry L.
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295
Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1
Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming
2006-01-01
Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656
Isaza, Maria P.; Duncan, Matthew S.; Kaplan, Jeffrey B.; Kachlany, Scott C.
2008-01-01
Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans is a pathogen that causes localized aggressive periodontitis and extraoral infections including infective endocarditis. Recently, we reported that A. actinomycetemcomitans is beta-hemolytic on certain growth media due to the production of leukotoxin (LtxA). Based on this observation and our ability to generate random transposon insertions in A. actinomycetemcomitans, we developed and carried out a rapid screen for LtxA mutants. Using PCR, we mapped several of the mutations to genes that are known or predicted to be required for LtxA production, including ltxA, ltxB, ltxD, and tdeA. In addition, we identified an insertion in a gene previously not recognized to be involved in LtxA biosynthesis, ptsH. ptsH encodes the protein HPr, a phosphocarrier protein that is part of the sugar phosphotransferase system. HPr results in the phosphorylation of other proteins and ultimately in the activation of adenylate cyclase and cyclic AMP (cAMP) production. The ptsH mutant showed only partial hemolysis on blood agar and did not produce LtxA. The phenotype was complemented by supplying wild-type ptsH in trans, and real-time PCR analysis showed that the ptsH mutant produced approximately 10-fold less ltxA mRNA than the wild-type strain. The levels of cAMP in the ptsH mutant were significantly lower than in the wild-type strain, and LtxA production could be restored by adding exogenous cAMP to the culture. PMID:18541661
Stuart, Gretchen S; Lesko, Catherine R; Stuebe, Alison M; Bryant, Amy G; Levi, Erika E; Danvers, Antoinette I
2015-04-01
The objective of this randomized trial was to compare breastfeeding among women who received a levonorgestrel-releasing intrauterine system within 6-48 h (early) or 4-6 weeks (standard) after an uncomplicated vaginal birth. Analysis groups of 86 women in each arm were needed to demonstrate a 20% difference in any breastfeeding. Thirty-five women were randomized to the early (N=17) and standard (N=18) arms. The combination of unsuccessful placement (2/17; 12%), expulsions (7/17; 41%) and removals (3/17; 18%) reached 71% (12/17) in the early arm, so the study was stopped. In our small study cohort, levonorgestrel-releasing intrauterine system insertion between 6 and 48 h after vaginal birth was associated with a high rate of expulsion or removal soon after insertion. Copyright © 2015 Elsevier Inc. All rights reserved.
Spanos, Stephanie; Booth, Rebekah; Koenig, Heidi; Sikes, Kendra; Gracely, Edward; Kim, In K
2008-08-01
Peripheral intravenous (PIV) catheter insertion is a frequent, painful procedure that is often performed with little or no anesthesia. Current approaches that minimize pain for PIV catheter insertion have several limitations: significant delay for onset of anesthesia, inadequate anesthesia, infectious disease exposure risk from needlestick injuries, and patients' needle phobia. Comparison of the anesthetic effectiveness of J-Tip needle-free jet injection of 1% buffered lidocaine to the anesthetic effectiveness of topical 4% ELA-Max for PIV catheter insertion. A prospective, block-randomized, controlled trial comparing J-Tip jet injection of 1% buffered lidocaine to a 30-minute application of 4% ELA-Max for topical anesthesia in children 8 to 15 years old presenting to a tertiary care pediatric emergency department for PIV catheter insertion. All subjects recorded self-reported visual analog scale (VAS) scores for pain at time of enrollment and pain felt following PIV catheter insertion. Jet injection subjects also recorded pain of jet injection. Subjects were videotaped during jet injection and PIV catheter insertion. Videotapes were reviewed by a single blinded reviewer for observer-reported VAS pain scores for jet injection and PIV catheter insertion. Of the 70 children enrolled, 35 were randomized to the J-Tip jet injection group and 35 to the ELA-Max group. Patient-recorded enrollment VAS scores for pain were similar between groups (P = 0.74). Patient-recorded VAS scores were significantly different between groups immediately after PIV catheter insertion (17.3 for J-Tip jet injection vs 44.6 for ELA-Max, P < 0.001). Blinded reviewer assessed VAS scores for pain after PIV catheter insertion demonstrated a similar trend, but the comparison was not statistically significant (21.7 for J-Tip jet injection vs 31.9 ELA-Max, P = 0.23). J-Tip jet injection of 1% buffered lidocaine provided greater anesthesia than a 30-minute application of ELA-Max according to patient self-assessment of pain for children aged 8 to 15 years undergoing PIV catheter insertion.
Utilization of next generation sequencing for analyzing transgenic insertions in plum
USDA-ARS?s Scientific Manuscript database
When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...
Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster
Weber, Kenneth; Johnson, Nancy; Champlin, David; Patty, April
2005-01-01
A screen of random, autosomal, homozygous-viable P-element insertions in D. melanogaster found small effects on wing shape in 11 of 50 lines. The effects were due to single insertions and remained stable and significant for over 5 years, in repeated, high-resolution measurements. All 11 insertions were within or near protein-coding transcription units, none of which were previously known to affect wing shape. Many sites in the genome can affect wing shape. PMID:15545659
Many P-element insertions affect wing shape in Drosophila melanogaster.
Weber, Kenneth; Johnson, Nancy; Champlin, David; Patty, April
2005-03-01
A screen of random, autosomal, homozygous-viable P-element insertions in D. melanogaster found small effects on wing shape in 11 of 50 lines. The effects were due to single insertions and remained stable and significant for over 5 years, in repeated, high-resolution measurements. All 11 insertions were within or near protein-coding transcription units, none of which were previously known to affect wing shape. Many sites in the genome can affect wing shape.
Karabayirli, Safinaz; Ayrim, Aylin Aker; Muslu, Bunyamin
2012-01-01
To compare the analgesic efficacy of oral tramadol and naproxen sodium on pain during insertion of an intrauterine device (IUD). Randomized, double-blinded, clinical trial (Canadian Task Force classification I). University-affiliated hospital. Single-center. One hundred three patients scheduled for insertion of an IUD. Patients were randomly assigned to receive oral tramadol 50 mg capsules (n = 35) or naproxen sodium 550 mg tablets (n = 34) or placebo (n = 34) 1 hour before insertion of the IUD. After insertion of the IUD, pain intensity was evaluated using a visual analog scale (VAS, 0-10). Adverse effects, patient satisfaction with the medication, and preference for using it during future insertions were also recorded. The VAS scores were significantly different during IUD insertion among the 3 groups (p = .001). Pain scores in the tramadol group were significantly lower than in the naproxen group (p = .003), and the scores in the naproxen group was significantly lower than in the control group (p = .001). Patient satisfaction with the medication and preference for its future use were significantly lower in the control group than in the other 2 groups (p = .001). Prophylactic analgesia using 50 mg tramadol and 550 mg naproxen, delivered orally, can be used to relieve pain during IUD insertion. However, tramadol capsules were found to be more effective than naproxen tablets. Copyright © 2012 AAGL. Published by Elsevier Inc. All rights reserved.
A natural allele of Nxf1/TAP supresses retrovirus insertional mutations
Floyd, Jennifer A.; Gold, David A.; Concepcion, Dorothy; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth; Chen, Dan; Ward, Erica J.; Chinn, Steven B.; Friedman, Rick A.; Yu, Hon-Tsen; Moriwaki, Kazuo; Shiroishi, Toshihiko; Hamilton, Bruce A.
2009-01-01
Endogenous retroviruses have shaped the evolution of mammalian genomes. Host genes that control the effects of retrovirus insertions are therefore of great interest. The Modifier-of-vibrator-1 locus controls level of correctly processed mRNA from genes mutated by endogenous retrovirus insertions into introns, including the pitpnvb tremor mutation and the Eya1BOR model of human branchiootorenal syndrome. Positional complementation cloning identifies Mvb1 as the nuclear export factor Nxf1, providing an unexpected link between mRNA export receptor and pre-mRNA processing. Population structure of the suppressing allele in wild M. m. castaneus suggests selective advantage. A congenic Mvb1CAST allele is a useful tool for modifying gene expression from existing mutations and could be used to manipulate engineered mutations containing retroviral elements. PMID:14517553
Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun
2017-09-01
Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.
An EAV-HP Insertion in 5′ Flanking Region of SLCO1B3 Causes Blue Eggshell in the Chicken
Yang, Xiaolin; Li, Guangqi; Zhang, Yuanyuan; Li, Junying; Wang, Xiaotong; Bai, Jirong; Xu, Guiyun; Deng, Xuemei; Yang, Ning; Wu, Changxin
2013-01-01
The genetic determination of eggshell coloration has not been determined in birds. Here we report that the blue eggshell is caused by an EAV-HP insertion that promotes the expression of SLCO1B3 gene in the uterus (shell gland) of the oviduct in chicken. In this study, the genetic map location of the blue eggshell gene was refined by linkage analysis in an F2 chicken population, and four candidate genes within the refined interval were subsequently tested for their expression levels in the shell gland of the uterus from blue-shelled and non-blue-shelled hens. SLCO1B3 gene was found to be the only one expressed in the uterus of blue-shelled hens but not in that of non-blue-shelled hens. Results from a pyrosequencing analysis showed that only the allele of SLCO1B3 from blue-shelled chickens was expressed in the uterus of heterozygous hens (O*LC/O*N). SLCO1B3 gene belongs to the organic anion transporting polypeptide (OATP) family; and the OATPs, functioning as membrane transporters, have been reported for the transportation of amphipathic organic compounds, including bile salt in mammals. We subsequently resequenced the whole genomic region of SLCO1B3 and discovered an EAV-HP insertion in the 5′ flanking region of SLCO1B3. The EAV-HP insertion was found closely associated with blue eggshell phenotype following complete Mendelian segregation. In situ hybridization also demonstrated that the blue eggshell is associated with ectopic expression of SLCO1B3 in shell glands of uterus. Our finding strongly suggests that the EAV-HP insertion is the causative mutation for the blue eggshell phenotype. The insertion was also found in another Chinese blue-shelled breed and an American blue-shelled breed. In addition, we found that the insertion site in the blue-shelled chickens from Araucana is different from that in Chinese breeds, which implied independent integration events in the blue-shelled chickens from the two continents, providing a parallel evolutionary example at the molecular level. PMID:23359636
Lee, Chin M.; Monson, Rita E.; Adams, Rachel M.; Salmond, George P. C.
2017-01-01
Gas vesicles (GVs) are proteinaceous, gas-filled organelles used by some bacteria to enable upward movement into favorable air/liquid interfaces in aquatic environments. Serratia sp. ATCC39006 (S39006) was the first enterobacterium discovered to produce GVs naturally. The regulation of GV assembly in this host is complex and part of a wider regulatory network affecting various phenotypes, including antibiotic biosynthesis. To identify new regulators of GVs, a comprehensive mutant library containing 71,000 insertion mutants was generated by random transposon mutagenesis and 311 putative GV-defective mutants identified. Three of these mutants were found to have a transposon inserted in a LacI family transcription regulator gene (rbsR) of the putative ribose operon. Each of these rbsR mutants was GV-defective; no GVs were visible by phase contrast microscopy (PCM) or transmission electron microscopy (TEM). GV deficiency was caused by the reduction of gvpA1 and gvrA transcription (the first genes of the two contiguous operons in the GV gene locus). Our results also showed that a mutation in rbsR was highly pleiotropic; the production of two secondary metabolites (carbapenem and prodigiosin antibiotics) was abolished. Interestingly, the intrinsic resistance to the carbapenem antibiotic was not affected by the rbsR mutation. In addition, the production of a siderophore, cellulase and plant virulence was reduced in the mutant, whereas it exhibited increased swimming and swarming motility. The RbsR protein was predicted to bind to regions upstream of at least 18 genes in S39006 including rbsD (the first gene of the ribose operon) and gvrA. Electrophoretic mobility shift assays (EMSA) confirmed that RbsR bound to DNA sequences upstream of rbsD, but not gvrA. The results of this study indicate that RbsR is a global regulator that affects the modulation of GV biogenesis, but also with complex pleiotropic physiological impacts in S39006. PMID:28955306
Jin, Ling; Perng, Guey-Chuen; Mott, Kevin R.; Osorio, Nelson; Naito, Julia; Brick, David J.; Carpenter, Dale; Jones, Clinton; Wechsler, Steven L.
2005-01-01
The latency-associated transcript (LAT) is essential for the wild-type herpes simplex virus type 1 (HSV-1) high-reactivation phenotype since LAT− mutants have a low-reactivation phenotype. We previously reported that LAT can decrease apoptosis and proposed that this activity is involved in LAT's ability to enhance the HSV-1 reactivation phenotype. The first 20% of the primary 8.3-kb LAT transcript is sufficient for enhancing the reactivation phenotype and for decreasing apoptosis, supporting this proposal. For this study, we constructed an HSV-1 LAT− mutant that expresses the baculovirus antiapoptosis gene product cpIAP under control of the LAT promoter and in place of the LAT region mentioned above. Mice were ocularly infected with this mutant, designated dLAT-cpIAP, and the reactivation phenotype was determined using the trigeminal ganglion explant model. dLAT-cpIAP had a reactivation phenotype similar to that of wild-type virus and significantly higher than that of (i) the LAT− mutant dLAT2903; (ii) dLAT1.5, a control virus containing the same LAT deletion as dLAT-cpIAP, but with no insertion of foreign DNA, thereby controlling for potential readthrough transcription past the cpIAP insert; and (iii) dLAT-EGFP, a control virus identical to dLAT-cpIAP except that it contained the enhanced green fluorescent protein open reading frame (ORF) in place of the cpIAP ORF, thereby controlling for expression of a random foreign gene instead of the cpIAP gene. These results show that an antiapoptosis gene with no sequence similarity to LAT can efficiently substitute for the LAT function involved in enhancing the in vitro-induced HSV-1 reactivation phenotype in the mouse. PMID:16160155
Site-Specific Fat-1 Knock-In Enables Significant Decrease of n-6PUFAs/n-3PUFAs Ratio in Pigs.
Li, Mengjing; Ouyang, Hongsheng; Yuan, Hongming; Li, Jianing; Xie, Zicong; Wang, Kankan; Yu, Tingting; Liu, Minghao; Chen, Xue; Tang, Xiaochun; Jiao, Huping; Pang, Daxin
2018-05-04
The fat-1 gene from Caenorhabditis elegans encodes a fatty acid desaturase which was widely studied due to its beneficial function of converting n-6 polyunsaturated fatty acids (n-6PUFAs) to n-3 polyunsaturated fatty acids (n-3PUFAs). To date, many fat-1 transgenic animals have been generated to study disease pathogenesis or improve meat quality. However, all of them were generated using a random integration method with variable transgene expression levels and the introduction of selectable marker genes often raise biosafety concern. To this end, we aimed to generate marker-free fat-1 transgenic pigs in a site-specific manner. The Rosa26 locus, first found in mouse embryonic stem cells, has become one of the most common sites for inserting transgenes due to its safe and ubiquitous expression. In our study, the fat-1 gene was inserted into porcine Rosa 26 (pRosa26) locus via Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas9) system. The Southern blot analysis of our knock-in pigs indicated a single copy of the fat-1 gene at the pRosa26 locus. Furthermore, this single-copy fat-1 gene supported satisfactory expression in a variety of tissues in F1 generation pigs. Importantly, the gas chromatography analysis indicated that these fat-1 knock-in pigs exhibited a significant increase in the level of n-3PUFAs, leading to an obvious decrease in the n-6PUFAs/n-3PUFAs ratio from 9.36 to 2.12 (*** P < 0.0001). Altogether, our fat-1 knock-in pigs hold great promise for improving the nutritional value of pork and serving as an animal model to investigate therapeutic effects of n-3PUFAs on various diseases. Copyright © 2018 Li et al.
A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers.
Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng
2015-12-01
The ornamental peach cultivar 'Hongbaihuatao (HBH)' can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene-regulator involved in anthocyanin transport (Riant)-which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Dictyostelium mobile elements: strategies to amplify in a compact genome.
Winckler, T; Dingermann, T; Glöckner, G
2002-12-01
Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.
Liu, Yangyang; Han, Xiao; Yuan, Junting; Geng, Tuoyu; Chen, Shihao; Hu, Xuming; Cui, Isabelle H; Cui, Hengmi
2017-04-07
The type II bacterial CRISPR/Cas9 system is a simple, convenient, and powerful tool for targeted gene editing. Here, we describe a CRISPR/Cas9-based approach for inserting a poly(A) transcriptional terminator into both alleles of a targeted gene to silence protein-coding and non-protein-coding genes, which often play key roles in gene regulation but are difficult to silence via insertion or deletion of short DNA fragments. The integration of 225 bp of bovine growth hormone poly(A) signals into either the first intron or the first exon or behind the promoter of target genes caused efficient termination of expression of PPP1R12C , NSUN2 (protein-coding genes), and MALAT1 (non-protein-coding gene). Both NeoR and PuroR were used as markers in the selection of clonal cell lines with biallelic integration of a poly(A) signal. Genotyping analysis indicated that the cell lines displayed the desired biallelic silencing after a brief selection period. These combined results indicate that this CRISPR/Cas9-based approach offers an easy, convenient, and efficient novel technique for gene silencing in cell lines, especially for those in which gene integration is difficult because of a low efficiency of homology-directed repair. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
A recombinant rabies virus carrying GFP between N and P affects viral transcription in vitro.
Luo, Jun; Zhao, Jing; Tian, Qin; Mo, Weiyu; Wang, Yifei; Chen, Hao; Guo, Xiaofeng
2016-06-01
Several studies have demonstrated the rabies virus to be a perfect potential vaccine vector to insert foreign genes into the target genome. For this study, a green fluorescent protein (GFP) gene was cloned into the rabies virus (RABV) genome between the N and P gene. CT dinucleotide was inserted as intergenic region. The recombinant high egg passage Flury strain (HEP-Flury) of RABV, carrying GFP (rHEP-NP-GFP), was generated in BHK-21 cells using reverse genetics. According to the viral growth kinetics assay, the addition of GFP between N and P gene has little effect on the viral growth compared to the parental strain HEP-Flury. Quantitative real-time PCR (qPCR) indicated that rHEP-NP-GFP showed different viral gene transcription, especially for G gene, compared to HEP-Flury. The same is true for one other recombinant RABV carrying GFP between G and L gene in NA cells. In addition, parent HEP-Flury showed more expression of innate immune-related molecules in NA cells. Compared to HEP-Flury, Western blotting (WB) indicated that insertion of a foreign gene following N gene enhanced the expression of M and G proteins. According to the qPCR and WB, GFP expression levels of rHEP-NP-GFP were significantly higher than rHEP-GFP. This study indicates HEP-Flury as valid vector to express exogenous genes between N and P.
Kassis, J. A.
1994-01-01
We have previously shown that a 2-kb fragment of engrailed DNA can suppress expression of a linked marker gene, white, in the P element vector CaSpeR. This suppression is dependent on the presence of two copies of engrailed DNA-containing P elements (P[en]) in proximity in the Drosophila genome (either in cis or in trans). In this study, the 2-kb fragment was dissected and found to contain three fragments of DNA which could mediate white suppression [called ``pairing-sensitive sites'' (PS)]. A PS site was also identified in regulatory DNA from the Drosophila escargot gene. The eye colors of six different P[en] insertions in the escargot gene suggest an interaction between P[en]-encoded and genome-encoded PS sites. I hypothesize that white gene expression from P[en] is repressed by the formation of a protein complex which is initiated at the engrailed PS sites and also requires interactions with flanking genomic DNA. Genes were sought which influence the function of PS sites. Mutations in some Polycomb and trithorax group genes were found to affect the eye color from some P[en] insertion sites. However, different mutations affected expression from different P[en] insertion sites and no one mutation was found to affect expression from all P[en] insertion sites examined. These results suggest that white expression from P[en] is not directly regulated by members of the Polycomb and trithorax group genes, but in some cases can be influenced by them. I propose that engrailed PS sites normally act to promote interactions between distantly located engrailed regulatory sites and the engrailed promoter. PMID:8005412
Dron, M; Hartmann, C; Rode, A; Sevignac, M
1985-01-01
We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.
A Look to Future Directions in Gene Therapy Research for Monogenic Diseases
Porteus, Matthew H; Connelly, Jon P; Pruett, Shondra M
2006-01-01
The concept of gene therapy has long appealed to biomedical researchers and clinicians because it promised to treat certain diseases at their origins. In the last several years, there have been several trials in which patients have benefited from gene therapy protocols. This progress, however, has revealed important problems, including the problem of insertional oncogenesis. In this review, which focuses on monogenic diseases, we discuss the problem of insertional oncogenesis and identify areas for future research, such as developing more quantitative assays for risk and efficacy, and ways of minimizing the genotoxic effects of gene therapy protocols, which will be important if gene therapy is to fulfill its conceptual promise. PMID:17009872
Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong; Schwarz, Stefan; Wang, Yang
2014-01-01
The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin.
Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong
2014-01-01
The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin. PMID:24366733
Ha, Sang Hee; Kim, Min-Soo; Suh, Jiwoo; Lee, Jong Seok
2018-05-01
The self-pressurized air-Q® (air-Q SP) intubating laryngeal airway is a relatively new supraglottic airway (SGA) device. The intracuff pressure of air-Q dynamically equilibrates with the airway pressure and adjusts to the patient's pharyngeal and periglottic anatomy, potentially providing improved airway fit and seal. The aim of this prospective randomized study was to compare the clinical performance of air-Q to the LMA® Classic™ SGA. Adult patients requiring general anesthesia for elective surgery were prospectively enrolled and randomly assigned to either air-Q SP or the LMA Classic SGA. Oropharyngeal leak pressure (primary endpoint), success rate, insertion features (insertion time, ease of insertion, requirement for device manipulation), sealing function, gastric insufflation, bronchoscopic view, and oropharyngeal complications at device insertion and following its removal (sore throat, dysphagia, dysphonia) were compared. The mean (standard deviation [SD]) oropharyngeal leak pressure just after insertion was similar in the air-Q SP and LMA [16.8 (4.9) vs 18.6 (5.5) cm H 2 O, respectively; mean difference, 1.8 cm H 2 O; 95% CI, -0.5 to 4.2; P = 0.13] and did not differ at ten minutes following device insertion. Median [interquartile range (IQR)] peak inspiratory pressure just after insertion was lower in the air-Q SP (11.0 [10.0-13.0] vs 13.0 [11.0-14.0] cmH 2 O, median difference, 1.0 cm H 2 O; 95% CI, 0.0 to 2.0; P = 0.03) but no difference was observed at ten minutes. The median [IQR] insertion time was faster with the air-Q SP (15.9 [13.6-20.3] sec vs 24 [21.2-27.1] sec; median difference, 8.1 sec; 95% CI, 5.6 to 9.9; P < 0.001) and improved bronchoscopic viewing grade were seen with the air-Q SP immediately after insertion (P < 0.001). No differences between the groups were observed with respect to the rate of successful insertion at first attempt, overall insertion success rate, ease of insertion, and complications. The air-Q SP had similar leak pressures but a faster insertion time and superior bronchoscopic viewing grade when compared with the LMA Classic. The air-Q SP is a suitable alternative to the LMA Classic in adult patients and may be a superior conduit for tracheal intubation. www.clinicaltrials.gov (NCT02206438). Registered 1 August 2014.
Boulnois, G J; Roberts, I S; Hodge, R; Hardy, K R; Jann, K B; Timmis, K N
1987-06-01
Transposon and deletion analysis of the cloned K1 capsule biosynthesis genes of Escherichia coli revealed that approximately 17 kb of DNA, split into three functional regions, is required for capsule production. One block (region 1) is required for translocation of polysaccharide to the cell surface and mutations in this region result in the intracellular appearance of polymer indistinguishable on immunoelectrophoresis to that found on the surface of K1 encapsulated bacteria. This material was released from the cell by osmotic shock indicating that the polysaccharide was probably present in the periplasmic space. Insertions in a second block (region 2) completely abolished polymer production and this second region is believed to encode the enzymes for the biosynthesis and polymerisation of the K1 antigen. Addition of exogenous N-acetylneuraminic acid to one insertion mutant in this region restored its ability to express surface polymer as judged by K1 phage sensitivity. This insertion probably defines genes involved in biosynthesis of N-acetylneuraminic acid. Insertions in a third block (region 3) result in the intracellular appearance of polysaccharide with a very low electrophoretic mobility. The presence of the cloned K1 capsule biosynthesis genes on a multicopy plasmid in an E. coli K-12 strain did not increase the yields of capsular polysaccharide produced compared to the K1+ isolate from which the genes were cloned.
Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.
2008-01-01
Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809
Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.
2012-01-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222
Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K
2012-08-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.
Rogers, John D; Sanders, Prashanthan; Piorkowski, Christopher; Sohail, M Rizwan; Anand, Rishi; Crossen, Karl; Khairallah, Farhat S; Kaplon, Rachelle E; Stromberg, Kurt; Kowal, Robert C
2017-02-01
Recent miniaturization of an insertable cardiac monitor (ICM) may make it possible to move device insertion from a hospital to office setting. However, the safety of this strategy is unknown. The primary objective was to compare the safety of inserting the Reveal LINQ ICM in an office vs a hospital environment. Ancillary objectives included summarizing device- and procedure-related adverse events and responses to a physician questionnaire. Five hundred twenty-one patients indicated for an ICM were randomized (1:1 ratio) to undergo ICM insertion in a hospital or office environment at 26 centers in the United States in the Reveal LINQ In-Office 2 study (ClinicalTrials.gov identifier NCT02395536). Patients were followed for 90 days. ICM insertion was successful in all 482 attempted patients (office: 251; hospital: 231). The untoward event rate (composite of unsuccessful insertion and ICM- or insertion-related complications) was 0.8% (2 of 244) in the office and 0.9% (2 of 227) in the hospital (95% confidence interval, -3.0% to 2.9%; 5% noninferiority: P < .001). In addition, adverse events occurred during 2.5% (6 of 244) of office and 4.4% (10 of 227) of hospital insertions (95% confidence interval [office minus inhospital rates], -5.8% to 1.9%; 5% noninferiority: P < .001). Physicians indicated that for procedures performed in an office vs a hospital, there were fewer delays >15 minutes (16% vs 35%; P < .001) and patient response was more often "very positive." Physicians considered the office location "very convenient" more frequently than the hospital location (85% vs 27%; P < .001). The safety profile for the insertion of the Reveal LINQ ICM is excellent irrespective of insertion environment. These results may expand site of service options for LINQ insertion. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Structure and expression of the attacin genes in Hyalophora cecropia.
Sun, S C; Lindström, I; Lee, J Y; Faye, I
1991-02-26
To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.
Dettenkofer, M; Wilson, C; Gratwohl, A; Schmoor, C; Bertz, H; Frei, R; Heim, D; Luft, D; Schulz, S; Widmer, A F
2010-06-01
To compare the efficacy of two commercially available, alcohol-based antiseptic solutions for preparation and care of central venous catheter (CVC) insertion sites, with and without octenidine dihydrochloride, a double-blind, randomized, controlled trial was undertaken in the haematology units and in one surgical unit of two university hospitals. Adult patients with a non-tunnelled CVC were randomly assigned to two different skin disinfection regimens at the insertion site: 0.1% octenidine with 30% 1-propanol and 45% 2-propanol, and as control 74% ethanol with 10% 2-propanol. Endpoints were (i) skin colonization at the insertion site; (ii) positive culture from the catheter tip (> or = 15 CFU); and (iii) occurrence of CVC-associated bloodstream infection (defined according to criteria set by the CDC). Four hundred patients with inserted CVC were enrolled from May 2002 through April 2005. Both groups were similar in respect of patient characteristics and co-morbidities. Skin colonization at the CVC insertion site during the first 10 days was significantly reduced by octenidine treatment (relative difference octenidine vs. control: 0.21; 95%CI: 0.11-0.39, p <0.0001). Positive culture of the catheter tip was significantly less frequent in the octenidine group (7.9%) than in the control group (17.8%): OR = 0.39 (95%CI: 0.20-0.80, p 0.009). Patients treated with octenidine had a non-significant reduction in catheter-associated bloodstream infections (4.1% vs. 8.3%; OR = 0.44; 95%CI: 0.18-1.08, p 0.081). Side effects were similar in both groups. This randomized controlled trial supports the results of two observational studies demonstrating octenidine in alcoholic solution to be a better option than alcohol alone for the prevention of CVC-associated infections.
Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P
2017-10-01
A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.
From the ORFeome concept to highly comprehensive, full-genome screening libraries.
Rid, Raphaela; Abdel-Hadi, Omar; Maier, Richard; Wagner, Martin; Hundsberger, Harald; Hintner, Helmut; Bauer, Johann; Onder, Kamil
2013-02-01
Recombination-based cloning techniques have in recent times facilitated the establishment of genome-scale single-gene ORFeome repositories. Their further handling and downstream application in systematic fashion is, however, practically impeded because of logistical plus economic challenges. At this juncture, simultaneously transferring entire gene collections in compiled pool format could represent an advanced compromise between systematic ORFeome (an organism's entire set of protein-encoding open reading frames) projects and traditional random library approaches, but has not yet been considered in great detail. In our endeavor to merge the comprehensiveness of ORFeomes with a basically simple, streamlined, and easily executable single-tube design, we have here produced five different pooled screening-ready libraries for both Staphylococcus aureus and Homo sapiens. By evaluating the parallel transfer efficiencies of differentially sized genes from initial polymerase chain reaction (PCR) product amplification to entry and final destination library construction via quantitative real-time PCR, we found that the complexity of the gene population is fairly stably maintained once an entry resource has been successfully established, and that no apparent size-selection bias loss of large inserts takes place. Recombinational transfer processes are hence robust enough for straightforwardly achieving such pooled screening libraries.
Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier
2016-05-01
Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.
Kovtunov, E A; Shelud'ko, A V; Chernyshova, M P; Petrova, L P; Katsy, E I
2013-11-01
Bacteria Azospirillum brasilense have mixed flagellation: in addition to the polar flagellum, numerous lateral flagella are formed in their cells on medium with increased density. Flagella determine the active swimming and swarming capacities of azospirilla. Using A. brasilense Sp245 as an example, we showed that the Omegon-Km artificial transposon insertion into the chromosomal gene for 3-hydroxyisobutyrate dehydrogenase (mmsB) was concurrent with the appearance of significant defects in the formation of polar flagella and with the paralysis of lateral flagella. The Sp245 mutant with the Omegon insertion into the plasmid AZOBR_p1-borne gene for 3-oxoacyl-[acyl-carrier protein]-reductase (fabG) showed the complete loss of flagella and the swarming capacity, as well as significant defects in polar flagellar assembly (though some cells are still motile in liquid medium). The viability of the A. brasilense Sp245 mutants with the Omegon insertion into the mmsB or fabG gene was not reduced. No considerable differences in the fatty acid composition of whole cell lipid extracts were found for the A. brasilense Sp245 strain and its mmsB and fabG mutants.
Construction and characterization of a recombinant invertebrate iridovirus.
Ozgen, Arzu; Muratoglu, Hacer; Demirbag, Zihni; Vlak, Just M; van Oers, Monique M; Nalcacioglu, Remziye
2014-08-30
Chilo iridescent virus (CIV), officially named Insect iridescent virus 6 (IIV6), is the type species of the genus Iridovirus (family Iridoviridae). In this paper we constructed a recombinant CIV, encoding the green fluorescent protein (GFP). This recombinant can be used to investigate viral replication dynamics. We showed that homologous recombination is a valid method to make CIV gene knockouts and to insert foreign genes. The CIV 157L gene, putatively encoding a non-functional inhibitor of apoptosis (IAP), was chosen as target for foreign gene insertion. The gfp open reading frame preceded by the viral mcp promoter was inserted into the 157L locus by homologous recombination in Anthonomus grandis BRL-AG-3A cells. Recombinant virus (rCIV-Δ157L-gfp) was purified by successive rounds of plaque purification. All plaques produced by the purified recombinant virus emitted green fluorescence due to the presence of GFP. One-step growth curves for recombinant and wild-type CIV were similar and the recombinant was fully infectious in vivo. Hence, CIV157L can be inactivated without altering the replication kinetics of the virus. Consequently, the CIV 157L locus can be used as a site for insertion of foreign DNA, e.g. to modify viral properties for insect biocontrol. Copyright © 2014 Elsevier B.V. All rights reserved.
Guilhabert, Magalie R; Kirkpatrick, Bruce C
2005-08-01
Xylella fastidosa, a gram-negative, xylem-limited bacterium, is the causal agent of several economically important plant diseases, including Pierce's disease (PD) and citrus variegated chlorosis (CVC). Until recently, the inability to transform or produce transposon mutants of X. fastidosa had been a major impediment to identifying X. fastidosa genes that mediate pathogen and plant interactions. A random transposon (Tn5) library of X. fastidosa was constructed and screened for mutants showing more severe symptoms and earlier grapevine death (hypervirulence) than did vines infected with the wild type. Seven hypervirulent mutants identified in this screen moved faster and reached higher populations than the wild type in grapevines. These results suggest that X. fastidosa attenuates its virulence in planta and that movement is important in X. fastidosa virulence. The mutated genes were sequenced and none had been described previously as antivirulence genes, although six of them showed similarity with genes of known functions in other organisms. One transposon insertion inactivated a hemagglutinin adhesin gene (PD2118), which we named HxfA. Another mutant in a second putative X. fastidosa hemagglutinin gene, PD1792 (HxfB), was constructed, and further characterization of these hxf mutants suggests that X. fastidosa hemagglutinins mediate contact between X. fastidosa cells, which results in colony formation and biofilm maturation within the xylem vessels.
Clode, Fiona E.; Kaufmann, Mary E.; Malnick, Henry; Pitt, Tyrone L.
2000-01-01
In the last 15 years, Burkholderia cepacia has emerged as a significant pathogen in cystic fibrosis (CF) patients, mainly due to the severity of infection observed in a subset of patients and the fear of transmission of the organism to noncolonized patients. Although patients who deteriorate rapidly cannot be predicted by microbiological characteristics, three genetic markers have been described for strains that spread between patients. These are the cblA gene, encoding giant cable pili; a hybrid of two insertion sequences, IS1356 and IS402; and a 1.4-kb open reading frame known as the B. cepacia epidemic strain marker (BCESM). The latter two are of unknown function. An epidemic strain lineage was previously identified among CF patients in the United Kingdom that apparently had spread from North America and that was characterized by a specific random amplified polymorphic DNA (RAPD) pattern. We searched for the described genetic markers using specific PCR assays with 117 patient isolates of B. cepacia from 40 United Kingdom hospitals. Isolates were grouped according to genomovar and epidemic strain lineage RAPD pattern with a 10-base primer, P272. A total of 41 isolates from patients in 12 hospitals were classified as the epidemic strain, and 40 of these were distributed in genomovars IIIa (11 isolates), IIIb (1 isolate), and IIIc (28 isolates). All isolates of the epidemic strain were positive for the cblA gene and BCESM, but two lacked the insertion sequence hybrid. None of the 76 sporadic isolates contained cblA or the insertion sequence hybrid, but 11 of them were positive for BCESM. Nonepidemic isolates were distributed among genomovars I or IV (9), II (49), IIIa (11), IIIb (3), and IIIc (4). There were three clusters of cross-infection (one involving two patients and two involving three patients) with isolates of genomovar II. We conclude that in the United Kingdom, a single clonal lineage has spread between and within some hospitals providing care for CF patients. The presence of the cblA gene is the most specific marker for the epidemic strain. We recommend that all isolates of B. cepacia from CF patients should be screened by PCR to influence segregation and infection control strategies. PMID:10790095
[Analysis of Alu-insertion polymorphism in three subethnic groups of Kalmyks].
Khusainova, R I; Balinova, N V; Kutuev, I A; Spitsina, N Kh; Akhmetova, V L; Valiev, R R; Spitsyn, V A; Khusnutdinova, E K
2009-03-01
Eight Alu insertions at the NBC27, TPA25, NBC148, NBC123, ACE, APOA1, NBC51, and PV92 locus were examined in three subethnic groups of Kalmyks (Torgouds, Derbets, and Buzava). In general, the pattern of allele frequencies in Kalmyks was consistent with that in Asian populations of the world, and was similar to the Alu insertion frequencies pattern in Turkic populations of the Volga--Ural region and Central Asia. Pairwise comparisons of three subpopulations of Kalmyks with respect to the frequency distributions of eight Alu insertions revealed the differences between the groups examined. The coefficient of gene differentiation, F(st), constituted 1.37%, pointing to the common origin of the groups of interest, as well as to the uniformity of the gene pools of subethnic groups of Kalmyks examined.
Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G
1995-01-01
A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070
Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu
2015-01-01
ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037
Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.
2006-01-01
Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754
A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers
Cheng, Jun; Liao, Liao; Zhou, Hui; Gu, Chao; Wang, Lu; Han, Yuepeng
2015-01-01
The ornamental peach cultivar ‘Hongbaihuatao (HBH)’ can simultaneously bear pink, red, and variegated flowers on a single tree. Anthocyanin content in pink flowers is extremely low, being only 10% that of a red flower. Surprisingly, the expression of anthocyanin structural and potential regulatory genes in white flowers was not significantly lower than that in both pink and red flowers. However, proteomic analysis revealed a GST encoded by a gene—regulator involved in anthocyanin transport (Riant)—which is expressed in the red flower, but almost undetectable in the variegated flower. The Riant gene contains an insertion-deletion (indel) polymorphism in exon 3. In white flowers, the Riant gene is interrupted by a 2-bp insertion in the last exon, which causes a frameshift and a premature stop codon. In contrast, both pink and red flowers that arise from bud sports are heterozygous for the Riant locus, with one functional allele due to the 2-bp deletion or a novel 1-bp insertion. Southern blot analysis indicated that the Riant gene occurs in a single copy in the peach genome and it is not interrupted by a transposon. The function of the Riant gene was confirmed by its ectopic expression in the Arabidopsis tt19 mutant, where it complements the anthocyanin phenotype, but not the proanthocyanidin pigmentation in seed coat. Collectively,these results indicate that a small indel mutation in the Riant gene, which is not the result of a transposon insertion or excision, causes variegated colouration of peach flowers. PMID:26357885
Otal, Isabel; Pérez-Herrán, Esther; Garcia-Morales, Lazaro; Menéndez, María C.; Gonzalez-y-Merchand, Jorge A.; Martín, Carlos; García, María J.
2017-01-01
In vitro transposition is a powerful genetic tool for identifying mycobacterial virulence genes and studying virulence factors in relation to the host. Transposon shuttle mutagenesis is a method for constructing stable insertions in the genome of different microorganisms including mycobacteria. Using an IS1096 derivative, we have constructed the Tngfp, a transposon containing a promoterless green fluorescent protein (gfp) gene. This transposon was able to transpose randomly in Mycobacterium bovis BCG. Bacteria with a single copy of the gfp gene per chromosome from an M. bovis BCG::Tngfp library were analyzed and cells exhibiting high levels of fluorescence were detected by flow cytometry. Application of this approach allowed for the selection of a mutant, BCG_2177c::Tngfp (BCG-Tn), on the basis of high level of long-standing fluorescence at stationary phase. This BCG-Tn mutant showed some particular phenotypic features compared to the wild type strain, mainly during stationary phase, when cholesterol was used as a sole carbon source, thus supporting the relationships of the targeted gene with the regulation of cholesterol metabolism in this bacteria. This approach showed that Tngfp is a potentially useful tool for studying the involvement of the targeted loci in metabolic pathways of mycobacteria. PMID:28321208
Joyce, Priya; Kuwahata, Melissa; Turner, Nicole; Lakshmanan, Prakash
2010-02-01
A reproducible method for transformation of sugarcane using various strains of Agrobacterium tumefaciens (A. tumefaciens) (AGL0, AGL1, EHA105 and LBA4404) has been developed. The selection system and co-cultivation medium were the most important factors determining the success of transformation and transgenic plant regeneration. Plant regeneration at a frequency of 0.8-4.8% occurred only when callus was transformed with A. tumefaciens carrying a newly constructed superbinary plasmid containing neomycin phosphotransferase (nptII) and beta-glucuronidase (gusA) genes, both driven by the maize ubiquitin (ubi-1) promoter. Regeneration was successful in plants carrying the nptII gene but not the hygromycin phosphotransferase (hph) gene. NptII gene selection was imposed at a concentration of 150 mg/l paromomycin sulphate and applied either immediately or 4 days after the co-cultivation period. Co-cultivation on Murashige and Skoog (MS)-based medium for a period of 4 days produced the highest number of transgenic plants. Over 200 independent transgenic lines were created using this protocol. Regenerated plants appeared phenotypically normal and contained both gusA and nptII genes. Southern blot analysis revealed 1-3 transgene insertion events that were randomly integrated in the majority of the plants produced.
Flynn, Rowan; Grundmann, Alexander; Renz, Peter; Hänseler, Walther; James, William S; Cowley, Sally A; Moore, Michael D
2015-10-01
Chronic granulomatous disease (CGD) is a rare genetic disease characterized by severe and persistent childhood infections. It is caused by the lack of an antipathogen oxidative burst, normally performed by phagocytic cells to contain and clear bacterial and fungal growth. Restoration of immune function can be achieved with heterologous bone marrow transplantation; however, autologous bone marrow transplantation would be a preferable option. Thus, a method is required to recapitulate the function of the diseased gene within the patient's own cells. Gene therapy approaches for CGD have employed randomly integrating viruses with concomitant issues of insertional mutagenesis, inaccurate gene dosage, and gene silencing. Here, we explore the potential of the recently described clustered regularly interspaced short palindromic repeat (CRISPR)-Cas9 site-specific nuclease system to encourage repair of the endogenous gene by enhancing the levels of homologous recombination. Using induced pluripotent stem cells derived from a CGD patient containing a single intronic mutation in the CYBB gene, we show that footprintless gene editing is a viable option to correct disease mutations. Gene correction results in restoration of oxidative burst function in iPS-derived phagocytes by reintroduction of a previously skipped exon in the cytochrome b-245 heavy chain (CYBB) protein. This study provides proof-of-principle for a gene therapy approach to CGD treatment using CRISPR-Cas9. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.
Stoltz, Petronella; Manworren, Renee C B
Needle procedures, like venipuncture and intravenous (IV) catheter insertion, are recognized as a common cause of pain and fear for children in hospitals and emergency departments. The purpose of this study was to compare children's self-reported pain and fear related to IV insertion with administration of either the topical local anesthetic EMLA® or 1% buffered lidocaine delivered with the J-Tip Needleless Injection System® (J-Tip®). In this prospective, randomized trial, 150 consecutive pediatric patients 8 to 18years of age undergoing IV insertion were randomly assigned 1:1 to treatment group. Participants self-reported procedural pain using a Visual Analog Scale, and procedural fear using the Children's Fear Scale. Procedural pain scores were significantly lower in the EMLA® group (mean score 1.63+1.659) vs. the J-Tip® group (2.99±2.586; p<0.001). Post-procedure fear scores were significantly lower than pre-procedure fear scores in both treatment groups (p<0.002), but there was no difference in fear scores between the two treatment groups (p=0.314). EMLA® provided superior pain relief for IV insertion compared to J-Tip®. Although EMLA® use resulted in lower self-reported pain scores compared to J-Tip®, pain scores for both treatments were low and fear scores did not differ. When IV insertion can be delayed for 60-90min, EMLA® should be used. When a delay is contraindicated, J-Tip® may be a reasonable alternative to minimize procedural pain of IV insertion. Copyright © 2017 Elsevier Inc. All rights reserved.
Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping
2016-01-01
Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775
Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F
2016-10-25
Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.
Zhang, Chun; Feng, Li; Tian, Xing-Shan
2018-04-26
The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Omel`yanchuk, L.V.
1995-12-01
A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.
Nilsson, Anders K; Andersson, Mats X
2017-01-01
A striking and unexpected biochemical phenotype was found in an insertion mutant line in the model plant Arabidopsis thaliana . One of two investigated insertion mutant lines in the gene encoding the phosphate transporter PHT4;1 demonstrated a prominent loss of trienoic fatty acids, whereas the other insertion line was indistinguishable from wild type in this aspect. We demonstrate that the loss of trienoic fatty acids was due to a remnant inactive negative selection marker gene in this particular transposon tagged line, pht4;1-3 . This constitutes a cautionary tale that warns of the importance to confirm the loss of this type of selection markers and the importance of verifying the relationship between a phenotype and genotype by more than one independent mutant line or alternatively genetic complementation.
Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E.; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto
2011-01-01
Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence determinants. PMID:21775541
DOE Office of Scientific and Technical Information (OSTI.GOV)
Golden, Susan S
2008-10-16
The aim of this project was to inactivate each locus of the genome of the cyanobacterium Synechococcus elongatus PCC 7942 and screen resulting mutants for altered circadian phenotypes. The immediate goal was to identify all open reading frames (ORFs) that contribute to circadian timing. An additional result was to create a complete archived set of mutagenesis templates, of great utility for the wider research community, that will allow inactivation of any given locus in the genome of S. elongatus. Clones that carry segments of the S. elongatus genome were saturated with transposon insertions in vitro. We completed saturation mutagenesis ofmore » the chromosome (~2800 ORFs). The positions of insertions were sequenced for 17,767 mutagenized clones. Each individual insertion into the S. elongatus DNA in a cosmid or plasmid is a substrate for mutagenesis of the genome via homologous recombination. Because the complete insertion mutation clone set is 5-7 fold redundant, we produced a streamlined set of clones that contains one insertion mutation per locus in the genome, a unigene set. All clones are archived as Escherichia coli stocks frozen in glycerol in 96-well plates at -85ºC and as replicas of these plates on Whatman CloneSaver cards. Each of the mutagenesis substrates from the unigene set has been recombined into the chromosome of wild-type S. elongatus and these cyanobacterial mutants have been archived at -85ºC as well. S. elongatus insertion mutants defective for than 1400 independent genes have screened in luciferase reporter gene backgrounds to evaluate the effect of each mutation on circadian rhythms of gene expression. For the first 700 genes tested, mutagenesis of 71 different ORFs resulted in circadian phenotypes. The mutagenesis project also created insertion mutations in the endogenous large plasmid of S. elongatus, pANL. The sequence of pANL revealed two potential addiction cassettes that appear to account for selection for plasmid persistence. Genetic experiments confirmed that these regions are present on all sub-sets of the plasmid that can replace wild-type pANL. Analysis of mutants defective in each of the remaining ~1400 genes for defects in circadian rhythms will be completed with support from another agency as part of a larger project on circadian rhythms in this cyanobacterium.« less
Clostridium perfringens type A–E toxin plasmids
Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.
2014-01-01
Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728
Prediction of antenna array performance from subarray measurements
NASA Technical Reports Server (NTRS)
Huisjen, M. A.
1978-01-01
Computer runs were used to determine the effect of mechanical distortions on array pattern performance. Subarray gain data, along with feed network insertion loss, and insertion phase data were combined with the analysis of Ruze on random errors to predict gain of a full array.
Ober, Julian; Walker, Tilman; Bergdolt, Christian; Friedrich, Mirco; Müller-Stich, Beat Peter; Forchheim, Franziska; Fischer, Christian; Schmidmaier, Gerhard; Tanner, Michael C
2018-01-01
Background The insertion of a chest tube should be as quick and accurate as possible to maximize the benefit and minimize possible complications for the patient. Therefore, comprehensive training and assessment before an emergency situation are essential for proficiency in chest tube insertion. Serious games have become more prevalent in surgical training because they enable students to study and train a procedure independently, and errors made have no effect on patients. However, up-to-date evidence regarding the effect of serious games on performance in procedures in emergency medicine remains scarce. Objective The aim of this study was to investigate the serious gaming approach in teaching medical students an emergency procedure (chest tube insertion) using the app Touch Surgery and a modified objective structural assessment of technical skills (OSATS). Methods In a prospective, rater-blinded, randomized controlled trial, medical students were randomized into two groups: intervention group or control group. Touch Surgery has been established as an innovative and cost-free app for mobile devices. The fully automatic software enables users to train medical procedures and afterwards self-assess their training effort. The module chest tube insertion teaches each key step in the insertion of a chest tube and enables users the meticulous application of a chest tube. In contrast, the module “Thoracocentesis” discusses a basic thoracocentesis. All students attended a lecture regarding chest tube insertion (regular curriculum) and afterwards received a Touch Surgery training lesson: intervention group used the module chest tube insertion and the control group used Thoracocentesis as control training. Participants’ performance in chest tube insertion on a porcine model was rated on-site via blinded face-to-face rating and via video recordings using a modified OSATS tool. Afterwards, every participant received an individual questionnaire for self-evaluation. Here, trainees gave information about their individual training level, as well as previous experiences, gender, and hobbies. Primary end point was operative performance during chest tube insertion by direct observance. Results A total of 183 students enrolled, 116 students participated (63.4%), and 21 were excluded because of previous experiences in chest tube insertion. Students were randomized to the intervention group (49/95, 52%) and control group (46/95, 48%). The intervention group performed significantly better than the control group (Intervention group: 38.0 [I50=7.0] points; control group: 30.5 [I50=8.0] points; P<.001). The intervention group showed significantly improved economy of time and motion (P=.004), needed significantly less help (P<.001), and was more confident in handling of instruments (P<.001) than the control group. Conclusions The results from this study show that serious games are a valid and effective tool in education of operative performance in chest tube insertion. We believe that serious games should be implemented in the surgical curriculum, as well as residency programs, in addition to traditional learning methods. Trial Registration German Clinical Trials Register (DRKS) DRKS00009994; https://www.drks.de/drks_web/navigate.do?navigationId=trial.HTML&TRIAL_ID=DRKS00009994 (Archived by Webcite at http://www.webcitation.org/6ytWF1CWg) PMID:29784634
A virus vector based on Canine Herpesvirus for vaccine applications in canids.
Strive, T; Hardy, C M; Wright, J; Reubel, G H
2007-01-31
Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.
Soon, Reni; Tschann, Mary; Salcedo, Jennifer; Stevens, Katelyn; Ahn, Hyeong Jun; Kaneshiro, Bliss
2017-08-01
To evaluate the efficacy of a paracervical block to decrease pain during osmotic dilator insertion before second-trimester abortion. In this double-blind, randomized trial, 41 women undergoing Laminaria insertion before a second-trimester abortion received either a paracervical block with 18 mL 1% lidocaine and 2 mL sodium bicarbonate or a sham block. Women were between 14 and 23 6/7 weeks of gestation. The primary outcome was pain immediately after insertion of Laminaria. Women assessed their pain on a 100-mm visual analog scale. Secondary outcomes included assessment of pain at other times during the insertion procedure and overall satisfaction with pain control. To detect a 25-mm difference in pain immediately after Laminaria insertion, at an α of 0.05 and 80% power, we aimed to enroll 20 patients in each arm. From May 2015 to December 2015, 20 women received a paracervical block and 21 received a sham block. Groups were similar in demographics, including parity, history of surgical abortion, and number of Laminaria placed. The paracervical block reduced pain after Laminaria insertion (median scores 13 mm [interquartile range 2-39] compared with 54 mm [interquartile range 27-61], P=.01, 95% CI -47.0 to -4.0). Women who received a paracervical block also reported higher satisfaction with overall pain control throughout the entire Laminaria insertion procedure (median scores 95 mm [interquartile range 78-100] compared with 70 mm [interquartile range 44-90], P=.05, 95% CI 0.0-37.0). Paracervical block is effective at reducing the pain of Laminaria insertion. Additionally, a paracervical block increases overall patient satisfaction with pain control during Laminaria placement. ClinicalTrials.gov, NCT02454296.
Reconstitutional Mutagenesis of the Maize P Gene by Short-Range Ac Transpositions
Moreno, M. A.; Chen, J.; Greenblatt, I.; Dellaporta, S. L.
1992-01-01
The tendency for Ac to transpose over short intervals has been utilized to develop insertional mutagenesis and fine structure genetic mapping strategies in maize. We recovered excisions of Ac from the P gene and insertions into nearby chromosomal sites. These closely linked Ac elements reinserted into the P gene, reconstituting over 250 unstable variegated alleles. Reconstituted alleles condition a variety of variegation patterns that reflect the position and orientation of Ac within the P gene. Molecular mapping and DNA sequence analyses have shown that reinsertion sites are dispersed throughout a 12.3-kb chromosomal region in the promoter, exons and introns of the P gene, but in some regions insertions sites were clustered in a nonrandom fashion. Transposition profiles and target site sequence data obtained from these studies have revealed several features of Ac transposition including its preference for certain target sites. These results clearly demonstrate the tendency of Ac to transpose to nearby sites in both proximal and distal directions from the donor site. With minor modifications, reconstitutional mutagenesis should be applicable to many Ac-induced mutations in maize and in other plant species and can possibly be extended to other eukaryotic transposon systems as well. PMID:1325389
Problems associated with gene transfer and opportunities for microgravity environments
NASA Astrophysics Data System (ADS)
Tennessen, Daniel J.
1997-01-01
The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.
Ranganathan, Dwarakanathan; John, George T; Yeoh, Edward; Williams, Nicola; O'Loughlin, Barry; Han, Thin; Jeyaseelan, Lakshmanan; Ramanathan, Kavitha; Healy, Helen
2017-01-01
The optimal time for the commencement of peritoneal dialysis (PD) after PD catheter insertion is unclear. If dialysis is started too soon after insertion, dialysate leaks and infection could occur. However, by starting PD earlier, morbidity and costs can be reduced through lesser hemodialysis requirements. This is the first randomized controlled trial to determine the safest and shortest interval to commence PD after catheter insertion. All consecutive patients undergoing PD catheter insertion at the Royal Brisbane and Women's Hospital and Rockhampton Hospital from 1 March 2008 to 31 May 2013 who met the inclusion and exclusion criteria were invited to participate in the trial. Participants were randomized to 1 of 3 groups. Group 1 (G1) commenced PD at 1 week, group 2 (G2) at 2 weeks and group 3 (G3) at 4 weeks after PD catheter insertion. These groups were stratified by hospital and the presence of diabetes. Primary outcomes were the incidence of peritoneal fluid leaks or PD-related infection during the 4 weeks after commencement of PD. In total 122 participants were recruited, 39, 42, and 41 randomized to G1, G2, and G3, respectively. The primary outcome catheter leak was significantly higher in G1 (28.2%) compared with G3 (2.4%, p = 0.001) but not compared with G2 (9.5%, p = 0.044), based on intention to treat analysis. These differences were even more marked when analyzed with per protocol method: G1 had a significantly higher percentage (32.4 %) compared with G3 (3.3%, p = 0.003) but not compared with G2 (10.5%, p = 0.040). Event percentages of leak were statistically higher in G1 and occurred significantly earlier compared with other groups ( p = 0.002). Amongst diabetics, technique failure was significantly higher (28.6%) in G3 compared with 0% in G1 and 7.1% in G2 ( p = 0.036) and earlier in G3 at 163.2 days vs 176.8 and 175.8 ( p = 0.037) for G1 and G2, respectively. Leaks were higher in participants commencing PD at 1 week after catheter insertion compared with the other 2 groups, and technique failure was higher in diabetics starting PD at 4 weeks. Copyright © 2017 International Society for Peritoneal Dialysis.
Leprinc, A S; Grandbastien, M A; Christian, M
2001-11-01
Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.
Chen, Mao-Kai; Hsu, Hung-Te; Lu, I-Cheng; Shih, Chih-Kai; Shen, Ya-Chun; Tseng, Kuang-Yi; Cheng, Kuang-I
2014-01-01
Many tools have been developed to facilitate the insertion of the ProSeal laryngeal mask airway (LMA) insertion, which can be impeded by folding of its soft cuff. The aim of this study was to compare the efficiency of ProSeal LMA insertion guided by a soft, direct optical Foley Airway Stylet Tool (FAST) with the standard introducer tool (IT). One hundred sixty patients undergoing general anesthesia using the ProSeal LMA as an airway management device were randomly allocated to either FAST-guided or IT-assisted groups. Following ProSeal LMA insertion, the glottic and esophageal openings were identified using a fiberoptic bronchoscope introduced through the airway and the drain tube. The primary outcomes were time taken to insert the ProSeal LMA and the success rate at the first attempt. Secondary end points included ease of insertion, hemodynamic response to insertion, and postoperative adverse events recorded in the recovery room and on the first postoperative morning. One hundred forty patients were included in the final analysis: 66 in the FAST-guided group and 74 in the IT-assisted group. The success rate of FAST device-guided ProSeal LMA insertion (95.7%) was broadly comparable with IT-assisted insertion (98.7%). However, the time taken to insert the ProSeal LMA was significantly longer when the FAST technique was used (p <0.001). The incidence of correct alignment of the airway tube and the drain tube did not differ significantly between the groups. There were no significant differences in ease of insertion or hemodynamic responses to insertion, except that the incidence of postoperative sore throat was significantly higher in the FAST group on the first postoperative day (22.2% compared with 6.8% in the IT group; p = 0.035). Both FAST-guided and IT-assisted techniques achieved correct ProSeal LMA positioning, but the IT technique was significantly quicker and less likely to cause a sore throat. ClinicalTrials.gov Identifier: NCT02048657.
Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin
2015-06-01
Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.
Evolutionary genomics: transdomain gene transfers.
Bordenstein, Seth R
2007-11-06
Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.
McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W
2018-04-01
Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.
McCarthy, Alex J.
2018-01-01
ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415
Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome
2013-01-01
Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in gene-rich regions, and it is assumed that they may contribute to the evolution of duplicated genes in the highly duplicated Brassica genome. The resulting MIPs can serve as a good source of DNA markers for Brassica crops because the insertions are highly dispersed in the gene-rich euchromatin region and are polymorphic between or within species. PMID:23547712
Proels, Reinhard K; Roitsch, Thomas
2006-03-01
Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.
2011-01-01
Background Twenty-nine Marek's disease virus (MDV) strains were isolated during a 3 year period (2007-2010) from vaccinated and infected chicken flocks in Poland. These strains had caused severe clinical symptoms and lesions. In spite of proper vaccination with mono- or bivalent vaccines against Marek's disease (MD), the chickens developed symptoms of MD with paralysis. Because of this we decided to investigate possible changes and mutations in the field strains that could potentially increase their virulence. We supposed that such mutations may have been caused by recombination with retroviruses of poultry - especially reticuloendotheliosis virus (REV). Methods In order to detect the possible reasons of recent changes in virulence of MDV strains, polymerase chain reaction (PCR) analyses for meq oncogene and for long-terminal repeat (LTR) region of REV were conducted. The obtained PCR products were sequenced and compared with other MDV and REV strains isolated worldwide and accessible in the GeneBank database. Results Sequencing of the meq oncogene showed a 68 basepair insertion and frame shift within 12 of 24 field strains. Interestingly, the analyses also showed 0.78, 0.8, 0.82, 1.6 kb and other random LTR-REV insertions into the MDV genome in 28 of 29 of strains. These genetic inserts were present after passage in chicken embryo kidney cells suggesting LTR integration into a non-functional region of the MDV genome. Conclusion The results indicate the presence of a recombination between MDV and REV under field conditions in Polish chicken farms. The genetic changes within the MDV genome may influence the virus replication and its features in vivo. However, there is no evidence that meq alteration and REV insertions are related to the strains' virulence. PMID:21320336
Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA
Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary
2013-01-01
Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322
DOE Office of Scientific and Technical Information (OSTI.GOV)
Otani, Sanae; Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka; Ayata, Minoru, E-mail: maverick@med.osaka-cu.ac.jp
Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader andmore » the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. - Highlights: • Wild-type MV can cause persistent infections in nude mice. • Biased hypermutation occurred in the M gene. • Biased hypermutation occurred in an inessential gene inserted between the leader and the N gene.« less
Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan
2008-01-01
Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541
Comparison of Insertional RNA Editing in Myxomycetes
Chen, Cai; Frankhouser, David; Bundschuh, Ralf
2012-01-01
RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871
Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian
2015-01-01
We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547
Schuyler, A C; Masvawure, T B; Smit, J A; Beksinska, M; Mabude, Z; Ngoloyi, C; Mantell, J E
2016-04-01
Partner negotiation and insertion difficulties are key barriers to female condom (FC) use in sub-Saharan Africa. Few FC interventions have provided comprehensive training in both negotiation and insertion skills, or focused on university students. In this study we explored whether training in FC insertion and partner negotiation influenced young women's FC use. 296 female students at a South African university were randomized to a one-session didactic information-only minimal intervention (n= 149) or a two-session cognitive-behavioral enhanced intervention (n= 147), which received additional information specific to partner negotiation and FC insertion. Both groups received FCs. We report the 'experiences of' 39 randomly selected female students who participated in post-intervention qualitative interviews. Two-thirds of women reported FC use. Most women (n= 30/39) applied information learned during the interventions to negotiate with partners. Women reported that FC insertion practice increased their confidence. Twelve women failed to convince male partners to use the FC, often due to its physical attributes or partners' lack of knowledge about insertion. FC educational and skills training can help facilitate use, improve attitudes toward the device and help women to successfully negotiate safer sex with partners. Innovative strategies and tailored interventions are needed to increase widespread FC adoption. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Toyama, H; Anthony, C; Lidstrom, M E
1998-09-01
Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.
Kuvaki, B; Küçükgüçlü, S; Iyilikçi, L; Tuncali, B E; Cinar, O
2008-10-01
We investigated whether insertion of the disposable Soft Seal laryngeal mask airway (SSLM) was successful without intra-oral digital manipulation. One hundred patients undergoing anaesthesia using the SSLM were randomly assigned into two groups. Insertion was performed by either a direct or a rotational technique, both without intra-oral digital manipulation. The primary outcome measure was successful insertion at first attempt. Other outcomes included insertion time, fibreoptic assessment of the airway view and airway morbidity. The first attempt success rate was higher (98%) with the direct technique than with the rotational technique (75%; p = 0.002) but insertion time was faster with the latter method (mean [range] 15 [8-50] s) than with the direct method (20 [8-56] s; p = 0.035). Fibreoptic assessment and airway morbidity were similar in both groups. We conclude that the SSLM can be successfully inserted without intra-oral digital manipulation.
Yoo, Joanne Y; Cai, Jenny; Chen, Antonia F; Austin, Matthew S; Sharkey, Peter F
2016-05-01
Some manufacturers have introduced polyethylene (PE) inserts in 1-mm increment thickness options to allow for finer adjustments in total knee arthroplasty kinematics. Two surgeons with extensive experience performed 88 total knee arthroplasties using implants with 1-mm PE inserts. After trial components were inserted and the optimal PE thickness was selected, the insert was removed and a trial insert size was randomly chosen from opaque envelopes (1-mm smaller, same size, and 1-mm larger). The knee was re-examined and the surgeon determined which size PE had been placed. Surgeons reliably determined insert thicknesses in 62.5% (55 of 88; P = .050) of trials. Surgeons were not able to accurately detect 1-mm incremental changes of trial PE implants on a consistent basis. The potential clinical usefulness of this concept should be further evaluated. Copyright © 2016 Elsevier Inc. All rights reserved.
Dubiley, Svetlana; Kirillov, Eugene; Ignatova, Anna; Stepanshina, Valentina; Shemyakin, Igor
2007-01-01
We analyzed IS6110-associated polymorphisms in the phospholipase C genes of 107 isolates of Mycobacterium tuberculosis selected to be representative of isolates circulating in central Russia. We found that the majority of Latin American-Mediterranean family strains contained an insertion in a unique position in the plcA gene, suggesting a common ancestor. This insertion can serve as a specific genetic marker for this group, which we designate the LAM-RUS family. PMID:17942651
Nuclease-free Adeno-Associated Virus-Mediated Il2rg Gene Editing in X-SCID Mice.
Hiramoto, Takafumi; Li, Li B; Funk, Sarah E; Hirata, Roli K; Russell, David W
2018-05-02
X-linked severe combined immunodeficiency (X-SCID) has been successfully treated by hematopoietic stem cell (HSC) transduction with retroviral vectors expressing the interleukin-2 receptor subunit gamma gene (IL2RG), but several patients developed malignancies due to vector integration near cellular oncogenes. This adverse side effect could in principle be avoided by accurate IL2RG gene editing with a vector that does not contain a functional promoter or IL2RG gene. Here, we show that adeno-associated virus (AAV) gene editing vectors can insert a partial Il2rg cDNA at the endogenous Il2rg locus in X-SCID murine bone marrow cells and that these ex vivo-edited cells repopulate transplant recipients and produce CD4 + and CD8 + T cells. Circulating, edited lymphocytes increased over time and appeared in secondary transplant recipients, demonstrating successful editing in long-term repopulating cells. Random vector integration events were nearly undetectable, and malignant transformation of the transplanted cells was not observed. Similar editing frequencies were observed in human hematopoietic cells. Our results demonstrate that therapeutically relevant HSC gene editing can be achieved by AAV vectors in the absence of site-specific nucleases and suggest that this may be a safe and effective therapy for hematopoietic diseases where in vivo selection can increase edited cell numbers. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Reiber, Gayle E; Smith, Douglas G; Wallace, Carolyn; Sullivan, Katrina; Hayes, Shane; Vath, Christy; Maciejewski, Matthew L; Yu, Onchee; Heagerty, Patrick J; LeMaster, Joseph
2002-05-15
Many people with diabetes experience lower-limb ulcers. Footwear has been implicated as a primary cause of foot ulcers, yet research is limited on the efficacy of shoe and insert combinations to prevent reulceration. To determine whether extra-depth and -width therapeutic shoes used with 2 types of inserts reduce reulceration in diabetic individuals with a history of foot ulcer. Randomized clinical trial of 400 diabetes patients with history of foot ulcer in 2 Washington State health care organizations who did not require custom shoes for foot deformity and were enrolled between August 1997 and December 1998 and followed up for 2 years. Data collected at regular intervals documented physical, foot, and diabetes characteristics; footwear use; foot lesions; and ulcers. Participants were randomly assigned to receive 3 pairs of therapeutic shoes and 3 pairs of customized medium-density cork inserts with a neoprene closed-cell cover (n = 121); to receive 3 pairs of therapeutic shoes and 3 pairs of prefabricated, tapered polyurethane inserts with a brushed nylon cover (n = 119); or to wear their usual footwear (controls; n = 160). Foot reulceration, compared among the 3 groups. Two-year cumulative reulceration incidence across the 3 groups was low: 15% in the cork-insert group, 14% in the prefabricated-insert group, and 17% in controls. In the intent-to-treat analysis, patients assigned to therapeutic shoes did not have a significantly lower risk of reulceration compared with controls (risk ratio [RR] for the cork-insert group, 0.88; 95% confidence interval [CI], 0.51-1.52 and RR the for prefabricated-insert group, 0.85; 95% CI, 0.48-1.48). All ulcer episodes in patients assigned to therapeutic shoes and 88% wearing nonstudy shoes occurred in patients with foot insensitivity. This study of persons without severe foot deformity does not provide evidence to support widespread dispensing of therapeutic shoes and inserts to diabetic patients with a history of foot ulcer. Study shoes and custom cork or preformed polyurethane inserts conferred no significant ulcer reduction compared with control footwear. This study suggests that careful attention to foot care by health care professionals may be more important than therapeutic footwear but does not negate the possibility that special footwear is beneficial in persons with diabetes who do not receive such close attention to foot care by their health care providers or in individuals with severe foot deformities.
Kobayashi, Takashi; Nishizawa, Koji; Ogura, Keiji
2003-01-01
To determine whether urethral injection of anesthetic and lubricating agent before outpatient flexible cystoscopic examination is worthwhile regarding patient tolerance of pain. A randomized prospective study was conducted. A total of 133 consecutive men scheduled to undergo flexible cystoscopy were randomized to receive 11 mL of 0.2% oxybuprocaine hydrochloride gel (group 1), 11 mL of plain lubricating gel (group 2), or no gel injection (group 3). In every group, 2% lidocaine gel was applied to the fiberscope. Patients recorded the level of pain during gel instillation, scope insertion, and intravesical observation separately on a 100-mm visual analog self-assessment scale. Pain scores for gel instillation were approximately two thirds those for scope insertion and intravesical observation in groups 1 and 2. No significant difference was noted in the pain score of each group during either scope insertion or intravesical observation. Pain during intraurethral gel instillation is significant. Anesthetic gel instillation has no advantage compared with no-gel injection in men when lubricating gel is applied to a flexible fiberscope.
A general insert label for peptide display on chimeric filamentous bacteriophages.
Kaplan, Gilad; Gershoni, Jonathan M
2012-01-01
The foreign insert intended to be displayed via recombinant phage proteins can have a negative effect on protein expression and phage assembly. A typical example is the case of display of peptides longer than 6 amino acid residues on the major coat protein, protein VIII of the filamentous bacteriophages M13 and fd. A solution to this problem has been the use of "two-gene systems" generating chimeric phages that concomitantly express wild-type protein VIII along with recombinant protein VIII. Although the two-gene systems are much more permissive in regard to insert length and composition, some cases can still adversely affect phage assembly. Although these phages genotypically contain the desired DNA of the insert, they appear to be phenotypically wild type. To avoid false-negative results when using chimeric phages in binding studies, it is necessary to confirm that the observed lack of phage recognition is not due to faulty assembly and display of the intended insert. Here we describe a strategy for generating antibodies that specifically recognize recombinant protein VIII regardless of the nature of its foreign insert. These antibodies can be used as a general monitor of the display of recombinant protein VIII into phage particles. Copyright © 2011 Elsevier Inc. All rights reserved.
Haubruck, Patrick; Nickel, Felix; Ober, Julian; Walker, Tilman; Bergdolt, Christian; Friedrich, Mirco; Müller-Stich, Beat Peter; Forchheim, Franziska; Fischer, Christian; Schmidmaier, Gerhard; Tanner, Michael C
2018-05-21
The insertion of a chest tube should be as quick and accurate as possible to maximize the benefit and minimize possible complications for the patient. Therefore, comprehensive training and assessment before an emergency situation are essential for proficiency in chest tube insertion. Serious games have become more prevalent in surgical training because they enable students to study and train a procedure independently, and errors made have no effect on patients. However, up-to-date evidence regarding the effect of serious games on performance in procedures in emergency medicine remains scarce. The aim of this study was to investigate the serious gaming approach in teaching medical students an emergency procedure (chest tube insertion) using the app Touch Surgery and a modified objective structural assessment of technical skills (OSATS). In a prospective, rater-blinded, randomized controlled trial, medical students were randomized into two groups: intervention group or control group. Touch Surgery has been established as an innovative and cost-free app for mobile devices. The fully automatic software enables users to train medical procedures and afterwards self-assess their training effort. The module chest tube insertion teaches each key step in the insertion of a chest tube and enables users the meticulous application of a chest tube. In contrast, the module "Thoracocentesis" discusses a basic thoracocentesis. All students attended a lecture regarding chest tube insertion (regular curriculum) and afterwards received a Touch Surgery training lesson: intervention group used the module chest tube insertion and the control group used Thoracocentesis as control training. Participants' performance in chest tube insertion on a porcine model was rated on-site via blinded face-to-face rating and via video recordings using a modified OSATS tool. Afterwards, every participant received an individual questionnaire for self-evaluation. Here, trainees gave information about their individual training level, as well as previous experiences, gender, and hobbies. Primary end point was operative performance during chest tube insertion by direct observance. A total of 183 students enrolled, 116 students participated (63.4%), and 21 were excluded because of previous experiences in chest tube insertion. Students were randomized to the intervention group (49/95, 52%) and control group (46/95, 48%). The intervention group performed significantly better than the control group (Intervention group: 38.0 [I 50 =7.0] points; control group: 30.5 [I 50 =8.0] points; P<.001). The intervention group showed significantly improved economy of time and motion (P=.004), needed significantly less help (P<.001), and was more confident in handling of instruments (P<.001) than the control group. The results from this study show that serious games are a valid and effective tool in education of operative performance in chest tube insertion. We believe that serious games should be implemented in the surgical curriculum, as well as residency programs, in addition to traditional learning methods. German Clinical Trials Register (DRKS) DRKS00009994; https://www.drks.de/drks_web/navigate.do?navigationId=trial.HTML&TRIAL_ID=DRKS00009994 (Archived by Webcite at http://www.webcitation.org/6ytWF1CWg). ©Patrick Haubruck, Felix Nickel, Julian Ober, Tilman Walker, Christian Bergdolt, Mirco Friedrich, Beat Peter Müller-Stich, Franziska Forchheim, Christian Fischer, Gerhard Schmidmaier, Michael C Tanner. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 21.05.2018.
Turok, David K; Leeman, Lawrence; Sanders, Jessica N; Thaxton, Lauren; Eggebroten, Jennifer L; Yonke, Nicole; Bullock, Holly; Singh, Rameet; Gawron, Lori M; Espey, Eve
2017-12-01
Immediate postpartum levonorgestrel intrauterine device insertion is increasing in frequency in the United States, but few studies have investigated the effect of early placement on breast-feeding outcomes. This study examined the effect of immediate vs delayed postpartum levonorgestrel intrauterine device insertion on breast-feeding outcomes. We conducted this noninferiority randomized controlled trial at the University of Utah and the University of New Mexico Health Sciences Centers from February 2014 through March 2016. Eligible women were pregnant and planned to breast-feed, spoke English or Spanish, were aged 18-40 years, and desired a levonorgestrel intrauterine device. Enrolled women were randomized 1:1 to immediate postpartum insertion or delayed insertion at 4-12 weeks' postpartum. Prespecified exclusion criteria included delivery <37.0 weeks' gestational age, chorioamnionitis, postpartum hemorrhage, contraindications to levonorgestrel intrauterine device insertion, and medical complications of pregnancy that could affect breast-feeding. We conducted per-protocol analysis as the primary approach, as it is considered the standard for noninferiority studies; we also report the alternative intent-to-treat analysis. We powered the study for the primary outcome, breast-feeding continuation at 8 weeks, to detect a 15% noninferiority margin between groups, requiring 132 participants in each arm. The secondary study outcome, time to lactogenesis, used a validated measure, and was analyzed by survival analysis and log rank test. We followed up participants for ongoing data collection for 6 months. Only the data analysis team was blinded to the intervention. We met the enrollment target with 319 participants, but lost 34 prior to randomization and excluded an additional 26 for medical complications prior to delivery. The final analytic sample included 132 in the immediate group and 127 in the delayed group. Report of any breast-feeding at 8 weeks in the immediate group (79%; 95% confidence interval, 70-86%) was noninferior to that of the delayed group (84%; 95% confidence interval, 76-91%). The 5% difference in breast-feeding continuation at 8 weeks between the groups fell within the noninferiority margin (95% confidence interval, -5.6 to 15%). Time to lactogenesis (mean ± SD) in the immediate group, 65.3 ± 25.7 hours, was noninferior to that of the delayed group, 63.6 ± 21.6 hours. The mean difference between groups was 1.7 hours (95% confidence interval, -4.8 to 8.2 hours), noninferior by log-rank test. A total of 24 intrauterine device expulsions occurred in the immediate group compared to 2 in the delayed group (19% vs 2%, P < .001), consistent with the known higher expulsion rate with immediate vs delayed postpartum intrauterine device insertion. No intrauterine device perforations occurred in either group. Our results of noninferior breast-feeding outcomes between women with immediate and delayed postpartum levonorgestrel intrauterine device insertion suggest that immediate postpartum intrauterine device insertion is an acceptable option for women planning to breast-feed and use the levonorgestrel intrauterine device. Expulsion rates are higher with immediate postpartum levonorgestrel intrauterine device insertion compared to delayed insertion, but this disadvantage may be outweighed by the advantages of immediate initiation of contraception. Providers should offer immediate postpartum intrauterine device insertion to breast-feeding women planning to use the levonorgestrel intrauterine device. Copyright © 2017 Elsevier Inc. All rights reserved.
Large exon size does not limit splicing in vivo.
Chen, I T; Chasin, L A
1994-03-01
Exon sizes in vertebrate genes are, with a few exceptions, limited to less than 300 bases. It has been proposed that this limitation may derive from the exon definition model of splice site recognition. In this model, a downstream donor site enhances splicing at the upstream acceptor site of the same exon. This enhancement may require contact between factors bound to each end of the exon; an exon size limitation would promote such contact. To test the idea that proximity was required for exon definition, we inserted random DNA fragments from Escherichia coli into a central exon in a three-exon dihydrofolate reductase minigene and tested whether the expanded exons were efficiently spliced. DNA from a plasmid library of expanded minigenes was used to transfect a CHO cell deletion mutant lacking the dhfr locus. PCR analysis of DNA isolated from the pooled stable cotransfectant populations displayed a range of DNA insert sizes from 50 to 1,500 nucleotides. A parallel analysis of the RNA from this population by reverse transcription followed by PCR showed a similar size distribution. Central exons as large as 1,400 bases could be spliced into mRNA. We also tested individual plasmid clones containing exon inserts of defined sizes. The largest exon included in mRNA was 1,200 bases in length, well above the 300-base limit implied by the survey of naturally occurring exons. We conclude that a limitation in exon size is not part of the exon definition mechanism.
Saeliw, Thanit; Tangsuwansri, Chayanin; Thongkorn, Surangrat; Chonchaiya, Weerasak; Suphapeetiporn, Kanya; Mutirangura, Apiwat; Tencomnao, Tewin; Hu, Valerie W; Sarachana, Tewarit
2018-01-01
Alu elements are a group of repetitive elements that can influence gene expression through CpG residues and transcription factor binding. Altered gene expression and methylation profiles have been reported in various tissues and cell lines from individuals with autism spectrum disorder (ASD). However, the role of Alu elements in ASD remains unclear. We thus investigated whether Alu elements are associated with altered gene expression profiles in ASD. We obtained five blood-based gene expression profiles from the Gene Expression Omnibus database and human Alu-inserted gene lists from the TranspoGene database. Differentially expressed genes (DEGs) in ASD were identified from each study and overlapped with the human Alu-inserted genes. The biological functions and networks of Alu-inserted DEGs were then predicted by Ingenuity Pathway Analysis (IPA). A combined bisulfite restriction analysis of lymphoblastoid cell lines (LCLs) derived from 36 ASD and 20 sex- and age-matched unaffected individuals was performed to assess the global DNA methylation levels within Alu elements, and the Alu expression levels were determined by quantitative RT-PCR. In ASD blood or blood-derived cells, 320 Alu-inserted genes were reproducibly differentially expressed. Biological function and pathway analysis showed that these genes were significantly associated with neurodevelopmental disorders and neurological functions involved in ASD etiology. Interestingly, estrogen receptor and androgen signaling pathways implicated in the sex bias of ASD, as well as IL-6 signaling and neuroinflammation signaling pathways, were also highlighted. Alu methylation was not significantly different between the ASD and sex- and age-matched control groups. However, significantly altered Alu methylation patterns were observed in ASD cases sub-grouped based on Autism Diagnostic Interview-Revised scores compared with matched controls. Quantitative RT-PCR analysis of Alu expression also showed significant differences between ASD subgroups. Interestingly, Alu expression was correlated with methylation status in one phenotypic ASD subgroup. Alu methylation and expression were altered in LCLs from ASD subgroups. Our findings highlight the association of Alu elements with gene dysregulation in ASD blood samples and warrant further investigation. Moreover, the classification of ASD individuals into subgroups based on phenotypes may be beneficial and could provide insights into the still unknown etiology and the underlying mechanisms of ASD.
Otani, Sanae; Ayata, Minoru; Takeuchi, Kaoru; Takeda, Makoto; Shintaku, Haruo; Ogura, Hisashi
2014-08-01
Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader and the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. Copyright © 2014 Elsevier Inc. All rights reserved.
Modular protein switches derived from antibody mimetic proteins.
Nicholes, N; Date, A; Beaujean, P; Hauk, P; Kanwar, M; Ostermeier, M
2016-02-01
Protein switches have potential applications as biosensors and selective protein therapeutics. Protein switches built by fusion of proteins with the prerequisite input and output functions are currently developed using an ad hoc process. A modular switch platform in which existing switches could be readily adapted to respond to any ligand would be advantageous. We investigated the feasibility of a modular protein switch platform based on fusions of the enzyme TEM-1 β-lactamase (BLA) with two different antibody mimetic proteins: designed ankyrin repeat proteins (DARPins) and monobodies. We created libraries of random insertions of the gene encoding BLA into genes encoding a DARPin or a monobody designed to bind maltose-binding protein (MBP). From these libraries, we used a genetic selection system for β-lactamase activity to identify genes that conferred MBP-dependent ampicillin resistance to Escherichia coli. Some of these selected genes encoded switch proteins whose enzymatic activity increased up to 14-fold in the presence of MBP. We next introduced mutations into the antibody mimetic domain of these switches that were known to cause binding to different ligands. To different degrees, introduction of the mutations resulted in switches with the desired specificity, illustrating the potential modularity of these platforms. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun
2014-01-01
The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. PMID:25332122
Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun; Ryu, Sangryeol
2015-01-01
The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Kapahnke, Marcel; Banning, Antje; Tikkanen, Ritva
2016-12-14
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated sequence 9 (CRISPR/Cas9) system is widely used for genome editing purposes as it facilitates an efficient knockout of a specific gene in, e.g. cultured cells. Targeted double-strand breaks are introduced to the target sequence of the guide RNAs, which activates the cellular DNA repair mechanism for non-homologous-end-joining, resulting in unprecise repair and introduction of small deletions or insertions. Due to this, sequence alterations in the coding region of the target gene frequently cause frame-shift mutations, facilitating degradation of the mRNA. We here show that such CRISPR/Cas9-mediated alterations in the target exon may also result in altered splicing of the respective pre-mRNA, most likely due to mutations of splice-regulatory sequences. Using the human FLOT-1 gene as an example, we demonstrate that such altered splicing products also give rise to aberrant protein products. These may potentially function as dominant-negative proteins and thus interfere with the interpretation of the data generated with these cell lines. Since most researchers only control the consequences of CRISPR knockout at genomic and protein level, our data should encourage to also check the alterations at the mRNA level.
Genotypic intraspecies heterogeneity of Enterococcus italicus: data from dairy environments.
Borgo, Francesca; Ferrario, Chiara; Ricci, Giovanni; Fortina, Maria Grazia
2013-01-01
The diversity of a collection of 19 Enterococcus italicus strains isolated from different dairy sources was explored using a molecular polyphasic approach, comprising random amplification of polymorphic DNA (RAPD-PCR), repetitive element PCR (REP-PCR), plasmid profiling and ribotyping. The data obtained showed a high-level of biodiversity, not always correlated to the niche of isolation. Particularly, REP-PCR with primer BOXA1R and plasmid profiling allowed the best discrimination at strain level. Exploiting the genome shotgun sequence of the type strain of the species, available in public database, genes related to insertion sequences present on enterococcal Pathogenic Islands (ISEf1, IS905), determinants related to virulence factors (codifying for hemolysin and cell wall surface proteins), exogenously DNA (conjugal transfer protein, replication plasmid protein, pheromone shutdown protein, phage integrase/recombinase) and penicillin binding proteins system were detected. The presence of most of these genes seemed a common genetic trait in the Enterococcus genus, sur gene (cell wall surface protein) was only detected in strains of E. italicus. To our knowledge, this is the first time that specific primers, with the expection of the species-specific probe targeted to 16S rRNA gene, have been designed for this species. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.
Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.
2017-01-01
CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104
Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji
2012-12-01
In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin
2010-05-01
Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.
Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A
1990-01-01
Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322
A transposable element in a NAC gene is associated with drought tolerance in maize seedlings
Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng
2015-01-01
Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805
Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.
Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato
2018-01-01
CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.
Dekker, M; Brouwers, C; Aarts, M; van der Torre, J; de Vries, S; van de Vrugt, H; te Riele, H
2006-04-01
We have previously demonstrated that site-specific insertion, deletion or substitution of one or two nucleotides in mouse embryonic stem cells (ES cells) by single-stranded deoxyribo-oligonucleotides is several hundred-fold suppressed by DNA mismatch repair (MMR) activity. Here, we have investigated whether compound mismatches and larger insertions escape detection by the MMR machinery and can be effectively introduced in MMR-proficient cells. We identified several compound mismatches that escaped detection by the MMR machinery to some extent, but could not define general rules predicting the efficacy of complex base-pair substitutions. In contrast, we found that four-nucleotide insertions were largely subject to suppression by the MSH2/MSH3 branch of MMR and could be effectively introduced in Msh3-deficient cells. As these cells have no overt mutator phenotype and Msh3-deficient mice do not develop cancer, Msh3-deficient ES cells can be used for oligonucleotide-mediated gene disruption. As an example, we present disruption of the Fanconi anemia gene Fancf.
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.
Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G
2008-12-01
With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.
Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L
2015-03-01
Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.
Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions
Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun
2012-01-01
Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557
Herrera, Victoria L; Pasion, Khristine A; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson
2015-01-01
Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5'-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28-0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/- male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/- mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population.
Herrera, Victoria L.; Pasion, Khristine A.; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson
2015-01-01
Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5’-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28–0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/− male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/− mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population. PMID:25615575
Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie
2015-01-01
Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955
Menanteau-Ledouble, Simon; Lawrence, Mark L
2013-03-23
Initial invasion of the host is the first and vital part of any infection process. We have demonstrated that Edwardsiella ictaluri is capable of colonizing and penetrating catfish skin. Therefore, a mutant library was constructed by random insertion of the Mar2xT7 transposon into the chromosome of E. ictaluri harboring the bioluminescence plasmid pAKgfplux1. This library was then screened through a series of three consecutive challenges for mutants showing a decreased ability to colonize the catfish epithelium. Eighteen mutants were identified that have decreased adhesion and virulence. Mutated genes encoded one sensor protein, two transport proteins, five enzymes, two regulatory proteins, and five hypothetical proteins. Among the mutated genes, the first one identified was a gene encoding for RstA/B, which is known to play a role in regulating the expression of invasion genes in Salmonella enterica Typhimurium. Another mutant was lacking a putative ribonuclease similar to a Shigella protein that regulates the expression of adhesin. A third mutant was defective in a protein similar to a Brucella protein that was initially identified as a transporter, but actually is a member of a newly discovered adhesin family. Results from this study could enable development of a new strategy for blocking E. ictaluri invasion at the initial adherence stage. Copyright © 2012 Elsevier B.V. All rights reserved.
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Transposon based functional characterization of soybean genes
USDA-ARS?s Scientific Manuscript database
Type II transposable elements that use cut and paste mechanism for jumping from one genomic region to another is ideal in tagging and cloning genes. Precise excision from an insertion site in a mutant gene leads to regaining the wild-type function. Thus, function of a gene can be established based o...
Chromosome rearrangements and the evolution of genome structuring and adaptability.
Crombach, Anton; Hogeweg, Paulien
2007-05-01
Eukaryotes appear to evolve by micro and macro rearrangements. This is observed not only for long-term evolutionary adaptation, but also in short-term experimental evolution of yeast, Saccharomyces cerevisiae. Moreover, based on these and other experiments it has been postulated that repeat elements, retroposons for example, mediate such events. We study an evolutionary model in which genomes with retroposons and a breaking/repair mechanism are subjected to a changing environment. We show that retroposon-mediated rearrangements can be a beneficial mutational operator for short-term adaptations to a new environment. But simply having the ability of rearranging chromosomes does not imply an advantage over genomes in which only single-gene insertions and deletions occur. Instead, a structuring of the genome is needed: genes that need to be amplified (or deleted) in a new environment have to cluster. We show that genomes hosting retroposons, starting with a random order of genes, will in the long run become organized, which enables (fast) rearrangement-based adaptations to the environment. In other words, our model provides a "proof of principle" that genomes can structure themselves in order to increase the beneficial effect of chromosome rearrangements.
Lin, Yu-Mei; Chou, I-Chun; Wang, Jaw-Fen; Ho, Fang-I; Chu, Yu-Ju; Huang, Pei-Cheng; Lu, Der-Kang; Shen, Hwei-Ling; Elbaz, Mounira; Huang, Shu-Mei; Cheng, Chiu-Ping
2008-09-01
Ralstonia solanacearum causes a deadly wilting disease on a wide range of crops. To elucidate pathogenesis of this bacterium in different host plants, we set out to identify R. solanacearum genes involved in pathogenesis by screening random transposon insertion mutants of a highly virulent strain, Pss190, on tomato and Arabidopsis thaliana. Mutants exhibiting various decreased virulence levels on these two hosts were identified. Sequence analysis showed that most, but not all, of the identified pathogenesis genes are conserved among distinct R. solanacearum strains. A few of the disrupted loci were not reported previously as being involved in R. solanacearum pathogenesis. Notably, a group of mutants exhibited differential pathogenesis on tomato and Arabidopsis. These results were confirmed by characterizing allelic mutants in one other R. solanacearum strain of the same phylotype. The significantly decreased mutants' colonization in Arabidopsis was found to be correlated with differential pathogenesis on these two plants. Differential requirement of virulence genes suggests adaptation of this bacterium in different host environments. Together, this study reveals commonalities and differences of R. solanacearum pathogenesis on single solanaceous and nonsolanaceous hosts, and provides important new insights into interactions between R. solanacearum and different host plants.
Liver-Directed Lentiviral Gene Therapy in a Dog Model of Hemophilia B
Bartholomae, Cynthia C.; Volpin, Monica; Della Valle, Patrizia; Sanvito, Francesca; Sergi Sergi, Lucia; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D’Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K.; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi
2017-01-01
We investigated the safety and efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B, and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We show that gene therapy using lentiviral vectors targeting expression of a canine factor IX transgene to hepatocytes was well-tolerated and provided stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we show that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be useful for the treatment of hemophilia. PMID:25739762
Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S
1987-07-01
Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.
Comprehensive identification of Vibrio vulnificus genes required for growth in human serum.
Carda-Diéguez, M; Silva-Hernández, F X; Hubbard, T P; Chao, M C; Waldor, M K; Amaro, C
2018-12-31
Vibrio vulnificus can be a highly invasive pathogen capable of spreading from an infection site to the bloodstream, causing sepsis and death. To survive and proliferate in blood, the pathogen requires mechanisms to overcome the innate immune defenses and metabolic limitations of this host niche. We created a high-density transposon mutant library in YJ016, a strain representative of the most virulent V. vulnificus lineage (or phylogroup) and used transposon insertion sequencing (TIS) screens to identify loci that enable the pathogen to survive and proliferate in human serum. Initially, genes underrepresented for insertions were used to estimate the V. vulnificus essential gene set; comparisons of these genes with similar TIS-based classification of underrepresented genes in other vibrios enabled the compilation of a common Vibrio essential gene set. Analysis of the relative abundance of insertion mutants in the library after exposure to serum suggested that genes involved in capsule biogenesis are critical for YJ016 complement resistance. Notably, homologues of two genes required for YJ016 serum-resistance and capsule biogenesis were not previously linked to capsule biogenesis and are largely absent from other V. vulnificus strains. The relative abundance of mutants after exposure to heat inactivated serum was compared with the findings from the serum screen. These comparisons suggest that in both conditions the pathogen relies on its Na + transporting NADH-ubiquinone reductase (NQR) complex and type II secretion system to survive/proliferate within the metabolic constraints of serum. Collectively, our findings reveal the potency of comparative TIS screens to provide knowledge of how a pathogen overcomes the diverse limitations to growth imposed by serum.
Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.
2003-01-01
A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306
Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M
2003-08-01
A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.
Chan, Daniel S; Serrano-Riera, Rafael; Griffing, Rebecca; Steverson, Barbara; Infante, Anthony; Watson, David; Sagi, H Claude; Sanders, Roy W
2016-03-01
The purpose of this OTA-approved pilot study was to compare the clinical and functional outcomes of the knee joint after infrapatellar (IP) versus suprapatellar (SP) tibial nail insertion. Prospective, randomized. Level I trauma center. After institutional review board approval, skeletally mature patients with OTA 42 tibial shaft fractures were randomized into either an IP or SP nail insertion group after informed consent was obtained. The SP also underwent prenail and postnail insertion patella-femoral (PF) joint arthroscopy. Patients underwent follow-up (6 weeks, 3, 6, and 12 months) with standard radiographs, as well as visual analog score and pain diagram documentation. At the 6-month and 12-month visits, knee function questionnaires (Lysholm knee scale and SF-36) were completed. Magnetic resonance imaging/image (MRI) of the affected knee was obtained at 12 months. Ten patients in each group were required for a power analysis for the anticipated larger randomized control trial, but enrollment in each arm was not limited because of known problems with patient follow-up over a 12-month period. A total of 41 patients/fractures were enrolled in this study. Of those, only 25 patients/fractures (14 IP, 11 SP) fully complied with and completed 12 months of follow-up. Six of 11 SP presented with articular changes (chondromalacia) in the PF joint during the preinsertion arthroscopy. Three patients displayed a change in the articular cartilage based on postnail insertion arthroscopy. At 12 months, all fractures in both groups had proceeded to union. There were no differences between the affected and unaffected knee with respect to range of motion. Functional visual analog score and Lysholm knee scores showed no significant differences between groups (P > 0.05). The SF-36v2 comparison also revealed no significant differences in the overall score, all 4 mental components, and 3/4 physical components (P > 0.05). The bodily pain component score was superior in the SP group (45 vs. 36, P = 0.035). All 11 SP patients obtained MRIs at 1 year. Five of these patients had evidence of chondromalacia on MRI. These findings did not correlate with either the prenail or postnail insertion arthroscopy. Importantly, no patient in the SP group with postnail insertion arthroscopic changes had PF joint pain at 1 year. Overall, there seemed to be no significant differences in pain, disability, or knee range of motion between these 2 tibial intramedullary nail insertion techniques after 12 months of follow-up. Based on this pilot study data, larger prospective trial with long-term follow-up is warranted. Therapeutic Level II. See Instructions for Authors for a complete description of levels of evidence.
Isolation of Erwinia chrysanthemi kduD mutants altered in pectin degradation.
Condemine, G; Hugouvieux-Cotte-Pattat, N; Robert-Baudouy, J
1986-01-01
Mutants of Erwinia chrysanthemi impaired in pectin degradation were isolated by chemical and Mu d(Ap lac) insertion mutagenesis. A mutation in the kduD gene coding for 2-keto-3-deoxygluconate oxidoreductase prevented the growth of the bacteria on polygalacturonate as the sole carbon source. Analysis of the kduD::Mu d(Ap lac) insertions indicated that kduD is either an isolated gene or the last gene of a polycistronic operon. Some of the Mu d(Ap lac) insertions were kduD-lac fusions in which beta-galactosidase synthesis reflected kduD gene expression. In all these fusions, beta-galactosidase activity was shown to be sensitive to catabolite repression by glucose and to be inducible by polygalacturonate, galacturonate, and other intermediates of polygalacturonate catabolism. Galacturonate-mediated induction was prevented by a mutation which blocked its metabolism to 2-keto-3-deoxygluconate. 2-Keto-3-deoxygluconate appeared to be the true inducer of kduD expression resulting from galacturonate degradation. 5-Keto-4-deoxyuronate or 2,5-diketo-3-deoxygluconate were the true inducers, originating from polygalacturonate cleavage. These three intermediates also appeared to induce pectate lyases, oligogalacturonate lyase, and 5-keto-4-deoxyuronate isomerase synthesis. PMID:3949717
Bilir, Ayten; Yelken, Birgül; Erkan, Ayse
2013-06-01
Protection of the catheter site by antimicrobial agents is one of the most important factors in the prevention of infection. Povidone iodine and chlorhexidine gluconate are the most common used agents for dressing. The purpose of this study was to compare the effects of povidone iodine, chlorhexidine gluconate and octenidine hydrochloride in preventing catheter related infections. Patients were randomized to receive; 4% chlorhexidine gluconate, 10% povidone iodine or octenidine hydrochlorodine for cutaneous antisepsis. Cultures were taken at the site surrounding catheter insertion and at the catheter hub after removal to help identify the source of microorganisms. Catheter related sepsis was 10.5% in the povidone iodine and octenidine hydrochlorodine groups. Catheter related colonization was 26.3% in povidone iodine group and 21.5% in octenidine hydrochlorodine group. 4% chlorhexidine or octenidine hydrochlorodine for cutaneous disinfection before insertion of an intravascular device and for post-insertion site care can reduce the catheter related colonization.
Alternate approaches to repress endogenous microRNA activity in Arabidopsis thaliana
Wang, Ming-Bo
2011-01-01
MicroRnAs (miRnAs) are an endogenous class of regulatory small RnA (sRnA). in plants, miRnAs are processed from short non-protein-coding messenger RnAs (mRnAs) transcribed from small miRnA genes (MIR genes). Traditionally in the model plant Arabidopsis thaliana (Arabidopsis), the functional analysis of a gene product has relied on the identification of a corresponding T-DnA insertion knockout mutant from a large, randomly-mutagenized population. However, because of the small size of MIR genes and presence of multiple, highly conserved members in most plant miRnA families, it has been extremely laborious and time consuming to obtain a corresponding single or multiple, null mutant plant line. Our recent study published in Molecular Plant1 outlines an alternate method for the functional characterization of miRnA action in Arabidopsis, termed anti-miRnA technology. Using this approach we demonstrated that the expression of individual miRnAs or entire miRnA families, can be readily and efficiently knocked-down. Our approach is in addition to two previously reported methodologies that also allow for the targeted suppression of either individual miRnAs, or all members of a MIR gene family; these include miRnA target mimicry2,3 and transcriptional gene silencing (TGS) of MIR gene promoters.4 All three methodologies rely on endogenous gene regulatory machinery and in this article we provide an overview of these technologies and discuss their strengths and weaknesses in inhibiting the activity of their targeted miRnA(s). PMID:21358288
Perturbation of nuclear architecture by long-distance chromosome interactions.
Dernburg, A F; Broman, K W; Fung, J C; Marshall, W F; Philips, J; Agard, D A; Sedat, J W
1996-05-31
Position-effect variegation (PEV) describes the stochastic transcriptional silencing of a gene positioned adjacent to heterochromatin. Using FISH, we have tested whether variegated expression of the eye-color gene brown in Drosophila is influenced by its nuclear localization. In embryonic nuclei, a heterochromatic insertion at the brown locus is always spatially isolated from other heterochromatin. However, during larval development this insertion physically associates with other heterochromatic regions on the same chromosome in a stochastic manner. These observations indicate that the brown gene is silenced by specific contact with centromeric heterochromatin. Moreover, they provide direct evidence for long-range chromosome interactions and their impact on three-dimensional nuclear architecture, while providing a cohesive explanation for the phenomenon of PEV.
Sengupta, Janmejoy; Sengupta, Mohua; Nag, Tulsi
2014-01-01
Development of endotracheal intubation to avoid deleterious effect on hemodynamic responses occurring during laryngoscopy and intubation compelled researchers to venture into alternative measures of airway management with subtle hemodynamic responses. This study was carried out to compare the conditions for laryngeal mask airways LMA insertion with widely used intravenous induction agents, thiopentone sodium and propofol, and also to compare the undesired responses occurring during LMA insertion with them. The study was prospective, randomized, and double blind. All patients selected were randomly allocated into two groups: Group 1 (propofol) and group II (thiopentone). Preinduction heart rate and blood pressure were recorded. Sixty healthy adult patients of either sex belonging to age group of 20-60 years and ASA grade I or II, to undergo surgery less than 1 h, were selected for the study-Patients were randomly allocated in two groups, 30 in each group. Premedication with midazolam 0.04 mg/kg and fentanyl 2 mg/kg done in both groups. Thereafter, group 1 was induced with 2 mg/kg of propofol and group 2 with 5 mg/kg of thiopentone sodium. The study revealed that, ease of insertion of LMA, was statistically significantly greater in group 1 when compared with group 2 (P 0.05). The time required for successful insertion of LMA was lesser in group 1 patients (53.8 ± 7.77 s) than in group 2 patients (84.7 ± 16.54 s) (P 0.001). Severity of undesired responses were more in group 2, as incremental boluses of respective induction agents were required in 20% patients in thiopentone group compared to only 6% patients in propofol group and 13% of patients in thiopentone group required rescue succinylcholine.
Latif, Rana K; Bautista, Alexander F; Memon, Saima B; Smith, Elizabeth A; Wang, Chenxi; Wadhwa, Anupama; Carter, Mary B; Akca, Ozan
2012-03-01
Our goal was to determine whether simulation combined with didactic training improves sterile technique during ultrasound (US)-guided central venous catheter (CVC) insertion compared with didactic training alone among novices. We hypothesized that novices who receive combined didactic and simulation-based training would perform similarly to experienced residents in aseptic technique, knowledge, and perception of comfort during US-guided CVC insertion on a simulator. Seventy-two subjects were enrolled in a randomized, controlled trial of an educational intervention. Fifty-four novices were randomized into either the didactic group or the simulation combined with didactic group. Both groups received didactic training but the simulation combined with didactic group also received simulation-based CVC insertion training. Both groups were tested by demonstrating US-guided CVC insertion on a simulator. Aseptic technique was scored on 8 steps as "yes/no" and also using a 7-point Likert scale with 7 being "excellent technique" by a rater blinded to subject randomization. After initial testing, the didactic group was offered simulation-based training and retesting. Both groups also took a pre- and posttraining test of knowledge and rated their comfort with US and CVC insertion pre- and posttraining on a 5-point Likert scale. Subsequently, 18 experienced residents also took the test of knowledge, rated their comfort level, and were scored while performing aseptic US-guided CVC insertion using a simulator. The simulation combined with didactic group achieved a 167% (95% confidence interval [CI] 133%-167%) incremental increase in yes/no scores and 115% (CI 112%-127%) incremental increase in Likert scale ratings on aseptic technique compared with novices in the didactic group. Compared with experienced residents, simulation combined with didactic trained novices achieved an increase in aseptic scores with a 33.3% (CI 16.7%-50%) increase in yes/no ratings and a 20% (CI 13.3%-40%) increase in Likert scaled ratings, and scored 2.5-fold higher on the test of knowledge. There was a 3-fold increase in knowledge and 2-fold increase in comfort level among all novices (P < 0.001) after combined didactic and simulation-based training. Simulation combined with didactic training is superior to didactic training alone for acquisition of clinical skills such as US-guided CVC insertion. After combined didactic and simulation-based training, novices can outperform experienced residents in aseptic technique as well as in measurements of knowledge.
Kuang, Jiayi; Li, Yuxuan; He, Yufeng; Gan, Lin; Wang, Aiming; Chen, Yanhua; Li, Xiaoting; Guo, Lin; Tang, Rongjun
2016-04-01
To compare the effects of oblique insertion at anatomical points and conventional acupuncture for sacroiliac joint injury. Eighty patients were randomly divided into an observation group and a control group, 40 cases in each one. In the observation group, oblique insertion therapy at anatomical points was used, and the 9 points of equal division (anatomical points) marked by palpating the anatomical symbol were treated as the insertion acupoints. In the control group, conventional acupuncture was applied, and perpendicular insertion was adopted at Huantiao (GB 30), Zhibian (BL 54) and Weizhong (BL 40), etc. In the two groups, the! treatment was given once a day and 5 times per week. Ten treatments were made into one course and two courses were required. The clinical effects, the changes of visual analogue scale (VAS) and Oswestry dysfunctional index. (ODI) before and after treatment were observed in the two groups. The total effective rate of the observation group was 90.0% (36/40), which was better than 72.5% (29/40) of the control group (P < 0.05). After treatment, the results of the VAS and ODI of the two groups were apparently declined (both P < 0.01), and those in the observation group were decreased more obviously (both P < 0.01). The effect of oblique inser-tion at anatomical points for sacroiliac joint injury is superior to that of conventional acupuncture, which can effectively relieve pain and improve the disfunction.
Pfeffer, G; Bacchetti, P; Deland, J; Lewis, A; Anderson, R; Davis, W; Alvarez, R; Brodsky, J; Cooper, P; Frey, C; Herrick, R; Myerson, M; Sammarco, J; Janecki, C; Ross, S; Bowman, M; Smith, R
1999-04-01
Fifteen centers for orthopaedic treatment of the foot and ankle participated in a prospective randomized trial to compare several nonoperative treatments for proximal plantar fasciitis (heel pain syndrome). Included were 236 patients (160 women and 76 men) who were 16 years of age or older. Most reported duration of symptoms of 6 months or less. Patients with systemic disease, significant musculoskeletal complaints, sciatica, or local nerve entrapment were excluded. We randomized patients prospectively into five different treatment groups. All groups performed Achilles tendon- and plantar fascia-stretching in a similar manner. One group was treated with stretching only. The other four groups stretched and used one of four different shoe inserts, including a silicone heel pad, a felt pad, a rubber heel cup, or a custom-made polypropylene orthotic device. Patients were reevaluated after 8 weeks of treatment. The percentages improved in each group were: (1) silicone insert, 95%; (2) rubber insert, 88%; (3) felt insert, 81%; (4)stretching only, 72%; and (5) custom orthosis, 68%. Combining all the patients who used a prefabricated insert, we found that their improvement rates were higher than those assigned to stretching only (P = 0.022) and those who stretched and used a custom orthosis (P = 0.0074). We conclude that, when used in conjunction with a stretching program, a prefabricated shoe insert is more likely to produce improvement in symptoms as part of the initial treatment of proximal plantar fasciitis than a custom polypropylene orthotic device.
Fertility comparison between wild type and transgenic mice by in vitro fertilization.
Vasudevan, Kuzhalini; Raber, James; Sztein, Jorge
2010-08-01
Transgenic mice are increasingly used as animal models for studies of gene function and regulation of mammalian genes. Although there has been continuous and remarkable progress in the development of transgenic technology over several decades, many aspects of the resulting transgenic model's phenotype cannot be completely predicted. For example, it is well known that as a consequence of the random insertion of the injected DNA construct, several founder mice of the new line need to be analyzed for possible differences in phenotype secondary to different insertion sites. The Knock out technique for transgenic production disrupts a specific gene by insertion or homologous recombination creating a null expression or replacement of the gene with a marker to localize it expression. This modification could result in pleiotropic phenotype if the gene is also expressed in tissues other than the target organs. Although the future breeding performance of the newly created model is critical to many studies, it is rarely anticipated that the new integrations could modify the reproductive profile of the new transgenic line. To date, few studies have demonstrated the difference between the parent strain's reproductive performance and the newly developed transgenic model. This study was designed to determine whether a genetic modification, knock out (KO) or transgenics, not anticipated to affect reproductive performance could affect the resulting reproductive profile of the newly developed transgenic mouse. More specifically, this study is designed to study the impact of the genetic modification on the ability of gametes to be fertilized in vitro. We analyzed the reproductive performance of mice with different background strains: FVB/N, C57BL/6 (129Sv/J x C57Bl/6)F1 and outbred CD1((R)) and compared them to mice of the same strain carrying a transgene or KO which was not anticipated to affect fertility. In vitro Fertilization was used to analyze the fertility of the mice. Oocytes from superovulated females were inseminated with sperm of same background. Fertility rate was considered as the percentage of two cell embryos scored 24 h after insemination. The data collected from this study shows that the fertilization rate is affected (reduced to half fold) in some of the transgenic mice compared to the respective Wild Type (WT) mice. For the WT the average fertility rate ranged from 80% (C57BL/6), 90% (FVB/N), 45% (129Sv/J x C57Bl/6)F1 and 43% (CD1). For transgenic mice it was 52% (C57BL/6), 65% (FVB/N), 22% (129Sv/J x C57Bl/6)F1 and 25% (CD1).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chain, P; Garcia, E
2003-02-06
The goal of this proposed effort was to assess the difficulty in identifying and characterizing virulence candidate genes in an organism for which very limited data exists. This was accomplished by first addressing the finishing phase of draft-sequenced F. tularensis genomes and conducting comparative analyses to determine the coding potential of each genome; to discover the differences in genome structure and content, and to identify potential genes whose products may be involved in the F. tularensis virulence process. The project was divided into three parts: (1) Genome finishing: This part involves determining the order and orientation of the consensus sequencesmore » of contigs obtained from Phrap assemblies of random draft genomic sequences. This tedious process consists of linking contig ends using information embedded in each sequence file that relates the sequence to the original cloned insert. Since inserts are sequenced from both ends, we can establish a link between these paired-ends in different contigs and thus order and orient contigs. Since these genomes carry numerous copies of insertion sequences, these repeated elements ''confuse'' the Phrap assembly program. It is thus necessary to break these contigs apart at the repeated sequences and individually join the proper flanking regions using paired-end information, or using results of comparisons against a similar genome. Larger repeated elements such as the small subunit ribosomal RNA operon require verification with PCR. Tandem repeats require manual intervention and typically rely on single nucleotide polymorphisms to be resolved. Remaining gaps require PCR reactions and sequencing. Once the genomes have been ''closed'', low quality regions are addressed by resequencing reactions. (2) Genome analysis: The final consensus sequences are processed by combining the results of three gene modelers: Glimmer, Critica and Generation. The final gene models are submitted to a battery of homology searches and domain prediction programs in order to annotate them (e.g. BLAST, Pfam, TIGRfam, COG, KEGG, InterPro, TMhmm, SignalP). The genome structure is also assessed in terms of G+C content, GC bias (GC skew), and locations of repeated regions (e.g. IS elements) and phage-like genes. (3) Comparative genomics: The results of the various genome analyses are compared between the finished (or almost finished) genomes. Here, we have compared the F. tularensis genomes from the extremely lethal strain Schu4 (subsp. tularensis), the vaccine strain LVS (subsp. holartica), and strain UT01-4992 of the less virulent, opportunistic subsp. novicida. Regions present in the highly virulent strain that are absent from the other less virulent strains may provide insight into what factors are required for the high level of virulence.« less
Montero-Conde, Cristina; Leandro-Garcia, Luis J; Chen, Xu; Oler, Gisele; Ruiz-Llorente, Sergio; Ryder, Mabel; Landa, Iñigo; Sanchez-Vega, Francisco; La, Konnor; Ghossein, Ronald A; Bajorin, Dean F; Knauf, Jeffrey A; Riordan, Jesse D; Dupuy, Adam J; Fagin, James A
2017-06-20
Oncogenic RAS mutations are present in 15-30% of thyroid carcinomas. Endogenous expression of mutant Ras is insufficient to initiate thyroid tumorigenesis in murine models, indicating that additional genetic alterations are required. We used Sleeping Beauty (SB) transposon mutagenesis to identify events that cooperate with Hras G12V in thyroid tumor development. Random genomic integration of SB transposons primarily generated loss-of-function events that significantly increased thyroid tumor penetrance in Tpo-Cre/homozygous FR-Hras G12V mice. The thyroid tumors closely phenocopied the histological features of human RAS-driven, poorly differentiated thyroid cancers. Characterization of transposon insertion sites in the SB-induced tumors identified 45 recurrently mutated candidate cancer genes. These mutation profiles were remarkably concordant with mutated cancer genes identified in a large series of human poorly differentiated and anaplastic thyroid cancers screened by next-generation sequencing using the MSK-IMPACT panel of cancer genes, which we modified to include all SB candidates. The disrupted genes primarily clustered in chromatin remodeling functional nodes and in the PI3K pathway. ATXN7 , a component of a multiprotein complex with histone acetylase activity, scored as a significant SB hit. It was recurrently mutated in advanced human cancers and significantly co-occurred with RAS or NF1 mutations. Expression of ATXN7 mutants cooperated with oncogenic RAS to induce thyroid cell proliferation, pointing to ATXN7 as a previously unrecognized cancer gene.
Montero-Conde, Cristina; Leandro-Garcia, Luis J.; Chen, Xu; Oler, Gisele; Ruiz-Llorente, Sergio; Ryder, Mabel; Landa, Iñigo; Sanchez-Vega, Francisco; La, Konnor; Ghossein, Ronald A.; Bajorin, Dean F.; Knauf, Jeffrey A.; Riordan, Jesse D.; Dupuy, Adam J.; Fagin, James A.
2017-01-01
Oncogenic RAS mutations are present in 15–30% of thyroid carcinomas. Endogenous expression of mutant Ras is insufficient to initiate thyroid tumorigenesis in murine models, indicating that additional genetic alterations are required. We used Sleeping Beauty (SB) transposon mutagenesis to identify events that cooperate with HrasG12V in thyroid tumor development. Random genomic integration of SB transposons primarily generated loss-of-function events that significantly increased thyroid tumor penetrance in Tpo-Cre/homozygous FR-HrasG12V mice. The thyroid tumors closely phenocopied the histological features of human RAS-driven, poorly differentiated thyroid cancers. Characterization of transposon insertion sites in the SB-induced tumors identified 45 recurrently mutated candidate cancer genes. These mutation profiles were remarkably concordant with mutated cancer genes identified in a large series of human poorly differentiated and anaplastic thyroid cancers screened by next-generation sequencing using the MSK-IMPACT panel of cancer genes, which we modified to include all SB candidates. The disrupted genes primarily clustered in chromatin remodeling functional nodes and in the PI3K pathway. ATXN7, a component of a multiprotein complex with histone acetylase activity, scored as a significant SB hit. It was recurrently mutated in advanced human cancers and significantly co-occurred with RAS or NF1 mutations. Expression of ATXN7 mutants cooperated with oncogenic RAS to induce thyroid cell proliferation, pointing to ATXN7 as a previously unrecognized cancer gene. PMID:28584132
Genome Engineering in Bacillus anthracis Using Cre Recombinase
Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.
2006-01-01
Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.
Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling
2015-06-19
Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.
Botkin, Douglas J.; Abbott, April N.; Stewart, Philip E.; Rosa, Patricia A.; Kawabata, Hiroki; Watanabe, Haruo; Norris, Steven J.
2006-01-01
Lyme disease Borrelia organisms are highly invasive spirochetes that alternate between vertebrate and arthropod hosts and that establish chronic infections and elicit inflammatory reactions in mammals. Although progress has been made in the targeted mutagenesis of individual genes in infectious Borrelia burgdorferi, the roles of the vast majority of gene products in pathogenesis remain unresolved. In this study, we examined the feasibility of using transposon mutagenesis to identify infectivity-related factors in B. burgdorferi. The transformable, infectious strain 5A18 NP1 was transformed with the spirochete-adapted Himar1 transposon delivery vector pMarGent to create a small library of 33 insertion mutants. Single mouse inoculations followed by culture of four tissue sites and serology were used to screen the mutants for infectivity phenotypes. Mutants that appeared attenuated (culture positive at some sites) or noninfectious (negative at all sites) and contained the virulence-associated plasmids lp25 and lp28-1 were examined in more extensive animal studies. Three of these mutants (including those with insertions in the putative fliG-1-encoded flagellar motor switch protein and the guaB-encoded IMP dehydrogenase) were noninfectious, whereas four clones appeared to exhibit reduced infectivity. Serological reactivity in VlsE enzyme-linked immunosorbent assays correlated with the assignment of mutants to the noninfectious or attenuated-infectivity groups. The results of this study indicate that random transposon mutagenesis of infectious B. burgdorferi is feasible and will be of value in studying the pathogenesis of Lyme disease Borrelia. PMID:17015459
Negi, Vir S; Devaraju, Panneer; Gulati, Reena
2015-09-01
SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian Tamils.
Secretion Trap Tagging of Secreted and Membrane-Spanning Proteins Using Arabidopsis Gene Traps
Andrew T. Groover; Joseph R. Fontana; Juana M. Arroyo; Cristina Yordan; W. Richard McCombie; Robert A. Martienssen
2003-01-01
Secreted and membrane-spanning proteins play fundamental roles in plant development but pose challenges for genetic identification and characterization. We describe a "secretion trap" screen for gene trap insertions in genes encoding proteins routed through the secretory pathway. The gene trap transposon encodes a ß-glucuronidase reporter enzyme...
What makes up plant genomes: The vanishing line between transposable elements and genes.
Zhao, Dongyan; Ferguson, Ann A; Jiang, Ning
2016-02-01
The ultimate source of evolution is mutation. As the largest component in plant genomes, transposable elements (TEs) create numerous types of mutations that cannot be mimicked by other genetic mechanisms. When TEs insert into genomic sequences, they influence the expression of nearby genes as well as genes unlinked to the insertion. TEs can duplicate, mobilize, and recombine normal genes or gene fragments, with the potential to generate new genes or modify the structure of existing genes. TEs also donate their transposase coding regions for cellular functions in a process called TE domestication. Despite the host defense against TE activity, a subset of TEs survived and thrived through discreet selection of transposition activity, target site, element size, and the internal sequence. Finally, TEs have established strategies to reduce the efficacy of host defense system by increasing the cost of silencing TEs. This review discusses the recent progress in the area of plant TEs with a focus on the interaction between TEs and genes. Copyright © 2015 Elsevier B.V. All rights reserved.
Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.
The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less
Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides
Geiselman, Gina M; Ito, Masakazu; Mondo, Stephen J; Reilly, Morgann C; Cheng, Ya-Fang; Bauer, Stefan; Grigoriev, Igor V; Gladden, John M; Simmons, Blake A; Brem, Rachel B
2018-01-01
The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted function in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. These results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi. PMID:29521624
Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides
Coradetti, Samuel T.; Pinel, Dominic; Geiselman, Gina M.; ...
2018-03-09
The basidiomycete yeast Rhodosporidium toruloides (also known as Rhodotorula toruloides) accumulates high concentrations of lipids and carotenoids from diverse carbon sources. It has great potential as a model for the cellular biology of lipid droplets and for sustainable chemical production. We developed a method for high-throughput genetics (RB-TDNAseq), using sequence-barcoded Agrobacterium tumefaciens T-DNA insertions. We identified 1,337 putative essential genes with low T-DNA insertion rates. We functionally profiled genes required for fatty acid catabolism and lipid accumulation, validating results with 35 targeted deletion strains. We identified a high-confidence set of 150 genes affecting lipid accumulation, including genes with predicted functionmore » in signaling cascades, gene expression, protein modification and vesicular trafficking, autophagy, amino acid synthesis and tRNA modification, and genes of unknown function. Lastly, these results greatly advance our understanding of lipid metabolism in this oleaginous species and demonstrate a general approach for barcoded mutagenesis that should enable functional genomics in diverse fungi.« less
Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat
Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying
2018-01-01
A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P < 0.01), and the average first-born litter size of individuals with an insertion/insertion genotype higher than that of those with the deletion/deletion genotype (P < 0.05). There was also a significant difference in genotype distributions of the 16 bp indel between mothers of single-lamb and multi-lamb litters in the studied goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081
Chen, Song; Li, Xianchun
2007-01-01
Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843
Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2015-01-01
Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation.
Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2015-01-01
Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation. PMID:26581077
Constructing high complexity synthetic libraries of long ORFs using in vitro selection
NASA Technical Reports Server (NTRS)
Cho, G.; Keefe, A. D.; Liu, R.; Wilson, D. S.; Szostak, J. W.
2000-01-01
We present a method that can significantly increase the complexity of protein libraries used for in vitro or in vivo protein selection experiments. Protein libraries are often encoded by chemically synthesized DNA, in which part of the open reading frame is randomized. There are, however, major obstacles associated with the chemical synthesis of long open reading frames, especially those containing random segments. Insertions and deletions that occur during chemical synthesis cause frameshifts, and stop codons in the random region will cause premature termination. These problems can together greatly reduce the number of full-length synthetic genes in the library. We describe a strategy in which smaller segments of the synthetic open reading frame are selected in vitro using mRNA display for the absence of frameshifts and stop codons. These smaller segments are then ligated together to form combinatorial libraries of long uninterrupted open reading frames. This process can increase the number of full-length open reading frames in libraries by up to two orders of magnitude, resulting in protein libraries with complexities of greater than 10(13). We have used this methodology to generate three types of displayed protein library: a completely random sequence library, a library of concatemerized oligopeptide cassettes with a propensity for forming amphipathic alpha-helical or beta-strand structures, and a library based on one of the most common enzymatic scaffolds, the alpha/beta (TIM) barrel. Copyright 2000 Academic Press.
A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.
Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna
2008-03-01
Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.
The Essential Genome of Escherichia coli K-12
2018-01-01
ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657
Zaballos, Matilde; Bastida, Emilia; Agustí, Salomé; Portas, Maite; Jiménez, Consuelo; López-Gil, Maite
2015-10-06
A new supraglottic device, the LMA-Supreme™, has recently become available for clinical use. Information on anaesthetic and co-adjuvant requirements for insertion of the LMA-Supreme™ is limited. The present study aimed to evaluate the optimal effect-site concentration of propofol in 50 % (EC50) of adults necessary for successful insertion of the LMA-Supreme™ and to examine remifentanil's effect on propofol requirements. Fifty-eight elective patients (aged 18-60 years; ASA (American Society Anaesthesiologists) physical status classification I and II) scheduled for day surgery were randomly assigned to one of two groups: propofol with saline or propofol with remifentanil. Anaesthesia was induced by target-controlled infusion according to predetermined effect-site concentrations of propofol and remifentanil (5 ng.mL(-1)). The EC50 was calculated using Dixon's up-and-down method. Ten minutes following drug administration, LMA-Supreme™ insertion was attempted without the use of muscle relaxant drugs. In the propofol + saline group, the EC50 of propofol required for LMA-Supreme™ insertion was 6.32 ± 0.67 μg.mL(-1) (95 % CI, 5.69-6.94 μg.mL(-1)). With the addition of remifentanil at an effect-site concentration of 5 ng.mL(-1), the EC50 of propofol required for LMA-Supreme™ insertion was 2.50 ± 0.80 μg.mL(-1) (95 % CI, 1.82-3.17 μg.mL(-1); p < 0.0001). The propofol requirement for smooth insertion of the LMA-Supreme™ was 60 % less when remifentanil (5 ng.mL(-1)) was co-administered. Identified as NCT01974648 at www.clinicaltrials.gov .
Liver-directed lentiviral gene therapy in a dog model of hemophilia B.
Cantore, Alessio; Ranzani, Marco; Bartholomae, Cynthia C; Volpin, Monica; Valle, Patrizia Della; Sanvito, Francesca; Sergi, Lucia Sergi; Gallina, Pierangela; Benedicenti, Fabrizio; Bellinger, Dwight; Raymer, Robin; Merricks, Elizabeth; Bellintani, Francesca; Martin, Samia; Doglioni, Claudio; D'Angelo, Armando; VandenDriessche, Thierry; Chuah, Marinee K; Schmidt, Manfred; Nichols, Timothy; Montini, Eugenio; Naldini, Luigi
2015-03-04
We investigated the efficacy of liver-directed gene therapy using lentiviral vectors in a large animal model of hemophilia B and evaluated the risk of insertional mutagenesis in tumor-prone mouse models. We showed that gene therapy using lentiviral vectors targeting the expression of a canine factor IX transgene in hepatocytes was well tolerated and provided a stable long-term production of coagulation factor IX in dogs with hemophilia B. By exploiting three different mouse models designed to amplify the consequences of insertional mutagenesis, we showed that no genotoxicity was detected with these lentiviral vectors. Our findings suggest that lentiviral vectors may be an attractive candidate for gene therapy targeted to the liver and may be potentially useful for the treatment of hemophilia. Copyright © 2015, American Association for the Advancement of Science.
Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.
Byrne, Susan M; Church, George M
2015-01-01
CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.
Unstable transpositions of his4 in yeast.
Greer, H; Fink, G R
1979-01-01
Unstable transpositions in yeast have been selected in which the his4C gene from chromosome III is inserted into chromosome XII. This event is associated with the generation of a recessive lethal mutation, resulting from the integration of his4C into an essential gene. Strains with these transpositions are viable as diploids or aneuploids for chromosome XII. The event that generates the transpositions does not lead reciprocally to a deletion on chromosome III, implying that synthesis of a new copy of his4C and subsequent transposition may have occurred. The his4C transpositions are unstable and give rise to C- segregants at a high frequency, as a result of either precise excision of the his4C gene (restoring function of the gene into which insertion had occurred) or chromosome loss. PMID:386353
Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian
2015-01-01
The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076
Sun, Ying; Yang, Chenghuai; Li, Junping; Li, Ling; Cao, Minghui; Li, Qihong; Li, Huijiao
2017-01-01
H9 subtype avian influenza viruses (AIVs) remain a significant burden in the poultry industry and are considered to be one of the most likely causes of any new influenza pandemic in humans. As ducks play an important role in the maintenance of H9 viruses in nature, successful control of the spread of H9 AIVs in ducks will have significant beneficial effects on public health. Duck enteritis virus (DEV) may be a promising candidate viral vector for aquatic poultry vaccination. In this study, we constructed a recombinant DEV, rDEV-∆UL2-HA, inserting the hemagglutinin (HA) gene from duck-origin H9N2 AIV into the UL2 gene by homologous recombination. One-step growth analyses showed that the HA gene insertion had no effect on viral replication and suggested that the UL2 gene was nonessential for virus growth in vitro. In vivo tests further showed that the insertion of the HA gene in place of the UL2 gene did not affect the immunogenicity of the virus. Moreover, a single dose of 10 3 TCID 50 of rDEV-∆UL2-HA induced solid protection against lethal DEV challenge and completely prevented H9N2 AIV viral shedding. To our knowledge, this is the first report of a DEV-vectored vaccine providing robust protection against both DEV and H9N2 AIV virus infections in ducks.
Pisello, Franco; Geraci, Girolamo; Li Volsi, Francesco; Modica, Giuseppe; Sciumè, Carmelo
2008-11-01
Endoscopic sphincterotomy (ES) and stone extraction is the treatment of choice for bile duct stones. Therefore, if ES and conventional stone extraction fail, further treatment is mandatory. Insertion of a biliary endoprosthesis is an effective option. We treated 30 high-risk patients (17 women and 13 men, mean age 82 years) affected by difficult common bile duct stones. The patients were randomly assigned preoperatively using closed envelopes (blind randomization) into two groups to receive insertion of polyethylene or hydrophilic hydromer-coated polyurethane stent, respectively. Follow-up was achieved by contacting referring physicians and patient's relatives. Biliary drainage was established in all patients. Early minor complications occurred in 28%. In all these patients, the stent was a definitive measure. Median follow-up was 38 months. Late complications occurred in 34%. Cholangitis was the most frequent. During follow up, 11 patients died, two as result of a biliary-related cause. No statistically significant difference was observed on different stents patency. Endoprosthesis insertion as a permanent therapy is an effective alternative to surgery or dissolution therapy. Therefore, biliary stenting should preferably be restricted to high-risk patients unfit for operative treatment and with a short life expectancy.
Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution
Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.
2005-01-01
The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818
Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.
Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R
2013-02-01
To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.
Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred
2015-01-01
Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.
Turner, Arthur K.; Lovell, Margaret A.; Hulme, Scott D.; Zhang-Barber, Li; Barrow, Paul A.
1998-01-01
From a collection of 2,800 Tn5-TC1 transposon mutants of Salmonella typhimurium F98, 18 that showed reduced intestinal colonization of 3-week-old chicks were identified. The sites of transposon insertion were determined for most of the mutants and included insertions in the lipopolysaccharide biosynthesis genes rfaK, rfaY, rfbK, and rfbB and the genes dksA, clpB, hupA, and sipC. In addition, identification was made of an insertion into a novel gene that encodes a protein showing similarity to the IIC component of the mannose class of phosphoenolpyruvate-carbohydrate phosphotransferase systems, which we putatively called ptsC. Transduction of most of the transposon mutations to a fresh S. typhimurium F98 genetic background and construction of defined mutations in the rfbK, dksA, hupA, sipC, and ptsC genes of S. typhimurium F98 supported the role in colonization of all but the pts locus. The virulence of the rfbK, dksA, hupA, sipC, and ptsC defined mutants and clpB and rfaY transductants in 1-day-old chicks was tested. All but the ptsC and rfaY mutants were attenuated for virulence. A number of other phenotypes associated with some of the mutations are described. PMID:9573095
Kim, Hee-Sook; Park, Sung Hee; Günzl, Arthur; Cross, George A M
2013-01-01
Trypanosoma brucei variant surface glycoprotein (VSG) expression is a classic example of allelic exclusion. While the genome of T. brucei contains >2,000 VSG genes and VSG pseudogenes, only one allele is expressed at the surface of each infectious trypanosome and the others are repressed. Along with recombinatorial VSG switching, allelic exclusion provides a major host evasion mechanism for trypanosomes, a phenomenon known as antigenic variation. To extend our understanding of how trypanosomes escape host immunity by differential expression of VSGs, we attempted to identify genes that contribute to VSG silencing, by performing a loss-of-silencing screen in T. brucei using a transposon-mediated random insertional mutagenesis. One identified gene, which we initially named LOS1, encodes a T. brucei MCM-Binding Protein (TbMCM-BP). Here we show that TbMCM-BP is essential for viability of infectious bloodstream-form (BF) trypanosome and is required for proper cell-cycle progression. Tandem affinity purification of TbMCM-BP followed by mass spectrometry identified four subunits (MCM4-MCM7) of the T. brucei MCM complex, a replicative helicase, and MCM8, a subunit that is uniquely co-purified with TbMCM-BP. TbMCM-BP is required not only for repression of subtelomeric VSGs but also for silencing of life-cycle specific, insect-stage genes, procyclin and procyclin-associated genes (PAGs), that are normally repressed in BF trypanosomes and are transcribed by RNA polymerase I. Our study uncovers a functional link between chromosome maintenance and RNA pol I-mediated gene silencing in T. brucei.
Hahntow, Ines N; Mairuhu, Gideon; van Valkengoed, Irene Gm; Koopmans, Richard P; Michel, Martin C
2010-06-02
Genotype-phenotype association studies are typically based upon polymorphisms or haplotypes comprised of multiple polymorphisms within a single gene. It has been proposed that combinations of polymorphisms in distinct genes, which functionally impact the same phenotype, may have stronger phenotype associations than those within a single gene. We have tested this hypothesis using genes encoding components of the renin-angiotensin-aldosterone system and the high blood pressure phenotype. Our analysis is based on 1379 participants of the cross-sectional SUNSET study randomly selected from the population register of Amsterdam. Each subject was genotyped for the angiotensinogen M235T, the angiotensin-converting enzyme insertion/deletion and the angiotensin II type 1 receptor A1166C polymorphism. The phenotype high blood pressure was defined either as a categorical variable comparing hypertension versus normotension as in most previous studies or as a continuous variable using systolic, diastolic and mean blood pressure in a multiple regression analysis with gender, ethnicity, age, body-mass-index and antihypertensive medication as covariates. Genotype-phenotype relationships were explored for each polymorphism in isolation and for double and triple polymorphism combinations. At the single polymorphism level, only the A allele of the angiotensin II type 1 receptor was associated with a high blood pressure phenotype. Using combinations of polymorphisms of two or all three genes did not yield stronger/more consistent associations. We conclude that combinations of physiologically related polymorphisms of multiple genes, at least with regard to the renin-angiotensin-aldosterone system and the hypertensive phenotype, do not necessarily offer additional benefit in analyzing genotype/phenotype associations.
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
Gene Function Analysis in the Ubiquitous Human Commensal and Pathogen Malassezia Genus.
Ianiri, Giuseppe; Averette, Anna F; Kingsbury, Joanne M; Heitman, Joseph; Idnurm, Alexander
2016-11-29
The genus Malassezia includes 14 species that are found on the skin of humans and animals and are associated with a number of diseases. Recent genome sequencing projects have defined the gene content of all 14 species; however, to date, genetic manipulation has not been possible for any species within this genus. Here, we develop and then optimize molecular tools for the transformation of Malassezia furfur and Malassezia sympodialis using Agrobacterium tumefaciens delivery of transfer DNA (T-DNA) molecules. These T-DNAs can insert randomly into the genome. In the case of M. furfur, targeted gene replacements were also achieved via homologous recombination, enabling deletion of the ADE2 gene for purine biosynthesis and of the LAC2 gene predicted to be involved in melanin biosynthesis. Hence, the introduction of exogenous DNA and direct gene manipulation are feasible in Malassezia species. Species in the genus Malassezia are a defining component of the microbiome of the surface of mammals. They are also associated with a wide range of skin disease symptoms. Many species are difficult to culture in vitro, and although genome sequences are available for the species in this genus, it has not been possible to assess gene function to date. In this study, we pursued a series of possible transformation methods and identified one that allows the introduction of DNA into two species of Malassezia, including the ability to make targeted integrations into the genome such that genes can be deleted. This research opens a new direction in terms of now being able to analyze gene functions in this little understood genus. These tools will contribute to define the mechanisms that lead to the commensalism and pathogenicity in this group of obligate fungi that are predominant on the skin of mammals. Copyright © 2016 Ianiri et al.
Maumus, Florian; Blanc, Guillaume
2016-12-14
The nucleocytoplasmic large DNA viruses (NCLDV) are a group of extremely complex double-stranded DNA viruses, which are major parasites of a variety of eukaryotes. Recent studies showed that certain unicellular eukaryotes contain fragments of NCLDV DNA integrated in their genome, when surprisingly many of these organisms were not previously shown to be infected by NCLDVs. These findings prompted us to search the genome of Acanthamoeba castellanii strain Neff (Neff), one of the most prolific hosts in the discovery of giant NCLDVs, for possible DNA inserts of viral origin. We report the identification of 267 markers of lateral gene transfer with viruses, approximately half of which are clustered in Neff genome regions of viral origins, transcriptionally inactive or exhibit nucleotide-composition signatures suggestive of a foreign origin. The integrated viral genes had diverse origin among relatives of viruses that infect Neff, including Mollivirus, Pandoravirus, Marseillevirus, Pithovirus, and Mimivirus However, phylogenetic analysis suggests the existence of a yet-undiscovered family of amoeba-infecting NCLDV in addition to the five already characterized. The active transcription of some apparently anciently integrated virus-like genes suggests that some viral genes might have been domesticated during the amoeba evolution. These insights confirm that genomic insertion of NCLDV DNA is a common theme in eukaryotes. This gene flow contributed fertilizing the eukaryotic gene repertoire and participated in the occurrence of orphan genes, a long standing issue in genomics. Search for viral inserts in eukaryotic genomes followed by environmental screening of the original viruses should be used to isolate radically new NCLDVs. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Insertional engineering of chromosomes with Sleeping Beauty transposition: an overview.
Grabundzija, Ivana; Izsvák, Zsuzsanna; Ivics, Zoltán
2011-01-01
Novel genetic tools and mutagenesis strategies based on the Sleeping Beauty (SB) transposable element are currently under development with a vision to link primary DNA sequence information to gene functions in vertebrate models. By virtue of its inherent capacity to insert into DNA, the SB transposon can be developed into powerful tools for chromosomal manipulations. Mutagenesis screens based on SB have numerous advantages including high throughput and easy identification of mutated alleles. Forward genetic approaches based on insertional mutagenesis by engineered SB transposons have the advantage of providing insight into genetic networks and pathways based on phenotype. Indeed, the SB transposon has become a highly instrumental tool to induce tumors in experimental animals in a tissue-specific -manner with the aim of uncovering the genetic basis of diverse cancers. Here, we describe a battery of mutagenic cassettes that can be applied in conjunction with SB transposon vectors to mutagenize genes, and highlight versatile experimental strategies for the generation of engineered chromosomes for loss-of-function as well as gain-of-function mutagenesis for functional gene annotation in vertebrate models.
Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.
1993-01-01
Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274
Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.
Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana
2015-03-01
We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya
2013-07-01
We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.
An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease.
Urban, M; Bhargava, T; Hamer, J E
1999-01-01
Cells tolerate exposure to cytotoxic compounds through the action of ATP-driven efflux pumps belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. Phytopathogenic fungi encounter toxic environments during plant invasion as a result of the plant defense response. Here we demonstrate the requirement for an ABC transporter during host infection by the fungal plant pathogen Magnaporthe grisea. The ABC1 gene was identified in an insertional mutagenesis screen for pathogenicity mutants. The ABC1 insertional mutant and a gene-replacement mutant arrest growth and die shortly after penetrating either rice or barley epidermal cells. The ABC1-encoded protein is similar to yeast ABC transporters implicated in multidrug resistance, and ABC1 gene transcripts are inducible by toxic drugs and a rice phytoalexin. However, abc1 mutants are not hypersensitive to antifungal compounds. The non-pathogenic, insertional mutation in ABC1 occurs in the promoter region and dramatically reduces transcript induction by metabolic poisons. These data strongly suggest that M.grisea requires the up-regulation of specific ABC transporters for pathogenesis; most likely to protect itself against plant defense mechanisms. PMID:9927411
In vivo modification of a maize engineered minichromosome.
Gaeta, Robert T; Masonbrink, Rick E; Zhao, Changzeng; Sanyal, Abhijit; Krishnaswamy, Lakshminarasimhan; Birchler, James A
2013-06-01
Engineered minichromosomes provide efficient platforms for stacking transgenes in crop plants. Methods for modifying these chromosomes in vivo are essential for the development of customizable systems for the removal of selection genes or other sequences and for the addition of new genes. Previous studies have demonstrated that Cre, a site-specific recombinase, could be used to modify lox sites on transgenes on maize minichromosomes; however, these studies demonstrated somatic recombination only, and modified minichromosomes could not be recovered. We describe the recovery of an engineered chromosome composed of little more than a centromere plus transgene that was derived by telomere-mediated truncation. We used the fiber fluorescence in situ hybridization technique and detected a transgene on the minichromosome inserted among stretches of CentC centromere repeats, and this insertion was large enough to suggest a tandem insertion. By crossing the minichromosome to a plant expressing Cre-recombinase, the Bar selection gene was removed, leaving behind a single loxP site. This study demonstrates that engineered chromosomes can be modified in vivo using site-specific recombinases, a demonstration essential to the development of amendable chromosome platforms in plants.
[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].
Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V
2012-04-01
Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.
Single gene insertion drives bioalcohol production by a thermophilic archaeon
Basen, Mirko; Schut, Gerrit J.; Nguyen, Diep M.; Lipscomb, Gina L.; Benn, Robert A.; Prybol, Cameron J.; Vaccaro, Brian J.; Poole, Farris L.; Kelly, Robert M.; Adams, Michael W. W.
2014-01-01
Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways. PMID:25368184
Single gene insertion drives bioalcohol production by a thermophilic archaeon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Basen, M; Schut, GJ; Nguyen, DM
2014-12-09
Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. Bymore » heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.« less
Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H
2006-01-01
Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.
Seiberlich, Laura E; Keay, Vanessa; Kallos, Stephane; Junghans, Tiffany; Lang, Eddy; McRae, Andrew D
2016-03-01
The performance of a new safety peripheral intravenous catheter (PIVC) that contains a blood control feature in the hub (blood control) was compared against the current hospital standard without blood control (standard). In this prospective, non-blinded trial, patients were randomized 1:1 to receive either device. Insertions were performed and rated by emergency room nurses. Primary endpoints included clinical acceptability, incidence of blood leakage, and risk of blood exposure. Secondary endpoints were digital compression, insertion success, and usability. 15 clinicians performed 152 PIVC insertions (73 blood control, 79 standard). Clinical acceptability of the blood control device (100%) was non-inferior to the standard (98.7%) (p < 0.0001). The blood control device had a lower incidence of blood leakage (14.1% vs 68.4%), was superior in eliminating the risk of blood exposure (93.9% vs 19.1%) and the need for digital compression (95.3% vs 19.1%), while maintaining non-inferior insertion success rates (95.9% vs 93.7%) and usability ratings (p < 0.0001). In comparison with the hospital-standard, the new safety PIVC with integrated blood control valve had similar clinical acceptability ratings yet demonstrated superior advantages to both clinicians and patients to decrease blood leakage and the clinician's risk of blood exposure, during the insertion process. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Ebert, Matthias; Laaß, Sebastian; Burghartz, Melanie; Petersen, Jörn; Koßmehl, Sebastian; Wöhlbrand, Lars; Rabus, Ralf; Wittmann, Christoph; Jahn, Dieter
2013-01-01
Anaerobic growth and survival are integral parts of the life cycle of many marine bacteria. To identify genes essential for the anoxic life of Dinoroseobacter shibae, a transposon library was screened for strains impaired in anaerobic denitrifying growth. Transposon insertions in 35 chromosomal and 18 plasmid genes were detected. The essential contribution of plasmid genes to anaerobic growth was confirmed with plasmid-cured D. shibae strains. A combined transcriptome and proteome approach identified oxygen tension-regulated genes. Transposon insertion sites of a total of 1,527 mutants without an anaerobic growth phenotype were determined to identify anaerobically induced but not essential genes. A surprisingly small overlap of only three genes (napA, phaA, and the Na+/Pi antiporter gene Dshi_0543) between anaerobically essential and induced genes was found. Interestingly, transposon mutations in genes involved in dissimilatory and assimilatory nitrate reduction (napA, nasA) and corresponding cofactor biosynthesis (genomic moaB, moeB, and dsbC and plasmid-carried dsbD and ccmH) were found to cause anaerobic growth defects. In contrast, mutation of anaerobically induced genes encoding proteins required for the later denitrification steps (nirS, nirJ, nosD), dimethyl sulfoxide reduction (dmsA1), and fermentation (pdhB1, arcA, aceE, pta, acs) did not result in decreased anaerobic growth under the conditions tested. Additional essential components (ferredoxin, cccA) of the anaerobic electron transfer chain and central metabolism (pdhB) were identified. Another surprise was the importance of sodium gradient-dependent membrane processes and genomic rearrangements via viruses, transposons, and insertion sequence elements for anaerobic growth. These processes and the observed contributions of cell envelope restructuring (lysM, mipA, fadK), C4-dicarboxylate transport (dctM1, dctM3), and protease functions to anaerobic growth require further investigation to unravel the novel underlying adaptation strategies. PMID:23974024
Expressing genes do not forget their LINEs: transposable elements and gene expression
Kines, Kristine J.; Belancio, Victoria P.
2012-01-01
1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807
Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong
2015-08-01
In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy.
Ma, Zhengqiang
2013-01-01
Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966
USDA-ARS?s Scientific Manuscript database
Until now, functional analyses of soybean genes have been very arduous because of the lack of a rapid transformation procedure. Recently identified the active endogenous type II transposable element, Tgm9, excises from insertion sites and restores wild-type phenotypes. Thus, this element provides a ...
Facial asymmetry and clinical manifestations in patients with novel insertion of the TCOF1 gene.
Su, P-H; Liu, Y-F; Yu, J-S; Chen, J-Y; Chen, S-J; Lai, Y-J
2012-11-01
This study explored the role of TCOF1 insertion mutations in Taiwanese patients with craniofacial anomalies. Twelve patients with single or multiple, asymmetrical congenital craniofacial anomalies were enrolled. Genomic DNA was prepared from leukocytes; the coding regions of TCOF1 were analyzed by polymerase chain reaction and direct sequencing. Clinical manifestations were correlated to the TCOF1 mutation. Six of 12 patients diagnosed with hemifacial microsomia exhibited a novel insertion mutation 4127 ins G (frameshift) in exon 24 in the TCOF1 gene. All six patients were diagnosed with anomalies on the left side. In addition, four of these six patients had hearing impairment; three had other major anomalies; and two had developmental delay. The insertion caused a frameshift, an early truncation, the loss of two putative nuclear localization signals (residues 1404-1420 and 1424-1440), and the loss of coiled coil domain (1406-1426) in treacle protein. These findings support the existence of two regulators of growth of the mandibular condyles. © 2011 John Wiley & Sons A/S.
Bovine Polledness – An Autosomal Dominant Trait with Allelic Heterogeneity
Medugorac, Ivica; Seichter, Doris; Graf, Alexander; Russ, Ingolf; Blum, Helmut; Göpel, Karl Heinrich; Rothammer, Sophie; Förster, Martin; Krebs, Stefan
2012-01-01
The persistent horns are an important trait of speciation for the family Bovidae with complex morphogenesis taking place briefly after birth. The polledness is highly favourable in modern cattle breeding systems but serious animal welfare issues urge for a solution in the production of hornless cattle other than dehorning. Although the dominant inhibition of horn morphogenesis was discovered more than 70 years ago, and the causative mutation was mapped almost 20 years ago, its molecular nature remained unknown. Here, we report allelic heterogeneity of the POLLED locus. First, we mapped the POLLED locus to a ∼381-kb interval in a multi-breed case-control design. Targeted re-sequencing of an enlarged candidate interval (547 kb) in 16 sires with known POLLED genotype did not detect a common allele associated with polled status. In eight sires of Alpine and Scottish origin (four polled versus four horned), we identified a single candidate mutation, a complex 202 bp insertion-deletion event that showed perfect association to the polled phenotype in various European cattle breeds, except Holstein-Friesian. The analysis of the same candidate interval in eight Holsteins identified five candidate variants which segregate as a 260 kb haplotype also perfectly associated with the POLLED gene without recombination or interference with the 202 bp insertion-deletion. We further identified bulls which are progeny tested as homozygous polled but bearing both, 202 bp insertion-deletion and Friesian haplotype. The distribution of genotypes of the two putative POLLED alleles in large semi-random sample (1,261 animals) supports the hypothesis of two independent mutations. PMID:22737241
Li, Zhaoli; Bouckaert, Julie; Deboeck, Francine; De Greve, Henri; Hernalsteens, Jean-Pierre
2012-03-01
NAD and NADP are ubiquitous in the metabolism of Escherichia coli K-12. NAD auxotrophy can be rendered by mutation in any of the three genes nadB, nadA and nadC. The nadB and nadA genes were defined as antivirulence loci in Shigella spp., as a mutation (mainly in nadB) disrupting the synthesis of quinolinate is required for virulence. Uropathogenic E. coli (UPEC) isolates from acute cystitis patients, exhibiting nicotinamide auxotrophy, were of serotype O18 : K1 : H7. E. coli UTI89, the model uropathogenic and O18 : K1 : H7 strain, requires nicotinamide or quinolinate for growth. A mutation in the nadB gene, encoding L-aspartate oxidase, was shown to be responsible for the nicotinamide requirement of UTI89. This was further confirmed by complementation of UTI89 with a recombinant plasmid harbouring the nadB gene of E. coli K-12. An Ala28Val point mutant of the recombinant plasmid failed to support the growth of UTI89 in minimal medium. This proves that the Ala28Val mutation in the NadB gene of UTI89 completely impedes de novo synthesis of nicotinamide. In spontaneous prototrophic revertants of UTI89, the nadB gene has a Val28Ala mutation. Both analyses implicate that the nicotinamide auxotrophy of UTI89 is caused by a single Ala28Val mutation in NadB. We showed that the same mutation is also present in other NAD auxotrophic E. coli O18 strains. No significant differences were observed between the virulence of isogenic NAD auxotrophic and prototrophic strains in the murine ascending urinary tract infection model. Considering these data, we applied the nadB locus as a neutral site for DNA insertions in the bacterial chromosome. We successfully restored the parental phenotype of a fimH mutant by inserting fimH, with a synthetic em7 promoter, into the nadB gene. This neutral insertion site is of significance for further research on the pathogenicity of UPEC.
Sun, Jun-Ren; Perng, Cherng-Lih; Chan, Ming-Chin; Morita, Yuji; Lin, Jung-Chung; Su, Chih-Mao; Wang, Wei-Yao; Chang, Tein-Yao; Chiueh, Tzong-Shi
2012-01-01
Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element. PMID:23166700
Park, Jin Ha; Lee, Jong Seok; Nam, Sang Beom; Ju, Jin Wu
2016-01-01
Purpose Supraglottic airway devices have been widely utilized as an alternative to tracheal intubation in various clinical situations. The rotation technique has been proposed to improve the insertion success rate of supraglottic airways. However, the clinical efficacy of this technique remains uncertain as previous results have been inconsistent, depending on the variable evaluated. Materials and Methods We systematically searched PubMed, Embase, and the Cochrane Central Register of Controlled Trials in April 2015 for randomized controlled trials that compared the rotation and standard techniques for inserting supraglottic airways. Results Thirteen randomized controlled trials (1505 patients, 753 with the rotation technique) were included. The success rate at the first attempt was significantly higher with the rotation technique than with the standard technique [relative risk (RR): 1.13; 95% confidence interval (CI): 1.05 to 1.23; p=0.002]. The rotation technique provided significantly higher overall success rates (RR: 1.06; 95% CI: 1.04 to 1.09; p<0.001). Device insertion was completed faster with the rotation technique (mean difference: -4.6 seconds; 95% CI: -7.37 to -1.74; p=0.002). The incidence of blood staining on the removed device (RR: 0.36; 95% CI: 0.27 to 0.47; p<0.001) was significantly lower with the rotation technique. Conclusion The rotation technique provided higher first-attempt and overall success rates, faster insertion, and a lower incidence of blood on the removed device, reflecting less mucosal trauma. Thus, it may be considered as an alternative to the standard technique when predicting or encountering difficulty in inserting supraglottic airways. PMID:27189296
Mitchell, Michael S; Lee White, Marjorie; King, William D; Wang, Henry E
2012-01-01
Pediatric endotracheal intubation (ETI) is difficult and can have serious adverse events when performed by paramedics in the prehospital setting. Paramedics may use the King Laryngeal Tube airway (KLT) in difficult adult airways, but only limited data describe their application in pediatric patients. To compare paramedic airway insertion speed and complications between KLT and ETI in a simulated model of pediatric respiratory arrest. This prospective, randomized trial included paramedics and senior paramedic students with limited prior KLT experience. We provided brief training on pediatric KLT insertion. Using a random allocation protocol, participants performed both ETI and KLT on a pediatric mannequin (6-month old size) in simulated respiratory arrest. The primary outcomes were 1) elapsed time to successful airway placement (seconds), and 2) proper airway positioning. We compared airway insertion performance between KLT and ETI using the Wilcoxon signed-ranks test. Subjects also indicated their preferred airway device. The 25 subjects included 19 paramedics and 6 senior paramedic students. Two subjects had prior adult KLT experience. Airway insertion time was not statistically different between the KLT (median 27 secs) and ETI (median 31 secs) (p = 0.08). Esophageal intubation occurred in 2 of 25 (8%) ETI. Airway leak occurred in 3 of 25 (12%) KLT, but ventilation remained satisfactory. Eighty-four percent of the subjects preferred the KLT over ETI. Paramedics and paramedic students demonstrated similar airway insertion performance between KLT and ETI in simulated, pediatric respiratory arrest. Most subjects preferred KLT. KLT may provide a viable alternative to ETI in prehospital pediatric airway management.
Naproxen Sodium for Pain Control With Intrauterine Device Insertion: A Randomized Controlled Trial.
Ngo, Lynn L; Braaten, Kari P; Eichen, Eva; Fortin, Jennifer; Maurer, Rie; Goldberg, Alisa B
2016-12-01
To evaluate whether 550 mg oral naproxen sodium given 1 hour before intrauterine device (IUD) insertion is effective for pain relief as compared with placebo. This was a randomized, double-blind, placebo-controlled trial. The primary outcome was pain with IUD insertion measured on a 100-mm visual analog scale (VAS). Our sample size was calculated to detect a 15-mm difference in VAS scores with 80% power (α=0.05). Secondary outcomes included pain with tenaculum placement, uterine sounding, and 5 and 15 minutes postinsertion. A total of 118 women were enrolled and analyzed (58 in the naproxen sodium arm, 60 in the placebo arm, 97% nulliparous) between May 11, 2015, and March 25, 2016. There were no differences in baseline demographics or reproductive characteristics between arms. There were no differences in median VAS pain scores for the primary outcome of pain with IUD insertion between the naproxen sodium arm compared with the placebo arm (69 compared with 66 mm, P=.89). There were no differences in the secondary outcomes of median VAS pain scores with tenaculum placement (37 compared with 32 mm, P=.97) or uterine sounding (60 compared with 58 mm, P=.66). However, median pain scores postprocedure were lower in the naproxen arm as compared with the placebo arm: 17 compared with 26 mm (P=.01) at 5 minutes and 13 compared with 24 mm (P=.01) at 15 minutes postinsertion. Oral naproxen sodium does not reduce pain with IUD insertion but does reduce pain after insertion and should be considered as a premedication. ClinicalTrials.gov, http://clinicaltrials.gov, NCT02388191.
Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T
2006-05-01
Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.
Schebelle, Laura; Wolf, Claudia; Stribl, Carola; Javaheri, Tahereh; Schnütgen, Frank; Ettinger, Andreas; Ivics, Zoltán; Hansen, Jens; Ruiz, Patricia; von Melchner, Harald; Wurst, Wolfgang; Floss, Thomas
2010-01-01
Recombinase-mediated cassette exchange (RMCE) exploits the possibility to unidirectionally exchange any genetic material flanked by heterotypic recombinase recognition sites (RRS) with target sites in the genome. Due to a limited number of available pre-fabricated target sites, RMCE in mouse embryonic stem (ES) cells has not been tapped to its full potential to date. Here, we introduce a universal system, which allows the targeted insertion of any given transcriptional unit into 85 742 previously annotated retroviral conditional gene trap insertions, representing 7013 independent genes in mouse ES cells, by RMCE. This system can be used to express any given cDNA under the control of endogenous trapped promoters in vivo, as well as for the generation of transposon ‘launch pads’ for chromosomal region-specific ‘Sleeping Beauty’ insertional mutagenesis. Moreover, transcription of the gene-of-interest is only activated upon Cre-recombinase activity, a feature that adds conditionality to this expression system, which is demonstrated in vivo. The use of the RMCE system presented in this work requires one single-cloning step followed by one overnight gateway clonase reaction and subsequent cassette exchange in ES cells with efficiencies of 40% in average. PMID:20139417
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
Khitrinskaia, I Iu; Khar'kov, V N; Voevoda, M I; Stepanova, V A
2014-01-01
We for the first time have examined the autosomal gene pool of the Siberia, Central Asian and the Far East populations (27 populations of 12 ethnic groups) using a set of polymorphic Alu insertions in the human genome. The results of the analysis testify (i) to a significant level of genetic diversity in the Northern Eurasian populations and (ii) to a considerable differentiation of gene pool in the population of this region. It has been shown that at the CD4 locus, the frequency of Alu (-) is inversely related to the Mongoloid component of the population, the lowest and highest frequencies of the Alu deletion at locus CD4 were recorded respectively in Eskimo (0.012) and Russian and Ukrainian (0.35). The analysis of gene flow proved Caucasoid populations (Russian, Tajik and Uzbek), as well as those of Turkic ethnic groups from the Southern Siberia (Altaians and Tuvinians) and Khanty and Mansy populations to be the recipients of a considerable gene flow from the outside of the concerned population system, as compared with the East Siberian and the Far East ethnic groups. The results of the correlation analysis received with use polymorphic Alu insertion testify to the greatest correlation of genetic distances with anthropological characteristics of populations.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Selfish DNA in protein-coding genes of Rickettsia.
Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M
2000-10-13
Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.
Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K
2017-10-03
Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.
Deminoff, S. J.; Tornow, J.; Santangelo, G. M.
1995-01-01
The GCR1 gene of Saccharomyces cerevisiae encodes a transcriptional activator that complexes with Rap1p and, through UAS(RPG) elements (Rap1p DNA binding sites), stimulates efficient expression of glycolytic and translational component genes. To map the functionally important domains in Gcr1p, we combined multiple rounds of random mutagenesis in vitro with in vivo selection of functional genes to locate conserved, or hypomutable, regions. We name this method unigenic evolution, a statistical analysis of mutations in evolutionary variants of a single gene in an otherwise isogenic background. Examination of the distribution of 315 mutations in 24 variant alleles allowed the localization of four hypomutable regions in GCR1 (A, B, C, and D). Dispensable N-terminal (intronic) and C-terminal portions of the evolved region of GCR1 were included in the analysis as controls and were, as expected, not hypomutable. The analysis of several insertion, deletion, and point mutations, combined with a comparison of the hypomutability and hydrophobicity plots of Gcr1p, suggested that some of the hypomutable regions may individually or in combination correspond to functionally important surface domains. In particular, we determined that region D contains a putative leucine zipper and is necessary and sufficient for Gcr1p homodimerization. PMID:8601472
Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors
Bii, Victor M.; Trobridge, Grant D.
2016-01-01
Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127
The dam replacing gene product enhances Neisseria gonorrhoeae FA1090 viability and biofilm formation
Kwiatek, Agnieszka; Bacal, Pawel; Wasiluk, Adrian; Trybunko, Anastasiya; Adamczyk-Poplawska, Monika
2014-01-01
Many Neisseriaceae do not exhibit Dam methyltransferase activity and, instead of the dam gene, possess drg (dam replacing gene) inserted in the leuS/dam locus. The drg locus in Neisseria gonorrhoeae FA1090 has a lower GC-pairs content (40.5%) compared to the whole genome of N. gonorrhoeae FA1090 (52%). The gonococcal drg gene encodes a DNA endonuclease Drg, with GmeATC specificity. Disruption of drg or insertion of the dam gene in gonococcal genome changes the level of expression of genes as shown by transcriptome analysis. For the drg-deficient N. gonorrhoeae mutant, a total of 195 (8.94% of the total gene pool) genes exhibited an altered expression compared to the wt strain by at least 1.5 fold. In dam-expressing N. gonorrhoeae mutant, the expression of 240 genes (11% of total genes) was deregulated. Most of these deregulated genes were involved in translation, DNA repair, membrane biogenesis and energy production as shown by cluster of orthologous group analysis. In vivo, the inactivation of drg gene causes the decrease of the number of live neisserial cells and long lag phase of growth. The insertion of dam gene instead of drg locus restores cell viability. We have also shown that presence of the drg gene product is important for N. gonorrhoeae FA1090 in adhesion, including human epithelial cells, and biofilm formation. Biofilm produced by drg-deficient strain is formed by more dispersed cells, compared to this one formed by parental strain as shown by scanning electron and confocal microscopy. Also adherence assays show a significantly smaller biomass of formed biofilm (OD570 = 0.242 ± 0.038) for drg-deficient strain, compared to wild-type strain (OD570 = 0.378 ± 0.057). Dam-expressing gonococcal cells produce slightly weaker biofilm with cells embedded in an extracellular matrix. This strain has also a five times reduced ability for adhesion to human epithelial cells. In this context, the presence of Drg is more advantageous for N. gonorrhoeae biology than Dam presence. PMID:25566225
Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe
2018-05-28
In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.
Chu, C-G; Tan, C T; Yu, G-T; Zhong, S; Xu, S S; Yan, L
2011-12-01
Vernalization genes determine winter/spring growth habit in temperate cereals and play important roles in plant development and environmental adaptation. In wheat (Triticum L. sp.), it was previously shown that allelic variation in the vernalization gene VRN1 was due to deletions or insertions either in the promoter or in the first intron. Here, we report a novel Vrn-B1 allele that has a retrotransposon in its promoter conferring spring growth habit. The VRN-B1 gene was mapped in a doubled haploid population that segregated for winter-spring growth habit but was derived from two spring tetraploid wheat genotypes, the durum wheat (T. turgidum subsp. durum) variety 'Lebsock' and T. turgidum subsp. carthlicum accession PI 94749. Genetic analysis revealed that Lebsock carried the dominant Vrn-A1 and recessive vrn-B1 alleles, whereas PI 94749 had the recessive vrn-A1 and dominant Vrn-B1 alleles. The Vrn-A1 allele in Lebsock was the same as the Vrn-A1c allele previously reported in hexaploid wheat. No differences existed between the vrn-B1 and Vrn-B1 alleles, except that a 5463-bp insertion was detected in the 5'-UTR region of the Vrn-B1 allele. This insertion was a novel retrotransposon (designated as retrotrans_VRN), which was flanked by a 5-bp target site duplication and contained primer binding site and polypurine tract motifs, a 325-bp long terminal repeat, and an open reading frame encoding 1231 amino acids. The insertion of retrotrans_VRN resulted in expression of Vrn-B1 without vernalization. Retrotrans_VRN is prevalent among T. turgidum subsp. carthlicum accessions, less prevalent among T. turgidum subsp. dicoccum accessions, and rarely found in other tetraploid wheat subspecies.
NASA Technical Reports Server (NTRS)
Smeltzer, M. S.; Hart, M. E.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)
1993-01-01
We recently described a Tn551 insertion in the chromosome of Staphylococcus aureus S6C that resulted in drastically reduced expression of extracellular lipase (M. S. Smeltzer, S. R. Gill, and J. J. Iandolo, J. Bacteriol. 174:4000-4006, 1992). The insertion was localized to a chromosomal site (designated omega 1058) distinct from the lipase structural gene (geh) and the accessory gene regulator (agr), both of which were structurally intact in the lipase-negative (Lip-) mutants. In this report, we describe a phenotypic comparison between strains S6C, a hyperproducer of enterotoxin B; KSI9051, a derivative of S6C carrying the Tn551 insertion at omega 1058; ISP546, an 8325-4 strain that carries a Tn551 insertion in the agr locus; and ISP479C, the parent strain of ISP546 cured of the Tn551 delivery plasmid pI258repA36. Compared with their respective parent strains, ISP546 and KSI9051 produced greatly reduced amounts of lipase, alpha-toxin, delta-toxin, protease, and nuclease. KSI9051 also produced reduced amounts of staphylococcal enterotoxin B. Coagulase production was increased in ISP546 but not in KSI9051. Using a mouse model, we also demonstrated that ISP546 and KSI9051 were far less virulent than ISP479C and S6C. We have designated the genetic element defined by the Tn551 insertion at omega 1058 xpr to denote its role as a regulator of extracellular protein synthesis. We conclude that xpr and agr are similar and possibly interactive regulatory genes that play an important role in pathogenesis of staphylococcal disease.
Kato-Inui, Tomoko; Takahashi, Gou; Hsu, Szuyin; Miyaoka, Yuichiro
2018-05-18
Genome editing using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) predominantly induces non-homologous end joining (NHEJ), which generates random insertions or deletions, whereas homology-directed repair (HDR), which generates precise recombination products, is useful for wider applications. However, the factors that determine the ratio of HDR to NHEJ products after CRISPR/Cas9 editing remain unclear, and methods by which the proportion of HDR products can be increased have not yet been fully established. We systematically analyzed the HDR and NHEJ products after genome editing using various modified guide RNAs (gRNAs) and Cas9 variants with an enhanced conformational checkpoint to improve the fidelity at endogenous gene loci in HEK293T cells and HeLa cells. We found that these modified gRNAs and Cas9 variants were able to enhance HDR in both single-nucleotide substitutions and a multi-kb DNA fragment insertion. Our results suggest that the original CRISPR/Cas9 system from the bacterial immune system is not necessarily the best option for the induction of HDR in genome editing and indicate that the modulation of the kinetics of conformational checkpoints of Cas9 can optimize the HDR/NHEJ ratio.
Transposon mutagenesis of Xylella fastidiosa by electroporation of Tn5 synaptic complexes.
Guilhabert, M R; Hoffman, L M; Mills, D A; Kirkpatrick, B C
2001-06-01
Pierce's disease, a lethal disease of grapevine, is caused by Xylella fastidiosa, a gram-negative, xylem-limited bacterium that is transmitted from plant to plant by xylem-feeding insects. Strains of X. fastidiosa also have been associated with diseases that cause tremendous losses in many other economically important plants, including citrus. Although the complete genome sequence of X. fastidiosa has recently been determined, the inability to transform or produce transposon mutants of X. fastidiosa has been a major impediment to understanding pathogen-, plant-, and insect-vector interactions. We evaluated the ability of four different suicide vectors carrying either Tn5 or Tn10 transposons as well as a preformed Tn5 transposase-transposon synaptic complex (transposome) to transpose X. fastidiosa. The four suicide vectors failed to produce any detectable transposition events. Electroporation of transposomes, however, yielded 6 x 10(3) and 4 x 10(3) Tn5 mutants per microg of DNA in two different grapevine strains of X. fastidiosa. Molecular analysis showed that the transposition insertions were single, independent, stable events. Sequence analysis of the Tn5 insertion sites indicated that the transpositions occur randomly in the X. fastidiosa genome. Transposome-mediated mutagenesis should facilitate the identification of X. fastidiosa genes that mediate plant pathogenicity and insect transmission.
A putative regulatory genetic locus modulates virulence in the pathogen Leptospira interrogans.
Eshghi, Azad; Becam, Jérôme; Lambert, Ambroise; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Wunder, Elsio A; Ko, Albert I; Coppee, Jean-Yves; Goarant, Cyrille; Picardeau, Mathieu
2014-06-01
Limited research has been conducted on the role of transcriptional regulators in relation to virulence in Leptospira interrogans, the etiological agent of leptospirosis. Here, we identify an L. interrogans locus that encodes a sensor protein, an anti-sigma factor antagonist, and two genes encoding proteins of unknown function. Transposon insertion into the gene encoding the sensor protein led to dampened transcription of the other 3 genes in this locus. This lb139 insertion mutant (the lb139(-) mutant) displayed attenuated virulence in the hamster model of infection and reduced motility in vitro. Whole-transcriptome analyses using RNA sequencing revealed the downregulation of 115 genes and the upregulation of 28 genes, with an overrepresentation of gene products functioning in motility and signal transduction and numerous gene products with unknown functions, predicted to be localized to the extracellular space. Another significant finding encompassed suppressed expression of the majority of the genes previously demonstrated to be upregulated at physiological osmolarity, including the sphingomyelinase C precursor Sph2 and LigB. We provide insight into a possible requirement for transcriptional regulation as it relates to leptospiral virulence and suggest various biological processes that are affected due to the loss of native expression of this genetic locus.
Deficiencies in the reporting of VD and t1/2 in the FDA approved chemotherapy drug inserts
D’Souza, Malcolm J.; Alabed, Ghada J.
2011-01-01
Since its release in 2006, the US Food and Drug Administration (FDA) final improved format for prescription drug labeling has revamped the comprehensiveness of drug inserts, including chemotherapy drugs. The chemotherapy drug “packets”, retrieved via the FDA website and other accredited drug information reporting agencies such as the Physician Drug Reference (PDR), are practically the only available unbiased summary of information. One objective is to impartially evaluate the reporting of useful pharmacokinetic parameters, in particular, Volume of Distribution (VD) and elimination half-life (t1/2), in randomly selected FDA approved chemotherapy drug inserts. The web-accessible portable document format (PDF) files for 30 randomly selected chemotherapy drugs are subjected to detailed search and the two parameters of interest are tabulated. The knowledge of the two parameters is essential in directing patient care as well as for clinical research and since the completeness of the core FDA recommendations has been found deficient, a detailed explanation of the impact of such deficiencies is provided. PMID:21643531
Bilir, Ayten; Yelken, Birgül; Erkan, Ayse
2013-01-01
Background: Protection of the catheter site by antimicrobial agents is one of the most important factors in the prevention of infection. Povidone iodine and chlorhexidine gluconate are the most common used agents for dressing. The purpose of this study was to compare the effects of povidone iodine, chlorhexidine gluconate and octenidine hydrochloride in preventing catheter related infections. Materials and Methods: Patients were randomized to receive; 4% chlorhexidine gluconate, 10% povidone iodine or octenidine hydrochlorodine for cutaneous antisepsis. Cultures were taken at the site surrounding catheter insertion and at the catheter hub after removal to help identify the source of microorganisms. Results: Catheter related sepsis was 10.5% in the povidone iodine and octenidine hydrochlorodine groups. Catheter related colonization was 26.3% in povidone iodine group and 21.5% in octenidine hydrochlorodine group. Conclusion: 4% chlorhexidine or octenidine hydrochlorodine for cutaneous disinfection before insertion of an intravascular device and for post-insertion site care can reduce the catheter related colonization. PMID:24250702
The expanding universe of transposon technologies for gene and cell engineering.
Ivics, Zoltán; Izsvák, Zsuzsanna
2010-12-07
Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons) can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (sh)RNA expression cassette, a mutagenic gene trap or a therapeutic gene construct) cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB) was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB), discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.
Babenko, Vladimir N; Makunin, Igor V; Brusentsova, Irina V; Belyaeva, Elena S; Maksimov, Daniil A; Belyakin, Stepan N; Maroy, Peter; Vasil'eva, Lyubov A; Zhimulev, Igor F
2010-05-21
Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions compared to the genome average or neighboring regions. In contrast, Minos-based transposons show no paucity in URs but have a strong bias to testis-specific genes. We estimated the suppression level in 2,852 stocks carrying a single P-element by analysis of eye color determined by the mini-white marker gene and demonstrate that the proportion of suppressed transgenes in URs is more than three times higher than in the flanking regions or the genomic average. The suppressed transgenes reside in intergenic, genic or promoter regions of the annotated genes. We speculate that the low insertion frequency of P-elements and piggyBacs in URs partially results from suppression of transgenes that potentially could prevent identification of transgenes due to complete suppression of the marker gene. In a similar manner, the proportion of suppressed transgenes is higher in loci replicating late or very late in Kc cells and these loci have a lower density of P-elements and piggyBac insertions. In transgenes with two marker genes suppression of mini-white gene in eye coincides with suppression of yellow gene in bristles. Our results suggest that the late replication domains have a high inactivation potential apparently linked to the silenced or closed chromatin state in these regions, and that such inactivation potential is largely maintained in different tissues.
Biodegradation of the Organic Disulfide 4,4′-Dithiodibutyric Acid by Rhodococcus spp.
Khairy, Heba; Wübbeler, Jan Hendrik
2015-01-01
Four Rhodococcus spp. exhibited the ability to use 4,4′-dithiodibutyric acid (DTDB) as a sole carbon source for growth. The most important step for the production of a novel polythioester (PTE) using DTDB as a precursor substrate is the initial cleavage of DTDB. Thus, identification of the enzyme responsible for this step was mandatory. Because Rhodococcus erythropolis strain MI2 serves as a model organism for elucidation of the biodegradation of DTDB, it was used to identify the genes encoding the enzymes involved in DTDB utilization. To identify these genes, transposon mutagenesis of R. erythropolis MI2 was carried out using transposon pTNR-TA. Among 3,261 mutants screened, 8 showed no growth with DTDB as the sole carbon source. In five mutants, the insertion locus was mapped either within a gene coding for a polysaccharide deacetyltransferase, a putative ATPase, or an acetyl coenzyme A transferase, 1 bp upstream of a gene coding for a putative methylase, or 176 bp downstream of a gene coding for a putative kinase. In another mutant, the insertion was localized between genes encoding a putative transcriptional regulator of the TetR family (noxR) and an NADH:flavin oxidoreductase (nox). Moreover, in two other mutants, the insertion loci were mapped within a gene encoding a hypothetical protein in the vicinity of noxR and nox. The interruption mutant generated, R. erythropolis MI2 noxΩtsr, was unable to grow with DTDB as the sole carbon source. Subsequently, nox was overexpressed and purified, and its activity with DTDB was measured. The specific enzyme activity of Nox amounted to 1.2 ± 0.15 U/mg. Therefore, we propose that Nox is responsible for the initial cleavage of DTDB into 2 molecules of 4-mercaptobutyric acid (4MB). PMID:26407888
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
2012-01-01
Introduction Catheter-related bloodstream infections (CRBSIs) associated with short-term central venous catheters (CVCs) in intensive care unit (ICU) patients are a major clinical problem. Bacterial colonization of the skin at the CVC insertion site is an important etiologic factor for CRBSI. The aim of this study was to assess the efficacy of medical-grade honey in reducing bacterial skin colonization at insertion sites. Methods A prospective, single-center, open-label randomized controlled trial was performed at the ICU of a university hospital in The Netherlands to assess the efficacy of medical-grade honey to reduce skin colonization of insertion sites. Medical-grade honey was applied in addition to standard CVC-site dressing and disinfection with 0.5% chlorhexidine in 70% alcohol. Skin colonization was assessed on a daily basis before CVC-site disinfection. The primary end point was colonization of insertion sites with >100 colony-forming units at the last sampling before removal of the CVC or transfer of the patient from the ICU. Secondary end points were quantitative levels of colonization of the insertion sites and colonization of insertion sites stratified for CVC location. Results Colonization of insertion sites was not affected by the use of medical-grade honey, as 44 (34%) of 129 and 36 (34%) of 106 patients in the honey and standard care groups, respectively, had a positive skin culture (P = 0.98). Median levels of skin colonization at the last sampling were 1 (0 to 2.84) and 1 (0 to 2.70) log colony-forming units (CFUs)/swab for the honey and control groups, respectively (P = 0.94). Gender, days of CVC placement, CVC location, and CVC type were predictive for a positive skin culture. Correction for these variables did not change the effect of honey on skin-culture positivity. Conclusions Medical-grade honey does not affect colonization of the skin at CVC insertion sites in ICU patients when applied in addition to standard disinfection with 0.5% chlorhexidine in 70% alcohol. Trial registration Netherlands Trial Registry, NTR1652. PMID:23111148
Kwakman, Paulus H; Müller, Marcella C; Binnekade, Jan M; van den Akker, Johannes P; de Borgie, Corianne A; Schultz, Marcus J; Zaat, Sebastian A
2012-10-30
Catheter-related bloodstream infections (CRBSIs) associated with short-term central venous catheters (CVCs) in intensive care unit (ICU) patients are a major clinical problem. Bacterial colonization of the skin at the CVC insertion site is an important etiologic factor for CRBSI. The aim of this study was to assess the efficacy of medical-grade honey in reducing bacterial skin colonization at insertion sites. A prospective, single-center, open-label randomized controlled trial was performed at the ICU of a university hospital in The Netherlands to assess the efficacy of medical-grade honey to reduce skin colonization of insertion sites. Medical-grade honey was applied in addition to standard CVC-site dressing and disinfection with 0.5% chlorhexidine in 70% alcohol. Skin colonization was assessed on a daily basis before CVC-site disinfection. The primary end point was colonization of insertion sites with >100 colony-forming units at the last sampling before removal of the CVC or transfer of the patient from the ICU. Secondary end points were quantitative levels of colonization of the insertion sites and colonization of insertion sites stratified for CVC location. Colonization of insertion sites was not affected by the use of medical-grade honey, as 44 (34%) of 129 and 36 (34%) of 106 patients in the honey and standard care groups, respectively, had a positive skin culture (P = 0.98). Median levels of skin colonization at the last sampling were 1 (0 to 2.84) and 1 (0 to 2.70) log colony-forming units (CFUs)/swab for the honey and control groups, respectively (P = 0.94). Gender, days of CVC placement, CVC location, and CVC type were predictive for a positive skin culture. Correction for these variables did not change the effect of honey on skin-culture positivity. Medical-grade honey does not affect colonization of the skin at CVC insertion sites in ICU patients when applied in addition to standard disinfection with 0.5% chlorhexidine in 70% alcohol. Netherlands Trial Registry, NTR1652.
Methods and compositions for controlling gene expression by RNA processing
Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.
2017-08-29
The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.
Peltan, Ithan D.; Shiga, Takashi; Gordon, James A.; Currier, Paul F.
2015-01-01
Background Simulation training may improve proficiency at and reduces complications from central venous catheter (CVC) placement, but the scope of simulation’s effect remains unclear. This randomized controlled trial evaluated the effects of a pragmatic CVC simulation program on procedural protocol adherence, technical skill, and patient outcomes. Methods Internal medicine interns were randomized to standard training for CVC insertion or standard training plus simulation-based mastery training. Standard training involved a lecture, a video-based online module, and instruction by the supervising physician during actual CVC insertions. Intervention-group subjects additionally underwent supervised training on a venous access simulator until they demonstrated procedural competence. Raters evaluated interns’ performance during internal jugular CVC placement on actual patients in the medical intensive care unit. Generalized estimating equations were used to account for outcome clustering within trainees. Results We observed 52 interns place 87 CVCs. Simulation-trained interns exhibited better adherence to prescribed procedural technique than interns who received only standard training (p=0.024). There were no significant differences detected in first-attempt or overall cannulation success rates, mean needle passes, global assessment scores or complication rates. Conclusions Simulation training added to standard training improved protocol adherence during CVC insertion by novice practitioners. This study may have been too small to detect meaningful differences in venous cannulation proficiency and other clinical outcomes, highlighting the difficulty of patient-centered simulation research in settings where poor outcomes are rare. For high-performing systems, where protocol deviations may provide an important proxy for rare procedural complications, simulation may improve CVC insertion quality and safety. PMID:26154250
Biochemical and genetic analyses of acetoin catabolism in Alcaligenes eutrophus.
Fründ, C; Priefert, H; Steinbüchel, A; Schlegel, H G
1989-01-01
In genetic studies on the catabolism of acetoin in Alcaligenes eutrophus, we used Tn5::mob-induced mutants which were impaired in the utilization of acetoin as the sole carbon source for growth. The transposon-harboring EcoRI restriction fragments from 17 acetoin-negative and slow-growing mutants (class 2a) and from six pleiotropic mutants of A. eutorphus, which were acetoin-negative and did not grow chemolithoautotrophically (class 2b), were cloned from pHC79 gene banks. The insertions of Tn5 were mapped on four different chromosomal EcoRI restriction fragments (A, C, D, and E) in class 2a mutants. The native DNA fragments were cloned from a lambda L47 or from a cosmid gene bank. Evidence is provided that fragments A (21 kilobase pairs [kb]) and C (7.7 kb) are closely linked in the genome; the insertions of Tn5 covered a region of approximately 5 kb. Physiological experiments revealed that this region encodes for acetoin:dichlorophenol-indophenol oxidoreductase, a fast-migrating protein, and probably for one additional protein that is as yet unknown. In mutants which were not completely impaired in growth on acetoin but which grew much slower and after a prolonged lag phase, fragments D (7.2 kb) and E (8.1 kb) were inactivated by insertion of Tn5::mob. No structural gene could be assigned to the D or E fragments. In class 2b mutants, insertions of Tn5 were mapped on fragment B (11.3 kb). This fragment complemented pleiotropic hno mutants in trans; these mutants were impaired in the formation of a rpoN-like protein. The expression of the gene cluster on fragments A and C seemed to be rpoN dependent. PMID:2556366
Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan
2015-07-01
To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
[Analysis of ethnogeographic groups of Kazakhs based on nuclear genome DNA polymorphism].
Salimova, A Z; Kutuev, I A; Khusainova, R I; Akhmetova, V L; Sviatova, G S; Berezina, G M; Khusnutdinova, E K
2005-07-01
Eight nuclear DNA loci, including six Alu insertions (ACE, APOA1, PV92, TPA25, Ya5NBC27, and Ya5NBC148), 32-bp deletion in the CCR5 gene, and VNTR locus at the eNOS gene, were examined in three ethnogeographic groups of Kazakhs (342 individuals). The individuals examined lived in southeastern, central, and southwestern regions of Kazakhstan, and according to their tribal attribution, belonged to the Senior, Middle, and Junior Zhuzes. The Alu insertions appeared to be polymorphic in all populations examined: the insertion frequency varied from 0.264 in the populations of the Senior and Middle Zhuzes at the Ya5NBC27 and Ya5NBC148 loci, to 0.827 in Kazakhs of the Middle Zhuz at the APOA1 locus. In Kazakh groups examined only two alleles of the eNOS VNTR locus were detected with the number of repeats constituting four (A) and five (B) copies. The highest frequency of A allele was found in Kazakhs from the Junior Zhuz (0.113), while the highest frequency of B allele was detected in population of the Senior Zhuz (0.893). The frequency of the 32-bp deletion in the chemokine receptor CCR5 gene varied from 0.027 in the Junior Zhuz to 0.045 in the Senior Zhuz. Kazakhs showed high genetic diversity (Hex = 0.376). In general, in three ethnogeographic groups of Kazakhs, the coefficient of gene differentiation (G(ST)) over eight diallelic markers of nuclear genome constituted 1.1%. The differences in the Alu insertions made the highest contribution to the among-population diversity (G(ST) = 1.2%).
Kahle, Maximilian; Ter Beek, Josy; Hosler, Jonathan P; Ädelroth, Pia
2018-06-03
Bacterial NO reductases (NOR) catalyze the reduction of NO into N 2 O, either as a step in denitrification or as a detoxification mechanism. cNOR from Paracoccus (P.) denitrificans is expressed from the norCBQDEF operon, but only the NorB and NorC proteins are found in the purified NOR complex. Here, we established a new purification method for the P. denitrificans cNOR via a His-tag using heterologous expression in E. coli. The His-tagged enzyme is both structurally and functionally very similar to non-tagged cNOR. We were also able to express and purify cNOR from the structural genes norCB only, in absence of the accessory genes norQDEF. The produced protein is a stable NorCB complex containing all hemes and it can bind gaseous ligands (CO) to heme b 3 , but it is catalytically inactive. We show that this deficient cNOR lacks the non-heme iron cofactor Fe B . Mutational analysis of the nor gene cluster revealed that it is the norQ and norD genes that are essential to form functional cNOR. NorQ belongs to the family of MoxR P-loop AAA+ ATPases, which are in general considered to facilitate enzyme activation processes often involving metal insertion. Our data indicates that NorQ and NorD work together in order to facilitate non-heme Fe insertion. This is noteworthy since in many cases Fe cofactor binding occurs spontaneously. We further suggest a model for NorQ/D-facilitated metal insertion into cNOR. Copyright © 2018 Elsevier B.V. All rights reserved.
Reverse genetics of Newcastle disease virus
USDA-ARS?s Scientific Manuscript database
Reverse genetics allows the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique allows genetic manipulation and cloning of viral genomes, mutation through site-directed mutagenesis, and gene insertion or deletion, among othe...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solera, J.; Magallon, M.; Martin-Villar, J.
1992-02-01
DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less
Fléchard, Maud; Gilot, Philippe
2014-07-01
We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.
Letsou, Anthea; Liskay, R. Michael
1987-01-01
With the intent of further exploring the nature of gene conversion in mammalian cells, we systematically addressed the effects of the molecular nature of mutation on the efficiency of intrachromosomal gene conversion in cultured mouse cells. Comparison of conversion rates revealed that all mutations studied were suitable substrates for gene conversion; however, we observed that the rates at which different mutations converted to wild-type could differ by two orders of magnitude. Differences in conversion rates were correlated with the molecular nature of the mutations. In general, rates of conversion decreased with increasing size of the molecular lesions. In comparisons of conversion rates for single base pair insertions and deletions we detected a genotype-directed path for conversion, by which an insertion was converted to wild-type three to four times more efficiently than was a deletion which maps to the same site. The data are discussed in relation to current theories of gene conversion, and are consistent with the idea that gene conversion in mammalian cells can result from repair of heteroduplex DNA (hDNA) intermediates. PMID:2828159
Khan, Imran A; Jahan, Parveen; Hasan, Qurratulain; Rao, Pragna
2014-12-01
Gestational diabetes mellitus (GDM) is defined as glucose intolerance first recognized during pregnancy. Insertion/deletion (I/D) polymorphism of a 287 bp Alu repetitive sequence in intron 16 of the angiotensin-converting enzyme (ACE) gene has been widely investigated in Asian Indian populations with different ethnic origins. The present study examined possible association between I/D polymorphism of the ACE gene and GDM in Asian Indian pregnant women. A total of 200 pregnant women (100 GDM and 100 non-GDM) were recruited in this study and I/D polymorphism of a 287 bp Alu1 element inside intron 16 of the ACE gene was examined by polymerase chain reaction (PCR)-based gel electrophoresis. The distribution of the variants like II, ID, and DD genotypes of ACE gene showed differences between normal GDM versus non-GDM subjects, and the frequency of the ID+ DD Vs II genotype was significant (p=0.0002) in the GDM group. ACE gene polymorphism was associated with GDM in Asian Indian pregnant women. © The Author(s) 2013.
Validation of a Projection-domain Insertion of Liver Lesions into CT Images
Chen, Baiyu; Ma, Chi; Leng, Shuai; Fidler, Jeff L.; Sheedy, Shannon P.; McCollough, Cynthia H.; Fletcher, Joel G.; Yu, Lifeng
2016-01-01
Rationale and Objectives The aim of this study was to validate a projection-domain lesion-insertion method with observer studies. Materials and Methods A total of 51 proven liver lesions were segmented from computed tomography images, forward projected, and inserted into patient projection data. The images containing inserted and real lesions were then reconstructed and examined in consensus by two radiologists. First, 102 lesions (51 original, 51 inserted) were viewed in a randomized, blinded fashion and scored from 1 (absolutely inserted) to 10 (absolutely real). Statistical tests were performed to compare the scores for inserted and real lesions. Subsequently, a two-alternative-forced-choice test was conducted, with lesions viewed in pairs (real vs. inserted) in a blinded fashion. The radiologists selected the inserted lesion and provided a confidence level of 1 (no confidence) to 5 (completely certain). The number of lesion pairs that were incorrectly classified was calculated. Results The scores for inserted and proven lesions had the same median (8) and similar interquartile ranges (inserted, 5.5–8; real, 6.5–8). The means scores were not significantly different between real and inserted lesions (P value = 0.17). The receiver operating characteristic curve was nearly diagonal, with an area under the curve of 0.58 ± 0.06. For the two-alternative-forced-choice study, the inserted lesions were incorrectly identified in 49% (25 out of 51) of pairs; radiologists were incorrect in 38% (3 out of 8) of pairs even when they felt very confident in identifying the inserted lesion (confidence level ≥4). Conclusions Radiologists could not distinguish between inserted and real lesions, thereby validating the lesion-insertion technique, which may be useful for conducting virtual clinical trials to optimize image quality and radiation dose. PMID:27432267
Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.
Kline, E L; Chiang, S J; Lattora, D; Chaung, W
1992-02-01
We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.
Li, Zhuo; Mooney, Alaina J.; Gabbard, Jon D.; Gao, Xiudan; Xu, Pei; Place, Ryan J.; Hogan, Robert J.; Tompkins, S. Mark
2013-01-01
A safe and effective vaccine is the best way to prevent large-scale highly pathogenic avian influenza virus (HPAI) H5N1 outbreaks in the human population. The current FDA-approved H5N1 vaccine has serious limitations. A more efficacious H5N1 vaccine is urgently needed. Parainfluenza virus 5 (PIV5), a paramyxovirus, is not known to cause any illness in humans. PIV5 is an attractive vaccine vector. In our studies, a single dose of a live recombinant PIV5 expressing a hemagglutinin (HA) gene of H5N1 (rPIV5-H5) from the H5N1 subtype provided sterilizing immunity against lethal doses of HPAI H5N1 infection in mice. Furthermore, we have examined the effect of insertion of H5N1 HA at different locations within the PIV5 genome on the efficacy of a PIV5-based vaccine. Interestingly, insertion of H5N1 HA between the leader sequence, the de facto promoter of PIV5, and the first viral gene, nucleoprotein (NP), did not lead to a viable virus. Insertion of H5N1 HA between NP and the next gene, V/phosphorprotein (V/P), led to a virus that was defective in growth. We have found that insertion of H5N1 HA at the junction between the small hydrophobic (SH) gene and the hemagglutinin-neuraminidase (HN) gene gave the best immunity against HPAI H5N1 challenge: a dose as low as 1,000 PFU was sufficient to protect against lethal HPAI H5N1 challenge in mice. The work suggests that recombinant PIV5 expressing H5N1 HA has great potential as an HPAI H5N1 vaccine. PMID:23077314
A Forward Genetic Screening for Prostate Cancer Progression Genes
2012-10-01
sequence reads. For verifying the prevalence of insertions in tumors, PCR was performed on genomic DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science
Improve homology search sensitivity of PacBio data by correcting frameshifts.
Du, Nan; Sun, Yanni
2016-09-01
Single-molecule, real-time sequencing (SMRT) developed by Pacific BioSciences produces longer reads than secondary generation sequencing technologies such as Illumina. The long read length enables PacBio sequencing to close gaps in genome assembly, reveal structural variations, and identify gene isoforms with higher accuracy in transcriptomic sequencing. However, PacBio data has high sequencing error rate and most of the errors are insertion or deletion errors. During alignment-based homology search, insertion or deletion errors in genes will cause frameshifts and may only lead to marginal alignment scores and short alignments. As a result, it is hard to distinguish true alignments from random alignments and the ambiguity will incur errors in structural and functional annotation. Existing frameshift correction tools are designed for data with much lower error rate and are not optimized for PacBio data. As an increasing number of groups are using SMRT, there is an urgent need for dedicated homology search tools for PacBio data. In this work, we introduce Frame-Pro, a profile homology search tool for PacBio reads. Our tool corrects sequencing errors and also outputs the profile alignments of the corrected sequences against characterized protein families. We applied our tool to both simulated and real PacBio data. The results showed that our method enables more sensitive homology search, especially for PacBio data sets of low sequencing coverage. In addition, we can correct more errors when comparing with a popular error correction tool that does not rely on hybrid sequencing. The source code is freely available at https://sourceforge.net/projects/frame-pro/ yannisun@msu.edu. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Maria Marin, Anelis; de la Torre, Jésus; Ricardo Marques Oliveira, Alfredo; Barison, Andersson; Satie Chubatsu, Leda; Adele Monteiro, Rose; de Oliveira Pedrosa, Fabio; Maltempi de Souza, Emanuel; Wassem, Roseli; Duque, Estrella; Ramos, Juan-Luis
2016-12-01
In this study, a random mutant library of Herbaspirillum seropedicae SmR1 was constructed by Tn5 insertion and a mutant incapable of utilizing naringenin as a carbon source was isolated. The Tn5 transposon was found to be inserted in the fdeE gene (Hsero_1007), which encodes a monooxygenase. Two other mutant strains in fdeC (Hsero_1005) and fdeG (Hsero_1009) genes coding for a dioxygenase and a putative cyclase, respectively, were obtained by site-directed mutagenesis and then characterized. Liquid Chromatography coupled to mass spectrometry (LC-MS)/MS analyses of culture supernatant from the fdeE mutant strain revealed that naringenin remained unaltered, suggesting that the FdeE protein is involved in the initial step of naringenin degradation. LC-MS/MS analyses of culture supernatants from the wild-type (SmR1) and FdeC deficient mutant suggested that in H. seropedicae SmR1 naringenin is first mono-oxygenated by the FdeE protein, to produce 5,7,8-trihydroxy-2-(4-hydroxyphenyl)-2,3-dihydro-4H-chromen-4-one, that is subsequently dioxygenated and cleaved at the A-ring by the FdeC dioxygenase, since the latter compound accumulated in the fdeC strain. After meta-cleavage of the A-ring, the subsequent metabolic steps generate oxaloacetic acid that is metabolized via the tricarboxylic acid cycle. This bacterium can also modify naringenin by attaching a glycosyl group to the B-ring or a methoxy group to the A-ring, leading to the generation of dead-end products. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Singh, Amit Kumar; Suryanarayanan, Bhaskar; Choudhary, Ajay; Prasad, Akhila; Singh, Sachin; Gupta, Laxmi Narayan
2014-01-01
Chronic subdural hematoma (CSDH) recurs after surgical evacuation in 5-30% of patients. Inserting subdural drain might reduce the recurrence rate, but is not commonly practiced. There are few prospective studies to evaluate the effect of subdural drains. A prospective randomized study to investigate the effect of subdural drains in the on recurrence rates and clinical outcome following burr-hole drainage (BHD) of CSDH was undertaken. During the study period, 246 patients with CSDH were assessed for eligibility. Among 200 patients fulfilling the eligibility criteria, 100 each were assigned to "drain group" (drain inserted into the subdural space following BHD) and "without drain group" (subdural drain was not inserted following BHD) using random allocation software. The primary end point was recurrence needing re-drainage up to a period of 6 months from surgery. Recurrence occurred in 9 of 100 patients with a drain, and 26 of 100 patients in without drain group (P = 0.002). The mortality was 5% in patients with drain and 4% in patients without drain group (P = 0.744). The medical and surgical complications were comparable between the two study groups. Use of a subdural drain after burr-hole evacuation of a CSDH reduces the recurrence rate and is not associated with increased complications.
Yeo, Caitlin T; Ungi, Tamas; U-Thainual, Paweena; Lasso, Andras; McGraw, Robert C; Fichtinger, Gabor
2011-07-01
The purpose of this study was to determine if augmented reality image overlay and laser guidance systems can assist medical trainees in learning the correct placement of a needle for percutaneous facet joint injection. The Perk Station training suite was used to conduct and record the needle insertion procedures. A total of 40 volunteers were randomized into two groups of 20. 1) The Overlay group received a training session that consisted of four insertions with image and laser guidance, followed by two insertions with laser overlay only. 2) The Control group received a training session of six classical freehand insertions. Both groups then conducted two freehand insertions. The movement of the needle was tracked during the series of insertions. The final insertion procedure was assessed to determine if there was a benefit to the overlay method compared to the freehand insertions. The Overlay group had a better success rate (83.3% versus 68.4%, p=0.002), and potential for less tissue damage as measured by the amount of needle movement inside the phantom (3077.6 mm(2) versus 5607.9 mm(2) , p =0.01). These results suggest that an augmented reality overlay guidance system can assist medical trainees in acquiring technical competence in a percutaneous needle insertion procedure. © 2011 IEEE
In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library
Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul
2005-01-01
The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642
Norman, Wendy V; Kaczorowski, Janusz; Soon, Judith A; Brant, Rollin; Bryan, Stirling; Trouton, Konia J; Dicus, Lyda
2011-06-14
We describe the rationale and protocol for a randomized controlled trial (RCT) to assess whether intrauterine contraception placed immediately after a second trimester abortion will result in fewer pregnancies than current recommended practice of intended placement at 4 weeks post-abortion. Decision analysis suggests the novel strategy could substantially reduce subsequent unintended pregnancies and abortions. This paper highlights considerations of design, implementation and evaluation of a trial expected to provide rigorous evidence for appropriate insertion timing and health economics of intrauterine contraception after second trimester abortion. Consenting women choosing to use intrauterine contraception after abortion for a pregnancy of 12 to 24 weeks will be randomized to insertion timing groups either immediately (experimental intervention) or four weeks (recommended care) post abortion. Primary outcome measure is pregnancy rate at one year. Secondary outcomes include: cumulative pregnancy rates over five year follow-up period, comprehensive health economic analyses comparing immediate and delayed insertion groups, and device retention rates, complication rates (infection, expulsion) and, contraceptive method satisfaction. Web-based Contraception Satisfaction Questionnaires, clinical records and British Columbia linked health databases will be used to assess primary and secondary outcomes. Enrolment at all clinics in the province performing second trimester abortions began in May 2010 and is expected to complete in late 2011. Data on one year outcomes will be available for analysis in 2014. The RCT design combined with access to clinical records at all provincial abortion clinics, and to information in provincial single-payer linked administrative health databases, birth registry and hospital records, offers a unique opportunity to evaluate such an approach by determining pregnancy rate at one through five years among enrolled women. We highlight considerations of design, implementation and evaluation of a trial expected to provide rigorous evidence for appropriate insertion timing and health economics of intrauterine contraception after second trimester abortion.
2011-01-01
Background We describe the rationale and protocol for a randomized controlled trial (RCT) to assess whether intrauterine contraception placed immediately after a second trimester abortion will result in fewer pregnancies than current recommended practice of intended placement at 4 weeks post-abortion. Decision analysis suggests the novel strategy could substantially reduce subsequent unintended pregnancies and abortions. This paper highlights considerations of design, implementation and evaluation of a trial expected to provide rigorous evidence for appropriate insertion timing and health economics of intrauterine contraception after second trimester abortion. Methods/Design Consenting women choosing to use intrauterine contraception after abortion for a pregnancy of 12 to 24 weeks will be randomized to insertion timing groups either immediately (experimental intervention) or four weeks (recommended care) post abortion. Primary outcome measure is pregnancy rate at one year. Secondary outcomes include: cumulative pregnancy rates over five year follow-up period, comprehensive health economic analyses comparing immediate and delayed insertion groups, and device retention rates, complication rates (infection, expulsion) and, contraceptive method satisfaction. Web-based Contraception Satisfaction Questionnaires, clinical records and British Columbia linked health databases will be used to assess primary and secondary outcomes. Enrolment at all clinics in the province performing second trimester abortions began in May 2010 and is expected to complete in late 2011. Data on one year outcomes will be available for analysis in 2014. Discussion The RCT design combined with access to clinical records at all provincial abortion clinics, and to information in provincial single-payer linked administrative health databases, birth registry and hospital records, offers a unique opportunity to evaluate such an approach by determining pregnancy rate at one through five years among enrolled women. We highlight considerations of design, implementation and evaluation of a trial expected to provide rigorous evidence for appropriate insertion timing and health economics of intrauterine contraception after second trimester abortion. Trial registration Current Controlled Trials ISRCTN19506752 PMID:21672213
Lopez-Gil, M; Brimacombe, J; Garcia, G
2005-12-01
We tested the hypothesis that ease of insertion, oropharyngeal leak pressure, fibreoptic position, gastric insufflation, and the frequency of mucosal trauma differ between the ProSeal laryngeal mask airway (PLMA) and the classic laryngeal mask airway (cLMA) in anaesthetized children. For the PLMA, we also assessed the ease of gastric tube placement via the PLMA drain tube and measure residual gastric volume. 240 consecutive ASA I-III children aged 1-16 yr were randomized for airway management with the ProSeal or cLMA. The time taken to provide an effective airway, the number of insertion attempts, fibreoptic position of the airway tube and frequency of mucosal trauma were similar, but oropharyngeal leak pressure was higher (33 vs 26 cm H(2)O, P<0.0001) and gastric insufflation less common (0 vs 6%, P<0.01) for the PLMA. Gastric tube insertion was successful at the first attempt in 106 of 120, and at the second attempt in 14 of 120. The mean (sd; range) value for residual gastric volume was 2.2 (5.9; 0-30) ml. There were no differences in performance among sizes for the PLMA and the cLMA. We conclude that ease of insertion, fibreoptic position, and frequency of mucosal trauma are similar for the PLMA and cLMA in children, but oropharyngeal leak pressure is higher and gastric insufflation less common for the PLMA. Gastric tube insertion has a high success rate, provided the PLMA is correctly positioned.
Guy, Lionel; Nystedt, Björn; Toft, Christina; Zaremba-Niedzwiedzka, Katarzyna; Berglund, Eva C.; Granberg, Fredrik; Näslund, Kristina; Eriksson, Ann-Sofie; Andersson, Siv G. E.
2013-01-01
Gene transfer agents (GTAs) randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes. PMID:23555299
Guy, Lionel; Nystedt, Björn; Toft, Christina; Zaremba-Niedzwiedzka, Katarzyna; Berglund, Eva C; Granberg, Fredrik; Näslund, Kristina; Eriksson, Ann-Sofie; Andersson, Siv G E
2013-03-01
Gene transfer agents (GTAs) randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes.
Braga, Giordana Campos; Ferriolli, Eduardo; Quintana, Silvana Maria; Ferriani, Rui Alberto; Pfrimer, Karina; Vieira, Carolina Sales
2015-12-01
Breast milk volume has never been evaluated when the etonogestrel (ENG) implant was inserted immediately postpartum. Thus, this study evaluated if the immediate postpartum insertion of the ENG implant alters breast milk volume. Twenty-four postpartum women and their newborns (NBs) were randomized into two groups: Implant group (ENG implant inserted within 48 h after delivery) and Control group (absence of contraceptive method). The primary outcome was the amount of breast milk intake by the NBs in the first 6 weeks after delivery. Five and ten grams of deuterium (D(2)O) were orally administered to the postpartum women on the day of randomization (day 0) and on the 29th study day, respectively. Saliva samples were collected from the mother-NB pairs prior to each D(2)O dose administration and after D(2)O ingestion (periodic collection). The amount of breast milk ingested by the NBs was estimated by the amount of deuterium (D(2)O) ingested by the NBs through breastfeeding, using mass spectrometry in the saliva samples. Twenty-four postpartum women and their NB were randomized (12 per group). The median of breast milk intake by NBs following the two D(2)O doses were similar between groups {first D(2)O dose [Implant: 340 mL/day (240-420 mL/day) vs. 330 mL/day (300-530 mL/day), p=.54]; second D(2)O dose [Implant: 845 mL/day (770-980 mL/day) vs. 785 mL/day (680-980 mL/day), p=.63]}. The exclusive breastfeeding rate and NB weight were similar between groups in the first 6 weeks postpartum. ENG implant insertion immediately postpartum does not alter the volume of breast milk intake by NBs. Considering the benefits of immediate postpartum initiation of ENG implant on reducing unintended pregnancy and pregnancy recurrence, especially in vulnerable populations, our study adds safety data on breastfeeding effect of this practice. Copyright © 2015 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Objectives: Newcastle disease virus (NDV), a member of the Paramxoviridae family, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU...
Mechanism for DNA transposons to generate introns on genomic scales
Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.
2017-01-01
Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113
Endogenous Retroviruses: With Us and Against Us
NASA Astrophysics Data System (ADS)
Meyer, Thomas J.; Rosenkrantz, Jimi L.; Carbone, Lucia; Chavez, Shawn L.
2017-04-01
Mammalian genomes are scattered with thousands of copies of endogenous retroviruses (ERVs), mobile genetic elements that are relics of ancient retroviral infections. After inserting copies into the germ line of a host, most ERVs accumulate mutations that prevent the normal assembly of infectious viral particles, becoming trapped in host genomes and unable to leave to infect other cells. While most copies of ERVs are inactive, some are transcribed and encode the proteins needed to generate new insertions at novel loci. In some cases, old copies are removed via recombination and other mechanisms. This creates a shifting landscape of ERV copies within host genomes. New insertions can disrupt normal expression of nearby genes via directly inserting into key regulatory elements or by containing regulatory motifs within their sequences. Further, the transcriptional silencing of ERVs via epigenetic modification may result in changes to the epigenetic regulation of adjacent genes. In these ways, ERVs can be potent sources of regulatory disruption as well as genetic innovation. Here, we provide a brief review of the association between ERVs and gene expression, especially as observed in pre-implantation development and placentation. Moreover, we will describe the roles ERVs may play in somatic tissues, mostly in the context of human disease, including cancer, neurodegenerative disorders, and schizophrenia. Lastly, we discuss the recent discovery that some ERVs may have been pressed into the service of their host genomes to aid in the innate immune response to exogenous viral infections.
Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping
2018-01-01
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.
Papanikolaou, Eleni; Paruzynski, Anna; Kasampalidis, Ioannis; Deichmann, Annette; Stamateris, Evangelos; Schmidt, Manfred; von Kalle, Christof; Anagnou, Nicholas P
2015-01-01
Gene therapy utilizing lentiviral-vectors (LVs) is postulated as a dynamic therapeutic alternative for monogenic diseases. However, retroviral gene transfer may cause insertional mutagenesis. Although, such risks had been originally estimated as extremely low, several reports of leukemias or clonal dominance, have led to a re-evaluation of the mechanisms operating in insertional mutagenesis. Therefore, unraveling the mechanism of retroviral integration is mandatory toward safer gene therapy applications. In the present study, we undertook an experimental approach which enabled direct correlation of the cell cycle stage of the target cell with the integration profile of LVs. CD34+ cells arrested at different stages of cell cycle, were transduced with a GFP-LV. LAM-PCR was employed for integration site detection, followed by microarray analysis to correlate transcribed genes with integration sites. The results indicate that ~10% of integration events occurred in actively transcribed genes and that the cell cycle stage of target cells affects integration pattern. Specifically, use of thymine promoted a safer profile, since it significantly reduced integration within cell cycle-related genes, while we observed increased possibility for integration into genes related to development, and decreased possibility for integration within cell cycle and cancer-related genes, when transduction occurs during mitosis. PMID:25523760
NASA Technical Reports Server (NTRS)
Torrejon, Marcela; Li, Erica; Nguyen, Minh; Winfree, Seth; Wang, Esther; Reinsch, Sigrid; Dalton, Bonnie (Technical Monitor)
2002-01-01
Sensitivity to gravity is essential for spatial orientation. Consequently, the gravity receptor system is one of the phylogenetically oldest sensory systems, and the special adaptations that enhance sensitivity to gravity are highly conserved. The main goal of this project is to use Xenopus (frog) to identify genes expressed during vestibular and auditory development. These studies will lead a better understanding of the molecular mechanisms involved in vestibular and auditory development and function. We are using a gene-trap approach in Xenopus tropicalis with the green fluorescent protein (GFP) gene as the transgene reporter. GFP expression occurs only when the GFP gene is correctly integrated in actively transcribed genes. Using the GFP as a tag we can easily identify and clone the mutated gene. In addition, we can study the function of the mutated gene by analyzing the defects generated by insertion of the GFP transgene. To date we have tissue specific GFP expression in X. tropicalis including expression in ear, neural tube, kidney, muscle, eyes and nose. Our transgenic animals will soon reach maturity so that we can outcross them and analyze their progeny. Our next goal is to isolate RNA from our transgenics and clone the tagged genes using RACE-PCR. Currently we are optimizing the RACE-PCR method using transgenics with crystallin GFP expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gong, Y.; Li, X.M.; Shapiro, L.J.
1994-09-01
Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less
Gilling, Damian H; Luna, Vicki Ann; Pflugradt, Cori
2014-01-01
The etiologic agents for melioidosis and glanders, Burkholderia mallei and Burkholderia pseudomallei respectively, are genetically similar making identification and differentiation from other Burkholderia species and each other challenging. We used pyrosequencing to determine the presence or absence of an insertion sequence IS407A within the flagellin P (fliP) gene and to exploit the difference in orientation of this gene in the two species. Oligonucleotide primers were designed to selectively target the IS407A-fliP interface in B. mallei and the fliP gene specifically at the insertion point in B. pseudomallei. We then examined DNA from ten B. mallei, ten B. pseudomallei, 14 B. cepacia, eight other Burkholderia spp., and 17 other bacteria. Resultant pyrograms encompassed the target sequence that contained either the fliP gene with the IS407A interruption or the fully intact fliP gene with 100% sensitivity and 100% specificity. These pyrosequencing assays based upon a single gene enable investigators to reliably identify the two species. The information obtained by these assays provides more knowledge of the genomic reduction that created the new species B. mallei from B. pseudomallei and may point to new targets that can be exploited in the future.
Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.
2016-01-01
The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289
NASA Astrophysics Data System (ADS)
Woo, Sun Young; Lee, Hwankyu
2016-03-01
Peptides E and K, which are synthetic coiled-coil peptides for membrane fusion, were simulated with lipid bilayers composed of lipids and cholesterols at different ratios using all-atom models. We first calculated free energies of binding from umbrella sampling simulations, showing that both E and K peptides tend to adsorb onto the bilayer surface, which occurs more strongly in the bilayer composed of smaller lipid headgroups. Then, unrestrained simulations show that K peptides more deeply insert into the bilayer with partially retaining the helical structure, while E peptides less insert and predominantly become random coils, indicating the structural transition from helices to random coils, in quantitative agreement with experiments. This is because K peptides electrostatically interact with lipid phosphates, as well as because hydrocarbons of lysines of K peptide are longer than those of glutamic acids of E peptide and thus form stronger hydrophobic interactions with lipid tails. This deeper insertion of K peptide increases the bilayer dynamics and a vacancy below the peptide, leading to the rearrangement of smaller lipids. These findings help explain the experimentally observed or proposed differences in the insertion depth, binding strength, and structural transition of E and K peptides, and support the snorkeling effect.
Woo, Sun Young; Lee, Hwankyu
2016-03-01
Peptides E and K, which are synthetic coiled-coil peptides for membrane fusion, were simulated with lipid bilayers composed of lipids and cholesterols at different ratios using all-atom models. We first calculated free energies of binding from umbrella sampling simulations, showing that both E and K peptides tend to adsorb onto the bilayer surface, which occurs more strongly in the bilayer composed of smaller lipid headgroups. Then, unrestrained simulations show that K peptides more deeply insert into the bilayer with partially retaining the helical structure, while E peptides less insert and predominantly become random coils, indicating the structural transition from helices to random coils, in quantitative agreement with experiments. This is because K peptides electrostatically interact with lipid phosphates, as well as because hydrocarbons of lysines of K peptide are longer than those of glutamic acids of E peptide and thus form stronger hydrophobic interactions with lipid tails. This deeper insertion of K peptide increases the bilayer dynamics and a vacancy below the peptide, leading to the rearrangement of smaller lipids. These findings help explain the experimentally observed or proposed differences in the insertion depth, binding strength, and structural transition of E and K peptides, and support the snorkeling effect.
Mok, Hoyin; Cheng, Xing; Xu, Qi; Zengel, James R; Parhy, Bandita; Zhao, Jackie; Wang, C. Kathy; Jin, Hong
2012-01-01
Live attenuated recombinant measles vaccine virus (MV) Edmonston-Zagreb (EZ) strain was evaluated as a viral vector to express the ectodomains of fusion protein of respiratory syncytial virus (RSV F) or glycoprotein 350 of Epstein-Barr virus (EBV gp350) as candidate vaccines for prophylaxis of RSV and EBV. The glycoprotein gene was inserted at the 1st or the 3rd position of the measles virus genome and the recombinant viruses were generated. Insertion of the foreign gene at the 3rd position had a minimal impact on viral replication in vitro. RSV F or EBV gp350 protein was secreted from infected cells. In cotton rats, EZ-RSV F and EZ-EBV gp350 induced MV- and insert-specific antibody responses. In addition, both vaccines also induced insert specific interferon gamma (IFN-γ) secreting T cell response. EZ-RSV F protected cotton rats from pulmonary replication of RSV A2 challenge infection. In rhesus macaques, although both EZ-RSV F and EZ-EBV gp350 induced MV specific neutralizing antibody responses, only RSV F specific antibody response was detected. Thus, the immunogenicity of the foreign antigens delivered by measles vaccine virus is dependent on the nature of the insert and the animal models used for vaccine evaluation. PMID:22383906
Kim, Hee-Sook; Park, Sung Hee; Günzl, Arthur; Cross, George A. M.
2013-01-01
Trypanosoma brucei variant surface glycoprotein (VSG) expression is a classic example of allelic exclusion. While the genome of T. brucei contains >2,000 VSG genes and VSG pseudogenes, only one allele is expressed at the surface of each infectious trypanosome and the others are repressed. Along with recombinatorial VSG switching, allelic exclusion provides a major host evasion mechanism for trypanosomes, a phenomenon known as antigenic variation. To extend our understanding of how trypanosomes escape host immunity by differential expression of VSGs, we attempted to identify genes that contribute to VSG silencing, by performing a loss-of-silencing screen in T. brucei using a transposon-mediated random insertional mutagenesis. One identified gene, which we initially named LOS1, encodes a T. brucei MCM-Binding Protein (TbMCM-BP). Here we show that TbMCM-BP is essential for viability of infectious bloodstream-form (BF) trypanosome and is required for proper cell-cycle progression. Tandem affinity purification of TbMCM-BP followed by mass spectrometry identified four subunits (MCM4-MCM7) of the T. brucei MCM complex, a replicative helicase, and MCM8, a subunit that is uniquely co-purified with TbMCM-BP. TbMCM-BP is required not only for repression of subtelomeric VSGs but also for silencing of life-cycle specific, insect-stage genes, procyclin and procyclin-associated genes (PAGs), that are normally repressed in BF trypanosomes and are transcribed by RNA polymerase I. Our study uncovers a functional link between chromosome maintenance and RNA pol I-mediated gene silencing in T. brucei. PMID:23451133
Jeong, Young-Hee; Kim, Yeong Ji; Kim, Eun Young; Kim, Se Eun; Kim, Jiwoo; Park, Min Jee; Lee, Hong-Gu; Park, Se Pill; Kang, Man-Jong
2016-06-01
Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.
Dou, Yafeng; Wang, Xiaolan; Yu, Guijing; Wang, Shaohui; Tian, Mingxing; Qi, Jingjing; Li, Tao; Ding, Chan; Yu, Shengqing
2017-02-06
Riemerella anatipestifer is an important pathogen that causes septicemia anserum exsudativa in ducks. Lipopolysaccharide (LPS) is considered to be a major virulence factor of R. anatipestifer. To identify genes involved in LPS biosynthesis, we screened a library of random Tn4351 transposon mutants using a monoclonal antibody against R. anatipestifer serotype 1 LPS (anti-LPS MAb). A mutant strain RA1067 which lost the reactivity in an indirect ELISA was obtained. Southern blot and sequencing analyses indicated a single Tn4351 was inserted at 116 bp in the M949_RS01915 gene in the RA1067 chromosomal DNA. Silver staining and Western blot analyses indicated that the RA1067 LPS was defected compared to the wild-type strain CH3 LPS. The RA1067 displayed a significant decreased growth rate at the late stage of growth in TSB in comparison with CH3. In addition, RA1067 showed higher susceptibility to complement-dependent killing, more than 360-fold attenuated virulence based on the median lethal dose determination, increased bacterial adhesion and invasion capacities to Vero cells and significantly decreased blood bacterial loads in RA1067 infected ducks, when compared to the CH3. An animal experiment indicated that inactivated RA1067 cells was effective in cross-protecting of the ducks from challenging with R. anatipestifer strains WJ4 (serotype 1), Yb2 (serotype 2) and HXb2 (serotype 10), further confirming the alteration of the RA1067 antigenicity. Moreover, RNA-Seq analysis and real-time PCR verified two up-regulated and three down-regulated genes in RA1067. Our findings demonstrate that the M949_RS01915 gene is associated to bacterial antigenicity, pathogenicity and gene regulation of R. anatipestifer.
Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen
2007-01-01
We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...
USDA-ARS?s Scientific Manuscript database
Prophage insertions in Escherichia coli O157:H7 mlrA contribute to the low expression of curli fimbriae and biofilm observed in many clinical isolates. Varying levels of CsgD-dependent curli/biofilm expression are restored to strains bearing prophage insertions in mlrA by mutation of regulatory gene...
Origin of mitochondria by intracellular enslavement of a photosynthetic purple bacterium
Cavalier-Smith, Thomas
2006-01-01
Mitochondria originated by permanent enslavement of purple non-sulphur bacteria. These endosymbionts became organelles through the origin of complex protein-import machinery and insertion into their inner membranes of protein carriers for extracting energy for the host. A chicken-and-egg problem exists: selective advantages for evolving import machinery were absent until inner membrane carriers were present, but this very machinery is now required for carrier insertion. I argue here that this problem was probably circumvented by conversion of the symbiont protein-export machinery into protein-import machinery, in three phases. I suggest that the first carrier entered the periplasmic space via pre-existing β-barrel proteins in the bacterial outer membrane that later became Tom40, and inserted into the inner membrane probably helped by a pre-existing inner membrane protein, thereby immediately providing the protoeukaryote host with photosynthesate. This would have created a powerful selective advantage for evolving more efficient carrier import by inserting Tom70 receptors. Massive gene transfer to the nucleus inevitably occurred by mutation pressure. Finally, pressure from harmful, non-selected gene transfer to the nucleus probably caused evolution of the presequence mechanism, and photosynthesis was lost. PMID:16822756
Transposable elements and insecticide resistance.
Rostant, Wayne G; Wedell, Nina; Hosken, David J
2012-01-01
Transposable elements (TEs) are mobile DNA sequences that are able to copy themselves within a host genome. They were initially characterized as selfish genes because of documented or presumed costs to host fitness, but it has become increasingly clear that not all TEs reduce host fitness. A good example of TEs benefiting hosts is seen with insecticide resistance, where in a number of cases, TE insertions near specific genes confer resistance to these man-made products. This is particularly true of Accord and associated TEs in Drosophila melanogaster and Doc insertions in Drosophila simulans. The first of these insertions also has sexually antagonistic fitness effects in the absence of insecticides, and although the magnitude of this effect depends on the genetic background in which Accord finds itself, this represents an excellent example of intralocus sexual conflict where the precise allele involved is well characterized. We discuss this finding and the role of TEs in insecticide resistance. We also highlight areas for further research, including the need for surveys of the prevalence and fitness consequences of the Doc insertion and how Drosophila can be used as models to investigate resistance in pest species. Copyright © 2012 Elsevier Inc. All rights reserved.
Clinical effectiveness of lidocaine and benzocaine for topical anesthesia.
Rosa, A. L.; Sverzut, C. E.; Xavier, S. P.; Lavrador, M. A.
1999-01-01
The effectiveness of lidocaine and benzocaine in reducing pain produced by needle insertion into the palate was evaluated in a double-blind and placebo-controlled study using a more suitable method. Twenty subjects, 10 men and 10 women, submitted to 4 sessions in which they were randomly treated with 5% lidocaine, a placebo that tasted like lidocaine, 20% benzocaine, and a placebo that tasted like benzocaine. At each session, a 27-gauge needle was inserted into the palate twice, once before (baseline) and once after drug application for 1 minute. Immediately after each insertion, subjects indicated on a visual analog scale the pain intensity perceived. Lidocaine and benzocaine were equally efficient, and both were better than placebo in reducing pain caused by insertion of needles into the palate. PMID:11692349
NASA Astrophysics Data System (ADS)
Korotkov, E. V.; Korotkova, M. A.
2017-01-01
The purpose of this study was to detect latent periodicity in the presence of deletions or insertions in the analyzed data, when the points of deletions or insertions are unknown. A mathematical method was developed to search for periodicity in the numerical series, using dynamic programming and random matrices. The developed method was applied to search for periodicity in the Euro/Dollar (Eu/) exchange rate, since 2001. The presence of periodicity within the period length equal to 24 h in the analyzed financial series was shown. Periodicity can be detected only with insertions and deletions. The results of this study show that periodicity phase shifts, depend on the observation time. The reasons for the existence of the periodicity in the financial ranks are discussed.
Hognert, Helena; Kopp Kallner, Helena; Cameron, Sharon; Nyrelli, Christina; Jawad, Izabella; Heller, Rebecca; Aronsson, Annette; Lindh, Ingela; Benson, Lina; Gemzell-Danielsson, Kristina
2016-11-01
Does a progestin releasing subdermal contraceptive implant affect the efficacy of medical abortion if inserted at the same visit as the progesterone receptor modulator, mifepristone, at medical abortion? A etonogestrel releasing subdermal implant inserted on the day of mifepristone did not impair the efficacy of the medical abortion compared with routine insertion at 2-4 weeks after the abortion. The etonogestrel releasing subdermal implant is one of the most effective long acting reversible contraceptive methods. The effect of timing of placement on the efficacy of mifepristone and impact on prevention of subsequent unintended pregnancy is not known. This multicentre, randomized controlled, equivalence trial with recruitment between 13 October 2013 and 17 October 2015 included a total of 551 women with pregnancies below 64 days gestation opting for the etonogestrel releasing subdermal implant as postabortion contraception. Women were randomized to either insertion at 1 hour after mifepristone intake (immediate) or at follow-up 2-4 weeks later (delayed insertion). An equivalence design was used due to advantages for women such as fewer visits to the clinic with immediate insertion. The primary outcome was the percentage of women with complete abortion not requiring surgical intervention within 1 month. Secondary outcomes included insertion rates, pregnancy and repeat abortion rates during 6 months follow-up. Analysis was per protocol and by intention to treat. Women aged 18 years and older who had requested medical termination of a pregnancy up to 63 days of gestation and opted for an etonogestrel releasing contraceptive implant were recruited in outpatient family planning clinics in six hospitals in Sweden and Scotland. Efficacy of medical abortion was 259/275 (94.2%) in the immediate insertion group and 239/249 (96%) in the routine insertion group with a risk difference of 1.8% (95% CI -0.4 to 4.1%), which was within the ±5% margin of equivalence. The insertion rate was 275/277 (98.9%) in the immediate group compared to 187/261 (71.6%) women in the routine group (P < 0.001). At 6 months of follow-up significantly fewer women in the immediate group had become pregnant again (2/277, 0.8%) compared to the routine group (10/261, 3.8%) P = 0.018. For the main outcome loss to follow-up data was minimized through access to patient records. Efforts were made to reduce loss to follow-up also for secondary outcomes. The results of the sensitivity analysis did not differ from the intention to treat or per protocol analysis. Guidelines on postabortion contraception should be amended to include insertion of the etonogestrel releasing implant at the time of mifepristone intake for medical abortion up to and including a gestation of 63 days. This study was funded by the Swedish Research Council (2012-2844), Stockholm City County and Karolinska Institutet (ALF). The contraceptive implants were provided by Merck and supplied by MSD Sweden. HKK and KGD have received honorariums for giving lectures for MSD/Merck and have participated in the national (HKK and KGD) and international (KGD) medical advisory boards for MSD/Merck. The other authors have nothing to declare. ClinicalTrials number NCT01920022. 06 August 2013. 13 October 2013. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-01-01
Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384
Wang, Guodong; Ellendorff, Ursula; Kemp, Ben; Mansfield, John W.; Forsyth, Alec; Mitchell, Kathy; Bastas, Kubilay; Liu, Chun-Ming; Woods-Tör, Alison; Zipfel, Cyril; de Wit, Pierre J.G.M.; Jones, Jonathan D.G.; Tör, Mahmut; Thomma, Bart P.H.J.
2008-01-01
Receptor-like proteins (RLPs) are cell surface receptors that typically consist of an extracellular leucine-rich repeat domain, a transmembrane domain, and a short cytoplasmatic tail. In several plant species, RLPs have been found to play a role in disease resistance, such as the tomato (Solanum lycopersicum) Cf and Ve proteins and the apple (Malus domestica) HcrVf2 protein that mediate resistance against the fungal pathogens Cladosporium fulvum, Verticillium spp., and Venturia inaequalis, respectively. In addition, RLPs play a role in plant development; Arabidopsis (Arabidopsis thaliana) TOO MANY MOUTHS (TMM) regulates stomatal distribution, while Arabidopsis CLAVATA2 (CLV2) and its functional maize (Zea mays) ortholog FASCINATED EAR2 regulate meristem maintenance. In total, 57 RLP genes have been identified in the Arabidopsis genome and a genome-wide collection of T-DNA insertion lines was assembled. This collection was functionally analyzed with respect to plant growth and development and sensitivity to various stress responses, including susceptibility toward pathogens. A number of novel developmental phenotypes were revealed for our CLV2 and TMM insertion mutants. In addition, one AtRLP gene was found to mediate abscisic acid sensitivity and another AtRLP gene was found to influence nonhost resistance toward Pseudomonas syringae pv phaseolicola. This genome-wide collection of Arabidopsis RLP gene T-DNA insertion mutants provides a tool for future investigations into the biological roles of RLPs. PMID:18434605
Cuenca, María Del Sol; Molina-Santiago, Carlos; Gómez-García, María R; Ramos, Juan L
2016-03-01
Biological production in heterologous hosts is of interest for the production of the C4 alcohol (butanol) and other chemicals. However, some hurdles need to be overcome in order to achieve an economically viable process; these include avoiding the consumption of butanol and maintaining tolerance to this solvent during production. Pseudomonas putida is a potential host for solvent production; in order to further adapt P. putida to this role, we generated mini-Tn5 mutant libraries in strain BIRD-1 that do not consume butanol. We analyzed the insertion site of the mini-Tn5 in a mutant that was deficient in assimilation of butanol using arbitrary PCR followed by Sanger sequencing and found that the transposon was inserted in the malate synthase B gene. Here, we show that in a second round of mutagenesis a double mutant unable to take up butanol had an insertion in a gene coding for a multisensor hybrid histidine kinase. The genetic context of the histidine kinase sensor revealed the presence of a set of genes potentially involved in butanol assimilation; qRT-PCR analysis showed induction of this set of genes in the wild type and the malate synthase mutant but not in the double mutant. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
de Matos, Christiano J S; de S Menezes, Leonardo; Brito-Silva, Antônio M; Martinez Gámez, M A; Gomes, Anderson S L; de Araújo, Cid B
2007-10-12
We investigate the effects of two-dimensional confinement on the lasing properties of a classical random laser system operating in the incoherent feedback (diffusive) regime. A suspension of 250 nm rutile (TiO2) particles in a rhodamine 6G solution was inserted into the hollow core of a photonic crystal fiber generating the first random fiber laser and a novel quasi-one-dimensional random laser geometry. A comparison with similar systems in bulk format shows that the random fiber laser presents an efficiency that is at least 2 orders of magnitude higher.
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard
2013-01-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863
Chrcanovic, Bruno Ramos; Albrektsson, Tomas; Wennerberg, Ann
2015-01-01
To test the null hypothesis of no difference in the implant failure rates, postoperative infection and marginal bone loss for the insertion of dental implants in fresh extraction sockets compared to the insertion in healed sites, against the alternative hypothesis of a difference. Main search terms used in combination: dental implant, oral implant, resh extraction socket, immediate placement, immediate insertion, immediate implant. An electronic search was undertaken in July/2014, in PubMed, Web of Science, Cochrane Oral Health Group Trials Register plus hand-searching. Eligibility criteria included clinical human studies, either randomized or not. The search strategy resulted in 73 publications, with 8,241 implants inserted in sockets (330 failures, 4.00%), and 19,410 in healed sites (599 failures, 3.09%). It is suggested that the insertion of implants in fresh extraction sockets affects the failure rates (RR 1.58, 95% CI 1.27-1.95, P<0.0001). The difference was not statistically significant when studies evaluating implants inserted in maxillae or in mandibles were pooled, or when the studies using implants to rehabilitate patients with full-arch prostheses were pooled; however, it was significant for the studies that rehabilitated patients with implant-supported single crowns and for the controlled studies. There was no apparent significant effect on the occurrence of postoperative infection or on the magnitude of marginal bone loss. The results should be interpreted with caution due to the potential for biases and to the presence of uncontrolled confounding factors in the included studies, most of them not randomized. The question whether immediate implants are more at risk for failure than implants placed in mature bone has received increasing attention in the last years. As the philosophies of treatment alter over time, a periodic review of the different concepts is necessary to refine techniques and eliminate unnecessary procedures. This would form a basis for optimum treatment. Copyright © 2014 Elsevier Ltd. All rights reserved.
Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.
Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E
2003-11-01
We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.
Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen
2013-01-01
The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.
Molecular biology. Mothers setting boundaries.
Thorvaldsen, J L; Bartolomei, M S
2000-06-23
Certain genes are only expressed at one allele, a phenomenon called imprinting. Although it is well established that one allele of certain imprinted genes is silenced through methylation, this does not appear to be the case for all imprinted genes. In a thoughtful Perspective, Thorvaldsen and Bartolomei discuss new findings showing that insertion of insulator elements (boundary regions) between the promoter of a gene and its enhancer (a sequence that boosts gene expression) may be another way in which genes are silenced during imprinting.
hisT is part of a multigene operon in Escherichia coli K-12.
Marvel, C C; Arps, P J; Rubin, B C; Kammen, H O; Penhoet, E E; Winkler, M E
1985-01-01
The Escherichia coli K-12 hisT gene has been cloned, and its organization and expression have been analyzed on multicopy plasmids. The hisT gene, which encodes tRNA pseudouridine synthase I (PSUI), was isolated on a Clarke-Carbon plasmid known to contain the purF gene. The presence of the hisT gene on this plasmid was suggested by its ability to restore both production of PSUI enzymatic activity and suppression of amber mutations in a hisT mutant strain. A 2.3-kilobase HindIII-ClaI restriction fragment containing the hisT gene was subcloned into plasmid pBR322, and the resulting plasmid (designated psi 300) was mapped with restriction enzymes. Complementation analysis with different kinds of hisT mutations and tRNA structural analysis confirmed that plasmid psi 300 contained the hisT structural gene. Enzyme assays showed that plasmid psi 300 overproduced PSUI activity by ca. 20-fold compared with the wild-type level. Subclones containing restriction fragments from plasmid psi 300 inserted downstream from the lac promoter established that the hisT gene is oriented from the HindIII site toward the ClaI site. Other subclones and derivatives of plasmid psi 300 containing insertion or deletion mutations were constructed and assayed for production of PSUI activity and production of proteins in minicells. These experiments showed that: (i) the proximal 1.3-kilobase HindIII-BssHII restriction fragment contains a promoter for the hisT gene and encodes a 45,000-dalton polypeptide that is not PSUI; (ii) the distal 1.0-kilobase BssHII-ClaI restriction fragment encodes the 31,000-dalton PSUI polypeptide; (iii) the 45,000-dalton polypeptide is synthesized in an approximately eightfold excess compared with PSUI; and (iv) synthesis of the two polypeptides is coupled, suggesting that the two genes are part of an operon. Insertion of mini-Mu d1 (lac Km) phage into plasmid psi 300 confirmed that the hisT gene is the downstream gene in the operon. Images PMID:2981810
Short and long-term genome stability analysis of prokaryotic genomes.
Brilli, Matteo; Liò, Pietro; Lacroix, Vincent; Sagot, Marie-France
2013-05-08
Gene organization dynamics is actively studied because it provides useful evolutionary information, makes functional annotation easier and often enables to characterize pathogens. There is therefore a strong interest in understanding the variability of this trait and the possible correlations with life-style. Two kinds of events affect genome organization: on one hand translocations and recombinations change the relative position of genes shared by two genomes (i.e. the backbone gene order); on the other, insertions and deletions leave the backbone gene order unchanged but they alter the gene neighborhoods by breaking the syntenic regions. A complete picture about genome organization evolution therefore requires to account for both kinds of events. We developed an approach where we model chromosomes as graphs on which we compute different stability estimators; we consider genome rearrangements as well as the effect of gene insertions and deletions. In a first part of the paper, we fit a measure of backbone gene order conservation (hereinafter called backbone stability) against phylogenetic distance for over 3000 genome comparisons, improving existing models for the divergence in time of backbone stability. Intra- and inter-specific comparisons were treated separately to focus on different time-scales. The use of multiple genomes of a same species allowed to identify genomes with diverging gene order with respect to their conspecific. The inter-species analysis indicates that pathogens are more often unstable with respect to non-pathogens. In a second part of the text, we show that in pathogens, gene content dynamics (insertions and deletions) have a much more dramatic effect on genome organization stability than backbone rearrangements. In this work, we studied genome organization divergence taking into account the contribution of both genome order rearrangements and genome content dynamics. By studying species with multiple sequenced genomes available, we were able to explore genome organization stability at different time-scales and to find significant differences for pathogen and non-pathogen species. The output of our framework also allows to identify the conserved gene clusters and/or partial occurrences thereof, making possible to explore how gene clusters assembled during evolution.
Laasik, Eve; Ojarand, Merli; Pajunen, Maria; Savilahti, Harri; Mäe, Andres
2005-02-01
As in Erwinia carotovora subsp. carotovora the regulation details of the main virulence factors, encoding extracellular enzymes that degrade the plant cell wall, is only rudimentally understood, we performed a genetic screen to identify novel candidate genes involved in the process. Initially, we used Mu transpososome-mediated mutagenesis approach to generate a comprehensive transposon insertion mutant library of ca. 10000 clones and screened the clones for the loss of extracellular enzyme production. Extracellular enzymes production was abolished by mutations in the chromosomal helEcc, trkAEcc yheLEcc, glsEcc, igaAEcc and cysQEcc genes. The findings reported here demonstrate that we have isolated six new representatives that belong to the pool of genes modulating the production of virulence factors in E. carotovora.
Gause, Maria; Morcillo, Patrick; Dorsett, Dale
2001-01-01
The Drosophila mod(mdg4) gene products counteract heterochromatin-mediated silencing of the white gene and help activate genes of the bithorax complex. They also regulate the insulator activity of the gypsy transposon when gypsy inserts between an enhancer and promoter. The Su(Hw) protein is required for gypsy-mediated insulation, and the Mod(mdg4)-67.2 protein binds to Su(Hw). The aim of this study was to determine whether Mod(mdg4)-67.2 is a coinsulator that helps Su(Hw) block enhancers or a facilitator of activation that is inhibited by Su(Hw). Here we provide evidence that Mod(mdg4)-67.2 acts as a coinsulator by showing that some loss-of-function mod(mdg4) mutations decrease enhancer blocking by a gypsy insert in the cut gene. We find that the C terminus of Mod(mdg4)-67.2 binds in vitro to a region of Su(Hw) that is required for insulation, while the N terminus mediates self-association. The N terminus of Mod(mdg4)-67.2 also interacts with the Chip protein, which facilitates activation of cut. Mod(mdg4)-67.2 truncated in the C terminus interferes in a dominant-negative fashion with insulation in cut but does not significantly affect heterochromatin-mediated silencing of white. We infer that multiple contacts between Su(Hw) and a Mod(mdg4)-67.2 multimer are required for insulation. We theorize that Mod(mdg4)-67.2 usually aids gene activation but can also act as a coinsulator by helping Su(Hw) trap facilitators of activation, such as the Chip protein. PMID:11416154
Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei
2006-11-01
To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.
Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro
2015-11-18
RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.
Goulin, Eduardo Henrique; Savi, Daiani Cristina; Petters, Desirrê Alexia Lourenço; Kava, Vanessa; Galli-Terasawa, Lygia; Silva, Geraldo José; Glienke, Chirlei
2016-11-01
Phyllosticta citricarpa is the epidemiological agent of Citrus Black Spot (CBS) disease, which is responsible for large economic losses worldwide. CBS is characterized by the presence of spores (pycnidiospores) in dark lesions of fruit, which are also responsible for short distance dispersal of the disease. The identification of genes involved in asexual reproduction of P. citricarpa can be an alternative for directional disease control. We analyzed a library of mutants obtained through Agrobacterium tumefaciens transformation system, looking for alterations in growth and reproductive structure formation. Two mutant strains were found to have lost the ability to form pycnidia. The flanking T-DNA insertion regions were identified on P. citricarpa genome by using blast analysis and further gene prediction. The predicted genes containing the T-DNA insertions were identified as Spindle Poison Sensitivity Scp3, Ion Transport protein, and Cullin Binding proteins. The Ion Transport and Cullin Binding proteins are known to be correlated with sexual and asexual reproduction in fungi; however, the exact mechanism by which these proteins act on spore formation in P. citricarpa needs to be better characterized. The Scp3 proteins are suggested here for the first time as being associated with asexual reproduction in fungus. This protein is associated with microtubule formation, and as microtubules play an essential role as spindle machinery for chromosome segregation and cytokinesis, insertions in this gene can lead to abnormal formations, such as that observed here in P. citricarpa. We suggest these genes as new targets for fungicide development and CBS disease control, by iRNA. Copyright © 2016 Elsevier GmbH. All rights reserved.
Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena
2016-01-01
ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816
Human Alu insertion polymorphisms in North African populations.
Cherni, Loth; Frigi, Sabeh; Ennafaa, Hajer; Mtiraoui, Nabil; Mahjoub, Touhami; Benammar-Elgaaied, Amel
2011-10-01
Several features make Alu insertions a powerful tool used in population genetic studies: the polymorphic nature of many Alu insertions, the stability of an Alu insertion event and, furthermore, the ancestral state of an Alu insertion is known to be the absence of the Alu element at a particular locus and the presence of an Alu insertion at the site that forward mutational change. This study analyses seven Alu insertion polymorphisms in a sample of 297 individuals from the autochthonous population of Tunisia (Thala, Smar, Zarzis, and Bou Salem) and Libya with the aim of studying their genetic structure with respect to the populations of North Africa, Western, Eastern and Central Europe. The comparative analyses carried out using the MDS and AMOVA methods reveal the existence of spatial heterogeneity, and identify four population groups. Study populations (Libya, Smar, Zarzis, and Bou Salem) are closest to North African populations whereas Thala is isolated and is closest to Western European populations. In conclusion, Results of the present study support the important role that migratory movements have played in the North African gene pool, at least since the Neolithic period.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langlois, S.; Kastelein, J.J.; Hayden, M.R.
1989-02-01
Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less
van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T
2012-07-01
Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.
Resources for Biological Annotation of the Drosophila Genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gerald M. Rubin
2005-08-08
This project supported seed money for the development of cDNA and genetic resources to support studies of the Drosophila melanogaster genome. Key publications supported by this work that provide additional detail: (1) ''The Drosophila gene collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes''; and (2) ''The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes''.
Hoang, Ky Van; Wang, Ying; Lin, Jun
2012-01-01
Antimicrobial peptides (AMPs) are critical components of host defense limiting bacterial infections at the gastrointestinal mucosal surface. Bacterial pathogens have co-evolved with host innate immunity and developed means to counteract the effect of endogenous AMPs. However, molecular mechanisms of AMP resistance in Campylobacter, an important human food-borne pathogen with poultry as a major reservoir, are still largely unknown. In this study, random transposon mutagenesis and targeted site-directed mutagenesis approaches were used to identify genetic loci contributing Campylobacter resistance to fowlicidin-1, a chicken AMP belonging to cathelicidin family. An efficient transposon mutagenesis approach (EZ::TN™
Genetic resources offer efficient tools for rice functional genomics research.
Lo, Shuen-Fang; Fan, Ming-Jen; Hsing, Yue-Ie; Chen, Liang-Jwu; Chen, Shu; Wen, Ien-Chie; Liu, Yi-Lun; Chen, Ku-Ting; Jiang, Mirng-Jier; Lin, Ming-Kuang; Rao, Meng-Yen; Yu, Lin-Chih; Ho, Tuan-Hua David; Yu, Su-May
2016-05-01
Rice is an important crop and major model plant for monocot functional genomics studies. With the establishment of various genetic resources for rice genomics, the next challenge is to systematically assign functions to predicted genes in the rice genome. Compared with the robustness of genome sequencing and bioinformatics techniques, progress in understanding the function of rice genes has lagged, hampering the utilization of rice genes for cereal crop improvement. The use of transfer DNA (T-DNA) insertional mutagenesis offers the advantage of uniform distribution throughout the rice genome, but preferentially in gene-rich regions, resulting in direct gene knockout or activation of genes within 20-30 kb up- and downstream of the T-DNA insertion site and high gene tagging efficiency. Here, we summarize the recent progress in functional genomics using the T-DNA-tagged rice mutant population. We also discuss important features of T-DNA activation- and knockout-tagging and promoter-trapping of the rice genome in relation to mutant and candidate gene characterizations and how to more efficiently utilize rice mutant populations and datasets for high-throughput functional genomics and phenomics studies by forward and reverse genetics approaches. These studies may facilitate the translation of rice functional genomics research to improvements of rice and other cereal crops. © 2015 John Wiley & Sons Ltd.
Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas
Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.
2010-01-01
Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734
Kim, Min-Soo; Lee, Jae Hoon; Han, Sang Won; Im, Young Jae; Kang, Hyo Jong; Lee, Jeong-Rim
2015-04-01
Supraglottic airway devices with noninflatable cuff have advantages in omitting the cuff pressure monitoring and reducing potential pharyngolaryngeal complications. Typical devices without cuff inflation available in children are the i-gel and the self-pressurized air-Q intubating laryngeal airway (air-Q SP). To date, there is no comparative study between these devices in pediatric patients. The purpose of this randomized study was to compare the i-gel(™) and the self-pressurized air-Q(™) intubating laryngeal airway (air-Q SP) in children undergoing general anesthesia. Eighty children, 1-108 months of age, 7-30 kg of weight, and scheduled for elective surgery in which supraglottic airway devices would be suitable for airway management, were randomly assigned to either the i-gel or the air-Q SP. Oropharyngeal leak pressure and fiberoptic view were assessed three times as follows: after insertion and fixation of the device, 10 min after initial assessment, and after completion of surgery. We also assessed insertion parameters and complications. Insertion of the i-gel was regarded as significantly easier compared to the air-Q SP (P = 0.04). Compared to the air-Q SP group, the i-gel group had significantly higher oropharyngeal leak pressures at all measurement points and significantly lower frequencies of gastric insufflation at 10 min after initial assessment and completion of surgery. The air-Q SP group had better fiberoptic views than the i-gel group at all measurement points. Our results showed that the i-gel had easier insertion and better sealing function, and the air-Q SP provided improved fiberoptic views in children requiring general anesthesia. © 2015 John Wiley & Sons Ltd.
Vasavada, Abhay R; Johar, Kaid; Praveen, Mamidipudi R; Vasavada, Viraj A; Arora, Anshul I
2013-04-01
To compare changes in the incision's histomorphology and denaturation of collagen I in rabbit eyes having microcoaxial phacoemulsification through 2.2 mm and 1.8 mm incision-compatible systems. Randomized experimental trial. Iladevi Cataract & IOL Research Centre, Ahmedabad, India. Thirty rabbit eyes were randomized into Group 1 (microcoaxial phacoemulsification through 2.2 mm incisions using Infiniti system [torsional ultrasound]) and Group 2 (microcoaxial phacoemulsification through 1.8 mm incisions using Stellaris system [longitudinal ultrasound]). Each group was then divided into 3 subgroups of 5 eyes each based on 1 of the 3 intervention options: phacoemulsification only, intraocular lens (IOL) insertion only, and phacoemulsification with IOL insertion. Left eyes were randomized for microcoaxial phacoemulsification, and right eyes were treated as controls. After phacoemulsification, eyes in Group 1 showed loss of epithelium at the roof of the incisions and Descemet membrane detachment at the floor of the incisions. These findings did not change after IOL insertion. After phacoemulsification, eyes in Group 2 showed loss of epithelium, but Descemet membrane remained attached. There was a longitudinal split in the incision's stroma in the direction of internal entry. The stromal damage increased after IOL implantation. Immunofluorescence studies showed no obvious irregularities in the arrangement of collagen I in either group. A dot blot analysis showed significant denaturation of collagen I in Group 2. The histomorphology of the 2.2 mm system incision showed localized Descemet membrane detachment and endothelial cell loss. The 1.8 mm system incision showed exaggerated stromal damage after IOL insertion. Copyright © 2013 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Fu, Yang; Waldor, Matthew K.; Mekalanos, John J.
2014-01-01
SUMMARY Analysis of genes required for host infection will provide clues to the drivers of evolutionary fitness of pathogens like Vibrio cholerae, a mounting threat to global heath. We used transposon insertion site sequencing (Tn-seq) to comprehensively assess the contribution of nearly all V. cholerae genes toward growth in the infant rabbit intestine. Four hundred genes were identified as critical to V. cholerae in vivo fitness. These included most known colonization factors and several new genes affecting the bacterium's metabolic properties, resistance to bile, and ability to synthesize cyclic AMP-GMP. Notably, a mutant carrying an insertion in tsiV3, encoding immunity to a bacteriocidal type VI secretion system (T6SS) effector VgrG3, exhibited a colonization defect. The reduced in vivo fitness of tsiV3 mutants depends on their cocolonization with bacterial cells carrying an intact T6SS locus and VgrG3 gene, suggesting that the V. cholerae T6SS is functional and mediates antagonistic interbacterial interactions during infection. PMID:24331463
Weyer, U; Possee, R D
1991-12-01
A baculovirus transfer vector, pAcUW3, was developed to facilitate the insertion of two influenza virus genes, those encoding the haemagglutinin (HA) and neuraminidase (NA) membrane glycoproteins, into the Autographa californica nuclear polyhedrosis virus genome in a single cotransfection experiment. The NA gene was inserted in place of the polyhedrin coding sequences under the control of the polyhedrin promoter, whereas the HA gene was placed under the control of a copy of the p10 promoter at a site upstream of and in opposite orientation to the polyhedrin promoter. After infection of Spodoptera frugiperda cells with the recombinant virus, AcUW3HANA, both HA and NA were expressed in the very late phase of infection and were shown to be functional in appropriate assays. Immunofluorescence assays demonstrated their localization at the surface of infected insect cells. The expression of both foreign genes in the recombinant virus was found to be stable for at least 12 passages in cell culture.
Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.
Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W
2001-06-01
A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.
Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven
2011-07-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.
Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven
2011-01-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997
Copertino, D W; Christopher, D A; Hallick, R B
1991-01-01
The splicing of a 409 nucleotide intron from the Euglena gracilis chloroplast ribosomal protein S3 gene (rps3) was examined by cDNA cloning and sequencing, and northern hybridization. Based on the characterization of a partially spliced pre-mRNA, the intron was characterized as a 'mixed' twintron, composed of a 311 nucleotide group II intron internal to a 98 nucleotide group III intron. Twintron excision is via a 2-step sequential splicing pathway, with removal of the internal group II intron preceding excision of the external group III intron. Based on secondary structural analysis of the twintron, we propose that group III introns may represent highly degenerate versions of group II introns. The existence of twintrons is interpreted as evidence that group II introns were inserted during the evolution of Euglena chloroplast genes from a common ancestor with eubacteria, archaebacteria, cyanobacteria, and other chloroplasts. Images PMID:1721702
Heme and menaquinone induced electron transport in lactic acid bacteria.
Brooijmans, Rob; Smit, Bart; Santos, Filipe; van Riel, Jan; de Vos, Willem M; Hugenholtz, Jeroen
2009-05-29
For some lactic acid bacteria higher biomass production as a result of aerobic respiration has been reported upon supplementation with heme and menaquinone. In this report, we have studied a large number of species among lactic acid bacteria for the existence of this trait. Heme- (and menaquinone) stimulated aerobic growth was observed for several species and genera of lactic acid bacteria. These include Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacilllus brevis, Lactobacillus paralimentarius, Streptococcus entericus and Lactococcus garviae. The increased biomass production without further acidification, which are respiration associated traits, are suitable for high-throughput screening as demonstrated by the screening of 8000 Lactococcus lactis insertion mutants. Respiration-negative insertion-mutants were found with noxA, bd-type cytochrome and menaquinol biosynthesis gene-disruptions. Phenotypic screening and in silico genome analysis suggest that respiration can be considered characteristic for certain species. We propose that the cyd-genes were present in the common ancestor of lactic acid bacteria, and that multiple gene-loss events best explains the observed distribution of these genes among the species.
Hsu, Cary; Jones, Stephanie A.; Cohen, Cyrille J.; Zheng, Zhili; Kerstann, Keith; Zhou, Juhua; Robbins, Paul F.; Peng, Peter D.; Shen, Xinglei; Gomes, Theotonius J.; Dunbar, Cynthia E.; Munroe, David J.; Stewart, Claudia; Cornetta, Kenneth; Wangsa, Danny; Ried, Thomas; Rosenberg, Steven A.
2007-01-01
Malignancies arising from retrovirally transduced hematopoietic stem cells have been reported in animal models and human gene therapy trials. Whether mature lymphocytes are susceptible to insertional mutagenesis is unknown. We have characterized a primary human CD8+ T-cell clone, which exhibited logarithmic ex vivo growth in the absence of exogenous cytokine support for more than 1 year after transduction with a murine leukemia virus–based vector encoding the T-cell growth factor IL-15. Phenotypically, the clone was CD28−, CD45RA−, CD45RO+, and CD62L−, a profile consistent with effector memory T lymphocytes. After gene transfer with tumor-antigen–specific T-cell receptors, the clone secreted IFN-γ upon encountering tumor targets, providing further evidence that they derived from mature lymphocytes. Gene-expression analyses revealed no evidence of insertional activation of genes flanking the retroviral insertion sites. The clone exhibited constitutive telomerase activity, and the presence of autocrine loop was suggested by impaired cell proliferation following knockdown of IL-15Rα expression. The generation of this cell line suggests that nonphysiologic expression of IL-15 can result in the long-term in vitro growth of mature human T lymphocytes. The cytokine-independent growth of this line was a rare event that has not been observed in other IL-15 vector transduction experiments or with any other integrating vector system. It does not appear that the retroviral vector integration sites played a role in the continuous growth of this cell clone, but this remains under investigation. PMID:17353346