Sample records for range hopping conductivity

  1. Electrical transport via variable range hopping in an individual multi-wall carbon nanotube

    NASA Astrophysics Data System (ADS)

    Husain Khan, Zishan; Husain, M.; Perng, T. P.; Salah, Numan; Habib, Sami

    2008-11-01

    E-beam lithography is used to make four leads on an individual multi-wall carbon nanotube for carrying out electrical transport measurements. Temperature dependence of conductance of an individual multi-wall carbon nanotube (MWNT) is studied over a temperature range of (297 4.8 K). The results indicate that the conduction is governed by variable range hopping (VRH) for the entire temperature range (297 4.8 K). This VRH mechanism changes from three dimensions (3D) to two dimensions (2D) as we go down to 70 K. Three-dimensional variable range hopping (3D VRH) is responsible for conduction in the temperature range (297 70 K), which changes to two-dimensional VRH for much lower temperatures (70 4.8 K). For 3D VRH, various Mott parameters such as density of states, hopping distance and hopping energy have been calculated. The 2D VRH mechanism has been applied for the temperature range (70 4.8 K) and, with the help of this model, the parameters such as localization length and hopping distance are calculated. All these parameters give interesting information about this complex structure, which may be useful for many applications.

  2. Range and energetics of charge hopping in organic semiconductors

    NASA Astrophysics Data System (ADS)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  3. DC electrical conductivity of Ag2O-TeO2-V2O5 glassy systems

    NASA Astrophysics Data System (ADS)

    Souri, D.; Tahan, Z. Esmaeili; Salehizadeh, S. A.

    2016-04-01

    In the present article, samples of xAg2O-40TeO2-(60 - x)V2O5 ternary tellurite glasses with 0 ≤ x ≤ 50 (in mol%) have been prepared using the melt-quenching technique. XRD analysis, density measurement by Archimedes' law, determination of reduced vanadium ions by titration method, and electrical conductivity measurement by using four-probe methods have been done for these glasses. The mixed electronic-ionic conduction of these glasses has been investigated over a wide temperature range of 150-380 K. The experimental results have been analyzed with different theoretical models of hopping conduction. The analysis shows that at high temperatures the conductivity data are consistent with Mott's model of phonon-assisted polaronic hopping, while Mott's variable-range hopping model and Greaves' hopping model are valid at low temperatures. The temperature dependence of the conductivity has been also interpreted in the framework of the percolation model proposed by Triberis and Friedman. The analysis of the conductivity data also indicates that the hopping in these tellurite glasses occurs in the non-adiabatic regime. In each sample, based upon the justified transport mechanism, carrier density and mobility have been determined at different temperatures. The values of oxygen molar volume indicate the effect of Ag2O concentration on the thermal stability or fragility of understudied samples.

  4. Comparative studies of the structure, morphology and electrical conductivity of polyaniline weakly doped with chlorocarboxylic acids

    NASA Astrophysics Data System (ADS)

    Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif

    2007-08-01

    We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.

  5. -Sb Glasses at Low Temperatures

    NASA Astrophysics Data System (ADS)

    Souri, Dariush; Azizpour, Parvin; Zaliani, Hamideh

    2014-09-01

    Semiconducting glasses of the type 40TeO2-(60 - x) V2O5- xSb were prepared by rapid melt quenching and their dc electrical conductivity was measured in the temperature range 180-296 K. For these glassy samples, the dc electrical conductivity ranged from 2.26 × 10-7 S cm-1 to 1.11 × 10-5 S cm-1 at 296 K, indicating the conductivity is enhanced by increasing the V2O5 content. These experimental results could be explained on the basis of different mechanisms (based on polaron-hopping theory) in the different temperature regions. At temperatures above Θ D/2 (where Θ D is the Debye temperature), the non-adiabatic small polaron hopping (NASPH) model is consistent with the data, whereas at temperatures below Θ D/2, a T -1/4 dependence of the conductivity indicative of the variable range hopping (VRH) mechanism is dominant. For all these glasses crossover from SPH to VRH conduction was observed at a characteristic temperature T R ≤ Θ D/2. In this study, the hopping carrier density and carrier mobility were determined at different temperatures. N ( E F), the density of states at (or near) the Fermi level, was also determined from the Mott variables; the results were dependent on V2O5 content.

  6. Single-legged Hop Tests as Predictors of Self-reported Knee Function After Anterior Cruciate Ligament Reconstruction

    PubMed Central

    Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn

    2012-01-01

    Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749

  7. Study of hopping type conduction from AC conductivity in multiferroic composite

    NASA Astrophysics Data System (ADS)

    Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan

    2018-05-01

    0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).

  8. Effects of europium substitution for In on structure and photoelectric properties of CuIn{sub 1−x}Eu{sub x}Te{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nie, Xiaomeng; Guo, Yongquan

    2016-01-15

    The structures and optical and electric properties of europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2} have been studied systematically using powder X-ray diffraction (XRD), scanning electron microscopy (SEM) with energy dispersive spectrum (EDS), ultraviolet and visible spectrophotometer (UV–vis), and standard four-probe method. The studies reveal that the minor europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} could still stabilize the chalcopyrite structure in a solid solution of x=0.1. The lattice parameters are going up with increasing the content of europium in CuIn{sub 1−x}Eu{sub x}Te{sub 2} due to the size effect at In site. The structural refinement confirms that Eu partly substitutes formore » In and occupies the 4b crystal position. SEM morphologies show that the europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} can fine the grains from the largely agglomerated state to the uniformly separated state. The electrical resistivities of single phase CuIn{sub 1−x}Eu{sub x}Te{sub 2} follow a mixture model of hopping conductivity and variable range hopping conductivity. The absorption band-gaps of CuIn{sub 1−x}Eu{sub x}Te{sub 2} at room temperature tend to increase with increasing Eu content. CuIn{sub 1−x}Eu{sub x}Te{sub 2} might be a good candidate for photovoltaic cell. - Graphical abstract: CuIn{sub 0.9}Eu{sub 0.1}Te{sub 2} follows a mixture of hopping conductivity and variable range hopping conductivity mechanism. - Highlights: • Novel europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2}. • Potential application for devices and solar cells. • A mixture of hopping and variable range hopping conductivity mechanism.« less

  9. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    NASA Astrophysics Data System (ADS)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  10. Efros-Shklovskii variable range hopping and nonlinear transport in 1 T /1 T'-MoS2

    NASA Astrophysics Data System (ADS)

    Papadopoulos, N.; Steele, G. A.; van der Zant, H. S. J.

    2017-12-01

    We have studied temperature- and electric-field-dependent carrier transport in single flakes of MoS2 treated with n -butyllithium. The temperature dependence of the four-terminal resistance follows the Efros-Shklovskii variable range hopping conduction mechanism. From measurements in the Ohmic and non-Ohmic regime, we estimate the localization length and the average hopping length of the carriers, as well as the effective dielectric constant. Furthermore, a comparison between two- and four-probe measurements yields a contact resistance that increases significantly with decreasing temperature.

  11. Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity

    NASA Astrophysics Data System (ADS)

    Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir

    2018-05-01

    We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

  12. Conduction mechanism in bismuth silicate glasses containing titanium

    NASA Astrophysics Data System (ADS)

    Dult, Meenakshi; Kundu, R. S.; Murugavel, S.; Punia, R.; Kishore, N.

    2014-11-01

    Bismuth silicate glasses mixed with different concentrations of titanium dioxide having compositions xTiO2-(60-x)Bi2O3-40SiO2 with x=0, 5, 10, 15 and 20 were prepared by the normal melt quench technique. The frequency dependence of the ac electrical conductivity of different compositions of titanium bismuth silicate glasses has been studied in the frequency range 10-1 Hz to 10 MHz and in the temperature range 623-703 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of titanium bismuth silicate glass system. The dc conductivity (σdc), so called crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. The conductivity data have been analyzed in terms of different theoretical models to determine the possible conduction mechanism. Analysis of the conductivity data and the frequency exponent shows that the correlated barrier hopping of electrons between Ti3+ and Ti4+ ions in the glasses is the most favorable mechanism for ac conduction. The temperature dependent dc conductivity has been analyzed in the framework of theoretical variable range hopping model (VRH) proposed by Mott which describe the hopping conduction in disordered semiconducting systems. The various polaron hopping parameters have also been deduced. Mott's VRH model is found to be in good agreement with experimental data and the values of inverse localization length of s-like wave function (α) obtained by this model with modifications suggested by Punia et al. are close to the ones reported for a number of oxide glasses.

  13. Quantum interference magnetoconductance of polycrystalline germanium films in the variable-range hopping regime

    NASA Astrophysics Data System (ADS)

    Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong

    2018-06-01

    Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.

  14. Electronic transport mechanism in intrinsic and doped nanocrystalline silicon films deposited by RF-magnetron sputtering at low temperature

    NASA Astrophysics Data System (ADS)

    Benlakehal, D.; Belfedal, A.; Bouizem, Y.; Sib, J. D.; Chahed, L.; Zellama, K.

    2016-12-01

    The dependence on the temperature range, T, of the electronic transport mechanism in intrinsic and doped hydrogenated nanocrystalline silicon films, deposited by radiofrequency-magnetron sputtering at low substrate temperature, has been studied. Electrical conductivity measurements σ(T) have been conducted on these films, as a function of temperature, in the 93-450 K range. The analysis of these results clearly shows a thermally activated conduction process in the 273-450 K range which allows us to estimate the associated activation energy as well as the preexponential conductivity factor. While, in the lower temperature range (T < 273 K), a non-ohmic behavior is observed for the conductivity changes. The conductivity σ(T) presents a linear dependence on (T-1/4) , and a hopping mechanism is suggested to explain these results. By using the Percolation theory, further information can be gained about the density of states near the Fermi level as well as the range and the hopping energy.

  15. Magnetoreresistance of carbon nanotube-polypyrrole composite yarns

    NASA Astrophysics Data System (ADS)

    Ghanbari, R.; Ghorbani, S. R.; Arabi, H.; Foroughi, J.

    2018-05-01

    Three types of samples, carbon nanotube yarn and carbon nanotube-polypyrrole composite yarns had been investigated by measurement of the electrical conductivity as a function of temperature and magnetic field. The conductivity was well explained by 3D Mott variable range hopping (VRH) law at T < 100 K. Both positive and negative magnetoresistance (MR) were observed by increasing magnetic field. The MR data were analyzed based a theoretical model. A quadratic positive and negative MR was observed for three samples. It was found that the localization length decreases with applied magnetic field while the density of states increases. The increasing of the density of states induces increasing the number of available energy states for hopping. Thus the electron hopping probability increases in between sites with the shorter distance that results to small the average hopping length.

  16. Dielectric Measurements on Sol-Gel Derived Titania Films

    NASA Astrophysics Data System (ADS)

    Capan, Rifat; Ray, Asim K.

    2017-11-01

    Alternating current (AC) impedance measurements were performed on 37 nm thick nanostructured sol-gel derived anatase titania films on ultrasonically cleaned (100) p-silicon substrates at temperatures T ranging from 100 K to 300 K over a frequency range between 20 Hz and 1 MHz. The frequency-dependent behavior of the AC conductivity σ ac( f, T) obeys the universal power law, and the values of the effective hopping barrier and hopping distance were found to be 0.79 eV and 6.7 × 10-11 m from an analysis due to the correlated barrier-hopping model. The dielectric relaxation was identified as a thermally activated non-Debye process involving an activation energy of 41.5 meV.

  17. Characterization of SiO2/SiC interface states and channel mobility from MOSFET characteristics including variable-range hopping at cryogenic temperature

    NASA Astrophysics Data System (ADS)

    Yoshioka, Hironori; Hirata, Kazuto

    2018-04-01

    The characteristics of SiC MOSFETs (drain current vs. gate voltage) were measured at 0.14-350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm-2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V-1s-1 and was almost independent of temperature.

  18. Cotunneling and polaronic effect in granular systems

    NASA Astrophysics Data System (ADS)

    Ioselevich, A. S.; Sivak, V. V.

    2017-06-01

    We theoretically study the conductivity in arrays of metallic grains due to the variable-range multiple cotunneling of electrons with short-range (screened) Coulomb interaction. The system is supposed to be coupled to random stray charges in the dielectric matrix that are only loosely bounded to their spatial positions by elastic forces. The flexibility of the stray charges gives rise to a polaronic effect, which leads to the onset of Arrhenius-type conductivity behavior at low temperatures, replacing conventional Mott variable-range hopping. The effective activation energy logarithmically depends on temperature due to fluctuations of the polaron barrier heights. We present the unified theory that covers both weak and strong polaron effect regimes of hopping in granular metals and describes the crossover from elastic to inelastic cotunneling.

  19. Theoretical and experimental study of AC electrical conduction mechanism in the low temperature range of p-CuIn3Se5

    NASA Astrophysics Data System (ADS)

    Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.

    2018-05-01

    In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.

  20. Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus

    DOE PAGES

    Liu, Huili; Sung Choe, Hwan; Chen, Yabin; ...

    2017-09-05

    Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less

  1. Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Huili; Sung Choe, Hwan; Chen, Yabin

    Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less

  2. Variable range hopping in ZnO films

    NASA Astrophysics Data System (ADS)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  3. Temperature and field-dependent transport measurements in continuously tunable tantalum oxide memristors expose the dominant state variable

    NASA Astrophysics Data System (ADS)

    Graves, Catherine E.; Dávila, Noraica; Merced-Grafals, Emmanuelle J.; Lam, Si-Ty; Strachan, John Paul; Williams, R. Stanley

    2017-03-01

    Applications of memristor devices are quickly moving beyond computer memory to areas of analog and neuromorphic computation. These applications require the design of devices with different characteristics from binary memory, such as a large tunable range of conductance. A complete understanding of the conduction mechanisms and their corresponding state variable(s) is crucial for optimizing performance and designs in these applications. Here we present measurements of low bias I-V characteristics of 6 states in a Ta/ tantalum-oxide (TaOx)/Pt memristor spanning over 2 orders of magnitude in conductance and temperatures from 100 K to 500 K. Our measurements show that the 300 K device conduction is dominated by a temperature-insensitive current that varies with non-volatile memristor state, with an additional leakage contribution from a thermally-activated current channel that is nearly independent of the memristor state. We interpret these results with a parallel conduction model of Mott hopping and Schottky emission channels, fitting the voltage and temperature dependent experimental data for all memristor states with only two free parameters. The memristor conductance is linearly correlated with N, the density of electrons near EF participating in the Mott hopping conduction, revealing N to be the dominant state variable for low bias conduction in this system. Finally, we show that the Mott hopping sites can be ascribed to oxygen vacancies, where the local oxygen vacancy density responsible for critical hopping pathways controls the memristor conductance.

  4. Purely hopping conduction in c-axis oriented LiNbO3 thin films

    NASA Astrophysics Data System (ADS)

    Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay

    2009-05-01

    Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.

  5. AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

    PubMed

    Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

    2015-06-01

    In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

  6. Study of temperature dependent electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses

    NASA Astrophysics Data System (ADS)

    Deepika, Singh, Hukum

    2018-05-01

    This paper reports the variation in electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses studied at different temperatures. The amorphous samples were prepared using the melt quenching method and the electrical measurements were performed on Keithley Electrometer in the temperature ranging from 298-373 K. The I-V characteristics were noted at different temperatures and the data obtained was analysed to get dc electrical conductivity and activation energy of electrical conduction. Further, Mott's 3D VRH model has been applied to obtain density of states, hopping range and hopping energy at different temperatures. The obtained results show that dc electrical conductivity increases with increase in Bi composition in Se-Te system. These compositions also show close agreement to Mott's VRH model.

  7. AC and DC conductivity study on Ca substituted bismuth ferrite

    NASA Astrophysics Data System (ADS)

    Pandey, Rabichandra; Pradhan, Lagen Kumar; Kumar, Sunil; Kar, Manoranjan

    2018-05-01

    Bi0.95Ca0.05FeO3 multiferroic compound was synthesized by the citric acid modified sol-gel method. Crystal structure of Bi0.95Ca0.05FeO3 is studied by the X-ray diffraction (XRD) technique. The ac impedance analysis of the compound has been carried out in a wide range of frequency (100 Hz - 1MHz) as well as temperature (40-2500C). Frequency variation of dielectric constant at different temperatures can be understood by the modified Debye formula. The activation energy was found to be 0.48eV, which was obtained by employing Arrhenius equation. The AC conductivity of the sample follows the Johnscher's power law which indicates the presence of hopping type conduction in localized charged states. To understand the conduction mechanism with localized charge states, the DC resistivity data were analyzed by Mott's variable range hopping (VRH) model. The activation energy calculated from Debye relaxation time, AC conductivity and DC resistivity are comparable to each other.

  8. Analysis of Electrical Transport and Noise Mechanisms in Amorphous Silicon

    DTIC Science & Technology

    2015-11-23

    and Skhlovskii [9] considered the long range Coulomb interaction and found that it reduces the DOS to zero at the Fermi level, thereby creating a so...called “ Coulomb gap (CG)” at low enough temperatures. This form of hopping conductivity results when an electron migrates from one site to another...site leaving a positively charged vacancy. For hopping to occur, the electron must have sufficient energy to overcome this Coulomb interaction

  9. AC conduction of Ba1-xCaxTiO3 and BZT-BCTx

    NASA Astrophysics Data System (ADS)

    Khien, Nguyen Van; Huy, Than Trong; Hong, Le Van

    2018-03-01

    Ba1-xCaxTiO3 (BCTx), (x =0.0-0.3) and Ba0.8Zr0.2TiO3-Ba1-xCaxTiO3 (BZT-BCTx), (x=0.15-0.35) were fabricated by the solid state reaction method. Phase structure of the material samples was identified by X-ray diffraction. The impedance versus frequency in a range of 100 Hz to 2.5 MHz was measured for all the samples at room temperature. AC conductivity versus frequency of the BCTx and BZT-BCTx was evaluated and fitted by using the extended Universal Dielectric Response (UDR) equations. The fitting results were discussed in detail and shown that the localized reorientation polarization-based mechanism is most contributed in BCTx matrial samples. Basically both two the hopping polaron and polarization mechanisms play roles in BZT-BCTx material samples. In contrary the short-range polaron hopping is dominated in ac conductivity of BZT-BCTx material samples in low frequency range.

  10. Structural characterization and observation of variable range hopping conduction mechanism at high temperature in CdSe quantum dot solids

    NASA Astrophysics Data System (ADS)

    Sinha, Subhojyoti; Kumar Chatterjee, Sanat; Ghosh, Jiten; Kumar Meikap, Ajit

    2013-03-01

    We have used Rietveld refinement technique to extract the microstructural parameters of thioglycolic acid capped CdSe quantum dots. The quantum dot formation and its efficient capping are further confirmed by HR-TEM, UV-visible and FT-IR spectroscopy. Comparative study of the variation of dc conductivity with temperature (298 K ≤ T ≤ 460 K) is given considering Arrhenius formalism, small polaron hopping and Schnakenberg model. We observe that only Schnakenberg model provides good fit to the non-linear region of the variation of dc conductivity with temperature. Experimental variation of ac conductivity and dielectric parameters with temperature (298 K ≤ T ≤ 460 K) and frequency (80 Hz ≤ f ≤ 2 MHz) are discussed in the light of hopping theory and quantum confinement effect. We have elucidated the observed non-linearity in the I-V curves (measured within ±50 V), at dark and at ambient light, in view of tunneling mechanism. Tunnel exponents and non-linearity weight factors have also been evaluated in this regard.

  11. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    PubMed

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  12. Redirected charge transport arising from diazonium grafting of carbon coated LiFePO4.

    PubMed

    Madec, L; Seid, K A; Badot, J-C; Humbert, B; Moreau, P; Dubrunfaut, O; Lestriez, B; Guyomard, D; Gaubicher, J

    2014-11-07

    The morphological and the electrical properties of carbon coated LiFePO4 (LFPC) active material functionalized by 4-ethynylbenzene tetrafluoroboratediazonium salt were investigated. For this purpose, FTIR, Raman, XPS, High Resolution Transmission Electron Microscopy (HRTEM) and Broadband Dielectric Spectroscopy (BDS) were considered. Electronic conductivities of LFPC samples at room temperature were found to decrease in a large frequency range upon simple immersion in polar solvents and to decrease further upon functionalization. Due to their high dipole moment, strongly physisorbed molecules detected by XPS likely add barriers to electron hopping. Significant alteration of the carbon coating conductivity was only observed, however, upon functionalization. This effect is most presumably associated with an increase in the sp(3) content determined by Raman spectroscopy, which is a strong indication of the formation of a covalent bond between the organic layer and the carbon coating. In this case, the electron flux appears to be redirected and relayed by short-range (intra chain) and long-range (inter chain) electron transport through molecular oligomers anchored at the LFPC surface. The latter are controlled by tunnelling and slightly activated hopping, which enable higher conductivity at low temperature (T < 250 K). Alteration of the electron transport within the carbon coating also allows detection of a relaxation phenomenon that corresponds to small polaron hopping in bulk LiFePO4. XPS and HRTEM images allow a clear correlation of these findings with the island type oligomeric structure of grafted molecules.

  13. Vortex variable range hopping in a conventional superconducting film

    NASA Astrophysics Data System (ADS)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  14. Charge carrier transport mechanisms in perovskite CdTiO{sub 3} fibers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imran, Z.; Rafiq, M. A., E-mail: aftab@cantab.net; Hasan, M. M.

    Electrical transport properties of electrospun cadmium titanate (CdTiO{sub 3}) fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behaviormore » followed by space charge limited current (SCLC) with traps at higher voltages at all temperatures (200 K – 420 K). Trap density in our fibers system is N{sub t} = 6.27 × 10{sup 17} /cm{sup 3}. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH) from 200 K – 300 K. The localized density of states were found to be N(E{sub F}) = 5.51 × 10{sup 21} eV{sup −1} cm{sup −3} at 2 V. Other VRH parameters such as hopping distance (R{sub hop}) and hopping energy (W{sub hop}) were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO{sub 3} fibers efficient material for capacitive energy storage devices.« less

  15. Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.

    2013-12-01

    Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.

  16. ac conductivity in Gd doped Pb(Zr0.53Ti0.47)O3 ceramics

    NASA Astrophysics Data System (ADS)

    Portelles, J.; Almodovar, N. S.; Fuentes, J.; Raymond, O.; Heiras, J.; Siqueiros, J. M.

    2008-10-01

    This study is focused in the conduction processes taking place in 0.6 wt % Gd doped lead zirconate titanate samples PbZr0.53Ti0.47O3:Gd (PZT53/47:Gd) in the vicinity of the morphotropic phase boundary. Doped samples show very large dielectric permittivity with respect to that of undoped ones near the transition temperature. The frequency dependent ac conductivity of PZT53/47:Gd ceramics was studied in the 30-450 °C temperature range. X-ray diffraction analyses indicate the incorporation of Gd atoms to the structure. The changes in the dielectric properties as functions of temperature of the doped samples are taken as additional evidence of the incorporation of Gd into the crystal structure. Gd acts as donor center promoting extrinsic n-type conduction. The ac conductivity behavior obeys Jonscher universal relation in the 100 Hz-1 MHz frequency range for temperatures between 30 and 300 °C. The measured conductivity values for Gd doped PZT53/47 are higher than those of pure PZT53/47. According to the correlated barrier hopping model, the preponderant conduction mechanism in the frequency-temperature response was recognized as small polarons hopping mechanism.

  17. Thermally Stimulated Currents in Nanocrystalline Titania

    PubMed Central

    Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Cavallaro, Alessandro; Scaringella, Monica

    2018-01-01

    A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO2. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5–630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 1014–1018 cm−3, associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies. PMID:29303976

  18. Thermally Stimulated Currents in Nanocrystalline Titania.

    PubMed

    Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Carnevale, Ennio Antonio; Cavallaro, Alessandro; Scaringella, Monica

    2018-01-05

    A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO₂. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5-630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 10 14 -10 18 cm -3 , associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies.

  19. Conduction mechanism and dielectric relaxation in high dielectric KxTiyNi1-x-yO

    NASA Astrophysics Data System (ADS)

    Jana, Pradip Kumar; Sarkar, Sudipta; Karmakar, Shilpi; Chaudhuri, B. K.

    2007-10-01

    Complex impedance spectroscopic study has been made to elucidate the conductivity mechanism and dielectric relaxations in a low loss giant dielectric (ɛ'˜104) KxTiyNi1-x-yO (KTNO) system with x =0.05-0.30 and y =0.02 over a wide temperature range (200-400K). Below ambient temperature (300K), dc conductivity follows variable range hopping mechanism. The estimated activation energy for dielectric relaxation is found to be higher than the corresponding polaron hopping energy, which is attributed to the combined effect of K-doped grains and highly disordered grain boundary (GB) contributions in KTNO. Observed sharp fall of ɛ' below ˜270K is ascribed to the freezing of charge carriers. Comparatively lower value of relaxation time distribution parameter β of KTNO than that of the CaCu3Ti4O12 (CCTO) system reveals more disorder in KTNO. It is also found that KTNO is structurally more stable compared to the CCTO system, both having giant ɛ' value.

  20. Hopper on wheels: evolving the hopping robot concept

    NASA Technical Reports Server (NTRS)

    Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.

    2001-01-01

    This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.

  1. Identification of Mott insulators and Anderson insulators in self-assembled gold nanoparticles thin films

    NASA Astrophysics Data System (ADS)

    Jiang, Cheng-Wei; Ni, I.-Chih; Tzeng, Shien-Der; Wu, Cen-Shawn; Kuo, Watson

    2014-05-01

    How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction.How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr06627d

  2. Ceramics at High Temperatures

    NASA Astrophysics Data System (ADS)

    Zheng, Peng; Zhang, Rui-zhi; Chen, Hao-ying; Hao, Wen-tao

    2014-06-01

    The Seebeck coefficient and electrical conductivity of CaCu3Ti4O12 (CCTO) ceramics were measured and analyzed in the high temperature range of 300°C to 800°C, and then the electrical conduction mechanism was investigated by using a combination of experimental data fitting and first-principles calculations. The Seebeck coefficient of the CCTO ceramic sintered at 1050°C is negative with largest absolute value of ˜650 μV/K at 300°C, and the electrical conductivity is 2-3 orders greater than the value reported previously by other researchers. With increasing sintering temperature, the Seebeck coefficient decreases while the electrical conductivity increases. The temperature dependence of the electrical conductivity follows the rule of adiabatic hopping conduction of small polarons. The calculated density of states of CCTO indicates that the conduction band is mainly contributed by the antibonding states of Cu 3 d electrons, therefore small-polaron hopping between CuO4 square planar clusters was proposed. Possible ways to further improve the thermoelectric properties of CCTO are also discussed.

  3. Study of conduction behavior in Pr0.67Sr0.03Ag0.30MnO3

    NASA Astrophysics Data System (ADS)

    Bhat, Masroor Ahmad; Modi, Anchit; Pandey, Devendra K.; Gaur, N. K.

    2018-05-01

    In this paper, we report the conduction mechanism in Pr0.67Sr0.03Ag0.30MnO3 system synthesized via conventional solid state reaction route. The structural information was carried by X - Ray diffraction using Rietveld refinement which confirms the secondary phase of the sample. The SEM image shows the formation of double phase composite because of limited reaction of silver with parent compound. The resistivity behavior indicates the semiconducting behavior. The electronic nature can be estimated by means of variable range hopping (VRH) and small polaron hopping (SPH) model showing that the enhancement of double exchange interaction suppress the band gap and boost the carrier delocalization of charge carriers.

  4. Hopping conduction in zirconium oxynitrides thin film deposited by reactive magnetron sputtering

    NASA Astrophysics Data System (ADS)

    Guo, Jie; Zhan, Guanghui; Liu, Jingquan; Yang, Bin; Xu, Bin; Feng, Jie; Chen, Xiang; Yang, Chunsheng

    2015-10-01

    Zirconium oxynitrides thin film thermometers were demonstrated to be useful temperature sensors. However, the basic conduction mechanism of zirconium oxynitrides films has been a long-standing issue, which hinders the prediction and optimization of their ultimate performance. In this letter, zirconium oxynitrides films were grown on sapphire substrates by magnetron sputtering and their electric transport mechanism has been systemically investigated. It was found that in high temperatures region (>150 K) the electrical conductivity was dominated by thermal activation for all samples. In the low temperatures range, while Mott variable hopping conduction (VRH) was dominated the transport for films with relatively low resistance, a crossover from Mott VRH conduction to Efros-Shklovskii (ES) VRH was observed for films with relatively high resistance. This low temperature crossover from Mott to ES VRH indicates the presence of a Coulomb gap (~7 meV). These results demonstrate the competing and tunable conduction mechanism in zirconium oxynitrides thin films, which would be helpful for optimizing the performance of zirconium oxynitrides thermometer.

  5. Effect of pH on the electrical properties and conducting mechanism of SnO2 nanoparticles

    NASA Astrophysics Data System (ADS)

    Periathai, R. Sudha; Abarna, S.; Hirankumar, G.; Jeyakumaran, N.; Prithivikumaran, N.

    2017-03-01

    Semiconductor nanoparticles have attracted more interests because of their size-dependent optical and electrical properties.SnO2 is an oxygen-deficient n-type semiconductor with a wide band gap of 3.6 eV (300 K). It has many remarkable applications as sensors, catalysts, transparent conducting electrodes, anode material for rechargeable Li- ion batteries and optoelectronic devices. In the present work, the role of pH in determining the electrical and dielectric properties of SnO2 nanoparticles has been studied as a function of temperature ranging from Room temperature (RT) to 114 °C in the frequency range of 7 MHz to 50 mHz using impedance spectroscopic technique. The non linear behavior observed in the thermal dependence of the conductance of SnO2 nanoparticles is explained by means of the surface property of SnO2 nanoparticles where proton hopping mechanism is dealt with. Jonscher's power law has been fitted for the conductance spectra and the frequency exponent ("s" value) gives an insight about the ac conducting mechanism. The temperature dependence of electrical relaxation phenomenon in the material has been observed. The complex electric modulus analysis indicates the possibility of hopping conduction mechanism in the system with non-exponential type of conductivity relaxation.

  6. Polaronic conductivity and scaling behavior of lithium iron phosphate glass

    NASA Astrophysics Data System (ADS)

    Banday, Azeem; Murugavel, Sevi

    2018-05-01

    Charge transport properties of the Lithium Iron Phosphate (LFP) glass has been investigated in a wide frequency and temperature range by means of broadband dielectric spectroscopy. The conductivity spectra has been studied on the basis of Jonscher power law for characterizing the hopping dynamics of charge carriers. The ac conductivity and scaling behavior of the LFP glass has been studied in the temperature range from 333K to 573K and frequency range from 100 mHz to 1 MHz. The conductivity isotherms of LFP glass do not superimpose upon each other by using Summerfield scaling. The structural peculiarities in the material could result in different conduction pathways giving rise to the deviation from Summerfield scaling.

  7. Electronic transport in mixed-phase hydrogenated amorphous/nanocrystalline silicon thin films

    NASA Astrophysics Data System (ADS)

    Wienkes, Lee Raymond

    Interest in mixed-phase silicon thin film materials, composed of an amorphous semiconductor matrix in which nanocrystalline inclusions are embedded, stems in part from potential technological applications, including photovoltaic and thin film transistor technologies. Conventional mixed-phase silicon films are produced in a single plasma reactor, where the conditions of the plasma must be precisely tuned, limiting the ability to adjust the film and nanoparticle parameters independently. The films presented in this thesis are deposited using a novel dual-plasma co-deposition approach in which the nanoparticles are produced separately in an upstream reactor and then injected into a secondary reactor where an amorphous silicon film is being grown. The degree of crystallinity and grain sizes of the films are evaluated using Raman spectroscopy and X-ray diffraction respectively. I describe detailed electronic measurements which reveal three distinct conduction mechanisms in n-type doped mixed-phase amorphous/nanocrystalline silicon thin films over a range of nanocrystallite concentrations and temperatures, covering the transition from fully amorphous to ~30% nanocrystalline. As the temperature is varied from 470 to 10 K, we observe activated conduction, multiphonon hopping (MPH) and Mott variable range hopping (VRH) as the nanocrystal content is increased. The transition from MPH to Mott-VRH hopping around 100K is ascribed to the freeze out of the phonon modes. A conduction model involving the parallel contributions of these three distinct conduction mechanisms is shown to describe both the conductivity and the reduced activation energy data to a high accuracy. Additional support is provided by measurements of thermal equilibration effects and noise spectroscopy, both done above room temperature (>300 K). This thesis provides a clear link between measurement and theory in these complex materials.

  8. Dielectric and AC conductivity studies on SrBi4Ti4O15

    NASA Astrophysics Data System (ADS)

    Jose, Roshan; Saravanan, K. Venkata

    2018-05-01

    The four layered SrBi4Ti4O15 ceramics which belong to the aurivillius family of oxide was prepared by conventional solid state reaction technique. Analysis of the dielectric data as a function of temperature and frequency revealed normal phase transition. The frequency dependent ac conductivity follows Jonscher's universal power law. Frequency exponent (n), pre-exponential factor (A), bulk dc conductivity (σdc), and hopping frequency (ωp) were determined from the fitting curves. The variation of frequency exponent with temperature indicates that large polaron hopping mechanism up to curie-temperature, then its changes to small polaron hopping. The activation energies were calculated from ac conductivity, bulk dc conductivity and hopping frequency. The activation energies revealed that conductivity had contributions from migrations of oxygen vacancies, bismuth ion vacancies and strontium ion vacancies.

  9. Thermally activated charge transport in microbial protein nanowires

    PubMed Central

    Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

    2016-01-01

    The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors. PMID:27009596

  10. Thermally activated charge transport in microbial protein nanowires

    NASA Astrophysics Data System (ADS)

    Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

    2016-03-01

    The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

  11. Thermally activated charge transport in microbial protein nanowires.

    PubMed

    Lampa-Pastirk, Sanela; Veazey, Joshua P; Walsh, Kathleen A; Feliciano, Gustavo T; Steidl, Rebecca J; Tessmer, Stuart H; Reguera, Gemma

    2016-03-24

    The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

  12. Dielectric relaxation dynamics and AC conductivity scaling of metal-organic framework (MOF-5) based polymer electrolyte nanocomposites incorporated with ionic liquid

    NASA Astrophysics Data System (ADS)

    Dutta, Rituraj; Kumar, A.

    2017-10-01

    Dielectric relaxation dynamics and AC conductivity scaling of a metal-organic framework (MOF-5) based poly (vinylidene fluoride-co-hexafluoropropylene) (PVdf-HFP) incorporated with 1-Butyl-3-methylimidazolium hexafluorophosphate have been studied over a frequency range of 40 Hz-5 MHz and in the temperature range of 300 K-380 K. High values of dielectric permittivity (~{{\\varepsilon }\\prime} ) having strong dispersion are obtained at low frequency because of interfacial polarization. The real part of the dielectric modulus spectra (M‧) shows no prominent peak, whereas the imaginary part (M″) shows certain peaks, with a reduction in relaxation time (τ) that can be attributed to a non-Debye relaxation mechanism. The spectra also depict both concentration- and temperature-independent scaling behavior. The power law dependent variation of AC conductivity follows the jump relaxation model and reveals activated ion hopping over diffusion barriers. The value of the frequency exponent is observed to decrease with increasing concentration of ionic liquid, indicating the forward hopping of ions in the relaxation process. The AC conductivity scaling curves at different temperatures also depict the temperature-independent relaxation dynamics.

  13. AC and DC conductivity due to hopping mechanism in double ion doped ceramics

    NASA Astrophysics Data System (ADS)

    Rizwana, Mahboob, Syed; Sarah, P.

    2018-04-01

    Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.

  14. Reverse leakage current characteristics of InGaN/GaN multiple quantum well ultraviolet/blue/green light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Zhou, Shengjun; Lv, Jiajiang; Wu, Yini; Zhang, Yuan; Zheng, Chenju; Liu, Sheng

    2018-05-01

    We investigated the reverse leakage current characteristics of InGaN/GaN multiple quantum well (MQW) near-ultraviolet (NUV)/blue/green light-emitting diodes (LEDs). Experimental results showed that the NUV LED has the smallest reverse leakage current whereas the green LED has the largest. The reason is that the number of defects increases with increasing nominal indium content in InGaN/GaN MQWs. The mechanism of the reverse leakage current was analyzed by temperature-dependent current–voltage measurement and capacitance–voltage measurement. The reverse leakage currents of NUV/blue/green LEDs show similar conduction mechanisms: at low temperatures, the reverse leakage current of these LEDs is attributed to variable-range hopping (VRH) conduction; at high temperatures, the reverse leakage current of these LEDs is attributed to nearest-neighbor hopping (NNH) conduction, which is enhanced by the Poole–Frenkel effect.

  15. Electrical conductivity and dielectric properties of TlInS2 single crystals

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.; Hassan, A.

    2011-07-01

    TlInS2 single crystals were grown by using Bridgman-Stockbauer technique. Measurements of DC conductivity were carried out in parallel (σ//) and perpendicular (σ⊥) directions to the c-axis over a temperature range from 303 to 463 K. The anisotropic behaviour of the electrical conductivity was also detected. AC conductivity and dielectric measurements were studied as a function of both frequency (102-106 Hz) and temperature (297-375 K). The frequency dependence of the AC conductivity revealed that σac(ω) obeys the universal law: σac(ω) = Aωs. The mechanism of the ac charge transport across the layers of TlInS2 single crystals was referred to the hopping over localized states near the Fermi level in the frequency range >3.5 × 103 Hz. The temperature dependence of σac(ω) for TlInS2 showed that σac is thermally activated process. Both of ɛ1 and ɛ2 decrease by increasing frequency and increase by increasing temperature. Some parameters were calculated as: the density of localized states near the Fermi level NF = 1.5 × 1020 eV-1 cm-3, the average time of charge carrier hoping between localized states τ = 3.79 μs and the average hopping distance R = 6.07 nm.

  16. Electrical modulus and dielectric behavior of Cr3+ substituted Mg-Zn nanoferrites

    NASA Astrophysics Data System (ADS)

    Mansour, S. F.; Abdo, M. A.

    2017-04-01

    The dielectric parameters and ac electrical conductivity of Mg0.8Zn0.2CrxFe2-xO4; (0≤x≤0.025) nanoferrites synthesized citrate-nitrate auto-combustion method were studied using the complex impedance technique in the frequency and temperature ranges 4 Hz-5 MHz and 303-873 K respectively. Hopping of charge carriers plus interfacial polarization could interpret the behaviors of dielectric constant (ε‧), dielectric loss tangent (tanδ) and ac electrical conductivity (σac) with frequency, temperatures and composition. The up-normal behavior observed in tanδ trend with temperatures confirms the presence of relaxation loss (dipoles losses). Correlated barrier hopping (CBH) of electron is the conduction mechanism of the investigated nanoferrites. Cole-Cole plots at different temperatures emphasize the main role of grain and grain boundaries in the properties of the investigated nanoferrites. Cr3+ substitution can control the dielectric parameters and ac electrical conductivity of Mg-Zn nanoferrites making it candidates for versatile applications.

  17. Nerve Conduction Through Dendrites via Proton Hopping.

    PubMed

    Kier, Lemont B

    2017-01-01

    In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  18. Sensitive photo-thermal response of graphene oxide for mid-infrared detection

    NASA Astrophysics Data System (ADS)

    Bae, Jung Jun; Yoon, Jung Hyun; Jeong, Sooyeon; Moon, Byoung Hee; Han, Joong Tark; Jeong, Hee Jin; Lee, Geon-Woong; Hwang, Ha Ryong; Lee, Young Hee; Jeong, Seung Yol; Lim, Seong Chu

    2015-09-01

    This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability.This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04039f

  19. Role of carrier density and disorder on anisotropic charge transport in polypyrrole

    NASA Astrophysics Data System (ADS)

    Varade, Vaibhav; Anjaneyulu, P.; Suchand Sangeeth, C. S.; Ramesh, K. P.; Menon, Reghu

    2013-01-01

    Polypyrrole (PPy) has been synthesized electrochemically on platinum substrate by varying synthesis temperature and dopant concentration. The charge transport in PPy has been investigated as a function of temperature for both in-plane and out-of-plane geometry in a wide temperature range of 5 K-300 K. The charge transport showed strong anisotropy and various mechanisms were used to explain the transport. The conductivity ratio, σr = σ(300 K)/σ(5 K) is calculated for each sample to quantify the relative disorder. At all the temperatures, the conductivity values for in-plane transport are found to be more for PPy synthesized at lower temperature, while the behavior is found to be different for out-of-plane transport. The carrier density is found to play a crucial role in case of in-plane transport. An effort has been made to correlate charge transport to morphology by analyzing temperature and frequency dependence of conductivity. Charge transport in lateral direction is found to be dominated by hopping whereas tunneling mechanisms are dominated in vertical direction. Parameters such as density of states at the Fermi level [N(EF)], average hopping distance (R), and average hopping energy (W) have been estimated for each samples in both geometry.

  20. Origin and enhancement of spin polarized current in diluted magnetic oxides by oxygen vacancies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chou, Hsiung, E-mail: hchou@mail.nsysu.edu.tw; Yang, Kung-Shang; Tsao, Yao-Chung

    Spin polarized current (SPC) is a crucial characteristic of diluted magnetic oxides due to the potential application of oxides in spintronic devices. However, most research has been focused on ferromagnetic properties rather than polarization of electric current, because direct measurements are difficult and the origin of SPC has yet to be fully understood. The method to increase the SPC percentage is beyond practical consideration at present. To address this problem, we focus on the role of oxygen vacancies (V{sub O}) on SPC, which are controlled by growing the Co-doped ZnO thin-films at room temperature in a reducing atmosphere [Ar + (1%–30%)H{sub 2}].more » We found that the conductivity increases with an increase of V{sub O} via two independent channels: the variable range hopping (VRH) within localized states and the itinerant transport in the conduction band. The point contact Andreev reflection measurements at 4.2 K, where the electric conduction is governed only by the VRH mechanism, prove that the current flowing in the VRH hopping channel is SPC. The percentage of SPC increases with the introduction of V{sub O} and increase in its concentration. The transport measurement shows that by manipulating V{sub O}, one can control the percentage of VRH hopping conduction such that it can even dominate room temperature conduction. The highest achieved SPC ratio at room temperature was 80%.« less

  1. The frequency hopping pattern design for random hopping frequency signal based on stationary phase principle

    NASA Astrophysics Data System (ADS)

    Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun

    2018-04-01

    For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.

  2. Transport and charging mechanisms in Ta2O5 thin films for capacitive RF MEMS switches application

    NASA Astrophysics Data System (ADS)

    Persano, A.; Quaranta, F.; Martucci, M. C.; Cretı, P.; Siciliano, P.; Cola, A.

    2010-06-01

    The potential of sputtered Ta2O5 thin films to be used as dielectric layers in capacitive radio frequency microelectromechanical system switches is evaluated by investigating two factors of crucial importance for the performance of these devices which are the transport mechanisms and the charging effects in the dielectric layer. We find that Ta2O5 films show good electrical and dielectrical properties for the considered application in terms of a low leakage current density of 4 nA/cm2 for E =1 MV/cm, a high breakdown field of 4 MV/cm and a high dielectric constant of 32. For electric fields lower than 1 MV/cm the conduction mechanism is found to be variable-range hopping in the temperature range 300-400 K, while nearest-neighbor hopping is observed at higher temperatures. For fields in the range 1-4 MV/cm Poole-Frenkel becomes the dominant conduction mechanism. Current and capacitance transients used to investigate the charging effects show a decay which is well described by the stretched-exponential law, thus providing further insights on capture and emission processes.

  3. A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

    PubMed

    Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

    2018-05-08

    With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

  4. First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China

    USDA-ARS?s Scientific Manuscript database

    Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...

  5. Controlling charge transport mechanisms in molecular junctions: Distilling thermally induced hopping from coherent-resonant conduction.

    PubMed

    Kim, Hyehwang; Segal, Dvira

    2017-04-28

    The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.

  6. Polaron conductivity mechanism in oxalic acid dihydrate: ac conductivity experiment

    NASA Astrophysics Data System (ADS)

    Levstik, Adrijan; Filipič, Cene; Bobnar, Vid; Levstik, Iva; Hadži, Dušan

    2006-10-01

    The ac electrical conductivity of the oxalic acid dihydrate ( α -POX) was investigated as a function of the frequency and temperature. The real part of the complex ac electrical conductivity was found to follow the universal dielectric response σ'∝νs , indicating that hopping or tunneling of localized charge carriers governs the electrical transport. A detailed analysis of the temperature dependence of the exponent s revealed that in a broad temperature range 50-200K the tunneling of polarons is the dominating charge transport mechanism.

  7. Colossal dielectric behavior of semiconducting Sr2TiMnO6 ceramics

    NASA Astrophysics Data System (ADS)

    Meher, K. R. S. Preethi; Varma, K. B. R.

    2009-02-01

    Manganitelike double perovskite Sr2TiMnO6 (STMO) ceramics fabricated from the powders synthesized via the solid-state reaction route, exhibited dielectric constants as high as ˜105 in the low frequency range (100 Hz-10 kHz) at room temperature. The Maxwell-Wagner type of relaxation mechanism was found to be more appropriate to rationalize such high dielectric constant values akin to that observed in materials such as KxTiyNi(1-x-y)O and CaCu3Ti4O12. The dielectric measurements carried out on the samples with different thicknesses and electrode materials reflected the influence of extrinsic effects. The impedance studies (100 Hz-10 MHz) in the 180-300 K temperature range revealed the presence of two dielectric relaxations corresponding to the grain boundary and the electrode. The dielectric response of the grain boundary was found to be weakly dependent on the dc bias field (up to 11 V/cm). However, owing to the electrode polarization, the applied ac/dc field had significant effect on the low frequency dielectric response. At low temperatures (100-180 K), the dc conductivity of STMO followed a variable range hopping behavior. Above 180 K, it followed the Arrhenius behavior because of the thermally activated conduction process. The bulk conductivity relaxation owing to the localized hopping of charge carriers obeyed the typical universal dielectric response.

  8. Realizing one-dimensional quantum and high-frequency transport features in aligned single-walled carbon nanotube ropes

    NASA Astrophysics Data System (ADS)

    Ncube, Siphephile; Chimowa, George; Chiguvare, Zivayi; Bhattacharyya, Somnath

    2014-07-01

    The superiority of the electronic transport properties of single-walled carbon nanotube (SWNT) ropes over SWNT mats is verified from low temperature and frequency-dependent transport. The overall change of resistance versus in nanotube mats shows that 3D variable range hopping is the dominant conduction mechanism within the 2-300 K range. The magneto-resistance (MR) is found to be predominantly negative with a parabolic nature, which can also be described by the hopping model. Although the positive upturn of the MR at low temperatures establishes the contribution from quantum interference, the inherent quantum transport in individual tubes is suppressed at elevated temperatures. Therefore, to minimize multi-channel effects from inter-tube interactions and other defects, two-terminal devices were fabricated from aligned SWNT (extracted from a mat) for low temperature transport as well as high-frequency measurements. In contrast to the mat, the aligned ropes exhibit step-like features in the differential conductance within the 80-300 K temperature range. The effects of plasmon propagation, unique to one dimension, were identified in electronic transport as a non-universal power-law dependence of the differential conductance on temperature and source-drain voltage. The complex impedance showed high power transmission capabilities up to 65 GHz as well as oscillations in the frequency range up to 30 GHz. The measurements suggest that aligned SWNT ropes have a realistic potential for high-speed device applications.

  9. AC conductivity and dielectric behavior of bulk Furfurylidenemalononitrile

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.

    2012-06-01

    AC conductivity and dielectric behavior for bulk Furfurylidenemalononitrile have been studied over a temperature range (293-333 K) and frequency range (50-5×106 Hz). The frequency dependence of ac conductivity, σac, has been investigated by the universal power law, σac(ω)=Aωs. The variation of the frequency exponent (s) with temperature was analyzed in terms of different conduction mechanisms, and it was found that the correlated barrier hopping (CBH) model is the predominant conduction mechanism. The temperature dependence of σac(ω) showed a linear increase with the increase in temperature at different frequencies. The ac activation energy was determined at different frequencies. Dielectric data were analyzed using complex permittivity and complex electric modulus for bulk Furfurylidenemalononitrile at various temperatures.

  10. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    NASA Astrophysics Data System (ADS)

    Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

    2014-11-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB2 has a very high bulk glass transition temperature Tg, and we observe no three-state hopping or sequential two-state hopping previously seen on lower Tg glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Duc; Girolami, Gregory S.; Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB{sub 2} glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunnelingmore » spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB{sub 2} has a very high bulk glass transition temperature T{sub g}, and we observe no three-state hopping or sequential two-state hopping previously seen on lower T{sub g} glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses.« less

  12. "Makin' Somethin' Outta Little-to-Nufin'': Racism, Revision and Rotating Records--The Hip-Hop DJ in Composition Praxis

    ERIC Educational Resources Information Center

    Craig, Todd

    2015-01-01

    Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…

  13. Wheeled hopping robot

    DOEpatents

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  14. Effect of Carbon on the Electrical Properties of Copper Oxide-Based Bulk Composites

    NASA Astrophysics Data System (ADS)

    Kalinin, Yu. E.; Kashirin, M. A.; Makagonov, V. A.; Pankov, S. Yu.; Sitnikov, A. V.

    2018-04-01

    The effect of carbon filler on the electrical resistance and the thermopower of copper oxide-based composites produced by ceramic technology by hot pressing has been studied. It is found that the dependences of the electrical resistivity on the filler concentration are characteristic by S-like curves that are typical of percolation systems; in this case, the resistivity decreases more substantially as the carbon content increases as compared to the decrease in thermopower value, which is accompanied by the existence of the maximum of the factor of thermoelectric power near the percolation threshold. The studies of the temperature dependences of the resistivity and the thermopower at low temperatures show that, in the range 240-300 K, the predominant mechanism of the electrotransfer of all the composites under study is the hopping mechanism. At temperatures lower than 240 K, the composites with a nanocrystalline CuO matrix have a hopping conductivity with a variable hopping distance over localized states of the matrix near the Fermi level, which is related to the conductivity over intergrain CuO boundaries. A schematic model of the band structure of nanocrystalline CuO with carbon filler is proposed on the base of the analysis of the found experimental regularities of the electrotransfer.

  15. AC conductivity and dielectric properties of bulk tungsten trioxide (WO3)

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; Saadeldin, M.; Zaghllol, M.

    2012-11-01

    AC conductivity and dielectric properties of tungsten trioxide (WO3) in a pellet form were studied in the frequency range from 42 Hz to 5 MHz with a variation of temperature in the range from 303 K to 463 K. AC conductivity, σac(ω) was found to be a function of ωs where ω is the angular frequency and s is the frequency exponent. The values of s were found to be less than unity and decrease with increasing temperature, which supports the correlated barrier hopping mechanism (CBH) as the dominant mechanism for the conduction in WO3. The dielectric constant (ε‧) and dielectric loss (ε″) were measured. The Cole-Cole diagram determined complex impedance for different temperatures.

  16. Electronic phase separation in insulating (Ga, Mn) As with low compensation: super-paramagnetism and hopping conduction

    NASA Astrophysics Data System (ADS)

    Yuan, Ye; Wang, Mao; Xu, Chi; Hübner, René; Böttger, Roman; Jakiela, Rafal; Helm, Manfred; Sawicki, Maciej; Zhou, Shengqiang

    2018-03-01

    In the present work, low compensated insulating (Ga,Mn)As with 0.7% Mn is obtained by ion implantation combined with pulsed laser melting. The sample shows variable-range hopping transport behavior with a Coulomb gap in the vicinity of the Fermi energy, and the activation energy is reduced by an external magnetic field. A blocking super-paramagnetism is observed rather than ferromagnetism. Below the blocking temperature, the sample exhibits a colossal negative magnetoresistance. Our studies confirm that the disorder-induced electronic phase separation occurs in (Ga,Mn)As samples with a Mn concentration in the insulator-metal transition regime, and it can account for the observed superparamagnetism and the colossal magnetoresistance.

  17. Harvesting electricity from human hair.

    PubMed

    Tulachan, Brindan; Singh, Sushil K; Philip, Deepu; Das, Mainak

    2016-01-01

    Electrical conductivity of human hair is a debatable issue among hair experts and scientists. There are unsubstantiated claims that hair conducts electricity. However, hair experts provided ample evidence that hair is an insulator. Although wet hair exhibited drastic reduction in resistivity; scientists regarded hair as a proton semiconductor at the best. Here, we demonstrate that hair filaments generate electricity on absorbing water vapor between 50 degrees and 80 degrees C. This electricity can operate low power electronic systems. Essentially, we are exposing the hydrated hair polymer to a high temperature (50 degrees-80 degrees C). It has long been speculated that when certain biopolymers are simultaneously hydrated and exposed to high temperature, they exhibit significant proton hopping at a specific temperature regime. This happens due to rapid movement of water molecules on the polymer surface. This lead us to speculate that the observed flow of current is partly ionic and partly due to "proton hopping" in the hydrated nano spaces of hair filament. Such proton hopping is exceptionally high when the hydrated hair polymer is exposed to a temperature between 50 degrees and 80 degrees C. Differential scanning calorimetry data further corroborated the results and indicated that indeed at this temperature range, there is an enormous movement of water molecules on the hair polymer surface. This enormously rapid movement of water molecules lead to the "making and breaking" of innumerable hydrogen bonds and thus resulting in hopping of the protons. What is challenging is "how to tap these hopping protons to obtain useful electricity?" We achieved this by placing a bundle of hair between two different electrodes having different electro negativities, and exposing it to water vapor (water + heat). The two different electrodes offered directionality to the hopping protons and the existing ions and thus resulting in the generation of useful current. Further, by continuously hydrating the polymer with water vapor, we prolonged the process. If this interesting aspect of polymer is exploited further and fine tuned, then it will open new avenues for development of sophisticated polymer-based systems, which could be used to harvest electricity from waste heat.

  18. Hierarchical Hopping through Localized States in a Random Potential

    NASA Astrophysics Data System (ADS)

    Rajan, Harihar; Srivastava, Vipin

    2003-03-01

    Generalisation of Mott's idea on (low - temperature, large-time), Variable-range-hopping is considered to include hopping at some what higher temperature(that do not kill localization). These transitions complement the variable- range-hopping in that they do not conserve energy and occur at relatively lower time scales. The hopper picks the next state in a hierarchical fashion in accordance with certain conditions. The results are found to tie up nicely with an interesting property pertaining to the energy dependence of localized states. Acknowlwdgements: One of us(VS) would like to thank Association of Commonwealth Universities and Leverhulme Trust for financial help and to Sir Sam Edwards for hospitality at Cavendish Laboratory,Cambridge CB3 0HE.

  19. Electrical conduction mechanism and dielectric characterization of MnTPPCl thin films

    NASA Astrophysics Data System (ADS)

    Meikhail, M. S.; Oraby, A. H.; El-Nahass, M. M.; Zeyada, H. M.; Al-Muntaser, A. A.

    2018-06-01

    The AC conductivity and dielectric properties of MnTPPCl sandwich structure as Au/MnTPPCl/Au were studied. The conductivity of the MnTPPCl thin films have been interpreted by the correlated barrier hopping (CBH) model. The dominant conduction process have found to be the single polaron hopping conduction. The values of the hopping distance, Rω, barrier height, W, and the localized-state density, N, are estimated at different frequencies. The behavior of dielectric constant and dielectric loss was discussed as a function of temperature and frequency. The dielectric constant was described in terms of polarization mechanism in materials. The spectral behavior of dielectric loss is interpreted on the basis of the Giuntini et al. model [1]. The value of WM is obtained as 0.32 eV. A non-Debye relaxation phenomenon was observed from the dielectric relaxation mechanism.

  20. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  1. Differences between direct current and alternating current capacitance nonlinearities in high-k dielectrics and their relation to hopping conduction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khaldi, O.; Kassmi, M.; El Manar University, LMOP, 2092 Tunis

    2014-08-28

    Capacitance nonlinearities were studied in atomic layer deposited HfO{sub 2} films using two types of signals: a pure ac voltage of large magnitude (ac nonlinearities) and a small ac voltage superimposed to a large dc voltage (dc nonlinearities). In theory, ac and dc nonlinearities should be of the same order of magnitude. However, in practice, ac nonlinearities are found to be an order of magnitude higher than dc nonlinearities. Besides capacitance nonlinearities, hopping conduction is studied using low-frequency impedance measurements and is discussed through the correlated barrier hopping model. The link between hopping and nonlinearity is established. The ac nonlinearitiesmore » are ascribed to the polarization of isolated defect pairs, while dc nonlinearities are attributed to electrode polarization which originates from defect percolation paths. Both the ac and dc capacitance nonlinearities display an exponential variation with voltage, which results from field-induced lowering of the hopping barrier energy.« less

  2. Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

    PubMed

    Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

    2018-03-30

    Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

  3. Hopping robot

    DOEpatents

    Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.

    2001-01-01

    The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.

  4. Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite

    NASA Astrophysics Data System (ADS)

    Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya

    2017-12-01

    Charge transport in the temperature range 80 K < T < 300 K was studied in a composite of carbon spheres (CS), prepared via hydrothermal carbonization of sucrose, and the conducting polymer polyaniline (PANi). PANi was synthesized via the oxidative polymerization of aniline with ammonium peroxydisulfate (APS) in acidic media. The CS/PANi composite was prepared by coating the spheres with a thin polyaniline (PANi) film doped with hydrochloric acid (HCl) in situ during the polymerization process. Temperature dependent conductivity measurements show that three dimensional variable range hopping of electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

  5. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    NASA Astrophysics Data System (ADS)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.

  6. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

    PubMed

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-09-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

  7. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping

    PubMed Central

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-01-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670

  8. Impedance Spectroscopy and AC Conductivity Studies of Bulk 3-Amino-7-(dimethylamino)-2-methyl-hydrochloride

    NASA Astrophysics Data System (ADS)

    El-Shabaan, M. M.

    2018-02-01

    Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.

  9. Duality in Power-Law Localization in Disordered One-Dimensional Systems

    NASA Astrophysics Data System (ADS)

    Deng, X.; Kravtsov, V. E.; Shlyapnikov, G. V.; Santos, L.

    2018-03-01

    The transport of excitations between pinned particles in many physical systems may be mapped to single-particle models with power-law hopping, 1 /ra . For randomly spaced particles, these models present an effective peculiar disorder that leads to surprising localization properties. We show that in one-dimensional systems almost all eigenstates (except for a few states close to the ground state) are power-law localized for any value of a >0 . Moreover, we show that our model is an example of a new universality class of models with power-law hopping, characterized by a duality between systems with long-range hops (a <1 ) and short-range hops (a >1 ), in which the wave function amplitude falls off algebraically with the same power γ from the localization center.

  10. The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.

    PubMed

    Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David

    2016-08-15

    Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors

    NASA Astrophysics Data System (ADS)

    Marple, M. A. T.; Avila-Paredes, H.; Kim, S.; Sen, S.

    2018-05-01

    A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.

  12. Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors.

    PubMed

    Marple, M A T; Avila-Paredes, H; Kim, S; Sen, S

    2018-05-28

    A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.

  13. "Music Fit for Us Minorities": Latinas/os' Use of Hip Hop as Pedagogy and Interpretive Framework to Negotiate and Challenge Racism

    ERIC Educational Resources Information Center

    Pulido, Isaura

    2009-01-01

    Using Critical Race and Latino Critical theories, this study examines 20 in-depth interviews conducted by the author with Mexican and Puerto Rican youth from the Chicago area. The author contends that youth utilized hip hop music in multiple and overlapping ways, engaging hip hop music as both a pedagogy that centers the perspectives of people of…

  14. Topological Anderson insulator induced by inter-cell hopping disorder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lv, Shu-Hui; College of Sciences, Hebei University of Science and Technology, Shijiazhuang 050018; Song, Juntao, E-mail: jtsong@mail.hebtu.edu.cn

    We have studied in detail the influence of same-orbit and different-orbit hopping disorders in HgTe/CdTe quantum wells. Intriguingly, similar to the behavior of the on-site Anderson disorder, a phase transition from a topologically trivial phase to a topological phase is induced at a proper strength of the same-orbit hopping disorder. For different-orbit hopping disorder, however, the phase transition does not occur. The results have been analytically verified by using effective medium theory. A consistent conclusion can be obtained by comparing phase diagrams, conductance, and conductance fluctuations. In addition, the influence of Rashba spin-orbit interaction (RSOI) on the system has beenmore » studied for different types of disorder, and the RSOI shows different influence on topological phase at different disorders. The topological phase induced by same-orbit hopping disorder is more robust against the RSOI than that induced by on-site Anderson disorder. For different-orbit hopping disorder, no matter whether the RSOI is included or not, the phase transition does not occur. The results indicate, whether or not the topological Anderson insulator can be observed depends on a competition between the different types of the disorder as well as the strength of the RSOI in a system.« less

  15. Effects of interdot hopping and Coulomb blockade on the thermoelectric properties of serially coupled quantum dots

    PubMed Central

    2012-01-01

    We have theoretically studied the thermoelectric properties of serially coupled quantum dots (SCQDs) embedded in an insulator connected to metallic electrodes. In the framework of Keldysh Green’s function technique, the Landauer formula of transmission factor is obtained using the equation of motion method. Based on such analytical expressions of charge and heat currents, we calculate the electrical conductance, Seebeck coefficient, electron thermal conductance, and figure of merit (ZT) of SCQDs in the linear response regime. The effects of interdot hopping and electron Coulomb interactions on ZT are analyzed. We demonstrate that ZT is not a monotonic increasing function of interdot electron hopping strength (tc). We also show that in the absence of phonon thermal conductance, SCQD can reach the Carnot efficiency as tcapproaches zero. PMID:22591807

  16. D.C. electrical conductivity and conduction mechanism of some azo sulfonyl quinoline ligands and uranyl complexes.

    PubMed

    El-Ghamaz, N A; Diab, M A; El-Sonbati, A Z; Salem, O L

    2011-12-01

    Supramolecular coordination of dioxouranium(VI) heterochelates 5-sulphono-7-(4'-X phenylazo)-8-hydroxyquinoline HL(n) (n=1, X=CH(3); n=2, X=H; n=3, X=Cl; n=4, X=NO(2)) have been prepared and characterized with various physico-chemical techniques. The infrared spectral studies showed a monobasic bidentate behavior with the oxygen and azonitrogen donor system. The temperature dependence of the D.C. electrical conductivity of HL(n) ligands and their uranyl complexes has been studied in the temperature range 305-415 K. The thermal activation energies E(a) for HL(n) compounds were found to be in the range 0.44-0.9 eV depending on the nature of the substituent X. The complexation process decreased E(a) values to the range 0.043-045 eV. The electrical conduction mechanism has been investigated for all samples under investigation. It was found to obey the variable range hopping mechanism (VRH). Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Surface Diffusion in Systems of Interacting Brownian Particles

    NASA Astrophysics Data System (ADS)

    Mazroui, M'hammed; Boughaleb, Yahia

    The paper reviews recent results on diffusive phenomena in two-dimensional periodic potential. Specifically, static and dynamic properties are investigated by calculating different correlation functions. Diffusion process is first studied for one-dimensional system by using the Fokker-Planck equation which is solved numerically by the matrix continued fraction method in the case of bistable potential. The transition from hopping to liquid-like diffusion induced by variation of some parameters is discussed. This study will therefore serve to demonstrate the influence of this form of potential. Further, an analytical approximation for the dc-conductivity is derived for a wide damping range in the framework of the Linear Response Theory. On the basis of this expression, calculations of the ac conductivity of two-dimensional system with Frenkel-Kontorova pair interaction in the intermediate friction regime is performed by using the continued fraction expansion method. The dc-conductivity expression is used to determine the rest of the development. By varying the density of mobile ions we discuss commensurability effects. To get information about the diffusion mechanism, the full width at half maximum λω(q), of the quasi-elastic line of the dynamical structure factor S(q,ω) is computed. The calculations are extended up to large values of q covering several Brillouin zones. The analysis of λω(q) with different parameters shows that the most probable diffusion process in good two-dimensional superionic conductors consists of a competition between a back correlated hopping in one direction and forward correlated hopping in addition to liquid-like motions in the other direction.

  18. Quantum Spin Dynamics with Pairwise-Tunable, Long-Range Interactions

    DTIC Science & Technology

    2016-08-05

    rection of the arrows. Dashed (dotted) lines mark the NNN hopping terms (coefficients ±t2). NNNN long -range hopping along curved lines are included to...Quantum spin dynamics with pairwise-tunable, long -range interactions C.-L. Hunga,b,1,2, Alejandro González-Tudelac,1,2, J. Ignacio Ciracc, and H. J...atoms) that interact by way of a variety of processes, such as atomic collisions. Such pro- cesses typically lead to short -range, nearest-neighbor

  19. Magnetoresistance in two-dimensional array of Ge/Si quantum dots

    NASA Astrophysics Data System (ADS)

    Stepina, N. P.; Koptev, E. S.; Pogosov, A. G.; Dvurechenskii, A. V.; Nikiforov, A. I.; Zhdanov, E. Yu

    2012-07-01

    Magnetoresistance in two-dimensional array of Ge/Si was studied for a wide range of the conductance, where the transport regime changes from hopping to diffusive one. The behavior of magnetoresistance is similar for all samples; it is negative in weak fields and becomes positive with increasing of magnetic field. Negative magnetoresistance can be described in the frame of weak localization approach with suggestion that quantum interference contribution to the conductance is restricted not only by the phase breaking length but also by the localization length.

  20. Spin-glass and variable range hopping quantum interference magnetoresistance in FeSr2Y1.3Ce0.7Cu2O10-x

    NASA Astrophysics Data System (ADS)

    Sambale, S.; Williams, G. V. M.; Stephen, J.; Chong, S. V.

    2014-12-01

    Electronic transport and magnetic measurements have been made on FeSr2Y1.3Ce0.7Cu2O10-x. We observe a spin-glass at ˜23 K and a magnetoresistance that reaches -22% at 8 T. The magnetoresistance is due to variable range hopping quantum interference where at low temperatures each hop is over a large number of scatterers. This magnetoresistance is negative at and above 5 K and can be described by the Nguen, Spivak, and Shklovskii (NSS) model. However, there is an increasingly positive contribution to the magnetoresistance for temperatures below 5 K that may be due to scattering from localized free spins during each hop that is not accounted for in the NSS model.

  1. Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d-dimensional regular lattices.

    PubMed

    Dias, W S; Bertrand, D; Lyra, M L

    2017-06-01

    Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d>4.

  2. Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d -dimensional regular lattices

    NASA Astrophysics Data System (ADS)

    Dias, W. S.; Bertrand, D.; Lyra, M. L.

    2017-06-01

    Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d >4 .

  3. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    NASA Astrophysics Data System (ADS)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  4. Combustion powered linear actuator

    DOEpatents

    Fischer, Gary J.

    2007-09-04

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  5. Influence of Ag, Cd or Pb Addition on Electrical and Dielectric Properties of Bulk Glassy Se-Ge

    NASA Astrophysics Data System (ADS)

    El-Metwally, E. G.; Shakra, A. M.

    2018-05-01

    Bulk glassy samples of Se0.7Ge0.3 and Se0.7Ge0.25 X 0.05 (X = Ag, Cd or Pb) chalcogenide glass have been prepared by melt-quenching method. The studied compositions were examined in powder form by x-ray diffraction analysis. The direct-current (dc) conductivity σ_{{dc}} was measured for bulk samples in the temperature range from 303 K to 433 K, revealing enhancement with temperature for all samples. The results indicate two values of activation energy ( Δ E_{{σ1 }} and Δ E_{{σ2 }} ) due to two conduction mechanisms. Measurements of the alternating-current (ac) conductivity σ_{{ac}} ( ω ) and dielectric properties for bulk samples were carried out in the temperature range from 303 K to 433 K and frequency range from 1 kHz to 1 MHz. The ac conductivity σ_{{ac}} ( ω ) was temperature dependent and proportional to ωS , where S is the frequency exponent, which reduced with rising temperature, and ω is the angular frequency. These results are discussed based on a correlated barrier hopping model. The calculated values of the maximum height of the barrier W_{{M}} for each composition are consistent with carrier hopping over a potential barrier. The density of localized states N( {E_{{F}} } ) at the Fermi level lay in the range from 1019 eV-1 cm-3 to 1020 eV-1 cm-3, and increased with temperature. The dielectric constant ɛ1 ( ω ) and loss ɛ2 ( ω ) increased with temperature but decreased with frequency. The values of σ_{{dc}} , σ_{{ac}} ( ω ) , ɛ1 ( ω ) , and ɛ2 ( ω ) increased with temperature and with addition of Ag, Cd or Pb. The observed increase was greater for Se0.7Ge0.25Pb0.05 than for Se0.7Ge0.25Cd0.05, which was greater than for Se0.7Ge0.25Ag0.05.

  6. Manipulating Conduction in Metal Oxide Semiconductors: Mechanism Investigation and Conductance Tuning in Doped Fe2O3 Hematite and Metal/Ga2O3/Metal Heterostructure

    NASA Astrophysics Data System (ADS)

    Zhao, Bo

    This study aims at understanding the fundamental mechanisms of conduction in several metal oxide semiconductors, namely alpha-Fe2O 3 and beta-Ga2O3, and how it could be tuned to desired values/states to enable a wide range of application. In the first effort, by adding Ti dopant, we successfully turned Fe2O3 from insulating to conductive by fabricated compositionally and structurally well-defined epitaxial alpha-(TixFe1-x)2 O3(0001) films for x ≤ 0.09. All films were grown by oxygen plasma assisted molecular beam epitaxy on Al2O3(0001) sapphire substrate with a buffer layer of Cr2O3 to relax the strain from lattice mismatch. Van der Pauw resistivity and Hall effect measurements reveal carrier concentrations between 1019 and 1020 cm-3 at room temperature and mobilities in the range of 0.1 to 0.6 cm2/V˙s. Such low mobility, unlike conventional band-conduction semiconductor, was attributed to hopping mechanism due to strong electron-phonon interaction in the lattice. More interestingly, conduction mechanism transitions from small-polaron hopping at higher temperatures to variable range hopping at lower temperatures with a transition temperature between 180 to 140 K. Consequently, by adding Ti dopant, conductive Fe 2O3 hematite thin films were achieved with a well-understood conducting mechanism that could guide further device application such as spin transistor and water splitting. In the case of Ga2O3, while having a band gap as high as 5 eV, they are usually conductive for commercially available samples due to unintentional Si doping. However, we discovered the conductance could be repeatedly switched between high resistance state and low resistance state when made into metal/Ga2O3 /metal heterostructure. However, to obtain well controlled switching process with consistent switching voltages and resistances, understanding switching mechanism is the key. In this study, we fabricated resistive switching devices utilizing a Ni/Ga2O3/Ir heterostructure. Bipolar switching, non-volatility, and repeatable switching are tested for the devices fabricated. Following previous discoveries on Ni/Ga2O3 single crystal which shows interface barrier type change (Schottky ↔ Ohmic) upon annealing accompanied by defects migration, characterization of the interface behavior on resistive switching cell Ni/Ga2O 3(thin film)/Ir under two different resistive states was performed using X-ray photoemission spectroscopy (XPS). Most interestingly, feathers in XPS spectrum of Ga allow for a unique nondestructive approach to investigate interface by XPS through electron transparent top contact. Theoretical modeling shows that Ga migrate towards the interface upon switching to low resistive state, indicating a possible mechanism that involves interfacial switch through barrier height modifying. Such device holds potential to become the next generation of non-volatile memory device, resistive RAM.

  7. Visualizing Current Flow at the Mesoscale in Disordered Assemblies of Touching Semiconductor Nanocrystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Qinyi; Guest, Jeffrey R.; Thimsen, Elijah

    2017-07-12

    The transport of electrons through assemblies of nanocrystals is important to performance in optoelectronic applications for these materials. Previous work has primarily focused on single nanocrystals or transitions between pairs of nanocrystals. There is a gap in knowledge of how large numbers of nanocrystals in an assembly behave collectively, and how this collective behavior manifests at the mesoscale. In this work, the variable range hopping (VRH) transport of electrons in disordered assemblies of touching, heavily doped ZnO nanocrystals was visualized at the mesoscale as a function of temperature both theoretically, using the model of Skinner, Chen and Shklovskii (SCS), andmore » experimentally, with conductive atomic force microscopy on ultrathin films only a few particle layers thick. Agreement was obtained between the model and experiments, with a few notable exceptions. The SCS model predicts that a single network within the nanocrystal assembly, comprised of sites connected by small resistances, dominates conduction - namely the optimum band from variable range hopping theory. However, our experiments revealed that in addition to the optimum band, there are subnetworks that appear as additional peaks in the resistance histogram of conductive atomic force microscopy (CAFM) maps. Furthermore, the connections of these subnetworks to the optimum band change in time, such that some subnetworks become connected to the optimum band while others become disconnected and isolated from the optimum band; this observation appears to be an experimental manifestation of the ‘blinking’ phenomenon in our images of mesoscale transport.« less

  8. Variable-Range Hopping through Marginally Localized Phonons

    NASA Astrophysics Data System (ADS)

    Banerjee, Sumilan; Altman, Ehud

    2016-03-01

    We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.

  9. Ultrasonic Multiple-Access Ranging System Using Spread Spectrum and MEMS Technology for Indoor Localization

    PubMed Central

    Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah

    2014-01-01

    Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084

  10. Origin of the Strain Sensitivity for an Organic Heptazole Thin-Film and Its Strain Gauge Application

    NASA Astrophysics Data System (ADS)

    Bae, Heesun; Jeon, Pyo Jin; Park, Ji Hoon; Lee, Kimoon

    2018-04-01

    The authors report on the origin of the strain sensitivity for an organic C26H16N2 (heptazole) thinfilm and its application for the detection of tensile strain. From the electrical characterization on the thin-film transistor adopting a heptazole channel, heptazole film exhibits p-channel conduction with a relatively low value of field-effect mobility (0.05 cm2/Vs), suggesting a hopping conduction behavior via hole carriers. By analyzing the strain and temperature dependences of the electrical conductivity, we reveal that the electrical conduction for a heptazole thin-film is dominated by the variable range hopping process with quite a large energy separation (224.9 meV) between the localized states under a relatively long attenuation length (10.46 Å). This indicates that a change in the inter-grain spacing that is much larger than the attenuation length is responsible for the reversible modification of electrical conductivity depending on strain for the heptazole film. By utilizing our heptazole thin-film both as a strain sensitive passive resistor and an active semiconducting channel layer, we can achieve a strain gauge device exhibiting reversible endurance for tensile strains up to 2.12%. Consequently, this study advances the understanding of the fundamental strain sensing mechanism in a heptazole thin-film toward finding a promise material with a strain gauge for applications as potential flexible devices and/or wearable electronics.

  11. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

    PubMed Central

    Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

    2010-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

  12. Nanoscale live cell imaging using hopping probe ion conductance microscopy

    PubMed Central

    Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.

    2009-01-01

    We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505

  13. Dielectric and impedance spectral characteristics of bulk ZnIn2Se4

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Attia, A. A.; Salem, G. F.; Ali, H. A. M.; Ismail, M. I.

    2014-02-01

    The frequency and temperature dependence of ac conductivity, dielectric constant and dielectric loss of ZnIn2Se4 in a pellet form were investigated in the frequency range of 102-106 Hz and temperature range of 293-356 K. The behavior of ac conductivity was interpreted by the correlated barrier hopping (CBH) model. Temperature dependence of ac conductivity indicates that ac conduction is a thermally activated process. The density of localized states N(EF) and ac activation energy were estimated for various frequencies. Dielectric constant and dielectric loss showed a decrease with increasing frequency and an increase with increasing in temperature. The frequency dependence of real and imaginary parts of the complex impedance was investigated. The relaxation time decreases with the increase in temperature. The impedance spectrum exhibits the appearance of the single semicircular arc. The radius of semicircular arcs decreases with increasing temperature which suggests a mechanism of temperature-dependent on relaxation.

  14. A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

    PubMed

    Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

    2018-06-01

    African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

  15. Localization in a random XY model with long-range interactions: Intermediate case between single-particle and many-body problems

    NASA Astrophysics Data System (ADS)

    Burin, Alexander L.

    2015-09-01

    Many-body localization in an XY model with a long-range interaction is investigated. We show that in the regime of a high strength of disordering compared to the interaction an off-resonant flip-flop spin-spin interaction (hopping) generates the effective Ising interactions of spins in the third order of perturbation theory in a hopping. The combination of hopping and induced Ising interactions for the power-law distance dependent hopping V (R ) ∝R-α always leads to the localization breakdown in a thermodynamic limit of an infinite system at α <3 d /2 where d is a system dimension. The delocalization takes place due to the induced Ising interactions U (R ) ∝R-2 α of "extended" resonant pairs. This prediction is consistent with the numerical finite size scaling in one-dimensional systems. Many-body localization in an XY model is more stable with respect to the long-range interaction compared to a many-body problem with similar Ising and Heisenberg interactions requiring α ≥2 d which makes the practical implementations of this model more attractive for quantum information applications. The full summary of dimension constraints and localization threshold size dependencies for many-body localization in the case of combined Ising and hopping interactions is obtained using this and previous work and it is the subject for the future experimental verification using cold atomic systems.

  16. Powdery mildew reaction of hop cultivars and USDA germplasm, 2015

    USDA-ARS?s Scientific Manuscript database

    This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

  17. Study of dielectric relaxation and AC conductivity of InP:S single crystal

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; El-Shazly, E. A.

    2012-07-01

    The dielectric relaxation and AC conductivity of InP:S single crystal were studied in the frequency range from 100 to 5.25 × 105 Hz and in the temperature range from 296 to 455 K. The dependence of the dielectric constant (ɛ1) and the dielectric loss (ɛ2) on both frequency and temperature was investigated. Since no peak was observed on the dielectric loss, we used a method based on the electric modulus to evaluate the activation energy of the dielectric relaxation. Scaling of the electric modulus spectra showed that the charge transport dynamics is independent of temperature. The AC conductivity (σAC) was found to obey the power law: Aωs. Analysis of the AC conductivity data and the frequency exponent showed that the correlated barrier hopping (CBH) model is the dominant mechanism for the AC conduction. The variation of AC conductivity with temperature at different frequencies showed that σAC is a thermally activated process.

  18. Effect of Impedance Relaxation in Conductance Mechanisms in TiO2/ITO/ZnO:Al/p-Si Heterostructure

    NASA Astrophysics Data System (ADS)

    Nouiri, M.; El Mir, L.

    2018-03-01

    The electrical conduction of a TiO2/ITO/ZnO:Al/p-Si structure under alternating-current excitation was investigated in the temperature range of 80 K to 300 K. The frequency dependence of the capacitance and conductance revealed the response of a thermally activated trap characterized by activation energy of about 140 meV. The frequency dependence of the conductance obeyed the universal dynamic response according to the common relation G = Aωs . The temperature dependence of the frequency exponent s illustrates that, in the low frequency range, conduction is governed by the correlated barrier hopping (CBH) mechanism involving two distinct energy levels for all investigated temperatures. For the high frequency region, conduction takes place according to the overlapping large-polaron tunneling mechanism at low temperatures but the CBH mechanism becomes dominant in the high temperature region. This difference in electrical behavior between low and high temperatures can be attributed to the dominance of dielectric relaxation at low compared with high temperatures.

  19. Evaluation of fungicides for hop downy mildew, Hubbard, Oregon, 2016

    USDA-ARS?s Scientific Manuscript database

    This research was conducted to quantify the degree of control of the disease with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standard fungicide,...

  20. Evaluation of fungicides for hop downy mildew, Woodburn, Oregon, 2016

    USDA-ARS?s Scientific Manuscript database

    This research was conducted to quantify the degree of control of the disease downy mildew with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standa...

  1. Dielectric relaxation and localized electron hopping in colossal dielectric (Nb,In)-doped TiO2 rutile nanoceramics.

    PubMed

    Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A

    2017-03-28

    Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO 2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.

  2. Low Power Multi-Hop Networking Analysis in Intelligent Environments.

    PubMed

    Etxaniz, Josu; Aranguren, Gerardo

    2017-05-19

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

  3. Low Power Multi-Hop Networking Analysis in Intelligent Environments

    PubMed Central

    Etxaniz, Josu; Aranguren, Gerardo

    2017-01-01

    Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847

  4. Condom use and hip hop culture: the case of urban young men in New York City.

    PubMed

    Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

    2008-06-01

    We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

  5. Effect of substitution group on dielectric properties of 4H-pyrano [3, 2-c] quinoline derivatives thin films

    NASA Astrophysics Data System (ADS)

    H, M. Zeyada; F, M. El-Taweel; M, M. El-Nahass; M, M. El-Shabaan

    2016-07-01

    The AC electrical conductivity and dielectrical properties of 2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3, 2-c]quinoline-3-carbonitrile (Ph-HPQ) and 2-amino-4-(2-chlorophenyl)-6-ethyl-5-oxo-5,6-dihydro-4H-pyrano [3, 2-c] quinoline-3-carbonitrile (Ch-HPQ) thin films were determined in the frequency range of 0.5 kHz-5 MHz and the temperature range of 290-443 K. The AC electrical conduction of both compounds in thin film form is governed by the correlated barrier hopping (CBH) mechanism. Some parameters such as the barrier height, the maximum barrier height, the density of charges, and the hopping distance were determined as functions of temperature and frequency. The phenoxyphenyl group has a greater influence on those parameters than the chlorophenyl group. The AC activation energies were determined at different frequencies and temperatures. The dielectric behaviors of Ph-HPQ and Ch-HPQ were investigated using the impedance spectroscopy technique. The impedance data are presented in Nyquist diagrams for different temperatures. The Ch-HPQ films have higher impedance than the Ph-HPQ films. The real dielectric constant and dielectric loss show a remarkable dependence on the frequency and temperature. The Ph-HPQ has higher dielectric constants than the Ch-HPQ.

  6. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    PubMed Central

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  7. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    PubMed

    Neiens, Silva D; Steinhaus, Martin

    2018-02-14

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  8. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs

    PubMed Central

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-01-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014

  9. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    PubMed

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  10. COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT.

    PubMed

    Kivlan, Benjamin R; Carcia, Christopher R; Christoforetti, John J; Martin, RobRoy L

    2016-08-01

    Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Quasi-experimental, cohort comparison. Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. 3B, non-consectutive cohort study.

  11. COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT

    PubMed Central

    Carcia, Christopher R.; Christoforetti, John J.; Martin, RobRoy L.

    2016-01-01

    ABSTRACT Background Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. Purpose The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Study Design Quasi-experimental, cohort comparison. Methods Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. Results No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Conclusion Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. Level of Evidence 3B, non-consectutive cohort study PMID:27525177

  12. A Crystal-Physical Model of Electrotransfer in the Superionic Conductor Pb1 - x Sc x F2 + x ( x = 0.1)

    NASA Astrophysics Data System (ADS)

    Sorokin, N. I.

    2018-04-01

    The frequency (ν = 10-1-107 Hz) dependences of electrical conductivity σ(ν) of single crystals of superionic conductor Pb0.9Sc0.1F2.1 (10 mol % ScF3) with fluorite type structure (CaF2) in the temperature range 153-410 K have been investigated. The static bulk conductivity σ dc =1.5 × 10-4 S/cm and average hopping frequency ν h = 1.5 × 107 Hz of charge carriers (mobile ions F-) at room temperature (293 K) have been defined from the σ dc (ν) experimental curves. Enthalpies of thermoactivated processes of ionic conductivity σ dc ( T) (Δ H σ = 0.393 ± 0.005 eV) and dielectric relaxation ν h ( T) (Δ H h = 0.37 ± 0.03 eV) coincide within their errors. A crystal-physical model of fluorine-ion transport in a Pb0.9Sc0.1F2.1 crystal lattice has been proposed. The characteristic parameters of charge carriers have been calculated: concentration n mob = 2.0 × 1021 cm-3, the distance of the hopping d ≈ 0.5 nm and mobility μmob = 4.5 × 10-7 cm2/s V (293 K).

  13. Matrix-valued Boltzmann equation for the nonintegrable Hubbard chain.

    PubMed

    Fürst, Martin L R; Mendl, Christian B; Spohn, Herbert

    2013-07-01

    The standard Fermi-Hubbard chain becomes nonintegrable by adding to the nearest neighbor hopping additional longer range hopping amplitudes. We assume that the quartic interaction is weak and investigate numerically the dynamics of the chain on the level of the Boltzmann type kinetic equation. Only the spatially homogeneous case is considered. We observe that the huge degeneracy of stationary states in the case of nearest neighbor hopping is lost and the convergence to the thermal Fermi-Dirac distribution is restored. The convergence to equilibrium is exponentially fast. However for small next-nearest neighbor hopping amplitudes one has a rapid relaxation towards the manifold of quasistationary states and slow relaxation to the final equilibrium state.

  14. "Writing in the Margins": Brazilian Hip-Hop as an Educational Project

    ERIC Educational Resources Information Center

    Pardue, Derek

    2004-01-01

    Hip-hop culture's force as part of globalization in the fields of economics, popular aesthetics, and identity politics has been well documented. However, its articulation to educational practices has received less attention. This article draws upon fieldwork conducted in 1999 and 2002 in a youth correctional facility to analyze how state…

  15. Quasiclassical description of the nearest-neighbor hopping dc conduction via hydrogen-like donors in intermediately compensated GaAs crystals

    NASA Astrophysics Data System (ADS)

    Poklonski, N. A.; Vyrko, S. A.; Zabrodskii, A. G.

    2010-08-01

    Expressions for the pre-exponential factor σ3 and the thermal activation energy ɛ3 of hopping electric conductivity of electrons via hydrogen-like donors in n-type gallium arsenide are obtained in the quasiclassical approximation. Crystals with the donor concentration N and the acceptor concentration KN at the intermediate compensation ratio K (approximately from 0.25 to 0.75) are considered. We assume that the donors in the charge states (0) and (+1) and the acceptors in the charge state (-1) form a joint nonstoichiometric simple cubic 'sublattice' within the crystalline matrix. In such sublattice the distance between nearest impurity atoms is Rh = [(1 + K)N]-1/3 which is also the length of an electron hop between donors. To take into account orientational disorder of hops we assume that the impurity sublattice randomly and smoothly changes orientation inside a macroscopic sample. Values of σ3(N) and ɛ3(N) calculated for the temperature of 2.5 K agree with known experimental data at the insulator side of the insulator-metal phase transition.

  16. Dielectric relaxation and ac conductivity behavior of carboxyl functionalized multiwalled carbon nanotubes/poly (vinyl alcohol) composites

    NASA Astrophysics Data System (ADS)

    Amrin, Sayed; Deshpande, V. D.

    2017-03-01

    We study the dielectric relaxation and ac conductivity behavior of MWCNT-COOH/Polyvinyl alcohol nanocomposite films in the temperature (T) range 303-423 K and in the frequency (f) range 0.1 Hz-1 MHz. The dielectric constant increases with an increase in temperature and also with an increase in MWCNT-COOH loading into the polymer matrix, as a result of interfacial polarization. The permittivity data were found to fit well with the modified Cole-Cole equation. Temperature dependent values of the relaxation times, free charge carrier conductivity and space charge carrier conductivity were extracted from the equation. An observed increment in the ac conductivity for the nanocomposites was analysed by a Jonscher power law which suggests that the correlated barrier hopping is the dominant charge transport mechanism for the nanocomposite films. The electric modulus study revealed deviations from ideal Debye-type behavior which are explained by considering a generalized susceptibility function. XRD and DSC results show an increase in the degree of crystallinity.

  17. Electrical conductivity and dielectric relaxation of 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile

    NASA Astrophysics Data System (ADS)

    El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.

    2014-03-01

    The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.

  18. Landing Mechanics During Side Hopping and Crossover Hopping Maneuvers in Noninjured Women and Women With Anterior Cruciate Ligament Reconstruction

    PubMed Central

    Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.

    2011-01-01

    Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128

  19. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    PubMed

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  20. Partially suppressed shot noise in hopping conduction: observation in SiGe quantum wells

    PubMed

    Kuznetsov; Mendez; Zuo; Snider; Croke

    2000-07-10

    We have observed shot noise in the hopping conduction of two-dimensional carriers confined in a p-type SiGe quantum well at a temperature of 4 K. Moreover, shot noise is suppressed relative to its "classical" value 2eI by an amount that depends on the length of the sample and the carrier density. We have found a suppression factor to the classical value of about one-half for a 2 &mgr;m long sample, and of one-fifth for a 5 &mgr;m sample. In each case, the factor decreased slightly as the density increased toward the insulator-metal transition. We explain these results in terms of the characteristic length ( approximately 1 &mgr;m in our case) of the inherent inhomogeneity of hopping transport, obtained from percolation theory.

  1. Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City

    PubMed Central

    Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.

    2008-01-01

    Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799

  2. The Hip-Hop club scene: Gender, grinding and sex.

    PubMed

    Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

    2007-01-01

    Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

  3. Small polaronic hole hopping mechanism and Maxwell-Wagner relaxation in NdFeO3

    NASA Astrophysics Data System (ADS)

    Ahmad, I.; Akhtar, M. J.; Younas, M.; Siddique, M.; Hasan, M. M.

    2012-10-01

    In the modern micro-electronics, transition metal oxides due to their colossal values of dielectric permittivity possess huge potential for the development of capacitive energy storage devices. In the present work, the dielectric permittivity and the effects of temperature and frequency on the electrical transport properties of polycrystalline NdFeO3, prepared by solid state reaction method, are discussed. Room temperature Mossbauer spectrum confirms the phase purity, octahedral environment for Fe ion, and high spin state of Fe3+ ion. From the impedance spectroscopic measurements, three relaxation processes are observed, which are related to grains, grain boundaries (gbs), and electrode-semiconductor contact in the measured temperature and frequency ranges. Decrease in resistances and relaxation times of the grains and grain boundaries with temperature confirms the involvement of thermally activated conduction mechanisms. Same type of charge carriers (i.e., small polaron hole hopping) have been found responsible for conduction and relaxation processes through the grain and grain boundaries. The huge value of the dielectric constant (˜8 × 103) at high temperature and low frequency is correlated to the Maxwell-Wagner relaxation due to electrode-sample contact.

  4. Electrophysical Properties of Onion-Like Carbon

    NASA Astrophysics Data System (ADS)

    Tkachev, E. N.; Romanenko, A. I.; Zhdanov, K. R.; Anikeeva, O. B.; Buryakov, T. I.; Kuznetsov, V. L.; Moseenkov, S. I.

    2016-06-01

    The paper examines electrophysical properties of onion-like carbon (OLC) samples, where particles have the average size of 4-8 nm and are formed by 5-10 nested fullerene-like spheres connected by 1-3 common curved graphene shells into aggregates with a size of 50-300 nm. We measured the temperature dependence of electrical resistance from 4.2 to 300 K and dependence of magnetoresistance in magnetic fields up to 6 T at the temperature of 4.2 K. Temperature dependences of electrical resistance of samples can be described within the framework of the Mott law with variable hop length for the one-dimensional case or within the framework of the Efros-Shklovskii Coulomb gap. We observed the quadratically increasing positive magnetoresistance up to 6 T associated with compression of wave functions of conduction electrons. Negative magnetoresistance was observed in the range of magnetic fields up to 1-2 T in the case of some samples. This is due to the fact that magnetic field suppresses the contributions to magnetoresistance made by interference effects in the area of hopping conductivity. The measurements were used to estimate the localization radius that is comparable to the diameter of OLC particles (nano-onions).

  5. Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States

    NASA Astrophysics Data System (ADS)

    Mendels, Dan; Organic Electronics Group Technion Team

    2014-03-01

    An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

  6. Magneto-transport properties of a random distribution of few-layer graphene patches

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu

    In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime.

  7. Carbon films embedded by nickel nanoparticles: The effect of deposition time on Berthelot-type hopping conduction parameters

    NASA Astrophysics Data System (ADS)

    Dalouji, Vali; Asareh, Nastaran; Hashemizadeh, Seyed Ali; Solaymani, Shahram

    2016-12-01

    In this paper, the electrical conductivity of carbon films embedded by nickel nanoparticles at different deposition times 50, 90, 180 and 600 s over a temperature range from 50 to 500 K was studied. The conductivity data in the temperature range T > 300 K shows the extended state conduction mechanism. The tunneling through a thermally vibrating barrier in the temperature range 50-150 K is described by the Berthelot-type conduction mechanism. It can be seen that the films deposited at 180 s have maximum conductivity and the Berthelot temperature is about 53.5 K. Due to the vibrations of Ni ions in the tetrahedral, sites the extents of the carrier wave function are lower than in the octahedral complexes sites which have maximum values of about 2.16 × 10^{-7} cm and 1.85 × 10^{-7} cm in the octahedral-metal stretching vibrations and intrinsic stretching vibrations of the metal ions at the tetrahedral site, respectively. On the other hand, the average distance between the sites in both vibrations at 180 s deposition modes have minimum values of 2.02 × 10^{-7} cm and 1.72 × 10^{-7} cm.

  8. Thermoelectric properties of Sr0.61Ba0.39Nb2O6-δ ceramics in different oxygen-reduction conditions

    NASA Astrophysics Data System (ADS)

    Li, Yi; Liu, Jian; Wang, Chun-Lei; Su, Wen-Bin; Zhu, Yuan-Hu; Li, Ji-Chao; Mei, Liang-Mo

    2015-04-01

    The thermoelectric properties of Sr0.61Ba0.39Nb2O6-δ ceramics, reduced in different conditions, are investigated in the temperature range from 323 K to 1073 K. The electrical transport behaviors of the samples are dominated by the thermal-activated polaron hopping in the low temperature range, the Fermi glass behavior in the middle temperature range, and the Anderson localized behavior in the high temperature range. The thermal conductivity presents a plateau at high-temperatures, indicating a glass-like thermal conduction behavior. Both the thermoelectric power factor and the thermal conductivity increase with the increase of the degree of oxygen-reduction. Taking these two factors into account, the oxygen-reduction can still contribute to promoting the thermoelectric figure of merit. The highest ZT value is obtained to be ˜0.19 at 1073 K in the heaviest oxygen reduced sample. Project supported by the National Basic Research Program of China (Grant No. 2013CB632506) and the National Natural Science Foundation of China (Grant Nos. 51202132 and 51002087).

  9. Chicano Hip-Hop as Interethnic Contact Zone

    ERIC Educational Resources Information Center

    McFarland, Pancho

    2008-01-01

    Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

  10. Frame error rate for single-hop and dual-hop transmissions in 802.15.4 LoWPANs

    NASA Astrophysics Data System (ADS)

    Biswas, Sankalita; Ghosh, Biswajit; Chandra, Aniruddha; Dhar Roy, Sanjay

    2017-08-01

    IEEE 802.15.4 is a popular standard for personal area networks used in different low-rate short-range applications. This paper examines the error rate performance of 802.15.4 in fading wireless channel. An analytical model is formulated for evaluating frame error rate (FER); first, for direct single-hop transmission between two sensor nodes, and second, for dual-hop (DH) transmission using an in-between relay node. During modeling the transceiver design parameters are chosen according to the specifications set for both the 2.45 GHz and 868/915 MHz bands. We have also developed a simulation test bed for evaluating FER. Some results showed expected trends, such as FER is higher for larger payloads. Other observations are not that intuitive. It is interesting to note that the error rates are significantly higher for the DH case and demands a signal-to-noise ratio (SNR) penalty of about 7 dB. Also, the FER shoots from zero to one within a very small range of SNR.

  11. Characterization of host-dependent mutations of apple fruit crinkle viroid replicating in newly identified experimental hosts suggests maintenance of stem-loop structures in the left-hand half of the molecule is important for replication.

    PubMed

    Suzuki, Takahiro; Fujibayashi, Misato; Hataya, Tatsuji; Taneda, Akito; He, Ying-Hong; Tsushima, Taro; Duraisamy, Ganesh Selvaraj; Siglová, Kristyna; Matoušek, Jaroslav; Sano, Teruo

    2017-03-01

    Apple fruit crinkle viroid (AFCVd) is a tentative member of the genus Apscaviroid, family Pospiviroidae. AFCVd has a narrow host range and is known to infect apple, hop and persimmon as natural hosts. In this study, tomato, cucumber and wild hop have been identified as new experimental herbaceous hosts. Foliar symptoms were very mild or virtually undetectable, but fruits of infected tomato were small, cracked and distorted. These symptoms resemble those observed on some AFCVd-sensitive apple cultivars. After transfer to tomato, cucumber and wild hop, sequence changes were detected in a natural AFCVd isolate from hop, and major variants in tomato, cucumber and wild hop differed in 10, 8 or 2 nucleotides, respectively, from the predominant one in the inoculum. The major variants in tomato and cucumber were almost identical, and the one in wild hop was very similar to the one in cultivated hop. Detailed analyses of the host-dependent sequence changes that appear in a naturally occurring AFCVd isolate from hop after transfer to tomato using small RNA deep sequence data and infectivity studies with dimeric RNA transcripts followed by progeny analysis indicate that the major AFCVd variant in tomato emerged by selection of a minor variant present in the inoculum (i.e. hop) followed by one to two host-dependent de novo mutations. Comparison of the secondary structures of major variants in hop, tomato and persimmon after transfer to tomato suggested that maintenance of stem-loop structures in the left-hand half of the molecule is critical for infection.

  12. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    PubMed

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  13. "Reaching the Hip-Hop Generation." The MEE Symposium (New York, New York, March 1-2, 1993). Final (Symposium Proceedings) Report.

    ERIC Educational Resources Information Center

    MEE Productions Inc., Philadelphia, PA. Research Div.

    This final report attempts to capture the work and atmosphere of the recent symposium convened by Motivational Educational Entertainment, Inc. (MEE), a black-owned communications research, consulting, and video production company. In its commitment to helping urban youth, MEE conducted a study of the "hip-hop" generation and its…

  14. Low-frequency dielectric properties of intrinsic and Al-doped rutile TiO{sub 2} thin films grown by the atomic layer deposition technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kassmi, M.; LMOP, El Manar University, Tunis 2092; Pointet, J.

    2016-06-28

    Dielectric spectroscopy is carried out for intrinsic and aluminum-doped TiO{sub 2} rutile films which are deposited on RuO{sub 2} by the atomic layer deposition technique. Capacitance and conductance are measured in the 0.1 Hz–100 kHz range, for ac electric fields up to 1 MV{sub rms}/cm. Intrinsic films have a much lower dielectric constant than rutile crystals. This is ascribed to the presence of oxygen vacancies which depress polarizability. When Al is substituted for Ti, the dielectric constant further decreases. By considering Al-induced modification of polarizability, a theoretical relationship between the dielectric constant and the Al concentration is proposed. Al doping drastically decreasesmore » the loss in the very low frequency part of the spectrum. However, Al doping has almost no effect on the loss at high frequencies. The effect of Al doping on loss is discussed through models of hopping transport implying intrinsic oxygen vacancies and Al related centers. When increasing the ac electric field in the MV{sub rms}/cm range, strong voltage non-linearities are evidenced in undoped films. The conductance increases exponentially with the ac field and the capacitance displays negative values (inductive behavior). Hopping barrier lowering is proposed to explain high-field effects. Finally, it is shown that Al doping strongly improves the high-field dielectric behavior.« less

  15. Photon hopping and nanowire based hybrid plasmonic waveguide and ring-resonator

    PubMed Central

    Gu, Zhiyuan; Liu, Shuai; Sun, Shang; Wang, Kaiyang; Lyu, Quan; Xiao, Shumin; Song, Qinghai

    2015-01-01

    Nanowire based hybrid plasmonic structure plays an important role in achieving nanodevices, especially for the wide band-gap materials. However, the conventional schemes of nanowire based devices such as nano-resonators are usually isolated from the integrated nano-network and have extremely low quality (Q) factors. Here we demonstrate the transmission of waves across a gap in hybrid plasmonic waveguide, which is termed as “photon hopping”. Based on the photon hopping, we show that the emissions from nanodevices can be efficiently collected and conducted by additional nanowires. The collection ratio can be higher than 50% for a wide range of separation distance, transverse shift, and tilt. Moreover, we have also explored the possibility of improving performances of individual devices by nano-manipulating the nanowire to a pseudo-ring. Our calculations show that both Q factor and Purcell factor have been increased by more than an order of magnitude. We believe that our researches will be essential to forming nanolasers and the following nano-networks.

  16. Unique dielectric dipole and hopping ion dipole relaxation in disordered systems

    NASA Astrophysics Data System (ADS)

    Govindaraj, G.

    2018-04-01

    Dielectric or ac conductivity measurements of dielectric and ion conducting glass and crystalline systems provide considerable insight into the nature of the dipolar and ionic motions in disordered solids. However, interpreting the dielectric or ac conductivity has been a matter of considerable debate based on the existing models and empirical formalism, particularly in regards to how best to represent the relaxation process that is the result of a transition from correlated to uncorrelated dipolar and ionic motions. A unique dipole interaction process has been proposed for the (a) dielectric dipole process (b) the hopping ion conducting dipole process and the (c) combination (a) and (b) for the description of dielectric spectra and ac conductivityspectra and results are reported.

  17. High-Speed Hopping: Time-Resolved Tomographic PIV Measurements of Water Flea Swimming

    NASA Astrophysics Data System (ADS)

    Murphy, D. W.; Webster, D. R.; Yen, J.

    2012-11-01

    Daphniids, also known as water fleas, are small, freshwater crustaceans that live in a low-to-intermediate Reynolds number regime. These plankters are equipped with a pair of branched, setae-bearing antennae that they beat to impulsively propel themselves, or ``hop,'' through the water. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. We present time-resolved tomographic PIV measurements of swimming by Daphnia magna. The body kinematics and flow physics of the daphniid hop are quantified. It is shown that the flow generated by each stroking antenna resembles an asymmetric viscous vortex ring. It is proposed that the flow produced by the daphniid hop can be modeled as a double Stokeslet consisting of two impulsively applied point forces separated by the animal width. The flow physics are discussed in the context of other species operating in the same Reynolds number range of 10 to 100: sea butterfly swimming and flight by the smallest flying insects.

  18. Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy.

    PubMed

    Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L

    2016-12-01

    Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD 0-200ms , and the knee extension moment was positively associated with RTD 0-200ms . At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD 0-200ms , and RTD 0-peak torque . Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance.

  19. Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy

    PubMed Central

    Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.

    2016-01-01

    Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD0-200ms, and the knee extension moment was positively associated with RTD0-200ms. At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD0-200ms, and RTD0–peak torque. Conclusion: Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Clinical Relevance: Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance. PMID:28210647

  20. Systematic assessment of scaffold hopping versus activity cliff formation across bioactive compound classes following a molecular hierarchy.

    PubMed

    Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

    2015-07-01

    Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. HOPPING CONDUCTIVITY AND MAGNETIC TRANSITIONS OF THE Cu2+ SPINS IN SINGLE-CRYSTAL La2CuO4+y

    NASA Astrophysics Data System (ADS)

    Thio, Tineke; Birgeneau, R. J.; Chen, C. Y.; Freer, B. S.; Gabbe, D. R.; Jenssen, H. P.; Kastner, M. A.; Picone, P. J.; Preyer, N. W.

    Measurements are reported of the magnetoresistance (MR) for fields up to 23T in La2CuO4+y single crystals in which the Cu2+ spins order antiferromagnetically at TN˜240K, and in which the conductivity at low temperature is characterised by hopping between localised states. Using the MR, we map out the phase diagram of the spin flop transition, observed when the magnetic field is applied parallel to the zero-field staggered magnetisation, and that of the weak-ferromagnetic transition, observed with the field perpendicular to the CuO planes. In both transitions the antiferromagnetic propagation vector changes from the ěca direction at zero field to the ěcc direction at the highest fields. This rather subtle change of the Cu spin ordering is accompanied by a large increase in the interlayer hopping conductivity: up to a factor 2. We show that the magnetoconductance is proportional to the three-dimensional staggered moment with propagation vector in the orthorhombic ěcc direction. The origin of this unusual behaviour is an important unsolved problem.

  2. The Helicopter Observation Platform for Marine and Continental Boundary Layer Studies

    NASA Astrophysics Data System (ADS)

    Avissar, R.; Broad, K.; Walko, R. L.; Drennan, W. M.; Williams, N. J.

    2016-02-01

    The University of Miami has acquired a commercial helicopter (Airbus H125) that was transformed into a one-of-a-kind Helicopter Observation Platform (HOP) that fills critical gaps in physical, chemical and biological observations of the environment. This new research facility is designed to carry sensors and instrument inlets in the undisturbed air in front of the helicopter nose at low airspeed and at various altitudes, from a few feet above the Earth's surface (where much of the climate and weather "action" takes place, and where we live) and up through the atmospheric boundary layer and the mid troposphere. The HOP, with its hovering capability, is also ideal for conducting various types of remote-sensing observations. It provides a unique and essential component of airborne measurement whose purpose, among others, is to quantify the exchanges of gases and energy at the Earth surface, as well as aerosol properties that affect the environment, the climate system, and human health. For its first scientific mission, an eddy-correlation system is being mounted in front of its nose to conduct high-frequency measurements of turbulence variables relevant to atmospheric boundary layer studies.Fully fueled and with both pilot and co-pilot on board, the HOP can carry a scientific payload of up to about 1,000 lbs internally (about 3,000 lbs externally) and fly for nearly 4 hours without refueling at an airspeed of 65 knots ( 30 m/s) that is ideal for in-situ observations. Its fast cruising speed is about 140 knots andits range, at that speed, is about 350 nautical miles. This specific helicopter was chosen because of its flat floor design, which is particularly convenient for installing scientific payload and also because of its high-altitude capability (it is the only commercial helicopter that ever landed at the top of Mt Everest).The HOP is available to the entire scientific community for any project that is feasible from a flight safety point of view and that fulfills the flight regulations of the country that it is flown in. It can be easily transported anywhere in the world and can also be operated from a properly equipped ship at sea foroceanographic research.

  3. Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

    NASA Astrophysics Data System (ADS)

    Beyer, Eric W.

    The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions is shown to validate the dynamic model. Using the validated dynamic model, simulations were performed to better understand the dynamics of the device. In addition, key parameters such as system weight, rotor speed, internal mass weight and location, as well as battery capacity are varied to explore and optimize flight performance characteristics such as single hop height and range, number of hops, and total achievable range. The sensitivity of the Hopping Rotochute to atmospheric winds is also investigated as is the ability of the device to perform trajectory shaping.

  4. Phase sensitive molecular dynamics of self-assembly glycolipid thin films: A dielectric spectroscopy investigation

    NASA Astrophysics Data System (ADS)

    Velayutham, T. S.; Ng, B. K.; Gan, W. C.; Majid, W. H. Abd.; Hashim, R.; Zahid, N. I.; Chaiprapa, Jitrin

    2014-08-01

    Glycolipid, found commonly in membranes, is also a liquid crystal material which can self-assemble without the presence of a solvent. Here, the dielectric and conductivity properties of three synthetic glycolipid thin films in different thermotropic liquid crystal phases were investigated over a frequency and temperature range of (10-2-106 Hz) and (303-463 K), respectively. The observed relaxation processes distinguish between the different phases (smectic A, columnar/hexagonal, and bicontinuous cubic Q) and the glycolipid molecular structures. Large dielectric responses were observed in the columnar and bicontinuous cubic phases of the longer branched alkyl chain glycolipids. Glycolipids with the shortest branched alkyl chain experience the most restricted self-assembly dynamic process over the broad temperature range studied compared to the longer ones. A high frequency dielectric absorption (Process I) was observed in all samples. This is related to the dynamics of the hydrogen bond network from the sugar group. An additional low-frequency mechanism (Process II) with a large dielectric strength was observed due to the internal dynamics of the self-assembly organization. Phase sensitive domain heterogeneity in the bicontinuous cubic phase was related to the diffusion of charge carriers. The microscopic features of charge hopping were modelled using the random walk scheme, and two charge carrier hopping lengths were estimated for two glycolipid systems. For Process I, the hopping length is comparable to the hydrogen bond and is related to the dynamics of the hydrogen bond network. Additionally, that for Process II is comparable to the bilayer spacing, hence confirming that this low-frequency mechanism is associated with the internal dynamics within the phase.

  5. Hip hopping the gap--performing arts approaches to sexual health disadvantage in young people in remote settings.

    PubMed

    Crouch, Alan; Robertson, Heather; Fagan, Patricia

    2011-07-01

    Closing the gap in Indigenous health and wellbeing in remote settings in the Torres Strait and Northern Peninsula Area of Far North Queensland (FNQ) includes addressing a well-documented sexual health disadvantage among young people. Community mobilization around the underlying risk factors influencing sexual health is required. Performing-arts-based workshops were conducted in schools and after-school venues in four remote Aboriginal and Torres Strait islander locations in FNQ in early 2010, to initiate consciousness-raising around the real dimensions of youth sexual health risk. Specific objectives included strengthening operational partnerships at school-level and developing ongoing consultative processes in each location for sexual health reference group development. Results include a significantly strengthened productive partnership with primary and high schools in each location and sixteen production-ready hip hop songs exploring a range of physical, emotional and sexual health themes authored by the students and recorded on site. Additional outcomes included the willingness of community councils and civil society organizations to support local sexual health reference group activity. This initiative, the Indigenous Hip Hop Project, although accompanied by opportunity costs including alternative, more core business uses of staff time and program budget, has demonstrated the power of tapping the creative energy of young people at risk and the potential for mobilizing communities to activism around sexual health disadvantage.

  6. Performance of multi-hop parallel free-space optical communication over gamma-gamma fading channel with pointing errors.

    PubMed

    Gao, Zhengguang; Liu, Hongzhan; Ma, Xiaoping; Lu, Wei

    2016-11-10

    Multi-hop parallel relaying is considered in a free-space optical (FSO) communication system deploying binary phase-shift keying (BPSK) modulation under the combined effects of a gamma-gamma (GG) distribution and misalignment fading. Based on the best path selection criterion, the cumulative distribution function (CDF) of this cooperative random variable is derived. Then the performance of this optical mesh network is analyzed in detail. A Monte Carlo simulation is also conducted to demonstrate the effectiveness of the results for the average bit error rate (ABER) and outage probability. The numerical result proves that it needs a smaller average transmitted optical power to achieve the same ABER and outage probability when using the multi-hop parallel network in FSO links. Furthermore, the system use of more number of hops and cooperative paths can improve the quality of the communication.

  7. Electrical conduction mechanism of LaNi{sub x}Me{sub 1−x}O{sub 3−δ} (Me = Fe, Mn)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niwa, Eiki, E-mail: e-niwa@phys.chs.nihon-u.ac.jp; Department of Integrated Sciences in Physics and Biology, College of Humanities and Sciences, Nihon University, Setagaya-ku, Tokyo 156-8550; Maeda, Hiroki

    Graphical abstract: Compositional dependence of (a) electrical conductivity and (b) E{sub a} for hopping conduction of LaNi{sub x}Me{sub 1−x}O{sub 3} (Me = Fe, Mn). - Highlights: • Electrical conduction mechanism of LaNi{sub x}Me{sub 1−x}O{sub 3} (Me = Fe, Mn) was investigated. • Hopping conduction model could be applied for conductivity of both specimens. • The difference of E{sub a} due to that of energy level of Fe and Mn was observed. • Hole concentration estimated by iodimetry increases with increasing Ni content. - Abstract: Electrical conduction mechanism of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} expected as Sr-freemore » new cathode material for solid oxide fuel cells was analyzed. Electrical conduction behaviors of both specimens could be well fitted by small polaron hopping conduction model. The electrical conductivity of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} increased with increasing Ni content, showing agreement with decrease of activation energy for hopping conduction. The decrease of electrical conductivity and increase of activation energy of LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} were observed with increasing Ni content for 0.0 ≤ x ≤ 0.4. Further Ni substitution increased electrical conductivity and decreased activation energy for 0.4 ≤ x ≤ 0.6. It was revealed using iodometry that the difference of hole carrier density between LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} was small. It was suspected that the origin of the difference of electrical conduction behavior of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1-x}O{sub 3+δ} was difference of energy level of e{sub g} band composed of Fe 3d or Mn 3d orbitals and their overlapping quantity with O 2p and Ni 3d band.« less

  8. Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

    ERIC Educational Resources Information Center

    Alim, H. Samy

    2011-01-01

    This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

  9. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

    ERIC Educational Resources Information Center

    Love, Bettina L.

    2015-01-01

    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  10. Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes

    PubMed Central

    Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

    2017-01-01

    Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types. Conclusion: The single-leg hop tests and isokinetic strength measurements were both useful for a bilateral comparison of knee functional performance and strength. Knee flexion strength deficits and flexion-to-extension ratios seemed to be correlated with single-leg hop test performance. There was no difference in postoperative hop test performance or knee strength according to graft type. PMID:29164167

  11. Electronic correlation effects and the Coulomb gap at finite temperature.

    PubMed

    Sandow, B; Gloos, K; Rentzsch, R; Ionov, A N; Schirmacher, W

    2001-02-26

    We have investigated the effect of the long-range Coulomb interaction on the one-particle excitation spectrum of n-type germanium, using tunneling spectroscopy on mechanically controllable break junctions. At low temperatures, the tunnel conductance shows a minimum at zero bias voltage due to the Coulomb gap. Above 1 K, the gap is filled by thermal excitations. This behavior is reflected in the variable-range hopping resistivity measured on the same samples: up to a few degrees Kelvin the Efros-Shklovskii lnR infinity T(-1/2) law is obeyed, whereas at higher temperatures deviations from this law occur. The type of crossover differs from that considered previously in the literature.

  12. Impedance spectroscopy study of 2, 2, 7, 7' -tetra kis-(N,N-di-4-methoxy phenyl amino)-9,9'-spirobifluorene thin films

    NASA Astrophysics Data System (ADS)

    Rana, Omwati; Agrawal, Kalpana; Rajput, S. S.; Zulfequar, M.; Husain, M.; Kamalasanan, M. N.; Srivastava, Ritu

    2016-05-01

    The electrical properties of thermally evaporated film of 2,2,7,7'-tetrakis-(N,N-di-4-methoxyphenylamino)-9,9'-spirobifluorene (Spiro MeO TAD) have been investigated for hole only devices as a function of temperatures at frequency range from 1Hz to 1 MHz using Impedance spectroscopy. Cole-Cole plots, at each temperature, show semicircles that can be modeled with a contact resistance and parallel resistance -capacitor(R-C) circuits. Bulk resistance decreases and electrical conductivity increases with increasing temperature which indicate negative temperature coefficient of resistance nature and short range translational type hopping mechanism in Spiro MeO TAD thin films.

  13. Dielectric study of chalcogenide (Se80Te20)94Ge6 glass

    NASA Astrophysics Data System (ADS)

    Sharma, Neha; Patial, Balbir Singh; Thakur, Nagesh

    2018-04-01

    In the present study, dielectric characteristics specifically dielectric constant (ɛ'), dielectric loss (ɛ″) and AC conductivity (σAC) have been investigated for chalcogenide (Se80Te20)94Ge6 glass in the frequency range from 1Hz to 1MHz and within the temperature range from 300 K to 380 K. ɛ'(ω) and ɛ″(ω) are found to be frequency and temperature dependent. This behaviour is interpreted on the basis of Guintini's theory of dielectric dispersion. The investigated glass obeys the power law ωs (s<1) and decreases as temperature rises. The obtained results are discussed in terms of the correlation barrier hopping (CBH) model proposed by Elliot.

  14. Steerable Hopping Six-Legged Robot

    NASA Technical Reports Server (NTRS)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that indicates the amount by which the spool has been turned. When the robot is ready to hop, the electromagnetic clutch disengages the motor from the spool, thus releasing the cable restraints on the springs and allowing the springs to extend all six legs simultaneously.

  15. Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.

    PubMed

    Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J

    2006-04-01

    A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.

  16. Study of electrical conductivity and memory switching in the zinc-vanadium-phosphate glasses

    NASA Astrophysics Data System (ADS)

    Mirzayi, M.; Hekmatshoar, M. H.

    2013-07-01

    Vanadium zinc phosphate glasses were prepared by the conventional melt quenching technique and effect of V2O5 concentration on d.c. conductivity of prepared samples were investigated. X-ray diffraction patterns confirmed the glassy character of the samples. The d.c. conductivity increased with increase in V2O5 content. Results showed that activation energy has a single value in the investigated range of temperature, which can be explained in accordance with Mott small pollaron hopping model. I-V characteristics at high electric field showed that switching in these glasses was memory type. The threshold field of switching was found to decrease with increase in V2O5 content. Non-linear behavior and switching phenomenon was explained by Pool-Frenkel effect and thermal model.

  17. Possible origin of nonlinear conductivity and large dielectric constant in the commensurate charge-density-wave phase of 1 T -TaS2

    NASA Astrophysics Data System (ADS)

    Ma, Yongchang; Hou, Yanhui; Lu, Cuimin; Li, Lijun; Petrovic, Cedomir

    2018-05-01

    The electric field dependence of the dielectric properties and the nonlinear conductance of 1 T -TaS2 below 50 K has been investigated. A large dielectric constant of about 104 is obtained up to 107 Hz, which cannot be attributed to hopping of the localized carriers alone, the collective excitations of the commensurate charge-density-wave must be another contributor. The dielectric spectra disperse slightly in our measured temperature and frequency range. At a moderate dc bias field, the real part of the dielectric constant ɛ1(ω ) decreases. We propose that the separation of bound soliton-antisoliton pairs may be a contributor to the reduction of ɛ1(ω ) and the accompanying nonlinear conductivity with increasing dc bias.

  18. Detrending with Empirical Mode Decomposition (DEMD): Theory, Evaluation, and Application

    NASA Astrophysics Data System (ADS)

    Bolch, Michael Adam

    Land-surface heterogeneity (LSH) at different scales has significant influence on atmospheric boundary layer (ABL) buoyant and shear turbulence generation and transfers of water, carbon and heat. The extent of proliferation of this influence into larger-scale circulations and atmospheric structures is a topic continually investigated in experimental and numerical studies, in many cases with the hopes of improving land-atmosphere parameterizations for modeling purposes. The blending height is a potential metric for the vertical propagation of LSH effects into the ABL, and has been the subject of study for several decades. Proper assessment of the efficacy of blending height theory invites the combination of observations throughout ABLs above different LSH scales with model simulations of the observed ABL and LSH conditions. The central goal of this project is to develop an apt and thoroughly scrutinized method for procuring ABL observations that are accurately detrended and justifiably relevant for such a study, referred to here as Detrending with Empirical Mode Decomposition (DEMD). The Duke University helicopter observation platform (HOP) provides ABL data [wind (u, v, and w), temperature ( T), moisture (q), and carbon dioxide (CO 2)] at a wide range of altitudes, especially in the lower ABL, where LSH effects are most prominent, and where other aircraft-based platforms cannot fly. Also, lower airspeeds translate to higher resolution of the scalars and fluxes needed to evaluate blending height theory. To confirm noninterference of the main rotor downwash with the HOP sensors, and also to identify optimal airspeeds, analytical, numerical, and observational studies are presented. Analytical analysis clears the main rotor downwash from the HOP nose at airspeeds above 10 m s-1. Numerical models find an acceptable range from 20-40 m s-1, due to a growing compressed air preceding the HOP nose. The first observational study finds no impact of different HOP airspeeds on measurements from ˜18 m s -1 to ˜55 m s-1 over a stable marine boundary layer (MBL). Another set of observations studies HOP and tower data, using the Duke University Mobile Micrometeorological Station (MMS) over an MBL, and concludes that HOP sensible heat (SH), latent heat (LE), and carbon dioxide (F CO2) fluxes align well with MMS findings. The HOP sensors provide ABL data at 40 Hz, as well as a real-time display of theta for in-flight ABL height estimation. Sensor calibration and alignment procedures indicate usable ABL measurements. HOP data are especially susceptible to the spurious influence of platform motion on ABL data, largely due to the low-altitude and low-airspeed capabilities of the HOP. For example, HOP altitude motion in the presence of a lapse rate can cause spurious T fluctuations. Empirical mode decomposition (EMD) can separate HOP data into a set of adaptive and unique intrinsic mode functions (IMFs), often with physical meaning. DEMD aims to correct for spurious contributions to HOP data, while merging EMD with a correlation analysis to adjust data without eliminating relevant ABL dynamics. To evaluate DEMD efficacy, two-dimensional synthetic T fields with simulated turbulence over a prescribed lapse rate are sampled with altitude fluctuations similar to HOP flights, and with a wide range of T perturbation and sampling path parameter variations. DEMD recovers the prescribed lapse rate within 1% on average for the 552 test cases passing the filtering criteria. The method is further evaluated via application to vertical cross sections taken from the Ocean-Land-Atmosphere Model (OLAM) large-eddy simulation (LES) results, where DEMD shows improved accuracy of SH recovery. DEMD is applied to three low-altitude HOP flight legs flown on 19 June 2007 during the Cloud and Land Surface Interaction Campaign (CLASIC), both as an example of practical application and to compare DEMD to the initially proposed method (Holder et al. 2011, hereafter H11). H11 dictates the elimination of correlated IMFs, along with other subtle differences from DEMD, which also eliminates any ABL motions embedded in those IMFs. As suspected, the H11 method produces marked reductions of variances and turbulence kinetic energy (TKE) and substantial deviations in SH, LE, and FCO2 compared to DEMD. DEMD detrends without unnecessary elimination. DEMD is vital for ensuring accurate scalars and fluxes from HOP data, and a strategy for future research is presented that integrates properly detrended observations from the CLASIC HOP dataset with OLAM simulations to explore LSH effects on ABL processes and evaluate blending height theory.

  19. Type III Effector Diversification via Both Pathoadaptation and Horizontal Transfer in Response to a Coevolutionary Arms Race

    PubMed Central

    Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S

    2006-01-01

    The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219

  20. Temperature gating and competing temperature-dependent effects in DNA molecular wires

    NASA Astrophysics Data System (ADS)

    Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

    2017-02-01

    While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

  1. Transition temperature from band to hopping direct current conduction in crystalline semiconductors with hydrogen-like impurities: Heat versus Coulomb attraction

    NASA Astrophysics Data System (ADS)

    Poklonski, N. A.; Vyrko, S. A.; Poklonskaya, O. N.; Zabrodskii, A. G.

    2011-12-01

    For nondegenerate bulk semiconductors, we have used the virial theorem to derive an expression for the temperature Tj of the transition from the regime of "free" motion of electrons in the c-band (or holes in the υ-band) to their hopping motion between donors (or acceptors). Distribution of impurities over the crystal was assumed to be of the Poisson type, while distribution of their energy levels was assumed to be of the Gaussian type. Our conception of the virial theorem implementation is that the transition from the band-like conduction to hopping conduction occurs when the average kinetic energy of an electron in the c-band (hole in the υ-band) is equal to the half of the absolute value of the average energy of the Coulomb interaction of an electron (hole) with the nearest neighbor ionized donor (acceptor). Calculations of Tj according to our model agree with experimental data for crystals of Ge, Si, diamond, etc. up to the concentrations of a hydrogen-like impurity, at which the phase insulator-metal transition (Mott transition) occurs. Under the temperature Th ≈ Tj /3, when the nearest neighbor hopping conduction via impurity atoms dominates, we obtained expressions for the electrostatic field screening length Λh in the Debye-Hückel approximation, taking into account a nonzero width of the impurity energy band. It is shown that the measurements of quasistatic capacitance of the semiconductor in a metal-insulator-semiconductor structure in the regime of the flat bands at the temperature Th allow to determine the concentration of doping impurity or its compensation ratio by knowing Λh.

  2. Studies on frequency dependent electrical and dielectric properties of sintered zinc oxide pellets: effects of Al-doping

    NASA Astrophysics Data System (ADS)

    Tewari, S.; Ghosh, A.; Bhattacharjee, A.

    2016-11-01

    Sintered pellets of zinc oxide (ZnO), both undoped and Al-doped are prepared through a chemical process. Dopant concentration of Aluminium in ZnO [Al/Zn in weight percentage (wt%)] is varied from 0 to 3 wt%. After synthesis structural characterisation of the samples are performed with XRD and SEM-EDAX which confirm that all the samples are of ZnO having polycrystalline nature with particle size from 108.6 to 116 nm. Frequency dependent properties like a.c. conductivity, capacitance, impedance and phase angle are measured in the frequency range 10 Hz to 100 kHz as a function of temperature (in the range 25-150 °C). Nature of a.c. conductivity in these samples indicates hopping type of conduction arising from localised defect states. The frequency and temperature dependent properties under study are found to be as per correlated barrier hoping model. Dielectric and impedance properties studied in the samples indicate distributed relaxation, showing decrease of relaxation time with temperature.

  3. Ac conductivity and dielectric properties of bulk tin phthalocyanine dichloride (SnPcCl 2)

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Farid, A. M.; Abd El-Rahman, K. F.; Ali, H. A. M.

    2008-07-01

    The ac conductivity, σac( ω), has been measured for bulk tin phthalocyanine dichloride (SnPcCl 2) in the form of compressed pellet with evaporated ohmic Au electrodes in a temperature range 303-403 K. Ac conductivity, σac( ω), is found to vary as ωs in the frequency range 42 Hz-5×10 6 Hz. At low range of frequency, s<1 and it decreases with the increase in temperature indicating a dominant hopping process. At high range of frequency, s is found to be equal to ≈1.09 and is temperature independent. The dielectric constant, ε1, and dialectic loss, ε2, have been determined for bulk SnPcCl 2. Both ε1 and ε2 decrease with the increase in frequency and increase with the increase in temperature. The Cole-Cole types have been used to determine some parameters such as; the macroscopic relaxation time ( τo), the molecular relaxation time ( τ), the activation energy for relaxation ( Eo) and the distribution parameter ( α). The temperature dependence of τ is expressed by a thermally activated process with the activation energy of 0.299 eV.

  4. Optoelectrical, structural and morphological characterization of Cu2ZnSnSe4 compound used in photovoltaic applications

    NASA Astrophysics Data System (ADS)

    Mesa, F.; Leguizamon, A.; Dussan, A.; Gordillo, G.

    2016-10-01

    In this work, results are reported concerning the effect of the deposition parameters on the structural properties of Cu2ZnSnSe4 (CZTSe) thin films, grown through a chemical reaction of the metallic precursors by co-evaporation in a two-stage process. XRD measurements revealed that the samples deposited by selenization of Cu and Sn grow in the kesterite phase (CZTSe), respectively. Effect of the deposition temperature and mass ratio Cu/ZnSe on the transport properties of CZTSe films were analyzed. It was also found that the electrical conductivity of the thin films is affected by the transport of free carriers in extended states of the conduction band as well as for variable range hopping transport mechanisms, each one predominating in a different temperature range. The molecular and morphological effect on the compound through Raman and AFM measurements was studied.

  5. The influence of oxidation time on the properties of oxidized zinc films

    NASA Astrophysics Data System (ADS)

    Rambu, A. P.

    2012-09-01

    The effect of oxidation time on the structural characteristics and electronic transport mechanism of zinc oxide thin films prepared by thermal oxidation, have been investigated. Zinc metallic films were deposited by thermal evaporation under vacuum, the subsequent oxidation of Zn films being carried out in open atmosphere. XRD and AFM analysis indicate that obtained films posses a polycrystalline structure, the crystallites having a preferential orientation. Structural analysis reveals that microstructure of the films (crystallite size, surface roughness, internal stress) is depending on the oxidation time of metallic films. The electrical behavior of ZnO films was investigated, during a heat treatment (two heating/cooling cycles). It was observed that after the first heating, the temperature dependences of electrical conductivity become reversible. Mott variable range hopping model was proposed to analyze the temperature dependence of the electrical conductivity, in low temperature ranges. Values of some characteristic parameters were calculated.

  6. Thermopower of molecular junctions: Tunneling to hopping crossover in DNA

    NASA Astrophysics Data System (ADS)

    Korol, Roman; Kilgour, Michael; Segal, Dvira

    2016-12-01

    We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].

  7. Charge transport in molecular junctions: From tunneling to hopping with the probe technique

    NASA Astrophysics Data System (ADS)

    Kilgour, Michael; Segal, Dvira

    2015-07-01

    We demonstrate that a simple phenomenological approach can be used to simulate electronic conduction in molecular wires under thermal effects induced by the surrounding environment. This "Landauer-Büttiker's probe technique" can properly replicate different transport mechanisms, phase coherent nonresonant tunneling, ballistic behavior, and hopping conduction. Specifically, our simulations with the probe method recover the following central characteristics of charge transfer in molecular wires: (i) the electrical conductance of short wires falls off exponentially with molecular length, a manifestation of the tunneling (superexchange) mechanism. Hopping dynamics overtakes superexchange in long wires demonstrating an ohmic-like behavior. (ii) In off-resonance situations, weak dephasing effects facilitate charge transfer, but under large dephasing, the electrical conductance is suppressed. (iii) At high enough temperatures, kBT/ɛB > 1/25, with ɛB as the molecular-barrier height, the current is enhanced by a thermal activation (Arrhenius) factor. However, this enhancement takes place for both coherent and incoherent electrons and it does not readily indicate on the underlying mechanism. (iv) At finite-bias, dephasing effects may impede conduction in resonant situations. We further show that memory (non-Markovian) effects can be implemented within the Landauer-Büttiker's probe technique to model the interaction of electrons with a structured environment. Finally, we examine experimental results of electron transfer in conjugated molecular wires and show that our computational approach can reasonably reproduce reported values to provide mechanistic information.

  8. Hops (Humulus lupulus L.) Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

    PubMed Central

    Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy

    2017-01-01

    Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284

  9. Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times.

    PubMed

    Ahmadi, Sheida; Bowles, Richard K

    2017-04-21

    Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

  10. Unified conduction mechanism in unconventional VZnCaFeO glasses

    NASA Astrophysics Data System (ADS)

    Ahmed, E. M.; Abdel-Wahab, F.

    2014-09-01

    Unconventional glasses with (70-x)%V2O5 - x%ZnO-10%CaO-20%FeO compositions (where x=0, 2.5, 5, 7.5, 10, 12.5 and 15 mol %) were prepared by a normal melt-quench technique. We investigated the DC and AC conductivities of these glasses as functions of temperature and frequency. We have noted that activation energy and pre-exponential factor of the DC conductivity both vary with composition and satisfy Meyer-Neldel rule (MNR). The AC conductivity exhibited a universal dynamic response: σAC=Aωs. The obtained results of the DC, AC and exponent factor S were discussed in terms of the modified correlated barrier hopping model, which assumes that the relaxation time should contain a Meyer-Neldel rule term. An agreement between experimental and theoretical results suggests that the conduction mechanism could be hopping of polarons over barriers.

  11. AC conductivity and Dielectric Study of Chalcogenide Glasses of Se-Te-Ge System

    NASA Astrophysics Data System (ADS)

    Salman, Fathy

    2004-01-01

    The ac conductivity and dielectric properties of glassy system SexTe79 - xGe21, with x = 11, 14, 17 at.%, has been studied at temperatures 300 to 450 K and over a wide range of frequencies (50 Hz to 500 kHz). Experimental results indicate that the ac conductivity and the dielectric constants depend on temperature, frequency and Se content. The conductivity as a function of frequency exhibited two components: dc conductivity s dc, and ac conductivity s ac, where s ac ˜ w s. The mechanism of ac conductivity can be reasonably interpreted in terms of the correlated barrier hopping model (CBH). The activation energies are estimated and discussed. The dependence of ac conductivity and dielectric constants on the Se content x can be interpreted as the effect of Se fraction on the positional disorder. The impedance plot at each temperature appeared as a semicircle passes through the origin. Each semicircle is represented by an equivalent circuit of parallel resistance Rb and capacitance Cb.

  12. Electrical conductivity and modulus formulation in zinc modified bismuth boro-tellurite glasses

    NASA Astrophysics Data System (ADS)

    Dhankhar, Sunil; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Punia, R.; Kishore, N.

    2016-09-01

    The ac conductivity of zinc modified tellurium based quaternary glasses having composition 60 TeO2-10 B2O3-(30 - x) Bi2O3-x ZnO; x = 10, 15, 20, 25 and 30 has been investigated in the frequency range 10-1-105 Hz and in temperature range 483-593 K. Frequency and temperature dependent ac conductivity found to obey Jonscher power law modified by Almond-West. DC conductivity, crossover frequency and frequency exponent have been estimated from the fitting of the experimental data of conductivity with Jonscher power law modified by Almond-West. The ac conductivity and its frequency exponent have been analyzed by various theoretical models. In presently studied glasses ac conduction takes place via tunneling of overlapping large polaron tunneling. Activation energy is found to be increased with increase in zinc content and dc conduction takes place via variable range hopping proposed by Mott with some modification suggested by Punia et al. The value of the stretched exponent ( β) obtained by fitting of M^' ' }} reveals the presence of non-Debye type relaxation. Scaling spectra of ac conductivity and electric modulus collapse into a single master curve for all compositions and temperatures, reveals the presence of composition and temperature independent conduction and relaxation process in these glasses. Activation energy of conduction ( W) and electric modulus ( E R ) are nearly equal, indicating that polaron have to overcome the same energy barrier during conduction as well as relaxation processes.

  13. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    NASA Astrophysics Data System (ADS)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  14. Cyclic electrical conductivity in BaTiO3-PbTiO3-V2O5 glass-ceramic nanocomposite

    NASA Astrophysics Data System (ADS)

    Bahgat, A. A.; Heikal, Sh.; Mahdy, Iman A.; Abd-Rabo, A. S.; Abdel Ghany, A.

    2014-08-01

    In this present work a glass of the composition 22.5 BaTiO3+7.5 PbTiO3+70 V2O5 was prepared by applying the conventional melt quashing technique. Isothermal annealing of the glass was applied at 732 K following differential scanning calorimetric analysis. The annealing was performed during different time intervals in the range of 0.25-24.0 h. X-ray diffraction and transmission electron microscopy were used to identify different phases as well as particle size precipitated during the annealing process. Nanocomposite glass-ceramic precipitation was recognized with nonperiodic cyclic particle sizes as a function of the annealing period. DC electrical conductivity, on the other hand, was conducted in the temperature range from 300 to 625 K. Electrical conductivity enhancement of the order 3×103 times after 2.5 h of annealing was observed. Nonperiodic cyclic DC electrical conductivity behavior was also observed and which was encountered in a reverse manner with particle size development. Furthermore, the analysis of the electrical conduction mechanism predicts that both adiabatic and nonadiabatic small polaron hopping trend may describe the experimental data depending on the particle size.

  15. On the AC-conductivity mechanism in nano-crystalline Se79-xTe15In6Pbx (x = 0, 1, 2, 4, 6, 8 and 10) alloys

    NASA Astrophysics Data System (ADS)

    Anjali; Patial, Balbir Singh; Bhardwaj, Suresh; Awasthi, A. M.; Thakur, Nagesh

    2017-10-01

    In-depth analysis of complex AC-conductivity for nano-crystalline Se79-xTe15In6Pbx (x = 0, 1, 2, 4, 6, 8 and 10 at wt%) alloys is made in the temperature range 308-423 K and over the frequency range 10-1-107 Hz, to understand the conduction mechanism. The investigated nano-crystalline alloys were prepared by melt-quench technique. Sharp structural peaks in X-ray diffraction pattern indicate the nano-crystalline nature, which is also confirmed by FESEM. The AC conductivity shows universal characteristics and at higher frequency a transition from dc to dispersive behavior occurs. Moreover, it is confirmed that ac conductivity (σac) obeys the Jonscher power law as ωs (s< 1). The obtained results are analyzed in the light of various theoretical models. The correlated barrier hopping (CBH) model associated with non-intimate valence alternation pairs (NVAP's) is found most appropriate to describe the conduction mechanisms in these alloys. In addition, the CBH model description reveals that the bipolaron (single polaron) transport dominates at lower (higher) temperature. The density of localized states has also been deduced.

  16. Bluetooth and security

    NASA Astrophysics Data System (ADS)

    Ivo, Penn

    2004-04-01

    Bluetooth is the new emerging technology for wireless communication. It can be used to connect almost any device to another device. The traditional example is to link a Personal Digital Assistant (PDA) or a laptop to a mobile phone. That way you can easily take remote connections with your PDA or laptop without getting your mobile phone from your pocket or messing around with cables. A Class 3 Bluetooth device has range of 0,1 - 10 meters. The architecture of Bluetooth is formed by the radio, the base frequency part and the Link Manager. Bluetooth uses the radio range of 2.45 GHz. The theoretical maximum bandwidth is 1 Mb/s, which is slowed down a bit by Forward Error Correction (FEC). Bluetooth specification designates the frequency hopping to be implemented with Gaussian Frequency Shift Keying (GFSK). The base frequency part of the Bluetooth architecture uses a combination of circuit and packet switching technologies. Bluetooth can support either one asynchronous data channel and up to three simultaneous synchronous speech channels, or one channel that transfers asynchronous data and synchronous speech simultaneously. The Link Manager is an essential part of the Bluetooth architecture. It uses Link Manager Protocol (LMP) to configure, authenticate and handle the connections between Bluetooth devices. Several Bluetooth devices can form an ad hoc network. In these piconets, one of the Bluetooth devices will act as a master and the others are slaves. The master sets the frequency-hopping behavior of the piconet. It is also possible to connect up to 10 piconets to each other to form so-called scatternets. Bluetooth has been designed to operate in noisy radio frequency environments, and uses a fast acknowledgement and frequency-hopping scheme to make the link robust, communication-wise. Bluetooth radio modules avoid interference from other signals by hopping to a new frequency after transmitting or receiving a packet. Compared with other systems operating in the same frequency band, the Bluetooth radio typically hops faster and uses shorter packets. This is because short packages and fast hopping limit the impact of microwave ovens and other sources of disturbances. Use of Forward Error Correction (FEC) limits the impact of random noise on long-distance links. Bluetooth transmissions are secure in a business and home environment. Bluetooth has built in sufficient encryption and authentication and is thus very secure in any environment. In addition to this, a frequency-hopping scheme with 1600 hops/sec. is employed. This is far quicker than any other competing system. This, together with an automatic output power adaption to reduce the range exactly to requirement, makes the system extremely difficult to eavesdrop. Information Integrity in Bluetooth has these components: Random Number Generation, Encryption, Encryption Key Management and Authentication.

  17. Relaxation processes and conduction mechanism in bismuth ferrite lead titanate composites

    NASA Astrophysics Data System (ADS)

    Sahu, Truptimayee; Behera, Banarji

    2018-02-01

    In this study, samarium (Sm)-doped multiferroic composites of 0.8BiSmxFe1-xO3-0.2PbTiO3 where x = 0.05, 0.10, 0.15, and 0.20 were prepared via the conventional solid state reaction route. The electrical properties of these composites were analyzed using an impedance analyzer over a wide range of temperatures and frequencies (102-106 Hz). The impedance and modulus analyses confirmed the presence of both bulk and grain boundary effects in the materials. The temperature dependence of impedance and modulus spectrum indicated the negative temperature coefficient of resistance behavior. The dielectric relaxation exhibited non-Debye type behavior and it was temperature dependent. The relaxation time (τ) and DC conductivity followed an Arrhenius type behavior. The frequency-dependent AC conductivity obeyed Jonscher's power law. The correlated barrier hopping model was appropriate to understand the conduction mechanism in the composites considered.

  18. Nonlinear conductivity in silicon nitride

    NASA Astrophysics Data System (ADS)

    Tuncer, Enis

    2017-08-01

    To better comprehend electrical silicon-package interaction in high voltage applications requires full characterization of the electrical properties of dielectric materials employed in wafer and package level design. Not only the packaging but wafer level dielectrics, i.e. passivation layers, would experience high electric fields generated by the voltage applied pads. In addition the interface between the passivation layer and a mold compound might develop space charge because of the mismatch in electrical properties of the materials. In this contribution electrical properties of a thin silicon nitride (Si3N4) dielectric is reported as a function of temperature and electric field. The measured values later analyzed using different temperature dependent exponential expressions and found that the Mott variable range hopping conduction model was successful to express the data. A full temperature/electric field dependency of conductivity is generated. It was found that the conduction in Si3N4 could be expressed like a field ionization or Fowler-Nordheim mechanism.

  19. Carrier Transport and Effective Barrier Height of Low Resistance Metal Contact to Highly Mg-Doped p-GaN

    NASA Astrophysics Data System (ADS)

    Park, Youngjun; Kim, Hyunsoo

    2011-08-01

    The effective barrier height and carrier transport mechanism of low resistance Ag-based contact to highly Mg-doped p-GaN were investigated. The specific contact resistance obtained was as low as 7.0×10-4 Ω cm2. The electrical resistivity of p-GaN was found to increase depending on ˜T-1/4, indicating variable-range hopping (VRH) conduction through Mg-related deep-level defects. Based on the VRH conduction model, the effective barrier height for carrier transport could be measured as 0.12 eV, which is low enough to explain the formation of excellent ohmic contact. The deep-level defects were also found to induce surface Fermi pinning.

  20. Thermoelectric Properties of Selenospinel Cu6Fe4Sn12Se32

    NASA Astrophysics Data System (ADS)

    Suekuni, Koichiro; Kunii, Masaru; Nishiate, Hirotaka; Ohta, Michihiro; Yamamoto, Atsushi; Koyano, Mikio

    2012-06-01

    This report describes thermoelectric properties up to 500 K for polycrystalline selenospinel Cu6Fe4Sn12Se32 samples. Thermal conductivity shows a low value of 1 W/Km because of their structural complexity such as Fe/Sn site disorder. Electrical resistivity ρ varies as exp( T 0/ T 1/4) and thermopower S varies as T 1/2 at low temperatures, which indicates that Mott variable-range hopping is the dominant conduction mechanism. However, at high temperatures (above 350 K), ρ and S decrease simultaneously. The temperature dependences are attributed to the thermal excitation of electrons. The possible band structure for Cu6Fe4Sn12Se32 is examined to clarify the behavior of ρ and S.

  1. The Number of Trials Required to Obtain a Representative Movement Pattern During a Hurdle Hop Exercise.

    PubMed

    Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A

    2016-06-01

    When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.

  2. Precision improvement of frequency-modulated continuous-wave laser ranging system with two auxiliary interferometers

    NASA Astrophysics Data System (ADS)

    Shi, Guang; Wang, Wen; Zhang, Fumin

    2018-03-01

    The measurement precision of frequency-modulated continuous-wave (FMCW) laser distance measurement should be proportional to the scanning range of the tunable laser. However, the commercial external cavity diode laser (ECDL) is not an ideal tunable laser source in practical applications. Due to the unavoidable mode hopping and scanning nonlinearity of the ECDL, the measurement precision of FMCW laser distance measurements can be substantially affected. Therefore, an FMCW laser ranging system with two auxiliary interferometers is proposed in this paper. Moreover, to eliminate the effects of ECDL, the frequency-sampling method and mode hopping influence suppression method are employed. Compared with a fringe counting interferometer, this FMCW laser ranging system has a measuring error of ± 20 μm at the distance of 5.8 m.

  3. Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

    PubMed

    Kea, J; Kramer, J; Forwell, L; Birmingham, T

    2001-08-01

    Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

  4. Magnetic, electronic, dielectric and optical properties of Pr(Ca:Sr)MnO 3

    NASA Astrophysics Data System (ADS)

    Sichelschmidt, J.; Paraskevopoulos, M.; Brando, M.; Wehn, R.; Ivannikov, D.; Mayr, F.; Pucher, K.; Hemberger, J.; Pimenov, A.; Krug von Nidda, H.-A.; Lunkenheimer, P.; Ivanov, V. Yu.; Mukhin, A. A.; Balbashov, A. M.; Loidl, A.

    2001-03-01

    The charge-ordered perovskite Pr0.65Ca0.28Sr0.07MnO3 was investigated by means of magnetic susceptibility, specific heat, dielectric and optical spectroscopy and electron-spin resonance techniques. Under moderate magnetic fields, the charge order melts yielding colossal magnetoresistance effects with changes of the resistivity over eleven orders of magnitude. The optical conductivity is studied from audio frequencies far into the visible spectral regime. Below the phonon modes hopping conductivity is detected. Beyond the phonon modes the optical conductivity is explained by polaronic excitations out of a bound state. ESR techniques yield detailed informations on the (H,T ) phase diagram and reveal a broadening of the linewidth which can be modeled in terms of activated polaron hopping.

  5. Positive magnetoresistance in Fe3Se4 nanowires

    NASA Astrophysics Data System (ADS)

    Li, D.; Jiang, J. J.; Liu, W.; Zhang, Z. D.

    2011-04-01

    We report the magnetotransport properties of Fe3Se4 nanowire arrays in anodic aluminum oxide (AAO) porous membrane. The temperature dependence of resistance of Fe3Se4 nanowires at a zero field shows thermal activated behavior below 295 K. The exponential relationship in resistance is consistent with the model of strong localization with variable-range hopping (VRH) for a finite one-dimensional wire. Resistance versus magnetic field curves below 100 K show small positive magnetoresistance (MR). The field dependencies of log[R(H)/R(0)] explain the positive MR as the effect of magnetic field on the VRH conduction.

  6. Length-Dependent Nanotransport and Charge Hopping Bottlenecks in Long Thiophene-Containing π-Conjugated Molecular Wires.

    PubMed

    Smith, Christopher E; Odoh, Samuel O; Ghosh, Soumen; Gagliardi, Laura; Cramer, Christopher J; Frisbie, C Daniel

    2015-12-23

    Self-assembled conjugated molecular wires containing thiophene up to 6 nm in length were grown layer-by-layer using click chemistry. Reflection-absorption infrared spectroscopy, ellipsometry and X-ray photoelectron spectroscopy were used to follow the stepwise growth. The electronic structure of the conjugated wires was studied with cyclic voltammetry and UV-vis spectroscopy as well as computationally with density functional theory (DFT). The current-voltage curves (±1 V) of the conjugated molecular wires were measured with conducting probe atomic force microscopy (CP-AFM) in which the molecular wire film bound to a gold substrate was contacted with a conductive AFM probe. By systematically measuring the low bias junction resistance as a function of length for molecules 1-4 nm long, we extracted the structure dependent tunneling attenuation factor (β) of 3.4 nm(-1) and a contact resistance of 220 kΩ. The crossover from tunneling to hopping transport was observed at a molecular length of 4-5 nm with an activation energy of 0.35 eV extracted from Arrhenius plots of resistance versus temperature. DFT calculations revealed localizations of spin densities (polarons) on molecular wire radical cations. The calculations were employed to gauge transition state energies for hopping of polarons along wire segments. Individual estimated transition state energies were 0.2-0.4 eV, in good agreement with the experimental activation energy. The transition states correspond to flattening of dihedral angles about specific imine bonds. These results open up possibilities to further explore the influence of molecular architecture on hopping transport in molecular junctions, and highlight the utility of DFT to understand charge localization and associated hopping-based transport.

  7. Frequency effects on charge ordering in Y0.5Ca0.5MnO3 by impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Sarwar, Tuba; Qamar, Afzaal; Nadeem, Muhammad

    2015-02-01

    In this work, structural and electrical properties of Y0.5Ca0.5MnO3 are investigated by employing X-ray diffraction and impedance spectroscopy, respectively. Applied ac electric field showed the charge ordering transition temperature around 265 K and below this temperature the heteromorphic behavior of the sample is discussed in the proximity of TCO. With frequency effects the volume of robust charge orbital ordering (COO) domains diminishes due to different competing phases along with Jahn Teller distortions. Comprehensive melting and collapse of charge orbital ordering occurs below TN(125 K), where a colossal drop in the value of impedance is observed. The change in profile of modulus plane plots determines the spreading of relaxation time of intermingled phases. Hopping mechanism is elaborated in terms of strong electron phonon coupling. Variable range hopping model and Arrhenius model are used to discuss the short and long range hopping between Mn3+ and Mn4+ channels assessing the activation energy Ea.

  8. Theoretical study of electron transport along self-assembled graphitic nanowires

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Stafström, Sven

    2000-11-01

    Electron transport through stacks of polyaromatic hydrocarbons is studied theoretically using the Landauer formalism. The polyaromatic hydrocarbons can be synthesized in many different sizes and can form molecular stacks with a varying number of molecules and with a rather strong π-overlap along the stack. This allows for a large flexibility in the nanostructure of these materials and makes it possible to study the variation in the conductance with a number of different factors: a near-linear increase in the conductance as a function of the number of atoms in the individual molecule is observed. Furthermore, the conductance drops exponentially with the number of molecules in the stacks, from which it follows that an increase in the intermolecular hopping results in an increase in the conductance which is proportional to the intermolecular hopping to the power of 2(N-1), where N is the number of molecules in the stack.

  9. Analysis of the conduction mechanism and dielectric properties of N, N', N" tris(4-methylphenyl)phosphoric triamide

    NASA Astrophysics Data System (ADS)

    Ali, H. A. M.

    2016-03-01

    The structure for the powder of N,N', N"-tris(4-methylphenyl)phosphoric triamide, TMP-TA, was characterized using X-ray diffraction (XRD) and differential thermal analysis (DTA) techniques. The ac conductivity and dielectric properties were measured in the frequency range of 42-105 Hz for the bulk TMP-TA in a pellet form at different temperatures. The frequency dependence of ac conductivity was expressed by a Jonscher's universal power law. The frequency exponent (s) was determined from the fitting of experimental data of ac conductivity. The correlated barrier hopping (CBH) model was found to be responsible for the ac conduction mechanism in TMP-TA. The activation energy was calculated from the temperature dependence of ac conductivity. The values of the density of states at the Fermi level were determined for different frequencies. The components of the electric modulus (M' and M") were calculated and used to estimate the relaxation time.

  10. Sodium deficiency effect on the transport properties of La0.8Na0.2-x□xMnO3 manganites

    NASA Astrophysics Data System (ADS)

    Elghoul, N.; Wali, M.; Kraiem, S.; Rahmouni, H.; Dhahri, E.; Khirouni, K.

    2015-12-01

    Effect of sodium deficiency on the transport properties of La0.8Na0.2-x□xMnO3 manganites is investigated using impedance spectroscopy technique. In the whole explored temperature range (77-700 K), conductivity measurements show the appearance of a metal-semiconductor transition for all investigated samples. Also, a saturation region is observed in σ (T) curves. It is found that conduction mechanism is governed by hopping process. The conductivity of the material decreases with increasing sodium deficiency. The transition temperature and the activation energy values inferred from grain boundary resistance and conductivity analysis are closed to each other. Such result confirms the contribution of grain boundary on the electrical conductivity. The variation of the Average Normalized Change (ANC) and its derivative with temperature gives important information about the available density of trapped charge states. The obtained results explain the observed saturation region in conductivity at high temperature region.

  11. Structural study and DC conductivity of vanadyl doped zinc lithium borate glasses

    NASA Astrophysics Data System (ADS)

    Seema, Khasa, S.; Dahiya, M. S.; Yadav, Arti; Agarwal, A.; Dahiya, S.

    2015-06-01

    Glasses with composition xZnOṡ(30 - x)ṡLi2Oṡ70B2O3 containing 2 mol% of V2O5 (x = 0, 2, 5, 7 and 10) were prepared by standard melt-quench technique. The amorphous nature of the glass samples was confirmed by using x-ray diffraction. The structural changes in these glasses have been investigated by employing IR spectroscopy in the mid-IR range. The infrared spectroscopic analysis confirms the presence of both triangular and tetraheldral coordinated boron units and absence of boroxol ring. It also shows that metal-oxide vibrations are present which are due to the bonding of lithium and zinc ions with oxygen. The dc conductivity was measured in the temperature range 353-523 K. The dc conductivity results show that conductivity decreases and activation energy increases when Li2O is replaced by ZnO, keeping the concentration of B2O3 constant. Decrease in conductivity and increase in activation energy shows that addition of ZnO to the glass matrix shows a "blocking effect" on the overall mobility of alkali ions, but at higher concentration the hopping effect was also observed.

  12. Photoconductivity study of acid on Zinc phthalocyanine pyridine thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Sukhwinder, E-mail: ss7667@gmail.com; Saini, G. S. S.; Tripathi, S. K.

    2016-05-06

    The Metal Phthalocyanine (MPc) have attracted much interest because of chemical and high thermal stability. Molecules forming a crystal of MPc are held together by weak attractive Vander Waals forces. Organic semiconductors have π conjugate bonds which allow electrons to move via π-electron cloud overlaps. Conduction mechanisms for organic semiconductor are mainly through tunneling; hopping between localized states, mobility gaps, and phonon assisted hopping. The photo conductivity of thin films of these complexes changes when exposed to oxidizing and reducing gases. Arrhenius plot is used to find the thermal activation energy in the intrinsic region and impurity scattering region. Arrheniusmore » plotsare used to find the thermal activation energy.« less

  13. Millimeter Wave Alternate Route Study.

    DTIC Science & Technology

    1981-04-01

    processing gains are based upon the assumption that the jammer equally distributes his available power over all the hopping frequencies. If this is true...Examples Assumptions 0 25 GHz hopping range (e.g., 20 GHz to 45 GHz) 0 10 ms settling time * 0.1 second dwell time - implies 11% increase in channel data...of the architectures presented previously. The assumption that each link has equal probability p of being disrupted (i.e., successfully jammed) seems

  14. Ionization equilibrium at the transition from valence-band to acceptor-band migration of holes in boron-doped diamond

    NASA Astrophysics Data System (ADS)

    Poklonski, N. A.; Vyrko, S. A.; Poklonskaya, O. N.; Kovalev, A. I.; Zabrodskii, A. G.

    2016-06-01

    A quasi-classical model of ionization equilibrium in the p-type diamond between hydrogen-like acceptors (boron atoms which substitute carbon atoms in the crystal lattice) and holes in the valence band (v-band) is proposed. The model is applicable on the insulator side of the insulator-metal concentration phase transition (Mott transition) in p-Dia:B crystals. The densities of the spatial distributions of impurity atoms (acceptors and donors) and of holes in the crystal are considered to be Poissonian, and the fluctuations of their electrostatic potential energy are considered to be Gaussian. The model accounts for the decrease in thermal ionization energy of boron atoms with increasing concentration, as well as for electrostatic fluctuations due to the Coulomb interaction limited to two nearest point charges (impurity ions and holes). The mobility edge of holes in the v-band is assumed to be equal to the sum of the threshold energy for diffusion percolation and the exchange energy of the holes. On the basis of the virial theorem, the temperature Tj is determined, in the vicinity of which the dc band-like conductivity of holes in the v-band is approximately equal to the hopping conductivity of holes via the boron atoms. For compensation ratio (hydrogen-like donor to acceptor concentration ratio) K ≈ 0.15 and temperature Tj, the concentration of "free" holes in the v-band and their jumping (turbulent) drift mobility are calculated. Dependence of the differential energy of thermal ionization of boron atoms (at the temperature 3Tj/2) as a function of their concentration N is calculated. The estimates of the extrapolated into the temperature region close to Tj hopping drift mobility of holes hopping from the boron atoms in the charge states (0) to the boron atoms in the charge states (-1) are given. Calculations based on the model show good agreement with electrical conductivity and Hall effect measurements for p-type diamond with boron atom concentrations in the range from 3 × 1017 to 3 × 1020 cm-3, i.e., up to the Mott transition. The model uses no fitting parameters.

  15. Predictive parameters for return to pre-injury level of sport 6 months following anterior cruciate ligament reconstruction surgery.

    PubMed

    Müller, Ulrike; Krüger-Franke, Michael; Schmidt, Michael; Rosemeyer, Bernd

    2015-12-01

    The aim of the study was to find predictive parameters for a successful resumption of pre-injury level of sport 6 months post anterior cruciate ligament (ACL) reconstruction. In a prospective study, 40 patients with a ruptured ACL were surgically treated with semitendinosus tendon autograft. Six months after surgery, strength of knee extensors and flexors, four single-leg hop tests, Anterior Cruciate Ligament-Return to Sport after Injury Scale (ACL-RSI), subjective International Knee Documentation Committee (IKDC) 2000 and the Tampa Scale of Kinesiophobia-11 (TSK-11) were assessed. Seven months post-operatively, a standardized interview was conducted to identify "return to sport" (RS) and "non-return to sport" (nRS) patients. Logistic regression and "Receiver Operating Characteristic" (ROC) analyses were used to determine predictive parameters. No significant differences could be detected between RS and nRS patients concerning socio-demographic data, muscle tests, square hop and TSK-11. In nRS patients, the Limb Symmetry Index (LSI) of single hop for distance (p = 0.005), crossover hop (p = 0.008) and triple hop (p = 0.001) were significantly lower, in addition to the ACL-RSI (p = 0.013) and IKDC 2000 (p = 0.037). The cut-off points for LSI single hop for distance were 75.4 % (sensitivity 0.74; specificity 0.88), and for ACL-RSI 51.3 points (sensitivity 0.97; specificity 0.63). Logistic regression distinguished between RS and nRS subjects (sensitivity 0.97; specificity 0.63). The single hop for distance and ACL-RSI were found to be the strongest predictive parameters, assessing both the objective functional and the subjective psychological aspects of returning to sport. Both tests may help to identify patients at risk of not returning to pre-injury sport. II.

  16. Hopping Conduction and Bacteria: Transport Properties of Disordered Reaction-Diffusion Systems

    NASA Astrophysics Data System (ADS)

    Missel, Andrew; Dahmen, Karin

    2008-03-01

    Reaction-diffusion (RD) systems are used to model everything from the formation of animal coat patterns to the spread of genes in a population to the seasonal variation of plankton density in the ocean. In all of these problems, disorder plays a large role, but determining its effects on transport properties in RD systems has been a challenge. We present here both analytical and numerical studies of a particular disordered RD system consisting of particles which are allowed to diffuse and compete for resources (2A->A) with spatially homogeneous rates, reproduce (A->2A) in certain areas (``oases''), and die (A->0) everywhere else (the ``desert''). In the low oasis density regime, transport is mediated through rare ``hopping events'' in which a small number of particles diffuse through the desert from one oasis to another; the situation is mathematically analogous to hopping conduction in doped semiconductors, and this analogy, along with some ideas from first passage percolation theory, allows us to make some quantitative predictions about the transport properties of the system on a large scale.

  17. Theoretical study of spin Hall effect in conjugated Organic semiconductors

    NASA Astrophysics Data System (ADS)

    Mahani, M. R.; Delin, A.

    The spin Hall effect (SHE), a direct conversion between electronic and spin currents, is a rapidly growing branch of spintronics. The study of SHE in conjugated polymers has gained momentum recently due to the weak spin-orbit couplings and hyperfine interactions in these materials. Our calculations of SHE based on the recent work, are the result of the misalignment of pi-orbitals in triads consisting of three molecules. In disordered organics, where the electronic conduction is through hopping of the electrons among randomly oriented molecules, instead of identifying a hopping triad to represent the entire system, we numerically solve the master equations for electrical and spin hall conductivities by summing the contributions from all triads in a sufficiently large system. The interference between the direct and indirect hoppings in these triads leads to SHE proportional to the orientation vector of molecule at the first order of spin-orbit coupling. Hence, our results show, the degree of molecular alignment as well as the strength of the spin-orbit coupling can be used to control the SHE in organics.

  18. An Evaluation of a Numerical Prediction Method for Electric Field Strength of Low Frequency Radio Waves based on Wave-Hop Ionospheric Propagation

    NASA Astrophysics Data System (ADS)

    Kitauchi, H.; Nozaki, K.; Ito, H.; Kondo, T.; Tsuchiya, S.; Imamura, K.; Nagatsuma, T.; Ishii, M.

    2014-12-01

    We present our recent efforts on an evaluation of the numerical prediction method of electric field strength for ionospheric propagation of low frequency (LF) radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012), "Prediction of field strength at frequencies below about 150 kHz," made by International Telecommunication Union Radiocommunication Sector (ITU-R). As part of the Japanese Antarctic Research Expedition (JARE), we conduct on-board measurements of the electric field strengths and phases of LF 40 kHz and 60 kHz of radio signals (call sign JJY) continuously along both the ways between Tokyo, Japan and Syowa Station, the Japanese Antarctic station, at 69° 00' S, 39° 35' E on East Ongul Island, Lützow-Holm Bay, East Antarctica. The measurements are made by a newly developed, highly sensitive receiving system installed on board the Japanese Antarctic research vessel (RV) Shirase. We obtained new data sets of the electric field strength up to approximately 13,000-14,000 km propagation of LF JJY 40 kHz and 60 kHz radio waves by utilizing a newly developed, highly sensitive receiving system, comprised of an orthogonally crossed double-loop antenna and digital-signal-processing lock-in amplifiers, on board RV Shirase during the 55th JARE from November 2013 to April 2014. We have made comparisons between those on-board measurements and the numerical predictions of field strength for long-range propagation of low frequency radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012) to show that our results qualitatively support the recommended wave-hop theory for the great-circle paths approximately 7,000-8,000 km and 13,000-14,000 km propagations.

  19. Plasmodium falciparum Hop (PfHop) Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

    PubMed

    Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore

    2015-01-01

    Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.

  20. Mobile bound states of Rydberg excitations in a lattice

    NASA Astrophysics Data System (ADS)

    Letscher, Fabian; Petrosyan, David

    2018-04-01

    Spin-lattice models play a central role in the studies of quantum magnetism and nonequilibrium dynamics of spin excitations—-magnons. We show that a spin lattice with strong nearest-neighbor interactions and tunable long-range hopping of excitations can be realized by a regular array of laser-driven atoms, with an excited Rydberg state representing the spin-up state and a Rydberg-dressed ground state corresponding to the spin-down state. We find exotic interaction-bound states of magnons that propagate in the lattice via the combination of resonant two-site hopping and nonresonant second-order hopping processes. Arrays of trapped Rydberg-dressed atoms can thus serve as a flexible platform to simulate and study fundamental few-body dynamics in spin lattices.

  1. Origin of strong dispersion in Hubbard insulators

    DOE PAGES

    Wang, Y.; Wohlfeld, K.; Moritz, B.; ...

    2015-08-10

    Using cluster perturbation theory, we explain the origin of the strongly dispersive feature found at high binding energy in the spectral function of the Hubbard model. By comparing the Hubbard and $t₋J₋3s$ model spectra, we show that this dispersion does not originate from either coupling to spin fluctuations ($∝ J$ ) or the free hopping ($∝ t$ ). Instead, it should be attributed to a long-range, correlated hopping $∝ t²/U$ which allows an effectively free motion of the hole within the same antiferromagnetic sublattice. This origin explains both the formation of the high-energy anomaly in the single-particle spectrum and themore » sensitivity of the high-binding-energy dispersion to the next-nearest-neighbor hopping $t'$ .« less

  2. Thermal, Structural, AC Conductivity, and Dielectric Properties of Ethyl-2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3,2-c]quinoline-3-carboxylate Thin Films

    NASA Astrophysics Data System (ADS)

    El-Shabaan, M. M.

    2018-05-01

    Thermal, structural, alternating-current (AC) conductivity (σ AC), and dielectric properties of ethyl-2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3,2-c]quinoline-3-carboxylate (HPQC) thin films have been studied. Thermogravimetry analysis and differential scanning calorimetry confirmed the thermal stability of HPQC over a wide temperature range. Fourier-transform infrared spectroscopy and x-ray diffraction analysis were carried out on HPQC in powder form and as-deposited thin film. The crystal system and space group type were determined for HPQC in powder form. The AC conductivity and dielectric properties were determined in the frequency range from 0.5 kHz to 5 MHz and temperature range from 296 K to 443 K. The AC electrical conduction of HPQC thin film was found to be governed by the small-polaron tunneling mechanism. The polaron hopping energy (W H), tunneling distance (R), and density of states (N) near the Fermi level were determined as functions of temperature and frequency. The dielectric properties of HPQC thin film were studied by analysis of Nyquist diagrams, the dissipation factor (tan δ), and real (ɛ') and imaginary (ɛ″) parts of the dielectric constant.

  3. Hip-Hop to Health Jr. for Latino preschool children.

    PubMed

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2006-09-01

    Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

  4. Injury incidence in hip hop dance.

    PubMed

    Ojofeitimi, S; Bronner, S; Woo, H

    2012-06-01

    Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

  5. Holder pasteurization affects S100B concentrations in human milk.

    PubMed

    Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Li Volti, Giovanni; Galvano, Fabio; Visser, Gerard H A; Gazzolo, Diego

    2018-02-01

    Donor milk (DM) represents an important nutrition source for high-risk newborns. Holder pasteurization (HoP) is the most recommended procedure for DM treatment, providing a good compromise between microbiological safety and biological quality. HoP was previously shown to affect DM cytokines, growth factors and hormones levels, whilst no data concerning the possible effects of HoP on neurobiomarkers (NB) are available. Therefore, our study investigated whether the concentration in DM of a well-known NB involved in brain development/damage, namely S100B, changes due to HoP. We conducted a pretest-test study in 11 mothers, whose DM samples were sub-divided into two parts: the first was immediately frozen (-80 °C); the second was pasteurized with Holder method before freezing. S100B DM levels were measured using a commercially available immunoluminometric assay. S100B protein was detected in all milk samples. Results showed significant differences between groups (p < 0.05) in S100B levels after HoP. Our data provide evidence that S100B is present in preterm milk as well as in term milk during maturation degree. Moreover, the results confirm the susceptibility of this neurotrophic factor to pasteurization stresses and the need to develop new storage techniques to preserve the biological quality of human milk.

  6. Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn; School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ

    Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loadingmore » concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.« less

  7. Effect of annealing on the temperature dependence of inelastic tunneling contributions vis-à-vis tunneling magnetoresistance and barrier parameters in CoFe/MgO/NiFe magnetic tunnel junctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhusan Singh, Braj; Chaudhary, Sujeet, E-mail: sujeetc@physics.iitd.ac.in

    The effect of annealing on the changes in the inelastic tunneling contributions in tunneling conductance of ion beam sputtered CoFe/MgO/NiFe magnetic tunnel junctions (MTJs) is investigated. The inelastic contributions are evaluated using hopping conduction model of Glazman and Matveev in the temperature range of 25–300 K. The hopping through number of series of localized states present in the barrier due to structural defects increases from 9 (in as deposited MTJ) to 18 after annealing (at 200 °C/1 h); although no changes in the interface roughness of CoFe-MgO and MgO-NiFe interfaces are observed as revealed by the x-ray reflectance studies on planar MTJs. Themore » bias dependence of tunneling magnetoresistance (TMR) at 25 K is found to get improved after annealing as revealed by the value V{sub 1/2} (the bias value at which the TMR reaches to half of its value at nearly zero bias); which is 78 mV (in MTJ annealed at 200 °C/1 h) 2.5 times the value of 33 mV (in as deposited MTJ). At 25 K the inelastic tunneling spectra revealed the presence of zero bias anomaly and magnon excitations in the range of 10–15 mV. While the barrier height exhibited a strong temperature dependence with nearly 100% increase from the value at 300 K to 25 K, the temperature dependence of TMR becomes steep after annealing.« less

  8. Interplay of long-range and short-range Coulomb interactions in an Anderson-Mott insulator

    NASA Astrophysics Data System (ADS)

    Baćani, Mirko; Novak, Mario; Orbanić, Filip; Prša, Krunoslav; Kokanović, Ivan; Babić, Dinko

    2017-07-01

    In this paper, we tackle the complexity of coexisting disorder and Coulomb electron-electron interactions (CEEIs) in solids by addressing a strongly disordered system with intricate CEEIs and a screening that changes both with charge carrier doping level Q and temperature T . We report on an experimental comparative study of the T dependencies of the electrical conductivity σ and magnetic susceptibility χ of polyaniline pellets doped with dodecylbenzenesulfonic acid over a wide range. This material is special within the class of doped polyaniline by exhibiting in the electronic transport a crossover between a low-T variable range hopping (VRH) and a high-T nearest-neighbor hopping (NNH) well below room temperature. Moreover, there is evidence of a soft Coulomb gap ΔC in the disorder band, which implies the existence of a long-range CEEI. Simultaneously, there is an onsite CEEI manifested as a Hubbard gap U and originating in the electronic structure of doped polyaniline, which consists of localized electron states with dynamically varying occupancy. Therefore, our samples represent an Anderson-Mott insulator in which long-range and short-range CEEIs coexist. The main result of the study is the presence of a crossover between low- and high-T regimes not only in σ (T ) but also in χ (T ) , the crossover temperature T* being essentially the same for both observables over the entire doping range. The relatively large electron localization length along the polymer chains results in U being small, between 12 and 20 meV for the high and low Q , respectively. Therefore, the thermal energy at T* is sufficiently large to lead to an effective closing of the Hubbard gap and the consequent appearance of NNH in the electronic transport within the disorder band. ΔC is considerably larger than U , decreasing from 190 to 30 meV as Q increases, and plays the role of an activation energy in the NNH.

  9. Dielectric, Piezoelectric and Variable Range Hopping Conductivity Studies of Bi0.5(Na, K)0.5TiO3 Ceramics

    NASA Astrophysics Data System (ADS)

    Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu

    2018-04-01

    We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1-x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase (T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase (T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac(T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant (ɛ' = 1273), dielectric loss (tanδ = 0.047) at 1 kHz, electromechanical coupling coefficients (k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants (d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).

  10. Dielectric, Piezoelectric and Variable Range Hopping Conductivity Studies of Bi0.5(Na, K)0.5TiO3 Ceramics

    NASA Astrophysics Data System (ADS)

    Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu

    2018-07-01

    We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1- x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase ( T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase ( T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac( T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant ( ɛ' = 1273), dielectric loss (tan δ = 0.047) at 1 kHz, electromechanical coupling coefficients ( k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants ( d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).

  11. Electrical conductivity and dielectric behavior in sodium zinc divanadates

    NASA Astrophysics Data System (ADS)

    Sallemi, F.; Louati, B.; Guidara, K.

    2014-11-01

    The Na2ZnV2O7 compound was obtained by the conventional solid-state reaction. The sample was characterized by X-ray powder diffraction, Raman and impedance spectroscopy. The ac electrical conductivity and dielectric properties have been investigated in the frequency and temperature range of 200 Hz-1 MHz and 513 K-729 K, respectively. The direct current conductivity process is thermally activated. The frequency dependence of the conductivity is interpreted using the power law. The close values of activation energies obtained from the analysis of hopping frequency and dc conductivity implies that the transport is due to Na+ cation displacement parallel to (0 0 1) plane located between ZnO4 and VO4 tetrahedra. The evolution of the complex permittivity as a function of angular frequency was investigated. Several important parameters such as charge carrier concentration, ionic mobility and diffusion coefficient were determined. Thermodynamic parameters such as the free energy of activation ∆F, the enthalpy ∆H, and the change in entropy ∆S have been calculated.

  12. Synthesis and characterization of mesoporous indium tin oxide possessing an electronically conductive framework.

    PubMed

    Emons, Theo T; Li, Jianquan; Nazar, Linda F

    2002-07-24

    The new mesoporous transparent conducting oxide based on indium-tin-oxide, meso-ITO, has been synthesized by a modified sol-gel method, using CTAB as the surfactant. Critical was the employment of triethanolamine to control the rate of hydrolysis and inhibit deposition of the bulk oxides. Removal of the surfactant by calcination yielded a relatively well-ordered worm-hole motif arrangement of pores visible in the TEM and stable to 400 degrees C. BET measurements revealed no hysteresis in the absorption-desorption isotherm, consistent with a narrow pore-size distribution (between 20 and 40 A depending on the In:Sn ratio); surface areas ranged between 270 and 310 m2/g. This colorless material is the first mesoporous oxide exhibiting substantial framework conductivity, with a conductivity at 25 degrees C of 1.2 x 10-3 S/cm. This distinguishes it from mesoporous mixed-valence transition-metal oxides that exhibit weak hopping semiconductor behavior and much lower conductivity.

  13. Hierarchical multifunctional composites by conformally coating aligned carbon nanotube arrays with conducting polymer.

    PubMed

    Vaddiraju, Sreeram; Cebeci, Hülya; Gleason, Karen K; Wardle, Brian L

    2009-11-01

    A novel method for the fabrication of carbon nanotube (CNT)-conducting polymer composites is demonstrated by conformally coating extremely high aspect ratio vertically aligned-CNT (A-CNT) arrays with conducting polymer via oxidative chemical vapor deposition (oCVD). A mechanical densification technique is employed that allows the spacing of the A-CNTs to be controlled, yielding a range of inter-CNT distances between 20 and 70 nm. Using this morphology control, oCVD is shown to conformally coat 8-nm-diameter CNTs having array heights up to 1 mm (an aspect ratio of 10(5)) at all inter-CNT spacings. Three phase CNT-conducting polymer nanocomposites are then fabricated by introducing an insulating epoxy via capillary-driven wetting. CNT morphology is maintained during processing, allowing quantification of direction-dependent (nonisotropic) composite properties. Electrical conductivity occurs primarily along the CNT axial direction, such that the conformal conducting polymer has little effect on the activation energy required for charge conduction. In contrast, the conducting polymer coating enhanced the conductivity in the radial direction by lowering the activation energy required for the creation of mobile charge carriers, in agreement with variable-range-hopping models. The fabrication strategy introduced here can be used to create many multifunctional materials and devices (e.g., direction-tailorable hydrophobic and highly conducting materials), including a new four-phase advanced fiber composite architecture.

  14. Electron and thermal transport via variable range hopping in MoSe2 single crystals

    NASA Astrophysics Data System (ADS)

    Suri, Dhavala; Patel, R. S.

    2017-06-01

    Bulk single crystal molybdenum diselenide has been studied for its electronic and thermal transport properties. We perform resistivity measurements with current in-plane (CIP) and current perpendicular to plane (CPP) as a function of temperature. The CIP measurements exhibit metal to semiconductor transition at ≃31 K. In the semiconducting phase (T > 31 K), the transport is best explained by the variable range hopping (VRH) model. Large magnitude of resistivity in the CPP mode indicates strong structural anisotropy. The Seebeck coefficient as a function of temperature measured in the range of 90-300 K also agrees well with the VRH model. The room temperature Seebeck coefficient is found to be 139 μV/K. VRH fittings of the resistivity and the Seebeck coefficient data indicate high degree of localization.

  15. Mn Impurity in Bulk GaAs Crystals

    NASA Astrophysics Data System (ADS)

    Pawłowski, M.; Piersa, M.; Wołoś, A.; Palczewska, M.; Strzelecka, G.; Hruban, A.; Gosk, J.; Kamińska, M.; Twardowski, A.

    2006-11-01

    Magnetic and electron transport properties of GaAs:Mn crystals grown by Czochralski method were studied. Electron spin resonance showed the presence of Mn acceptor A in two charge states: singly ionized A- in the form of Mn2+(d5), and neutral A0 in the form of Mn2+(d5) plus a bound hole (h). It was possible to determine the relative concentration of both types of centers from intensity of the corresponding electron spin resonance lines. Magnetization measured as a function of magnetic field (up to 6 T) in the temperature range of 2-300 K revealed overall paramagnetic behavior of the samples. Effective spin was found to be about 1.5 value, which was consistent with the presence of two types of Mn configurations. In most of the studied samples the dominance of Mn2+(d5)+h configuration was established and it increased after annealing of native donors. The total value of Mn content was obtained from fitting of magnetization curves with the use of parameters obtained from electron spin resonance. In electron transport, two mechanisms of conductivity were observed: valence band transport dominated above 70 K, and hopping conductivity within Mn impurity band at lower temperatures. From the analysis of the hopping conductivity and using the obtained values of the total Mn content, the effective radius of Mn acceptor in GaAs was estimated as a = 11 ± 3 Å.

  16. A 10-Year Prospective Trial of a Patient Management Algorithm and Screening Examination for Highly Active Individuals with ACL Injury. Part II: Determinants of Dynamic Knee Stability

    PubMed Central

    Hurd, Wendy J.; Axe, Michael J.; Snyder-Mackler, Lynn

    2010-01-01

    Objectives To clarify the determinants of dynamic knee stability early after anterior cruciate ligament (ACL) injury. Materials and Methods 345 consecutive patients who were regular participants in IKDC level I/II sports before injury and had an acute isolated ACL injury from the practice of a single orthopaedic surgeon underwent a screening examination including clinical measures, knee laxity, quadriceps strength, hop testing, and patient self-reported knee function an average of 6 weeks after injury when impairments were resolved. Independent t-tests were performed to evaluate differences in quadriceps strength and anterior knee laxity between potential copers and noncopers. Hierarchical regression was performed to determine the influence of quadriceps strength, pre-injury activity level, and anterior knee laxity on hop test performance, as well as the influence of timed hop, cross-over hop, quadriceps strength, pre-injury activity level, and anterior knee laxity on self-assessed global function. Results Neither anterior knee laxity nor quadriceps strength differed between potential copers and non-copers. Quadriceps strength influenced hop test performance more significantly than pre-injury activity level or anterior knee laxity, but the variance accounted for by quadriceps strength was low (Range: 4-8%). Timed hop performance was the only variable that impacted self-assessed global function. Conclusions Traditional surgical decision making based on passive anterior knee laxity and pre-injury activity level is not supported by the results, as neither are good predictors of dynamic knee stability. Clinical tests that capture neuromuscular adaptations, including the timed hop test, may be useful in predicting function and guiding individualized patient management after ACL injury. PMID:17932399

  17. Go with your gut: Digestibility and digestive function of two arid-zone Australian murids, Pseudomys australis and Notomys alexis.

    PubMed

    Stannard, Hayley J; Tulk, Melissa L; Bortolazzo, Melissa J; Old, Julie M

    2018-06-01

    Spinifex hopping-mice (Notomys alexis) and plains mice (Pseudomys australis) are able to successfully occupy arid zones of Australia. We studied the digestive parameters and energy assimilation of captive spinifex hopping-mice and plains mice. The experiment consisted of six diets fed to the animals for periods of 12days per food type. On a dry matter basis, the plains mice consumed between 2.5 and 7.2% and the hopping-mice between 5.8 and 9.3% of their body mass in food per day. The body mass of the spinifex hopping-mice increased significantly on the sunflower seed diet, while body mass did not change significantly for the plains mice on any diet. Apparent digestibility of macronutrients was similar in the hopping-mice and plains mice when maintained on the same diet, however digestibility of total micronutrients differed. Maintenance energy requirements for the plains mice were 529kJkg -0.75 d -1 and spinifex hopping-mice 550kJkg -0.75 d -1 . Spinifex hopping-mice and plains mice are able to exploit a range of food items and efficiently digest macronutrients, to ensure they meet their nutritional needs, an ability they require in the variable arid environment. The information gained in this study increases the paucity of information on Australian native murids, specifically their digestive function and energy requirements, and will aid captive murid management. The study will allow future expansion into field studies, to aid the conservation of wild rodent diets and nutrition of arid zone murids. Copyright © 2018 Elsevier GmbH. All rights reserved.

  18. Environmental effects are stronger than human effects on mammalian predator-prey relationships in arid Australian ecosystems.

    PubMed

    Allen, Benjamin L; Fawcett, Alana; Anker, Alison; Engeman, Richard M; Lisle, Allan; Leung, Luke K-P

    2018-01-01

    Climate (drought, rainfall), geology (habitat availability), land use change (provision of artificial waterpoints, introduction of livestock), invasive species (competition, predation), and direct human intervention (lethal control of top-predators) have each been identified as processes driving the sustainability of threatened fauna populations. We used a systematic combination of empirical observational studies and experimental manipulations to comprehensively evaluate the effects of these process on a model endangered rodent, dusky hopping-mice (Notomys fuscus). We established a large manipulative experiment in arid Australia, and collected information from relative abundance indices, camera traps, GPS-collared dingoes (Canis familiaris) and dingo scats, along with a range of related environmental data (e.g. rainfall, habitat type, distance to artificial water etc.). We show that hopping-mice populations were most strongly influenced by geological and climatic effects of resource availability and rainfall, and not land use, invasive species, or human effects of livestock grazing, waterpoint provision, or the lethal control of dingoes. Hopping-mice distribution declined along a geological gradient of more to less available hopping-mice habitat (sand dunes), and their abundance was driven by rainfall. Hopping-mice populations fluctuated independent of livestock presence, artificial waterpoint availability or repeated lethal dingo control. Hopping-mice populations appear to be limited first by habitat availability, then by food availability, then by predation. Contemporary top-predator control practices (for protection of livestock) have little influence on hopping-mice behaviour or population dynamics. Given our inability to constrain the effects of predation across broad scales, management actions focusing on increasing available food and habitat (e.g. alteration of fire and herbivory) may have a greater chance of improving the conservation status of hopping-mice and other small mammals in arid areas. Our study also reaffirms the importance of using systematic and experimental approaches to detect true drivers of population distribution and dynamics where multiple potential drivers operate simultaneously. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes

    PubMed Central

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-01-01

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices. PMID:27829663

  20. Structure, Raman, dielectric behavior and electrical conduction mechanism of strontium titanate

    NASA Astrophysics Data System (ADS)

    Trabelsi, H.; Bejar, M.; Dhahri, E.; Graça, M. P. F.; Valente, M. A.; Khirouni, K.

    2018-05-01

    Strontium titanate was prepared by solid-state reaction method. According to the XRD, it was single phase and has a cubic perovskite structure. The Raman spectroscopic investigation was carried out at room-temperature, and the second-order Raman modes were observed. By employing impedance spectroscopy, the dielectric relaxation and electrical properties were investigated over the temperature range of 500-700 K at various frequencies. The activation energies evaluated from dielectric and modulus studies are in good agreement and these values are attributed to the bulk relaxation. The impedance data were well fitted to an (R1//C1)-(R2//CPE1) equivalent electrical circuit. It could be concluded that the grain boundaries are more resistive and capacitive than the grains. The ac conductivity was found to follow the Jonscher's universal dynamic law ωS and the correlated barrier hopping model (CBH) has been proposed to describe the conduction mechanism.

  1. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes

    NASA Astrophysics Data System (ADS)

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-11-01

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

  2. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes.

    PubMed

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-11-10

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

  3. Metabolite profiling of flavonols and in vitro antioxidant activity of young shoots of wild Humulus lupulus L. (hop).

    PubMed

    Maietti, Annalisa; Brighenti, Virginia; Bonetti, Gianpiero; Tedeschi, Paola; Prencipe, Francesco Pio; Benvenuti, Stefania; Brandolini, Vincenzo; Pellati, Federica

    2017-08-05

    Humulus lupulus L., commonly named hop, is well-known for its sedative and estrogenic activity. While hop cones are widely characterized, only few works have been carried out on the young shoots of this plant. In the light of this, the aim of this study was to identify for the first time the flavonoids present in young hop shoots and to compare the composition of samples harvested from different locations in Northern Italy with their antioxidant activity. The samples were extracted by means of dynamic maceration with methanol. The HPLC-UV/DAD, HPLC-ESI-MS and MS 2 analysis were carried out by using an Ascentis C 18 column (250×4.6mm I.D., 5μm), with a mobile phase composed of 0.1M formic acid in both water and acetonitrile, under gradient elution. Quercetin and kaempferol glycosides were the main compounds identified and quantified in hop shoot extracts. Total flavonols ranged from 2698±185 to 517±48μg/g (fresh weight). The antioxidant activity was determined by means of the radical scavenging activity assay against diphenylpicrylhydrazyl (DPPH) and by using a photochemiluscence assay with a Photochem ® apparatus. The results showed that hop shoots represent a new source of flavonols; therefore, they can be useful for a possible incorporation in the diet as a functional food or applied in the nutraceutical ambit. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Dynamics of interacting Dicke model in a coupled-cavity array

    NASA Astrophysics Data System (ADS)

    Badshah, Fazal; Qamar, Shahid; Paternostro, Mauro

    2014-09-01

    We consider the dynamics of an array of mutually interacting cavities, each containing an ensemble of N two-level atoms. By exploring the possibilities offered by ensembles of various dimensions and a range of atom-light and photon-hopping values, we investigate the generation of multisite entanglement, as well as the performance of excitation transfer across the array, resulting from the competition between on-site nonlinearities of the matter-light interaction and intersite photon hopping. In particular, for a three-cavity interacting system it is observed that the initial excitation in the first cavity completely transfers to the ensemble in the third cavity through the hopping of photons between the adjacent cavities. Probabilities of the transfer of excitation of the cavity modes and ensembles exhibit characteristics of fast and slow oscillations governed by coupling and hopping parameters, respectively. In the large-hopping case, by seeding an initial excitation in the cavity at the center of the array, a tripartite W state, as well as a bipartite maximally entangled state, is obtained, depending on the interaction time. Population of the ensemble in a cavity has a positive impact on the rate of excitation transfer between the ensembles and their local cavity modes. In particular, for ensembles of five to seven atoms, tripartite W states can be produced even when the hopping rate is comparable to the cavity-atom coupling rate. A similar behavior of the transfer of excitation is observed for a four-coupled-cavity system with two initial excitations.

  5. Carbon nanotube vacuum gauges utilizing long, dissipative tubes

    NASA Astrophysics Data System (ADS)

    Kaul, Anupama B.; Manohara, Harish M.

    2008-04-01

    A carbon nanotube-based thermal conductivity vacuum gauge is described which utilizes 5-10 μm long diffusively contacted SWNTs for vacuum sensing. By etching the thermal SiO II beneath the tubes and minimizing heat conduction through the substrate, pressure sensitivity was extended toward higher vacuums. The pressure response of unannealed and annealed devices was compared to that of released devices. The released devices showed sensitivity to pressure as low as 1 x 10 -6 Torr. The sensitivity increased more dramatically with power for the released device compared to that of the unreleased device. Low temperature electronic transport measurements of the tubes were suggestive of a thermally activated hopping mechanism where the activation energy for hopping was calculated to be ~ 39 meV.

  6. Leakage current transport mechanism under reverse bias in Au/Ni/GaN Schottky barrier diode

    NASA Astrophysics Data System (ADS)

    Peta, Koteswara Rao; Kim, Moon Deock

    2018-01-01

    The leakage current transport mechanism under reverse bias of Au/Ni/GaN Schottky diode is studied using temperature dependent current-voltage (I-V-T) and capacitance-voltage (C-V) characteristics. I-V measurement in this study is in the range of 140 K-420 K in steps of 10 K. A reduction in voltage dependent barrier height and a strong internal electric field in depletion region under reverse bias suggested electric field enhanced thermionic emission in carrier transport via defect states in Au/Ni/GaN SBD. A detailed analysis of reverse leakage current revealed two different predominant transport mechanisms namely variable-range hopping (VRH) and Poole-Frenkel (PF) emission conduction at low (<260 K) and high (>260 K) temperatures respectively. The estimated thermal activation energies (0.20-0.39 eV) from Arrhenius plot indicates a trap assisted tunneling of thermally activated electrons from a deep trap state into a continuum of states associated with each conductive threading dislocation.

  7. Hopping locomotion at different gravity: metabolism and mechanics in humans.

    PubMed

    Pavei, Gaspare; Minetti, Alberto E

    2016-05-15

    Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.

  8. Field-dependent hopping conduction

    NASA Astrophysics Data System (ADS)

    Hayashi, T.; Tokura, Y.; Fujiwara, A.

    2018-07-01

    We have numerically calculated transport characteristics on a Miller-Abraham network in a non-linear regime by solving the Kirchhoff's current law at each site. Assuming the Mott model, we obtained the relation between current density and electric field, J ∝exp(γ√{ E}) , which has often been observed in low-mobility materials and whose mechanism has been a source of controversy for over half a century. Our numerical calculation makes it possible to analyze the energy configuration of relevant hopping sites and visualize percolation networks. Following the percolation theory proposed by Shklovskii [Shklovskii, Sov. Phys. Semicond. 10, 855 (1976)], we show that the main mechanism of the field dependence is the replacement of dominating resistances accompanied by the geometrical evolution of the percolation networks. Our calculation is so general that it can be applied to hopping transport in a variety of systems.

  9. Hopping and band mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) from first principle calculations.

    PubMed

    Kobayashi, Hajime; Kobayashi, Norihito; Hosoi, Shizuka; Koshitani, Naoki; Murakami, Daisuke; Shirasawa, Raku; Kudo, Yoshihiro; Hobara, Daisuke; Tokita, Yuichi; Itabashi, Masao

    2013-07-07

    Hopping and band mobilities of holes in organic semiconductors at room temperature were estimated from first principle calculations. Relaxation times of charge carriers were evaluated using the acoustic deformation potential model. It is found that van der Waals interactions play an important role in determining accurate relaxation times. The hopping mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) in bulk single crystalline structures were found to be smaller than 4 cm(2)∕Vs, whereas the band mobilities were estimated between 36 and 58 cm(2)∕Vs, which are close to the maximum reported experimental values. This strongly suggests that band conductivity is dominant in these materials even at room temperature.

  10. Analysis of muscle activity and ankle joint movement during the side-hop test.

    PubMed

    Yoshida, Masahiro; Taniguchi, Keigo; Katayose, Masaki

    2011-08-01

    Functional performance tests (FPTs) that consist of movements, such as hopping, landing, and cutting, provide useful measurements. Although some tests have been established for kinematic studies of the knee joint, very few tests have been established for the ankle joint. To use the FPT as a test battery for patients with an ankle sprain, it is necessary to document typical patterns of muscle activation and range of motion (ROM) of the ankle joint during FPTs. Therefore, the purpose of this study was to investigate the pattern of the ROM of the ankle inversion/eversion and the muscle activity of the peroneus longus muscle (PL) and the tibial anterior muscle (TA) in normal subjects during the side-hop test. To emphasize the characteristics of ROM and electromyography (EMG) at each phase, the side-hop tests were divided into 4 phases: lateral-hop contact phase (LC), lateral-hop flight phase (LF), medial hop contact phase (MC), and medial hop flight phase (MF), and the ROM of ankle inversion/eversion, a peak angle of ankle inversion, and Integral EMG (IEMG) of PL and TA compared among 4 phases. Fifteen male subjects with no symptoms of ankle joint problems participated in this research. The ROM of ankle inversion/eversion during the side-hop test was 27 ± 3.8° (mean ± SD), and there was a significant difference in the ROM of ankle inversion/eversion among 4 phases (p < 0.05). The phase in which the widest ROM was presented was the MF. A peak angle of the ankle inversion at MC was significantly greater than at LC and MF (p <0.05). A peak angle of the ankle inversion at LF was significantly greater than at LC and MF. The PL remained contracting with 50-160% of maximal voluntary contraction (MVC). The IEMGs of PL in both the contact phases were significantly greater than in both the flight phases (p < 0.05). In addition, the PL activity at LC was significantly greater than at MC. The TA remained contracting at 50-80% of MVC through the side-hop test. The IEMG of TA at both the contact phases was significantly greater than at 2 flight phases. However, there was no significant difference between LC and MF. Results of this study could be useful as basic data when evaluating the validity of the side-hop test for patients with ankle sprain.

  11. Reliability and validity of functional performance tests in dancers with hip dysfunction.

    PubMed

    Kivlan, Benjamin R; Carcia, Christopher R; Clemente, F Richard; Phelps, Amy L; Martin, Robroy L

    2013-08-01

    Quasi-experimental, repeated measures. Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. NINETEEN FEMALE DANCERS (AGE: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = -4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = -0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = -0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = -1.84, p=0.08) were not statistically different between sides. The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. 3b. Non-consecutive cohort study.

  12. RELIABILITY AND VALIDITY OF FUNCTIONAL PERFORMANCE TESTS IN DANCERS WITH HIP DYSFUNCTION

    PubMed Central

    Carcia, Christopher R.; Clemente, F. Richard; Phelps, Amy L.; Martin, RobRoy L.

    2013-01-01

    Study Design: Quasi-experimental, repeated measures. Purpose/Background: Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. Methods: Nineteen female dancers (age: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Results: Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = −4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = −0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = −0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = −1.84, p=0.08) were not statistically different between sides. Conclusion: The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. Level of Evidence: 3b. Non-consecutive cohort study PMID:24175123

  13. Synthesis and properties of nanocrystalline copper indium oxide thin films deposited by Rf magnetron sputtering.

    PubMed

    Singh, Mandeep; Singh, V N; Mehta, B R

    2008-08-01

    Nanocrystalline copper indium oxide (CuInO2) thin films with particle size ranging from 25 nm to 71 nm have been synthesized from a composite target using reactive Rf magnetron sputtering technique. X-ray photoelectron spectroscopy (XPS) combined with glancing angle X-ray diffraction (GAXRD) analysis confirmed the presence of delafossite CuInO2 phase in these films. The optical absorption studies show the presence of two direct band gaps at 3.3 and 4.3 eV, respectively. The resistance versus temperature measurements show thermally activated hopping with activation energy of 0.84 eV to be the conduction mechanism.

  14. Polaronic Effect on Electrical Conductivity and Thermoelectric Power in Ga(Cu)V4S8

    NASA Astrophysics Data System (ADS)

    Naik, I.

    2018-01-01

    Polycrystalline V4-cluster compounds of GaV4S8 and its derivatives Ga0.90 Cu0.10V4S8 and Ga0.90Cu0.20V4S8 have been prepared at 800°C by solid-state reaction method. Although the cubic-rhombohedral phase transformation at 45 K was found to be absent in the derivatives of GaV4S8, low-temperature hopping conduction occurred in all the materials. In the present context, we explain the conduction mechanism for all the materials using polaron theory. The polaron size was found to be large above 260 K but small below 260 K in GaV4S8, as confirmed by the Seebeck coefficient. From the activation energies and polaron size, the anomaly at 260 K is interpreted as associated with crossover from thermally activated to nearest-neighbor hopping upon cooling.

  15. Temperature-dependent ac conductivity and dielectric response of vanadium doped CaCu3Ti4O12 ceramic

    NASA Astrophysics Data System (ADS)

    Sen, A.; Maiti, U. N.; Thapa, R.; Chattopadhyay, K. K.

    2011-09-01

    Successful incorporation of vanadium dopant within the giant dielectric material CaCu 3Ti 4O12 (CCTO) through a conventional solid-state sintering process is achieved and its influence on the dielectric as well as electrical properties as a function of temperature and frequency is reported here. Proper crystalline phase formation together with dopant induced lattice constant shrinkage was confirmed through X-ray diffraction. The temperature dependence of the dielectric constant at different constant frequencies was investigated. We infer that the correlated barrier hopping (CBH) model is dominant in the conduction mechanism of the ceramic as per the temperature-dependent ac conductivity measurements. The electronic parameters such as density of the states at the Fermi level, N( E f) and hopping distance, R ω of the ceramic were also calculated using this model.

  16. Charge relaxation and dynamics in organic semiconductors

    NASA Astrophysics Data System (ADS)

    Kwok, H. L.

    2006-08-01

    Charge relaxation in dispersive materials is often described in terms of the stretched exponential function (Kohlrausch law). The process can be explained using a "hopping" model which in principle, also applies to charge transport such as current conduction. This work analyzed reported transient photoconductivity data on functionalized pentacene single crystals using a geometric hopping model developed by B. Sturman et al and extracted values (or range of values) on the materials parameters relevant to charge relaxation as well as charge transport. Using the correlated disorder model (CDM), we estimated values of the carrier mobility for the pentacene samples. From these results, we observed the following: i) the transport site density appeared to be of the same order of magnitude as the carrier density; ii) it was possible to extract lower bound values on the materials parameters linked to the transport process; and iii) by matching the simulated charge decay to the transient photoconductivity data, we were able to refine estimates on the materials parameters. The data also allowed us to simulate the stretched exponential decay. Our observations suggested that the stretching index and the carrier mobility were related. Physically, such interdependence would allow one to demarcate between localized molecular interactions and distant coulomb interactions.

  17. Hopping Conduction in Polymers

    NASA Astrophysics Data System (ADS)

    Bässler, Heinz

    The concept of hopping within a Gaussian density of localized states introduced earlier to rationalize charge transport in random organic photoconductors is developed further to account for temporal features of time of flight (TOF) signals. At moderate degree of energetic disorder (σ/kT~3.5…4.5) there is a transport regime intermediate between dispersive and quasi-Gaussian type whose signatures are (i) universal TOF signals that can appear weakly dispersive despite yielding a well defined carrier mobility and (ii) an asymmetric propagator of the carrier packet yielding a time dependent diffusivity.

  18. Outage analysis of relay-assisted underwater wireless optical communication systems

    NASA Astrophysics Data System (ADS)

    Tabeshnezhad, Azadeh; Pourmina, Mohammad Ali

    2017-12-01

    In this paper, we theoretically evaluate the outage probabilities of underwater wireless optical communication (UWOC) systems. Our derivations are general as the channel model under consideration takes into account all of the channel degrading effects, namely absorption, scattering, and turbulence-induced fading. We numerically show that the UWOC systems, due to the severe channel impairments, cannot typically support longer link ranges than 100 m. Therefore, in this paper, in order to increase the transmission reliability and hence extend the viable communication range of UWOC systems, we apply decode-and-forward (DF) relay-assisted communications either in the form of multi-hop transmission, where multiple intermediate relays are serially employed between the source and destination, or parallel relaying in which multiple DF relays are distributed among the source-to-destination path to cooperate in the end-to-end transmission. Our numerical results reveal that multi-hop transmission, owing to the distance-dependency of all of the channel degrading effects, can tremendously improve the end-to-end outage probability and increase the accessible link ranges to hundreds of meter. For example, a dual-hop transmission in a 45 m coastal water link can provide up to 41 dB performance improvement at the outage probability of 10-9.

  19. Polaron formation in normal state optical conductivity of iron-based superconductor

    NASA Astrophysics Data System (ADS)

    Choudhary, K. K.; Lodhi, Pavitra Devi; Kaurav, Netram

    2018-05-01

    Normal state Optical conductivity σ(ω) of Iron-Based superconductor LaFeAsO have been investigated using polaron formation mechanism. The coherent Drude free carrier excitations as well as the incoherent motion of carriers leading to a polaron formation, originated from inter and intra layer transitions of charge carriers are incorporated in the present model. Coherent motion of Drude carriers obtained from an effective interaction potential leads to a peak at zero frequency regime which is an indication of metallic conduction in superconducting materials and also produces a long tail at higher frequencies infrared region. Whereas, the incoherent motion i.e. hopping of carriers from Fe to Fe in the FeAs layer and from FeAs layer to LaO layer produces two different peaks at around 100 cm-1 and 430 cm-1 respectively. Two contributions, Drude and hopping carriers successfully explain the anomalies observed in the optical conductivity of metallic state of the iron-based superconductors.

  20. Small polaron hopping conduction mechanism in LiFePO4 glass and crystal

    NASA Astrophysics Data System (ADS)

    Banday, Azeem; Murugavel, Sevi

    2017-01-01

    The optimization of a cathode material is the most important criterion of lithium ion battery technology, which decides the power density. In order to improve the rate capability, a cathode material must possess high electronic and ionic conductivities. Therefore, it is important to understand the charge transport mechanism in such an advanced cathode material in its intrinsic state before modifying it by various means. In this work, we report the thermal, structural, and electrical conductivity studies on lithium iron phosphate, LiFePO4, both in its polycrystalline (LFPC) and glassy (LFPG) counterpart states. The vibrational spectroscopic measurements reveal the characteristic vibrational modes, which are the intrinsic part of LFPC, whereas in LFPG, the phonon modes become broader and overlap with each other due to the lattice disorder. The electrical conductivity measurements reveal that LFPG exhibits a higher polaronic conductivity of 1.6 orders than the LFPC sample. The temperature dependent dc conductivity has been analyzed with the Mott model of polarons and reveals the origin of enhanced polaronic conductivity in LFPG. Based on the analysis, the enhanced polaronic conductivity in LFPG has been attributed to the combined effect of reduced hopping length, decreased activation energy, and enhanced polaron concentration.

  1. Efficient DV-HOP Localization for Wireless Cyber-Physical Social Sensing System: A Correntropy-Based Neural Network Learning Scheme

    PubMed Central

    Xu, Yang; Luo, Xiong; Wang, Weiping; Zhao, Wenbing

    2017-01-01

    Integrating wireless sensor network (WSN) into the emerging computing paradigm, e.g., cyber-physical social sensing (CPSS), has witnessed a growing interest, and WSN can serve as a social network while receiving more attention from the social computing research field. Then, the localization of sensor nodes has become an essential requirement for many applications over WSN. Meanwhile, the localization information of unknown nodes has strongly affected the performance of WSN. The received signal strength indication (RSSI) as a typical range-based algorithm for positioning sensor nodes in WSN could achieve accurate location with hardware saving, but is sensitive to environmental noises. Moreover, the original distance vector hop (DV-HOP) as an important range-free localization algorithm is simple, inexpensive and not related to the environment factors, but performs poorly when lacking anchor nodes. Motivated by these, various improved DV-HOP schemes with RSSI have been introduced, and we present a new neural network (NN)-based node localization scheme, named RHOP-ELM-RCC, through the use of DV-HOP, RSSI and a regularized correntropy criterion (RCC)-based extreme learning machine (ELM) algorithm (ELM-RCC). Firstly, the proposed scheme employs both RSSI and DV-HOP to evaluate the distances between nodes to enhance the accuracy of distance estimation at a reasonable cost. Then, with the help of ELM featured with a fast learning speed with a good generalization performance and minimal human intervention, a single hidden layer feedforward network (SLFN) on the basis of ELM-RCC is used to implement the optimization task for obtaining the location of unknown nodes. Since the RSSI may be influenced by the environmental noises and may bring estimation error, the RCC instead of the mean square error (MSE) estimation, which is sensitive to noises, is exploited in ELM. Hence, it may make the estimation more robust against outliers. Additionally, the least square estimation (LSE) in ELM is replaced by the half-quadratic optimization technique. Simulation results show that our proposed scheme outperforms other traditional localization schemes. PMID:28085084

  2. Temperature-driven evolution of critical points, interlayer coupling, and layer polarization in bilayer Mo S2

    NASA Astrophysics Data System (ADS)

    Du, Luojun; Zhang, Tingting; Liao, Mengzhou; Liu, Guibin; Wang, Shuopei; He, Rui; Ye, Zhipeng; Yu, Hua; Yang, Rong; Shi, Dongxia; Yao, Yugui; Zhang, Guangyu

    2018-04-01

    The recently emerging two-dimensional (2D) transition-metal dichalcogenides (TMDCs) have been a fertile ground for exploring abundant exotic physical properties. Critical points, the extrema or saddle points of electronic bands, are the cornerstone of condensed-matter physics and fundamentally determine the optical and transport phenomena of the TMDCs. However, for bilayer Mo S2 , a typical TMDC and the unprecedented electrically tunable venue for valleytronics, there has been a considerable controversy on its intrinsic electronic structure, especially for the conduction band-edge locations. Moreover, interlayer hopping and layer polarization in bilayer Mo S2 which play vital roles in valley-spintronic applications have remained experimentally elusive. Here, we report the experimental observation of intrinsic critical points locations, interlayer hopping, layer-spin polarization, and their evolution with temperature in bilayer Mo S2 by performing temperature-dependent photoluminescence. Our measurements confirm that the conduction-band minimum locates at the Kc instead of Qc, and the energy splitting between Qc and Kc redshifts with a descent of temperature. Furthermore, the interlayer hopping energy for holes and temperature-dependent layer polarization are quantitatively determined. Our observations are in good harmony with density-functional theory calculations.

  3. Degradation of spent craft brewer's yeast by caprine rumen hyper ammonia-producing bacteria.

    PubMed

    Harlow, B E; Bryant, R W; Cohen, S D; O'Connell, S P; Flythe, M D

    2016-10-01

    Spent yeast from craft beers often includes more hops (Humulus lupulus L.) secondary metabolites than traditional recipes. These compounds include α- and β- acids, which are antimicrobial to the rumen hyper ammonia-producing bacteria (HAB) that are major contributors to amino acid degradation. The objective was to determine if the hops acids in spent craft brewer's yeast (CY; ~ 3·5 mg g(-1) hops acids) would protect it from degradation by caprine rumen bacteria and HAB when compared to a baker's yeast (BY; no hops acids). Cell suspensions were prepared by harvesting rumen fluid from fistulated goats, straining and differential centrifugation. The cells were re-suspended in media with BY or CY. After 24 h (39°C), HAB were enumerated and ammonia was measured. Fewer HAB and less ammonia was produced from CY than from BY. Pure culture experiments were conducted with Peptostreptococcus anaerobiusBG1 (caprine HAB). Ammonia production by BG1 from BY was greater than from CY. Ammonia production was greater when exogenous amino acids were included, but similar inhibition was observed in CY treatments. These results indicate that rumen micro-organisms deaminated the amino acids in CY to a lesser degree than BY. Spent brewer's yeast has long been included in ruminant diets as a protein supplement. However, modern craft beers often include more hops (Humulus lupulus L.) than traditional recipes. These compounds include α- and β- acids, which are antimicrobial to the rumen hyper ammonia-producing bacteria (HAB) that are major contributors to amino acid degradation. This study demonstrated that hops acids in spent craft brewer's yeast protected protein from destruction by HABin vitro. These results suggest that the spent yeast from craft breweries, a source of beneficial hops secondary metabolites, could have value as rumen-protected protein. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  4. Dynamic conductivity from audio to optical frequencies of semiconducting manganites approaching the metal-insulator transition

    NASA Astrophysics Data System (ADS)

    Lunkenheimer, P.; Mayr, F.; Loidl, A.

    2006-07-01

    We report the frequency-dependent conductivity of the manganite system La1-xSrxMnO3 (x0.2) when approaching the metal-insulator transition from the insulating side. Results from low-frequency dielectric measurements are combined with spectra in the infrared region. For low doping levels the behavior is dominated by hopping transport of localized charge carriers at low frequencies and by phononic and electronic excitations in the infrared region. For the higher Sr contents the approach of the metallic state is accompanied by the successive suppression of the hopping contribution at low frequencies and by the development of polaronic excitations in the infrared region, which finally become superimposed by a strong Drude contribution in the fully metallic state.

  5. Appearance of small polaron hopping conduction in iron modified cobalt lithium bismuth borate glasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dahiya, M. S.; Khasa, S., E-mail: skhasa@yahoo.com; Yadav, Arti

    2016-05-23

    Lithium bismuth borate glasses containing different amounts of cobalt and iron oxides having chemical composition xFe{sub 2}O{sub 3}•(20-x)CoO•30Li{sub 2}O•10Bi{sub 2}O{sub 3}•40B{sub 2}O{sub 3} (x = 0, 5, 10, 15 and 20 mol% abbreviated as CFLBB1-5 respectively) prepared via melt quench technique have been investigated for their dc electrical conductivity. The amorphous nature of prepared glasses has been confirmed through X-ray diffraction measurements. The dc electrical conductivity has been analyzed by applying Mott’s small polaron hopping model. Activation energies corresponding to lower and higher temperature region have been evaluated. The iron ion concentration (N), mean spacing between iron ions (R) and polaronmore » radius (R{sub p}) has been evaluated using the values of phonon radius (R{sub ph}) and Debye temperature (θ{sub D}). The glass sample without iron (CFLBB1) shows ionic conductivity but the incorporation of iron in the glass matrix results in the appearance of electronic conductivity.« less

  6. Effect of high energy ions on the electrical and morphological properties of Poly(3-Hexylthiophene) (P3HT) thin film

    NASA Astrophysics Data System (ADS)

    Sharma, Trupti; Singhal, R.; Vishnoi, R.; Sharma, G. D.; Biswas, S. K.

    2018-05-01

    The spin-coated thin films of Poly(3-Hexylthiophene) (P3HT) on the glass and Si (double side polished) substrates have been irradiated with 55 MeV Si+4 swift heavy ions (SHI) at fluences in the range from 1 × 1010 to 1 × 1012 ions/cm2. Structural modifications produced by energetic ions are observed by characterization of pristine and irradiated P3HT thin films. Different techniques like high-resolution X-ray diffraction (HR-XRD), micro-Raman spectroscopy and Fourier transform infrared spectroscopy (FTIR) were used to analyze the structural changes in the material. A significant increase in crystallinity and room temperature electrical conductivity of P3HT film has been detected on exposure to the heavy ions. The observed increase in the electrical conductivity with increased fluences is explained in the light of improved ordering of polymer chains after irradiation. Mott's variable range hopping model has been used to explain the conduction mechanism in the material in the temperature range of 230-350 K. The modification in surface properties also observed using AFM analysis and contact angle measurement. It is observed that nature of the P3HT thin films remains hydrophobic after irradiation.

  7. Electronic and transport properties of Li-doped NiO epitaxial thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, J. Y.; Li, W. W.; Hoye, R. L. Z.

    NiO is a p-type wide bandgap semiconductor of use in various electronic devices ranging from solar cells to transparent transistors. Understanding and improving its optical and transport properties have been of considerable interest. In this work, we have investigated the effect of Li doping on the electronic, optical and transport properties of NiO epitaxial thin films grown by pulsed laser deposition. We show that Li doping significantly increases the p-type conductivity of NiO, but all the films have relatively low room-temperature mobilities (<0.05 cm2 V -1s -1). The conduction mechanism is better described by small-polaron hoping model in the temperaturemore » range of 200 K < T <330 K, and variable range hopping at T <200 K. A combination of x-ray photoemission and O K-edge x-ray absorption spectroscopic investigations reveal that the Fermi level gradually shifts toward the valence band maximum (VBM) and a new hole state develops with Li doping. Both the VBM and hole states are composed of primarily Zhang-Rice bound states, which accounts for the small polaron character (low mobility) of hole conduction. Our work provides guidelines for the search for p-type oxide materials and device optimization.NiO is a p-type wide bandgap semiconductor of use in various electronic devices ranging from solar cells to transparent transistors. This work reports the controlling of conductivity and increase of work functions by Li doping.« less

  8. Contesting history and pursuing "other" knowledge: A study of hip-hop and non-formal education among Native American youth in San Francisco and black Portuguese youth in Lisbon

    NASA Astrophysics Data System (ADS)

    Tom, Miye Nadya

    2016-12-01

    This paper presents a broad-reaching effort to interrogate enduring colonial legacies as experienced by Native American youth in the United States of America and Black Portuguese youth of Cape Verdean origin in Portugal. As part of its methodological approach, it uses hip-hop - a cultural movement composed of four elements including rap music - to examine how youth from specific communities access knowledge which is denied to them in schools, give revolutionary voice to their realities, and broadcast perspectives on race, place and belonging. When knowledge is negated in learning institutions, non-formal education created by youth is a powerful force in re-affirming tradition and transformation. Hip-hop becomes a medium to create alternative educational projects addressing the needs of youth in San Francisco, USA, and Lisbon, Portugal, where this research was conducted.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xian, Fenglin; Department of Electronic Materials Engineering, Research School of Physics and Engineering, The Australian National University, Canberra 2601; Ye, Jiandong, E-mail: yejd@nju.edu.cn

    In this work, anion alloying is engineered in ZnON nanocrystalline films, and the resultant evolution of the structural transition, subgap states, and carrier transport is investigated. A broad distribution of sub-gap states above the valence band maximum is introduced by nitrogen due to the hybridization of N 2p and O 2p orbitals. The phase transition from partially amorphous states to full crystallinity occurs above a characteristic growth temperature of 100 °C, and the localized states are suppressed greatly due to the reduction of nitrogen composition. The electronic properties are dominated by grain boundary scattering and electron transport across boundary barriers throughmore » thermal activation at band edge states at high temperatures. The conductivity below 130 K exhibits a weak temperature dependence, which is a signature of variable-range hopping conduction between localized states introduced by nitrogen incorporation.« less

  10. Ceramics

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Chang, Aimin; Zhao, Qing; Ye, Haitao; Wu, Yiquan

    2014-11-01

    The microstructure and thermoelectric properties of Yb-doped Ca0.9- x Yb x La0.1 MnO3 (0 ≤ x ≤ 0.05) ceramics prepared by using the Pechini method derived powders have been investigated. X-ray diffraction analysis has shown that all samples exhibit single phase with orthorhombic perovskite structure. All ceramic samples possess high relative densities, ranging from 97.04% to 98.65%. The Seebeck coefficient is negative, indicating n-type conduction in all samples. The substitution of Yb for Ca leads to a marked decrease in the electrical resistivity, along with a moderate decrease in the absolute value of the Seebeck coefficient. The highest power factor is obtained for the sample with x = 0.05. The electrical conduction in these compounds is due to electrons hopping between Mn3+ and Mn4+, which is enhanced by increasing Yb content.

  11. Slow Relaxation in Anderson Critical Systems

    NASA Astrophysics Data System (ADS)

    Choi, Soonwon; Yao, Norman; Choi, Joonhee; Kucsko, Georg; Lukin, Mikhail

    2016-05-01

    We study the single particle dynamics in disordered systems with long range hopping, focusing on the critical cases, i.e., the hopping amplitude decays as 1 /rd in d-dimension. We show that with strong on-site potential disorder, the return probability of the particle decays as power-law in time. As on-site potential disorder decreases, the temporal profile smoothly changes from a simple power-law to the sum of multiple power-laws with exponents ranged from 0 to νmax. We analytically compute the decay exponents using a simple resonance counting argument, which quantitatively agrees with exact numerical results. Our result implies that the dynamics in Anderson Critical systems are dominated by resonances. Harvard-MIT CUA, Kwanjeong Educational Fellowship, AFOSR MURI, Samsung Scholarship.

  12. Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

    PubMed

    Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

    2016-04-06

    Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

  13. Dichotomy between the band and hopping transport in organic crystals: insights from experiments.

    PubMed

    Yavuz, I

    2017-10-04

    The molecular understanding of charge-transport in organic crystals has often been tangled with identifying the true dynamical origin. While in two distinct cases where complete delocalization and localization of charge-carriers are associated with band-like and hopping-like transports, respectively, their possible coalescence poses some mystery. Moreover, the existing models are still controversial at ambient temperatures. Here, we review the issues in charge-transport theories of organic materials and then provide an overview of prominent transport models. We explored ∼60 organic crystals, the single-crystal hole/electron mobilities of which have been predicted by band-like and hopping-like transport models, separately. Our comparative results show that at room-temperature neither of the models are exclusively capable of accurately predicting mobilities in a very broad range. Hopping-like models well-predict experimental mobilities around μ ∼ 1 cm 2 V -1 s -1 but systematically diverge at high mobilities. Similarly, band-like models are good at μ > ∼50 cm 2 V -1 s -1 but systematically diverge at lower mobilities. These results suggest the development of a unique and robust room-temperature transport model incorporating a mixture of these two extreme cases, whose relative importance is associated with their predominant regions. We deduce that while band models are beneficial for rationally designing high mobility organic-semiconductors, hopping models are good to elucidate the charge-transport of most organic-semiconductors.

  14. Robotic investigation on effect of stretch reflex and crossed inhibitory response on bipedal hopping

    PubMed Central

    Rosendo, Andre; Ikemoto, Shuhei; Shimizu, Masahiro; Hosoda, Koh

    2018-01-01

    To maintain balance during dynamic locomotion, the effects of proprioceptive sensory feedback control (e.g. reflexive control) should not be ignored because of its simple sensation and fast reaction time. Scientists have identified the pathways of reflexes; however, it is difficult to investigate their effects during locomotion because locomotion is controlled by a complex neural system and current technology does not allow us to change the control pathways in living humans. To understand these effects, we construct a musculoskeletal bipedal robot, which has similar body structure and dynamics to those of a human. By conducting experiments on this robot, we investigate the effects of reflexes (stretch reflex and crossed inhibitory response) on posture during hopping, a simple and representative bouncing gait with complex dynamics. Through over 300 hopping trials, we confirm that both the stretch reflex and crossed response can contribute to reducing the lateral inclination during hopping. These reflexive pathways do not use any prior knowledge of the dynamic information of the body such as its inclination. Beyond improving the understanding of the human neural system, this study provides roboticists with biomimetic ideas for robot locomotion control. PMID:29593088

  15. Magneto Transport of CVD Carbon in Artificial Opals

    NASA Astrophysics Data System (ADS)

    Wang, Lei; Yin, Ming; Arammash, Fauzi; Datta, Timir

    2014-03-01

    Magneto-transport of carbon inverse opal structures were investigated in the 2.5 to 300 K temperatures and magnetic fields in the 0-10T regime. Qualitatively, our observations lie between those reported by previous researchers. Over this temperature range, transport (in zero magnetic field) is non-metallic; the resistance decreased with rising temperature however the temperature dependent behavior is not activated, as observed with variable range hopping. In three-dimensions, such behavior can also be the result of weak localization and electron-electron interactions; in particular the change in conductivity is a polynomial in fractional powers of absolute temperature. At sub-helium temperature regimes the relative magneto resistance is measured to be ~ 0.1 percent per Tesla. Results of data analysis for several different scenarios will be reported. DOD award #60177-RT-H from the ARO.

  16. Hopping transport through an array of Luttinger liquid stubs

    NASA Astrophysics Data System (ADS)

    Chudnovskiy, A. L.

    2004-01-01

    We consider a thermally activated transport across and array of parallel one-dimensional quantum wires of finite length (quantum stubs). The disorder enters as a random tunneling between the nearest-neighbor stubs as well as a random shift of the bottom of the energy band in each stub. Whereas one-particle wave functions are localized across the array, the plasmons are delocalized, which affects the variable-range hopping. A perturbative analytical expression for the low-temperature resistance across the array is obtained for a particular choice of plasmon dispersion.

  17. Generalized Kondo lattice model and its spin-polaron realization by the projection method for cuprates

    NASA Astrophysics Data System (ADS)

    Valkov, V. V.; Dzebisashvili, D. M.; Barabanov, A. F.

    2017-05-01

    The spin-fermion model, which is an effective low-energy realization of the three-band Emery model after passing to the Wannier representation for the px and py orbitals of the subsystem of oxygen ions, reduces to the generalized Kondo lattice model. A specific feature of this model is the existence of spin-correlated hoppings of the current carriers between distant cells. Numerical calculations of the spectrum of spin-electron excitations highlight the important role of the long-range spin-correlated hoppings.

  18. Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).

    PubMed

    Stannard, Hayley J; Tulk, Melissa L; Old, Julie M

    2017-03-01

    Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine procedures, close montoring and quick action in response to signs of illness will ensure Tyzzer's disease outbreaks do not occur. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Role of electrostatic fluctuations in doped semiconductors upon the transition from band to hopping conduction (by the example of p-Ge:Ga)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poklonski, N. A., E-mail: poklonski@bsu.by; Vyrko, S. A.; Poklonskaya, O. N.

    The electrostatic model of ionization equilibrium between hydrogen-like acceptors and v-band holes in crystalline covalent p-type semiconductors is developed. The range of applicability of the model is the entire insulator side of the insulator–metal (Mott) phase transition. The density of the spatial distribution of acceptor- and donor-impurity atoms and holes over a crystal was assumed to be Poissonian and the fluctuations of their electrostatic potential energy, to be Gaussian. The model takes into account the effect of a decrease in the energy of affinity of an ionized acceptor to a v-band hole due to Debye–Hückel ion screening by both freemore » v-band holes and localized holes hopping over charge states (0) and (–1) of acceptors in the acceptor band. All donors are in charge state (+1) and are not directly involved in the screening, but ensure the total electroneutrality of a sample. In the quasiclassical approximation, analytical expressions for the root-mean-square fluctuation of the v-band hole energy W{sub p} and effective acceptor bandwidth W{sub a} are obtained. In calculating W{sub a}, only fluctuations caused by the Coulomb interaction between two nearest point charges (impurity ions and holes) are taken into account. It is shown that W{sub p} is lower than W{sub a}, since electrostatic fluctuations do not manifest themselves on scales smaller than the average de Broglie wavelength of a free hole. The delocalization threshold for v-band holes is determined as the sum of the diffusive-percolation threshold and exchange energy of holes. The concentration of free v-band holes is calculated at the temperature T{sub j} of the transition from dc band conductivity to conductivity implemented via hopping over acceptor states, which is determined from the virial theorem. The dependence of the differential energy of the thermal ionization of acceptors at the temperature 3T{sub j}/2 on their concentration N and degree of compensation K (the ratio between the donor and acceptor concentrations) is determined. Good quantitative agreement between the results of the calculation and data on the series of neutron transmutation doped p-Ge samples is obtained up to the Mott transition without using any fitting parameters.« less

  20. Ionization equilibrium at the transition from valence-band to acceptor-band migration of holes in boron-doped diamond

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poklonski, N. A., E-mail: poklonski@bsu.by; Vyrko, S. A.; Poklonskaya, O. N.

    A quasi-classical model of ionization equilibrium in the p-type diamond between hydrogen-like acceptors (boron atoms which substitute carbon atoms in the crystal lattice) and holes in the valence band (v-band) is proposed. The model is applicable on the insulator side of the insulator–metal concentration phase transition (Mott transition) in p-Dia:B crystals. The densities of the spatial distributions of impurity atoms (acceptors and donors) and of holes in the crystal are considered to be Poissonian, and the fluctuations of their electrostatic potential energy are considered to be Gaussian. The model accounts for the decrease in thermal ionization energy of boron atomsmore » with increasing concentration, as well as for electrostatic fluctuations due to the Coulomb interaction limited to two nearest point charges (impurity ions and holes). The mobility edge of holes in the v-band is assumed to be equal to the sum of the threshold energy for diffusion percolation and the exchange energy of the holes. On the basis of the virial theorem, the temperature T{sub j} is determined, in the vicinity of which the dc band-like conductivity of holes in the v-band is approximately equal to the hopping conductivity of holes via the boron atoms. For compensation ratio (hydrogen-like donor to acceptor concentration ratio) K ≈ 0.15 and temperature T{sub j}, the concentration of “free” holes in the v-band and their jumping (turbulent) drift mobility are calculated. Dependence of the differential energy of thermal ionization of boron atoms (at the temperature 3T{sub j}/2) as a function of their concentration N is calculated. The estimates of the extrapolated into the temperature region close to T{sub j} hopping drift mobility of holes hopping from the boron atoms in the charge states (0) to the boron atoms in the charge states (−1) are given. Calculations based on the model show good agreement with electrical conductivity and Hall effect measurements for p-type diamond with boron atom concentrations in the range from 3 × 10{sup 17} to 3 × 10{sup 20 }cm{sup −3}, i.e., up to the Mott transition. The model uses no fitting parameters.« less

  1. Colossal permittivity and the polarization mechanism of (Mg, Mn) co-doped LaGaO3 ceramics

    NASA Astrophysics Data System (ADS)

    Luo, Tingting; Liu, Zhifu; Zhang, Faqiang; Li, Yongxiang

    2018-03-01

    Mg and Mn co-doped LaGa0.7-xMgxMn0.3O3 (x = 0, 0.05, 0.10, 0.15) ceramics were prepared by a solid-state reaction method. The electrical properties of the LaGa0.7-xMgxMn0.3O3 ceramics were studied in detail by dielectric spectra, impedance spectra, and I-V characteristic analysis. Colossal permittivity up to 104 could be obtained across the frequency range up to 104 Hz. The impedance analysis of the co-doped LaGaO3 ceramics indicated that the Mott's variable range hopping (VRH) polarization should be the main origin of colossal permittivity. Mg and Mn co-doping suppressed the formation of Mn3+ and enhanced the VRH polarization, resulting in increased permittivity. Partial localization of electrons by Mg reduced the long-range electron hopping and led to the decrease in dielectric loss.

  2. A study of H and D doped ZnO epitaxial films grown by pulsed laser deposition

    NASA Astrophysics Data System (ADS)

    Li, Y. J.; Kaspar, T. C.; Droubay, T. C.; Joly, A. G.; Nachimuthu, P.; Zhu, Z.; Shutthanandan, V.; Chambers, S. A.

    2008-09-01

    We examine the crystal structure and electrical and optical properties of ZnO epitaxial films grown by pulsed laser deposition in a H2 or D2 ambient. n-type electrical conductivity is enhanced by three orders of magnitude as a result of growing in H2 (D2) compared to ZnO films grown in O2. Hall effect measurements reveal very small carrier activation energies and carrier concentrations in the mid-1018 cm-3 range. Optical absorption measurements show that the enhanced conductivity is not a result of ZnO reduction and interstitial Zn formation. Photoluminescence spectra suggest excitonic emission associated with exciton-hydrogen donor complex formation and show no evidence for midgap emission resulting from defects. We have modeled the transport properties of H (D) doped ZnO films using variable range hopping and surface layer conductivity models, but our data do not fit well with these models. Rather, it appears that growth in H2 (D2) promotes the formation of an exceedingly shallow donor state not seen in ZnO crystals annealed in H2 after growth. This new state may be associated with H (D) substitution at O sites in the lattice.

  3. Multiferroic properties of microwave sintered PbFe12-xO19-δ

    NASA Astrophysics Data System (ADS)

    Prathap, S.; Madhuri, W.

    2017-05-01

    The effect of iron deficiency on the structural, electrical, ferroelectric and magnetic properties of nano PbFe12-xO19-δ (where x=0.0, 0.25, 0.50, 0.75, 1.0) hexaferrites prepared by sol-gel auto combustion and processed by microwaves are investigated. X-ray analysis confirms single phase magneto-plumbite phase formation. The surface morphology is studied from Field Emission Scanning Electron Microscope. Further, optical properties are investigated using Fourier Transform Infrared spectra and UV-visible spectra. AC electrical conductivity is estimated as a function of temperature and frequency in the range of room temperature (RT) to 500 °C and 100 Hz to 5MHz. AC electrical conduction analysis shows that conduction is mainly due to small polaron hopping mechanism. The variation of polarization with applied electric field exhibits hysteresis loop confirming the ferroelectric nature. The initial permeability studies with varying temperature reveals that the Curie transition temperature for the present series is around 400 °C. Variation of initial permeability with frequency ranging from 100 to 5 MHz shows a constant value (except for x=0.0) opening avenues for high frequency applications.

  4. Electrical conduction and thermoelectric properties of perovskite-type BaBi1-xSbxO3

    NASA Astrophysics Data System (ADS)

    Yasukawa, Masahiro; Shiga, Yuta; Kono, Toshio

    2012-06-01

    To elucidate the thermoelectric properties at high temperatures, the electrical conductivity and Seebeck coefficient were measured at temperatures between 423 K and 973 K for perovskite-type ceramics of BaBi1-xSbxO3 solid solutions with x=0.0-0.5. All the ceramics exhibit p-type semiconducting behaviors and electrical conduction is attributed to hopping of small polaronic holes localized on the pentavalent cations. Substitution of Bi with Sb causes the electrical conductivity σ and cell volume to decrease, but the Seebeck coefficient S to increase, suggesting that the Sb atoms are doped as Sb5+ and replace Bi5+, reducing 6s holes conduction from Bi5+(6s0) to Bi3+ (6s2). The thermoelectric power factor S2σ has values of 6×10-8-3×10-5 W m-1 K-2 in the measured temperature range, and is maximized for an Sb-undoped BaBiO3-δ, but decreases upon Sb doping due to the decreased σ values.

  5. Electrical analysis of inter-growth structured Bi4Ti3O12-Na0.5Bi4.5Ti4O15 ceramics

    NASA Astrophysics Data System (ADS)

    Jiang, Xiangping; Jiang, Yalin; Jiang, Xingan; Chen, Chao; Tu, Na; Chen, Yunjing

    2017-06-01

    Inter-growth bismuth layer-structured ferroelectrics (BLSFs), Bi4Ti3O12-Na0.5Bi4.5Ti4O15 (BIT-NBT), were successfully synthesized using the traditional solid-state reaction method. X-ray diffraction (XRD) Rietveld refinements were conducted using GSAS software. Good agreement and low residual are obtained. The XRD diffraction peaks can be well indexed into I2cm space group. The inter-growth structure was further observed in the high-resolution TEM image. Dielectric and impedance properties were measured and systematically analyzed. At the temperature range 763-923 K (below {T}{{c}}), doubly ionized oxygen vacancies (OVs) are localized and the short-range hopping leads to the relaxation processes with an activation energy of 0.79-1.01 eV. Above {T}{{c}}, the doubly charged OVs are delocalized and become free ones, which contribute to the long-range dc conduction. The reduction in relaxation species gives rise to a higher relaxation activation energy ˜1.6  eV. Project supported by the National Natural Science Foundation of China (Grant Nos. 51562014, 51262009, and 51602135).

  6. Electron transport in the two-dimensional channel material - zinc oxide nanoflake

    NASA Astrophysics Data System (ADS)

    Lai, Jian-Jhong; Jian, Dunliang; Lin, Yen-Fu; Ku, Ming-Ming; Jian, Wen-Bin

    2018-03-01

    ZnO nanoflakes of 3-5 μm in lateral size and 15-20 nm in thickness are synthesized. The nanoflakes are used to make back-gated transistor devices. Electron transport in the ZnO nanoflake channel between source and drain electrodes are investigated. In the beginning, we argue and determine that electrons are in a two-dimensional system. We then apply Mott's two-dimensional variable range hopping model to analyze temperature and electric field dependences of resistivity. The disorder parameter, localization length, hopping distance, and hopping energy of the electron system in ZnO nanoflakes are obtained and, additionally, their temperature behaviors and dependences on room-temperature resistivity are presented. On the other hand, the basic transfer characteristics of the channel material are carried out, as well, and the carrier concentration, the mobility, and the Fermi wavelength of two-dimensional ZnO nanoflakes are estimated.

  7. CROSS-DISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Characteristics of alternating current hopping conductivity in DNA sequences

    NASA Astrophysics Data System (ADS)

    Ma, Song-Shan; Xu, Hui; Wang, Huan-You; Guo, Rui

    2009-08-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of øac(ω) ~ ω2 ln2(1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p >= 0.5, the conductivity increases with the increase of p.

  8. Temperature and frequency response of conductivity in Ag2S doped chalcogenide glassy semiconductor

    NASA Astrophysics Data System (ADS)

    Ojha, Swarupa; Das, Anindya Sundar; Roy, Madhab; Bhattacharya, Sanjib

    2018-06-01

    The electric conductivity of chalcogenide glassy semiconductor xAg2S-(1-x)(0.5S-0.5Te) has been presented here as a function of temperature and frequency. Formation of different nanocrystallites has been confirmed from X-ray diffraction study. It is also noteworthy that average size of nanocrystallites decreases with the increase of dislocation density. Dc conductivity data have been interpreted using Mott's model and Greaves's model in low and high temperature regions respectively. Ac conductivity above the room temperature has been analyzed using Meyer-Neldel (MN) conduction rule. It is interestingly noted that Correlated Barrier Hopping (CBH) model is the most appropriate conduction mechanism for x = 0.35, where pairs of charge carrier are considered to hop over the potential barrier between the sites via thermal activation. To interpret experimental data for x = 0.45, modified non-overlapping small polaron tunnelling (NSPT) model is supposed to be appropriate model due to tunnelling through grain boundary. The conductivity spectra at various temperatures have been analyzed using Almond-West Formalism (power law model). Scaling of conductivity spectra reveals that electrical relaxation process of charge carriers (polaron) is temperature independent but depends upon the composition of the present chalcogenide glassy system.

  9. HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.

    PubMed

    Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar

    2018-05-08

    HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.

  10. Dielectric properties of metallic alloy FeCoZr-dielectric ceramic PZT nanostructures prepared by ion sputtering in vacuum conditions

    NASA Astrophysics Data System (ADS)

    Boiko, O.

    2018-05-01

    The main objective of the research was investigation of dielectric properties of (FeCoZr)x(PZT)(100-x) granular nanocomposites and determination the influence of isochronous annealing in temperatures of 398 K-573 K on them. The impedance spectroscopy methodology was used. The measurements of electrical parameters, such as: phase shift angle φ, dielectric loss factor tgδ, capacity C and conductivity σ of (FeCoZr)x(PZT)(100-x) nanocomposites have been performed. Frequency dependencies of these parameters were obtained for the ambient temperature range 98 K-373 K for the frequencies ranging from 50 Hz to 105 Hz. It was established, that the conductivity σ of the tested materials before the percolation threshold demonstrates non-linear dependence on frequency. Furthermore, it increases when the ambient temperature is increasing, which indicates a dielectric type of the material. The two types of electrical conduction: capacitive (phase shift angle φ takes negative values) and inductive (φ takes positive values) have been observed. It was concluded that the hopping conductivity dominated in the nanocomposites. Voltage and current resonances phenomena are observed in the materials. The isochronous annealing intensifies the dielectric properties of (FeCoZr)x(PZT)(100-x) nanocomposites.

  11. Topological Sachdev-Ye-Kitaev model

    NASA Astrophysics Data System (ADS)

    Zhang, Pengfei; Zhai, Hui

    2018-05-01

    In this Rapid Communication, we construct a large-N exactly solvable model to study the interplay between interaction and topology, by connecting the Sachdev-Ye-Kitaev (SYK) model with constant hopping. The hopping forms a band structure that can exhibit both topologically trivial and nontrivial phases. Starting from a topologically trivial insulator with zero Hall conductance, we show that the interaction can drive a phase transition to a topologically nontrivial insulator with quantized nonzero Hall conductance, and a single gapless Dirac fermion emerges when the interaction is fine tuned to the critical point. The finite temperature effect is also considered, and we show that the topological phase with a stronger interaction is less stable against temperature. Our model provides a concrete example to illustrate the interacting topological phases and phase transitions, and can shed light on similar problems in physical systems.

  12. Cu1–xFexO: hopping transport and ferromagnetism

    PubMed Central

    Nasir, Mohd.; Islam, Rakibul; Ahmed, Md. A; Ayaz, Saniya; Kumar, Gautham; Kumar, Sunil; Prajapat, C. L.; Roussel, Frederick; Biring, Sajal

    2017-01-01

    Single phase, sol–gel prepared Cu1–xFexO (0 ≤ x ≤ 0.125) powders are characterized in terms of structural, electronic and magnetic properties. Using dielectric and magnetic studies we investigate the coupling of electron and spin. The electrical conductivities and activation energies are studied with increasing Fe content. Modelling of experimental conductivity data emphasizes a single hopping mechanism for all samples except x = 0.125, which have two activation energies. Hole doping is confirmed by confirming a majority Fe3+ substitution of Cu2+ in CuO from X-ray photoelectron spectroscopy studies (XPS). Such a substitution results in stabilized ferromagnetism. Fe substitution introduces variation in coercivity as an intrinsic magnetic property in Fe-doped CuO, and not as a secondary impurity phase. PMID:28989741

  13. Search behavior of arboreal insectivorous migrants at gulf coast stopover sites in spring

    USGS Publications Warehouse

    Chen, Chao-Chieh; Barrow, W.C.; Ouchley, K.; Hamilton, R.B.

    2011-01-01

    Search behavior of arboreal insectivorous migrants was studied at three stopover sites along the northern coast of the Gulf of Mexico during spring migrations, 1993–1995. We examined if search behavior was affected by phylogeny, or by environmental factors. A sequence of search movements (hop, flutter, or flight) in a foraging bout was recorded for each migrant encountered. Search rate, frequency, and distance of movements were calculated for each species. Search rate was positively correlated with proportion of hop, but negatively correlated to flight distance. Hop distance was positively correlated to tarsus length, as was flight distance to wing length for the 31 species of migrants. Cluster analysis indicated closely related species generally have similar foraging modes, which range from “sit-and-wait” of flycatchers to “widely foraging” of warblers. Migrants tended to use more hops in dense vegetation, but more flights in areas with sparse vegetation. Migrants also used more flights when foraging in mixed-species flocks and during periods of high migrant density. Logistic models indicated warblers were more influenced by environmental factors than vireos, possibly because warblers are near-perch searchers and more affected by these factors.

  14. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dou, Wenjie; Subotnik, Joseph E.; Nitzan, Abraham

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case ofmore » out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.« less

  15. Human hopping on damped surfaces: strategies for adjusting leg mechanics.

    PubMed

    Moritz, Chet T; Farley, Claire T

    2003-08-22

    Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.

  16. Human hopping on damped surfaces: strategies for adjusting leg mechanics.

    PubMed Central

    Moritz, Chet T; Farley, Claire T

    2003-01-01

    Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003

  17. Alternating current characterization of nano-Pt(II) octaethylporphyrin (PtOEP) thin film as a new organic semiconductor

    NASA Astrophysics Data System (ADS)

    M, Dongol; M, M. El-Nahass; A, El-Denglawey; A, A. Abuelwafa; T, Soga

    2016-06-01

    Alternating current (AC) conductivity and dielectric properties of thermally evaporated Au/PtOEP/Au thin films are investigated each as a function of temperature (303 K-473 K) and frequency (50 Hz-5 MHz). The frequency dependence of AC conductivity follows the Jonscher universal dynamic law. The AC-activation energies are determined at different frequencies. It is found that the correlated barrier hopping (CBH) model is the dominant conduction mechanism. The variation of the frequency exponent s with temperature is analyzed in terms of the CBH model. Coulombic barrier height W m , hopping distance R ω , and the density of localized states N(E F) are valued at different frequencies. Dielectric constant ɛ 1(ω,T) and dielectric loss ɛ 2(ω,T) are discussed in terms of the dielectric polarization process. The dielectric modulus shows the non-Debye relaxation in the material. The extracted relaxation time by using the imaginary part of modulus (M″) is found to follow the Arrhenius law.

  18. Influence of Thermal Annealing Treatment on Bipolar Switching Properties of Vanadium Oxide Thin-Film Resistance Random-Access Memory Devices

    NASA Astrophysics Data System (ADS)

    Chen, Kai-Huang; Cheng, Chien-Min; Kao, Ming-Cheng; Chang, Kuan-Chang; Chang, Ting-Chang; Tsai, Tsung-Ming; Wu, Sean; Su, Feng-Yi

    2017-04-01

    The bipolar switching properties and electrical conduction mechanism of vanadium oxide thin-film resistive random-access memory (RRAM) devices obtained using a rapid thermal annealing (RTA) process have been investigated in high-resistive status/low-resistive status (HRS/LRS) and are discussed herein. In addition, the resistance switching properties and quality improvement of the vanadium oxide thin-film RRAM devices were measured by x-ray diffraction (XRD) analysis, x-ray photoelectron spectrometry (XPS), scanning electron microscopy (SEM), atomic force microscopy (AFM), and current-voltage ( I- V) measurements. The activation energy of the hopping conduction mechanism in the devices was investigated based on Arrhenius plots in HRS and LRS. The hopping conduction distance and activation energy barrier were obtained as 12 nm and 45 meV, respectively. The thermal annealing process is recognized as a candidate method for fabrication of thin-film RRAM devices, being compatible with integrated circuit technology for nonvolatile memory devices.

  19. Correlation between cation conduction and ionic morphology in a PEO-based single ion conductor

    NASA Astrophysics Data System (ADS)

    Lin, Kan-Ju; Maranas, Janna

    2011-03-01

    We use molecular dynamics simulation to study ion transport and backbone mobility of a PEO-based single ion conductor. Ion mobility depends on the chemical structure and the local environment of the ions, which consequently impact ionic conductivity. We characterize the aggregation state of the ions, and assess the role of ion complexes in ionomer dynamics. In addition to solvated cations and pairs, higher order ion clusters are found. Most of the ion clusters are in string-like structure and cross-link two or more different ionomer chains through ionic binding. Ionic crosslinks decrease mobility at the ionic co-monomer; hence the mobility of the adjacent PEO segment is influenced. Na ions show slow mobility when they are inside large clusters. The hopping timescale for Na varies from 20 ns to 200. A correlation is found between Na mobility and the number of hops from one coordination site to another. Besides ether oxygens, Na ions in the ionomer also use the anion and the edge of the cluster as hopping sites. The string-like structure of clusters provide less stable sites at the two ends thus ions are more mobile in those regions. We observed Grotthus like mechanism in our ionomer, in which the positive charge migrates within the string-like cluster without the cations actually moving.

  20. Extrinsic contributions to the dielectric response in sintered BaTiO3 nanostructures in paraelectric and ferroelectric regimes

    NASA Astrophysics Data System (ADS)

    Jaffari, G. Hassnain; Rehman, Atiq ur; Iqbal, Asad M.; Awan, M. S.; Saleemi, Mohsin

    2017-11-01

    Post sintering studies of BaTiO3 (BTO) nanoparticles are presented in detail. Bulk nanostructures were prepared via three different compaction processes, namely, uniaxial cold pressing (UCP), Cold Isostatic Pressing (CIP) and Spark Plasma Sintering (SPS). Effect of compaction technique on microstructures have been investigated and correlated with electrical response for each sample. In addition to the transport properties, temperature and frequency dependent dielectric response of variously sintered samples and bulk counterpart was recorded. Several aspects have been identified that are essential to be taken into account in order to completely understand physical processes. Drastically distinct features were observed in paraelectric (PE) regime well above ferroelectric (FE)-PE transition temperature. These features include intra grain conduction with a reduction in the magnitude of PE to FE peak dielectric constant magnitude. Role of strain, grain boundary conduction associated with observation of Maxwell Wagner relaxation and hopping conduction in dielectric and ferroelectric response have been observed and discussed. Densification with presence of oxygen vacancies, significantly enhances conductivity associated with the hopping of the carriers, in turn deteriorated ferroelectric response.

  1. Multi-Hop Teleportation of an Unknown Qubit State Based on W States

    NASA Astrophysics Data System (ADS)

    Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

    2018-04-01

    Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.

  2. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    PubMed

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Nature of Dielectric Properties, Electric Modulus and AC Electrical Conductivity of Nanocrystalline ZnIn2Se4 Thin Films

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Attia, A. A.; Ali, H. A. M.; Salem, G. F.; Ismail, M. I.

    2018-02-01

    The structural characteristics of thermally deposited ZnIn2Se4 thin films were indexed utilizing x-ray diffraction as well as scanning electron microscopy techniques. Dielectric properties, electric modulus and AC electrical conductivity of ZnIn2Se4 thin films were examined in the frequency range from 42 Hz to 106 Hz. The capacitance, conductance and impedance were measured at different temperatures. The dielectric constant and dielectric loss decrease with an increase in frequency. The maximum barrier height was determined from the analysis of the dielectric loss depending on the Giuntini model. The real part of the electric modulus revealed a constant maximum value at higher frequencies and the imaginary part of the electric modulus was characterized by the appearance of dielectric relaxation peaks. The AC electrical conductivity obeyed the Jonscher universal power law. Correlated barrier hopping model was the appropriate mechanism for AC conduction in ZnIn2Se4 thin films. Estimation of the density of states at the Fermi level and activation energy, for AC conduction, was carried out based on the temperature dependence of AC electrical conductivity.

  4. The impedance spectroscopy analysis of complex perovskite Sr2YbSbO6

    NASA Astrophysics Data System (ADS)

    Barua, A.; Maity, S.; Mondal, R.; Kumar, S.

    2018-04-01

    Herein, we have reported the dielectric properties of single phase monoclinic double perovskite oxide of Sr2YbSbO6 having lattice parameter a=5.79 Å, b=5.79 Å, c=8.19 Å and β = 90.136° with grain size ranging between 0.5 to 2.4 µm. The sample has been synthesized by solid state ceramic method. We have performed the impedence spectroscopic study of the sample in the frequency range of 40 Hz to 5 MHz at various temperatures. The relaxation in the sample is polydispersive in nature and obeys the Cole-Cole model. The values of dielectric permittivity and loss tangent at room temperature are 117.94 and 0.18 respectively. The temperature variation of dc conductivity follows the Arrhenius Law with activation energy 0.2 eV and the conduction mechanism of the sample is governed by p-type polaron hopping. Due to its high dielectric permittivity and low loss tangent the sample can be fruitfully utilized for the fabrication of radio frequency devices.

  5. Sensomics analysis of key bitter compounds in the hard resin of hops (Humulus lupulus L.) and their contribution to the bitter profile of Pilsner-type beer.

    PubMed

    Dresel, Michael; Dunkel, Andreas; Hofmann, Thomas

    2015-04-08

    Recent brewing trials indicated the occurrence of valuable bitter compounds in the hard resin fraction of hop. Aiming at the discovery of these compounds, hop's ε-resin was separated by means of a sensory guided fractionation approach and the key taste molecules were identified by means of UV/vis, LC-TOF-MS, and 1D/2D-NMR studies as well as synthetic experiments. Besides a series of literature known xanthohumol derivatives, multifidol glucosides, flavon-3-on glycosides, and p-coumaric acid esters, a total of 11 bitter tastants are reported for the first time, namely, 1",2"-dihydroxanthohumol F, 4'-hydroxytunicatachalcone, isoxantholupon, 1-methoxy-4-prenylphloroglucinol, dihydrocyclohumulohydrochinone, xanthohumols M, N, and P, and isoxanthohumols M, N, and P, respectively. Human sensory analysis revealed low bitter recognition threshold concentrations ranging from 5 (co-multifidol glucopyranoside) to 198 μmol/L (trans-p-coumaric acid ethyl ester) depending on their chemical structure. For the first time, LC-MS/MS quantitation of these taste compounds in Pilsner-type beer, followed by taste re-engineering experiments, revealed the additive contribution of iso-α-acids and the identified hard resin components to be truly necessary and sufficient for constructing the authentic bitter percept of beer. Finally, brewing trails using the ε-resin as the only hop source impressively demonstrated the possibility to produce beverages strongly enriched with prenylated hop flavonoids.

  6. Adaptations in single-leg hop biomechanics following anterior cruciate ligament reconstruction.

    PubMed

    Orishimo, Karl F; Kremenic, Ian J; Mullaney, Michael J; McHugh, Malachy P; Nicholas, Stephen J

    2010-11-01

    When a patient performs a clinically normal hop test based on distance, it cannot be assumed that the biomechanics are similar between limbs. The objective was to compare takeoff and landing biomechanics between legs in patients who have undergone anterior cruciate ligament reconstruction. Kinematics and ground reaction forces were recorded as 13 patients performed the single-leg hop on each leg. Distance hopped, joint range of motion, peak joint kinetics and the peak total extensor moment were compared between legs during both takeoff and landing. Average hop distance ratio (involved/noninvolved) was 93 ± 4%. Compared to the noninvolved side, knee motion during takeoff on the involved side was significantly reduced (P = 0.008). Peak moments and powers on the involved side were lower at the knee and higher at the ankle and hip compared with the noninvolved side (Side by Joint P = 0.011; P = 0.003, respectively). The peak total extensor moment was not different between legs (P = 0.305) despite a decrease in knee moment and increases in ankle and hip moments (Side by Joint P = 0.015). During landing, knee motion was reduced (P = 0.043), and peak power absorbed was decreased at the knee and hip and increased at the ankle on the involved side compared to the noninvolved side (P = 0.003). The compensations by other joints may indicate protective adaptations to avoid overloading the reconstructed knee.

  7. Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

    PubMed

    Lawson, Carl J

    2015-12-01

    The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

  8. Refractory materials for high-temperature thermoelectric energy conversion

    NASA Technical Reports Server (NTRS)

    Wood, C.; Emin, D.

    1983-01-01

    Theoretical work of two decades ago adequately explained the transport behavior and effectively guided the development of thermoelectric materials of high conversion efficiencies of conventional semiconductors (e.g., SiGe alloys). The more significant contributions involved the estimation of optimum doping concentrations, the reduction of thermal conductivity by solid solution doping and the development of a variety of materials with ZT approx. 1 in the temperature range 300 K to 1200 K. ZT approx. 1 is not a theoretical limitation although, experimentally, values in excess of one were not achieved. Work has continued with emphasis on higher temperature energy conversion. A number of promising materials have been discovered in which it appears that ZT 1 is realizable. These materials are divided into two classes: (1) the rare-earth chalcogenides which behave as itinerant highly-degenerate n-type semiconductors at room-temperature, and (2) the boron-rich borides, which exhibit p-type small-polaronic hopping conductivity.

  9. Oxysulfide LiAlSO: A Lithium Superionic Conductor from First Principles.

    PubMed

    Wang, Xuelong; Xiao, Ruijuan; Li, Hong; Chen, Liquan

    2017-05-12

    Through first-principles calculations and crystal structure prediction techniques, we identify a new layered oxysulfide LiAlSO in orthorhombic structure as a novel lithium superionic conductor. Two kinds of stacking sequences of layers of AlS_{2}O_{2} are found in different temperature ranges. Phonon and molecular dynamics simulations verify their dynamic stabilities, and wide band gaps up to 5.6 eV are found by electronic structure calculations. The lithium migration energy barrier simulations reveal the collective interstitial-host ion "kick-off" hopping mode with barriers lower than 50 meV as the dominating conduction mechanism for LiAlSO, indicating it to be a promising solid-state electrolyte in lithium secondary batteries with fast ionic conductivity and a wide electrochemical window. This is a first attempt in which the lithium superionic conductors are designed by the crystal structure prediction method and may help explore other mixed-anion battery materials.

  10. Oxysulfide LiAlSO: A Lithium Superionic Conductor from First Principles

    NASA Astrophysics Data System (ADS)

    Wang, Xuelong; Xiao, Ruijuan; Li, Hong; Chen, Liquan

    2017-05-01

    Through first-principles calculations and crystal structure prediction techniques, we identify a new layered oxysulfide LiAlSO in orthorhombic structure as a novel lithium superionic conductor. Two kinds of stacking sequences of layers of AlS2O2 are found in different temperature ranges. Phonon and molecular dynamics simulations verify their dynamic stabilities, and wide band gaps up to 5.6 eV are found by electronic structure calculations. The lithium migration energy barrier simulations reveal the collective interstitial-host ion "kick-off" hopping mode with barriers lower than 50 meV as the dominating conduction mechanism for LiAlSO, indicating it to be a promising solid-state electrolyte in lithium secondary batteries with fast ionic conductivity and a wide electrochemical window. This is a first attempt in which the lithium superionic conductors are designed by the crystal structure prediction method and may help explore other mixed-anion battery materials.

  11. Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

    NASA Astrophysics Data System (ADS)

    Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

    2017-06-01

    The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

  12. Hind limb scaling of kangaroos and wallabies (superfamily Macropodoidea): implications for hopping performance, safety factor and elastic savings

    PubMed Central

    McGowan, C P; Skinner, J; Biewener, A A

    2008-01-01

    The aim of this study was to examine hind limb scaling of the musculoskeletal system in the Macropodoidea, the superfamily containing wallabies and kangaroos, to re-examine the effect of size on the locomotor mechanics and physiology of marsupial hopping. Morphometric musculoskeletal analyses were conducted of 15 species and skeletal specimens of 21 species spanning a size range from 0.8 to 80 kg that included representatives of 12 of the 16 extant genera of macropodoids. We found that unlike other groups, macropodoids are able to match force demands associated with increasing body size primarily through a combination of positive allometry in muscle area and muscle moment arms. Isometric scaling of primary hind limb bones suggests, however, that larger species experience relatively greater bone stresses. Muscle to tendon area ratios of the ankle extensors scale with strong positive allometry, indicating that peak tendon stresses also increase with increasing body size but to a lesser degree than previously reported. Consistent with previous morphological and experimental studies, large macropodoids are therefore better suited for elastic strain energy recovery but operate at lower safety factors, which likely poses an upper limit to body size. Scaling patterns for extant macropodoids suggest that extinct giant kangaroos (∼250 kg) were likely limited in locomotor capacity. PMID:18086129

  13. Structural, electrical and magnetic characteristics of improper multiferroic: GdFeO3

    NASA Astrophysics Data System (ADS)

    Sahoo, Sushrisangita; Mahapatra, P. K.; Choudhary, R. N. P.; Nandagoswami, M. L.; Kumar, Ashok

    2016-06-01

    Studies of dielectric, impedance, conductivity, magnetic and magneto-electric (ME) properties of GdFeO3 ceramics fabricated by chemical method are reported here. The synthesized powder is phase-pure and crystallizes in the orthorhombic crystal structure. Below 50 °C, the impedance has only grain contribution, while at higher temperatures, it has both grain and grain boundary contributions. Based on the depression angle of the Nyquist plot, the inhomogeneity of the sample is estimated. The capacitance data reveal that at low temperatures, the sample behaves as a leaky capacitor while at higher temperatures the sample shows the effect of the diffusion of thermally excited charge carriers across a barrier. In the low-frequency domain, the dielectric characteristics were explained on the basis of the Maxwell-Wagner mechanism, while in the high-frequency range those were correlated to the grain effect. The frequency dependent characteristic of the tangent loss is explained as a combined contribution from the Debye-like relaxation and dc conductivity related mechanism at higher temperatures. The temperature dependence of the dielectric characteristic and data are found to fit with two Gaussian peaks centered at 148 °C and 169 °C. While the first peak is explained on the basis of the Maxwell-Wagner mechanism, the second has its origin in magnetic reordering and the shifting of Gd3+ ions along the c-axis. The magnetic reordering also results in a sharp decrease of conductivity between 169 °C and 243 °C. The frequency dependent ac conductivity is explained on the basis of the correlated barrier hopping model and the quantum mechanical hopping model for the different frequency domain. The existence of P-E and M-H loops support its improper ferroelectric behavior and canted anti-ferromagnetism respectively. The ME coefficient of the sample is found to be 1.78 mV cm-1 Oe-1.

  14. The electron spin resonance study of heavily nitrogen doped 6H SiC crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Savchenko, D. V., E-mail: dariyasavchenko@gmail.com

    2015-01-28

    The magnetic and electronic properties of heavily doped n-type 6H SiC samples with a nitrogen concentration of 10{sup 19} and 4 × 10{sup 19 }cm{sup −3} were studied with electron spin resonance (ESR) at 5–150 K. The observed ESR line with a Dysonian lineshape was attributed to the conduction electrons (CE). The CE ESR (CESR) line was fitted by Lorentzian (insulating phase) (T < 40 K) and by Dysonian lineshape (metallic phase) above 40 K, demonstrating that Mott insulator-metal (IM) transition takes place at ∼40 K, accompanied by significant change in the microwave conductivity. The temperature dependence of CESR linewidth follows the linear Korringa law below 40 K,more » caused by the coupling of the localized electrons (LE) and CE, and is described by the exponential law above 40 K related to the direct relaxation of the LE magnetic moments via excited levels driven by the exchange interaction of LE with CE. The g-factor of the CESR line (g{sub ‖} = 2.0047(3), g{sub ⊥} = 2.0034(3)) is governed by the coupling of the LE of nitrogen donors at hexagonal and quasi-cubic sites with the CE. The sharp drop in CESR line intensity (25–30 K) was explained by the formation of antiferromagnetic ordering in the spin system close to the IM transition. The second broad ESR line overlapped with CESR signal (5–25 K) was attributed to the exchange line caused by the hopping motion of electrons between occupied and non-occupied positions of the nitrogen donors. Two mechanisms of conduction, hopping and band conduction, were distinguished in the range of T = 10–25 K and T > 50 K, respectively.« less

  15. Ionic-to-electronic conductivity of glasses in the P2O5-V2O5-ZnO-Li2O system

    NASA Astrophysics Data System (ADS)

    Langar, A.; Sdiri, N.; Elhouichet, H.; Ferid, M.

    2016-12-01

    Glasses having a composition 15V2O5-5ZnO-(80- x P2O5- xLi2O ( x = 5 , 10, 15 mol%) were prepared by the conventional melt quenching. Conduction and relaxation mechanisms in these glasses were studied using impedance spectroscopy in a frequency range from 10 Hz to 10 MHz and in a temperature range from 513 K to 566 K. The structure of the amorphous synthetic product was corroborated by X-ray diffraction (disappearance of nacrite peaks). The DC conductivity follows the Arrhenius law and the activation energy determined by regression analysis varies with the content of Li2O. Frequency-dependent AC conductivity was analyzed by Jonscher's universal power law, which is varying as ωn, and the temperature-dependent power parameter supported by the Correlated Barrier Hopping (CBH) model. For x = 15 mol%, the values of n ≤ 0.5 confirm the dominance of ionic conductivity. The analysis of the modulus formalism with a distribution of relaxation times was carried out using the Kohlrausch-Williams-Watts (KWW) stretched exponential function. The stretching exponent, β, is dependent on temperature. The analysis of the temperature variation of the M" peak indicates that the relaxation process is thermally activated. Modulus study reveals the temperature-dependent non-Debye-type relaxation phenomenon.

  16. Superconducting and magnetic properties of Bi 2Sr 2Ca 1- xY xCu 2O y (0≦ x≦1)

    NASA Astrophysics Data System (ADS)

    Yoshizaki, R.; Saito, Y.; Abe, Y.; Ikeda, H.

    1988-07-01

    The effect of substitution of Y atoms for Ca atoms has been studied in the Bi 2Sr 2Ca 1- xY xCu 2O y compound system. For x<0.5, superconductivity is observed and its fractional volume is reduced with increasing x, though the transition temperature of about 85 K is maintained. For x≧0.5 samples, the electrical resistivity behavior can be well described by the three-dimensional variable range hopping conduction, indicating that the system is essentially insulating. In this range of x, magnetic susceptibility shows spin-glass-type cusp at 13 K in the heating process after zero-field cooling and an enhanced cusp at 11 K in the field-cooling process. In the temperature range above about 150 K the Curie-Weiss dependence holds well with a positive paramagnetic Curie temperature, which increases to 40 K with increasing x in the insulating region.

  17. Microscopic theory of the Coulomb based exchange coupling in magnetic tunnel junctions.

    PubMed

    Udalov, O G; Beloborodov, I S

    2017-05-04

    We study interlayer exchange coupling based on the many-body Coulomb interaction between conduction electrons in magnetic tunnel junction. This mechanism complements the known interaction between magnetic layers based on virtual electron hopping (or spin currents). We find that these two mechanisms have different behavior on system parameters. The Coulomb based coupling may exceed the hopping based exchange. We show that the Coulomb based exchange interaction, in contrast to the hopping based coupling, depends strongly on the dielectric constant of the insulating layer. The dependence of the interlayer exchange interaction on the dielectric properties of the insulating layer in magnetic tunnel junction is similar to magneto-electric effect where electric and magnetic degrees of freedom are coupled. We calculate the interlayer coupling as a function of temperature and electric field for magnetic tunnel junction with ferroelectric layer and show that the exchange interaction between magnetic leads has a sharp decrease in the vicinity of the ferroelectric phase transition and varies strongly with external electric field.

  18. Microwave-Assisted Synthesis of Boron and Nitrogen co-doped Reduced Graphene Oxide for the Protection of Electromagnetic Radiation in Ku-Band.

    PubMed

    Umrao, Sima; Gupta, Tejendra K; Kumar, Shiv; Singh, Vijay K; Sultania, Manish K; Jung, Jung Hwan; Oh, Il-Kwon; Srivastava, Anchal

    2015-09-09

    The electromagnetic interference (EMI) shielding of reduced graphene oxide (MRG), B-doped MRG (B-MRG), N-doped MRG (N-MRG), and B-N co-doped MRG (B-N-MRG) have been studied in the Ku-band frequency range (12.8-18 GHz). We have developed a green, fast, and cost-effective microwave assisted route for synthesis of doped MRG. B-N-MRG shows high electrical conductivity in comparison to MRG, B-MRG and N-MRG, which results better electromagnetic interference (EMI) shielding ability. The co-doping of B and N significantly enhances the electrical conductivity of MRG from 21.4 to 124.4 Sm(-1) because N introduces electrons and B provides holes in the system and may form a nanojunction inside the material. Their temperature-dependent electrical conductivity follows 2D-variable range hopping (2D-VRH) and Efros-Shklovskii-VRH (ES-VRH) conduction model in a low temperature range (T<50 K). The spatial configuration of MRG after doping of B and N enhances the space charge polarization, natural resonance, dielectric polarization, and trapping of EM waves by internal reflection leading to a high EMI shielding of -42 dB (∼99.99% attenuation) compared to undoped MRG (-28 dB) at a critical thickness of 1.2 mm. Results suggest that the B-N-MRG has great potential as a candidate for a new type of EMI shielding material useful in aircraft, defense industries, communication systems, and stealth technology.

  19. Sparsity-aware multiple relay selection in large multi-hop decode-and-forward relay networks

    NASA Astrophysics Data System (ADS)

    Gouissem, A.; Hamila, R.; Al-Dhahir, N.; Foufou, S.

    2016-12-01

    In this paper, we propose and investigate two novel techniques to perform multiple relay selection in large multi-hop decode-and-forward relay networks. The two proposed techniques exploit sparse signal recovery theory to select multiple relays using the orthogonal matching pursuit algorithm and outperform state-of-the-art techniques in terms of outage probability and computation complexity. To reduce the amount of collected channel state information (CSI), we propose a limited-feedback scheme where only a limited number of relays feedback their CSI. Furthermore, a detailed performance-complexity tradeoff investigation is conducted for the different studied techniques and verified by Monte Carlo simulations.

  20. Transport of oxygen ions in Er doped La2Mo2O9 oxide ion conductors: Correlation with microscopic length scales

    NASA Astrophysics Data System (ADS)

    Paul, T.; Ghosh, A.

    2018-01-01

    We report oxygen ion transport in La2-xErxMo2O9 (0.05 ≤ x ≤ 0.25) oxide ion conductors. We have measured conductivity and dielectric spectra at different temperatures in a wide frequency range. The mean square displacement and spatial extent of non-random sub-diffusive regions are estimated from the conductivity spectra and dielectric spectra, respectively, using linear response theory. The composition dependence of the conductivity is observed to be similar to that of the spatial extent of non-random sub-diffusive regions. The behavior of the composition dependence of the mean square displacement of oxygen ions is opposite to that of the conductivity. The attempt frequency estimated from the analysis of the electric modulus agrees well with that obtained from the Raman spectra analysis. The full Rietveld refinement of X-ray diffraction data of the samples is performed to estimate the distance between different oxygen lattice sites. The results obtained from such analysis confirm the ion hopping within the spatial extent of non-random sub-diffusive regions.

  1. Size dependent polaronic conduction in hematite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Monika; Banday, Azeem; Murugavel, Sevi

    2016-05-23

    Lithium Ion Batteries have been attracted as the major renewable energy source for all portable electronic devices because of its advantages like superior energy density, high theoretical capacity, high specific energy, stable cycling and less memory effects. Recently, α-Fe{sub 2}O{sub 3} has been considered as a potential anode material due to high specific capacity, low cost, high abundance and environmental benignity. We have synthesized α-Fe{sub 2}O{sub 3} with various sizes by using the ball milling and sol-gel procedure. Here, we report the dc conductivity measurement for the crystallite size ranging from 15 nm to 50 nm. It has been observedmore » that the enhancement in the polaronic conductivity nearly two orders in magnitude while reducing the crystallite size from bulk into nano scale level. The enhancement in the conductivity is due to the augmented to compressive strain developed in the material which leads to pronounced decrease in the hopping length of polarons. Thus, nanocrystaline α-Fe{sub 2}O{sub 3} may be a better alternative anode material for lithium ion batteries than earlier reported systems.« less

  2. Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.

    PubMed

    Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F

    2006-10-01

    Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.

  3. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    PubMed Central

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jedrecy, N., E-mail: jedrecy@insp.jussieu.fr; Hamieh, M.; Hebert, C.

    We show that the well-established universal scaling σ{sub xy}{sup AHE} ∼ σ{sub xx}{sup 1.6} between anomalous Hall and longitudinal conductivities in the low conductivity regime (σ{sub xx} < 10{sup 4} Ω{sup −1} cm{sup −1}) transforms into the scaling σ{sub xy}{sup AHE} ∼ σ{sub xx}{sup 2} at the onset of strong electron localization. The crossover between the two relations is observed in magnetite-derived Zn{sub x}Fe{sub 3-x}O{sub 4} thin films where an insulating/hopping regime follows a bad metal/hopping regime below the Verwey transition temperature T{sub v}. Our results demonstrate that electron localization effects come into play in the anomalous Hall effect (AHE)more » modifying significantly the scaling exponent. In addition, the thermal evolution of the anomalous Hall resistivity suggests the existence of spin polarons whose size would decrease below T{sub v}.« less

  5. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    PubMed

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  6. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  7. Low-temperature thermal transport and thermopower of monolayer transition metal dichalcogenide semiconductors

    NASA Astrophysics Data System (ADS)

    Sengupta, Parijat; Tan, Yaohua; Klimeck, Gerhard; Shi, Junxia

    2017-10-01

    We study the low temperature thermal conductivity of single-layer transition metal dichalcogenides (TMDCs). In the low temperature regime where heat is carried primarily through transport of electrons, thermal conductivity is linked to electrical conductivity through the Wiedemann-Franz law (WFL). Using a k.p Hamiltonian that describes the K and K{\\prime} valley edges, we compute the zero-frequency electric (Drude) conductivity using the Kubo formula to obtain a numerical estimate for the thermal conductivity. The impurity scattering determined transit time of electrons which enters the Drude expression is evaluated within the self-consistent Born approximation. The analytic expressions derived show that low temperature thermal conductivity (1) is determined by the band gap at the valley edges in monolayer TMDCs and (2) in presence of disorder which can give rise to the variable range hopping regime, there is a distinct reduction. Additionally, we compute the Mott thermopower and demonstrate that under a high frequency light beam, a valley-resolved thermopower can be obtained. A closing summary reviews the implications of results followed by a brief discussion on applicability of the WFL and its breakdown in context of the presented calculations.

  8. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    ERIC Educational Resources Information Center

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  9. Nonadiabatic small-polaron hopping conduction in Li-doped and undoped Bi4Sr3Ca3CuyOx (0<=y<=5)

    NASA Astrophysics Data System (ADS)

    Mollah, S.; Som, K. K.; Bose, K.; Chakravorty, A. K.; Chaudhuri, B. K.

    1992-11-01

    Detailed experimental results of temperature- and CuO-concentration-dependent dc conductivities of semiconducting Bi4Sr3Ca3CuyOx (y=0 to 5) and Li-doped Bi4Sr3Ca3-zLizCu4Ox (z=0.1, 0.5, and 1.0) glasses are reported. The variation of activation energy with glass compositions dominates the conductivity. Unlike many glasses with transition-metal ions, a strong preexponential factor containing the ``small-polaron'' tunneling term [exp(-2αR)] is observed. Nonadiabatic small-polaron hopping mechanism is found to be appropriate for explaining the conductivity data of both glass systems. Addition of alkali-metal ions decreases the conductivities and causes appreciable change of some model parameters obtained from least-squares fittings of the experimental data. The overall thermal behavior of the electrical conductivities of the glasses, however, remains unaltered. This indicates that small (less than 10 wt.%) amount of Li or other alkali-metal ions in these glasses acts as a flux to keep the oxygen content fixed in the corresponding glass-ceramic (superconducting) phases. This in turn helps increase the superconducting transition temperature of the glass ceramics and also lower the sintering and melting temperatures of the glasses.

  10. CONSISTENCY OF FIELD-BASED MEASURES OF NEUROMUSCULAR CONTROL USING FORCE PLATE DIAGNOSTICS IN ELITE MALE YOUTH SOCCER PLAYERS

    PubMed Central

    READ, PAUL; OLIVER, JON L.; DE STE CROIX, MARK B.A.; MYER, GREGORY D.; LLOYD, RHODRI S.

    2016-01-01

    Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players and reliability data is sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force plate diagnostics in this cohort. Twenty six pre-peak height velocity (PHV) and twenty five post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single leg 75% horizontal hop and stick (75%HOP) and single leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilisation (TTS), time to pVGRF, and pVGRF asymmetry were recorded. A test, re-test design was used and reliability statistics included: change in mean, intraclass correlation coefficient (ICC) and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the three protocols (CV range = 13.8 – 49.7%). ICC values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be utilized to support a screening battery for elite male youth soccer players and for test re-test comparison. PMID:27075641

  11. Photo-induced changes of the surface band bending in GaN: Influence of growth technique, doping and polarity

    NASA Astrophysics Data System (ADS)

    Winnerl, Andrea; Pereira, Rui N.; Stutzmann, Martin

    2017-05-01

    In this work, we use conductance and contact potential difference photo-transient data to study the influence of the growth technique, doping, and crystal polarity on the kinetics of photo-generated charges in GaN. We found that the processes, and corresponding time scales, involved in the decay of charge carriers generated at and close to the GaN surface via photo-excitation are notably independent of the growth technique, doping (n- and p-types), and also crystal polarity. Hence, the transfer of photo-generated charges from band states back to surface states proceeds always by hopping via shallow defect states in the space-charge region (SCR) close to the surface. Concerning the charge carrier photo-generation kinetics, we observe considerable differences between samples grown with different techniques. While for GaN grown by metal-organic chemical vapor deposition, the accumulation of photo-conduction electrons results mainly from a combined trapping-hopping process (slow), where photo-generated electrons hop via shallow defect states to the conduction band (CB), in hydride vapor phase epitaxy and molecular beam epitaxy materials, a faster direct process involving electron transfer via CB states is also present. The time scales of both processes are quite insensitive to the doping level and crystal polarity. However, these processes become irrelevant for very high doping levels (both n- and p-types), where the width of the SCR is much smaller than the photon penetration depth, and therefore, most charge carriers are generated outside the SCR.

  12. Variation in band gap energy and electrical analysis of double doped cobalt ferrite

    NASA Astrophysics Data System (ADS)

    Parveen, Azra; Agrawal, Shraddha; Azam, Ameer

    2018-05-01

    The Ca and Cr doped cobalt ferrite nanoparticles (Co0.9Ca0.1) (Fe0.8 Cr0.2)2O4 were synthesized by microwave gel combustion method. Microstructural studies were carried out by XRD and SEM. Structural studies suggest that the crystal system remains spinal even with the doping of calcium and chromium. The SEM image shows the spherical morphology of surface of the sample. Optical properties of Ca and Cr doped cobalt ferrite were studied by UV-visible technique in the range of 400-600 nm. The electrical conductivity of pure and doped cobalt ferrite were studied as a function of frequency and were explained on the basis of electron hopping.

  13. The magnetic ordering in high magnetoresistance Mn-doped ZnO thin films

    DOE PAGES

    Venkatesh, S.; Baras, A.; Lee, J. -S.; ...

    2016-03-24

    Here, we studied the nature of magnetic ordering in Mn-doped ZnO thin films that exhibited ferromagnetism at 300 K and superparamagnetism at 5 K. We directly inter-related the magnetisation and magnetoresistance by invoking the polaronpercolation theory and variable range of hopping conduction below the metal-to-insulator transition. By obtaining a qualitative agreement between these two models, we attribute the ferromagnetism to the s-d exchange-induced spin splitting that was indicated by large positive magnetoresistance (~40 %). Low temperature superparamagnetism was attributed to the localization of carriers and non-interacting polaron clusters. This analysis can assist in understanding the presence or absence of ferromagnetismmore » in doped/un-doped ZnO.« less

  14. Metal to insulator transition in Sb doped SnO2 monocrystalline nanowires thin films

    NASA Astrophysics Data System (ADS)

    Costa, I. M.; Bernardo, E. P.; Marangoni, B. S.; Leite, E. R.; Chiquito, A. J.

    2016-12-01

    We report on the growth and transport properties of single crystalline Sb doped SnO2 wires grown from chemical vapour deposition. While undoped samples presented semiconducting behaviour, doped ones clearly undergo a transition from an insulating state ( d R /d T <0 ) to a metallic one ( d R /d T >0 ) around 130 -150 K depending on the doping level. Data analysis in the framework of the metal-to-insulator transition theories allowed us to investigate the underlying physics: electron-electron and electron-phonon interactions were identified as the scattering mechanisms present in the metallic phase, while the conduction mechanism of the semiconducting phase (undoped sample) was characterized by thermal activation and variable range hopping mechanisms.

  15. Organogenic nodule formation in hop: a tool to study morphogenesis in plants with biotechnological and medicinal applications.

    PubMed

    Fortes, Ana M; Santos, Filipa; Pais, Maria S

    2010-01-01

    The usage of Humulus lupulus for brewing increased the demand for high-quality plant material. Simultaneously, hop has been used in traditional medicine and recently recognized with anticancer and anti-infective properties. Tissue culture techniques have been reported for a wide range of species, and open the prospect for propagation of disease-free, genetically uniform and massive amounts of plants in vitro. Moreover, the development of large-scale culture methods using bioreactors enables the industrial production of secondary metabolites. Reliable and efficient tissue culture protocol for shoot regeneration through organogenic nodule formation was established for hop. The present review describes the histological, and biochemical changes occurring during this morphogenic process, together with an analysis of transcriptional and metabolic profiles. We also discuss the existence of common molecular factors among three different morphogenic processes: organogenic nodules and somatic embryogenesis, which strictly speaking depend exclusively on intrinsic developmental reprogramming, and legume nitrogen-fixing root nodules, which arises in response to symbiosis. The review of the key factors that participate in hop nodule organogenesis and the comparison with other morphogenic processes may have merit as a study presenting recent advances in complex molecular networks occurring during morphogenesis and together, these provide a rich framework for biotechnology applications.

  16. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    PubMed Central

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  17. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    PubMed

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  18. Clinical Effects of Dry Needling Among Asymptomatic Individuals With Hamstring Tightness: A Randomized Controlled Trial.

    PubMed

    Geist, Kathleen; Bradley, Claire; Hofman, Alan; Koester, Rob; Roche, Fenella; Shields, Annalise; Frierson, Elizabeth; Rossi, Ainsley; Johanson, Marie

    2017-11-01

    Randomized controlled trial. The aim of this study was to determine the effects of dry needling on hamstring extensibility and functional performance tests among asymptomatic individuals with hamstring muscle tightness. Dry needling has been shown to increase range of motion in the upper quarter and may have similar effects in the lower quarter. 27 subjects with hamstring extensibility deficits were randomly assigned to side of treatment (dominant or nondominant) and group (blunt needling or dry needling). The first session included measurement of hamstring extensibility and performance on 4 unilateral hop tests, instruction in home hamstring stretching exercises and needling distal to the ischial tuberosity and midbellies of the medial and lateral hamstrings. A second session, 3-5 days following the first session, included outcome measures and a second needling intervention, and a third session, 4-6 weeks following the first session, included outcome measures only. A 2 × 3 × 2 ANOVA was used to statistically analyze the data. Hamstring extensibility showed a significant side × time interaction (P < .05). The single hop for distance, timed 6-meter hop, and the crossover hop test had a significant main effect of time (P < .05). The triple hop for distance showed a significant side × time × group interaction (P < .05). It does not appear dry needling results in increased extensibility beyond that of stretching alone in asymptomatic individuals. Our study findings suggest that dry needling may improve certain dimensions of functional performance, although no clear conclusion can be made. Intervention, level 2b.

  19. Spin-orbit interaction and negative magnetoresistance for localized electrons in InSb quantum wells

    NASA Astrophysics Data System (ADS)

    Ishida, S.; Manago, T.; Nishizako, N.; Geka, H.; Shibasaki, I.

    2010-02-01

    Weak-field magnetoresistance (MR) in the variable-range hopping (VRH) in the presence of spin-orbit interaction (SOI) for 2DEGs at the hetero-interface of InSb quantum wells was examined in view of the quantum interference (QI) effect. Samples with the sheet resistance, ρ> ρc= h/ e2, exhibit VRH, while those with ρ< ρc exhibit weak localiz ation (WL) at low temperatures, where h/ e2 is the quantum resistance. In the WL regime, a positive magnetoresistance (MR) peak due to the weak anti-localization (WAL) with SOI is clearly observed in low magnetic field. In contrast, the low-field hopping MR remains entirely negative surviving the SOI, indicating that the hopping MR due to the QI is completely negative regardless of the SOI. This result supports the predictions based on the directed-path approach for forward-scattering paths ignoring the back-scattering return loops for the QI in the VRH.

  20. Piezo activated mode tracking system for widely tunable mode-hop-free external cavity mid-IR semiconductor lasers

    NASA Technical Reports Server (NTRS)

    Tittel, Frank K. (Inventor); Curl, Robert F. (Inventor); Wysocki, Gerard (Inventor)

    2010-01-01

    A widely tunable, mode-hop-free semiconductor laser operating in the mid-IR comprises a QCL laser chip having an effective QCL cavity length, a diffraction grating defining a grating angle and an external cavity length with respect to said chip, and means for controlling the QCL cavity length, the external cavity length, and the grating angle. The laser of claim 1 wherein said chip may be tuned over a range of frequencies even in the absence of an anti-reflective coating. The diffraction grating is controllably pivotable and translatable relative to said chip and the effective QCL cavity length can be adjusted by varying the injection current to the chip. The laser can be used for high resolution spectroscopic applications and multi species trace-gas detection. Mode-hopping is avoided by controlling the effective QCL cavity length, the external cavity length, and the grating angle so as to replicate a virtual pivot point.

  1. BLUECOM+ project: Connecting Humans and Systems at Ocean Remote Areas using Cost-effective Broadband Communications field

    NASA Astrophysics Data System (ADS)

    Brito, Pedro; Terrinha, Pedro; Magalhães, Vitor; Santos, Joana; Duarte, Débora; Campos, Rui

    2017-04-01

    The BLUECOM + project (Connecting Humans and Systems at Remote Ocean Areas using Cost-effective Broadband Communications) aims at developing an innovative communications solution that will enable broadband, cost-effective Internet access in remote ocean areas (ideally beyond 100 km from shore), using standard wireless access technologies - e.g., Wi-Fi and LTE. BLUECOM+ is an EEA Grants PT02 project developed by INESC TEC (Institute for Systems and Computer Engineering, Technology and Science), IPMA (Portuguese Institute for the Sea and the Atmosphere), and MARLO (Transport and Logistics Consultants). The BLUECOM+ key idea and innovation lies on deploying a long-term communications infrastructure, which will extend broadband communications from shore to remote ocean areas by leveraging (1) Helikites - a combination of a helium balloon and kite - that can be tethered to existing or new land and ocean platforms, (2) long range line of sight wireless communications using TV white spaces, and (3) multi-hop relaying techniques to further increase range. At this stage the communications protocols were defined and tested in lab conditions and two sea trials for demonstration of the system were carried out in July/2016 and September/2016 using research vessels. Results of the cruises: 1st cruise corresponded to the first sea-trials of the project. Single-hop communications were established between a land base station deployed at Cabo Espichel lighthouse and the Sea Station deployed in a Helikite launched from the vessel and flying at an altitude of 120m. Successful communications between the two stations were established at a maximum distance of 40km with a data rate in excess of 1Mbit/s. 2nd cruise corresponded to the second sea-trials. During this trial single-hop and two-hop land-sea communications were tested. For two-hop communications tests two Helikites were launched at 120m from two vessels. The first was launched from a vessel closer to shore; the other was launched from the second vessel and connected to the first to have Internet access. The tests were performed at increasing distances up to a maximum distance of 45km from the land station and the first hop, and up to 10km between the two Helikites. The main results achieved were: • Single-hop data rates in excess of 1Mbit/s up to 45km; • Two-hop data rates in excess of 500kbit/s up to 55km; • Video conference with land at 42km offshore without a glitch; • Real-time upload of data collected by an autonomous vehicle offshore to the cloud. A 3rd cruise will be done this year to test video streaming to shore of sea bottom images acquired from the ship with a drop down video system. This will include the integration of the BLUECOM+ network with the drop down video system, in order to demonstrate real-time underwater video transmission offshore. Acknowledgements: This work was developed as part of the BLUECOM+ project (PT02_Aviso4_0005) funded by the EEA Grants and Norway Grants.

  2. Zinc chloride modified electronic transport and relaxation studies in barium-tellurite glasses

    NASA Astrophysics Data System (ADS)

    Dhankhar, Sunil; Kundu, R. S.; Rani, Sunita; Sharma, Preeti; Murugavel, S.; Punia, Rajesh; Kishore, N.

    2017-09-01

    The ac conductivity of halide based tellurium glasses having composition 70 TeO2-(30-x) BaO-x ZnCl2; x = 5, 10, 15, 20 and 25 has been investigated in the frequency range 10-1 Hz to 105Hz and in the temperature range 453 K to 553 K. The frequency and temperature dependent ac conductivity show mixed behaviour with increase in halide content and found to obey Jonscher's universal power law. The values of dc conductivity, crossover frequency and frequency exponent have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. For determining the conduction mechanism in studied glass system, frequency exponent has been analyzed by various theoretical models. In presently studied glasses, the ac conduction takes place via overlapping large polaron tunneling (OLPT). The values of activation energy for dc conduction (W) and the one associated with relaxation process ( E R) are found to increase with increase in x up to glass sample with x = 15 and thereafter it decrease with increase in zinc chloride content. DC conduction takes place via variable range hopping (VRH) as proposed by Mott with some modification suggested by Punia et al. The value of real part of modulus ( M') is observed to decrease with increase in temperature. The value of stretched exponent (β) obtained from fitting of M'' reveals the presence of non-Debye type of relaxation in presently studied glass samples. Scaling spectra of ac conductivity and values of electric modulus ( M' and M'') collapse into a single master curve for all the compositions and temperatures. The values of relaxation energy ( E R) for all the studied glass compositions are almost equal to W, suggesting that polarons have to overcome same barrier while relaxing and conducting. The conduction and relaxation processes in the studied glass samples are composition and temperature independent. [Figure not available: see fulltext.

  3. Propulsion of the Water Flea, Daphnia magna: Experiments, Scaling, and Modelling

    NASA Astrophysics Data System (ADS)

    Skipper, A. N.; Murphy, D.; Webster, D. R.; Yen, J.

    2016-02-01

    The freshwater crustacean Daphnia magna is a widely studied zooplankton in relation to food webs, predator-prey interactions, and other biological/ecological considerations; however, their locomotion is poorly quantified and understood. These water fleas utilize a hop-and-sink mechanism that consists of making quick, impulsive jumps by beating their antennae to propel themselves forward ( 1 body length). The animals then sink for a period, during which they stretch out their antennae to increase drag and thereby reduce their sinking velocity. Time-resolved three-dimensional flow fields surrounding the animals were quantified with a unique infrared tomographic particle image velocity (tomo-PIV) system. Three-dimensional kinematics data were also extracted from the image sequences. In the current work, we compared body kinematics and flow disturbance among organisms of size in the range of 1.3 to 2.8 mm. The stroke cycle averaged 150 ms in duration, ranging from 100 to 180 ms; this period is generally evenly split between the power and recovery strokes. The range of peak hop velocity was 27.2 to 32.5 mm/s, and peak acceleration was in the range of 0.68 to 1.8 m/s2. The results showed a distinct relationship between peak hop speed (Vmax 14 BL/s) and body size; these data collapsed onto a single time-record curve during the power stroke when properly non-dimensionalized. The fluid flow induced by each antennae consisted of a viscous vortex ring that demonstrated a slow decay in the wake. The strength, size, and decay of the induced viscous vortex rings were compared as a function of organism size. Finally, the viscous vortex rings were analyzed in the context of a double Stokeslet model that consisted of two impulsively applied point forces separated by the animal width.

  4. Characterization and electrical properties of V 2O 5-CuO-P 2O 5 glasses

    NASA Astrophysics Data System (ADS)

    Al-Assiri, M. S.

    2008-08-01

    Characterization and electrical properties of vanadium-copper-phosphate glasses of compositions xV 2O 5-(40- x)CuO-60P 2O 5 have been reported. X-ray diffraction (XRD) confirms the amorphous nature of these glasses. It was observed that, the density ( d) decreases gradually while the molar volume ( Vm) increases with the increase of the vanadium oxide content in such glasses. This may be due to the effect of the polarizing power strength, PPS, which is a measure of ratio of the cation valance to its diameter. The dc conductivity increases while the activation energy decreases with the increase of the V 2O 5 content. The dc conductivity in the present glasses is electronic and depends strongly upon the average distance, R, between the vanadium ions. Analysis of the electrical properties has been made in the light of small polaron hopping model. The parameters obtained from the fits of the experimental data to this model are reasonable and consistent with glass composition. The conduction is attributed to non-adiabatic hopping of small polaron.

  5. The Sedative Effect of Non-Alcoholic Beer in Healthy Female Nurses

    PubMed Central

    Franco, Lourdes; Sánchez, Cristina; Bravo, Rafael; Rodríguez, Ana B.; Barriga, Carmen; Romero, Eulalia; Cubero, Javier

    2012-01-01

    Introduction The hop (Humulus lupulus L.), a component of beer, is a sedative plant whose pharmacological activity is principally due to its bitter resins, in particular to the α-acid degradation product 2-methyl-3-buten-2-ol. The mechanism of action of hop resin consists of raising the levels of the neurotransmitter γ-aminobutyric acid (GABA), an inhibitory neurotransmitter acting in the central nervous system (CNS). Objectives To analyze the sedative effect of hops as a component of non-alcoholic beer on the sleep/wake rhythm in a work-stressed population. Methods The experiment was conducted with healthy female nurses (n = 17) working rotating and/or night shifts. Overnight sleep and chronobiological parameters were assessed by actigraphy (Actiwatch®) after moderate ingestion of non-alcoholic beer containing hops (333 ml with 0,0% alcohol) with supper for 14 days (treatment). Data were obtained in comparison with her own control group without consumption of beer during supper. Results Actigraphy results demonstrated improvement of night sleep quality as regards the most important parameters: Sleep Latency diminished (p≤0.05) in the Treatment group (12.01±1.19 min) when compared to the Control group (20.50±4.21 min), as also did Total Activity (p≤0.05; Treatment group = 5284.78±836.99 activity pulses vs Control = 7258.78±898.89 activity pulses). In addition, anxiety as indexed by the State-Trait Anxiety Inventory (STAI) decreased in the Treatment group (State Anxiety 18.09±3.8 vs Control 20.69±2.14). Conclusion The moderate consumption of non-alcoholic beer will favour night-time rest, due in particular to its hop components, in addition to its other confirmed benefits for the organism. PMID:22815680

  6. The Effect of Holder Pasteurization on Activin A Levels in Human Milk.

    PubMed

    Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Li Volti, Giovanni; Galvano, Fabio; Barbagallo, Ignazio; Visser, Gerard H A; Gazzolo, Diego

    2016-11-01

    There is evidence that mother's own milk is the best nutrient in terms of multiorgan protection and infection prevention. However, when maternal milk is scarce, the solution can be represented by donor milk (DM), which requires specific storage procedures such as Holder Pasteurization (HoP). HoP is not free from side effects since it is widely known that it causes qualitative/quantitative changes in milk composition, particularly in the protein content. Therefore, the aim of this study is to investigate the effects of HoP on Activin A, a neurobiomarker known to play an important role in the development and protection of the central nervous system. In 24 mothers who delivered preterm (n = 12) and term (n = 12) healthy newborns, we conducted a pretest/test study where the milk donors acted as their own controls. Each sample was divided into two parts: the first was frozen at -80°C (Group 1); the second was Holder-pasteurized before freezing at -80°C (Group 2). Activin A was quantified using an ELISA test. Activin A was detected in all samples. There were no significant differences (p > 0.05) between the two groups, also when the analysis was stratified for gestational age at delivery and milk maturation degree (p > 0.05, for both). The present findings on the absence of any side effects of HoP on the milk concentration of Activin A offer additional support to the efficacy of HoP in DM storage. Our data open up to further investigations on neurobiomarkers' assessment in human milk and their preanalytical stability according to storage procedures.

  7. Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.

    PubMed

    Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

    2016-09-12

    In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).

  8. Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program

    PubMed Central

    Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

    2016-01-01

    Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968

  9. HopBase: a unified resource for Humulus genomics

    PubMed Central

    Hill, Steven T.; Sudarsanam, Ramcharan

    2017-01-01

    Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075

  10. Origin of colossal permittivity in BaTiO3 via broadband dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Han, Hyuksu; Voisin, Christophe; Guillemet-Fritsch, Sophie; Dufour, Pascal; Tenailleau, Christophe; Turner, Christopher; Nino, Juan C.

    2013-01-01

    Barium titanate (BT) ceramics with Ba/Ti ratios of 0.95 and 1.00 were synthesized using spark plasma sintering (SPS) technique. Dielectric spectroscopy (frequency range from 40 Hz to 1 MHz and temperature range from 300 K to 30 K) was performed on those ceramics (SPS BT). SPS BT showed extremely high permittivity up to ˜105, which can be referred to as colossal permittivity, with relatively low dielectric loss of ˜0.05. Data analyses following Debye relaxation and universal dielectric response models indicate that the origin of colossal permittivity in BT ceramics is the result of a hopping polaron within semiconducting grains in combination with interfacial polarization at the insulating grain boundary. Furthermore, the contributions of each polarization mechanism to the colossal permittivity in SPS BT, such as a hopping polarization, internal barrier layer capacitance effect, and electrode effect, were estimated.

  11. Multielectronic conduction in La1-xSrxGa1/2Mn1/2O3-δ as solid oxide fuel cell cathode

    NASA Astrophysics Data System (ADS)

    Iguchi, E.; Hashimoto, Y.; Kurumada, M.; Munakata, F.

    2003-08-01

    Four-probe dc conductivities, capacitances, and thermopower have been measured in the temperature range of 80-1123 K for La1-xSrxGa1/2Mn1/2O3-δ, which is a desirable cathode material for lanthanum-gallate electrolytes of solid oxide fuel cells. The dc conductivities in the specimens (0.1⩽x⩽0.3) are insensitive to x but the thermopower is very sensitive to x, although the x=0 specimen exhibits a somewhat different conduction behavior. At T<300 K, a relaxation process has shown in dielectric loss factor with the activation energy higher than that for dc conduction in every specimen. These results at T<300 K have been numerically analyzed within the framework of the multielectronic conduction consisting of the polaronic conduction of Mn 3d eg holes created by Sr doping, the band conduction of O 2p holes and the hopping conduction of Mn 3d eg electrons, where the O 2p holes and Mn 3d eg electrons are created by thermal excitation of electrons from O 2p bands to Mn 3d eg narrow bands. At T>500 K, the band conduction dominates the electronic transports. The ionic conduction due to O2- migration seems difficult to contribute directly to the dc conduction even at high temperature.

  12. Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

    ERIC Educational Resources Information Center

    Lindsey, Treva B.

    2015-01-01

    This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

  13. Temperature and frequency dependent conductivity of bismuth zinc vanadate semiconducting glassy system

    NASA Astrophysics Data System (ADS)

    Punia, R.; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Kishore, N.

    2012-10-01

    The ac conductivity of bismuth zinc vanadate glasses with compositions 50V2O5. xBi2O3. (50-x) ZnO has been studied in the frequency range 10-1 Hz to 2 MHz and in temperature range 333.16 K to 533.16 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of bismuth zinc vanadate glass system. The dc conductivity (σdc), crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. It has been observed that mobility of charge carriers and ac conductivity in case of zinc vanadate glass system increases with increase in Bi2O3 content. In order to determine the conduction mechanism, the ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models based on classical hopping over barriers and quantum mechanical tunneling. The ac conduction takes place via tunneling of overlapping large polarons in all the compositions of presently studied vanadate glasses. The fitting of experimental data of ac conductivity with overlapping large polarons tunneling model has also been done. The parameters; density of states at Fermi level (N(EF)), activation energy associated with charge transfer between the overlapping sites (WHO), inverse localization length (α) and polaron radius (rp) obtained from fitting of this model with experimental data are reasonable.

  14. Semiconductor-insulator transition in VO{sub 2} (B) thin films grown by pulsed laser deposition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rúa, Armando; Díaz, Ramón D.; Lysenko, Sergiy

    2015-09-28

    Thin films of B-phase VO{sub 2} were grown by pulsed-laser deposition on glass and (100)-cut MgO substrates in a temperature range from 375 to 425 °C and at higher gas pressures than usual for this technique. The films were strongly oriented, with ab-planes parallel to the substrate surface. Detailed study of surface morphology through Atomic Force Microscopy images suggest significant differences in evolution as a function of growth temperature for films on the two types of substrates. Measurements of electrical conductivities through cooling-heating cycles from room temperature to 120 K showed changes of five orders of magnitude, with steeper changes between roommore » temperature and ∼150 K, which corresponds with the extended and reversible phase transition known to occur for this material. At lower temperatures conductivities exhibited Arrhenius behavior, indicating that no further structural change was occurring and that conduction is thermally activated. In this lower temperature range, conductivity of the samples can be described by the near-neighbor hopping model. No hysteresis was found between the cooling and heating braches of the cycles, which is at variance with previous results published for VO{sub 2} (B). This apparent lack of hysteresis for thin films grown in the manner described and the large conductivity variation as a function of temperature observed for the samples suggests this material could be of interest for infrared sensing applications.« less

  15. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    NASA Astrophysics Data System (ADS)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  16. Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

    ERIC Educational Resources Information Center

    Kruse, Adam J.

    2016-01-01

    This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

  17. The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

    ERIC Educational Resources Information Center

    Soderman, Johan

    2013-01-01

    Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

  18. Hip-hop as a resource for understanding the urban context

    NASA Astrophysics Data System (ADS)

    Brown, Bryan

    2010-06-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

  19. Where Is My Stuff? Conceptualizing Hip Hop as "Play"

    ERIC Educational Resources Information Center

    Broughton, Anthony

    2017-01-01

    Cultural continuity between home and school has been emphasized in a range of research concerning diversity and multicultural education [Colombo, M. (2005). "Reflections from teachers of culturally diverse children." "Young Children, Beyond the Journal," 60(6). Retrieved from…

  20. Structural and dielectric properties of Ba{sub 2}LaSbO{sub 6} ceramics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumari, Premlata, E-mail: k.premlata1@gmail.com; Dutta, Alo; Sinha, T. P.

    2014-04-24

    The ceramic Ba{sub 2}LaSbO{sub 6} (BLS) is synthesized by the solid state reaction technique. The Rietveld refinement of X-ray diffraction pattern at room temperature shows Monoclinic P2{sub 1}/n space group symmetry with lattice parameter a = 6.0720 (0) Å, b = 6.1058 (3) Å, c = 8.6016 (6) Å and β =89.7091 ° (8). Dielectric study of sample has been performed in the temperature range from 30 °C to 300 °C in the frequency range 50 Hz to 1.1 MHz. Dielectric relaxation peaks are observed in the imaginary part of complex permittivity of the spectra. The frequency dependence of realmore » and imaginary parts of dielectric permittivity is analyzed using Cole-Cole model. The temperature dependent relaxation time is found to obey the Arrhenius law having activation energy 0.48 eV which indicates that the conduction mechanism in the materials may be due to polaron hopping based on electron carriers. The complex plane plots of BLS shows the presence of both grain and grain boundary effects. Conductivity spectra follow the power law.« less

  1. Anomalously small resistivity and thermopower of strongly compensated semiconductors and topological insulators

    NASA Astrophysics Data System (ADS)

    Chen, Tianran; Shklovskii, B. I.

    2013-04-01

    In the recent paper, we explained why the maximum bulk resistivity of topological insulators (TIs) such as Bi2Se3 is so small [B. Skinner, T. Chen, and B. I. Shklovskii, Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.109.176801 109, 176801 (2012)]. Using the model of completely compensated semiconductor we showed that when the Fermi level is pinned in the middle of the gap the activation energy of resistivity is Δ=0.3(Eg/2), where Eg is the semiconductor gap. In this paper, we consider a strongly compensated n-type semiconductor. We find the position of the Fermi level μ calculated from the bottom of the conduction band Ec and the activation energy of resistivity Δ as a function of compensation K, and show that Δ=0.3(Ec-μ) holds at any 0<1-K≪1. In the same range of relatively high temperatures, the Peltier energy (heat) Π is even smaller: Π≃Δ/2=0.15(Ec-μ). We also show that at low temperatures, the activated conductivity crosses over to variable range hopping (VRH) and find the characteristic temperature of VRH, TES, as a function of K.

  2. Low-temperature thermoelectric properties of Pb doped Cu2SnSe3

    NASA Astrophysics Data System (ADS)

    Prasad K, Shyam; Rao, Ashok; Gahtori, Bhasker; Bathula, Sivaiah; Dhar, Ajay; Chang, Chia-Chi; Kuo, Yung-Kang

    2017-09-01

    A series of Cu2Sn1-xPbxSe3 (0 ≤ x ≤ 0.04) compounds was prepared by solid state synthesis technique. The electrical resistivity (ρ) decreased with increase in Pb content up to x = 0.01, thereafter it increased with further increase in x (till x = 0.03). However, the lowest value of electrical resistivity is observed for Cu2Sn0.96Pb0.04Se3. Analysis of electrical resistivity of all the samples suggests that small poloron hoping model is operative in the high temperature regime while variable range hopping is effective in the low temperature regime. The positive Seebeck coefficient (S) for pristine and doped samples in the entire temperature range indicates that the majority charge carriers are holes. The electronic thermal conductivity (κe) of the Cu2Sn1-xPbxSe3 compounds was estimated by the Wiedemann-Franz law and found that the contribution from κe is less than 1% of the total thermal conductivity (κ). The highest ZT 0.013 was achieved at 400 K for the sample Cu2Sn0.98Pb0.02Se3, about 30% enhancement as compared to the pristine sample.

  3. Gap state analysis in electric-field-induced band gap for bilayer graphene.

    PubMed

    Kanayama, Kaoru; Nagashio, Kosuke

    2015-10-29

    The origin of the low current on/off ratio at room temperature in dual-gated bilayer graphene field-effect transistors is considered to be the variable range hopping in gap states. However, the quantitative estimation of gap states has not been conducted. Here, we report the systematic estimation of the energy gap by both quantum capacitance and transport measurements and the density of states for gap states by the conductance method. An energy gap of ~ 250 meV is obtained at the maximum displacement field of ~ 3.1 V/nm, where the current on/off ratio of ~ 3 × 10(3) is demonstrated at 20 K. The density of states for the gap states are in the range from the latter half of 10(12) to 10(13) eV(-1) cm(-2). Although the large amount of gap states at the interface of high-k oxide/bilayer graphene limits the current on/off ratio at present, our results suggest that the reduction of gap states below ~ 10(11) eV(-1) cm(-2) by continual improvement of the gate stack makes bilayer graphene a promising candidate for future nanoelectronic device applications.

  4. Treatment of homozygous familial hypercholesterolaemia in paediatric patients: A monocentric experience.

    PubMed

    Buonuomo, Paola S; Macchiaiolo, Marina; Leone, Giovanna; Valente, Paola; Mastrogiorgio, Gerarda; Gnazzo, Maria; Rana, Ippolita; Gonfiantini, Michaela V; Gagliardi, Maria G; Romano, Francesca; Bartuli, Andrea

    2018-01-01

    Background Homozygous familial hypercholesterolaemia is a rare life-threatening disease characterized by markedly elevated low-density lipoprotein cholesterol (LDL-C) concentrations and accelerated atherosclerosis. The presence of double gene defects in the LDL-Receptor, either the same defect (homozygous) or two different LDL-raising mutations (compound heterozygotes) or other variants, identify the homozygous phenotype (HopFH). Apheresis is a procedure in which plasma is separated from red blood cells before the physical removal of LDL-C or the LDL-C is directly removed from whole blood. It is currently the treatment of choice for patients with HopFH whose LDL-C levels are not able to be reduced to target levels with conventional lipid-lowering drug therapy. Design The aim of this study is to report a cohort of six paediatric patients and to evaluate the long term efficacy of combined medical therapy and LDL-apheresis on LDL-C reduction. Methods We collected data from six children with confirmed diagnosis of HopFH (two females and four males; age range at diagnosis 3-8 years, mean 6 ± 1 years) from a single clinical hospital in Italy from 2007 to 2017. Results Clinical manifestations and outcomes may greatly vary in children with HopFH. Medical therapy and LDL-apheresis for the severe form should be started promptly in order to prevent cardiovascular disease. Conclusions Lipoprotein apheresis is a very important tool in managing patients with HopFH at high risk of cardiovascular disease. Based on our experience and the literature data, the method is feasible in very young children, efficient regarding biological results and cardiac events, and safe with minor side-effects and technical problems. We advise treating homozygous and compound heterozygous children as soon as possible.

  5. Structural and electrical properties of nickel substituted cadmium ferrite

    NASA Astrophysics Data System (ADS)

    Chethan, B.; Raj Prakash, H. G.; Vijayakumari, S. C.; Ravikiran, Y. T.

    2018-05-01

    Spinal nano-sized Cadmium ferrite (CD) and Nickel substituted cadmium ferrite (NSCF) were fabricated by sol-gel auto combustion method. The formation of spinal structure of ferrite materials was confirmed by X-ray diffraction (XRD) analysis. The crystallites size of CF and NSCF as determined by Scherrer's formula were found to be 24.73 nm and 17.70 nm respectively. comparative study of Fourier transform infrared spectroscopy (FTIR) of CF and NSCF revealed tetrahedral absorption bands shifted slightly towards higher frequency where as octahedral bands shifted towards lower frequency side confirming interfacial interaction between Ni and CF. The AC conductivity (σ), loss tangent (tan δ) and complex plane impedance plots for both CF and NSCF are determined at various frequencies ranging from 50 kHz to 5 MHz and comparatively analyzed. The increase in AC conductivity of the NSCF nano particles as compared to CF was explained in the light of hopping model. The impedance measurement of NSCF show presence of a semi-circle corresponding to the grain boundary resistance and hence shows that the conductivity takes place largely through grain boundaries.

  6. Structural versus electrical properties of an organic-inorganic hybrid material based on sulfate

    NASA Astrophysics Data System (ADS)

    Ben Rached, Asma; Guionneau, Philippe; Lebraud, Eric; Mhiri, Tahar; Elaoud, Zakaria

    2017-01-01

    A new organo-sulfate compound is obtained by slow evaporation at room temperature and is characterized by powder and single-crystal X-ray diffraction (XRD) at variable temperatures. The benzylammonium monohydrogenosulfate of formula C6H5CH2NH3+. HSO4-, denoted (BAS), crystallizes in the monoclinic system P21/c space group with the following parameters at room temperature: a=5.623(5)Å, b=20.239(5) Å, c=8.188(5)Å, β=94.104(5)°. The crystal structure consists of infinite parallel two-dimensional planes built by HSO4- anions and C6H5CH2NH3+ cations interconnected by strong O-H….. O and N-H….. O hydrogen bonds. A phase transition is detected at 350 K by differential scanning calorimetry (DSC) and confirmed by powder XRD. Conductivity measurements using the impedance spectroscopy technique allow to determine the conductivity relaxation parameters associated with the H+ conduction from an analysis of the M"/M"max spectrum measured in a wide temperature range. Transport properties of this material appear to be due to an H+ ion hopping mechanism.

  7. AC/DC electrical conduction and dielectric properties of PMMA/PVAc/C60 down-shifting nanocomposite films

    NASA Astrophysics Data System (ADS)

    El-Bashir, S. M.; Alwadai, N. M.; AlZayed, N.

    2018-02-01

    Polymer nanocomposite films were prepared by doping fullerene C60 in polymer blend composed of polymethacrylate/polyvinyl acetate blends (PMMA/PVAc) using solution cast technique. The films were characterized by differential scanning calorimeter (DSC), Transmission electron microscope (TEM), DC/AC electrical conductivity and dielectric measurements in the frequency range (100 Hz- 1 MHz). The glass transition temperature, Tg, was increased by increasing the concentration of fullerene C60; this property reflects the increase of thermal stability by increasing the nanofiller content. The DC and AC electrical conductivities were enhanced by increasing C60 concentration due to the electron hopping or tunneling between filled and empty localized states above Tg. The relaxation time was determined from the αβ -relaxations and found to be attenuated by increasing the temperature as a typical behavior of amorphous polymers. The calculated values of thermodynamic parameters revealed the increase of molecular stability by increasing the doping concentration; this feature supports the application of PMMA/PVAc/C60 nanocomposite films in a wide scale of solar energy conversion applications such as luminescent down-shifting (LDS) coatings for photovoltaic cells.

  8. Annealing of Heavily Boron-Doped Silicon: Effect on Electrical and Thermoelectric Properties.

    PubMed

    Zulian, Laura; Segrado, Francesco; Narducci, Dario

    2017-03-01

    In previous studies it was shown that heavily boron-doped nanocrystalline silicon submitted to thermal treatments at temperatures ≥800 °C is characterized by an anomalously high thermoelectric power factor. Its enhanced performances were ascribed to the formation of SiBx precipitates at grain boundary, leading to the formation of potential barriers that filter out low-energy carriers, then causing a simultaneous enhancement of the Seebeck coefficient and of the electrical conductivity. To further investigate the effect of thermal treatment on boron-doped nanocrystalline silicon, samples were submitted to a host of annealing processes or of sequences of them at temperatures between 900 and 1000 °C and for various amounts of time. Electrical conductivity and Hall effect measurements were carried out after each thermal treatment over the temperature range 20–300 K. They provided evidence of the formation of an impurity band, and of hopping conduction at very low temperatures. Hall resistivity data versus temperature provided therefore important insights in the electronic structure of the system, which will enable a more complete understanding of the factors ruling energy filtering in this class of materials.

  9. Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿

    PubMed Central

    Behr, Jürgen; Vogel, Rudi F.

    2010-01-01

    In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of hop inhibition, these investigations provide general insight on the role of electrophysiology and ion homeostasis in bacterial stress responses to membrane-active drugs. PMID:19880646

  10. A model for complex flows of soft glassy materials with application to flows through fixed fiber beds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarkar, Arijit; Koch, Donald L., E-mail: dlk15@cornell.edu

    2015-11-15

    The soft glassy rheology (SGR) model has successfully described the time dependent simple shear rheology of a broad class of complex fluids including foams, concentrated emulsions, colloidal glasses, and solvent-free nanoparticle-organic hybrid materials (NOHMs). The model considers a distribution of mesoscopic fluid elements that hop from trap to trap at a rate which is enhanced by the work done to strain the fluid element. While an SGR fluid has a broad exponential distribution of trap energies, the rheology of NOHMs is better described by a narrower energy distribution and we consider both types of trap energy distributions in this study.more » We introduce a tensorial version of these models with a hopping rate that depends on the orientation of the element relative to the mean stress field, allowing a range of relative strengths of the extensional and simple shear responses of the fluid. As an application of these models we consider the flow of a soft glassy material through a dilute fixed bed of fibers. The dilute fixed bed exhibits a range of local linear flows which alternate in a chaotic manner with time in a Lagrangian reference frame. It is amenable to an analytical treatment and has been used to characterize the strong flow response of many complex fluids including fiber suspensions, dilute polymer solutions and emulsions. We show that the accumulated strain in the fluid elements has an abrupt nonlinear growth at a Deborah number of order one in a manner similar to that observed for polymer solutions. The exponential dependence of the hopping rate on strain leads to a fluid element deformation that grows logarithmically with Deborah number at high Deborah numbers. SGR fluids having a broad range of trap energies flowing through fixed beds can exhibit a range of rheological behaviors at small Deborah numbers ranging from a yield stress, to a power law response and finally to Newtonian behavior.« less

  11. Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

    ERIC Educational Resources Information Center

    Petchauer, Emery

    2015-01-01

    One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

  12. Control of Scirtothrips dorsalis with foliar insecticides, 2011

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to evaluate the efficacy of several conventional and novel insecticides against a new invasive thrips pest, Scirtothrips dorsalis Hood, in pepper under greenhouse condition. The trial was conducted at Tropical Research and Education Center in Homestead, Florida in hop...

  13. High-Speed On-Board Data Processing for Science Instruments: HOPS

    NASA Technical Reports Server (NTRS)

    Beyon, Jeffrey

    2015-01-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  14. Sufficient Amounts of Functional HOP2/MND1 Complex Promote Interhomolog DNA Repair but Are Dispensable for Intersister DNA Repair during Meiosis in Arabidopsis[W

    PubMed Central

    Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde

    2013-01-01

    During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313

  15. Scanning ion conductance microscopy for visualizing the three-dimensional surface topography of cells and tissues.

    PubMed

    Nakajima, Masato; Mizutani, Yusuke; Iwata, Futoshi; Ushiki, Tatsuo

    2018-01-01

    Scanning ion conductance microscopy (SICM), which belongs to the family of scanning probe microscopy, regulates the tip-sample distance by monitoring the ion current through the use of an electrolyte-filled nanopipette as the probing tip. Thus, SICM enables "contact-free" imaging of cell surface topography in liquid conditions. In this paper, we applied hopping mode SICM for obtaining topographical images of convoluted tissue samples such as trachea and kidney in phosphate buffered saline. Some of the SICM images were compared with the images obtained by scanning electron microscopy (SEM) after drying the same samples. We showed that the imaging quality of hopping mode SICM was excellent enough for investigating the three-dimensional surface structure of the soft tissue samples. Thus, SICM is expected to be used for imaging a wide variety of cells and tissues - either fixed or alive- at high resolution under physiologically relevant liquid conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. CW and pulsed electrically detected magnetic resonance spectroscopy at 263 GHz/12 T on operating amorphous silicon solar cells

    NASA Astrophysics Data System (ADS)

    Akhtar, W.; Schnegg, A.; Veber, S.; Meier, C.; Fehr, M.; Lips, K.

    2015-08-01

    Here we describe a new high frequency/high field continuous wave and pulsed electrically detected magnetic resonance (CW EDMR and pEDMR) setup, operating at 263 GHz and resonance fields between 0 and 12 T. Spin dependent transport in illuminated hydrogenated amorphous silicon p-i-n solar cells at 5 K and 90 K was studied by in operando 263 GHz CW and pEDMR alongside complementary X-band CW EDMR. Benefiting from the superior resolution at 263 GHz, we were able to better resolve EDMR signals originating from spin dependent hopping and recombination processes. 5 K EDMR spectra were found to be dominated by conduction and valence band tail states involved in spin dependent hopping, with additional contributions from triplet exciton states. 90 K EDMR spectra could be assigned to spin pair recombination involving conduction band tail states and dangling bonds as the dominating spin dependent transport process, with additional contributions from valence band tail and triplet exciton states.

  17. Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

    NASA Astrophysics Data System (ADS)

    Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

    2018-01-01

    The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

  18. Classical Molecular Dynamics with Mobile Protons.

    PubMed

    Lazaridis, Themis; Hummer, Gerhard

    2017-11-27

    An important limitation of standard classical molecular dynamics simulations is the inability to make or break chemical bonds. This restricts severely our ability to study processes that involve even the simplest of chemical reactions, the transfer of a proton. Existing approaches for allowing proton transfer in the context of classical mechanics are rather cumbersome and have not achieved widespread use and routine status. Here we reconsider the combination of molecular dynamics with periodic stochastic proton hops. To ensure computational efficiency, we propose a non-Boltzmann acceptance criterion that is heuristically adjusted to maintain the correct or desirable thermodynamic equilibria between different protonation states and proton transfer rates. Parameters are proposed for hydronium, Asp, Glu, and His. The algorithm is implemented in the program CHARMM and tested on proton diffusion in bulk water and carbon nanotubes and on proton conductance in the gramicidin A channel. Using hopping parameters determined from proton diffusion in bulk water, the model reproduces the enhanced proton diffusivity in carbon nanotubes and gives a reasonable estimate of the proton conductance in gramicidin A.

  19. Crystal growth and magneto-transport behavior of PdS1-δ

    NASA Astrophysics Data System (ADS)

    Cao, Lin; Lv, Yang-Yang; Chen, Si-Si; Li, Xiao; Zhou, Jian; Yao, Shu-Hua; Chen, Y. B.; Lu, Minghui; Chen, Yan-Feng

    2018-04-01

    PdS is theoretically proposed to novel topological material with eight-band fermions. Here, PdS1-δ crystals were successfully grown from KI as solvent by modified flux method. The single crystalline quality and compositional homogeneity of grown PdS1-δ are characterized by X-ray diffraction and energy dispersion spectroscopy. Temperature dependent electrical transport property of PdS1-δ demonstrates a semiconductor-like behavior. Analysis of temperature-dependent resistance indicates that there is variable-range-hopping behavior at low temperature. The clear negative MR of PdS1-δ single crystals is measured at the low temperature (<30 K), which may be ascribed to the interaction between conducting carriers and localized moments. however, the magneto-transport results have not shown the clues of topological feature of PdS.

  20. Hopping Robot with Wheels

    NASA Technical Reports Server (NTRS)

    Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

    2003-01-01

    A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

  1. Experimental and Theoretical Demonstration on the Transport Properties of Fused Ring Host Materials for Organic Light-Emitting Diodes

    NASA Astrophysics Data System (ADS)

    Tse, S. C.; So, S. K.; Yeung, M. Y.; Lo, C. F.; Wen, S. W.; Chen, C. H.

    2006-01-01

    The charge transport properties of three tertiary-butyl (t-Bu) substituted anthracene derivatives (ADN), critical blue host materials for organic light-emitting diodes (OLEDs), have been investigated experimentally and computationally. From time-of-flight (TOF) measurements, all ADN compounds exhibit ambipolar characters. The hole and electron mobilities are in the range (1--5)× 10-7 cm2 V-1 s-1 under an external applied field of about 1 MV cm-1. Un-substituted ADN has the highest carrier mobilities while heavily t-Bu substituted ADN has the least. The electron and hole conducting properties of are consistent with ab initio calculation, which indicates that the frontier orbitals are localized mainly on the anthracene moiety. t-Bu substitutions in ADN increase the hopping path lengths among the molecules and hence reduce the electron and hole mobilities. The results demonstrate that t-Bu substitution is an effective means of engineering the conductivity of organic charge transporter for OLED applications.

  2. Stepping stones in the electron transport from cells to electrodes in Geobacter sulfurreducens biofilms.

    PubMed

    Bonanni, Pablo Sebastián; Massazza, Diego; Busalmen, Juan Pablo

    2013-07-07

    Geobacter sulfurreducens bacteria grow on biofilms and have the particular ability of using polarized electrodes as the final electron acceptor of their respiratory chain. In these biofilms, electrons are transported through distances of more than 50 μm before reaching the electrode. The way in which electrons are transported across the biofilm matrix through such large distances remains under intense discussion. None of the two mechanisms proposed for explaining the process, electron hopping through outer membrane cytochromes and metallic like conduction through conductive PilA filaments, can account for all the experimental evidence collected so far. Aiming at providing new elements for understanding the basis for electron transport, in this perspective article we present a modelled structure of Geobacter pilus. Its analysis in combination with already existing experimental evidence gives support to the proposal of the "stepping stone" mechanism, in which the combined action of pili and cytochromes allows long range electron transport through the biofilm.

  3. Non-Debye relaxation and resonance phenomena in dielectric spectra of CaCu3Ti4O12 family functional ceramic materials

    NASA Astrophysics Data System (ADS)

    Turik, A. V.; Bogatin, A. S.

    2015-01-01

    Experimental data on dielectric spectra of calcium copper titanate, CaCu3Ti4O12 (CCTO) family functional ceramics have been studied and analyzed. It is shown that there are both non-Debye relaxation and resonance regions in their spectra. An occurrence of a retardation of complex permittivity and a relaxation of electric modulus is established. An average relaxation frequency of the electric modulus is considerably (in some cases several orders of magnitude) larger than the retardation frequency of the permittivity. A parallel connection of the capacity and complex conductivity is used to model and interpret experimental data on a negative permittivity in the infralow frequency range. Computer simulation enables us to reveal that the hopping conductivity, characteristic for disordered heterogeneous systems, is to be taken into account to describe adequately experimental data on passing the real part of the capacity (or permittivity) through zero. We have found a critical frequency at which the parallel resonance would take place.

  4. Fabrication of PbFe12O19 nanoparticles and study of their structural, magnetic and dielectric properties

    NASA Astrophysics Data System (ADS)

    Mousavi Ghahfarokhi, S. E.; Rostami, Z. A.; Kazeminezhad, I.

    2016-02-01

    In this study, M-type Lead hexaferrite (PbFe12O19) nanoparticles were prepared by a sol-gel method and the prepared powders were annealed at 700-1000 °C for 1, 1.5, 2, 2.5 and 3 h. The Lead hexaferrite powders were characterized using thermogravimetry-differential thermal analysis, X-ray diffraction, scanning electron microscopy, LCR meter, vibrating sample magnetometer, and Fourier transforms infrared spectroscopy. The size of the nanoparticles was increased with the annealing temparature. The results reveal that the best annealing temperature and annealing time for preparing PbFe12O19 nanoparticles at 800 °C and 3 h are obtained. The infrared spectra measured in range of 4000-400 cm-1 exhibit stretching modes of metal ions in tetrahedral site at 580-550 cm-1 and octahedral site at 470-430 cm-1. The variation in ac conductivity (σac) with frequency shows that the electrical conductivity in these ferrites is mainly attributed to the electron hopping mechanism.

  5. Near interface traps in SiO{sub 2}/4H-SiC metal-oxide-semiconductor field effect transistors monitored by temperature dependent gate current transient measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fiorenza, Patrick; La Magna, Antonino; Vivona, Marilena

    This letter reports on the impact of gate oxide trapping states on the conduction mechanisms in SiO{sub 2}/4H-SiC metal-oxide-semiconductor field effect transistors (MOSFETs). The phenomena were studied by gate current transient measurements, performed on n-channel MOSFETs operated in “gate-controlled-diode” configuration. The measurements revealed an anomalous non-steady conduction under negative bias (V{sub G} > |20 V|) through the SiO{sub 2}/4H-SiC interface. The phenomenon was explained by the coexistence of a electron variable range hopping and a hole Fowler-Nordheim (FN) tunnelling. A semi-empirical modified FN model with a time-depended electric field is used to estimate the near interface traps in the gate oxide (N{sub trap} ∼ 2 × 10{supmore » 11} cm{sup −2}).« less

  6. Structure and transport investigations on lithium-iron-phosphate glasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banday, Azeem; Sharma, Monika; Murugavel, Sevi, E-mail: murug@physics.du.ac.in

    2016-05-23

    Cathode materials for Lithium Ion Batteries (LIB’s) are being constantly studied and reviewed especially in the past few decades. LiFePO{sub 4} (LFP) is one of the most potential candidates in the pedigree of cathode materials and has been under extensive study ever since. In this work, we report the synthesis of amorphous analogs of crystallite LFP by conventional melt quenching method. Thermal study by using differential scanning calorimetry (DSC) was used to determine the glass transition T{sub g} and crystallization T{sub c} temperatures on the obtained glass sample Fourier transform infrared (FTIR) absorption spectroscopy is being used to investigate themore » structural properties of the glass sample. The intrinsic electrical conductivity measurements were done using broad-band impedance spectroscopy with wide different temperature ranges. The conduction mechanism is described by non-adiabatic small polaron hopping between nearest neighbors. Based on the obtained results, we suggest that the glassy LFP is more suitable cathode material as compared to its crystalline counterpart.« less

  7. Electronic and transport properties of BCN alloy nanoribbons

    NASA Astrophysics Data System (ADS)

    Darvishi Gilan, Mahdi; Chegel, Raad

    2018-03-01

    The dependence of the carbon (C) concentration on the electronic and transport properties of boron carbonitride (BCN) alloy nanoribbons have been investigated using surface Green's functions technique and random Hamiltonian model by considering random hopping parameters including first and second nearest neighbors. Our calculations indicate that substituting boron (nitrogen) sites with carbon atoms induces a new band close to conduction (valence) band and carbon atoms behave like a donor (acceptor) dopants. Also, while both nitrogen and boron sites are substituted randomly by carbon atoms, new bands are induced close to both valence and conduction bands. The band gap decreases with C substituting and the number of charge carriers increases in low bias voltage. Far from Fermi level in the higher range of energy, transmission coefficient and current of the system are reduced by increasing the C concentration. Based on our results, tuning the electronic and transport properties of BCN alloy nanoribbons by random carbon dopants could be applicable to design nanoelectronics devices.

  8. Disruption of prion protein-HOP engagement impairs glioblastoma growth and cognitive decline and improves overall survival.

    PubMed

    Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R

    2015-06-01

    Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.

  9. Ion transport in the microporous titanosilicate ETS-10.

    PubMed

    Wei, Ta-Chen; Hillhouse, Hugh W

    2006-07-20

    Impedance spectroscopy was used to investigate ion transport in the microporous crystalline framework titanosilicate ETS-10 in the frequency range from 1 Hz to 10 MHz. These data were compared to measured data from the microporous aluminosilicate zeolite X. Na-ETS-10 was found to have a lower activation energy for ion conduction than that of NaX, 58.5 kJ/mol compared to 66.8 kJ/mol. However, the dc conductivity and ion hopping rate for Na-ETS-10 were also lower than NaX. This was found to be due to the smaller entropy contribution in Na-ETS-10 because of its high cation site occupancy. This was verified by ion exchanging Na(+) with Cu(2+) in both microporous frameworks. This exchange decreases the cation site occupancy and reduces correlation effects. The exchanged Cu-ETS-10 was found to have both lower activation energy and higher ionic conductivity than CuX. Zeolite X has the highest ion conductivity among the zeolites, and thus the data shown here indicate that ETS-10 has more facile transport of higher valence cations which may be important for ion-exchange, environmental remediation of radionucleotides, and nanofabrication.

  10. DNA in the material world: electrical properties and nano-applications.

    PubMed

    Triberis, Georgios P; Dimakogianni, Margarita

    2009-01-01

    Contradictory experimental findings and theoretical interpretations have spurred intense debate over the electrical properties of the DNA double helix. In the present review article the various factors responsible for these divergences are discussed. The enlightenment of this issue could improve long range chemistry of oxidative DNA damage and repair processes, monitoring protein-DNA interactions and possible applications in nano-electronic circuit technology. The update experimental situation concerning measurements of the electrical conductivity is given. The character of the carriers responsible for the electrical conductivity measured in DNA is investigated. A theoretical model for the temperature dependence of the electrical conductivity of DNA is presented, based on microscopic models and percolation theoretical arguments. The theoretical results, excluding or including correlation effects, are applied to recent experimental findings for DNA, considering it as a one dimensional molecular wire. The results indicate that correlation effects are probably responsible for large hopping distances in DNA samples. Other theoretical conductivity models proposed for the interpretation of the responsible transport mechanism are also reviewed. Some of the most known and pioneering works on DNA's nano-applications, future developments and perspectives along with current technological limitations and patents are presented and discussed.

  11. Dielectric Properties of PANI/CuO Nanocomposites

    NASA Astrophysics Data System (ADS)

    Ambalagi, Sharanabasamma M.; Devendrappa, Mahalesh; Nagaraja, Sannakki; Sannakki, Basavaraja

    2018-02-01

    The combustion method is used to prepare the Copper Oxide (CuO) nanoparticles. The nanocomposites of Polyaniline (PANI) by doping with copper oxide nanoparticles have synthesized at 10, 20, 30, 40 and 50 different weight percentages during the in-situ polymerization. The samples of nanocomposite of PANI-CuO were characterized by using X-Ray diffraction (XRD) technique. The physical properties such as dielectric constant, dielectric loss and A C conductivity of the nanocomposites are studied as a function of frequency in the range 5Hz-35MHz at room temperature. It is found that the dielectric constant decreases as the frequency increases. The dielectric constant it remains constant at higher frequencies and it is also observed that in particular frequency both the dielectric constant and dielectric loss are decreased as a weight percentage of CuO increased. In case of AC conductivity it is found that as the frequency increases the AC conductivity remains constant up to 3.56MHz and afterwards it increases as frequency increases. This is due to the increase in charge carriers through the hopping mechanism in the polymer nanocomposites. It is also observed that as a weight percentage of CuO increased the AC conductivity is also increasing at a particular frequency.

  12. Systematic characterization of a 1550 nm microelectromechanical (MEMS)-tunable vertical-cavity surface-emitting laser (VCSEL) with 7.92 THz tuning range for terahertz photomixing systems

    NASA Astrophysics Data System (ADS)

    Haidar, M. T.; Preu, S.; Cesar, J.; Paul, S.; Hajo, A. S.; Neumeyr, C.; Maune, H.; Küppers, F.

    2018-01-01

    Continuous-wave (CW) terahertz (THz) photomixing requires compact, widely tunable, mode-hop-free driving lasers. We present a single-mode microelectromechanical system (MEMS)-tunable vertical-cavity surface-emitting laser (VCSEL) featuring an electrothermal tuning range of 64 nm (7.92 THz) that exceeds the tuning range of commercially available distributed-feedback laser (DFB) diodes (˜4.8 nm) by a factor of about 13. We first review the underlying theory and perform a systematic characterization of the MEMS-VCSEL, with particular focus on the parameters relevant for THz photomixing. These parameters include mode-hop-free CW tuning with a side-mode-suppression-ratio >50 dB, a linewidth as narrow as 46.1 MHz, and wavelength and polarization stability. We conclude with a demonstration of a CW THz photomixing setup by subjecting the MEMS-VCSEL to optical beating with a DFB diode driving commercial photomixers. The achievable THz bandwidth is limited only by the employed photomixers. Once improved photomixers become available, electrothermally actuated MEMS-VCSELs should allow for a tuning range covering almost the whole THz domain with a single system.

  13. Mode Tracker for Mode-Hop-Free Operation of a Laser

    NASA Technical Reports Server (NTRS)

    Wysocki, Gerard; Tittel, Frank K.; Curl, Robert F.

    2010-01-01

    A mode-tracking system that includes a mode-controlling subsystem has been incorporated into an external-cavity (EC) quantum cascade laser that operates in a mid-infrared wavelength range. The mode-tracking system makes it possible to perform mode-hop-free wavelength scans, as needed for high-resolution spectroscopy and detection of trace gases. The laser includes a gain chip, a beam-collimating lens, and a diffraction grating. The grating is mounted on a platform, the position of which can be varied to effect independent control of the EC length and the grating angle. The position actuators include a piezoelectric stage for translation control and a motorized stage for coarse rotation control equipped with a piezoelectric actuator for fine rotation control. Together, these actuators enable control of the EC length over a range of about 90 m with a resolution of 0.9 nm, and control of the grating angle over a coarse-tuning range of +/-6.3deg and a fine-tuning range of +/-520 microrad with a resolution of 10 nrad. A mirror mounted on the platform with the grating assures always the same direction of the output laser beam.

  14. Study of percolation behavior depending on molecular structure design

    NASA Astrophysics Data System (ADS)

    Yu, Ji Woong; Lee, Won Bo

    Each differently designed anisotropic nano-crystals(ANCs) are studied using Langevin dynamic simulation and their percolation behaviors are presented. Popular molecular dynamics software LAMMPS was used to design the system and perform the simulation. We calculated the minimum number density at which percolation occurs(i.e. percolation threshold), radial distribution function, and the average number of ANCs for a cluster. Electrical conductivity is improved when the number of transfers of electrons between ANCs, so called ''inter-hopping process'', which has the considerable contribution to resistance decreases and the number of inter-hopping process is directly related with the concentration of ANCs. Therefore, with the investigation of relationship between molecular architecture and percolation behavior, optimal design of ANC can be achieved.

  15. Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

    NASA Astrophysics Data System (ADS)

    Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

    2017-08-01

    Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

  16. Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network

    NASA Astrophysics Data System (ADS)

    Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue

    2006-09-01

    In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.

  17. Is scaffold hopping a reliable indicator for the ability of computational methods to identify structurally diverse active compounds?

    NASA Astrophysics Data System (ADS)

    Dimova, Dilyana; Bajorath, Jürgen

    2017-07-01

    Computational scaffold hopping aims to identify core structure replacements in active compounds. To evaluate scaffold hopping potential from a principal point of view, regardless of the computational methods that are applied, a global analysis of conventional scaffolds in analog series from compound activity classes was carried out. The majority of analog series was found to contain multiple scaffolds, thus enabling the detection of intra-series scaffold hops among closely related compounds. More than 1000 activity classes were found to contain increasing proportions of multi-scaffold analog series. Thus, using such activity classes for scaffold hopping analysis is likely to overestimate the scaffold hopping (core structure replacement) potential of computational methods, due to an abundance of artificial scaffold hops that are possible within analog series.

  18. NMR and transport measurements of copper chalcogenide and clathrate compounds

    NASA Astrophysics Data System (ADS)

    Sirusi Arvij, Ali

    Due to limited sources of fossil fuels worldwide and a large percentage wasted as heat energy, searching for efficient thermoelectric materials to convert heat to electricity has gained a great deal of attention. Most of the attempts are focused on materials with substantially lower lattice thermal conductivity and narrow band gaps. Among them, inorganic clathrates and copper-based chalcogenides possess intrinsic low thermal conductivity which makes them promising thermoelectrics. In this work, nuclear magnetic resonance (NMR), transport, and magnetic measurements were performed on clathrates and copper-based chalcogenides to investigate their vibrational and electronic charge carrier properties, as well as the unknown structures of Cu2Se and Cu 2Te at low temperatures, and the effect of rattling of guest atoms in the clathrates. The NMR results in Ba8Ga16Ge30 indicate a pseudogap in the Ga electronic density of states, superposed upon a surprisingly large Ba contribution to the conduction band. Meanwhile, the phonon contributions to the Ga relaxation rates are large and increase more rapidly with temperature than typical semiconductors due to enhanced anharmonicity of the propagative phonon modes over a wide range. Moreover, the observed NMR shifts in the Ba8Cu5Si xGe41-x clathrates change in a nonlinear way with increasing Si substitution: from x = 0 to about 20 the shifts are essentially constant, while approaching x = 41 they increase rapidly, demonstrating a significant change in hybridizations vs Si substitution. NMR studies of Cu2Se show an initial appearance of ionic hopping in a narrow temperature range above 100 K, coinciding with the recently observed low-temperature phase transition. At room temperature and above, this goes over to rapid Cu-ion hopping and a single motionally narrowed line both above and below the alpha-beta structural transition. Furthermore, the NMR results on Cu2Te and Cu 1.98Ag0.2Te demonstrate unusually large negative chemical shifts, as well as large Cu and Te s-state contributions in the valence band. The large diamagnetic chemical shifts coincide with behavior previously identified for materials with topologically nontrivial band inversion, and in addition, the large metallic shifts point to analogous features in the valence band density of states, suggesting that Cu2Te may have similar inverted features.

  19. First-principles investigation of polarization and ion conduction mechanisms in hydroxyapatite

    NASA Astrophysics Data System (ADS)

    Kasamatsu, Shusuke; Sugino, Osamu

    We report first-principles simulation of polarization mechanisms in hydroxyapatite to explain the underlying mechanism behind the reported ion conductivities and polarization under electrical poling at elevated temperatures. It is found that ion conduction occurs mainly in the column of OH$^-$ ions along the $c$-axis through a combination of the flipping of OH$^-$ ions, exchange of proton vacancies between OH$^-$ ions, and the hopping of the OH$^-$ vacancy. The calculated activation energies are consistent with those found in conductivity measurements and thermally stimulated depolarization current measurements.

  20. Electrical conduction in PVDF/ZnO-Ag nanocomposites

    NASA Astrophysics Data System (ADS)

    Singh, Utpal; Jha, Anal K.; Chandra, K. P.; Kolte, Jayant; Kulkarni, A. R.; Prasad, K.

    2018-05-01

    A hybrid combination of Ag and ZnO nanoparticles were utilized to fabricate PVDF/ZnO(90/10)-Ag nanocomposites (with Ag as filler: 0.5, 1 and 1.5%) utilizing melt-mixing technique. X-ray diffraction study confirmed the formations of nanocomposites. Electric modulus analysis indicated the dielectric relaxation in this system to be of non- Debye type. Correlated barrier hopping model successfully explained the charge conduction in PVDF/ZnO-Ag nanocomposites and ac conductivity data followed Jonscher's power law.

  1. Role of Water in Proton-Hydroxide Conductance Across Membranes

    DTIC Science & Technology

    1988-06-28

    a~a,:v %~ ’ diffusion , rather than hopping along water wires, and there should be little or no deuterium effect. References Bangham , A.D...CONTRACT TITLE: Role of water in proton-hydroxide conductance across model and biological membranes. START DATE: October 1, 1987 RESEARCH OBJECTIVE: To...hypothesis of Bangham and Mason (1980) who suggested that general anesthetics might introduce defects into bilayers of synaptic vesicle membranes which lead

  2. Microscopic origin of read current noise in TaOx-based resistive switching memory by ultra-low temperature measurement

    NASA Astrophysics Data System (ADS)

    Pan, Yue; Cai, Yimao; Liu, Yefan; Fang, Yichen; Yu, Muxi; Tan, Shenghu; Huang, Ru

    2016-04-01

    TaOx-based resistive random access memory (RRAM) attracts considerable attention for the development of next generation nonvolatile memories. However, read current noise in RRAM is one of the critical concerns for storage application, and its microscopic origin is still under debate. In this work, the read current noise in TaOx-based RRAM was studied thoroughly. Based on a noise power spectral density analysis at room temperature and at ultra-low temperature of 25 K, discrete random telegraph noise (RTN) and continuous average current fluctuation (ACF) are identified and decoupled from the total read current noise in TaOx RRAM devices. A statistical comparison of noise amplitude further reveals that ACF depends strongly on the temperature, whereas RTN is independent of the temperature. Measurement results combined with conduction mechanism analysis show that RTN in TaOx RRAM devices arises from electron trapping/detrapping process in the hopping conduction, and ACF is originated from the thermal activation of conduction centers that form the percolation network. At last, a unified model in the framework of hopping conduction is proposed to explain the underlying mechanism of both RTN and ACF noise, which can provide meaningful guidelines for designing noise-immune RRAM devices.

  3. Alternating current transport and dielectric relaxation of nanocrystalline graphene oxide

    NASA Astrophysics Data System (ADS)

    Zedan, I. T.; El-Menyawy, E. M.

    2018-07-01

    Graphene oxide (GO) has been synthesized from natural graphite using modified Hummer's method and is subjected to sonication for 1 h. X-ray diffraction (XRD) showed that the prepared GO has nanocrystalline structure with particle size of about 5 nm and high-resolution transmission electron microscope showed that it had a layered structure. The nanocrystalline GO powder was pressed as a disk and the alternating current (AC) electrical conductivity, σAC, and dielectric properties have been investigated in the frequency range 50Hz-5 MHz and temperature range 298-523K using parallel plate spectroscopic technique. Analysis of σ AC as a function of frequency shows that the relation follows Jonscher's universal law with frequency exponent decreases with increasing temperature in which the correlated barrier hopping model is applicable to describe the behavior. The dielectric constant and dielectric loss are studied as functions of frequency and temperature. The dielectric modulus formalism is used for describing the relaxation process in which the relaxation time and its activation energy were evaluated.

  4. Dielectric and modulus analysis of the photoabsorber Cu2SnS3

    NASA Astrophysics Data System (ADS)

    Lahlali, S.; Essaleh, L.; Belaqziz, M.; Chehouani, H.; Alimoussa, A.; Djessas, K.; Viallet, B.; Gauffier, J. L.; Cayez, S.

    2017-12-01

    Dielectric properties of the ternary semiconductor compound Cu2SnS3 is studied for the first time in the high temperature range from 300 °C to 440 °C with the frequency range 1 kHz to 1 MHz. The dielectric constant ε ‧ and dielectric loss tan (δ) were observed to increase with temperature and decrease rapidly with frequency to remains constant at high frequencies. The variation of the dielectric loss Ln (ε ") with L n (ω) was found to follow the empirical law, ε " = B ω m (T). The dielectric data were analyzed using complex electrical modulus M* at various temperatures. The activation energy responsible for the relaxation is estimated from the analysis of the modulus spectra. The value of the hopping barrier potential is estimated from the dielectric loss and compared with the value previously obtained from ac-conductivity. These results are critical for understanding the behavior of based polycrystalline family of Cu2SnS3 for absorber materials in solar-cells.

  5. Direct evidence for double-exchange coupling in Ru- substituted La0.7Pb0.3Mn 1 - x Ru x O3, 0.0 <= x <= 0.4

    NASA Astrophysics Data System (ADS)

    Sundar Manoharan, S.; Sahu, R. K.; Rao, M. L.; Elefant, D.; Schneider, C. M.

    2002-08-01

    The La0.7Pb0.3Mn 1 - x Ru x O3 (0.0 <= x <= 0.4) system shows an innate relationship between Mn and Ru ions by a unique double-exchange mediated transport behavior. This is exonerated by the coexistence of Tp and Tc (range 330 K 245 K for 0.0 <= x <= 0.4). For Ru > 30%, the hole carrier mass influences the transport property. X-ray absorption spectra suggest that the Tc-Tp match is due to the transport mediated by the Mn3+/Mn4+ leftrightarrow Ru4+/Ru5+ redox pair and also due to the broad low-spin Ru:4d conduction band. For x > 0.2, T < 0.5Tc obeys a modified variable-range hopping model, where kT0 propto (M/Ms)2, suggesting a random magnetic potential which localizes the charge carriers.

  6. Large effects of A-site average cation size on the properties of the double perovskites Ba2-xSrxMnReO6:  A d5-d1 system

    NASA Astrophysics Data System (ADS)

    Popov, Guerman; Greenblatt, Martha; Croft, Mark

    2003-01-01

    Ba2-xSrxMnReO6 (x=0, 0.5, 1, 2) phases with a double-perovskite structure were prepared by solid-state techniques in evacuated sealed silica tubes. Mn2+ and Re6+ are virtually completely ordered on the B sites. The compounds are ferrimagnetic below 120 K. The maximum saturation moment was obtained for a compound with x=0.5 whose tolerance factor is closest to 1. The whole series of compounds, 0.0⩽x⩽2.0, exhibits semiconducting behavior with variable-range hopping type of conduction. Sr2MnReO6 has an unusually high coercive field (2.6 T at 5 K) and two transitions in the M-H loop. Ba2MnReO6 shows large positive magnetoresistance (14% at 80 K, 5 T) below 140 K, while the other compositions studied exhibit negative magnetoresistance in the temperature range measured.

  7. Measuring long-range carrier diffusion across multiple grains in polycrystalline semiconductors by photoluminescence imaging

    PubMed Central

    Alberi, K.; Fluegel, B.; Moutinho, H.; Dhere, R. G.; Li, J. V.; Mascarenhas, A.

    2013-01-01

    Thin-film polycrystalline semiconductors are currently at the forefront of inexpensive large-area solar cell and integrated circuit technologies because of their reduced processing and substrate selection constraints. Understanding the extent to which structural and electronic defects influence carrier transport in these materials is critical to controlling the optoelectronic properties, yet many measurement techniques are only capable of indirectly probing their effects. Here we apply a novel photoluminescence imaging technique to directly observe the low temperature diffusion of photocarriers through and across defect states in polycrystalline CdTe thin films. Our measurements show that an inhomogeneous distribution of localized defect states mediates long-range hole transport across multiple grain boundaries to locations exceeding 10 μm from the point of photogeneration. These results provide new insight into the key role deep trap states have in low temperature carrier transport in polycrystalline CdTe by revealing their propensity to act as networks for hopping conduction. PMID:24158163

  8. Hop crop wild relatives

    USDA-ARS?s Scientific Manuscript database

    The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...

  9. Quantifying exciton hopping in disordered media with quenching sites: Application to arrays of quantum dots

    NASA Astrophysics Data System (ADS)

    Miyazaki, Jun

    2013-10-01

    We present an analytical method for quantifying exciton hopping in an energetically disordered system with quenching sites. The method is subsequently used to provide a quantitative understanding of exciton hopping in a quantum dot (QD) array. Several statistical quantities that characterize the dynamics (survival probability, average number of distinct sites visited, average hopping distance, and average hopping rate in the initial stage) are obtained experimentally by measuring time-resolved fluorescence intensities at various temperatures. The time evolution of these quantities suggests in a quantitative way that at low temperature an exciton tends to be trapped at a local low-energy site, while at room temperature, exciton hopping occurs repeatedly, leading to a large hopping distance. This method will serve to facilitate highly efficient optoelectronic devices using QDs such as photovoltaic cells and light-emitting diodes, since exciton hopping is considered to strongly influence their operational parameters. The presence of a dark QD (quenching site) that exhibits fast decay is also quantified.

  10. Electrical properties and scaling behaviour of rare earth based Ho{sub 2}CoZrO{sub 6} double perovskite ceramics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mahato, Dev K., E-mail: drdevkumar@yahoo.com; Dutta, Alo; Sinha, T.P.

    2012-12-15

    Graphical abstract: The X-ray diffraction analysis suggests that the compound crystallizes in monoclinic phase at room temperature with β = 108.51 ± 0.021° (a = 8.1858 ± 0.0023 Å, b = 5.2599 ± 0.0027 Å, c = 7.9874 ± 0.0031 Å) and cell volume = 324.17 Å{sup 3}. The SEM image indicates the uniformity of the grains in the samples. The grain size of the microstructure of HCZ is found to be ∼0.48 μm on average. Display Omitted Highlights: ► The conduction mechanism in HCZ may be due to hopping of small polaron. ► The material shows semiconducting behaviour. ►more » Conductivity obeys Jonscher's power law with high frequency dispersion. ► Both long-range and localized relaxation are present. -- Abstract: The Ho{sub 2}CoZrO{sub 6} (HCZ) double perovskite has been prepared in polycrystalline form by solid state reaction technique. The analysis of the X-ray powder diffraction pattern indicates that the crystal structure is monoclinic at room temperature with cell parameters a = 8.1858 ± 0.0023 Å, b = 5.2599 ± 0.0027 Å, c = 7.9874 ± 0.0031 Å and β = 108.51 ± 0.021°. The compound shows significant frequency dispersion in its dielectric properties. The Cole–Cole model is used to determine the polydispersive nature of dielectric relaxation. The scaling behaviour of dielectric loss and imaginary electric modulus suggest that the relaxation describe same mechanism at various temperatures. Impedance data presented in the Nyquist plot (Z″ versus Z′) are used to identify an equivalent circuit and to know the bulk and interface contributions. The complex impedance analysis of HCZ exhibits the appearance of both the grain and the grain-boundary contribution. The frequency dependent conductivity spectra follow the universal power law. The magnitude of the activation energy indicates that the carrier transport is due to the hopping conduction.« less

  11. Electrical conductivity, thermopower and 57Fe Mössbauer spectroscopy of aegirine (NaFeSi2O6)

    NASA Astrophysics Data System (ADS)

    Schmidbauer, E.; Kunzmann, Th.

    DC and AC electrical conductivities were measured on samples of two different crystals of the mineral aegirine (NaFeSi2O6) parallel (∥) and perpendicular (⊥) to the [001] direction of the clinopyroxene structure between 200 and 600 K. Impedance spectroscopy was applied (20 Hz-1 MHz) and the bulk DC conductivity σDC was determined by extrapolating AC data to zero frequency. In both directions, the log σDC - 1/T curves bend slightly. In the high- and low-temperature limits, differential activation energies were derived for measurements ∥ [001] of EA 0.45 and 0.35 eV, respectively, and the numbers ⊥ [001] are very similar. The value of σDC ∥ [001] with σDC(300 K) 2.0 × 10-6 Ω-1cm-1 is by a factor of 2-10 above that measured ⊥ [001], depending on temperature, which means anisotropic charge transport. Below 350 K, the AC conductivity σ'(ω) (ω/2π=frequency) is enhanced relative to σDC for both directions with an increasing difference for rising frequencies on lowering the temperature. An approximate power law for σ'(ω) is noted at higher frequencies and low temperatures with σ'(ω) ωs, which is frequently observed on amorphous and disordered semiconductors. Scaling of σ'(ω) data is possible with reference to σDC, which results in a quasi-universal curve for different temperatures. An attempt was made to discuss DC and AC results in the light of theoretical models of hopping charge transport and of a possible Fe2+ --> Fe3+ electron hopping mechanism. The thermopower Θ (Seebeck effect) in the temperature range 360 K < T < 770 K is negative in both directions. There is a linear Θ - 1/T relationship above 400 K with activation energy EΘ 0.030 eV ∥ [001] and 0.070 eV ⊥ [001]. 57Fe Mössbauer spectroscopy was applied to detect Fe2+ in addition to the dominating concentration of Fe3+.

  12. Time synchronization of a frequency-hopped MFSK communication system

    NASA Technical Reports Server (NTRS)

    Simon, M. K.; Polydoros, A.; Huth, G. K.

    1981-01-01

    In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.

  13. Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.

    Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less

  14. Varietal discrimination of hop pellets by near and mid infrared spectroscopy.

    PubMed

    Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A

    2018-04-01

    Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Hospital and urban effluent waters as a source of accumulation of toxic metals in the sediment receiving system of the Cauvery River, Tiruchirappalli, Tamil Nadu, India.

    PubMed

    Devarajan, Naresh; Laffite, Amandine; Ngelikoto, Patience; Elongo, Vicky; Prabakar, Kandasamy; Mubedi, Josué I; Piana, Pius T M; Wildi, Walter; Poté, John

    2015-09-01

    Hospital and urban effluents contain a variety of toxic and/or persistent substances in a wide range of concentrations, and most of these compounds belong to the group of emerging contaminants. The release of these substances into the aquatic ecosystem can lead to the pollution of water resources and may place aquatic organisms and human health at risk. Sediments receiving untreated and urban effluent waters from the city of Tiruchirappalli in the state of Tamil Nadu, India, are analyzed for potential environmental and human health risks. The sediment samples were collected from five hospital outlet pipes (HOP) and from the Cauvery River Basin (CRB) both of which receive untreated municipal effluent waters (Tiruchirappalli, Tamil Nadu, India). The samples were characterized for grain size, organic matter, toxic metals, and ecotoxicity. The results highlight the high concentration of toxic metals in HOP, reaching values (mg kg(-1)) of 1851 (Cr), 210 (Cu), 986 (Zn), 82 (Pb), and 17 (Hg). In contrast, the metal concentrations in sediments from CRB were lower than the values found in the HOP (except for Cu, Pb), with maximum values (mg kg(-1)) of 75 (Cr), 906 (Cu), 649 (Zn), 111 (Pb), and 0.99 (Hg). The metal concentrations in all sampling sites largely exceed the Sediment Quality Guidelines (SQGs) and the Probable Effect Concentration (PEC) for the Protection of Aquatic Life recommendation. The ecotoxicity test with ostracods exposed to the sediment samples presents a mortality rate ranging from 22 to 100 % (in sediments from HOP) and 18-87 % (in sediments from CRB). The results of this study show the variation of toxic metal levels as well as toxicity in sediment composition related to both the type of hospital and the sampling period. The method of elimination of hospital and urban effluents leads to the pollution of water resources and may place aquatic organisms and human health at risk.

  16. Relationships between postural orientation and self reported function, hop performance and muscle power in subjects with anterior cruciate ligament injury.

    PubMed

    Trulsson, Anna; Roos, Ewa M; Ageberg, Eva; Garwicz, Martin

    2010-07-01

    Injury to the anterior cruciate ligament (ACL) is associated not only with knee instability and impaired neuromuscular control, but also with altered postural orientation manifested as observable "substitution patterns". However, tests currently used to evaluate knee function in subjects with ACL injury are not designed to assess postural orientation. Therefore, we are in the process of developing an observational test set that measures postural orientation in terms of the ability to stabilize body segments in relation to each other and to the environment. The aim of the present study was to characterise correlations between this novel test set, called the Test for Substitution Patterns (TSP) and commonly used tests of knee function. In a blinded set-up, 53 subjects (mean age 30 years, range 20-39, with 2-5 years since ACL injury) were assessed using the TSP, the Knee Injury and Osteoarthritis Outcome Score subscale sport/recreation (KOOS sport/rec), 3 hop tests and 3 muscle power tests. Correlations between the scores of the TSP and the other tests were determined. Moderate correlations were found between TSP scores and KOOS sport/rec (rs = -0.43; p = 0.001) and between TSP scores and hop test results (rs = -0.40 to -0.46; p < or = 0.003), indicating that altered postural orientation was associated with worse self-reported KOOS sport/rec function and worse hop performance. No significant correlations were found between TSP scores and muscle power results. Subjects had higher TSP scores on their injured side than on their uninjured side (median 4 and 1 points; interquartile range 2-6 and 0-1.5, respectively; p < 0.0001). We conclude that the Test for Substitution Patterns is of relevance to the patient and measures a specific aspect of neuromuscular control not quantified by the other tests investigated. We suggest that the TSP may be a valuable complement in the assessment of neuromuscular control in the rehabilitation of subjects with ACL injury.

  17. Consistency of Field-Based Measures of Neuromuscular Control Using Force-Plate Diagnostics in Elite Male Youth Soccer Players.

    PubMed

    Read, Paul J; Oliver, Jon L; Croix, Mark Ba De Ste; Myer, Gregory D; Lloyd, Rhodri S

    2016-12-01

    Read, P, Oliver, JL, Croix, MD, Myer, GD, and Lloyd, RS. Consistency of field-based measures of neuromuscular control using force-plate diagnostics in elite male youth soccer players. J Strength Cond Res 30(12): 3304-3311, 2016-Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players, and reliability data are sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force-plate diagnostics in this cohort. Twenty-six pre-peak height velocity (PHV) and 25 post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single-leg 75% horizontal hop and stick (75%HOP), and single-leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilization, time to pVGRF, and pVGRF asymmetry were recorded. A test-retest design was used, and reliability statistics included change in mean, intraclass correlation coefficient, and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the 3 protocols (CV range = 13.8-49.7%). Intraclass correlation coefficient values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be used to support a screening battery for elite male youth soccer players and for test-retest comparison.

  18. The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.

    ERIC Educational Resources Information Center

    Rice, Jeff

    2003-01-01

    Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…

  19. Effects of dopant induced defects on structural, multiferroic and optical properties of Bi1-x Pb x FeO3 (0 ≤ x ≤ 0.3) ceramics

    NASA Astrophysics Data System (ADS)

    Hassnain Jaffari, G.; Aftab, M.; Samad, Abdus; Mumtaz, Fiza; Awan, M. S.; Shah, S. Ismat

    2018-01-01

    Bi1-x Pb x FeO3 (0 ≤ x ≤ 0.3) has been characterized in detail with an aim to identify role of defect such as dopant, various vacancies, grain boundaries etc, and their effect on structural, optical and multiferroic properties. Structural analysis revealed that Pb substitution transforms the rhombohedral phase of BiFeO3 to the pseudocubic phase for x ≥ 0.15, consistently all vibrational Raman modes associated with the rhombohedral phase are found disappeared. Optical response revealed weakening of the d-d transitions with Pb addition indicating change in the Fe atoms environment consistent with the transition from non-centrosymmetric to the centrosymmetric structure. Transport and dielectric responses are explained in terms of hopping due to the presence of defects like oxygen vacancies and grain boundary conduction. In the high temperature regime, grain boundary conduction led to decrease in resistivity with the presence of a hump that is associated with hopping conduction. Extrinsic contributions in the transport properties correlate well with dielectric response. Magnetic and ferroelectric responses are also presented where role of oxygen vacancies defects has been clearly identified.

  20. Nanoscale Electron Transport Measurements of Immobilized Cytochrome P450 Proteins

    PubMed Central

    Bostick, Christopher D.; Flora, Darcy R.; Gannett, Peter M.; Tracy, Timothy S.; Lederman, David

    2015-01-01

    Gold nanopillars, functionalized with an organic self-assembled monolayer, can be used to measure the electrical conductance properties of immobilized proteins without aggregation. Measurements of the conductance of nanopillars with cytochrome P450 2C9 (CYP2C9) proteins using conducting probe atomic force microscopy demonstrate that a correlation exists between the energy barrier height between hopping sites and CYP2C9 metabolic activity. Measurements performed as a function of tip force indicate that, when subjected to a large force, the protein is more stable in the presence of a substrate. This agrees with the hypothesis that substrate entry into the active site helps to stabilize the enzyme. The relative distance between hopping sites also increases with increasing force, possibly because protein functional groups responsible for electron transport depend on the structure of the protein. The inhibitor sulfaphenazole, in addition to the previously studied aniline, increased the barrier height for electron transfer and thereby makes CYP2C9 reduction more difficult and inhibits metabolism. This suggests that P450 Type II binders may decrease the ease of electron transport processes in the enzyme, in addition to occupying the active site. PMID:25804257

  1. Research on synchronization technology of frequency hopping communication system

    NASA Astrophysics Data System (ADS)

    Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

    2018-05-01

    Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

  2. Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

    ERIC Educational Resources Information Center

    Brown, Bryan

    2010-01-01

    This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

  3. A new method of hybrid frequency hopping signals selection and blind parameter estimation

    NASA Astrophysics Data System (ADS)

    Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

    2018-04-01

    Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

  4. Chemical transformations of characteristic hop secondary metabolites in relation to beer properties and the brewing process: a review.

    PubMed

    Steenackers, Bart; De Cooman, Luc; De Vos, Dirk

    2015-04-01

    The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Mixed conductivity, structural and microstructural characterization of titania-doped yttria tetragonal zirconia polycrystalline/titania-doped yttria stabilized zirconia composite anode matrices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colomer, M.T., E-mail: tcolomer@icv.csic.e; Maczka, M.

    2011-02-15

    Taking advantage of the fact that TiO{sub 2} additions to 8YSZ cause not only the formation of a titania-doped YSZ solid solution but also a titania-doped YTZP solid solution, composite materials based on both solutions were prepared by solid state reaction. In particular, additions of 15 mol% of TiO{sub 2} give rise to composite materials constituted by 0.51 mol fraction titania-doped yttria tetragonal zirconia polycrystalline and 0.49 mol fraction titania-doped yttria stabilized zirconia (0.51TiYTZP/0.49TiYSZ). Furthermore, Y{sub 2}(Ti{sub 1-y}Zr{sub y}){sub 2}O{sub 7} pyrochlore is present as an impurity phase with y close to 1, according to FT-Raman results. Lower and highermore » additions of titania than that of 15 mol%, i.e., x=0, 5, 10, 20, 25 and 30 mol% were considered to study the evolution of 8YSZ phase as a function of the TiO{sub 2} content. Furthermore, zirconium titanate phase (ZrTiO{sub 4}) is detected when the titania content is equal or higher than 20 mol% and this phase admits Y{sub 2}O{sub 3} in solid solution according to FE-SEM-EDX. The 0.51TiYTZP/0.49TiYSZ duplex material was selected in this study to establish the mechanism of its electronic conduction under low oxygen partial pressures. In the pO{sub 2} range from 0.21 to 10{sup -7.5} atm. the conductivity is predominantly ionic and constant over the range and its value is 0.01 S/cm. The ionic plus electronic conductivity is 0.02 S/cm at 1000 {sup o}C and 10{sup -12.3} atm. Furthermore, the onset of electronic conductivity under reducing conditions exhibits a -1/4 pO{sub 2} dependence. Therefore, it is concluded that the n-type electronic conduction in the duplex material can be due to a small polaron-hopping between Ti{sup 3+} and Ti{sup 4+}. -- Graphical abstract: FE-SEM micrograph of a polished and thermal etched surface of a Ti-doped YTZP/Ti-doped YSZ composite material. Display Omitted Research highlights: {yields} Ti-doped YTZP/Ti-doped YSZ composite materials are mixed conductors under low partial pressures. {yields} From 5 mol% of TiO{sub 2}, Y{sub 2}(Ti{sub 1-y},Zr{sub y}){sub 2}O{sub 7} pyrochlore is present as a minor phase, being y close to 1 according to FT-Raman studies. {yields} The onset of the electronic conductivity under reducing conditions exhibit a -1/4 pO{sub 2} dependence. The n-type electronic conduction is due to a small polaron-hopping between Ti{sup 3+} and Ti{sup 4+}.« less

  6. Polaron hopping in olivine phosphates studied by nuclear resonant scattering

    NASA Astrophysics Data System (ADS)

    Tracy, Sally June

    Valence fluctuations of Fe2+ and Fe3+ were studied in a solid solution of LixFePO4 by nuclear resonant forward scattering of synchrotron x rays while the sample was heated in a diamond-anvil pressure cell. The spectra acquired at different temperatures and pressures were analyzed for the frequencies of valence changes using the Blume-Tjon model of a system with a fluctuating Hamiltonian. These frequencies were analyzed to obtain activation energies and an activation volume for polaron hopping. There was a large suppression of hopping frequency with pressure, giving an anomalously large activation volume. This large, positive value is typical of ion diffusion, which indicates correlated motions of polarons, and Li+ ions that alter the dynamics of both. In a parallel study of NaxFePO4, the interplay between sodium ordering and electron mobility was investigated using a combination of synchrotron x-ray diffraction and nuclear resonant scattering. Conventional Mossbauer spectra were collected while the sample was heated in a resistive furnace. An analysis of the temperature evolution of the spectral shapes was used to identify the onset of fast electron hopping and determine the polaron hopping rate. Synchrotron x-ray diffraction measurements were carried out in the same temperature range. Reitveld analysis of the diffraction patterns was used to determine the temperature of sodium redistribution on the lattice. The diffraction analysis also provides new information about the phase stability of the system. The temperature evolution of the iron site occupancies from the Mossbauer measurements, combined with the synchrotron diffraction results give strong evidence for a relationship between the onset of fast electron dynamics and the redistribution of sodium in the lattice. Measurements of activation barriers for polaron hopping gave fundamental insights about the correlation between electronic carriers and mobile ions. This work established that polaron-ion interactions can alter the local dynamics of electron and ion transport. These types of coupled processes may be common in many materials used for battery electrodes, and new details concerning the influence of polaron-ion interactions on the charge dynamics are relevant to optimizing their electrochemical performance.

  7. High-Speed On-Board Data Processing Platform for LIDAR Projects at NASA Langley Research Center

    NASA Astrophysics Data System (ADS)

    Beyon, J.; Ng, T. K.; Davis, M. J.; Adams, J. K.; Lin, B.

    2015-12-01

    The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 - April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

  8. Etching-free patterning method for electrical characterization of atomically thin MoSe2 films grown by chemical vapor deposition

    NASA Astrophysics Data System (ADS)

    Utama, M. Iqbal Bakti; Lu, Xin; Zhan, Da; Ha, Son Tung; Yuan, Yanwen; Shen, Zexiang; Xiong, Qihua

    2014-10-01

    Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures.Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures. Electronic supplementary information (ESI) available: Further experiments on patterning and additional electrical characterizations data. See DOI: 10.1039/c4nr03817g

  9. Performance Evaluation of an Oxygen Sensor as a Function of the Samaria Doped Ceria Film Thickness

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanghavi, Rahul P.; Nandasiri, Manjula I.; Kuchibhatla, Satyanarayana V N T

    The current demand in the automobile industry is in the control of air-fuel mixture in the combustion engine of automobiles. Oxygen partial pressure can be used as an input parameter for regulating or controlling systems in order to optimize the combustion process. Our goal is to identify and optimize the material system that would potentially function as the active sensing material for such a device that monitors oxygen partial pressure in these systems. We have used thin film samaria doped ceria (SDC) as the sensing material for the sensor operation, exploiting the fact that at high temperatures, oxygen vacancies generatedmore » due to samarium doping act as conducting medium for oxygen ions which hop through the vacancies from one side to the other contributing to an electrical signal. We have recently established that 6 atom % Sm doping in ceria films has optimum conductivity. Based on this observation, we have studied the variation in the overall conductivity of 6 atom % samaria doped ceria thin films as a function of thickness in the range of 50 nm to 300 nm at a fixed bias voltage of 2 volts. A direct proportionality in the increase in the overall conductivity is observed with the increase in sensing film thickness. For a range of oxygen pressure values from 1 mTorr to 100 Torr, a tolerable hysteresis error, good dynamic response and a response time of less than 10 seconds was observed« less

  10. Hip-Hopping across China: Intercultural Formulations of Local Identities

    ERIC Educational Resources Information Center

    Barrett, Catrice

    2012-01-01

    The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

  11. Revolutionizing Environmental Education through Indigenous Hip Hop Culture

    ERIC Educational Resources Information Center

    Gorlewski, Julie; Porfilio, Brad J.

    2012-01-01

    Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

  12. Infinite-range Heisenberg model and high-temperature superconductivity

    NASA Astrophysics Data System (ADS)

    Tahir-Kheli, Jamil; Goddard, William A., III

    1993-11-01

    A strongly coupled variational wave function, the doublet spin-projected Néel state (DSPN), is proposed for oxygen holes in three-band models of high-temperature superconductors. This wave function has the three-spin system of the oxygen hole plus the two neighboring copper atoms coupled in a spin-1/2 doublet. The copper spins in the neighborhood of a hole are in an eigenstate of the infinite-range Heisenberg antiferromagnet (SPN state). The doublet three-spin magnetic polaron or hopping polaron (HP) is stabilized by the hopping terms tσ and tτ, rather than by the copper-oxygen antiferromagnetic coupling Jpd. Although, the HP has a large projection onto the Emery (Dg) polaron, a non-negligible amount of doublet-u (Du) character is required for optimal hopping stabilization. This is due to Jdd, the copper-copper antiferromagnetic coupling. For the copper spins near an oxygen hole, the copper-copper antiferromagnetic coupling can be considered to be almost infinite ranged, since the copper-spin-correlation length in the superconducting phase (0.06-0.25 holes per in-plane copper) is approximately equal to the mean separation of the holes (between 2 and 4 lattice spacings). The general DSPN wave function is constructed for the motion of a single quasiparticle in an antiferromagnetic background. The SPN state allows simple calculations of various couplings of the oxygen hole with the copper spins. The energy minimum is found at symmetry (π/2,π/2) and the bandwidth scales with Jdd. These results are in agreement with exact computations on a lattice. The coupling of the quasiparticles leads to an attraction of holes and its magnitude is estimated.

  13. Biphasic Allometry of Cardiac Growth in the Developing Kangaroo Macropus fuliginosus.

    PubMed

    Snelling, Edward P; Taggart, David A; Maloney, Shane K; Farrell, Anthony P; Seymour, Roger S

    2015-01-01

    Interspecific studies of adult mammals show that heart mass (M(h), g) increases in direct proportion to body mass (M(b), kg), such that M(h) ∝ M(b)(1.00). However, intraspecific studies on heart mass in mammals at different stages of development reveal considerable variation between species, M(h) ∝ M(b)(0.70-1.00). Part of this variation may arise as a result of the narrow body size range of growing placental mammals, from birth to adulthood. Marsupial mammals are born relatively small and offer an opportunity to examine the ontogeny of heart mass over a much broader body size range. Data from 29 western grey kangaroos Macropus fuliginosus spanning 800-fold in body mass (0.084-67.5 kg) reveal the exponent for heart mass decreases significantly when the joey leaves the pouch (ca. 5-6 kg body mass). In the pouch, the heart mass of joeys scales with hyperallometry, M(h(in-pouch)) = 6.39 M(b)(1.10 ± 0.05), whereas in free-roaming juveniles and adults, heart mass scales with hypoallometry, M(h(postpouch)) = 14.2 Mb(0.77 ± 0.08). Measurements of heart height, width, and depth support this finding. The relatively steep heart growth allometry during in-pouch development is consistent with the increase in relative cardiac demands as joeys develop endothermy and the capacity for hopping locomotion. Once out of the pouch, the exponent decreases sharply, possibly because the energy required for hopping is independent of speed, and the efficiency of energy storage during hopping increases as the kangaroo grows. The right:left ventricular mass ratios (0.30-0.35) do not change over the body mass range and are similar to those of other mammals, reflecting the principle of Laplace for the heart.

  14. Is It Easier to Hop or Walk? Development Issues in Interface Design.

    ERIC Educational Resources Information Center

    Strommen, Erik F.

    1993-01-01

    Describes a study conducted by the Children's Television Workshop that tested two forms of Sesame Street character movement (i.e., discrete movement versus continuous motion) with three-year-old preschool children using a Nintendo controller. Cognitive factors governing children's game performance and implications for designing interactive…

  15. Effect of annealing temperatures on the electrical conductivity and dielectric properties of Ni1.5Fe1.5O4 spinel ferrite prepared by chemical reaction at different pH values

    NASA Astrophysics Data System (ADS)

    Aneesh Kumar, K. S.; Bhowmik, R. N.

    2017-12-01

    The electrical conductivity and dielectric properties of Ni1.5Fe1.5O4 ferrite has been controlled by varying the annealing temperature of the chemical routed samples. The frequency activated conductivity obeyed Jonscher’s power law and universal scaling suggested semiconductor nature. An unusual metal like state has been revealed in the measurement temperature scale in between two semiconductor states with different activation energy. The metal like state has been affected by thermal annealing of the material. The analysis of electrical impedance and modulus spectra has confirmed non-Debye dielectric relaxation with contributions from grains and grain boundaries. The dielectric relaxation process is thermally activated in terms of measurement temperature and annealing temperature of the samples. The hole hopping process, due to presence of Ni3+ ions in the present Ni rich ferrite, played a significant role in determining the thermal activated conduction mechanism. This work has successfully applied the technique of a combined variation of annealing temperature and pH value during chemical reaction for tuning electrical parameters in a wide range; for example dc limit of conductivity ~10-4-10-12 S cm-1, and unusually high activation energy ~0.17-1.36 eV.

  16. Classification of Scaffold Hopping Approaches

    PubMed Central

    Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders

    2012-01-01

    The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715

  17. A dynamical mean-field study of orbital-selective Mott phase enhanced by next-nearest neighbor hopping

    NASA Astrophysics Data System (ADS)

    Niu, Yuekun; Sun, Jian; Ni, Yu; Song, Yun

    2018-06-01

    The dynamical mean-field theory is employed to study the orbital-selective Mott transition (OSMT) of the two-orbital Hubbard model with nearest neighbor hopping and next-nearest neighbor (NNN) hopping. The NNN hopping breaks the particle-hole symmetry at half filling and gives rise to an asymmetric density of states (DOS). Our calculations show that the broken symmetry of DOS benefits the OSMT, where the region of the orbital-selective Mott phase significantly extends with the increasing NNN hopping integral. We also find that Hund's rule coupling promotes OSMT by blocking the orbital fluctuations, but the influence of NNN hopping is more remarkable.

  18. Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State

    NASA Astrophysics Data System (ADS)

    Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen

    2017-10-01

    Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.

  19. Charge Carrier Hopping Dynamics in Homogeneously Broadened PbS Quantum Dot Solids.

    PubMed

    Gilmore, Rachel H; Lee, Elizabeth M Y; Weidman, Mark C; Willard, Adam P; Tisdale, William A

    2017-02-08

    Energetic disorder in quantum dot solids adversely impacts charge carrier transport in quantum dot solar cells and electronic devices. Here, we use ultrafast transient absorption spectroscopy to show that homogeneously broadened PbS quantum dot arrays (σ hom 2 :σ inh 2 > 19:1, σ inh /k B T < 0.4) can be realized if quantum dot batches are sufficiently monodisperse (δ ≲ 3.3%). The homogeneous line width is found to be an inverse function of quantum dot size, monotonically increasing from ∼25 meV for the largest quantum dots (5.8 nm diameter/0.92 eV energy) to ∼55 meV for the smallest (4.1 nm/1.3 eV energy). Furthermore, we show that intrinsic charge carrier hopping rates are faster for smaller quantum dots. This finding is the opposite of the mobility trend commonly observed in device measurements but is consistent with theoretical predictions. Fitting our data to a kinetic Monte Carlo model, we extract charge carrier hopping times ranging from 80 ps for the smallest quantum dots to over 1 ns for the largest, with the same ethanethiol ligand treatment. Additionally, we make the surprising observation that, in slightly polydisperse (δ ≲ 4%) quantum dot solids, structural disorder has a greater impact than energetic disorder in inhibiting charge carrier transport. These findings emphasize how small improvements in batch size dispersity can have a dramatic impact on intrinsic charge carrier hopping behavior and will stimulate further improvements in quantum dot device performance.

  20. Conformation-selective resonant photoelectron imaging from dipole-bound states of cold 3-hydroxyphenoxide

    NASA Astrophysics Data System (ADS)

    Zhu, Guo-Zhu; Huang, Dao-Ling; Wang, Lai-Sheng

    2017-07-01

    We report a photoelectron imaging and photodetachment study of cryogenically cooled 3-hydroxyphenoxide (3HOP) anions, m-HO(C6H4)O-. In a previous preliminary study, two conformations of the cold 3HOP anions with different dipole bound states were observed [D. L. Huang et al., J. Phys. Chem. Lett. 6, 2153 (2015)]. Five near-threshold vibrational resonances were revealed in the photodetachment spectrum from the dipole-bound excited states of the two conformations. Here, we report a more extensive investigation of the two conformers with observation of thirty above-threshold vibrational resonances in a wide spectral range between 18 850 and 19 920 cm-1 (˜1000 cm-1 above the detachment thresholds). By tuning the detachment laser to the vibrational resonances in the photodetachment spectrum, high-resolution conformation-selective resonant photoelectron images are obtained. Using information of the autodetachment channels and theoretical vibrational frequencies, we are able to assign the resonant peaks in the photodetachment spectrum: seventeen are assigned to vibrational levels of anti-3HOP, eight to syn-3HOP, and five to overlapping vibrational levels of both conformers. From the photodetachment spectrum and the conformation-selective resonant photoelectron spectra, we have obtained fourteen fundamental vibrational frequencies for the neutral syn- and anti-m-HO(C6H4)Oṡ radicals. The possibility to produce conformation-selected neutral beams using resonant photodetachment via dipole-bound excited states of anions is discussed.

  1. An implementation of a data-transmission pipelining algorithm on Imote2 platforms

    NASA Astrophysics Data System (ADS)

    Li, Xu; Dorvash, Siavash; Cheng, Liang; Pakzad, Shamim

    2011-04-01

    Over the past several years, wireless network systems and sensing technologies have been developed significantly. This has resulted in the broad application of wireless sensor networks (WSNs) in many engineering fields and in particular structural health monitoring (SHM). The movement of traditional SHM toward the new generation of SHM, which utilizes WSNs, relies on the advantages of this new approach such as relatively low costs, ease of implementation and the capability of onboard data processing and management. In the particular case of long span bridge monitoring, a WSN should be capable of transmitting commands and measurement data over long network geometry in a reliable manner. While using single-hop data transmission in such geometry requires a long radio range and consequently a high level of power supply, multi-hop communication may offer an effective and reliable way for data transmissions across the network. Using a multi-hop communication protocol, the network relays data from a remote node to the base station via intermediary nodes. We have proposed a data-transmission pipelining algorithm to enable an effective use of the available bandwidth and minimize the energy consumption and the delay performance by the multi-hop communication protocol. This paper focuses on the implementation aspect of the pipelining algorithm on Imote2 platforms for SHM applications, describes its interaction with underlying routing protocols, and presents the solutions to various implementation issues of the proposed pipelining algorithm. Finally, the performance of the algorithm is evaluated based on the results of an experimental implementation.

  2. Hierarchy of low-energy models of the electronic structure of cuprate HTSCs: The role of long-range spin-correlated hops

    NASA Astrophysics Data System (ADS)

    Val'kov, V. V.; Mitskan, V. A.; Dzebisashvili, D. M.; Barabanov, A. F.

    2018-02-01

    It is shown that for the three-band Emery p-d-model that reflects the real structure of the CuO2-plane of high-temperature superconductors in the regime of strong electron correlations, it is possible to carry out a sequence of reductions to the effective models reproducing low-energy features of elementary excitation spectrum and revealing the spin-polaron nature of the Fermi quasiparticles. The first reduction leads to the spin-fermion model in which the subsystem of spin moments, coupled by the exchange interaction and localized on copper ions, strongly interacts with oxygen holes. The second reduction deals with the transformation from the spin-fermion model to the φ-d-exchange model. An important feature of this transformation is the large energy of the φ-d-exchange coupling, which leads to the formation of spin polarons. The use of this fact allows us to carry out the third reduction, resulting in the t ˜-J˜ *-I -model. Its distinctive feature is the importance of spin-correlated hops as compared to the role of such processes in the commonly used t-J*-model derived from the Hubbard model. Based on the comparative analysis of the spectrum of Fermi excitations calculated for the obtained effective models of the CuO2-plane of high-temperature superconductors, the important role of the usually ignored long-range spin-correlated hops is determined.

  3. Integrals of motion for one-dimensional Anderson localized systems

    DOE PAGES

    Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.; ...

    2016-03-02

    Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. Weanswer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precisemore » sense, motivate our construction.Wenote that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order.Weshow that despite the infinite range hopping, all states but one are localized.Wealso study the conservation laws for the disorder free Aubry–Andre model, where the states are either localized or extended, depending on the strength of a coupling constant.Weformulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry–Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Lastly, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.« less

  4. Integrals of motion for one-dimensional Anderson localized systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.

    Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. Weanswer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precisemore » sense, motivate our construction.Wenote that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order.Weshow that despite the infinite range hopping, all states but one are localized.Wealso study the conservation laws for the disorder free Aubry–Andre model, where the states are either localized or extended, depending on the strength of a coupling constant.Weformulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry–Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Lastly, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.« less

  5. Integrals of motion for one-dimensional Anderson localized systems

    NASA Astrophysics Data System (ADS)

    Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.; Shastry, B. Sriram

    2016-03-01

    Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. We answer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precise sense, motivate our construction. We note that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order. We show that despite the infinite range hopping, all states but one are localized. We also study the conservation laws for the disorder free Aubry-Andre model, where the states are either localized or extended, depending on the strength of a coupling constant. We formulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry-Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Finally, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.

  6. 1THz synchronous tuning of two optical synthesizers

    NASA Astrophysics Data System (ADS)

    Neuhaus, Rudolf; Rohde, Felix; Benkler, Erik; Puppe, Thomas; Raab, Christoph; Unterreitmayer, Reinhard; Zach, Armin; Telle, Harald R.; Stuhler, Jürgen

    2016-04-01

    Single-frequency optical synthesizers (SFOS) provide an optical field with arbitrarily adjustable frequency and phase which is phase-coherently linked to a reference signal. Ideally, they combine the spectral resolution of narrow linewidth frequency stabilized lasers with the broad spectral coverage of frequency combs in a tunable fashion. In state-of-the-art SFOSs tuning across comb lines requires comb line order switching,1, 2 which imposes technical overhead with problems like forbidden frequency gaps or strong phase glitches. Conventional tunable lasers often tune over only tens of GHz before mode-hops occur. Here, we present a novel type of SFOSs, which relies on a serrodyne technique with conditional flyback,3 shifting the carrier frequency of the employed frequency comb without an intrusion into the comb generator. It utilizes a new continuously tunable diode laser that tunes mode-hop-free across the full gain spectrum of the integrated laser diode. We investigate the tuning behavior of two identical SFOSs that share a common reference, by comparing the phases of their output signals. Previously, we achieved phase-stable and cycle-slip free frequency tuning over 28.1 GHz with a maximum zero-to-peak phase deviation of 62 mrad4 when sharing a common comb generator. With the new continuously tunable lasers, the SFOSs tune synchronously across nearly 17800 comb lines (1 THz). The tuning range in this approach can be extended to the full bandwidth of the frequency comb and the 110 nm mode-hop-free tuning range of the diode laser.

  7. Origin of colossal permittivity in (In1/2Nb1/2)TiO2via broadband dielectric spectroscopy.

    PubMed

    Zhao, Xiao-gang; Liu, Peng; Song, Yue-Chan; Zhang, An-ping; Chen, Xiao-ming; Zhou, Jian-ping

    2015-09-21

    (In1/2Nb1/2)TiO2 (IN-T) ceramics were prepared via a solid-state reaction route. X-ray diffraction (XRD) and Raman spectroscopy were used for the structural and compositional characterization of the synthesized compounds. The results indicated that the sintered ceramics have a single phase of rutile TiO2. Dielectric spectroscopy (frequency range from 20 Hz to 1 MHz and temperature range from 10 K to 270 K) was performed on these ceramics. The IN-T ceramics showed extremely high permittivities of up to ∼10(3), which can be referred to as colossal permittivity, with relatively low dielectric losses of ∼0.05. Most importantly, detailed impedance data analyses of IN-T demonstrated that electron-pinned defect-dipoles, interfacial polarization and polaron hopping polarization contribute to the colossal permittivity at high temperatures (270 K); however, only the complexes (pinned electron) and polaron hopping polarization are active at low temperatures (below 180 K), which is consistent with UDR analysis.

  8. Entanglement contour perspective for "strong area-law violation" in a disordered long-range hopping model

    NASA Astrophysics Data System (ADS)

    Roy, Nilanjan; Sharma, Auditya

    2018-03-01

    We numerically investigate the link between the delocalization-localization transition and entanglement in a disordered long-range hopping model of spinless fermions by studying various static and dynamical quantities. This includes the inverse participation ratio, level statistics, entanglement entropy, and number fluctuations in the subsystem along with quench and wave-packet dynamics. Finite systems show delocalized, quasilocalized, and localized phases. The delocalized phase shows strong area-law violation, whereas the (quasi)localized phase adheres to (for large subsystems) the strict area law. The idea of "entanglement contour" nicely explains the violation of area law and its relationship with "fluctuation contour" reveals a signature at the transition point. The relationship between entanglement entropy and number fluctuations in the subsystem also carries signatures for the transition in the model. Results from the Aubry-Andre-Harper model are compared in this context. The propagation of charge and entanglement are contrasted by studying quench and wave-packet dynamics at the single-particle and many-particle levels.

  9. Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

    ERIC Educational Resources Information Center

    Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

    2012-01-01

    "Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

  10. Precision QTL mapping of downy mildew resistance in Hop (Humulus lupulus L.)

    USDA-ARS?s Scientific Manuscript database

    Hop Downy mildew (DM) is an obligate parasite causing severe losses in hop if not controlled. Resistance to this pathogen is a primary goal for hop breeding programs. The objective of this study was to identify QTLs linked to DM resistance. Next-generation-sequencing was performed on a mapping po...

  11. Genomics of the hop psuedo-autosomal regions

    USDA-ARS?s Scientific Manuscript database

    Hop is one of the few crop species with female and male plants with sex being determined by either XX or XY chromosomes. Hop cones are only produced in female hops with or without fertilization. This has lead to most genomic research being directed toward female plants. Very little work has been don...

  12. Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

    ERIC Educational Resources Information Center

    Durham, Aisha S.

    2009-01-01

    The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

  13. Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

    ERIC Educational Resources Information Center

    Tobias, Evan S.

    2014-01-01

    Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

  14. Solvent Dependence of Lateral Charge Transfer in a Porphyrin Monolayer

    DOE PAGES

    Brennan, Bradley J.; Regan, Kevin P.; Durrell, Alec C.; ...

    2016-12-19

    Lateral charge transport in a redox)active monolayer can be utilized for solar energy harvesting. We chose the porphyrin system to study the influence of the solvent on lateral hole hopping, which plays a crucial role in the charge)transfer kinetics. We also examined the influence of water, acetonitrile, and propylene carbonate as solvents. Hole)hopping lifetimes varied by nearly three orders of magnitude among solvents, ranging from 3 ns in water to 2800 ns in propylene carbonate, and increased nonlinearly as a function of added acetonitrile in aqueous solvent mixtures. Our results elucidate the important roles of solvation, molecular packing dynamics, andmore » lateral charge)transfer mechanisms that have implications for all dye)sensitized photoelectrochemical device designs.« less

  15. 3-Sulfanyl-4-methylpentan-1-ol in Dry-Hopped Beers: First Evidence of Glutathione S-Conjugates in Hop (Humulus lupulus L.).

    PubMed

    Kankolongo Cibaka, Marie-Lucie; Decourrière, Laura; Lorenzo-Alonso, Celso-José; Bodart, Etienne; Robiette, Raphaël; Collin, Sonia

    2016-11-16

    Monovarietal dry-hopped beers were produced with the dual-purpose hop cultivars Amarillo, Hallertau Blanc, and Mosaic. The grapefruit-like 3-sulfanyl-4-methylpentan-1-ol was found in all three beers at concentrations much higher than expected on the basis of the free thiol content in hop. Even cysteinylated precursors proved unable to explain our results. As observed in wine, the occurrence of S-glutathione precursors was therefore suspected in hop. The analytical standards of S-3-(4-methyl-1-hydroxypentyl)glutathione, never described before, and of S-3-(1-hydroxyhexyl)glutathione, previously evidenced in grapes, were chemically synthesized. An optimized extraction of glutathionylated precursors was then applied to Amarillo, Hallertau Blanc, and Mosaic hop samples. HPLC-ESI(+)MS/MS revealed, for the first time, the occurrence of S-3-(1-hydroxyhexyl)glutathione and S-3-(4-methyl-1-hydroxypentyl)glutathione in hop, at levels well above those reported for their cysteinylated counterparts. S-3-(1-Hydroxyhexyl)glutathione emerged in all cases as the major adduct in hop. Yet, although 3-sulfanylhexan-1-ol seems relatively ubiquitous in free, cysteinylated, and glutathionylated forms, the glutathione adduct of 3-sulfanyl-4-methylpentan-1-ol, never evidenced in other plants up to now, was found only in the Hallertau Blanc variety.

  16. Relationships of Functional Tests Following ACL Reconstruction: Exploratory Factor Analyses of the Lower Extremity Assessment Protocol.

    PubMed

    DiFabio, Melissa; Slater, Lindsay V; Norte, Grant; Goetschius, John; Hart, Joseph M; Hertel, Jay

    2018-03-01

    After ACL reconstruction (ACLR), deficits are often assessed using a variety of functional tests, which can be time consuming. It is unknown whether these tests provide redundant or unique information. To explore relationships between components of a battery of functional tests, the Lower Extremity Assessment Protocol (LEAP) was created to aid in developing the most informative, concise battery of tests for evaluating ACLR patients. Descriptive, cross-sectional. Laboratory. 76 ACLR patients (6.86±3.07 months postoperative) and 54 healthy participants. Isokinetic knee flexion and extension at 90 and 180 degrees/second, maximal voluntary isometric contraction for knee extension and flexion, single leg balance, 4 hopping tasks (single, triple, crossover, and 6-meter timed hop), and a bilateral drop vertical jump that was scored with the Landing Error Scoring System (LESS). Peak torque, average torque, average power, total work, fatigue indices, center of pressure area and velocity, hop distance and time, and LESS score. A series of factor analyses were conducted to assess grouping of functional tests on the LEAP for each limb in the ACLR and healthy groups and limb symmetry indices (LSI) for both groups. Correlations were run between measures that loaded on retained factors. Isokinetic and isometric strength tests for knee flexion and extension, hopping, balance, and fatigue index were identified as unique factors for all limbs. The LESS score loaded with various factors across the different limbs. The healthy group LSI analysis produced more factors than the ACLR LSI analysis. Individual measures within each factor had moderate to strong correlations. Isokinetic and isometric strength, hopping, balance, and fatigue index provided unique information. Within each category of measures, not all tests may need to be included for a comprehensive functional assessment of ACLR patients due to the high amount of shared variance between them.

  17. Two-year follow-up results for Hip-Hop to Health Jr.: a randomized controlled trial for overweight prevention in preschool minority children.

    PubMed

    Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

    2005-05-01

    To assess the impact of a culturally proficient dietary/physical activity intervention on changes in body mass index (BMI) (kg/m 2 ). Randomized controlled trial (Hip-Hop to Health Jr.) conducted between September 1999 and June 2002 in 12 Head Start preschool programs in Chicago, Illinois. Intervention children had significantly smaller increases in BMI compared with control children at 1-year follow-up, 0.06 vs 0.59 kg/m 2 ; difference -0.53 kg/m 2 (95% CI -0.91 to -0.14), P = .01; and at 2-year follow-up, 0.54 vs 1.08 kg/m 2 ; difference -0.54 kg/m 2 (95% CI -0.98 to -0.10), P = .02, with adjustment for baseline age and BMI. The only significant difference between intervention and control children in food intake/physical activity was the Year 1 difference in percent of calories from saturated fat, 11.6% vs 12.8% ( P = .002). Hip-Hop to Health Jr. was effective in reducing subsequent increases in BMI in preschool children. This represents a promising approach to prevention of overweight among minority children in the preschool years.

  18. The Pseudomonas syringae type III effector HopG1 targets mitochondria, alters plant development, and suppresses plant innate immunity

    PubMed Central

    Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.

    2009-01-01

    Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557

  19. Differential regulation of detoxification enzymes in hepatic and mammary tissue by hops (Humulus lupulus) in vitro and in vivo

    PubMed Central

    Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

    2013-01-01

    Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484

  20. Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

    PubMed

    Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

    2018-04-01

    Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p < 0.01), triple hop (417 ± 106 vs 519 ± 102% limb length, p < 0.01), timed hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p < 0.01), and crossover hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the operative limb compared to the control and non-operative limbs, even after starting sport-specific drills. Importantly, HER strength independently predicted hop performance. Based on these findings, to resolve between-limb deficits in strength and hop performance clinicians should include HER strengthening exercises in post-operative rehabilitation. Prognostic Study, Level II.

  1. QTL examination of a bi-parental mapping population segregating for “short-stature” in hop (Humulus lupulus L.)

    USDA-ARS?s Scientific Manuscript database

    Increasing labor costs and reduced labor pools for hop production have resulted in the necessity to develop strategies to improve efficiency and automate hop production and harvest. One solution for reducing labor inputs is the use and production of “low-trellis” hop varieties optimized for mechani...

  2. Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

    ERIC Educational Resources Information Center

    Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

    2012-01-01

    Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

  3. Hip-Hop and the Academic Canon

    ERIC Educational Resources Information Center

    Abe, Daudi

    2009-01-01

    Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

  4. 21 CFR 173.270 - Hexane.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...

  5. 21 CFR 173.270 - Hexane.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...

  6. Preparation, structural and dielectric characteristics of Y0.5La0.95PO4 nanoparticles

    NASA Astrophysics Data System (ADS)

    Raina, Bindu; Verma, Seema; Gupta, Vandana; Bamzai, K. K.

    2018-05-01

    Nanoparticles of yttrium substituted lanthanum phosphate having formulae Y0.5La0.95PO4 were successfully prepared through co-precipitation method. The phase, purity and crystallinity of 5% yttrium substituted lanthanum phosphate (Y: LaP 5%) powder was characterized by X-ray diffraction technique which suggests the sample belonging to monoclinic monazite crystal system. The spherical morphology with partial agglomeration having grain size in the nano scale range was observed with transmission electron microscopy. FTIR analysis depicts the presence of water molecule along with the phosphate group. The electrical properties of the grown composition show dependence of dielectric constant and dielectric loss on frequency and temperature. The continuous decrease in dielectric constant with increase in frequency suggests that the conduction mechanism is due to hopping of the charge carriers from one site to another.

  7. Drug Product Life-Cycle Management as Anticompetitive Behavior: The Case of Memantine.

    PubMed

    Capati, Vincent C; Kesselheim, Aaron S

    2016-04-01

    A "product hop" involves the substitution of a new formulation of a prescription drug by a pharmaceutical manufacturer for an old version to forestall generic competition. In 2015, for example, Forest Laboratories, the brand-name drug manufacturer of memantine, an Alzheimer's disease treatment, introduced an extended-release version and tried to restrict patient access to the previous version. Product hops can lead to useful incremental innovation but can also have major public health implications by disrupting patients on stable treatment regimens and increasing costs for patients and payers. This commentary reviews alleged anticompetitive product hopping in the case of memantine, which involved proposed conduct that would have left Alzheimer's disease patients with no effective choice but to transition to memantine XR. Policy solutions that can limit anticompetitive product hops include raising the bar for obtaining patents on new drug product formulations and changing automatic generic substitution laws. No outside funding supported this research. To support his work at PORTAL in the summer of 2015, Capati was the recipient of the University of New Hampshire School of Law Rudman Center Public Service Fellowship. Kesselheim's research was supported by Greenwall Faculty Scholars program, the Laura and John Arnold Foundation, and the Harvard Program in Therapeutic Science. In 2013, Kesselheim served as an expert on behalf of a class of individual plaintiffs against Warner Chilcott regarding potential antitrust violations Kesselheim was responsible for concept and design of this commentary. Capati took the lead in data collection and analysis, along with Kesselheim. Capati wrote the manuscript, which was revised by primarily by Kesselheim, along with Capati.

  8. Nuclear magnetic resonance investigation of dynamics in poly(ethylene oxide) based polyether-ester-sulfonate ionomers

    NASA Astrophysics Data System (ADS)

    Roach, David J.

    Nuclear magnetic resonance (NMR) spectroscopy has been utilized to investigate the dynamics of poly(ethylene oxide)-based lithium sulfonate ionomer samples that have low glass transition temperatures. 1H and 7Li spin-lattice relaxation times (T1) of the bulk polymer and lithium ions, respectively, were measured and analyzed in samples with a range of ion contents. The temperature dependence of T1 values along with the presence of minima in T1 as a function of temperature enabled correlation times and activation energies to be obtained for both the segmental motion of the polymer backbone and the hopping motion of lithium cations. Similar activation energies for motion of both the polymer and lithium ions in the samples with lower ion content indicate that the polymer segmental motion and lithium ion hopping motion are correlated in these samples, even though lithium hopping is about ten times slower than the segmental motion. A divergent trend is observed for correlation times and activation energies of the highest ion content sample with 100% lithium sulfonation due to the presence of ionic aggregation. Details of the polymer and cation dynamics on the nanosecond timescale are discussed and complement the findings of X-ray scattering and Quasi Elastic Neutron Scattering experiments. Polymer backbone dynamics of single ion conducting poly(ethylene oxide) (PEO)-based ionomer samples with low glass transition temperatures (T g) have been investigated using solid-state nuclear magnetic resonance (NMR). Experiments detecting 13C with 1H decoupling under magic angle spinning (MAS) conditions identified the different components and relative mobilities of the polymer backbone of a suite of. lithium- and sodium-containing ionomer samples with varying cation contents. Variable temperature (203-373 K) 1H-13C cross-polarization MAS (CP-MAS) experiments also provided qualitative assessment of the differences in the motions of the polymer backbone components as a function of cation content. Each of the main backbone components (PEO spacer and isophthalate groups) exhibit distinct motions, following the trends expected for motional characteristics based on earlier Quasi Elastic Neutron Scattering and 1H spin-lattice relaxation rate measurements. The temperature dependences of 13C linewidths were used to both qualitatively and quantitatively examine the effects of cation content on PEO mobility. Variable contact time 1H-13C CP-MAS experiments were used to further assess the motions of the polymer backbone on the microsecond timescale. The motion of the PEO spacer, determined from the rate of magnetization transfer from 1H to 13C nuclei, in all ionic samples becomes similar for T [special characters omitted] 1.1 Tg, indicating that the motions of the polymer backbones on the microsecond timescale become insensitive to ion interactions. These results compliment previous findings and present an improved picture of the dependence of backbone dynamics on cation type and density in these amorphous PEO-based ionomer systems. 7Li PFG NMR experiments provided measurements of the self-diffusion coefficients for Li+ cations in the PEO600-y Li ionomer series over a range of temperatures. When the Tg values are taken into account, the self-diffusion coefficients of Li+ in each sample follow a similar trendline, indicating that lithium diffusion is independent of ion concentration at any given reduced inverse temperature, Tg/T. Ion aggregation increases Tg and slows both lithium cation diffusion and displacement, but there is no further slowing beyond the Tg effect in the PEO600-y Li ionomers samples. The differences in activation energies obtained from diffusion measurements and relaxation times suggest that at least one additional barrier must be overcome for cations emerge from local hopping motion to macroscopic cation transpfort. Using the Nernst- Einstein equation lithium diffusion coefficients were also calculated from conductivity measurements. The differences between the diffusion measured by the two separate techniques indicate the presence of ion pairs. The activation energy of lithium diffusion was found to be nearly identical between the PFG NMR and conductivity, suggesting that the conductivity and ionic diffusion are related to the same ionic dynamics. As the ion content within the PEO600-y Li samples increases the relative concentration of nonconducting ion pairs decrease. Also an increase in temperature causes a fraction of ion pairs to thermally dissociate into positive triple ions.

  9. Scaffold hopping in drug discovery using inductive logic programming.

    PubMed

    Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

    2008-05-01

    In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

  10. Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials.

    PubMed

    Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang

    2009-02-28

    To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. H pylori reference strain 26695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-(3)H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression.

  11. Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea

    PubMed Central

    Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun

    2016-01-01

    Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293

  12. Implementation of a School Nurse-led Intervention for Children With Severe Obesity in New York City Schools.

    PubMed

    Schroeder, Krista; Jia, Haomiao; Wang, Y Claire; Smaldone, Arlene

    The Healthy Options and Physical Activity Program (HOP) is a school nurse-led intervention for children with severe obesity. HOP was developed by experts at the New York City Department of Health and Mental Hygiene and implemented in New York City schools beginning in 2012. The purpose of this study was to evaluate HOP implementation with the goal of informing HOP refinement and potential future HOP dissemination. This study entailed a retrospective analysis of secondary data. Analytic methods included descriptive statistics, Wilcoxon rank sum and Chi square tests, and multivariate logistic regression. During the 2012-2013 school year, 20,518 children were eligible for HOP. Of these, 1054 (5.1%) were enrolled in the program. On average, enrolled children attended one HOP session during the school year. Parent participation was low (3.2% of HOP sessions). Low nurse workload, low school poverty, higher grade level, higher BMI percentile, and chronic illness diagnosis were associated with student enrollment in HOP. As currently delivered, HOP is not likely to be efficacious. Lessons learned from this evaluation are applicable to future nurse-led obesity interventions. Prior to implementing a school nurse-led obesity intervention, nursing workload and available support must be carefully considered. Interventions should be designed to facilitate (and possibly require) parent involvement. Nurses who deliver obesity interventions may require additional training in obesity treatment. With attention to these lessons learned, evidence-based school nurse-led obesity interventions can be developed. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Genetic interactions between the chromosome axis-associated protein Hop1 and homologous recombination determinants in Schizosaccharomyces pombe.

    PubMed

    Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander

    2018-03-17

    Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.

  14. The Habc Domain of the SNARE Vam3 Interacts with the HOPS Tethering Complex to Facilitate Vacuole Fusion*

    PubMed Central

    Lürick, Anna; Kuhlee, Anne; Bröcker, Cornelia; Kümmel, Daniel; Raunser, Stefan; Ungermann, Christian

    2015-01-01

    Membrane fusion at vacuoles requires a consecutive action of the HOPS tethering complex, which is recruited by the Rab GTPase Ypt7, and vacuolar SNAREs to drive membrane fusion. It is assumed that the Sec1/Munc18-like Vps33 within the HOPS complex is largely responsible for SNARE chaperoning. Here, we present direct evidence for HOPS binding to SNAREs and the Habc domain of the Vam3 SNARE protein, which may explain its function during fusion. We show that HOPS interacts strongly with the Vam3 Habc domain, assembled Q-SNAREs, and the R-SNARE Ykt6, but not the Q-SNARE Vti1 or the Vam3 SNARE domain. Electron microscopy combined with Nanogold labeling reveals that the binding sites for vacuolar SNAREs and the Habc domain are located in the large head of the HOPS complex, where Vps16 and Vps33 have been identified before. Competition experiments suggest that HOPS bound to the Habc domain can still interact with assembled Q-SNAREs, whereas Q-SNARE binding prevents recognition of the Habc domain. In agreement, membranes carrying Vam3ΔHabc fuse poorly unless an excess of HOPS is provided. These data suggest that the Habc domain of Vam3 facilitates the assembly of the HOPS/SNARE machinery at fusion sites and thus supports efficient membrane fusion. PMID:25564619

  15. Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

    ERIC Educational Resources Information Center

    Horton, Akesha Monique

    2013-01-01

    Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

  16. "Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

    ERIC Educational Resources Information Center

    Callahan, J. Sean; Grantham, Tarek C.

    2012-01-01

    One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

  17. HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

    ERIC Educational Resources Information Center

    Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

    2008-01-01

    Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

  18. Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

    ERIC Educational Resources Information Center

    Love, Bettina L.

    2016-01-01

    Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

  19. HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

    ERIC Educational Resources Information Center

    Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

    2014-01-01

    The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

  20. Advances and Promises of Layered Halide Hybrid Perovskite Semiconductors.

    PubMed

    Pedesseau, Laurent; Sapori, Daniel; Traore, Boubacar; Robles, Roberto; Fang, Hong-Hua; Loi, Maria Antonietta; Tsai, Hsinhan; Nie, Wanyi; Blancon, Jean-Christophe; Neukirch, Amanda; Tretiak, Sergei; Mohite, Aditya D; Katan, Claudine; Even, Jacky; Kepenekian, Mikaël

    2016-11-22

    Layered halide hybrid organic-inorganic perovskites (HOP) have been the subject of intense investigation before the rise of three-dimensional (3D) HOP and their impressive performance in solar cells. Recently, layered HOP have also been proposed as attractive alternatives for photostable solar cells and revisited for light-emitting devices. In this review, we combine classical solid-state physics concepts with simulation tools based on density functional theory to overview the main features of the optoelectronic properties of layered HOP. A detailed comparison between layered and 3D HOP is performed to highlight differences and similarities. In the same way as the cubic phase was established for 3D HOP, here we introduce the tetragonal phase with D 4h symmetry as the reference phase for 2D monolayered HOP. It allows for detailed analysis of the spin-orbit coupling effects and structural transitions with corresponding electronic band folding. We further investigate the effects of octahedral tilting on the band gap, loss of inversion symmetry and possible Rashba effect, quantum confinement, and dielectric confinement related to the organic barrier, up to excitonic properties. Altogether, this paper aims to provide an interpretive and predictive framework for 3D and 2D layered HOP optoelectronic properties.

  1. An Energy Efficient Power Control Protocol for Ad Hoc Networks Using Directional Antennas

    NASA Astrophysics Data System (ADS)

    Quiroz-Perez, Carlos; Gulliver, T. Aaron

    A wireless ad hoc network is a collection of mobile nodes that can communicate with each other. Typically, nodes employ omnidirectional antennas. The use of directional antennas can increase spatial reuse, reduce the number of hops to a destination, reduce interference, and increase the transmission range in a specific direction. This is because omnidirectional antennas radiate equally in all directions, limiting the transmission range.

  2. Structural, microstructural and electrical characterization of BaSnO3 and Ba0.90Y0.10SnO3 synthesized by solution combustion method

    NASA Astrophysics Data System (ADS)

    Kumar, Upendra; Yadav, Dharmendra; Upadhyay, Shail; Thakur, Anukul K.

    2018-04-01

    Powder of perovskite oxides BaSnO3 and Ba0.90Y0.10SnO3 have been synthesized by solution combustion method. Rietveld profile analysis shows that the phases crystallize with cubic unit cell in the space group pm3m. Further purity of the synthesized powders was checked by Fourier transform of infrared (FTIR) spectroscopy. The average grain size of the sintered samples was obtained using Scanning electron microscopy (SEM) and found to be 4.9 and 2.8 1m for BaSnO3 and Ba0.90Y0.10SnO3, respectively. The AC conductivity (σac) of synthesized samples was measured in the frequency range from 24Hz-1MHz and temperature range 100 - 600°C. Conductivity spectra of both the samples followed universal Johnscher's power law at different temperatures. The value of bulk or dc conductivity (σdc) at different temperatures has been extracted by fitting the Johnscher's power law to AC conductivity spectra. The activation energy for σc has been obtained from the least square linear fit of data points and found to be 0.53 eV and 0.43 eV, respectively for BaSnO3 and Ba0.90Y0.10SnO3. Based on the value of activation energy it is proposed that conduction in these samples is govern via hopping of (OH)•. The value of conductivity at temperature 550°C of Ba0.90Y0.10SnO3 is 0.00406 S-cm-1 higher than BaSnO3 (0.00173 S-cm-1) at the same temperature.

  3. A rapid isothermal assay for the detection of Hop stunt viroid in hop plants (Humulus lupulus), and its application in disease surveys.

    PubMed

    Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C

    2017-07-01

    Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.

  4. Teaching Inequalities: Using Public Transportation and Visual Sociology to Make It Real

    ERIC Educational Resources Information Center

    Grauerholz, Liz; Settembrino, Marc

    2016-01-01

    In this article, we describe an adaptation of Nichols, Berry, and Kalogrides's "Hop on the Bus" exercise. In addition to riding the bus, we incorporated a visual component similar to that developed by Whitley by having students conduct a sociological, photographic exercise after they disembarked. Qualitative and quantitative assessment…

  5. Interaction of basal foliage removal and late season fungicide applications in management of Hop powdery mildew

    USDA-ARS?s Scientific Manuscript database

    Experiments were conducted over three years to evaluate whether fungicide applications could be ceased after the most susceptible stages of cone development (late July) without unduly affecting crop yield and quality when disease pressure was moderated with varying levels of basal foliage removal. I...

  6. Photoconductivity study of acid on Zinc phthalocyanine pyridine thin films

    NASA Astrophysics Data System (ADS)

    Singh, Sukhwinder; Saini, G. S. S.; Tripathi, S. K.

    2016-05-01

    The Metal Phthalocyanine (MPc) have attracted much interest because of chemical and high thermal stability. Molecules forming a crystal of MPc are held together by weak attractive Vander Waals forces. Organic semiconductors have π conjugate bonds which allow electrons to move via π-electron cloud overlaps. Conduction mechanisms for organic semiconductor are mainly through tunneling; hopping between localized states, mobility gaps, and phonon assisted hopping. The photo conductivity of thin films of these complexes changes when exposed to oxidizing and reducing gases. Arrhenius plot is used to find the thermal activation energy in the intrinsic region and impurity scattering region. Arrhenius plotsare used to find the thermal activation energy. The original version of this article supplied to AIP Publishing contained erroneous text at the end of the abstract. "Arrhenius plots are used to find the thermal activation energy." was deleted as it does not pertain to the article. In addition, a figure citation was cited incorrectly and an equation was missing. This has been corrected in the updated version republished on 4 December 2017.

  7. Localization and hopping conduction in glass and crystal phases of monatomic Au layers on a silicon surface

    NASA Astrophysics Data System (ADS)

    Yamazaki, Shiro; Matsuda, Iwao; Okino, Hiroyuki; Morikawa, Harumo; Hasegawa, Shuji

    2009-02-01

    Monatomic layers of Au on Si(111) exhibit a glass-crystal phase transition between the ordered crystalline 6×6 reconstruction and the disordered glassy β-3×3 reconstruction on thermal annealing. Micro-four-point-probe electrical conductivity measurements clearly revealed that both monatomic layers had conductivities as large as the minimum metallic conductivity at the low-temperature region (˜10-100K) , and were well described by transport theory regarding Anderson localization. The sheet conductivity of the 6×6 was higher than that of the β-3×3 , which was attributed to different degrees of carrier localization.

  8. Crossover from Polaronic to Magnetically Phase-Separated Behavior in La1-xSrxCoO3

    NASA Astrophysics Data System (ADS)

    Phelan, D.; El Khatib, S.; Wang, S.; Barker, J.; Zhao, J.; Zheng, H.; Mitchell, J. F.; Leighton, C.

    2013-03-01

    Dilute hole-doping in La1-xSrxCoO3 leads to the formation of ``spin-state polarons'' where a non-zero spin-state is stabilized on the nearest Co3+ ions surrounding a hole. Here, we discuss the development of electronic/magnetic properties of this system from non-magnetic x=0, through the regime of spin-state polarons, and into the region where longer-range spin correlations and phase separation develop. We present magnetometry, transport, heat capacity, and small-angle neutron scattering (SANS) on single crystals. Magnetometry indicates a crossover with x from Langevin-like behavior (polaronic) to a state with a freezing temperature and finite coercivity. Fascinating correlations with this behavior are seen in transport measurements, the evolution from polaronic to clustered states being accompanied by a crossover from Mott variable range hopping to intercluster hopping. SANS data shows Lorentzian scattering from short-range ferromagnetic clusters first emerging around x = 0.03 with correlation lengths of order two unit cells. We argue that this system provides a unique opportunity to understand in detail the crossover from polaronic to truly phase-separated states.

  9. Formation and electrical transport properties of pentacene nanorod crystal.

    PubMed

    Akai-Kasaya, M; Ohmori, C; Kawanishi, T; Nashiki, M; Saito, A; Aono, M; Kuwahara, Y

    2010-09-10

    The monophasic formation of an uncharted pentacene crystal, the pentacene nanorod, has been investigated. The restricted formation of the pentacene nanorod on a bare mica surface reveals a peculiar surface catalytic crystal growth mode of the pentacene. We demonstrated the charge transport measurements through a single pentacene nanorod and analyzed the data using a periodic hopping conduction model. The results revealed that the pentacene nanorod has a periodic conductive node within their one-dimensional crystal.

  10. Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

    PubMed

    Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

    2015-08-01

    Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

  11. Structural, optical and ac electrical characterization of CBD synthesized NiO thin films: Influence of thickness

    NASA Astrophysics Data System (ADS)

    Das, M. R.; Mukherjee, A.; Mitra, P.

    2017-09-01

    We have studied the electrical conductivity, dielectric relaxation mechanism and impedance spectroscopy characteristics of nickel oxide (NiO) thin films synthesized by chemical bath deposition (CBD) method. Thickness dependent structural, optical and ac electrical characterization has been carried out and deposition time was varied to control the thickness. The material has been characterized using X-ray diffraction and UV-VIS spectrophotometer. Impedance spectroscopy analysis confirmed enhancement of ac conductivity and dielectric constant for films deposited with higher deposition time. Decrease of grain size in thicker films were confirmed from XRD analysis and activation energy of the material for electrical charge hopping process was increased with thickness of the film. Decrease in band gap in thicker films were observed which could be associated with creation of additional energy levels in the band gap of the material. Cole-Cole plot shows contribution of both grain and grain boundary towards total resistance and capacitance. The overall resistance was found to decrease from 14.6 × 105 Ω for 30 min deposited film ( 120 nm thick) to 2.42 × 105 Ω for 120 min deposited film ( 307 nm thick). Activation energy value to electrical conduction process evaluated from conductivity data was found to decrease with thickness. Identical result was obtained from relaxation time approach suggesting hopping mechanism of charge carriers.

  12. Microscopic origin of read current noise in TaO{sub x}-based resistive switching memory by ultra-low temperature measurement

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Yue; Cai, Yimao, E-mail: caiyimao@pku.edu.cn; Liu, Yefan

    TaO{sub x}-based resistive random access memory (RRAM) attracts considerable attention for the development of next generation nonvolatile memories. However, read current noise in RRAM is one of the critical concerns for storage application, and its microscopic origin is still under debate. In this work, the read current noise in TaO{sub x}-based RRAM was studied thoroughly. Based on a noise power spectral density analysis at room temperature and at ultra-low temperature of 25 K, discrete random telegraph noise (RTN) and continuous average current fluctuation (ACF) are identified and decoupled from the total read current noise in TaO{sub x} RRAM devices. A statisticalmore » comparison of noise amplitude further reveals that ACF depends strongly on the temperature, whereas RTN is independent of the temperature. Measurement results combined with conduction mechanism analysis show that RTN in TaO{sub x} RRAM devices arises from electron trapping/detrapping process in the hopping conduction, and ACF is originated from the thermal activation of conduction centers that form the percolation network. At last, a unified model in the framework of hopping conduction is proposed to explain the underlying mechanism of both RTN and ACF noise, which can provide meaningful guidelines for designing noise-immune RRAM devices.« less

  13. Swift heavy ion irradiation effects on structural, optical properties and ac conductivity of polypyrrole nanofibers

    NASA Astrophysics Data System (ADS)

    Hazarika, J.; Kumar, A.

    2016-12-01

    Polypyrrole (PPy) nanofibers have been synthesized by interfacial polymerization method and irradiated with 160 MeV Ni12+ ions under vacuum with fluences in the range of 1010-1012 ions/cm2. High-resolution transmission electron microscopy results show that upon swift heavy ion (SHI) irradiation the PPy nanofibers become denser. The crystallinity of PPy nanofibers increases upon SHI irradiation, while their d-spacing decreases. Upon SHI irradiation, the polaron absorption band gets red-shifted indicating reduction in the optical band gap energy of the irradiated PPy nanofibers. The indirect optical band gap energy is decreased as compared to corresponding direct optical band gap energy. The number of carbon atoms per conjugation length (N) and carbon atoms per cluster (M) of the SHI-irradiated PPy nanofibers increase with increasing the irradiation fluence. Fourier transform infrared spectra reveal the enhancement in intensity of some characteristic vibration bands upon SHI irradiation. The thermal stability of the PPy nanofibers is enhanced on SHI irradiation. The charge carriers in both pristine and irradiated PPy nanofibers follow the correlated barrier hopping mechanism. Scaling of ac conductivity reveals that the conduction mechanism is independent of the SHI irradiation fluence.

  14. Theory of quantum metal to superconductor transitions in highly conducting systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spivak, B.

    2010-04-06

    We derive the theory of the quantum (zero temperature) superconductor to metal transition in disordered materials when the resistance of the normal metal near criticality is small compared to the quantum of resistivity. This can occur most readily in situations in which 'Anderson's theorem' does not apply. We explicitly study the transition in superconductor-metal composites, in an swave superconducting film in the presence of a magnetic field, and in a low temperature disordered d-wave superconductor. Near the point of the transition, the distribution of the superconducting order parameter is highly inhomogeneous. To describe this situation we employ a procedure whichmore » is similar to that introduced by Mott for description of the temperature dependence of the variable range hopping conduction. As the system approaches the point of the transition from the metal to the superconductor, the conductivity of the system diverges, and the Wiedemann-Franz law is violated. In the case of d-wave (or other exotic) superconductors we predict the existence of (at least) two sequential transitions as a function of increasing disorder: a d-wave to s-wave, and then an s-wave to metal transition.« less

  15. Electronic transport in two-dimensional high dielectric constant nanosystems

    DOE PAGES

    Ortuño, M.; Somoza, A. M.; Vinokur, V. M.; ...

    2015-04-10

    There has been remarkable recent progress in engineering high-dielectric constant two dimensional (2D) materials, which are being actively pursued for applications in nanoelectronics in capacitor and memory devices, energy storage, and high-frequency modulation in communication devices. Yet many of the unique properties of these systems are poorly understood and remain unexplored. Here we report a numerical study of hopping conductivity of the lateral network of capacitors, which models two-dimensional insulators, and demonstrate that 2D long-range Coulomb interactions lead to peculiar size effects. We find that the characteristic energy governing electronic transport scales logarithmically with either system size or electrostatic screeningmore » length depending on which one is shorter. Our results are relevant well beyond their immediate context, explaining, for example, recent experimental observations of logarithmic size dependence of electric conductivity of thin superconducting films in the critical vicinity of superconductor-insulator transition where a giant dielectric constant develops. Our findings mark a radical departure from the orthodox view of conductivity in 2D systems as a local characteristic of materials and establish its macroscopic global character as a generic property of high-dielectric constant 2D nanomaterials.« less

  16. Magneto-transport of highly conductive carbon nanotube assemblies under high-field

    NASA Astrophysics Data System (ADS)

    Bulmer, John; Lekawa-Raus, Agnieszka; Koziol, Krzysztof; ECNM Group Team

    2014-03-01

    The magneto-transport response of carbon nanotube (CNT) assemblies has a resistance decrease with magnetic field, which is typically followed by a resistance increase with higher field. These negative and positive components of the magneto-resistance are from, respectively, suppression of weak localization and suppression of inter-tube coupling brought on by the magnetic restriction of the electron wave function. Recently, highly conductive CNT films, which were either doped or enriched with metallic chiralities, showed only a decrease in resistance with field and indicate that the extent of carrier delocalization is beyond individual CNTs. These magneto-transport measurements, however, were no greater then approximately 12 T and it is not clear when or if the magneto-resistance will go positive. In this study we prepared highly conductive single wall CNT films that have been either heavily doped, enriched with metallic chiralities, highly aligned, or a combination of these three. The magneto-resistance was measured up to 65 T with temperatures down to 2 K. The most metallic-like samples had the greatest delay in the positive magneto-resistance upturn. Fluctuation induced tunneling, variable range hopping, and weak localization models were each considered to quantitatively evaluate the transport behavior. http://www.kkoziol.org/index.html

  17. Electronic transport in two-dimensional high dielectric constant nanosystems.

    PubMed

    Ortuño, M; Somoza, A M; Vinokur, V M; Baturina, T I

    2015-04-10

    There has been remarkable recent progress in engineering high-dielectric constant two dimensional (2D) materials, which are being actively pursued for applications in nanoelectronics in capacitor and memory devices, energy storage, and high-frequency modulation in communication devices. Yet many of the unique properties of these systems are poorly understood and remain unexplored. Here we report a numerical study of hopping conductivity of the lateral network of capacitors, which models two-dimensional insulators, and demonstrate that 2D long-range Coulomb interactions lead to peculiar size effects. We find that the characteristic energy governing electronic transport scales logarithmically with either system size or electrostatic screening length depending on which one is shorter. Our results are relevant well beyond their immediate context, explaining, for example, recent experimental observations of logarithmic size dependence of electric conductivity of thin superconducting films in the critical vicinity of superconductor-insulator transition where a giant dielectric constant develops. Our findings mark a radical departure from the orthodox view of conductivity in 2D systems as a local characteristic of materials and establish its macroscopic global character as a generic property of high-dielectric constant 2D nanomaterials.

  18. Crystal growth and transport properties of CuAlO2 single crystal

    NASA Astrophysics Data System (ADS)

    Brahimi, R.; Rekhila, G.; Trari, M.; Bessekhouad, Y.

    2014-12-01

    The transport properties of the delafossite CuAlO2 single crystal, grown by the flux method, are confined in ∞[AlO2] layers extending in the (001) plans. The dielectric properties are measured up to 490 K in the frequency range (102-105 Hz). The small variation of the dielectric loss tan(δ) is attributed to the wide space charge region. The linear plot log (conductivity) vs. 1000/ T follows an Arrhenius type law and the results are discussed in terms of electron hopping among localized states. The activation energy (0.18 eV) gives an effective mass of 16 m 0 indicating that the levels in the vicinity of the Fermi level are strongly localized. Hence, the increase of the conductivity (σ) results from a thermal activation of the mobility (μ300 K = 1.2 × 10-5 cm-2 V-1 s-1). The sign of hole like small polarons is that of p type carriers originating from oxygen intercalation. The thermopower is little temperature dependent and characteristic of non degenerate conductivity with a low holes concentration and a large concentration of surface states within the gap region.

  19. Tourette Syndrome in the Classroom

    ERIC Educational Resources Information Center

    Coffman, Amanda

    2012-01-01

    Tourette syndrome is a neurodevelopmental disorder believed to be genetic. The most visible symptom is the presence of tics. These involuntary movements or sounds can range from simple (sniffing, throat clearing, blinking) to complex (words or phrases, hopping, body contortions). They may be frequent for a few weeks, then fade away almost…

  20. Metal rubber sensor technology to enable in-flight icing measurement

    NASA Astrophysics Data System (ADS)

    Berg, Michelle; Lalli, Jennifer; Claus, Richard; Kreeger, Richard E.

    2017-04-01

    This paper describes the development and testing of Metal Rubber sensors for the nondestructive, normal force detection of ice accretion on aerospace structures. The buildup of ice on aircraft engine components, wings and rotorblades is a problem for both civilian and military aircraft that must operate under all weather conditions. Ice adds mass to moving components, thus changing the equations of motion that control the operation of the system as well as increasing drag and torque requirements. Ice also alters the surface geometry of leading edges, altering the airflow transition from laminar to turbulent, generating turbulence and again increasing drag. Metal Rubber is a piezoresistive material that exhibits a change in electrical resistance in response to physical deformation. It is produced as a freestanding sheet that is assembled at the molecular level using alternating layers of conductive metal nanoparticles and polymers. As the volume percentage of the conductive nanoparticle clusters within the material is increased from zero, the onset of electrical conduction occurs abruptly at the percolation threshold. Electrical conduction occurs due to electron hopping between the clusters. If a length of the material is strained, the clusters move apart so the efficiency of electron hopping decreases and electrical resistance increases. The resulting change in resistance as a function of the change in strain in the material, at a specific volume percentage of conductive clusters, can be interpreted as the transduction response of the material. We describe how sensors fabricated from these materials can be used to measure ice buildup.

Top