Single-legged Hop Tests as Predictors of Self-reported Knee Function After Anterior Cruciate Ligament Reconstruction

PubMed Central

Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn

2012-01-01

Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749

Electron and thermal transport via variable range hopping in MoSe2 single crystals

NASA Astrophysics Data System (ADS)

Suri, Dhavala; Patel, R. S.

2017-06-01

Bulk single crystal molybdenum diselenide has been studied for its electronic and thermal transport properties. We perform resistivity measurements with current in-plane (CIP) and current perpendicular to plane (CPP) as a function of temperature. The CIP measurements exhibit metal to semiconductor transition at ≃31 K. In the semiconducting phase (T > 31 K), the transport is best explained by the variable range hopping (VRH) model. Large magnitude of resistivity in the CPP mode indicates strong structural anisotropy. The Seebeck coefficient as a function of temperature measured in the range of 90-300 K also agrees well with the VRH model. The room temperature Seebeck coefficient is found to be 139 μV/K. VRH fittings of the resistivity and the Seebeck coefficient data indicate high degree of localization.

High-Speed Hopping: Time-Resolved Tomographic PIV Measurements of Water Flea Swimming

NASA Astrophysics Data System (ADS)

Murphy, D. W.; Webster, D. R.; Yen, J.

2012-11-01

Daphniids, also known as water fleas, are small, freshwater crustaceans that live in a low-to-intermediate Reynolds number regime. These plankters are equipped with a pair of branched, setae-bearing antennae that they beat to impulsively propel themselves, or ``hop,'' through the water. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. We present time-resolved tomographic PIV measurements of swimming by Daphnia magna. The body kinematics and flow physics of the daphniid hop are quantified. It is shown that the flow generated by each stroking antenna resembles an asymmetric viscous vortex ring. It is proposed that the flow produced by the daphniid hop can be modeled as a double Stokeslet consisting of two impulsively applied point forces separated by the animal width. The flow physics are discussed in the context of other species operating in the same Reynolds number range of 10 to 100: sea butterfly swimming and flight by the smallest flying insects.

Detrending with Empirical Mode Decomposition (DEMD): Theory, Evaluation, and Application

NASA Astrophysics Data System (ADS)

Bolch, Michael Adam

Land-surface heterogeneity (LSH) at different scales has significant influence on atmospheric boundary layer (ABL) buoyant and shear turbulence generation and transfers of water, carbon and heat. The extent of proliferation of this influence into larger-scale circulations and atmospheric structures is a topic continually investigated in experimental and numerical studies, in many cases with the hopes of improving land-atmosphere parameterizations for modeling purposes. The blending height is a potential metric for the vertical propagation of LSH effects into the ABL, and has been the subject of study for several decades. Proper assessment of the efficacy of blending height theory invites the combination of observations throughout ABLs above different LSH scales with model simulations of the observed ABL and LSH conditions. The central goal of this project is to develop an apt and thoroughly scrutinized method for procuring ABL observations that are accurately detrended and justifiably relevant for such a study, referred to here as Detrending with Empirical Mode Decomposition (DEMD). The Duke University helicopter observation platform (HOP) provides ABL data [wind (u, v, and w), temperature ( T), moisture (q), and carbon dioxide (CO 2)] at a wide range of altitudes, especially in the lower ABL, where LSH effects are most prominent, and where other aircraft-based platforms cannot fly. Also, lower airspeeds translate to higher resolution of the scalars and fluxes needed to evaluate blending height theory. To confirm noninterference of the main rotor downwash with the HOP sensors, and also to identify optimal airspeeds, analytical, numerical, and observational studies are presented. Analytical analysis clears the main rotor downwash from the HOP nose at airspeeds above 10 m s-1. Numerical models find an acceptable range from 20-40 m s-1, due to a growing compressed air preceding the HOP nose. The first observational study finds no impact of different HOP airspeeds on measurements from ˜18 m s -1 to ˜55 m s-1 over a stable marine boundary layer (MBL). Another set of observations studies HOP and tower data, using the Duke University Mobile Micrometeorological Station (MMS) over an MBL, and concludes that HOP sensible heat (SH), latent heat (LE), and carbon dioxide (F CO2) fluxes align well with MMS findings. The HOP sensors provide ABL data at 40 Hz, as well as a real-time display of theta for in-flight ABL height estimation. Sensor calibration and alignment procedures indicate usable ABL measurements. HOP data are especially susceptible to the spurious influence of platform motion on ABL data, largely due to the low-altitude and low-airspeed capabilities of the HOP. For example, HOP altitude motion in the presence of a lapse rate can cause spurious T fluctuations. Empirical mode decomposition (EMD) can separate HOP data into a set of adaptive and unique intrinsic mode functions (IMFs), often with physical meaning. DEMD aims to correct for spurious contributions to HOP data, while merging EMD with a correlation analysis to adjust data without eliminating relevant ABL dynamics. To evaluate DEMD efficacy, two-dimensional synthetic T fields with simulated turbulence over a prescribed lapse rate are sampled with altitude fluctuations similar to HOP flights, and with a wide range of T perturbation and sampling path parameter variations. DEMD recovers the prescribed lapse rate within 1% on average for the 552 test cases passing the filtering criteria. The method is further evaluated via application to vertical cross sections taken from the Ocean-Land-Atmosphere Model (OLAM) large-eddy simulation (LES) results, where DEMD shows improved accuracy of SH recovery. DEMD is applied to three low-altitude HOP flight legs flown on 19 June 2007 during the Cloud and Land Surface Interaction Campaign (CLASIC), both as an example of practical application and to compare DEMD to the initially proposed method (Holder et al. 2011, hereafter H11). H11 dictates the elimination of correlated IMFs, along with other subtle differences from DEMD, which also eliminates any ABL motions embedded in those IMFs. As suspected, the H11 method produces marked reductions of variances and turbulence kinetic energy (TKE) and substantial deviations in SH, LE, and FCO2 compared to DEMD. DEMD detrends without unnecessary elimination. DEMD is vital for ensuring accurate scalars and fluxes from HOP data, and a strategy for future research is presented that integrates properly detrended observations from the CLASIC HOP dataset with OLAM simulations to explore LSH effects on ABL processes and evaluate blending height theory.

-Sb Glasses at Low Temperatures

NASA Astrophysics Data System (ADS)

Souri, Dariush; Azizpour, Parvin; Zaliani, Hamideh

2014-09-01

Semiconducting glasses of the type 40TeO2-(60 - x) V2O5- xSb were prepared by rapid melt quenching and their dc electrical conductivity was measured in the temperature range 180-296 K. For these glassy samples, the dc electrical conductivity ranged from 2.26 × 10-7 S cm-1 to 1.11 × 10-5 S cm-1 at 296 K, indicating the conductivity is enhanced by increasing the V2O5 content. These experimental results could be explained on the basis of different mechanisms (based on polaron-hopping theory) in the different temperature regions. At temperatures above Θ D/2 (where Θ D is the Debye temperature), the non-adiabatic small polaron hopping (NASPH) model is consistent with the data, whereas at temperatures below Θ D/2, a T -1/4 dependence of the conductivity indicative of the variable range hopping (VRH) mechanism is dominant. For all these glasses crossover from SPH to VRH conduction was observed at a characteristic temperature T R ≤ Θ D/2. In this study, the hopping carrier density and carrier mobility were determined at different temperatures. N ( E F), the density of states at (or near) the Fermi level, was also determined from the Mott variables; the results were dependent on V2O5 content.

Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dou, Wenjie; Subotnik, Joseph E.; Nitzan, Abraham

We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case ofmore » out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.« less

Hierarchy of low-energy models of the electronic structure of cuprate HTSCs: The role of long-range spin-correlated hops

NASA Astrophysics Data System (ADS)

Val'kov, V. V.; Mitskan, V. A.; Dzebisashvili, D. M.; Barabanov, A. F.

2018-02-01

It is shown that for the three-band Emery p-d-model that reflects the real structure of the CuO2-plane of high-temperature superconductors in the regime of strong electron correlations, it is possible to carry out a sequence of reductions to the effective models reproducing low-energy features of elementary excitation spectrum and revealing the spin-polaron nature of the Fermi quasiparticles. The first reduction leads to the spin-fermion model in which the subsystem of spin moments, coupled by the exchange interaction and localized on copper ions, strongly interacts with oxygen holes. The second reduction deals with the transformation from the spin-fermion model to the φ-d-exchange model. An important feature of this transformation is the large energy of the φ-d-exchange coupling, which leads to the formation of spin polarons. The use of this fact allows us to carry out the third reduction, resulting in the t ˜-J˜ *-I -model. Its distinctive feature is the importance of spin-correlated hops as compared to the role of such processes in the commonly used t-J*-model derived from the Hubbard model. Based on the comparative analysis of the spectrum of Fermi excitations calculated for the obtained effective models of the CuO2-plane of high-temperature superconductors, the important role of the usually ignored long-range spin-correlated hops is determined.

The frequency hopping pattern design for random hopping frequency signal based on stationary phase principle

NASA Astrophysics Data System (ADS)

Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun

2018-04-01

For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.

From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

NASA Astrophysics Data System (ADS)

Dolberry, Maurice E.

Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.

A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

PubMed

Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

2018-05-08

With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

Mobile bound states of Rydberg excitations in a lattice

NASA Astrophysics Data System (ADS)

Letscher, Fabian; Petrosyan, David

2018-04-01

Spin-lattice models play a central role in the studies of quantum magnetism and nonequilibrium dynamics of spin excitations—-magnons. We show that a spin lattice with strong nearest-neighbor interactions and tunable long-range hopping of excitations can be realized by a regular array of laser-driven atoms, with an excited Rydberg state representing the spin-up state and a Rydberg-dressed ground state corresponding to the spin-down state. We find exotic interaction-bound states of magnons that propagate in the lattice via the combination of resonant two-site hopping and nonresonant second-order hopping processes. Arrays of trapped Rydberg-dressed atoms can thus serve as a flexible platform to simulate and study fundamental few-body dynamics in spin lattices.

First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China

USDA-ARS?s Scientific Manuscript database

Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...

Integrals of motion for one-dimensional Anderson localized systems

DOE PAGES

Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.; ...

2016-03-02

Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. Weanswer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precisemore » sense, motivate our construction.Wenote that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order.Weshow that despite the infinite range hopping, all states but one are localized.Wealso study the conservation laws for the disorder free Aubry–Andre model, where the states are either localized or extended, depending on the strength of a coupling constant.Weformulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry–Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Lastly, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.« less

Integrals of motion for one-dimensional Anderson localized systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.

Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. Weanswer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precisemore » sense, motivate our construction.Wenote that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order.Weshow that despite the infinite range hopping, all states but one are localized.Wealso study the conservation laws for the disorder free Aubry–Andre model, where the states are either localized or extended, depending on the strength of a coupling constant.Weformulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry–Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Lastly, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.« less

Integrals of motion for one-dimensional Anderson localized systems

NASA Astrophysics Data System (ADS)

Modak, Ranjan; Mukerjee, Subroto; Yuzbashyan, Emil A.; Shastry, B. Sriram

2016-03-01

Anderson localization is known to be inevitable in one-dimension for generic disordered models. Since localization leads to Poissonian energy level statistics, we ask if localized systems possess ‘additional’ integrals of motion as well, so as to enhance the analogy with quantum integrable systems. We answer this in the affirmative in the present work. We construct a set of nontrivial integrals of motion for Anderson localized models, in terms of the original creation and annihilation operators. These are found as a power series in the hopping parameter. The recently found Type-1 Hamiltonians, which are known to be quantum integrable in a precise sense, motivate our construction. We note that these models can be viewed as disordered electron models with infinite-range hopping, where a similar series truncates at the linear order. We show that despite the infinite range hopping, all states but one are localized. We also study the conservation laws for the disorder free Aubry-Andre model, where the states are either localized or extended, depending on the strength of a coupling constant. We formulate a specific procedure for averaging over disorder, in order to examine the convergence of the power series. Using this procedure in the Aubry-Andre model, we show that integrals of motion given by our construction are well-defined in localized phase, but not so in the extended phase. Finally, we also obtain the integrals of motion for a model with interactions to lowest order in the interaction.

Effects of europium substitution for In on structure and photoelectric properties of CuIn{sub 1−x}Eu{sub x}Te{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nie, Xiaomeng; Guo, Yongquan

2016-01-15

The structures and optical and electric properties of europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2} have been studied systematically using powder X-ray diffraction (XRD), scanning electron microscopy (SEM) with energy dispersive spectrum (EDS), ultraviolet and visible spectrophotometer (UV–vis), and standard four-probe method. The studies reveal that the minor europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} could still stabilize the chalcopyrite structure in a solid solution of x=0.1. The lattice parameters are going up with increasing the content of europium in CuIn{sub 1−x}Eu{sub x}Te{sub 2} due to the size effect at In site. The structural refinement confirms that Eu partly substitutes formore » In and occupies the 4b crystal position. SEM morphologies show that the europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} can fine the grains from the largely agglomerated state to the uniformly separated state. The electrical resistivities of single phase CuIn{sub 1−x}Eu{sub x}Te{sub 2} follow a mixture model of hopping conductivity and variable range hopping conductivity. The absorption band-gaps of CuIn{sub 1−x}Eu{sub x}Te{sub 2} at room temperature tend to increase with increasing Eu content. CuIn{sub 1−x}Eu{sub x}Te{sub 2} might be a good candidate for photovoltaic cell. - Graphical abstract: CuIn{sub 0.9}Eu{sub 0.1}Te{sub 2} follows a mixture of hopping conductivity and variable range hopping conductivity mechanism. - Highlights: • Novel europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2}. • Potential application for devices and solar cells. • A mixture of hopping and variable range hopping conductivity mechanism.« less

Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus

DOE PAGES

Liu, Huili; Sung Choe, Hwan; Chen, Yabin; ...

2017-09-05

Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less

Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Huili; Sung Choe, Hwan; Chen, Yabin

Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less

Hops (Humulus lupulus L.) Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

PubMed Central

Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy

2017-01-01

Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284

Study of temperature dependent electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses

NASA Astrophysics Data System (ADS)

Deepika, Singh, Hukum

2018-05-01

This paper reports the variation in electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses studied at different temperatures. The amorphous samples were prepared using the melt quenching method and the electrical measurements were performed on Keithley Electrometer in the temperature ranging from 298-373 K. The I-V characteristics were noted at different temperatures and the data obtained was analysed to get dc electrical conductivity and activation energy of electrical conduction. Further, Mott's 3D VRH model has been applied to obtain density of states, hopping range and hopping energy at different temperatures. The obtained results show that dc electrical conductivity increases with increase in Bi composition in Se-Te system. These compositions also show close agreement to Mott's VRH model.

A model for complex flows of soft glassy materials with application to flows through fixed fiber beds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarkar, Arijit; Koch, Donald L., E-mail: dlk15@cornell.edu

2015-11-15

The soft glassy rheology (SGR) model has successfully described the time dependent simple shear rheology of a broad class of complex fluids including foams, concentrated emulsions, colloidal glasses, and solvent-free nanoparticle-organic hybrid materials (NOHMs). The model considers a distribution of mesoscopic fluid elements that hop from trap to trap at a rate which is enhanced by the work done to strain the fluid element. While an SGR fluid has a broad exponential distribution of trap energies, the rheology of NOHMs is better described by a narrower energy distribution and we consider both types of trap energy distributions in this study.more » We introduce a tensorial version of these models with a hopping rate that depends on the orientation of the element relative to the mean stress field, allowing a range of relative strengths of the extensional and simple shear responses of the fluid. As an application of these models we consider the flow of a soft glassy material through a dilute fixed bed of fibers. The dilute fixed bed exhibits a range of local linear flows which alternate in a chaotic manner with time in a Lagrangian reference frame. It is amenable to an analytical treatment and has been used to characterize the strong flow response of many complex fluids including fiber suspensions, dilute polymer solutions and emulsions. We show that the accumulated strain in the fluid elements has an abrupt nonlinear growth at a Deborah number of order one in a manner similar to that observed for polymer solutions. The exponential dependence of the hopping rate on strain leads to a fluid element deformation that grows logarithmically with Deborah number at high Deborah numbers. SGR fluids having a broad range of trap energies flowing through fixed beds can exhibit a range of rheological behaviors at small Deborah numbers ranging from a yield stress, to a power law response and finally to Newtonian behavior.« less

Entanglement contour perspective for "strong area-law violation" in a disordered long-range hopping model

NASA Astrophysics Data System (ADS)

Roy, Nilanjan; Sharma, Auditya

2018-03-01

We numerically investigate the link between the delocalization-localization transition and entanglement in a disordered long-range hopping model of spinless fermions by studying various static and dynamical quantities. This includes the inverse participation ratio, level statistics, entanglement entropy, and number fluctuations in the subsystem along with quench and wave-packet dynamics. Finite systems show delocalized, quasilocalized, and localized phases. The delocalized phase shows strong area-law violation, whereas the (quasi)localized phase adheres to (for large subsystems) the strict area law. The idea of "entanglement contour" nicely explains the violation of area law and its relationship with "fluctuation contour" reveals a signature at the transition point. The relationship between entanglement entropy and number fluctuations in the subsystem also carries signatures for the transition in the model. Results from the Aubry-Andre-Harper model are compared in this context. The propagation of charge and entanglement are contrasted by studying quench and wave-packet dynamics at the single-particle and many-particle levels.

Localization in one-dimensional lattices with non-nearest-neighbor hopping: Generalized Anderson and Aubry-Andre models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biddle, J.; Priour, D. J. Jr.; Wang, B.

We study the quantum localization phenomena of noninteracting particles in one-dimensional lattices based on tight-binding models with various forms of hopping terms beyond the nearest neighbor, which are generalizations of the famous Aubry-Andre and noninteracting Anderson models. For the case with deterministic disordered potential induced by a secondary incommensurate lattice (i.e., the Aubry-Andre model), we identify a class of self-dual models, for which the boundary between localized and extended eigenstates are determined analytically by employing a generalized Aubry-Andre transformation. We also numerically investigate the localization properties of nondual models with next-nearest-neighbor hopping, Gaussian, and power-law decay hopping terms. We findmore » that even for these nondual models, the numerically obtained mobility edges can be well approximated by the analytically obtained condition for localization transition in the self-dual models, as long as the decay of the hopping rate with respect to distance is sufficiently fast. For the disordered potential with genuinely random character, we examine scenarios with next-nearest-neighbor hopping, exponential, Gaussian, and power-law decay hopping terms numerically. We find that the higher-order hopping terms can remove the symmetry in the localization length about the energy band center compared to the Anderson model. Furthermore, our results demonstrate that for the power-law decay case, there exists a critical exponent below which mobility edges can be found. Our theoretical results could, in principle, be directly tested in shallow atomic optical lattice systems enabling non-nearest-neighbor hopping.« less

Wheeled hopping robot

DOEpatents

Fischer, Gary J [Albuquerque, NM

2010-08-17

The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿

PubMed Central

Behr, Jürgen; Vogel, Rudi F.

2010-01-01

In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of hop inhibition, these investigations provide general insight on the role of electrophysiology and ion homeostasis in bacterial stress responses to membrane-active drugs. PMID:19880646

Hierarchical Hopping through Localized States in a Random Potential

NASA Astrophysics Data System (ADS)

Rajan, Harihar; Srivastava, Vipin

2003-03-01

Generalisation of Mott's idea on (low - temperature, large-time), Variable-range-hopping is considered to include hopping at some what higher temperature(that do not kill localization). These transitions complement the variable- range-hopping in that they do not conserve energy and occur at relatively lower time scales. The hopper picks the next state in a hierarchical fashion in accordance with certain conditions. The results are found to tie up nicely with an interesting property pertaining to the energy dependence of localized states. Acknowlwdgements: One of us(VS) would like to thank Association of Commonwealth Universities and Leverhulme Trust for financial help and to Sir Sam Edwards for hospitality at Cavendish Laboratory,Cambridge CB3 0HE.

Nerve Conduction Through Dendrites via Proton Hopping.

PubMed

Kier, Lemont B

2017-01-01

In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Theoretical and experimental study of AC electrical conduction mechanism in the low temperature range of p-CuIn3Se5

NASA Astrophysics Data System (ADS)

Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.

2018-05-01

In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.

Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

PubMed

Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

2018-03-30

Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

Efros-Shklovskii variable range hopping and nonlinear transport in 1 T /1 T'-MoS2

NASA Astrophysics Data System (ADS)

Papadopoulos, N.; Steele, G. A.; van der Zant, H. S. J.

2017-12-01

We have studied temperature- and electric-field-dependent carrier transport in single flakes of MoS2 treated with n -butyllithium. The temperature dependence of the four-terminal resistance follows the Efros-Shklovskii variable range hopping conduction mechanism. From measurements in the Ohmic and non-Ohmic regime, we estimate the localization length and the average hopping length of the carriers, as well as the effective dielectric constant. Furthermore, a comparison between two- and four-probe measurements yields a contact resistance that increases significantly with decreasing temperature.

Hop limited epidemic-like information spreading in mobile social networks with selfish nodes

NASA Astrophysics Data System (ADS)

Wu, Yahui; Deng, Su; Huang, Hongbin

2013-07-01

Similar to epidemics, information can be transmitted directly among users in mobile social networks. Different from epidemics, we can control the spreading process by adjusting the corresponding parameters (e.g., hop count) directly. This paper proposes a theoretical model to evaluate the performance of an epidemic-like spreading algorithm, in which the maximal hop count of the information is limited. In addition, our model can be used to evaluate the impact of users’ selfish behavior. Simulations show the accuracy of our theoretical model. Numerical results show that the information hop count can have an important impact. In addition, the impact of selfish behavior is related to the information hop count.

Hopping robot

DOEpatents

Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.

2001-01-01

The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.

Spectral properties near the Mott transition in the two-dimensional t-J model with next-nearest-neighbor hopping

NASA Astrophysics Data System (ADS)

Kohno, Masanori

2018-05-01

The single-particle spectral properties of the two-dimensional t-J model with next-nearest-neighbor hopping are investigated near the Mott transition by using cluster perturbation theory. The spectral features are interpreted by considering the effects of the next-nearest-neighbor hopping on the shift of the spectral-weight distribution of the two-dimensional t-J model. Various anomalous features observed in hole-doped and electron-doped high-temperature cuprate superconductors are collectively explained in the two-dimensional t-J model with next-nearest-neighbor hopping near the Mott transition.

Dynamics of interacting Dicke model in a coupled-cavity array

NASA Astrophysics Data System (ADS)

Badshah, Fazal; Qamar, Shahid; Paternostro, Mauro

2014-09-01

We consider the dynamics of an array of mutually interacting cavities, each containing an ensemble of N two-level atoms. By exploring the possibilities offered by ensembles of various dimensions and a range of atom-light and photon-hopping values, we investigate the generation of multisite entanglement, as well as the performance of excitation transfer across the array, resulting from the competition between on-site nonlinearities of the matter-light interaction and intersite photon hopping. In particular, for a three-cavity interacting system it is observed that the initial excitation in the first cavity completely transfers to the ensemble in the third cavity through the hopping of photons between the adjacent cavities. Probabilities of the transfer of excitation of the cavity modes and ensembles exhibit characteristics of fast and slow oscillations governed by coupling and hopping parameters, respectively. In the large-hopping case, by seeding an initial excitation in the cavity at the center of the array, a tripartite W state, as well as a bipartite maximally entangled state, is obtained, depending on the interaction time. Population of the ensemble in a cavity has a positive impact on the rate of excitation transfer between the ensembles and their local cavity modes. In particular, for ensembles of five to seven atoms, tripartite W states can be produced even when the hopping rate is comparable to the cavity-atom coupling rate. A similar behavior of the transfer of excitation is observed for a four-coupled-cavity system with two initial excitations.

Outage analysis of relay-assisted underwater wireless optical communication systems

NASA Astrophysics Data System (ADS)

Tabeshnezhad, Azadeh; Pourmina, Mohammad Ali

2017-12-01

In this paper, we theoretically evaluate the outage probabilities of underwater wireless optical communication (UWOC) systems. Our derivations are general as the channel model under consideration takes into account all of the channel degrading effects, namely absorption, scattering, and turbulence-induced fading. We numerically show that the UWOC systems, due to the severe channel impairments, cannot typically support longer link ranges than 100 m. Therefore, in this paper, in order to increase the transmission reliability and hence extend the viable communication range of UWOC systems, we apply decode-and-forward (DF) relay-assisted communications either in the form of multi-hop transmission, where multiple intermediate relays are serially employed between the source and destination, or parallel relaying in which multiple DF relays are distributed among the source-to-destination path to cooperate in the end-to-end transmission. Our numerical results reveal that multi-hop transmission, owing to the distance-dependency of all of the channel degrading effects, can tremendously improve the end-to-end outage probability and increase the accessible link ranges to hundreds of meter. For example, a dual-hop transmission in a 45 m coastal water link can provide up to 41 dB performance improvement at the outage probability of 10-9.

Electron transport in the two-dimensional channel material - zinc oxide nanoflake

NASA Astrophysics Data System (ADS)

Lai, Jian-Jhong; Jian, Dunliang; Lin, Yen-Fu; Ku, Ming-Ming; Jian, Wen-Bin

2018-03-01

ZnO nanoflakes of 3-5 μm in lateral size and 15-20 nm in thickness are synthesized. The nanoflakes are used to make back-gated transistor devices. Electron transport in the ZnO nanoflake channel between source and drain electrodes are investigated. In the beginning, we argue and determine that electrons are in a two-dimensional system. We then apply Mott's two-dimensional variable range hopping model to analyze temperature and electric field dependences of resistivity. The disorder parameter, localization length, hopping distance, and hopping energy of the electron system in ZnO nanoflakes are obtained and, additionally, their temperature behaviors and dependences on room-temperature resistivity are presented. On the other hand, the basic transfer characteristics of the channel material are carried out, as well, and the carrier concentration, the mobility, and the Fermi wavelength of two-dimensional ZnO nanoflakes are estimated.

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

PubMed

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-09-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping

PubMed Central

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-01-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670

The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.

PubMed

Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David

2016-08-15

Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.

Technical strategy of triple jump: differences of inverted pendulum model between hop-dominated and balance techniques.

PubMed

Fujibayashi, Nobuaki; Otsuka, Mitsuo; Yoshioka, Shinsuke; Isaka, Tadao

2017-10-24

The present study aims to cross-sectionally clarify the characteristics of the motions of an inverted pendulum model, a stance leg, a swing leg and arms in different triple-jumping techniques to understand whether or not hop displacement is relatively longer rather than step and jump displacements. Eighteen male athletes performed the triple jump with a full run-up. Based on the technique of the jumpers, they were classified as hop-dominated (n = 10) or balance (n = 8) jumpers. The kinematic data were calculated using motion capture and compared between the two techniques using the inverted pendulum model. The hop-dominated jumpers had a significantly longer hop displacement and faster vertical centre-of-mass (COM) velocity of their whole body at hop take-off, which was generated by faster rotation behaviours of inverted pendulum model and faster swinging behaviours of arms. Conversely, balance jumpers had a significantly longer jump displacement and faster horizontal COM velocity of their whole body at take-off, which was generated by a stiffer inverted pendulum model and stance leg. The results demonstrate that hop-dominated and balance jumpers enhanced each dominated-jump displacement using different swing- and stance-leg motions. This information may help to enhance the actual displacement of triple jumpers using different jumping techniques.

Structural characterization and observation of variable range hopping conduction mechanism at high temperature in CdSe quantum dot solids

NASA Astrophysics Data System (ADS)

Sinha, Subhojyoti; Kumar Chatterjee, Sanat; Ghosh, Jiten; Kumar Meikap, Ajit

2013-03-01

We have used Rietveld refinement technique to extract the microstructural parameters of thioglycolic acid capped CdSe quantum dots. The quantum dot formation and its efficient capping are further confirmed by HR-TEM, UV-visible and FT-IR spectroscopy. Comparative study of the variation of dc conductivity with temperature (298 K ≤ T ≤ 460 K) is given considering Arrhenius formalism, small polaron hopping and Schnakenberg model. We observe that only Schnakenberg model provides good fit to the non-linear region of the variation of dc conductivity with temperature. Experimental variation of ac conductivity and dielectric parameters with temperature (298 K ≤ T ≤ 460 K) and frequency (80 Hz ≤ f ≤ 2 MHz) are discussed in the light of hopping theory and quantum confinement effect. We have elucidated the observed non-linearity in the I-V curves (measured within ±50 V), at dark and at ambient light, in view of tunneling mechanism. Tunnel exponents and non-linearity weight factors have also been evaluated in this regard.

The 1963 Hip-Hop Machine: Hip-Hop Pedagogy as Composition.

ERIC Educational Resources Information Center

Rice, Jeff

2003-01-01

Proposes an alternative invention strategy for research-based argumentative writing. Investigates the coincidental usage of the term "whatever" in hip-hop, theory, and composition studies. Presents a "whatever-pedagogy" identified as "hip-hop pedagogy," a writing practice that models itself after digital sampling's…

Effect of rare-earth substitution at La-site on structural, electrical and thermoelectric properties of La0.7-xRExSr0.3MnO3 compounds (x = 0, 0.2, 0.3; RE = Eu, Gd, Y)

NASA Astrophysics Data System (ADS)

Choudhary, Y. R. S.; Mangavati, Suraj; Patil, Siddanagouda; Rao, Ashok; Nagaraja, B. S.; Thomas, Riya; Okram, G. S.; Kini, Savitha G.

2018-04-01

In the present communication, we present results on the effect of rare-earth (RE) substitution at La-site on the structural, electrical and thermoelectric properties of La0.7-xRExSr0.3MnO3 compounds. The lattice parameters are observed to decrease with RE-doping which is attributed to the fact that the substituted RE ions (RE = Eu, Gd and Y) are smaller than that of La ion. In high temperature semiconducting regime, small polaron hopping (SPH) model is valid, whereas, variable hopping model is valid in low temperature metallic region. The resistivity in the entire temperature range follows percolation model. All the samples exhibit sign reversal in thermopower, S. From temperature dependent S data, it is seen that SPH model is applicable in high temperature regime.

Propulsion of the Water Flea, Daphnia magna: Experiments, Scaling, and Modelling

NASA Astrophysics Data System (ADS)

Skipper, A. N.; Murphy, D.; Webster, D. R.; Yen, J.

2016-02-01

The freshwater crustacean Daphnia magna is a widely studied zooplankton in relation to food webs, predator-prey interactions, and other biological/ecological considerations; however, their locomotion is poorly quantified and understood. These water fleas utilize a hop-and-sink mechanism that consists of making quick, impulsive jumps by beating their antennae to propel themselves forward ( 1 body length). The animals then sink for a period, during which they stretch out their antennae to increase drag and thereby reduce their sinking velocity. Time-resolved three-dimensional flow fields surrounding the animals were quantified with a unique infrared tomographic particle image velocity (tomo-PIV) system. Three-dimensional kinematics data were also extracted from the image sequences. In the current work, we compared body kinematics and flow disturbance among organisms of size in the range of 1.3 to 2.8 mm. The stroke cycle averaged 150 ms in duration, ranging from 100 to 180 ms; this period is generally evenly split between the power and recovery strokes. The range of peak hop velocity was 27.2 to 32.5 mm/s, and peak acceleration was in the range of 0.68 to 1.8 m/s2. The results showed a distinct relationship between peak hop speed (Vmax 14 BL/s) and body size; these data collapsed onto a single time-record curve during the power stroke when properly non-dimensionalized. The fluid flow induced by each antennae consisted of a viscous vortex ring that demonstrated a slow decay in the wake. The strength, size, and decay of the induced viscous vortex rings were compared as a function of organism size. Finally, the viscous vortex rings were analyzed in the context of a double Stokeslet model that consisted of two impulsively applied point forces separated by the animal width.

Longitudinal hopping in intervehicle communication: Theory and simulations on modeled and empirical trajectory data

NASA Astrophysics Data System (ADS)

Thiemann, Christian; Treiber, Martin; Kesting, Arne

2008-09-01

Intervehicle communication enables vehicles to exchange messages within a limited broadcast range and thus self-organize into dynamical and geographically embedded wireless ad hoc networks. We study the longitudinal hopping mode in which messages are transported using equipped vehicles driving in the same direction as a relay. Given a finite communication range, we investigate the conditions where messages can percolate through the network, i.e., a linked chain of relay vehicles exists between the sender and receiver. We simulate message propagation in different traffic scenarios and for different fractions of equipped vehicles. Simulations are done with both, modeled and empirical traffic data. These results are used to test the limits of applicability of an analytical model assuming a Poissonian distance distribution between the relays. We found a good agreement for homogeneous traffic scenarios and sufficiently low percentages of equipped vehicles. For higher percentages, the observed connectivity was higher than that of the model while in stop-and-go traffic situations it was lower. We explain these results in terms of correlations of the distances between the relay vehicles. Finally, we introduce variable transmission ranges and found that this additional stochastic component generally increased connectivity compared to a deterministic transmission with the same mean.

Quantum Spin Dynamics with Pairwise-Tunable, Long-Range Interactions

DTIC Science & Technology

2016-08-05

rection of the arrows. Dashed (dotted) lines mark the NNN hopping terms (coefficients ±t2). NNNN long -range hopping along curved lines are included to...Quantum spin dynamics with pairwise-tunable, long -range interactions C.-L. Hunga,b,1,2, Alejandro González-Tudelac,1,2, J. Ignacio Ciracc, and H. J...atoms) that interact by way of a variety of processes, such as atomic collisions. Such pro- cesses typically lead to short -range, nearest-neighbor

Environmental effects are stronger than human effects on mammalian predator-prey relationships in arid Australian ecosystems.

PubMed

Allen, Benjamin L; Fawcett, Alana; Anker, Alison; Engeman, Richard M; Lisle, Allan; Leung, Luke K-P

2018-01-01

Climate (drought, rainfall), geology (habitat availability), land use change (provision of artificial waterpoints, introduction of livestock), invasive species (competition, predation), and direct human intervention (lethal control of top-predators) have each been identified as processes driving the sustainability of threatened fauna populations. We used a systematic combination of empirical observational studies and experimental manipulations to comprehensively evaluate the effects of these process on a model endangered rodent, dusky hopping-mice (Notomys fuscus). We established a large manipulative experiment in arid Australia, and collected information from relative abundance indices, camera traps, GPS-collared dingoes (Canis familiaris) and dingo scats, along with a range of related environmental data (e.g. rainfall, habitat type, distance to artificial water etc.). We show that hopping-mice populations were most strongly influenced by geological and climatic effects of resource availability and rainfall, and not land use, invasive species, or human effects of livestock grazing, waterpoint provision, or the lethal control of dingoes. Hopping-mice distribution declined along a geological gradient of more to less available hopping-mice habitat (sand dunes), and their abundance was driven by rainfall. Hopping-mice populations fluctuated independent of livestock presence, artificial waterpoint availability or repeated lethal dingo control. Hopping-mice populations appear to be limited first by habitat availability, then by food availability, then by predation. Contemporary top-predator control practices (for protection of livestock) have little influence on hopping-mice behaviour or population dynamics. Given our inability to constrain the effects of predation across broad scales, management actions focusing on increasing available food and habitat (e.g. alteration of fire and herbivory) may have a greater chance of improving the conservation status of hopping-mice and other small mammals in arid areas. Our study also reaffirms the importance of using systematic and experimental approaches to detect true drivers of population distribution and dynamics where multiple potential drivers operate simultaneously. Copyright © 2017 Elsevier B.V. All rights reserved.

Dynamic Hop Service Differentiation Model for End-to-End QoS Provisioning in Multi-Hop Wireless Networks

NASA Astrophysics Data System (ADS)

Youn, Joo-Sang; Seok, Seung-Joon; Kang, Chul-Hee

This paper presents a new QoS model for end-to-end service provisioning in multi-hop wireless networks. In legacy IEEE 802.11e based multi-hop wireless networks, the fixed assignment of service classes according to flow's priority at every node causes priority inversion problem when performing end-to-end service differentiation. Thus, this paper proposes a new QoS provisioning model called Dynamic Hop Service Differentiation (DHSD) to alleviate the problem and support effective service differentiation between end-to-end nodes. Many previous works for QoS model through the 802.11e based service differentiation focus on packet scheduling on several service queues with different service rate and service priority. Our model, however, concentrates on a dynamic class selection scheme, called Per Hop Class Assignment (PHCA), in the node's MAC layer, which selects a proper service class for each packet, in accordance with queue states and service requirement, in every node along the end-to-end route of the packet. The proposed QoS solution is evaluated using the OPNET simulator. The simulation results show that the proposed model outperforms both best-effort and 802.11e based strict priority service models in mobile ad hoc environments.

Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d-dimensional regular lattices.

PubMed

Dias, W S; Bertrand, D; Lyra, M L

2017-06-01

Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d>4.

Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d -dimensional regular lattices

NASA Astrophysics Data System (ADS)

Dias, W. S.; Bertrand, D.; Lyra, M. L.

2017-06-01

Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d >4 .

Modeling and optimization of Quality of Service routing in Mobile Ad hoc Networks

NASA Astrophysics Data System (ADS)

Rafsanjani, Marjan Kuchaki; Fatemidokht, Hamideh; Balas, Valentina Emilia

2016-01-01

Mobile ad hoc networks (MANETs) are a group of mobile nodes that are connected without using a fixed infrastructure. In these networks, nodes communicate with each other by forming a single-hop or multi-hop network. To design effective mobile ad hoc networks, it is important to evaluate the performance of multi-hop paths. In this paper, we present a mathematical model for a routing protocol under energy consumption and packet delivery ratio of multi-hop paths. In this model, we use geometric random graphs rather than random graphs. Our proposed model finds effective paths that minimize the energy consumption and maximizes the packet delivery ratio of the network. Validation of the mathematical model is performed through simulation.

Search behavior of arboreal insectivorous migrants at gulf coast stopover sites in spring

USGS Publications Warehouse

Chen, Chao-Chieh; Barrow, W.C.; Ouchley, K.; Hamilton, R.B.

2011-01-01

Search behavior of arboreal insectivorous migrants was studied at three stopover sites along the northern coast of the Gulf of Mexico during spring migrations, 1993–1995. We examined if search behavior was affected by phylogeny, or by environmental factors. A sequence of search movements (hop, flutter, or flight) in a foraging bout was recorded for each migrant encountered. Search rate, frequency, and distance of movements were calculated for each species. Search rate was positively correlated with proportion of hop, but negatively correlated to flight distance. Hop distance was positively correlated to tarsus length, as was flight distance to wing length for the 31 species of migrants. Cluster analysis indicated closely related species generally have similar foraging modes, which range from “sit-and-wait” of flycatchers to “widely foraging” of warblers. Migrants tended to use more hops in dense vegetation, but more flights in areas with sparse vegetation. Migrants also used more flights when foraging in mixed-species flocks and during periods of high migrant density. Logistic models indicated warblers were more influenced by environmental factors than vireos, possibly because warblers are near-perch searchers and more affected by these factors.

Three-Dimensional Tracking of Interfacial Hopping Diffusion

NASA Astrophysics Data System (ADS)

Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

2017-12-01

Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

Combustion powered linear actuator

DOEpatents

Fischer, Gary J.

2007-09-04

The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

Theory of one-dimensional hopping motion of a heavy particle interacting with phonons by different couplings

NASA Astrophysics Data System (ADS)

Itai, K.

1987-02-01

Two models which describe one-dimensional hopping motion of a heavy particle interacting with phonons are discussed. Model A corresponds to hopping in 1D metals or to the polaron problem. In model B the momentum dependence of the particle-phonon coupling is proportional to k-1/2. The scaling equations show that only in model B does localization occur for a coupling larger than a critical value. In the localization region this model shows close analogy to the Caldeira-Leggett model for macroscopic quantum tunneling.

Metal-insulator transition in a doubly orbitally degenerate model with correlated hopping

NASA Astrophysics Data System (ADS)

Didukh, L.; Skorenkyy, Yu.; Dovhopyaty, Yu.; Hankevych, V.

2000-03-01

In the present paper, we propose a doubly orbitally degenerate narrow-band model with correlated hopping. The peculiarity of the model is taking into account the matrix element of electron-electron interaction, which describes intersite hoppings of electrons. In particular, this leads to the concentration dependence of the effective hopping integral. The cases of the strong and weak Hund's coupling are considered. By means of a generalized mean-field approximation the single-particle Green function and quasiparticle energy spectrum are calculated. Metal-insulator transition is studied in the model at different integer values of the electron concentration. With the help of the obtained energy spectrum, we find energy gap width and criteria of metal-insulator transition.

Antimicrobial activity of hop extracts against foodborne pathogens for meat applications.

PubMed

Kramer, B; Thielmann, J; Hickisch, A; Muranyi, P; Wunderlich, J; Hauser, C

2015-03-01

The objective of this study was the fundamental investigation of the antimicrobial efficiency of various hop extracts against selected foodborne pathogens in vitro, as well as their activity against Listeria monocytogenes in a model meat marinade and on marinated pork tenderloins. In a first step, the minimum inhibitory concentrations (MIC) of three hop extracts containing either α- or β-acids or xanthohumol were determined against test bacteria including L. monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli by a colorimetric method based on the measurement of bacterial metabolic activity. Moreover, the influence of either lactic or citric acid on the antimicrobial activity of the hop extracts was evaluated. The efficiency of hop extracts as a natural food preservative was then tested in a model meat marinade at 2 and 8°C, respectively, and finally on marinated pork. The experiments showed that Gram-positive bacteria were strongly inhibited by hop extracts containing β-acids and xanthohumol (MIC values of 6.3 and 12.5 ppm, respectively), whereas the antimicrobial activity of the investigated α-acid extract was significantly lower (MIC values of 200 ppm). Gram-negative bacteria were highly resistant against all tested hop extracts. Acidification of the test media led to a decrease of the MIC values. The inhibitory activity of the hop extracts against L. monocytogenes was strongly reduced in a fat-containing model meat marinade, but the efficiency of β-acids in this matrix could be increased by lowering pH and storage temperatures. By applying 0.5 % β-acids at pH = 5 in a model marinade, the total aerobic count of pork tenderloins was reduced up to 0.9 log10 compared with marinated pork without hop extract after 2 weeks of storage at 5°C. β-acid containing hop extracts have proven to possess a high antimicrobial activity against Gram-positive bacteria in vitro and in a practice-related application for food preservation. Antimicrobial hop extracts could be used as natural preservatives in food applications to extend the shelf life and to increase the safety of fresh products. © 2014 The Society for Applied Microbiology.

Variable-Range Hopping through Marginally Localized Phonons

NASA Astrophysics Data System (ADS)

Banerjee, Sumilan; Altman, Ehud

2016-03-01

We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.

Ultrasonic Multiple-Access Ranging System Using Spread Spectrum and MEMS Technology for Indoor Localization

PubMed Central

Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah

2014-01-01

Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084

Musculoskeletal modelling deconstructs the paradoxical effects of elastic ankle exoskeletons on plantar-flexor mechanics and energetics during hopping

PubMed Central

Farris, Dominic James; Hicks, Jennifer L.; Delp, Scott L.; Sawicki, Gregory S.

2014-01-01

Experiments have shown that elastic ankle exoskeletons can be used to reduce ankle joint and plantar-flexor muscle loading when hopping in place and, in turn, reduce metabolic energy consumption. However, recent experimental work has shown that such exoskeletons cause less favourable soleus (SO) muscle–tendon mechanics than is observed during normal hopping, which might limit the capacity of the exoskeleton to reduce energy consumption. To directly link plantar-flexor mechanics and energy consumption when hopping in exoskeletons, we used a musculoskeletal model of the human leg and a model of muscle energetics in simulations of muscle–tendon dynamics during hopping with and without elastic ankle exoskeletons. Simulations were driven by experimental electromyograms, joint kinematics and exoskeleton torque taken from previously published data. The data were from seven males who hopped at 2.5 Hz with and without elastic ankle exoskeletons. The energetics model showed that the total rate of metabolic energy consumption by ankle muscles was not significantly reduced by an ankle exoskeleton. This was despite large reductions in plantar-flexor force production (40–50%). The lack of larger metabolic reductions with exoskeletons was attributed to increases in plantar-flexor muscle fibre velocities and a shift to less favourable muscle fibre lengths during active force production. This limited the capacity for plantar-flexors to reduce activation and energy consumption when hopping with exoskeleton assistance. PMID:25278469

Collision-based energetic comparison of rolling and hopping over obstacles

PubMed Central

Iida, Fumiya

2018-01-01

Locomotion of machines and robots operating in rough terrain is strongly influenced by the mechanics of the ground-machine interactions. A rolling wheel in terrain with obstacles is subject to collisional energy losses, which is governed by mechanics comparable to hopping or walking locomotion. Here we investigate the energetic cost associated with overcoming an obstacle for rolling and hopping locomotion, using a simple mechanics model. The model considers collision-based interactions with the ground and the obstacle, without frictional losses, and we quantify, analyse, and compare the sources of energetic costs for three locomotion strategies. Our results show that the energetic advantages of the locomotion strategies are uniquely defined given the moment of inertia and the Froude number associated with the system. We find that hopping outperforms rolling at larger Froude numbers and vice versa. The analysis is further extended for a comparative study with animals. By applying size and inertial properties through an allometric scaling law of hopping and trotting animals to our models, we found that the conditions at which hopping becomes energetically advantageous to rolling roughly corresponds to animals’ preferred gait transition speeds. The energetic collision losses as predicted by the model are largely verified experimentally. PMID:29538459

HIP HOP for HIV Awareness: Using Hip Hop Culture to Promote Community-Level HIV Prevention

ERIC Educational Resources Information Center

Hill, Mandy J.; Hallmark, Camden J.; McNeese, Marlene; Blue, Nike; Ross, Michael W.

2014-01-01

The goal of this paper was to determine the effectiveness of the HIP HOP for HIV Awareness intervention, an innovative model utilising an exchange of an HIV test for a hip hop concert ticket, in a metropolitan city among African American youth and young adults. A subset of intervention participants participated in standardised testing, sex…

Dispersive Sachdev-Ye-Kitaev model: Band structure and quantum chaos

NASA Astrophysics Data System (ADS)

Zhang, Pengfei

2017-11-01

The Sachdev-Ye-Kitaev (SYK) model is a concrete model for a non-Fermi liquid with maximally chaotic behavior in (0 +1 ) dimensions. In order to gain some insights into real materials in higher dimensions where fermions could hop between different sites, here we consider coupling a SYK lattice by constant hopping. We call this the dispersive SYK model. Focusing on (1 +1 ) -dimensional homogeneous hopping, by either tuning the temperature or the relative strength of the random interaction (hopping) and constant hopping, we find a crossover between a dispersive metal to an incoherent metal, where the dynamic exponent z changes from 1 to ∞ . We study the crossover by calculating the spectral function, charge density correlator, and the Lyapunov exponent. We further find the Lyapunov exponent becomes larger when the chemical potential is tuned to approach a van Hove singularity because of the large density of states near the Fermi surface. The effect of the topological nontrivial bands is also discussed.

Thermally Stimulated Currents in Nanocrystalline Titania

PubMed Central

Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Cavallaro, Alessandro; Scaringella, Monica

2018-01-01

A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO2. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5–630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 1014–1018 cm−3, associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies. PMID:29303976

Thermally Stimulated Currents in Nanocrystalline Titania.

PubMed

Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Carnevale, Ennio Antonio; Cavallaro, Alessandro; Scaringella, Monica

2018-01-05

A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO₂. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5-630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 10 14 -10 18 cm -3 , associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies.

Origin of colossal permittivity in BaTiO3 via broadband dielectric spectroscopy

NASA Astrophysics Data System (ADS)

Han, Hyuksu; Voisin, Christophe; Guillemet-Fritsch, Sophie; Dufour, Pascal; Tenailleau, Christophe; Turner, Christopher; Nino, Juan C.

2013-01-01

Barium titanate (BT) ceramics with Ba/Ti ratios of 0.95 and 1.00 were synthesized using spark plasma sintering (SPS) technique. Dielectric spectroscopy (frequency range from 40 Hz to 1 MHz and temperature range from 300 K to 30 K) was performed on those ceramics (SPS BT). SPS BT showed extremely high permittivity up to ˜105, which can be referred to as colossal permittivity, with relatively low dielectric loss of ˜0.05. Data analyses following Debye relaxation and universal dielectric response models indicate that the origin of colossal permittivity in BT ceramics is the result of a hopping polaron within semiconducting grains in combination with interfacial polarization at the insulating grain boundary. Furthermore, the contributions of each polarization mechanism to the colossal permittivity in SPS BT, such as a hopping polarization, internal barrier layer capacitance effect, and electrode effect, were estimated.

Characterization of SiO2/SiC interface states and channel mobility from MOSFET characteristics including variable-range hopping at cryogenic temperature

NASA Astrophysics Data System (ADS)

Yoshioka, Hironori; Hirata, Kazuto

2018-04-01

The characteristics of SiC MOSFETs (drain current vs. gate voltage) were measured at 0.14-350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm-2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V-1s-1 and was almost independent of temperature.

Energy management that generates terrain following versus apex-preserving hopping in man and machine.

PubMed

Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

2012-01-01

While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

Infinite-range Heisenberg model and high-temperature superconductivity

NASA Astrophysics Data System (ADS)

Tahir-Kheli, Jamil; Goddard, William A., III

1993-11-01

A strongly coupled variational wave function, the doublet spin-projected Néel state (DSPN), is proposed for oxygen holes in three-band models of high-temperature superconductors. This wave function has the three-spin system of the oxygen hole plus the two neighboring copper atoms coupled in a spin-1/2 doublet. The copper spins in the neighborhood of a hole are in an eigenstate of the infinite-range Heisenberg antiferromagnet (SPN state). The doublet three-spin magnetic polaron or hopping polaron (HP) is stabilized by the hopping terms tσ and tτ, rather than by the copper-oxygen antiferromagnetic coupling Jpd. Although, the HP has a large projection onto the Emery (Dg) polaron, a non-negligible amount of doublet-u (Du) character is required for optimal hopping stabilization. This is due to Jdd, the copper-copper antiferromagnetic coupling. For the copper spins near an oxygen hole, the copper-copper antiferromagnetic coupling can be considered to be almost infinite ranged, since the copper-spin-correlation length in the superconducting phase (0.06-0.25 holes per in-plane copper) is approximately equal to the mean separation of the holes (between 2 and 4 lattice spacings). The general DSPN wave function is constructed for the motion of a single quasiparticle in an antiferromagnetic background. The SPN state allows simple calculations of various couplings of the oxygen hole with the copper spins. The energy minimum is found at symmetry (π/2,π/2) and the bandwidth scales with Jdd. These results are in agreement with exact computations on a lattice. The coupling of the quasiparticles leads to an attraction of holes and its magnitude is estimated.

Limits to the Extraction of Information from Multi-Hop Skywave Radar Signals

DTIC Science & Technology

2005-04-14

equations to compute the eikonal rays gh a model ionosphere, plotting the resulting tories in the range-height plane. oes received via these multi...kilometres. This extensive database is ideally suited to the sta- tistical analysis of the directional, diurnal, seasonal 0 0 500 1000 1500 2000 2500

Collective effects on activated segmental relaxation in supercooled polymer melts

NASA Astrophysics Data System (ADS)

Mirigian, Stephen; Schweizer, Kenneth

2013-03-01

We extend the polymer nonlinear Langevin equation (NLE) theory of activated segmental dynamics in supercooled polymer melts in two new directions. First, a well-defined mapping from real monomers to a freely-jointed chain is formulated that retains information about chain stiffness, monomer volume, and the amplitude of thermal density fluctuations. Second, collective effects beyond the local cage scale are included based on an elastic solid-state perspective in the ``shoving model'' spirit which accounts for longer range contributions to the activation barrier. In contrast to previous phenomenological treatments of this model, we formulate an explicit microscopic picture of the hopping event, and derive, not assume, that the collective barrier is directly related to the elastic shear modulus. Local hopping is thus renormalized by collective motions of the surroundings that are required to physically accommodate it. Using the PRISM theory of structure, and known compressibility and chain statistics information, quantitative applications of the new theory to predict the temperature and chain length dependence of the alpha time, shear modulus, and fragility are carried out for a range of real polymer liquids and compared to experiment.

Simulation study on characteristics of long-range interaction in randomly asymmetric exclusion process

NASA Astrophysics Data System (ADS)

Zhao, Shi-Bo; Liu, Ming-Zhe; Yang, Lan-Ying

2015-04-01

In this paper we investigate the dynamics of an asymmetric exclusion process on a one-dimensional lattice with long-range hopping and random update via Monte Carlo simulations theoretically. Particles in the model will firstly try to hop over successive unoccupied sites with a probability q, which is different from previous exclusion process models. The probability q may represent the random access of particles. Numerical simulations for stationary particle currents, density profiles, and phase diagrams are obtained. There are three possible stationary phases: the low density (LD) phase, high density (HD) phase, and maximal current (MC) in the system, respectively. Interestingly, bulk density in the LD phase tends to zero, while the MC phase is governed by α, β, and q. The HD phase is nearly the same as the normal TASEP, determined by exit rate β. Theoretical analysis is in good agreement with simulation results. The proposed model may provide a better understanding of random interaction dynamics in complex systems. Project supported by the National Natural Science Foundation of China (Grant Nos. 41274109 and 11104022), the Fund for Sichuan Youth Science and Technology Innovation Research Team (Grant No. 2011JTD0013), and the Creative Team Program of Chengdu University of Technology.

Limit Properties of One Dimensional Periodic Hopping Model

NASA Astrophysics Data System (ADS)

Zhang, Yun-xin

2010-02-01

One dimensional periodic hopping model is useful to understand the motion of microscopic particles in thermal noise environment. In this research, by formal calculation and based on detailed balance, the explicit expressions of the limits of mean velocity and diffusion constant of this model as the number of internal mechanochemical sates tend to infinity are obtained. These results will be helpful to understand the limit of the one dimensional hopping model. At the same time, the work can be used to get more useful results in continuous form from the corresponding ones obtained by discrete models.

The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

PubMed

Harakeh, Zeena; Bogt, Tom F M Ter

2018-02-16

Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

PubMed Central

Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

2007-01-01

The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

PubMed

Neiens, Silva D; Steinhaus, Martin

2018-02-14

The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

A dynamical mean-field study of orbital-selective Mott phase enhanced by next-nearest neighbor hopping

NASA Astrophysics Data System (ADS)

Niu, Yuekun; Sun, Jian; Ni, Yu; Song, Yun

2018-06-01

The dynamical mean-field theory is employed to study the orbital-selective Mott transition (OSMT) of the two-orbital Hubbard model with nearest neighbor hopping and next-nearest neighbor (NNN) hopping. The NNN hopping breaks the particle-hole symmetry at half filling and gives rise to an asymmetric density of states (DOS). Our calculations show that the broken symmetry of DOS benefits the OSMT, where the region of the orbital-selective Mott phase significantly extends with the increasing NNN hopping integral. We also find that Hund's rule coupling promotes OSMT by blocking the orbital fluctuations, but the influence of NNN hopping is more remarkable.

Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs

PubMed Central

Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

2017-01-01

Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014

Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

PubMed

Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

2017-08-01

Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT.

PubMed

Kivlan, Benjamin R; Carcia, Christopher R; Christoforetti, John J; Martin, RobRoy L

2016-08-01

Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Quasi-experimental, cohort comparison. Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. 3B, non-consectutive cohort study.

COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT

PubMed Central

Carcia, Christopher R.; Christoforetti, John J.; Martin, RobRoy L.

2016-01-01

ABSTRACT Background Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. Purpose The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Study Design Quasi-experimental, cohort comparison. Methods Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. Results No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Conclusion Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. Level of Evidence 3B, non-consectutive cohort study PMID:27525177

Matrix-valued Boltzmann equation for the nonintegrable Hubbard chain.

PubMed

Fürst, Martin L R; Mendl, Christian B; Spohn, Herbert

2013-07-01

The standard Fermi-Hubbard chain becomes nonintegrable by adding to the nearest neighbor hopping additional longer range hopping amplitudes. We assume that the quartic interaction is weak and investigate numerically the dynamics of the chain on the level of the Boltzmann type kinetic equation. Only the spatially homogeneous case is considered. We observe that the huge degeneracy of stationary states in the case of nearest neighbor hopping is lost and the convergence to the thermal Fermi-Dirac distribution is restored. The convergence to equilibrium is exponentially fast. However for small next-nearest neighbor hopping amplitudes one has a rapid relaxation towards the manifold of quasistationary states and slow relaxation to the final equilibrium state.

Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity

NASA Astrophysics Data System (ADS)

Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir

2018-05-01

We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

Low Power Multi-Hop Networking Analysis in Intelligent Environments.

PubMed

Etxaniz, Josu; Aranguren, Gerardo

2017-05-19

Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

Low Power Multi-Hop Networking Analysis in Intelligent Environments

PubMed Central

Etxaniz, Josu; Aranguren, Gerardo

2017-01-01

Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847

Study of conduction behavior in Pr0.67Sr0.03Ag0.30MnO3

NASA Astrophysics Data System (ADS)

Bhat, Masroor Ahmad; Modi, Anchit; Pandey, Devendra K.; Gaur, N. K.

2018-05-01

In this paper, we report the conduction mechanism in Pr0.67Sr0.03Ag0.30MnO3 system synthesized via conventional solid state reaction route. The structural information was carried by X - Ray diffraction using Rietveld refinement which confirms the secondary phase of the sample. The SEM image shows the formation of double phase composite because of limited reaction of silver with parent compound. The resistivity behavior indicates the semiconducting behavior. The electronic nature can be estimated by means of variable range hopping (VRH) and small polaron hopping (SPH) model showing that the enhancement of double exchange interaction suppress the band gap and boost the carrier delocalization of charge carriers.

A comparative study of different methods for calculating electronic transition rates

NASA Astrophysics Data System (ADS)

Kananenka, Alexei A.; Sun, Xiang; Schubert, Alexander; Dunietz, Barry D.; Geva, Eitan

2018-03-01

We present a comprehensive comparison of the following mixed quantum-classical methods for calculating electronic transition rates: (1) nonequilibrium Fermi's golden rule, (2) mixed quantum-classical Liouville method, (3) mean-field (Ehrenfest) mixed quantum-classical method, and (4) fewest switches surface-hopping method (in diabatic and adiabatic representations). The comparison is performed on the Garg-Onuchic-Ambegaokar benchmark charge-transfer model, over a broad range of temperatures and electronic coupling strengths, with different nonequilibrium initial states, in the normal and inverted regimes. Under weak to moderate electronic coupling, the nonequilibrium Fermi's golden rule rates are found to be in good agreement with the rates obtained via the mixed quantum-classical Liouville method that coincides with the fully quantum-mechanically exact results for the model system under study. Our results suggest that the nonequilibrium Fermi's golden rule can serve as an inexpensive yet accurate alternative to Ehrenfest and the fewest switches surface-hopping methods.

Landing Mechanics During Side Hopping and Crossover Hopping Maneuvers in Noninjured Women and Women With Anterior Cruciate Ligament Reconstruction

PubMed Central

Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.

2011-01-01

Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128

Correlated Hopping in the 1D Falicov--Kimball Model

NASA Astrophysics Data System (ADS)

Gajek, Z.; Lemanski, R.

2001-10-01

Ground state phase diagrams in the canonical ensemble of the one-dimensional Falicov-Kimball Model (FKM) with the correlated hopping are presented for several values of the model parameters. As compare to the conventional FKM, the diagrams exhibit a loss of the particle--hole symmetry.

Quantum interference magnetoconductance of polycrystalline germanium films in the variable-range hopping regime

NASA Astrophysics Data System (ADS)

Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong

2018-06-01

Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.

AC and DC conductivity study on Ca substituted bismuth ferrite

NASA Astrophysics Data System (ADS)

Pandey, Rabichandra; Pradhan, Lagen Kumar; Kumar, Sunil; Kar, Manoranjan

2018-05-01

Bi0.95Ca0.05FeO3 multiferroic compound was synthesized by the citric acid modified sol-gel method. Crystal structure of Bi0.95Ca0.05FeO3 is studied by the X-ray diffraction (XRD) technique. The ac impedance analysis of the compound has been carried out in a wide range of frequency (100 Hz - 1MHz) as well as temperature (40-2500C). Frequency variation of dielectric constant at different temperatures can be understood by the modified Debye formula. The activation energy was found to be 0.48eV, which was obtained by employing Arrhenius equation. The AC conductivity of the sample follows the Johnscher's power law which indicates the presence of hopping type conduction in localized charged states. To understand the conduction mechanism with localized charge states, the DC resistivity data were analyzed by Mott's variable range hopping (VRH) model. The activation energy calculated from Debye relaxation time, AC conductivity and DC resistivity are comparable to each other.

Chicano Hip-Hop as Interethnic Contact Zone

ERIC Educational Resources Information Center

McFarland, Pancho

2008-01-01

Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

Characterization of host-dependent mutations of apple fruit crinkle viroid replicating in newly identified experimental hosts suggests maintenance of stem-loop structures in the left-hand half of the molecule is important for replication.

PubMed

Suzuki, Takahiro; Fujibayashi, Misato; Hataya, Tatsuji; Taneda, Akito; He, Ying-Hong; Tsushima, Taro; Duraisamy, Ganesh Selvaraj; Siglová, Kristyna; Matoušek, Jaroslav; Sano, Teruo

2017-03-01

Apple fruit crinkle viroid (AFCVd) is a tentative member of the genus Apscaviroid, family Pospiviroidae. AFCVd has a narrow host range and is known to infect apple, hop and persimmon as natural hosts. In this study, tomato, cucumber and wild hop have been identified as new experimental herbaceous hosts. Foliar symptoms were very mild or virtually undetectable, but fruits of infected tomato were small, cracked and distorted. These symptoms resemble those observed on some AFCVd-sensitive apple cultivars. After transfer to tomato, cucumber and wild hop, sequence changes were detected in a natural AFCVd isolate from hop, and major variants in tomato, cucumber and wild hop differed in 10, 8 or 2 nucleotides, respectively, from the predominant one in the inoculum. The major variants in tomato and cucumber were almost identical, and the one in wild hop was very similar to the one in cultivated hop. Detailed analyses of the host-dependent sequence changes that appear in a naturally occurring AFCVd isolate from hop after transfer to tomato using small RNA deep sequence data and infectivity studies with dimeric RNA transcripts followed by progeny analysis indicate that the major AFCVd variant in tomato emerged by selection of a minor variant present in the inoculum (i.e. hop) followed by one to two host-dependent de novo mutations. Comparison of the secondary structures of major variants in hop, tomato and persimmon after transfer to tomato suggested that maintenance of stem-loop structures in the left-hand half of the molecule is critical for infection.

How Does a Hopping Kangaroo Breathe?

ERIC Educational Resources Information Center

Giuliodori, Mauricio J.; Lujan, Heidi L.; Janbaih, Hussein; DiCarlo, Stephen E.

2010-01-01

We developed a model to demonstrate how a hopping kangaroo breathes. Interestingly, a kangaroo uses less energy to breathe while hopping than while standing still. This occurs, in part, because rather than using muscle power to move air into and out of the lungs, air is pulled into (inspiration) and pushed out of (expiration) the lungs as the…

Extreme Kinematics in Selected Hip Hop Dance Sequences.

PubMed

Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

2015-09-01

Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

Blockage-induced condensation controlled by a local reaction

NASA Astrophysics Data System (ADS)

Cirillo, Emilio N. M.; Colangeli, Matteo; Muntean, Adrian

2016-10-01

We consider the setup of stationary zero range models and discuss the onset of condensation induced by a local blockage on the lattice. We show that the introduction of a local feedback on the hopping rates allows us to control the particle fraction in the condensed phase. This phenomenon results in a current versus blockage parameter curve characterized by two nonanalyticity points.

When human walking becomes random walking: fractal analysis and modeling of gait rhythm fluctuations

NASA Astrophysics Data System (ADS)

Hausdorff, Jeffrey M.; Ashkenazy, Yosef; Peng, Chang-K.; Ivanov, Plamen Ch.; Stanley, H. Eugene; Goldberger, Ary L.

2001-12-01

We present a random walk, fractal analysis of the stride-to-stride fluctuations in the human gait rhythm. The gait of healthy young adults is scale-free with long-range correlations extending over hundreds of strides. This fractal scaling changes characteristically with maturation in children and older adults and becomes almost completely uncorrelated with certain neurologic diseases. Stochastic modeling of the gait rhythm dynamics, based on transitions between different “neural centers”, reproduces distinctive statistical properties of the gait pattern. By tuning one model parameter, the hopping (transition) range, the model can describe alterations in gait dynamics from childhood to adulthood - including a decrease in the correlation and volatility exponents with maturation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gallego-Marcos, Fernando; Sánchez, Rafael; Platero, Gloria

We analyze long-range transport through an ac driven triple quantum dot with a single electron. Resonant transitions between separated and detuned dots are mediated by the exchange of n photons with the time-dependent field. An effective model is proposed in terms of second order (cotunneling) processes which dominate the long-range transport between the edge quantum dots. The ac field renormalizes the inter dot hopping, modifying the level hybridization. It results in a non-trivial behavior of the current with the frequency and amplitude of the external ac field.

Gender differences in active musculoskeletal stiffness. Part II. Quantification of leg stiffness during functional hopping tasks.

PubMed

Granata, K P; Padua, D A; Wilson, S E

2002-04-01

Leg stiffness was compared between age-matched males and females during hopping at preferred and controlled frequencies. Stiffness was defined as the linear regression slope between the vertical center of mass (COM) displacement and ground-reaction forces recorded from a force plate during the stance phase of the hopping task. Results demonstrate that subjects modulated the vertical displacement of the COM during ground contact in relation to the square of hopping frequency. This supports the accuracy of the spring-mass oscillator as a representative model of hopping. It also maintained peak vertical ground-reaction load at approximately three times body weight. Leg stiffness values in males (33.9+/-8.7 kN/m) were significantly (p<0.01) greater than in females (26.3+/-6.5 kN/m) at each of three hopping frequencies, 3.0, 2.5 Hz, and a preferred hopping rate. In the spring-mass oscillator model leg stiffness and body mass are related to the frequency of motion. Thus male subjects necessarily recruited greater leg stiffness to drive their heavier body mass at the same frequency as the lighter female subjects during the controlled frequency trials. However, in the preferred hopping condition the stiffness was not constrained by the task because frequency was self-selected. Nonetheless, both male and female subjects hopped at statistically similar preferred frequencies (2.34+/-0.22 Hz), therefore, the females continued to demonstrate less leg stiffness. Recognizing the active muscle stiffness contributes to biomechanical stability as well as leg stiffness, these results may provide insight into the gender bias in risk of musculoskeletal knee injury.

Design of Compressed Sensing Algorithm for Coal Mine IoT Moving Measurement Data Based on a Multi-Hop Network and Total Variation.

PubMed

Wang, Gang; Zhao, Zhikai; Ning, Yongjie

2018-05-28

As the application of a coal mine Internet of Things (IoT), mobile measurement devices, such as intelligent mine lamps, cause moving measurement data to be increased. How to transmit these large amounts of mobile measurement data effectively has become an urgent problem. This paper presents a compressed sensing algorithm for the large amount of coal mine IoT moving measurement data based on a multi-hop network and total variation. By taking gas data in mobile measurement data as an example, two network models for the transmission of gas data flow, namely single-hop and multi-hop transmission modes, are investigated in depth, and a gas data compressed sensing collection model is built based on a multi-hop network. To utilize the sparse characteristics of gas data, the concept of total variation is introduced and a high-efficiency gas data compression and reconstruction method based on Total Variation Sparsity based on Multi-Hop (TVS-MH) is proposed. According to the simulation results, by using the proposed method, the moving measurement data flow from an underground distributed mobile network can be acquired and transmitted efficiently.

Routing protocol for wireless quantum multi-hop mesh backbone network based on partially entangled GHZ state

NASA Astrophysics Data System (ADS)

Xiong, Pei-Ying; Yu, Xu-Tao; Zhang, Zai-Chen; Zhan, Hai-Tao; Hua, Jing-Yu

2017-08-01

Quantum multi-hop teleportation is important in the field of quantum communication. In this study, we propose a quantum multi-hop communication model and a quantum routing protocol with multihop teleportation for wireless mesh backbone networks. Based on an analysis of quantum multi-hop protocols, a partially entangled Greenberger-Horne-Zeilinger (GHZ) state is selected as the quantum channel for the proposed protocol. Both quantum and classical wireless channels exist between two neighboring nodes along the route. With the proposed routing protocol, quantum information can be transmitted hop by hop from the source node to the destination node. Based on multi-hop teleportation based on the partially entangled GHZ state, a quantum route established with the minimum number of hops. The difference between our routing protocol and the classical one is that in the former, the processes used to find a quantum route and establish quantum channel entanglement occur simultaneously. The Bell state measurement results of each hop are piggybacked to quantum route finding information. This method reduces the total number of packets and the magnitude of air interface delay. The deduction of the establishment of a quantum channel between source and destination is also presented here. The final success probability of quantum multi-hop teleportation in wireless mesh backbone networks was simulated and analyzed. Our research shows that quantum multi-hop teleportation in wireless mesh backbone networks through a partially entangled GHZ state is feasible.

Systematic assessment of scaffold hopping versus activity cliff formation across bioactive compound classes following a molecular hierarchy.

PubMed

Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

2015-07-01

Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.

Action at a Distance in the Cell's Nucleus

NASA Astrophysics Data System (ADS)

Kondev, Jane

Various functions performed by chromosomes involve long-range communication between DNA sequences that are tens of thousands of bases apart along the genome, and microns apart in the nucleus. In this talk I will discuss experiments and theory relating to two distinct modes of long-range communication in the nucleus, chromosome looping and protein hopping along the chromosome, both in the context of DNA-break repair in yeast. Yeast is an excellent model system for studies that link chromosome conformations to their function as there is ample experimental evidence that yeast chromosome conformations are well described by a simple, random-walk polymer model. Using a combination of polymer physics theory and experiments on yeast cells, I will demonstrate that loss of polymer entropy due to chromosome looping is the driving force for homology search during repair of broken DNA by homologous recombination. I will also discuss the spread of histone modifications along the chromosome and away from the DNA break point in the context of simple physics models based on chromosome looping and kinase hopping, and show how combining physics theory and cell-biology experiment can be used to dissect the molecular mechanism of the spreading process. These examples demonstrate how combined theoretical and experimental studies can reveal physical principles of long-range communication in the nucleus, which play important roles in regulation of gene expression, DNA recombination, and chromatin modification. This work was supported by the NSF DMR-1206146.

Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

PubMed

Schumacher, Christian; Seyfarth, André

2017-01-01

In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific design). Consequently, variations in body mechanics are permitted with consistent compositions of sensory feedback pathways. Given the variability in human body morphology, such variations are highly relevant for human motor control.

Identification of critical chemical features for Aurora kinase-B inhibitors using Hip-Hop, virtual screening and molecular docking

NASA Astrophysics Data System (ADS)

Sakkiah, Sugunadevi; Thangapandian, Sundarapandian; John, Shalini; Lee, Keun Woo

2011-01-01

This study was performed to find the selective chemical features for Aurora kinase-B inhibitors using the potent methods like Hip-Hop, virtual screening, homology modeling, molecular dynamics and docking. The best hypothesis, Hypo1 was validated toward a wide range of test set containing the selective inhibitors of Aurora kinase-B. Homology modeling and molecular dynamics studies were carried out to perform the molecular docking studies. The best hypothesis Hypo1 was used as a 3D query to screen the chemical databases. The screened molecules from the databases were sorted based on ADME and drug like properties. The selective hit compounds were docked and the hydrogen bond interactions with the critical amino acids present in Aurora kinase-B were compared with the chemical features present in the Hypo1. Finally, we suggest that the chemical features present in the Hypo1 are vital for a molecule to inhibit the Aurora kinase-B activity.

Communication: Standard surface hopping predicts incorrect scaling for Marcus' golden-rule rate: The decoherence problem cannot be ignored

NASA Astrophysics Data System (ADS)

Landry, Brian R.; Subotnik, Joseph E.

2011-11-01

We evaluate the accuracy of Tully's surface hopping algorithm for the spin-boson model for the case of a small diabatic coupling parameter (V). We calculate the transition rates between diabatic surfaces, and we compare our results to the expected Marcus rates. We show that standard surface hopping yields an incorrect scaling with diabatic coupling (linear in V), which we demonstrate is due to an incorrect treatment of decoherence. By modifying standard surface hopping to include decoherence events, we recover the correct scaling (˜V2).

Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

ERIC Educational Resources Information Center

Alim, H. Samy

2011-01-01

This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

ERIC Educational Resources Information Center

Love, Bettina L.

2015-01-01

Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

Charge Carrier Hopping Dynamics in Homogeneously Broadened PbS Quantum Dot Solids.

PubMed

Gilmore, Rachel H; Lee, Elizabeth M Y; Weidman, Mark C; Willard, Adam P; Tisdale, William A

2017-02-08

Energetic disorder in quantum dot solids adversely impacts charge carrier transport in quantum dot solar cells and electronic devices. Here, we use ultrafast transient absorption spectroscopy to show that homogeneously broadened PbS quantum dot arrays (σ hom 2 :σ inh 2 > 19:1, σ inh /k B T < 0.4) can be realized if quantum dot batches are sufficiently monodisperse (δ ≲ 3.3%). The homogeneous line width is found to be an inverse function of quantum dot size, monotonically increasing from ∼25 meV for the largest quantum dots (5.8 nm diameter/0.92 eV energy) to ∼55 meV for the smallest (4.1 nm/1.3 eV energy). Furthermore, we show that intrinsic charge carrier hopping rates are faster for smaller quantum dots. This finding is the opposite of the mobility trend commonly observed in device measurements but is consistent with theoretical predictions. Fitting our data to a kinetic Monte Carlo model, we extract charge carrier hopping times ranging from 80 ps for the smallest quantum dots to over 1 ns for the largest, with the same ethanethiol ligand treatment. Additionally, we make the surprising observation that, in slightly polydisperse (δ ≲ 4%) quantum dot solids, structural disorder has a greater impact than energetic disorder in inhibiting charge carrier transport. These findings emphasize how small improvements in batch size dispersity can have a dramatic impact on intrinsic charge carrier hopping behavior and will stimulate further improvements in quantum dot device performance.

Temperature and field-dependent transport measurements in continuously tunable tantalum oxide memristors expose the dominant state variable

NASA Astrophysics Data System (ADS)

Graves, Catherine E.; Dávila, Noraica; Merced-Grafals, Emmanuelle J.; Lam, Si-Ty; Strachan, John Paul; Williams, R. Stanley

2017-03-01

Applications of memristor devices are quickly moving beyond computer memory to areas of analog and neuromorphic computation. These applications require the design of devices with different characteristics from binary memory, such as a large tunable range of conductance. A complete understanding of the conduction mechanisms and their corresponding state variable(s) is crucial for optimizing performance and designs in these applications. Here we present measurements of low bias I-V characteristics of 6 states in a Ta/ tantalum-oxide (TaOx)/Pt memristor spanning over 2 orders of magnitude in conductance and temperatures from 100 K to 500 K. Our measurements show that the 300 K device conduction is dominated by a temperature-insensitive current that varies with non-volatile memristor state, with an additional leakage contribution from a thermally-activated current channel that is nearly independent of the memristor state. We interpret these results with a parallel conduction model of Mott hopping and Schottky emission channels, fitting the voltage and temperature dependent experimental data for all memristor states with only two free parameters. The memristor conductance is linearly correlated with N, the density of electrons near EF participating in the Mott hopping conduction, revealing N to be the dominant state variable for low bias conduction in this system. Finally, we show that the Mott hopping sites can be ascribed to oxygen vacancies, where the local oxygen vacancy density responsible for critical hopping pathways controls the memristor conductance.

Purely hopping conduction in c-axis oriented LiNbO3 thin films

NASA Astrophysics Data System (ADS)

Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay

2009-05-01

Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.

Steerable Hopping Six-Legged Robot

NASA Technical Reports Server (NTRS)

Younse, Paulo; Aghazarian, Hrand

2010-01-01

The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that indicates the amount by which the spool has been turned. When the robot is ready to hop, the electromagnetic clutch disengages the motor from the spool, thus releasing the cable restraints on the springs and allowing the springs to extend all six legs simultaneously.

Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.

PubMed

Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J

2006-04-01

A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.

Type III Effector Diversification via Both Pathoadaptation and Horizontal Transfer in Response to a Coevolutionary Arms Race

PubMed Central

Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S

2006-01-01

The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219

Bluetooth Low Power Modes Applied to the Data Transportation Network in Home Automation Systems.

PubMed

Etxaniz, Josu; Aranguren, Gerardo

2017-04-30

Even though home automation is a well-known research and development area, recent technological improvements in different areas such as context recognition, sensing, wireless communications or embedded systems have boosted wireless smart homes. This paper focuses on some of those areas related to home automation. The paper draws attention to wireless communications issues on embedded systems. Specifically, the paper discusses the multi-hop networking together with Bluetooth technology and latency, as a quality of service (QoS) metric. Bluetooth is a worldwide standard that provides low power multi-hop networking. It is a radio license free technology and establishes point-to-point and point-to-multipoint links, known as piconets, or multi-hop networks, known as scatternets. This way, many Bluetooth nodes can be interconnected to deploy ambient intelligent networks. This paper introduces the research on multi-hop latency done with park and sniff low power modes of Bluetooth over the test platform developed. Besides, an empirical model is obtained to calculate the latency of Bluetooth multi-hop communications over asynchronous links when links in scatternets are always in sniff or the park mode. Smart home devices and networks designers would take advantage of the models and the estimation of the delay they provide in communications along Bluetooth multi-hop networks.

Bluetooth Low Power Modes Applied to the Data Transportation Network in Home Automation Systems

PubMed Central

Etxaniz, Josu; Aranguren, Gerardo

2017-01-01

Even though home automation is a well-known research and development area, recent technological improvements in different areas such as context recognition, sensing, wireless communications or embedded systems have boosted wireless smart homes. This paper focuses on some of those areas related to home automation. The paper draws attention to wireless communications issues on embedded systems. Specifically, the paper discusses the multi-hop networking together with Bluetooth technology and latency, as a quality of service (QoS) metric. Bluetooth is a worldwide standard that provides low power multi-hop networking. It is a radio license free technology and establishes point-to-point and point-to-multipoint links, known as piconets, or multi-hop networks, known as scatternets. This way, many Bluetooth nodes can be interconnected to deploy ambient intelligent networks. This paper introduces the research on multi-hop latency done with park and sniff low power modes of Bluetooth over the test platform developed. Besides, an empirical model is obtained to calculate the latency of Bluetooth multi-hop communications over asynchronous links when links in scatternets are always in sniff or the park mode. Smart home devices and networks designers would take advantage of the models and the estimation of the delay they provide in communications along Bluetooth multi-hop networks. PMID:28468294

The crossover between tunnel and hopping conductivity in granulated films of noble metals

NASA Astrophysics Data System (ADS)

Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

2017-11-01

The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

A Large-Scale Multi-Hop Localization Algorithm Based on Regularized Extreme Learning for Wireless Networks.

PubMed

Zheng, Wei; Yan, Xiaoyong; Zhao, Wei; Qian, Chengshan

2017-12-20

A novel large-scale multi-hop localization algorithm based on regularized extreme learning is proposed in this paper. The large-scale multi-hop localization problem is formulated as a learning problem. Unlike other similar localization algorithms, the proposed algorithm overcomes the shortcoming of the traditional algorithms which are only applicable to an isotropic network, therefore has a strong adaptability to the complex deployment environment. The proposed algorithm is composed of three stages: data acquisition, modeling and location estimation. In data acquisition stage, the training information between nodes of the given network is collected. In modeling stage, the model among the hop-counts and the physical distances between nodes is constructed using regularized extreme learning. In location estimation stage, each node finds its specific location in a distributed manner. Theoretical analysis and several experiments show that the proposed algorithm can adapt to the different topological environments with low computational cost. Furthermore, high accuracy can be achieved by this method without setting complex parameters.

Origin of intrinsic Josephson coupling in the cuprates and its relation to order parameter symmetry: An incoherent hopping model

NASA Astrophysics Data System (ADS)

Radtke, R. J.; Levin, K.

1995-02-01

Experiments on the cuprate superconductors demonstrate that these materials may be viewed as a stack of Josephson junctions along the direction normal to the CuO 2 planes (the c-axis). In this paper, we present a model which describes this intrinsic Josephson coupling in terms of incherent quasiparticle hopping along the c-axis arising from wave-function overlap, impurity-assisted hopping, and boson-assised hopping. We use this model to compute the magnitude and temperature T dependence of the resulting Josephson critical current jc( T) for s- and d-wave superconductors. Contrary to other approaches, d-wave pairing in this model is compatible with an intrinsic Josephson effect at all hole concentrations and leads to jc( T) αT at low T. By parameterizing our theory with c-axis resistivity data from YBa 2Cu 3O 7-δ (YBCO), we estimate jc( T) for optimally doped and underdoped members of this family. jc( T) can be measured either directly or indirectly through microwave penetration depth experiments, and current measurements on Bi 2Sr 2CaCu 2O 8 and La 2- xSr xCuO 4 are found to be consistent with s-wave pairing and the dominance of assisted hopping processes. The situation in YBCO is still unclear, but our estimates suggest that further experiments on this compound would be of great help in elucidating the validity of our model in general and the pairing symmetry in particular.

Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times.

PubMed

Ahmadi, Sheida; Bowles, Richard K

2017-04-21

Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

Trans-polyacetylene within the extended tight-binding picture and evidence for next-nearest neighbour hopping from the dispersion of interband transition edges

NASA Astrophysics Data System (ADS)

Drechsler, S. L.; Heiner, E.; Osipov, V. A.

1986-11-01

The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.

Impact of Space-Charge Layers on Sudden Death in Li/O2 Batteries.

PubMed

Radin, Maxwell D; Monroe, Charles W; Siegel, Donald J

2015-08-06

The performance of Li/O2 batteries is thought to be limited by charge transport through the solid Li2O2 discharge product. Prior studies suggest that electron tunneling is the main transport mechanism through thin, compact Li2O2 deposits. The present study employs a new continuum transport model to explore an alternative scenario, in which charge transport is mediated by polaron hopping. Unlike earlier models, which assume a uniform carrier concentration or local electroneutrality, the possibility of nonuniform space charge is accounted for at the Li2O2/electrolyte and Li2O2/electrode interfaces, providing a more realistic picture of transport in Li2O2 films. The temperature and current-density dependences of the discharge curves predicted by the model are in good agreement with flat-electrode experiments over a wide range of rates, supporting the hypothesis that polaron hopping contributes significantly to charge transport. Exercising the model suggests that this mechanism could explain the observed enhancement in cell performance at elevated temperature and that performance could be further improved by tuning the interfacial orientation of Li2O2 crystallites.

Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

NASA Astrophysics Data System (ADS)

Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

2017-11-01

Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

Adsorbate hopping via vibrational-mode coupling induced by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Ueba, H.; Hayashi, M.; Paulsson, M.; Persson, B. N. J.

2008-09-01

We study the heat transfer from femtosecond laser-heated hot electrons in a metal to adsorbates in the presence of vibrational-mode coupling. The theory is successfully applied to the experimental result of atomic oxygen hopping on a vicinal Pt(111) surface. The effective friction coupling between hot electrons and the vibrational mode relevant to the hopping motion depends on the transient temperature of the partner mode excited by hot electrons. The calculated two-pulse correlation and fluence dependence of the hopping probability reproduce the experimental results, which were previously analyzed using the hot-electron temperature (Te) -dependent friction ηa(Te) in a conventional heat transfer equation. A possible elementary process behind such a hypothetic modeling using ηa(Te) is discussed in terms of an indirect heating of the vibrational mode for hopping at the surface.

Bluetooth and security

NASA Astrophysics Data System (ADS)

Ivo, Penn

2004-04-01

Bluetooth is the new emerging technology for wireless communication. It can be used to connect almost any device to another device. The traditional example is to link a Personal Digital Assistant (PDA) or a laptop to a mobile phone. That way you can easily take remote connections with your PDA or laptop without getting your mobile phone from your pocket or messing around with cables. A Class 3 Bluetooth device has range of 0,1 - 10 meters. The architecture of Bluetooth is formed by the radio, the base frequency part and the Link Manager. Bluetooth uses the radio range of 2.45 GHz. The theoretical maximum bandwidth is 1 Mb/s, which is slowed down a bit by Forward Error Correction (FEC). Bluetooth specification designates the frequency hopping to be implemented with Gaussian Frequency Shift Keying (GFSK). The base frequency part of the Bluetooth architecture uses a combination of circuit and packet switching technologies. Bluetooth can support either one asynchronous data channel and up to three simultaneous synchronous speech channels, or one channel that transfers asynchronous data and synchronous speech simultaneously. The Link Manager is an essential part of the Bluetooth architecture. It uses Link Manager Protocol (LMP) to configure, authenticate and handle the connections between Bluetooth devices. Several Bluetooth devices can form an ad hoc network. In these piconets, one of the Bluetooth devices will act as a master and the others are slaves. The master sets the frequency-hopping behavior of the piconet. It is also possible to connect up to 10 piconets to each other to form so-called scatternets. Bluetooth has been designed to operate in noisy radio frequency environments, and uses a fast acknowledgement and frequency-hopping scheme to make the link robust, communication-wise. Bluetooth radio modules avoid interference from other signals by hopping to a new frequency after transmitting or receiving a packet. Compared with other systems operating in the same frequency band, the Bluetooth radio typically hops faster and uses shorter packets. This is because short packages and fast hopping limit the impact of microwave ovens and other sources of disturbances. Use of Forward Error Correction (FEC) limits the impact of random noise on long-distance links. Bluetooth transmissions are secure in a business and home environment. Bluetooth has built in sufficient encryption and authentication and is thus very secure in any environment. In addition to this, a frequency-hopping scheme with 1600 hops/sec. is employed. This is far quicker than any other competing system. This, together with an automatic output power adaption to reduce the range exactly to requirement, makes the system extremely difficult to eavesdrop. Information Integrity in Bluetooth has these components: Random Number Generation, Encryption, Encryption Key Management and Authentication.

Polaron hopping in olivine phosphates studied by nuclear resonant scattering

NASA Astrophysics Data System (ADS)

Tracy, Sally June

Valence fluctuations of Fe2+ and Fe3+ were studied in a solid solution of LixFePO4 by nuclear resonant forward scattering of synchrotron x rays while the sample was heated in a diamond-anvil pressure cell. The spectra acquired at different temperatures and pressures were analyzed for the frequencies of valence changes using the Blume-Tjon model of a system with a fluctuating Hamiltonian. These frequencies were analyzed to obtain activation energies and an activation volume for polaron hopping. There was a large suppression of hopping frequency with pressure, giving an anomalously large activation volume. This large, positive value is typical of ion diffusion, which indicates correlated motions of polarons, and Li+ ions that alter the dynamics of both. In a parallel study of NaxFePO4, the interplay between sodium ordering and electron mobility was investigated using a combination of synchrotron x-ray diffraction and nuclear resonant scattering. Conventional Mossbauer spectra were collected while the sample was heated in a resistive furnace. An analysis of the temperature evolution of the spectral shapes was used to identify the onset of fast electron hopping and determine the polaron hopping rate. Synchrotron x-ray diffraction measurements were carried out in the same temperature range. Reitveld analysis of the diffraction patterns was used to determine the temperature of sodium redistribution on the lattice. The diffraction analysis also provides new information about the phase stability of the system. The temperature evolution of the iron site occupancies from the Mossbauer measurements, combined with the synchrotron diffraction results give strong evidence for a relationship between the onset of fast electron dynamics and the redistribution of sodium in the lattice. Measurements of activation barriers for polaron hopping gave fundamental insights about the correlation between electronic carriers and mobile ions. This work established that polaron-ion interactions can alter the local dynamics of electron and ion transport. These types of coupled processes may be common in many materials used for battery electrodes, and new details concerning the influence of polaron-ion interactions on the charge dynamics are relevant to optimizing their electrochemical performance.

IMPLICATIONS OF NON-LOCALITY OF TRANSPORT IN GEOMORPHIC TRANSPORT LAWS: HILLSLOPES AND LANDSCAPE EVOLUTION MODELING

NASA Astrophysics Data System (ADS)

Foufoula-Georgiou, E.; Ganti, V. K.; Dietrich, W. E.

2009-12-01

Sediment transport on hillslopes can be thought of as a hopping process, where the sediment moves in a series of jumps. A wide range of processes shape the hillslopes which can move sediment to a large distance in the downslope direction, thus, resulting in a broad-tail in the probability density function (PDF) of hopping lengths. Here, we argue that such a broad-tailed distribution calls for a non-local computation of sediment flux, where the sediment flux is not only a function of local topographic quantities but is an integral flux which takes into account the upslope topographic “memory” of the point of interest. We encapsulate this non-local behavior into a simple fractional diffusive model that involves fractional (non-integer) derivatives. We present theoretical predictions from this nonlocal model and demonstrate a nonlinear dependence of sediment flux on local gradient, consistent with observations. Further, we demonstrate that the non-local model naturally eliminates the scale-dependence exhibited by any local (linear or nonlinear) sediment transport model. An extension to a 2-D framework, where the fractional derivative can be cast into a mixture of directional derivatives, is discussed together with the implications of introducing non-locality into existing landscape evolution models.

Interaction of alcoholic extracts of hops with cocaine and paracetamol in mice.

PubMed

Horvat, Olga; Raskovic, Aleksandar; Jakovljevic, Vida; Sabo, Jan; Berenji, Janos

2007-01-01

This work describes a study of the interaction in the mouse model of alcoholic extracts of hops of Magnum, Aroma and wild genotypes with drugs that have excitatory effect on the cerebral cortex (cocaine) and analgesic action (paracetamol). Hop drying and preparation of the extracts were carried out according to standard pharmacological procedures for preparing total alcoholic extracts of dry herbs, consisting of one part of dry drug and two parts of 70% alcohol. The mice received four doses i.p. of 0.5% aqueous solutions of the above-mentioned extracts (10 ml/kg) 24, 16, 4 and 0.5 h prior to receiving cocaine (25 mg/kg) or paracetamol (80 mg/kg). The parameter investigated was the change in spontaneous motility of mice after combined treatment with the extracts and cocaine/paracetamol compared to control animals that received the same dose of the drug after treatment with physiological solution. Only the ethanolic extract of Magnum hops increased the spontaneous motility of mice, while none of the extracts showed analgesic action as measured by the hot-plate method. In the interaction with cocaine, the extract of Magnum hops suppressed almost completely the action of cocaine compared to controls. Extracts of the other hops also decreased the cocaine-induced locomotor activity of mice, but to a lesser extent. Hop extracts exhibited a significant pharmacological interaction with paracetamol, with the most pronounced increase in analgesic action being found for the ethanolic extract of Aroma hops and the tert-butanolic extract of wild hops.

Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

PubMed

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

The Number of Trials Required to Obtain a Representative Movement Pattern During a Hurdle Hop Exercise.

PubMed

Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A

2016-06-01

When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.

Precision improvement of frequency-modulated continuous-wave laser ranging system with two auxiliary interferometers

NASA Astrophysics Data System (ADS)

Shi, Guang; Wang, Wen; Zhang, Fumin

2018-03-01

The measurement precision of frequency-modulated continuous-wave (FMCW) laser distance measurement should be proportional to the scanning range of the tunable laser. However, the commercial external cavity diode laser (ECDL) is not an ideal tunable laser source in practical applications. Due to the unavoidable mode hopping and scanning nonlinearity of the ECDL, the measurement precision of FMCW laser distance measurements can be substantially affected. Therefore, an FMCW laser ranging system with two auxiliary interferometers is proposed in this paper. Moreover, to eliminate the effects of ECDL, the frequency-sampling method and mode hopping influence suppression method are employed. Compared with a fringe counting interferometer, this FMCW laser ranging system has a measuring error of ± 20 μm at the distance of 5.8 m.

Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

PubMed

Kea, J; Kramer, J; Forwell, L; Birmingham, T

2001-08-01

Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

Exact outage analysis of the effect of co-channel interference on secured multi-hop relaying networks

NASA Astrophysics Data System (ADS)

Quang Nguyen, Sang; Kong, Hyung Yun

2016-11-01

In this article, the presence of multi-hop relaying, eavesdropper and co-channel interference (CCI) in the same system model is investigated. Specifically, the effect of CCI on a secured multi-hop relaying network is studied, in which the source communicates with the destination via multi-relay-hopping under the presence of an eavesdropper and CCI at each node. The optimal relay at each cluster is selected to help forward the message from the source to the destination. We apply two relay selection approaches to such a system model, i.e. the optimal relay is chosen based on (1) the maximum channel gain from the transmitter to all relays in the desired cluster and (2) the minimum channel gain from the eavesdropper to all relays in each cluster. For the performance evaluation and comparison, we derived the exact closed form of the secrecy outage probability of the two approaches. That analysis is verified by Monte Carlo simulation. Finally, the effects of the number of hops, the transmit power at the source, relays and the external sources, the distance between the external sources and each node in the system, and the location of the eavesdropper are presented and discussed.

Flexible scheme to truncate the hierarchy of pure states.

PubMed

Zhang, P-P; Bentley, C D B; Eisfeld, A

2018-04-07

The hierarchy of pure states (HOPS) is a wavefunction-based method that can be used for numerically modeling open quantum systems. Formally, HOPS recovers the exact system dynamics for an infinite depth of the hierarchy. However, truncation of the hierarchy is required to numerically implement HOPS. We want to choose a "good" truncation method, where by "good" we mean that it is numerically feasible to check convergence of the results. For the truncation approximation used in previous applications of HOPS, convergence checks are numerically challenging. In this work, we demonstrate the application of the "n-particle approximation" to HOPS. We also introduce a new approximation, which we call the "n-mode approximation." We then explore the convergence of these truncation approximations with respect to the number of equations required in the hierarchy in two exemplary problems: absorption and energy transfer of molecular aggregates.

Flexible scheme to truncate the hierarchy of pure states

NASA Astrophysics Data System (ADS)

Zhang, P.-P.; Bentley, C. D. B.; Eisfeld, A.

2018-04-01

The hierarchy of pure states (HOPS) is a wavefunction-based method that can be used for numerically modeling open quantum systems. Formally, HOPS recovers the exact system dynamics for an infinite depth of the hierarchy. However, truncation of the hierarchy is required to numerically implement HOPS. We want to choose a "good" truncation method, where by "good" we mean that it is numerically feasible to check convergence of the results. For the truncation approximation used in previous applications of HOPS, convergence checks are numerically challenging. In this work, we demonstrate the application of the "n-particle approximation" to HOPS. We also introduce a new approximation, which we call the "n-mode approximation." We then explore the convergence of these truncation approximations with respect to the number of equations required in the hierarchy in two exemplary problems: absorption and energy transfer of molecular aggregates.

Self-Avoiding Walks on the Random Lattice and the Random Hopping Model on a Cayley Tree

NASA Astrophysics Data System (ADS)

Kim, Yup

Using a field theoretic method based on the replica trick, it is proved that the three-parameter renormalization group for an n-vector model with quenched randomness reduces to a two-parameter one in the limit n (--->) 0 which corresponds to self-avoiding walks (SAWs). This is also shown by the explicit calculation of the renormalization group recursion relations to second order in (epsilon). From this reduction we find that SAWs on the random lattice are in the same universality class as SAWs on the regular lattice. By analogy with the case of the n-vector model with cubic anisotropy in the limit n (--->) 1, the fixed-point structure of the n-vector model with randomness is analyzed in the SAW limit, so that a physical interpretation of the unphysical fixed point is given. Corrections of the values of critical exponents of the unphysical fixed point published previously is also given. Next we formulate an integral equation and recursion relations for the configurationally averaged one particle Green's function of the random hopping model on a Cayley tree of coordination number ((sigma) + 1). This formalism is tested by applying it successfully to the nonrandom model. Using this scheme for 1 << (sigma) < (INFIN) we calculate the density of states of this model with a Gaussian distribution of hopping matrix elements in the range of energy E('2) > E(,c)('2), where E(,c) is a critical energy described below. The singularity in the Green's function which occurs at energy E(,1)('(0)) for (sigma) = (INFIN) is shifted to complex energy E(,1) (on the unphysical sheet of energy E) for small (sigma)('-1). This calculation shows that the density of states is smooth function of energy E around the critical energy E(,c) = Re E(,1) in accord with Wegner's theorem. In this formulation the density of states has no sharp phase transition on the real axis of E because E(,1) has developed an imaginary part. Using the Lifschitz argument, we calculate the density of states near the band edge for the model when the hopping matrix elements are governed by a bounded probability distribution. It is also shown within the dynamical system language that the density of states of the model with a bounded distribution never vanishes inside the band and we suggest a theoretical mechanism for the formation of energy bands.

Cotunneling and polaronic effect in granular systems

NASA Astrophysics Data System (ADS)

Ioselevich, A. S.; Sivak, V. V.

2017-06-01

We theoretically study the conductivity in arrays of metallic grains due to the variable-range multiple cotunneling of electrons with short-range (screened) Coulomb interaction. The system is supposed to be coupled to random stray charges in the dielectric matrix that are only loosely bounded to their spatial positions by elastic forces. The flexibility of the stray charges gives rise to a polaronic effect, which leads to the onset of Arrhenius-type conductivity behavior at low temperatures, replacing conventional Mott variable-range hopping. The effective activation energy logarithmically depends on temperature due to fluctuations of the polaron barrier heights. We present the unified theory that covers both weak and strong polaron effect regimes of hopping in granular metals and describes the crossover from elastic to inelastic cotunneling.

Effect of Carbon on the Electrical Properties of Copper Oxide-Based Bulk Composites

NASA Astrophysics Data System (ADS)

Kalinin, Yu. E.; Kashirin, M. A.; Makagonov, V. A.; Pankov, S. Yu.; Sitnikov, A. V.

2018-04-01

The effect of carbon filler on the electrical resistance and the thermopower of copper oxide-based composites produced by ceramic technology by hot pressing has been studied. It is found that the dependences of the electrical resistivity on the filler concentration are characteristic by S-like curves that are typical of percolation systems; in this case, the resistivity decreases more substantially as the carbon content increases as compared to the decrease in thermopower value, which is accompanied by the existence of the maximum of the factor of thermoelectric power near the percolation threshold. The studies of the temperature dependences of the resistivity and the thermopower at low temperatures show that, in the range 240-300 K, the predominant mechanism of the electrotransfer of all the composites under study is the hopping mechanism. At temperatures lower than 240 K, the composites with a nanocrystalline CuO matrix have a hopping conductivity with a variable hopping distance over localized states of the matrix near the Fermi level, which is related to the conductivity over intergrain CuO boundaries. A schematic model of the band structure of nanocrystalline CuO with carbon filler is proposed on the base of the analysis of the found experimental regularities of the electrotransfer.

Exact Open Quantum System Dynamics Using the Hierarchy of Pure States (HOPS).

PubMed

Hartmann, Richard; Strunz, Walter T

2017-12-12

We show that the general and numerically exact Hierarchy of Pure States method (HOPS) is very well applicable to calculate the reduced dynamics of an open quantum system. In particular, we focus on environments with a sub-Ohmic spectral density (SD) resulting in an algebraic decay of the bath correlation function (BCF). The universal applicability of HOPS, reaching from weak to strong coupling for zero and nonzero temperature, is demonstrated by solving the spin-boson model for which we find perfect agreement with other methods, each one suitable for a special regime of parameters. The challenges arising in the strong coupling regime are not only reflected in the computational effort needed for the HOPS method to converge but also in the necessity for an importance sampling mechanism, accounted for by the nonlinear variant of HOPS. In order to include nonzero-temperature effects in the strong coupling regime we found that it is highly favorable for the HOPS method to use the zero-temperature BCF and include temperature via a stochastic Hermitian contribution to the system Hamiltonian.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Millimeter Wave Alternate Route Study.

DTIC Science & Technology

1981-04-01

processing gains are based upon the assumption that the jammer equally distributes his available power over all the hopping frequencies. If this is true...Examples Assumptions 0 25 GHz hopping range (e.g., 20 GHz to 45 GHz) 0 10 ms settling time * 0.1 second dwell time - implies 11% increase in channel data...of the architectures presented previously. The assumption that each link has equal probability p of being disrupted (i.e., successfully jammed) seems

Analysis of Electrical Transport and Noise Mechanisms in Amorphous Silicon

DTIC Science & Technology

2015-11-23

and Skhlovskii [9] considered the long range Coulomb interaction and found that it reduces the DOS to zero at the Fermi level, thereby creating a so...called “ Coulomb gap (CG)” at low enough temperatures. This form of hopping conductivity results when an electron migrates from one site to another...site leaving a positively charged vacancy. For hopping to occur, the electron must have sufficient energy to overcome this Coulomb interaction

Charge relaxation and dynamics in organic semiconductors

NASA Astrophysics Data System (ADS)

Kwok, H. L.

2006-08-01

Charge relaxation in dispersive materials is often described in terms of the stretched exponential function (Kohlrausch law). The process can be explained using a "hopping" model which in principle, also applies to charge transport such as current conduction. This work analyzed reported transient photoconductivity data on functionalized pentacene single crystals using a geometric hopping model developed by B. Sturman et al and extracted values (or range of values) on the materials parameters relevant to charge relaxation as well as charge transport. Using the correlated disorder model (CDM), we estimated values of the carrier mobility for the pentacene samples. From these results, we observed the following: i) the transport site density appeared to be of the same order of magnitude as the carrier density; ii) it was possible to extract lower bound values on the materials parameters linked to the transport process; and iii) by matching the simulated charge decay to the transient photoconductivity data, we were able to refine estimates on the materials parameters. The data also allowed us to simulate the stretched exponential decay. Our observations suggested that the stretching index and the carrier mobility were related. Physically, such interdependence would allow one to demarcate between localized molecular interactions and distant coulomb interactions.

Study of hopping type conduction from AC conductivity in multiferroic composite

NASA Astrophysics Data System (ADS)

Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan

2018-05-01

0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).

Back-Hopping in Spin-Transfer-Torque Devices: Possible Origin and Countermeasures

NASA Astrophysics Data System (ADS)

Abert, Claas; Sepehri-Amin, Hossein; Bruckner, Florian; Vogler, Christoph; Hayashi, Masamitsu; Suess, Dieter

2018-05-01

The effect of undesirable high-frequency free-layer switching in magnetic multilayer systems, referred to as back-hopping, is investigated by means of the spin-diffusion model. A possible origin of the back-hopping effect is found to be the destabilization of the pinned layer, which leads to the perpetual switching of both layers. While the presented mechanism is not claimed to be the only possible reason for back-hopping, we show that it is a fundamental effect that will occur in any spin-transfer-torque device when exceeding a critical current. The influence of different material parameters on the critical switching currents for the free and pinned layer is obtained by micromagnetic simulations. The spin-diffusion model enables an accurate description of the torque on both layers, depending on various material parameters. It is found that the choice of a free-layer material with low polarization β and saturation magnetization Ms and a pinned-layer material with high β and Ms leads to a low free-layer critical current and a high pinned-layer critical current and hence reduces the likelihood of back-hopping. While back-hopping has been observed in various types of devices, there are only a few experiments that exhibit this effect in perpendicularly magnetized systems. However, our simulations suggest that the described effect will also gain importance in perpendicular systems due to the loss of pinned-layer anisotropy for decreasing device sizes.

Visualizing Current Flow at the Mesoscale in Disordered Assemblies of Touching Semiconductor Nanocrystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Qinyi; Guest, Jeffrey R.; Thimsen, Elijah

2017-07-12

The transport of electrons through assemblies of nanocrystals is important to performance in optoelectronic applications for these materials. Previous work has primarily focused on single nanocrystals or transitions between pairs of nanocrystals. There is a gap in knowledge of how large numbers of nanocrystals in an assembly behave collectively, and how this collective behavior manifests at the mesoscale. In this work, the variable range hopping (VRH) transport of electrons in disordered assemblies of touching, heavily doped ZnO nanocrystals was visualized at the mesoscale as a function of temperature both theoretically, using the model of Skinner, Chen and Shklovskii (SCS), andmore » experimentally, with conductive atomic force microscopy on ultrathin films only a few particle layers thick. Agreement was obtained between the model and experiments, with a few notable exceptions. The SCS model predicts that a single network within the nanocrystal assembly, comprised of sites connected by small resistances, dominates conduction - namely the optimum band from variable range hopping theory. However, our experiments revealed that in addition to the optimum band, there are subnetworks that appear as additional peaks in the resistance histogram of conductive atomic force microscopy (CAFM) maps. Furthermore, the connections of these subnetworks to the optimum band change in time, such that some subnetworks become connected to the optimum band while others become disconnected and isolated from the optimum band; this observation appears to be an experimental manifestation of the ‘blinking’ phenomenon in our images of mesoscale transport.« less

Charge carrier transport mechanisms in perovskite CdTiO{sub 3} fibers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imran, Z.; Rafiq, M. A., E-mail: aftab@cantab.net; Hasan, M. M.

Electrical transport properties of electrospun cadmium titanate (CdTiO{sub 3}) fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behaviormore » followed by space charge limited current (SCLC) with traps at higher voltages at all temperatures (200 K – 420 K). Trap density in our fibers system is N{sub t} = 6.27 × 10{sup 17} /cm{sup 3}. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH) from 200 K – 300 K. The localized density of states were found to be N(E{sub F}) = 5.51 × 10{sup 21} eV{sup −1} cm{sup −3} at 2 V. Other VRH parameters such as hopping distance (R{sub hop}) and hopping energy (W{sub hop}) were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO{sub 3} fibers efficient material for capacitive energy storage devices.« less

ac conductivity in Gd doped Pb(Zr0.53Ti0.47)O3 ceramics

NASA Astrophysics Data System (ADS)

Portelles, J.; Almodovar, N. S.; Fuentes, J.; Raymond, O.; Heiras, J.; Siqueiros, J. M.

2008-10-01

This study is focused in the conduction processes taking place in 0.6 wt % Gd doped lead zirconate titanate samples PbZr0.53Ti0.47O3:Gd (PZT53/47:Gd) in the vicinity of the morphotropic phase boundary. Doped samples show very large dielectric permittivity with respect to that of undoped ones near the transition temperature. The frequency dependent ac conductivity of PZT53/47:Gd ceramics was studied in the 30-450 °C temperature range. X-ray diffraction analyses indicate the incorporation of Gd atoms to the structure. The changes in the dielectric properties as functions of temperature of the doped samples are taken as additional evidence of the incorporation of Gd into the crystal structure. Gd acts as donor center promoting extrinsic n-type conduction. The ac conductivity behavior obeys Jonscher universal relation in the 100 Hz-1 MHz frequency range for temperatures between 30 and 300 °C. The measured conductivity values for Gd doped PZT53/47 are higher than those of pure PZT53/47. According to the correlated barrier hopping model, the preponderant conduction mechanism in the frequency-temperature response was recognized as small polarons hopping mechanism.

Dielectric relaxation dynamics and AC conductivity scaling of metal-organic framework (MOF-5) based polymer electrolyte nanocomposites incorporated with ionic liquid

NASA Astrophysics Data System (ADS)

Dutta, Rituraj; Kumar, A.

2017-10-01

Dielectric relaxation dynamics and AC conductivity scaling of a metal-organic framework (MOF-5) based poly (vinylidene fluoride-co-hexafluoropropylene) (PVdf-HFP) incorporated with 1-Butyl-3-methylimidazolium hexafluorophosphate have been studied over a frequency range of 40 Hz-5 MHz and in the temperature range of 300 K-380 K. High values of dielectric permittivity (~{{\\varepsilon }\\prime} ) having strong dispersion are obtained at low frequency because of interfacial polarization. The real part of the dielectric modulus spectra (M‧) shows no prominent peak, whereas the imaginary part (M″) shows certain peaks, with a reduction in relaxation time (τ) that can be attributed to a non-Debye relaxation mechanism. The spectra also depict both concentration- and temperature-independent scaling behavior. The power law dependent variation of AC conductivity follows the jump relaxation model and reveals activated ion hopping over diffusion barriers. The value of the frequency exponent is observed to decrease with increasing concentration of ionic liquid, indicating the forward hopping of ions in the relaxation process. The AC conductivity scaling curves at different temperatures also depict the temperature-independent relaxation dynamics.

A 10-Year Prospective Trial of a Patient Management Algorithm and Screening Examination for Highly Active Individuals with ACL Injury. Part II: Determinants of Dynamic Knee Stability

PubMed Central

Hurd, Wendy J.; Axe, Michael J.; Snyder-Mackler, Lynn

2010-01-01

Objectives To clarify the determinants of dynamic knee stability early after anterior cruciate ligament (ACL) injury. Materials and Methods 345 consecutive patients who were regular participants in IKDC level I/II sports before injury and had an acute isolated ACL injury from the practice of a single orthopaedic surgeon underwent a screening examination including clinical measures, knee laxity, quadriceps strength, hop testing, and patient self-reported knee function an average of 6 weeks after injury when impairments were resolved. Independent t-tests were performed to evaluate differences in quadriceps strength and anterior knee laxity between potential copers and noncopers. Hierarchical regression was performed to determine the influence of quadriceps strength, pre-injury activity level, and anterior knee laxity on hop test performance, as well as the influence of timed hop, cross-over hop, quadriceps strength, pre-injury activity level, and anterior knee laxity on self-assessed global function. Results Neither anterior knee laxity nor quadriceps strength differed between potential copers and non-copers. Quadriceps strength influenced hop test performance more significantly than pre-injury activity level or anterior knee laxity, but the variance accounted for by quadriceps strength was low (Range: 4-8%). Timed hop performance was the only variable that impacted self-assessed global function. Conclusions Traditional surgical decision making based on passive anterior knee laxity and pre-injury activity level is not supported by the results, as neither are good predictors of dynamic knee stability. Clinical tests that capture neuromuscular adaptations, including the timed hop test, may be useful in predicting function and guiding individualized patient management after ACL injury. PMID:17932399

Go with your gut: Digestibility and digestive function of two arid-zone Australian murids, Pseudomys australis and Notomys alexis.

PubMed

Stannard, Hayley J; Tulk, Melissa L; Bortolazzo, Melissa J; Old, Julie M

2018-06-01

Spinifex hopping-mice (Notomys alexis) and plains mice (Pseudomys australis) are able to successfully occupy arid zones of Australia. We studied the digestive parameters and energy assimilation of captive spinifex hopping-mice and plains mice. The experiment consisted of six diets fed to the animals for periods of 12days per food type. On a dry matter basis, the plains mice consumed between 2.5 and 7.2% and the hopping-mice between 5.8 and 9.3% of their body mass in food per day. The body mass of the spinifex hopping-mice increased significantly on the sunflower seed diet, while body mass did not change significantly for the plains mice on any diet. Apparent digestibility of macronutrients was similar in the hopping-mice and plains mice when maintained on the same diet, however digestibility of total micronutrients differed. Maintenance energy requirements for the plains mice were 529kJkg -0.75 d -1 and spinifex hopping-mice 550kJkg -0.75 d -1 . Spinifex hopping-mice and plains mice are able to exploit a range of food items and efficiently digest macronutrients, to ensure they meet their nutritional needs, an ability they require in the variable arid environment. The information gained in this study increases the paucity of information on Australian native murids, specifically their digestive function and energy requirements, and will aid captive murid management. The study will allow future expansion into field studies, to aid the conservation of wild rodent diets and nutrition of arid zone murids. Copyright © 2018 Elsevier GmbH. All rights reserved.

The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

NASA Astrophysics Data System (ADS)

Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

2014-11-01

Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB2 has a very high bulk glass transition temperature Tg, and we observe no three-state hopping or sequential two-state hopping previously seen on lower Tg glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Duc; Girolami, Gregory S.; Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB{sub 2} glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunnelingmore » spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB{sub 2} has a very high bulk glass transition temperature T{sub g}, and we observe no three-state hopping or sequential two-state hopping previously seen on lower T{sub g} glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses.« less

Metabolite profiling of flavonols and in vitro antioxidant activity of young shoots of wild Humulus lupulus L. (hop).

PubMed

Maietti, Annalisa; Brighenti, Virginia; Bonetti, Gianpiero; Tedeschi, Paola; Prencipe, Francesco Pio; Benvenuti, Stefania; Brandolini, Vincenzo; Pellati, Federica

2017-08-05

Humulus lupulus L., commonly named hop, is well-known for its sedative and estrogenic activity. While hop cones are widely characterized, only few works have been carried out on the young shoots of this plant. In the light of this, the aim of this study was to identify for the first time the flavonoids present in young hop shoots and to compare the composition of samples harvested from different locations in Northern Italy with their antioxidant activity. The samples were extracted by means of dynamic maceration with methanol. The HPLC-UV/DAD, HPLC-ESI-MS and MS 2 analysis were carried out by using an Ascentis C 18 column (250×4.6mm I.D., 5μm), with a mobile phase composed of 0.1M formic acid in both water and acetonitrile, under gradient elution. Quercetin and kaempferol glycosides were the main compounds identified and quantified in hop shoot extracts. Total flavonols ranged from 2698±185 to 517±48μg/g (fresh weight). The antioxidant activity was determined by means of the radical scavenging activity assay against diphenylpicrylhydrazyl (DPPH) and by using a photochemiluscence assay with a Photochem ® apparatus. The results showed that hop shoots represent a new source of flavonols; therefore, they can be useful for a possible incorporation in the diet as a functional food or applied in the nutraceutical ambit. Copyright © 2017 Elsevier B.V. All rights reserved.

Prediction of infection risk of hop by Pseudoperonspora humuli

USDA-ARS?s Scientific Manuscript database

Downy mildew, caused by Pseudoperonospora humuli, is one of the most destructive diseases of hop. Weather factors associated with infection risk by P. humuli in the maritime region of western Oregon were examined for 24 and 48-h periods and quadratic discriminant function models were developed to c...

Differences between direct current and alternating current capacitance nonlinearities in high-k dielectrics and their relation to hopping conduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khaldi, O.; Kassmi, M.; El Manar University, LMOP, 2092 Tunis

2014-08-28

Capacitance nonlinearities were studied in atomic layer deposited HfO{sub 2} films using two types of signals: a pure ac voltage of large magnitude (ac nonlinearities) and a small ac voltage superimposed to a large dc voltage (dc nonlinearities). In theory, ac and dc nonlinearities should be of the same order of magnitude. However, in practice, ac nonlinearities are found to be an order of magnitude higher than dc nonlinearities. Besides capacitance nonlinearities, hopping conduction is studied using low-frequency impedance measurements and is discussed through the correlated barrier hopping model. The link between hopping and nonlinearity is established. The ac nonlinearitiesmore » are ascribed to the polarization of isolated defect pairs, while dc nonlinearities are attributed to electrode polarization which originates from defect percolation paths. Both the ac and dc capacitance nonlinearities display an exponential variation with voltage, which results from field-induced lowering of the hopping barrier energy.« less

Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

NASA Astrophysics Data System (ADS)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

Hopping locomotion at different gravity: metabolism and mechanics in humans.

PubMed

Pavei, Gaspare; Minetti, Alberto E

2016-05-15

Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.

Phase sensitive molecular dynamics of self-assembly glycolipid thin films: A dielectric spectroscopy investigation

NASA Astrophysics Data System (ADS)

Velayutham, T. S.; Ng, B. K.; Gan, W. C.; Majid, W. H. Abd.; Hashim, R.; Zahid, N. I.; Chaiprapa, Jitrin

2014-08-01

Glycolipid, found commonly in membranes, is also a liquid crystal material which can self-assemble without the presence of a solvent. Here, the dielectric and conductivity properties of three synthetic glycolipid thin films in different thermotropic liquid crystal phases were investigated over a frequency and temperature range of (10-2-106 Hz) and (303-463 K), respectively. The observed relaxation processes distinguish between the different phases (smectic A, columnar/hexagonal, and bicontinuous cubic Q) and the glycolipid molecular structures. Large dielectric responses were observed in the columnar and bicontinuous cubic phases of the longer branched alkyl chain glycolipids. Glycolipids with the shortest branched alkyl chain experience the most restricted self-assembly dynamic process over the broad temperature range studied compared to the longer ones. A high frequency dielectric absorption (Process I) was observed in all samples. This is related to the dynamics of the hydrogen bond network from the sugar group. An additional low-frequency mechanism (Process II) with a large dielectric strength was observed due to the internal dynamics of the self-assembly organization. Phase sensitive domain heterogeneity in the bicontinuous cubic phase was related to the diffusion of charge carriers. The microscopic features of charge hopping were modelled using the random walk scheme, and two charge carrier hopping lengths were estimated for two glycolipid systems. For Process I, the hopping length is comparable to the hydrogen bond and is related to the dynamics of the hydrogen bond network. Additionally, that for Process II is comparable to the bilayer spacing, hence confirming that this low-frequency mechanism is associated with the internal dynamics within the phase.

Electronic transport in mixed-phase hydrogenated amorphous/nanocrystalline silicon thin films

NASA Astrophysics Data System (ADS)

Wienkes, Lee Raymond

Interest in mixed-phase silicon thin film materials, composed of an amorphous semiconductor matrix in which nanocrystalline inclusions are embedded, stems in part from potential technological applications, including photovoltaic and thin film transistor technologies. Conventional mixed-phase silicon films are produced in a single plasma reactor, where the conditions of the plasma must be precisely tuned, limiting the ability to adjust the film and nanoparticle parameters independently. The films presented in this thesis are deposited using a novel dual-plasma co-deposition approach in which the nanoparticles are produced separately in an upstream reactor and then injected into a secondary reactor where an amorphous silicon film is being grown. The degree of crystallinity and grain sizes of the films are evaluated using Raman spectroscopy and X-ray diffraction respectively. I describe detailed electronic measurements which reveal three distinct conduction mechanisms in n-type doped mixed-phase amorphous/nanocrystalline silicon thin films over a range of nanocrystallite concentrations and temperatures, covering the transition from fully amorphous to ~30% nanocrystalline. As the temperature is varied from 470 to 10 K, we observe activated conduction, multiphonon hopping (MPH) and Mott variable range hopping (VRH) as the nanocrystal content is increased. The transition from MPH to Mott-VRH hopping around 100K is ascribed to the freeze out of the phonon modes. A conduction model involving the parallel contributions of these three distinct conduction mechanisms is shown to describe both the conductivity and the reduced activation energy data to a high accuracy. Additional support is provided by measurements of thermal equilibration effects and noise spectroscopy, both done above room temperature (>300 K). This thesis provides a clear link between measurement and theory in these complex materials.

Analysis of muscle activity and ankle joint movement during the side-hop test.

PubMed

Yoshida, Masahiro; Taniguchi, Keigo; Katayose, Masaki

2011-08-01

Functional performance tests (FPTs) that consist of movements, such as hopping, landing, and cutting, provide useful measurements. Although some tests have been established for kinematic studies of the knee joint, very few tests have been established for the ankle joint. To use the FPT as a test battery for patients with an ankle sprain, it is necessary to document typical patterns of muscle activation and range of motion (ROM) of the ankle joint during FPTs. Therefore, the purpose of this study was to investigate the pattern of the ROM of the ankle inversion/eversion and the muscle activity of the peroneus longus muscle (PL) and the tibial anterior muscle (TA) in normal subjects during the side-hop test. To emphasize the characteristics of ROM and electromyography (EMG) at each phase, the side-hop tests were divided into 4 phases: lateral-hop contact phase (LC), lateral-hop flight phase (LF), medial hop contact phase (MC), and medial hop flight phase (MF), and the ROM of ankle inversion/eversion, a peak angle of ankle inversion, and Integral EMG (IEMG) of PL and TA compared among 4 phases. Fifteen male subjects with no symptoms of ankle joint problems participated in this research. The ROM of ankle inversion/eversion during the side-hop test was 27 ± 3.8° (mean ± SD), and there was a significant difference in the ROM of ankle inversion/eversion among 4 phases (p < 0.05). The phase in which the widest ROM was presented was the MF. A peak angle of the ankle inversion at MC was significantly greater than at LC and MF (p <0.05). A peak angle of the ankle inversion at LF was significantly greater than at LC and MF. The PL remained contracting with 50-160% of maximal voluntary contraction (MVC). The IEMGs of PL in both the contact phases were significantly greater than in both the flight phases (p < 0.05). In addition, the PL activity at LC was significantly greater than at MC. The TA remained contracting at 50-80% of MVC through the side-hop test. The IEMG of TA at both the contact phases was significantly greater than at 2 flight phases. However, there was no significant difference between LC and MF. Results of this study could be useful as basic data when evaluating the validity of the side-hop test for patients with ankle sprain.

Reliability and validity of functional performance tests in dancers with hip dysfunction.

PubMed

Kivlan, Benjamin R; Carcia, Christopher R; Clemente, F Richard; Phelps, Amy L; Martin, Robroy L

2013-08-01

Quasi-experimental, repeated measures. Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. NINETEEN FEMALE DANCERS (AGE: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = -4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = -0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = -0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = -1.84, p=0.08) were not statistically different between sides. The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. 3b. Non-consecutive cohort study.

RELIABILITY AND VALIDITY OF FUNCTIONAL PERFORMANCE TESTS IN DANCERS WITH HIP DYSFUNCTION

PubMed Central

Carcia, Christopher R.; Clemente, F. Richard; Phelps, Amy L.; Martin, RobRoy L.

2013-01-01

Study Design: Quasi-experimental, repeated measures. Purpose/Background: Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. Methods: Nineteen female dancers (age: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Results: Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = −4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = −0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = −0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = −1.84, p=0.08) were not statistically different between sides. Conclusion: The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. Level of Evidence: 3b. Non-consecutive cohort study PMID:24175123

A spherical electron cloud hopping model for studying product branching ratios of dissociative recombination.

PubMed

Yu, Hua-Gen

2008-05-21

A spherical electron cloud hopping (SECH) model is proposed to study the product branching ratios of dissociative recombination (DR) of polyatomic systems. In this model, the fast electron-captured process is treated as an instantaneous hopping of a cloud of uniform spherical fractional point charges onto a target M+q ion (or molecule). The sum of point charges (-1) simulates the incident electron. The sphere radius is determined by a critical distance (Rc eM) between the incoming electron (e-) and the target, at which the potential energy of the e(-)-M+q system is equal to that of the electron-captured molecule M+q(-1) in a symmetry-allowed electronic state with the same structure as M(+q). During the hopping procedure, the excess energies of electron association reaction are dispersed in the kinetic energies of M+q(-1) atoms to conserve total energy. The kinetic energies are adjusted by linearly adding atomic momenta in the direction of driving forces induced by the scattering electron. The nuclear dynamics of the resultant M+q(-1) molecule are studied by using a direct ab initio dynamics method on the adiabatic potential energy surface of M+q(-1), or together with extra adiabatic surface(s) of M+q(-1). For the latter case, the "fewest switches" surface hopping algorithm of Tully was adapted to deal with the nonadiabaticity in trajectory propagations. The SECH model has been applied to study the DR of both CH+ and H3O+(H2O)2. The theoretical results are consistent with the experiment. It was found that water molecules play an important role in determining the product branching ratios of the molecular cluster ion.

Nanocontact Disorder in Nanoelectronics for Modulation of Light and Gas Sensitivities.

PubMed

Lin, Yen-Fu; Chang, Chia-Hung; Hung, Tsu-Chang; Jian, Wen-Bin; Tsukagoshi, Kazuhito; Wu, Yue-Han; Chang, Li; Liu, Zhaoping; Fang, Jiye

2015-08-11

To fabricate reliable nanoelectronics, whether by top-down or bottom-up processes, it is necessary to study the electrical properties of nanocontacts. The effect of nanocontact disorder on device properties has been discussed but not quantitatively studied. Here, by carefully analyzing the temperature dependence of device electrical characteristics and by inspecting them with a microscope, we investigated the Schottky contact and Mott's variable-range-hopping resistances connected in parallel in the nanocontact. To interpret these parallel resistances, we proposed a model of Ti/TiOx in the interface between the metal electrodes and nanowires. The hopping resistance as well as the nanocontact disorder dominated the total device resistance for high-resistance devices, especially at low temperatures. Furthermore, we introduced nanocontact disorder to modulate the light and gas responsivities of the device; unexpectedly, it multiplied the sensitivities compared with the intrinsic sensitivity of the nanowires. Our results improve the collective understanding of electrical contacts to low-dimensional semiconductor devices and will aid performance optimization in future nanoelectronics.

Nanocontact Disorder in Nanoelectronics for Modulation of Light and Gas Sensitivities

PubMed Central

Lin, Yen-Fu; Chang, Chia-Hung; Hung, Tsu-Chang; Jian, Wen-Bin; Tsukagoshi, Kazuhito; Wu, Yue-Han; Chang, Li; Liu, Zhaoping; Fang, Jiye

2015-01-01

To fabricate reliable nanoelectronics, whether by top-down or bottom-up processes, it is necessary to study the electrical properties of nanocontacts. The effect of nanocontact disorder on device properties has been discussed but not quantitatively studied. Here, by carefully analyzing the temperature dependence of device electrical characteristics and by inspecting them with a microscope, we investigated the Schottky contact and Mott’s variable-range-hopping resistances connected in parallel in the nanocontact. To interpret these parallel resistances, we proposed a model of Ti/TiOx in the interface between the metal electrodes and nanowires. The hopping resistance as well as the nanocontact disorder dominated the total device resistance for high-resistance devices, especially at low temperatures. Furthermore, we introduced nanocontact disorder to modulate the light and gas responsivities of the device; unexpectedly, it multiplied the sensitivities compared with the intrinsic sensitivity of the nanowires. Our results improve the collective understanding of electrical contacts to low-dimensional semiconductor devices and will aid performance optimization in future nanoelectronics. PMID:26260674

Lateral hopping of CO on Cu(111) induced by femtosecond laser pulses

NASA Astrophysics Data System (ADS)

Ueba, H.; Ootsuka, Y.; Paulsson, M.; Persson, B. N. J.

2010-09-01

We present a theoretical study of the lateral hopping of a single CO molecule on Cu(111) induced by femtosecond laser pulses by Mehlhorn [Phys. Rev. Lett. 104, 076101 (2010)]10.1103/PhysRevLett.104.076101. Our model assumes an intermode coupling between the CO frustrated translation (FT) and frustrated rotation (FR) modes with a weak and strong electronic friction coupling to hot electrons, respectively, and heat transfer between the FT mode and the substrate phonons. In this model the effective electronic friction coupling of the FT mode depends on the absorbed laser fluence F through the temperature of the FR mode. The calculated hopping yield as a function of F nicely reproduces the nonlinear increase observed above F=4.0J/m2 . It is found that the electronic heating via friction coupling nor the phonon coupling alone cannot explain the experimental result. Both heatings are cooperatively responsible for CO hopping on Cu(111). The electronic heat transfer dominates over the phononic one at high F , where the effective electronic friction coupling becomes larger than the phononic coupling.

Mechanics of inter-modal tunneling in nonlinear waveguides

NASA Astrophysics Data System (ADS)

Jiao, Weijian; Gonella, Stefano

2018-02-01

In this article, we investigate the mechanics of nonlinearly induced inter-modal energy tunneling between flexurally-dominated and axially-dominated modes in phononic waveguides. Special attention is devoted to elucidating the role played by the coupling between axial and flexural degrees of freedom in the determination of the available mode hopping conditions and the associated mechanisms of deformation. Waveguides offer an ideal test bed to investigate the mechanics of nonlinear energy tunneling, due to the fact that they naturally feature, even at low frequencies, families of modes (flexural and axial) that are intrinsically characterized by extreme complementarity. Moreover, thanks to their geometric simplicity, their behavior can be explained by resorting to intuitive structural mechanics models that effectively capture the dichotomy and interplay between flexural and axial mechanisms. After having delineated the fundamental mechanics of flexural-to-axial hopping using the benchmark example of a homogeneous structure, we adapt the analysis to the case of periodic waveguides, in which the complex dispersive behavior due to periodicity results in additional richness of mode hopping mechanisms. We finally extend the analysis to periodic waveguides with internal resonators, in which the availability of locally-resonant bandgaps implies the possibility to activate the resonators even at relatively low frequencies, thus increasing the degree of modal complementarity that is available in the acoustic range. In this context, inter-modal tunneling provides an unprecedented mechanism to transfer conspicuous packets of energy to the resonating microstructure.

Running springs: speed and animal size.

PubMed

Farley, C T; Glasheen, J; McMahon, T A

1993-12-01

Trotting and hopping animals use muscles, tendons and ligaments to store and return elastic energy as they bounce along the ground. We examine how the musculoskeletal spring system operates at different speeds and in animals of different sizes. We model trotting and hopping as a simple spring-mass system which consists of a leg spring and a mass. We find that the stiffness of the leg spring (k(leg)) is nearly independent of speed in dogs, goats, horses and red kangaroos. As these animals trot or hop faster, the leg spring sweeps a greater angle during the stance phase, and the vertical excursion of the center of mass during the ground contact phase decreases. The combination of these changes to the spring system causes animals to bounce off the ground more quickly at higher speeds. Analysis of a wide size range of animals (0.1-140 kg) at equivalent speeds reveals that larger animals have stiffer leg springs (k(leg) [symbol: see text] M0.67, where M is body mass), but that the angle swept by the leg spring is nearly independent of body mass. As a result, the resonant period of vertical vibration of the spring-mass system is longer in larger animals. The length of time that the feet are in contact with the ground increases with body mass in nearly the same way as the resonant period of vertical vibration.

Realizing one-dimensional quantum and high-frequency transport features in aligned single-walled carbon nanotube ropes

NASA Astrophysics Data System (ADS)

Ncube, Siphephile; Chimowa, George; Chiguvare, Zivayi; Bhattacharyya, Somnath

2014-07-01

The superiority of the electronic transport properties of single-walled carbon nanotube (SWNT) ropes over SWNT mats is verified from low temperature and frequency-dependent transport. The overall change of resistance versus in nanotube mats shows that 3D variable range hopping is the dominant conduction mechanism within the 2-300 K range. The magneto-resistance (MR) is found to be predominantly negative with a parabolic nature, which can also be described by the hopping model. Although the positive upturn of the MR at low temperatures establishes the contribution from quantum interference, the inherent quantum transport in individual tubes is suppressed at elevated temperatures. Therefore, to minimize multi-channel effects from inter-tube interactions and other defects, two-terminal devices were fabricated from aligned SWNT (extracted from a mat) for low temperature transport as well as high-frequency measurements. In contrast to the mat, the aligned ropes exhibit step-like features in the differential conductance within the 80-300 K temperature range. The effects of plasmon propagation, unique to one dimension, were identified in electronic transport as a non-universal power-law dependence of the differential conductance on temperature and source-drain voltage. The complex impedance showed high power transmission capabilities up to 65 GHz as well as oscillations in the frequency range up to 30 GHz. The measurements suggest that aligned SWNT ropes have a realistic potential for high-speed device applications.

Efficient DV-HOP Localization for Wireless Cyber-Physical Social Sensing System: A Correntropy-Based Neural Network Learning Scheme

PubMed Central

Xu, Yang; Luo, Xiong; Wang, Weiping; Zhao, Wenbing

2017-01-01

Integrating wireless sensor network (WSN) into the emerging computing paradigm, e.g., cyber-physical social sensing (CPSS), has witnessed a growing interest, and WSN can serve as a social network while receiving more attention from the social computing research field. Then, the localization of sensor nodes has become an essential requirement for many applications over WSN. Meanwhile, the localization information of unknown nodes has strongly affected the performance of WSN. The received signal strength indication (RSSI) as a typical range-based algorithm for positioning sensor nodes in WSN could achieve accurate location with hardware saving, but is sensitive to environmental noises. Moreover, the original distance vector hop (DV-HOP) as an important range-free localization algorithm is simple, inexpensive and not related to the environment factors, but performs poorly when lacking anchor nodes. Motivated by these, various improved DV-HOP schemes with RSSI have been introduced, and we present a new neural network (NN)-based node localization scheme, named RHOP-ELM-RCC, through the use of DV-HOP, RSSI and a regularized correntropy criterion (RCC)-based extreme learning machine (ELM) algorithm (ELM-RCC). Firstly, the proposed scheme employs both RSSI and DV-HOP to evaluate the distances between nodes to enhance the accuracy of distance estimation at a reasonable cost. Then, with the help of ELM featured with a fast learning speed with a good generalization performance and minimal human intervention, a single hidden layer feedforward network (SLFN) on the basis of ELM-RCC is used to implement the optimization task for obtaining the location of unknown nodes. Since the RSSI may be influenced by the environmental noises and may bring estimation error, the RCC instead of the mean square error (MSE) estimation, which is sensitive to noises, is exploited in ELM. Hence, it may make the estimation more robust against outliers. Additionally, the least square estimation (LSE) in ELM is replaced by the half-quadratic optimization technique. Simulation results show that our proposed scheme outperforms other traditional localization schemes. PMID:28085084

Long-Term Oral Administration of Hop Flower Extracts Mitigates Alzheimer Phenotypes in Mice

PubMed Central

Sasaoka, Norio; Sakamoto, Megumi; Kanemori, Shoko; Kan, Michiru; Tsukano, Chihiro; Takemoto, Yoshiji; Kakizuka, Akira

2014-01-01

Coincident with the expanding population of aged people, the incidence of Alzheimer disease (AD) is rapidly increasing in most advanced countries. At present, no effective prophylactics are available. Among several pathological mechanisms proposed for AD, the “amyloid hypothesis” has been most widely accepted, in which accumulation or deposition of Aβ is considered to be the initial event. Thus, prevention of Aβ production would be an ideal strategy for the treatment or prevention of AD. Aβ is produced via the proteolytic cleavage of its precursor protein, APP (amyloid precursor protein), by two different enzymes, β and γ-secretases. Indeed, inhibitors against either or both enzymes have been developed and tested for clinical efficacy. Based on the “amyloid hypothesis”, we developed a luciferase-based screening method to monitor γ-secretase activity, screened more than 1,600 plant extracts, most of which have long been used in Chinese medicine, and observed that Hop extracts significantly inhibit Aβ production in cultured cells. A major component of the inhibitory activity was purified, and its chemical identity was determined by NMR to be Garcinielliptone HC. In vivo, oral administration of Hop extracts to AD model mice decreased Aβ depositions in the cerebral cortex of the parietal lobe, hippocampus, and artery walls (amyloid angiopathy) in the brains. In a Morris water maze test, AD model mice that had daily consumed Hop extracts in their drinking water showed significant mitigation of memory impairment at ages of 9 and 12 months. Moreover, in the open field test oral administration of Hop extracts also prevented an emotional disturbance that appeared in the AD mice at 18 months. Despite lifelong consumption of Hop extracts, no deleterious side effects were observed at any age. These results support the “amyloid hypothesis”, and indicate that Hop extract is a promising candidate for an effective prophylactic for AD. PMID:24489866

Performance analysis of MISO multi-hop FSO links over log-normal channels with fog and beam divergence attenuations

NASA Astrophysics Data System (ADS)

Abaza, Mohamed; Mesleh, Raed; Mansour, Ali; Aggoune, el-Hadi

2015-01-01

The performance analysis of a multi-hop decode and forward relaying free-space optical (FSO) communication system is presented in this paper. The considered FSO system uses intensity modulation and direct detection as means of transmission and reception. Atmospheric turbulence impacts are modeled as a log-normal channel, and different weather attenuation effects and geometric losses are taken into account. It is shown that multi-hop is an efficient technique to mitigate such effects in FSO communication systems. A comparison with direct link and multiple-input single-output (MISO) systems considering correlation effects at the transmitter is provided. Results show that MISO multi-hop FSO systems are superior than their counterparts over links exhibiting high attenuation. Monte Carlo simulation results are provided to validate the bit error rate (BER) analyses and conclusions.

Electronic transport mechanism in intrinsic and doped nanocrystalline silicon films deposited by RF-magnetron sputtering at low temperature

NASA Astrophysics Data System (ADS)

Benlakehal, D.; Belfedal, A.; Bouizem, Y.; Sib, J. D.; Chahed, L.; Zellama, K.

2016-12-01

The dependence on the temperature range, T, of the electronic transport mechanism in intrinsic and doped hydrogenated nanocrystalline silicon films, deposited by radiofrequency-magnetron sputtering at low substrate temperature, has been studied. Electrical conductivity measurements σ(T) have been conducted on these films, as a function of temperature, in the 93-450 K range. The analysis of these results clearly shows a thermally activated conduction process in the 273-450 K range which allows us to estimate the associated activation energy as well as the preexponential conductivity factor. While, in the lower temperature range (T < 273 K), a non-ohmic behavior is observed for the conductivity changes. The conductivity σ(T) presents a linear dependence on (T-1/4) , and a hopping mechanism is suggested to explain these results. By using the Percolation theory, further information can be gained about the density of states near the Fermi level as well as the range and the hopping energy.

A new surface-potential-based compact model for the MoS2 field effect transistors in active matrix display applications

NASA Astrophysics Data System (ADS)

Cao, Jingchen; Peng, Songang; Liu, Wei; Wu, Quantan; Li, Ling; Geng, Di; Yang, Guanhua; Ji, Zhouyu; Lu, Nianduan; Liu, Ming

2018-02-01

We present a continuous surface-potential-based compact model for molybdenum disulfide (MoS2) field effect transistors based on the multiple trapping release theory and the variable-range hopping theory. We also built contact resistance and velocity saturation models based on the analytical surface potential. This model is verified with experimental data and is able to accurately predict the temperature dependent behavior of the MoS2 field effect transistor. Our compact model is coded in Verilog-A, which can be implemented in a computer-aided design environment. Finally, we carried out an active matrix display simulation, which suggested that the proposed model can be successfully applied to circuit design.

Impact of reduced scale free network on wireless sensor network

NASA Astrophysics Data System (ADS)

Keshri, Neha; Gupta, Anurag; Mishra, Bimal Kumar

2016-12-01

In heterogeneous wireless sensor network (WSN) each data-packet traverses through multiple hops over restricted communication range before it reaches the sink. The amount of energy required to transmit a data-packet is directly proportional to the number of hops. To balance the energy costs across the entire network and to enhance the robustness in order to improve the lifetime of WSN becomes a key issue of researchers. Due to high dimensionality of an epidemic model of WSN over a general scale free network, it is quite difficult to have close study of network dynamics. To overcome this complexity, we simplify a general scale free network by partitioning all of its motes into two classes: higher-degree motes and lower-degree motes, and equating the degrees of all higher-degree motes with lower-degree motes, yielding a reduced scale free network. We develop an epidemic model of WSN based on reduced scale free network. The existence of unique positive equilibrium is determined with some restrictions. Stability of the system is proved. Furthermore, simulation results show improvements made in this paper have made the entire network have a better robustness to the network failure and the balanced energy costs. This reduced model based on scale free network theory proves more applicable to the research of WSN.

Structural studies on the co-chaperone Hop and its complexes with Hsp90.

PubMed

Onuoha, S C; Coulstock, E T; Grossmann, J G; Jackson, S E

2008-06-13

The tetratricopeptide repeat domain (TPR)-containing co-chaperone Hsp-organising protein (Hop) plays a critical role in mediating interactions between Heat Shock Protein (Hsp)70 and Hsp90 as part of the cellular assembly machine. It also modulates the ATPase activity of both Hsp70 and Hsp90, thus facilitating client protein transfer between the two. Despite structural work on the individual domains of Hop, no structure for the full-length protein exists, nor is it clear exactly how Hop interacts with Hsp90, although it is known that its primary binding site is the C-terminal MEEVD motif. Here, we have undertaken a biophysical analysis of the structure and binding of Hop to Hsp90 using a variety of truncation mutants of both Hop and Hsp90, in addition to mutants of Hsp90 that are thought to modulate the conformation, in particular the N-terminal dimerisation of the chaperone. The results establish that whilst the primary binding site of Hop is the C-terminal MEEVD peptide of Hsp90, binding also occurs at additional sites in the C-terminal and middle domain. In contrast, we show that another TPR-containing co-chaperone, CyP40, binds solely to the C-terminus of Hsp90. Truncation mutants of Hop were generated and used to investigate the dimerisation interface of the protein. In good agreement with recently published data, we find that the TPR2a domain that contains the Hsp90-binding site is also the primary site for dimerisation. However, our results suggest that residues within the TPR2b may play a role. Together, these data along with shape reconstruction analysis from small-angle X-ray scattering measurements are used to generate a solution structure for full-length Hop, which we show has an overall butterfly-like quaternary structure. Studies on the nucleotide dependence of Hop binding to Hsp90 establish that Hop binds to the nucleotide-free, 'open' state of Hsp90. However, the Hsp90-Hop complex is weakened by the conformational changes that occur in Hsp90 upon ATP binding. Together, the data are used to propose a detailed model of how Hop may help present the client protein to Hsp90 by aligning the bound client on Hsp70 with the middle domain of Hsp90. It is likely that Hop binds to both monomers of Hsp90 in the form of a clamp, interacting with residues in the middle domain of Hsp90, thus preventing ATP hydrolysis, possibly by the prevention of association of N-terminal and middle domains in individual Hsp90 monomers.

The initial stage of uranium oxidation: mechanism of UO(2) scale formation in the presence of a native lateral stress field.

PubMed

Chernia, Z; Ben-Eliyahu, Y; Kimmel, G; Braun, G; Sariel, J

2006-11-23

In this work, an oxidation model for alpha-uranium is presented. It describes the internally lateral stress field built in the oxide scale during the reaction. The thickness of the elastic, stress-preserving oxide (UO(2+x)) scale is less than 0.5 microm. A lateral, 6.5 GPa stress field has been calculated from strains derived from line shifts (delta(2theta)) as measured by the X-ray diffraction of UO(2). It is shown that in the elastic growth domain, (110) is the main UO(2) growth plane for gas-solid oxidation. The diffusion-limited oxidation mechanism discussed here is based on the known "2:2:2" cluster theory which describes the mechanism of fluorite-based hyperstoichiometric oxides. In this study, it is adapted to describe oxygen-anion hopping. Anion hopping toward the oxide-metal interface proceeds at high rates in the [110] direction, hence making this pipeline route the principal growth direction in UO(2) formation. It is further argued that growth in the pure elastic domain of the oxide scale should be attributed entirely to anion hopping in 110. Anions, diffusing isotropically via grain boundaries and cracks, are shown to have a significant impact on the overall oxidation rate in relatively thick (>0.35 microm) oxide scales if followed by an avalanche break off in the postelastic regime. Stress affects oxidation in the elastic domain by controlling the hopping rate directly. In the postelastic regime, stress weakens hopping, indirectly, by enhancing isotropic diffusion. Surface roughness presents an additional hindering factor for the anion hopping. In comparison to anisotropic hopping, diffusion of isotropic hopping has a lower activation energy barrier. Therefore, a relatively stronger impact at lower temperatures due to isotropic diffusion is displayed.

A Genetic Screen Reveals an Unexpected Role for Yorkie Signaling in JAK/STAT-Dependent Hematopoietic Malignancies in Drosophila melanogaster

PubMed Central

Anderson, Abigail M.; Bailetti, Alessandro A.; Rodkin, Elizabeth; De, Atish; Bach, Erika A.

2017-01-01

A gain-of-function mutation in the tyrosine kinase JAK2 (JAK2V617F) causes human myeloproliferative neoplasms (MPNs). These patients present with high numbers of myeloid lineage cells and have numerous complications. Since current MPN therapies are not curative, there is a need to find new regulators and targets of Janus kinase/Signal transducer and activator of transcription (JAK/STAT) signaling that may represent additional clinical interventions . Drosophila melanogaster offers a low complexity model to study MPNs as JAK/STAT signaling is simplified with only one JAK [Hopscotch (Hop)] and one STAT (Stat92E). hopTumorous-lethal (Tum-l) is a gain-of-function mutation that causes dramatic expansion of myeloid cells, which then form lethal melanotic tumors. Through an F1 deficiency (Df) screen, we identified 11 suppressors and 35 enhancers of melanotic tumors in hopTum-l animals. Dfs that uncover the Hippo (Hpo) pathway genes expanded (ex) and warts (wts) strongly enhanced the hopTum-l tumor burden, as did mutations in ex, wts, and other Hpo pathway genes. Target genes of the Hpo pathway effector Yorkie (Yki) were significantly upregulated in hopTum-l blood cells, indicating that Yki signaling was increased. Ectopic hematopoietic activation of Yki in otherwise wild-type animals increased hemocyte proliferation but did not induce melanotic tumors. However, hematopoietic depletion of Yki significantly reduced the hopTum-l tumor burden, demonstrating that Yki is required for melanotic tumors in this background. These results support a model in which elevated Yki signaling increases the number of hemocytes, which become melanotic tumors as a result of elevated JAK/STAT signaling. PMID:28620086

The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers

NASA Astrophysics Data System (ADS)

Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong

2013-06-01

The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.

Ab initio calculation of diffusion barriers for Cu adatom hopping on Cu(1 0 0) surface and evolution of atomic configurations

NASA Astrophysics Data System (ADS)

Zhang, Wei; Gan, Jie; Li, Qian; Gao, Kun; Sun, Jian; Xu, Ning; Ying, Zhifeng; Wu, Jiada

2011-06-01

The self-diffusion dynamics of Cu adatoms on Cu(1 0 0) surface has been studied based on the calculation of the energy barriers for various hopping events using lattice-gas based approach and a modified model. To simplify the description of the interactions and the calculation of the energy barrier, a three-tier hierarchy of description of atomic configurations was conceived in which the active adatom and its nearest atoms were chosen to constitute basic configuration and taken as a whole to study many-body interactions of the atoms in various atomic configurations, whereas the impacts of the next nearest atoms on the diffusion of the active adatom were considered as multi-site interactions. Besides the simple hopping of single adatoms, the movements of dimers and trimers as the results of multiple hopping events have also been examined. Taking into account the hopping events of all adatoms, the stability of atomic configurations has been examined and the evolution of atomic configurations has also been analyzed.

Slow Relaxation in Anderson Critical Systems

NASA Astrophysics Data System (ADS)

Choi, Soonwon; Yao, Norman; Choi, Joonhee; Kucsko, Georg; Lukin, Mikhail

2016-05-01

We study the single particle dynamics in disordered systems with long range hopping, focusing on the critical cases, i.e., the hopping amplitude decays as 1 /rd in d-dimension. We show that with strong on-site potential disorder, the return probability of the particle decays as power-law in time. As on-site potential disorder decreases, the temporal profile smoothly changes from a simple power-law to the sum of multiple power-laws with exponents ranged from 0 to νmax. We analytically compute the decay exponents using a simple resonance counting argument, which quantitatively agrees with exact numerical results. Our result implies that the dynamics in Anderson Critical systems are dominated by resonances. Harvard-MIT CUA, Kwanjeong Educational Fellowship, AFOSR MURI, Samsung Scholarship.

Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

PubMed

Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

2016-04-06

Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

Electrical conduction mechanism and dielectric characterization of MnTPPCl thin films

NASA Astrophysics Data System (ADS)

Meikhail, M. S.; Oraby, A. H.; El-Nahass, M. M.; Zeyada, H. M.; Al-Muntaser, A. A.

2018-06-01

The AC conductivity and dielectric properties of MnTPPCl sandwich structure as Au/MnTPPCl/Au were studied. The conductivity of the MnTPPCl thin films have been interpreted by the correlated barrier hopping (CBH) model. The dominant conduction process have found to be the single polaron hopping conduction. The values of the hopping distance, Rω, barrier height, W, and the localized-state density, N, are estimated at different frequencies. The behavior of dielectric constant and dielectric loss was discussed as a function of temperature and frequency. The dielectric constant was described in terms of polarization mechanism in materials. The spectral behavior of dielectric loss is interpreted on the basis of the Giuntini et al. model [1]. The value of WM is obtained as 0.32 eV. A non-Debye relaxation phenomenon was observed from the dielectric relaxation mechanism.

An Exactly Soluble Model for Hopping Particles Moving with Correlations Between States due to Exchange Sites

NASA Astrophysics Data System (ADS)

Zhao, Xian-Geng; Jia, Sue-Tang

1992-09-01

The motion of hopping particles on an infinite chain is investigated. The model is characterized by the correlations between states due to exchange sites. The analytic solutions for this system are discussed in general case. For some special cases, exact results are obtained with the help of explicit calculations of propagators and mean square displacement deviation. Both probability propagators for the creation and annihilation of two particles or for the deformation and formation of Frenkel excitons are indicated.

Hopping transport through an array of Luttinger liquid stubs

NASA Astrophysics Data System (ADS)

Chudnovskiy, A. L.

2004-01-01

We consider a thermally activated transport across and array of parallel one-dimensional quantum wires of finite length (quantum stubs). The disorder enters as a random tunneling between the nearest-neighbor stubs as well as a random shift of the bottom of the energy band in each stub. Whereas one-particle wave functions are localized across the array, the plasmons are delocalized, which affects the variable-range hopping. A perturbative analytical expression for the low-temperature resistance across the array is obtained for a particular choice of plasmon dispersion.

Size-scaling behaviour of the electronic polarizability of one-dimensional interacting systems

NASA Astrophysics Data System (ADS)

Chiappe, G.; Louis, E.; Vergés, J. A.

2018-05-01

Electronic polarizability of finite chains is accurately calculated from the total energy variation of the system produced by small but finite static electric fields applied along the chain direction. Normalized polarizability, that is, polarizability divided by chain length, diverges as the second power of length for metallic systems but approaches a constant value for insulating systems. This behaviour provides a very convenient way to characterize the wave-function malleability of finite systems as it avoids the need of attaching infinite contacts to the chain ends. Hubbard model calculations at half filling show that the method works for a small U  =  1 interaction value that corresponds to a really small spectral gap of 0.005 (hopping t  =  ‑1 is assumed). Once successfully checked, the method has been applied to the long-range hopping model of Gebhard and Ruckenstein showing 1/r hopping decay (Gebhard and Ruckenstein 1992 Phys. Rev. Lett. 68 244; Gebhard et al 1994 Phys. Rev. B 49 10926). Metallicity for U values below the reported metal-insulator transition is obtained but the surprise comes for U values larger than the critical one (when a gap appears in the spectral density of states) because a steady increase of the normalized polarizability with size is obtained. This critical size-scaling behaviour can be understood as corresponding to a molecule which polarizability is unbounded. We have checked that a real transfer of charge from one chain end to the opposite occurs as a response to very small electric fields in spite of the existence of a large gap of the order of U for one-particle excitations. Finally, ab initio quantum chemistry calculations of realistic poly-acetylene chains prove that the occurrence of such critical behaviour in real systems is unlikely.

Correlated matrix-fluctuation-mediated activated transport of dilute penetrants in glass-forming liquids and suspensions

NASA Astrophysics Data System (ADS)

Zhang, Rui; Schweizer, Kenneth S.

2017-05-01

We formulate a microscopic, force-level statistical mechanical theory for the activated diffusion of dilute penetrants in dense liquids, colloidal suspensions, and glasses. The approach explicitly and self-consistently accounts for coupling between penetrant hopping and matrix dynamic displacements that actively facilitate the hopping event. The key new ideas involve two mechanistically (at a stochastic trajectory level) coupled dynamic free energy functions for the matrix and spherical penetrant particles. A single dynamic coupling parameter quantifies how much the matrix displaces relative to the penetrant when the latter reaches its transition state which is determined via the enforcement of a temporal causality or coincidence condition. The theory is implemented for dilute penetrants smaller than the matrix particles, with or without penetrant-matrix attractive forces. Model calculations reveal a rich dependence of the penetrant diffusion constant and degree of dynamic coupling on size ratio, volume fraction, and attraction strength. In the absence of attractions, a near exponential decrease of penetrant diffusivity with size ratio over an intermediate range is predicted, in contrast to the much steeper, non-exponential variation if one assumes local matrix dynamical fluctuations are not correlated with penetrant motion. For sticky penetrants, the relative and absolute influence of caging versus physical bond formation is studied. The conditions for a dynamic crossover from the case where a time scale separation between penetrant and matrix activated hopping exists to a "slaved" or "constraint release" fully coupled regime are determined. The particle mixture model is mapped to treat experimental thermal systems and applied to make predictions for the diffusivity of water, toluene, methanol, and oxygen in polyvinylacetate liquids and glasses. The theory agrees well with experiment with values of the penetrant-matrix size ratio close to their chemically intuitive values.

Improving dementia health literacy using the FLOW mnemonic: pilot findings from the Old SCHOOL hip-hop program.

PubMed

Noble, James M; Hedmann, Monique G; Williams, Olajide

2015-02-01

Dementia health literacy is low among the public and likely poses a significant barrier to Alzheimer's disease (AD) symptom recognition and treatment, particularly among minority populations already facing higher AD burden. We evaluated the pilot phase of a novel AD health education program, Old SCHOOL (Seniors Can Have Optimal Aging and Ongoing Longevity) Hip-Hop (OSHH), which is designed to enable children to be AD health educational conduits in the home ("child-mediated health communication"). OSHH applied our stroke-validated model of engaging, dynamic, and age- and culturally appropriate curriculum delivered to elementary school-age children (fourth/fifth grades, ages 9-11 years). We assessed AD knowledge among the children at baseline, immediately following the intervention (1-hour program delivered daily over 3 consecutive days), and 3 months later. For key AD symptoms, we developed the FLOW mnemonic (forget, lose, overlook, write/wander); students were additionally taught action plans for recognized symptoms. Seventy-five students completed baseline assessments, and 68 completed posttesting. AD symptoms in FLOW were not well known at baseline (individually ranging from 16% to 71% correct) but were highly learned after 3 days (89% to 98% correct) and retained well after 3 months (80% to 95% correct, p ≤ .01 for all comparisons vs. baseline). AD localization, including its effect on memory and the hippocampus, was also highly learned and retained (p < .001). Eighteen students (24%) reported having a close friend/family member with AD. This study suggests our hip-hop health education model may be an effective method to improve AD health literacy. © 2014 Society for Public Health Education.

Correlated matrix-fluctuation-mediated activated transport of dilute penetrants in glass-forming liquids and suspensions

PubMed Central

Schweizer, Kenneth S.

2017-01-01

We formulate a microscopic, force-level statistical mechanical theory for the activated diffusion of dilute penetrants in dense liquids, colloidal suspensions, and glasses. The approach explicitly and self-consistently accounts for coupling between penetrant hopping and matrix dynamic displacements that actively facilitate the hopping event. The key new ideas involve two mechanistically (at a stochastic trajectory level) coupled dynamic free energy functions for the matrix and spherical penetrant particles. A single dynamic coupling parameter quantifies how much the matrix displaces relative to the penetrant when the latter reaches its transition state which is determined via the enforcement of a temporal causality or coincidence condition. The theory is implemented for dilute penetrants smaller than the matrix particles, with or without penetrant-matrix attractive forces. Model calculations reveal a rich dependence of the penetrant diffusion constant and degree of dynamic coupling on size ratio, volume fraction, and attraction strength. In the absence of attractions, a near exponential decrease of penetrant diffusivity with size ratio over an intermediate range is predicted, in contrast to the much steeper, non-exponential variation if one assumes local matrix dynamical fluctuations are not correlated with penetrant motion. For sticky penetrants, the relative and absolute influence of caging versus physical bond formation is studied. The conditions for a dynamic crossover from the case where a time scale separation between penetrant and matrix activated hopping exists to a “slaved” or “constraint release” fully coupled regime are determined. The particle mixture model is mapped to treat experimental thermal systems and applied to make predictions for the diffusivity of water, toluene, methanol, and oxygen in polyvinylacetate liquids and glasses. The theory agrees well with experiment with values of the penetrant-matrix size ratio close to their chemically intuitive values. PMID:28527449

Subunit Organisation of In Vitro Reconstituted HOPS and CORVET Multisubunit Membrane Tethering Complexes

PubMed Central

Guo, Zhong; Johnston, Wayne; Kovtun, Oleksiy; Mureev, Sergey; Bröcker, Cornelia; Ungermann, Christian; Alexandrov, Kirill

2013-01-01

Biochemical and structural analysis of macromolecular protein assemblies remains challenging due to technical difficulties in recombinant expression, engineering and reconstitution of multisubunit complexes. Here we use a recently developed cell-free protein expression system based on the protozoan Leishmania tarentolae to produce in vitro all six subunits of the 600 kDa HOPS and CORVET membrane tethering complexes. We demonstrate that both subcomplexes and the entire HOPS complex can be reconstituted in vitro resulting in a comprehensive subunit interaction map. To our knowledge this is the largest eukaryotic protein complex in vitro reconstituted to date. Using the truncation and interaction analysis, we demonstrate that the complex is assembled through short hydrophobic sequences located in the C-terminus of the individual Vps subunits. Based on this data we propose a model of the HOPS and CORVET complex assembly that reconciles the available biochemical and structural data. PMID:24312556

Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems

NASA Astrophysics Data System (ADS)

Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen

2002-09-01

Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.

Experiments in balance with a 2D one-legged hopping machine

NASA Astrophysics Data System (ADS)

Raibert, M. H.; Brown, H. B., Jr.

1984-03-01

The ability to balance is important to the mobility obtained by legged creatures found in nature, and may someday lead to versatile legged vehicles. In order to study the role of balance in legged locomotion and to develop appropriate control strategies, a 2D hopping machine was constructed for experimentation. The machine has one leg on which it hops and runs, making balance a prime consideration. Control of the machine's locomotion was decomposed into three separate parts: a vertical height control part, a horizontal velocity part, and an angular attitude control part. Experiments showed that the three part control scheme, while very simple to implement, was powerful enough to permit the machine to hop in place, to run at a desired rate, to translate from place to place, and to leap over obstacles. Results from modeling and computer simulation of a similar one-legged device are described by Raibert (1983).

Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).

PubMed

Stannard, Hayley J; Tulk, Melissa L; Old, Julie M

2017-03-01

Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine procedures, close montoring and quick action in response to signs of illness will ensure Tyzzer's disease outbreaks do not occur. Copyright © 2017 Elsevier B.V. All rights reserved.

Colossal permittivity and the polarization mechanism of (Mg, Mn) co-doped LaGaO3 ceramics

NASA Astrophysics Data System (ADS)

Luo, Tingting; Liu, Zhifu; Zhang, Faqiang; Li, Yongxiang

2018-03-01

Mg and Mn co-doped LaGa0.7-xMgxMn0.3O3 (x = 0, 0.05, 0.10, 0.15) ceramics were prepared by a solid-state reaction method. The electrical properties of the LaGa0.7-xMgxMn0.3O3 ceramics were studied in detail by dielectric spectra, impedance spectra, and I-V characteristic analysis. Colossal permittivity up to 104 could be obtained across the frequency range up to 104 Hz. The impedance analysis of the co-doped LaGaO3 ceramics indicated that the Mott's variable range hopping (VRH) polarization should be the main origin of colossal permittivity. Mg and Mn co-doping suppressed the formation of Mn3+ and enhanced the VRH polarization, resulting in increased permittivity. Partial localization of electrons by Mg reduced the long-range electron hopping and led to the decrease in dielectric loss.

Two band model for the cuprates

NASA Astrophysics Data System (ADS)

Liu, Shiu; White, Steven

2009-03-01

We use a numerical canonical transformation approach to derive an effective two-band model for the hole-doped cuprates, which keeps both oxygen and copper orbitals but removes double occupancy from each. A similar model was considered previously by Frenkel, Gooding, Shraiman, and Siggia (PRB 41, number 1, page 350). We compare the numerically derived model with previously obtained analytical results. In addition to the usual hopping terms between oxygens tpp and Cu-Cu exchange terms Jdd, the model also includes a strong copper-oxygen exchange interaction Jpd and a Kondo-like spin-flip oxygen-oxygen hopping term Kpdp. We use the density matrix renormalization group to study the charge, spin, and pairing properties of the derived model on ladder systems.

A comparison of optimisation methods and knee joint degrees of freedom on muscle force predictions during single-leg hop landings.

PubMed

Mokhtarzadeh, Hossein; Perraton, Luke; Fok, Laurence; Muñoz, Mario A; Clark, Ross; Pivonka, Peter; Bryant, Adam L

2014-09-22

The aim of this paper was to compare the effect of different optimisation methods and different knee joint degrees of freedom (DOF) on muscle force predictions during a single legged hop. Nineteen subjects performed single-legged hopping manoeuvres and subject-specific musculoskeletal models were developed to predict muscle forces during the movement. Muscle forces were predicted using static optimisation (SO) and computed muscle control (CMC) methods using either 1 or 3 DOF knee joint models. All sagittal and transverse plane joint angles calculated using inverse kinematics or CMC in a 1 DOF or 3 DOF knee were well-matched (RMS error<3°). Biarticular muscles (hamstrings, rectus femoris and gastrocnemius) showed more differences in muscle force profiles when comparing between the different muscle prediction approaches where these muscles showed larger time delays for many of the comparisons. The muscle force magnitudes of vasti, gluteus maximus and gluteus medius were not greatly influenced by the choice of muscle force prediction method with low normalised root mean squared errors (<48%) observed in most comparisons. We conclude that SO and CMC can be used to predict lower-limb muscle co-contraction during hopping movements. However, care must be taken in interpreting the magnitude of force predicted in the biarticular muscles and the soleus, especially when using a 1 DOF knee. Despite this limitation, given that SO is a more robust and computationally efficient method for predicting muscle forces than CMC, we suggest that SO can be used in conjunction with musculoskeletal models that have a 1 or 3 DOF knee joint to study the relative differences and the role of muscles during hopping activities in future studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.

2013-12-01

Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.

Optimisation of active suspension control inputs for improved vehicle ride performance

NASA Astrophysics Data System (ADS)

Čorić, Mirko; Deur, Joško; Xu, Li; Tseng, H. Eric; Hrovat, Davor

2016-07-01

A collocation-type control variable optimisation method is used in the paper to analyse to which extent the fully active suspension (FAS) can improve the vehicle ride comfort while preserving the wheel holding ability. The method is first applied for a cosine-shaped bump road disturbance of different heights, and for both quarter-car and full 10 degree-of-freedom vehicle models. A nonlinear anti-wheel hop constraint is considered, and the influence of bump preview time period is analysed. The analysis is then extended to the case of square- or cosine-shaped pothole with different lengths, and the quarter-car model. In this case, the cost function is extended with FAS energy consumption and wheel damage resilience costs. The FAS action is found to be such to provide a wheel hop over the pothole, in order to avoid or minimise the damage at the pothole trailing edge. In the case of long pothole, when the FAS cannot provide the wheel hop, the wheel is travelling over the pothole bottom and then hops over the pothole trailing edge. The numerical optimisation results are accompanied by a simplified algebraic analysis.

Gold Digger or Video Girl: the salience of an emerging hip-hop sexual script.

PubMed

Ross, Jasmine N; Coleman, Nicole M

2011-02-01

Concerns have been expressed in the common discourse and scholarly literature about the negative influence of Hip-Hop on its young listeners' ideas about sex and sexuality. Most of the scholarly literature has focused on the impact of this urban, Black media on young African American girls' sexual self-concept and behaviours. In response to this discourse, Stephens and Phillips (2003) proposed a Hip-Hop sexual scripting model that theorises about specific sexual scripts for young African American women. Their model includes eight different sexual scripts including the Gold Digger script. The present study proposes a ninth emerging script - the Video Girl. Participants were 18 female African American college students, between the ages of 18 and 30 years old from a large urban public university in the Southwest USA. Using q-methodology the present study found support for the existence of a Video Girl script. In addition, the data indicates that this script is distinct but closely related to Stephens and Phillips' Gold Digger script. These findings support their theory by suggesting that Hip-Hop sexual scripts are salient and hold real meaning for this sample.

HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.

PubMed

Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar

2018-05-08

HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.

Human hopping on damped surfaces: strategies for adjusting leg mechanics.

PubMed

Moritz, Chet T; Farley, Claire T

2003-08-22

Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.

Human hopping on damped surfaces: strategies for adjusting leg mechanics.

PubMed Central

Moritz, Chet T; Farley, Claire T

2003-01-01

Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003

Changes in daily pollen concentration based on meteorological data and days after seasonal initiation - a case study for Japanese hop

NASA Astrophysics Data System (ADS)

Choe, H.; Kim, K. R.; Kim, M.; Han, M. J.; Cho, C.; Choi, B. C.

2014-12-01

Pollinosis causes various allergy symptoms such as seasonal rhinitis, asthma, and conjunctivitis (Min, 1991). Japanese hop (Humulus japonicus) is a major allergen in southern Gyonggi-do during the fall seasons (Park, 1998). So that it is needed to forecast the concentration of its pollens.For the germination of Japanese hop, a period of low temperature (<5C) followed by warm (~20C) and humid conditions is needed (Growing and Protecting New Zealand(2010)). The daily concentration of the pollens increases rapidly then decreases a few days afterward. In this study, the changes in daily pollen concentration were analyzed to yield a prediction model.As a result, a regression model was produced to forecast daily pollen concentration. It can be integrated into the daily pollinosis warning system of the Korea Meteorological Administration (KMA) and provide more accurate daily risk information.

Optimisation of phase ratio in the triple jump using computer simulation.

PubMed

Allen, Sam J; King, Mark A; Yeadon, M R Fred

2016-04-01

The triple jump is an athletic event comprising three phases in which the optimal proportion of each phase to the total distance jumped, termed the phase ratio, is unknown. This study used a whole-body torque-driven computer simulation model of all three phases of the triple jump to investigate optimal technique. The technique of the simulation model was optimised by varying torque generator activation parameters using a Genetic Algorithm in order to maximise total jump distance, resulting in a hop-dominated technique (35.7%:30.8%:33.6%) and a distance of 14.05m. Optimisations were then run with penalties forcing the model to adopt hop and jump phases of 33%, 34%, 35%, 36%, and 37% of the optimised distance, resulting in total distances of: 13.79m, 13.87m, 13.95m, 14.05m, and 14.02m; and 14.01m, 14.02m, 13.97m, 13.84m, and 13.67m respectively. These results indicate that in this subject-specific case there is a plateau in optimum technique encompassing balanced and hop-dominated techniques, but that a jump-dominated technique is associated with a decrease in performance. Hop-dominated techniques are associated with higher forces than jump-dominated techniques; therefore optimal phase ratio may be related to a combination of strength and approach velocity. Copyright © 2016 Elsevier B.V. All rights reserved.

Impedance spectroscopy study of 2, 2, 7, 7' -tetra kis-(N,N-di-4-methoxy phenyl amino)-9,9'-spirobifluorene thin films

NASA Astrophysics Data System (ADS)

Rana, Omwati; Agrawal, Kalpana; Rajput, S. S.; Zulfequar, M.; Husain, M.; Kamalasanan, M. N.; Srivastava, Ritu

2016-05-01

The electrical properties of thermally evaporated film of 2,2,7,7'-tetrakis-(N,N-di-4-methoxyphenylamino)-9,9'-spirobifluorene (Spiro MeO TAD) have been investigated for hole only devices as a function of temperatures at frequency range from 1Hz to 1 MHz using Impedance spectroscopy. Cole-Cole plots, at each temperature, show semicircles that can be modeled with a contact resistance and parallel resistance -capacitor(R-C) circuits. Bulk resistance decreases and electrical conductivity increases with increasing temperature which indicate negative temperature coefficient of resistance nature and short range translational type hopping mechanism in Spiro MeO TAD thin films.

Dielectric study of chalcogenide (Se80Te20)94Ge6 glass

NASA Astrophysics Data System (ADS)

Sharma, Neha; Patial, Balbir Singh; Thakur, Nagesh

2018-04-01

In the present study, dielectric characteristics specifically dielectric constant (ɛ'), dielectric loss (ɛ″) and AC conductivity (σAC) have been investigated for chalcogenide (Se80Te20)94Ge6 glass in the frequency range from 1Hz to 1MHz and within the temperature range from 300 K to 380 K. ɛ'(ω) and ɛ″(ω) are found to be frequency and temperature dependent. This behaviour is interpreted on the basis of Guintini's theory of dielectric dispersion. The investigated glass obeys the power law ωs (s<1) and decreases as temperature rises. The obtained results are discussed in terms of the correlation barrier hopping (CBH) model proposed by Elliot.

Multi-Hop Teleportation of an Unknown Qubit State Based on W States

NASA Astrophysics Data System (ADS)

Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

2018-04-01

Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.

Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

PubMed

Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

2017-09-01

The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

Molecular Dynamics Simulation of Salt Diffusion in Polyelectrolyte Assemblies.

PubMed

Zhang, Ran; Duan, Xiaozheng; Ding, Mingming; Shi, Tongfei

2018-06-05

The diffusion of salt ions and charged probe molecules in polyelectrolyte assemblies is often assumed to follow a theoretical hopping model, in which the diffusing ion is hopping between charged sites of chains based on electroneutrality. However, experimental verification of diffusing pathway at such microscales is difficult, and the corresponding molecular mechanisms remain elusive. In this study, we perform all-atom molecular dynamics (MD) simulations of salt diffusion in polyelectrolyte (PE) assembly of poly (sodium 4-styrenesulfonate) (PSS) and poly (diallyldimethylammonium chloride) (PDAC). Besides the ion hopping mode, the diffusing trajectories are found presenting common features of a jump process, i.e., subjecting to PE relaxation, water pockets in the structure open and close, thus the ion can move from one pocket to another. Anomalous subdiffusion of ions and water is observed due to the trapping scenarios in these water pockets. The jump events are much rarer compared with ion hopping but significantly increases salt diffusion with increasing temperature. Our result strongly indicates that salt diffusion in hydrated PDAC/PSS is a combined process of ion hopping and jump motion. This provides new molecular explanation for the coupling of salt motion with chain motion and the nonlinear increase of salt diffusion at glass transition temperature.

Hopping Diffusion of Nanoparticles in Polymer Matrices

PubMed Central

2016-01-01

We propose a hopping mechanism for diffusion of large nonsticky nanoparticles subjected to topological constraints in both unentangled and entangled polymer solids (networks and gels) and entangled polymer liquids (melts and solutions). Probe particles with size larger than the mesh size ax of unentangled polymer networks or tube diameter ae of entangled polymer liquids are trapped by the network or entanglement cells. At long time scales, however, these particles can diffuse by overcoming free energy barrier between neighboring confinement cells. The terminal particle diffusion coefficient dominated by this hopping diffusion is appreciable for particles with size moderately larger than the network mesh size ax or tube diameter ae. Much larger particles in polymer solids will be permanently trapped by local network cells, whereas they can still move in polymer liquids by waiting for entanglement cells to rearrange on the relaxation time scales of these liquids. Hopping diffusion in entangled polymer liquids and networks has a weaker dependence on particle size than that in unentangled networks as entanglements can slide along chains under polymer deformation. The proposed novel hopping model enables understanding the motion of large nanoparticles in polymeric nanocomposites and the transport of nano drug carriers in complex biological gels such as mucus. PMID:25691803

Origins and implications of the ordering of oxygen vacancies and localized electrons on partially reduced CeO 2(111)

DOE PAGES

Sutton, Jonathan E.; Beste, Ariana; Steven H. Overbury

2015-10-12

In this study, we use density functional theory to explain the preferred structure of partially reduced CeO 2(111). Low-energy ordered structures are formed when the vacancies are isolated (maximized intervacancy separation) and the size of the Ce 3+ ions is minimized. Both conditions help minimize disruptions to the lattice around the vacancy. The stability of the ordered structures suggests that isolated vacancies are adequate for modeling more complex (e.g., catalytic) systems. Oxygen diffusion barriers are predicted to be low enough that O diffusion between vacancies is thermodynamically controlled at room temperature. The O-diffusion-reaction energies and barriers are decreased when onemore » Ce f electron hops from a nearest-neighbor Ce cation to a next-nearest-neighbor Ce cation, with a barrier that has been estimated to be slightly less than the barrier to O diffusion in the absence of polaron hopping. In conculsion, this indicates that polaron hopping plays a key role in facilitating the overall O diffusion process, and depending on the relative magnitudes of the polaron hopping and O diffusion barriers, polaron hopping may be the kinetically limiting process.« less

Ionization equilibrium at the transition from valence-band to acceptor-band migration of holes in boron-doped diamond

NASA Astrophysics Data System (ADS)

Poklonski, N. A.; Vyrko, S. A.; Poklonskaya, O. N.; Kovalev, A. I.; Zabrodskii, A. G.

2016-06-01

A quasi-classical model of ionization equilibrium in the p-type diamond between hydrogen-like acceptors (boron atoms which substitute carbon atoms in the crystal lattice) and holes in the valence band (v-band) is proposed. The model is applicable on the insulator side of the insulator-metal concentration phase transition (Mott transition) in p-Dia:B crystals. The densities of the spatial distributions of impurity atoms (acceptors and donors) and of holes in the crystal are considered to be Poissonian, and the fluctuations of their electrostatic potential energy are considered to be Gaussian. The model accounts for the decrease in thermal ionization energy of boron atoms with increasing concentration, as well as for electrostatic fluctuations due to the Coulomb interaction limited to two nearest point charges (impurity ions and holes). The mobility edge of holes in the v-band is assumed to be equal to the sum of the threshold energy for diffusion percolation and the exchange energy of the holes. On the basis of the virial theorem, the temperature Tj is determined, in the vicinity of which the dc band-like conductivity of holes in the v-band is approximately equal to the hopping conductivity of holes via the boron atoms. For compensation ratio (hydrogen-like donor to acceptor concentration ratio) K ≈ 0.15 and temperature Tj, the concentration of "free" holes in the v-band and their jumping (turbulent) drift mobility are calculated. Dependence of the differential energy of thermal ionization of boron atoms (at the temperature 3Tj/2) as a function of their concentration N is calculated. The estimates of the extrapolated into the temperature region close to Tj hopping drift mobility of holes hopping from the boron atoms in the charge states (0) to the boron atoms in the charge states (-1) are given. Calculations based on the model show good agreement with electrical conductivity and Hall effect measurements for p-type diamond with boron atom concentrations in the range from 3 × 1017 to 3 × 1020 cm-3, i.e., up to the Mott transition. The model uses no fitting parameters.

Adaptive Transmission and Channel Modeling for Frequency Hopping Communications

DTIC Science & Technology

2009-09-21

proposed adaptive transmission method has much greater system capacity than conventional non-adaptive MC direct- sequence ( DS )- CDMA system. • We...several mobile radio systems. First, a new improved allocation algorithm was proposed for multicarrier code-division multiple access (MC- CDMA ) system...Multicarrier code-division multiple access (MC- CDMA ) system with adaptive frequency hopping (AFH) has attracted attention of researchers due to its

Experimental verification of hopping mechanism using permanent magnets for an asteroid rover at drop tower

NASA Astrophysics Data System (ADS)

Kurisu, Masamitsu; Yano, Hajime; Yoshimitsu, Tetsuo; Kubota, Takashi; Adachi, Tadashi; Kuroda, Yoji

Verification of the hopping mechanism using permanent magnets by microgravity experiments at ZARM drop tower will be presented in this report. The mechanism, which is called HMPM (Hopping Mechanism with Permanent Magnets) was developed for a small asteroid exploration rover to replace with conventional locomotion mechanism such as wheels and crawlers. The main part of HMPM consists of three permanent magnets which are two stationary magnets and one movable magnet aligned between them. HMPM itself hops by utilizing the impact force generated when the movable magnet sticks to one of the stationary magnets. The features of HMPM are that the large impact force can be generated in spite of low-power consumption, and that it can be easily miniaturized and modularized. On the other hand, the weak point of HMPM is that the performance of the mechanism cannot be controlled directly, since the performance is decided by its design. Therefore, it is significant to evaluate the performance of HMPM before it is mounted on a flight model of rover. On the microgravity experiments at the drop tower, an imitation rover with 0.8kg weight is tested to hop with the operation of a prototype HMPM mounted on the rover. The prototype module weighs only 0.03kg with dimension 0.033 m in width, 0.046 m in height, and 0.012 m in depth, except the drive circuit and power source. Experimental results show the availability of HMPM. Also, the hopping performance of HMPM which is evaluated from the motion of rover recorded by cameras equipped inside the dropping capsule is compared with the estimated performance derived from the theoretical model. From the investigation, validity of the evaluation method based on the theoretical model is discussed. In order that the potential ability of HMPM is fully derived, optimal design of HMPM will require the evaluation method. The experiments at ZARM drop tower were accomplished based on the agreement on the Hayabusa-2 project by DLR-JAXA. And we received technical and operation supports from ZARM. We express our gratitude to ZARM, DLR and JAXA.

Sensomics analysis of key bitter compounds in the hard resin of hops (Humulus lupulus L.) and their contribution to the bitter profile of Pilsner-type beer.

PubMed

Dresel, Michael; Dunkel, Andreas; Hofmann, Thomas

2015-04-08

Recent brewing trials indicated the occurrence of valuable bitter compounds in the hard resin fraction of hop. Aiming at the discovery of these compounds, hop's ε-resin was separated by means of a sensory guided fractionation approach and the key taste molecules were identified by means of UV/vis, LC-TOF-MS, and 1D/2D-NMR studies as well as synthetic experiments. Besides a series of literature known xanthohumol derivatives, multifidol glucosides, flavon-3-on glycosides, and p-coumaric acid esters, a total of 11 bitter tastants are reported for the first time, namely, 1",2"-dihydroxanthohumol F, 4'-hydroxytunicatachalcone, isoxantholupon, 1-methoxy-4-prenylphloroglucinol, dihydrocyclohumulohydrochinone, xanthohumols M, N, and P, and isoxanthohumols M, N, and P, respectively. Human sensory analysis revealed low bitter recognition threshold concentrations ranging from 5 (co-multifidol glucopyranoside) to 198 μmol/L (trans-p-coumaric acid ethyl ester) depending on their chemical structure. For the first time, LC-MS/MS quantitation of these taste compounds in Pilsner-type beer, followed by taste re-engineering experiments, revealed the additive contribution of iso-α-acids and the identified hard resin components to be truly necessary and sufficient for constructing the authentic bitter percept of beer. Finally, brewing trails using the ε-resin as the only hop source impressively demonstrated the possibility to produce beverages strongly enriched with prenylated hop flavonoids.

Adaptations in single-leg hop biomechanics following anterior cruciate ligament reconstruction.

PubMed

Orishimo, Karl F; Kremenic, Ian J; Mullaney, Michael J; McHugh, Malachy P; Nicholas, Stephen J

2010-11-01

When a patient performs a clinically normal hop test based on distance, it cannot be assumed that the biomechanics are similar between limbs. The objective was to compare takeoff and landing biomechanics between legs in patients who have undergone anterior cruciate ligament reconstruction. Kinematics and ground reaction forces were recorded as 13 patients performed the single-leg hop on each leg. Distance hopped, joint range of motion, peak joint kinetics and the peak total extensor moment were compared between legs during both takeoff and landing. Average hop distance ratio (involved/noninvolved) was 93 ± 4%. Compared to the noninvolved side, knee motion during takeoff on the involved side was significantly reduced (P = 0.008). Peak moments and powers on the involved side were lower at the knee and higher at the ankle and hip compared with the noninvolved side (Side by Joint P = 0.011; P = 0.003, respectively). The peak total extensor moment was not different between legs (P = 0.305) despite a decrease in knee moment and increases in ankle and hip moments (Side by Joint P = 0.015). During landing, knee motion was reduced (P = 0.043), and peak power absorbed was decreased at the knee and hip and increased at the ankle on the involved side compared to the noninvolved side (P = 0.003). The compensations by other joints may indicate protective adaptations to avoid overloading the reconstructed knee.

Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

PubMed

Lawson, Carl J

2015-12-01

The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

Research on the frequency hopping bistatic sonar system

NASA Astrophysics Data System (ADS)

Liang, Guo-long; Zhang, Yao; Zhang, Guang-pu; Liu, Kai

2011-10-01

A new model for bistatic sonar system is established, in which frequency hopping (FH) signals are used for targets detection according to some rules. This model can decrease the time between adjacent signals and obtain more information in a unit time. The receiving system will receive and process the signals of different frequency respectively, according the FH pattern, for detecting and locating targets. This method can helps yield more stable and accurate outputs, using the characteristic of the FH signals, increase the ability of anti-detection and anti partial-band jamming.

Honest, Open, Proud for adolescents with mental illness: pilot randomized controlled trial.

PubMed

Mulfinger, Nadine; Müller, Sabine; Böge, Isabel; Sakar, Vehbi; Corrigan, Patrick W; Evans-Lacko, Sara; Nehf, Luise; Djamali, Julia; Samarelli, Anna; Kempter, Michael; Ruckes, Christian; Libal, Gerhard; Oexle, Nathalie; Noterdaeme, Michele; Rüsch, Nicolas

2018-06-01

Due to public stigma or self-stigma and shame, many adolescents with mental illness (MI) struggle with the decision whether to disclose their MI to others. Both disclosure and nondisclosure are associated with risks and benefits. Honest, Open, Proud (HOP) is a peer-led group program that supports participants with disclosure decisions in order to reduce stigma's impact. Previously, HOP had only been evaluated among adults with MI. This two-arm pilot randomized controlled trial included 98 adolescents with MI. Participants were randomly assigned to HOP and treatment as usual (TAU) or to TAU alone. Outcomes were assessed pre (T0/baseline), post (T1/after the HOP program), and at 3-week follow-up (T2/6 weeks after T0). Primary endpoints were stigma stress at T1 and quality of life at T2. Secondary outcomes included self-stigma, disclosure-related distress, empowerment, help-seeking intentions, recovery, and depressive symptoms. The trial is registered on ClinicalTrials (NCT02751229; http://www.clinicaltrials.gov). Compared to TAU, adolescents in the HOP program showed significantly reduced stigma stress at T1 (d = .92, p < .001) and increased quality of life at T2 (d = .60, p = .004). In a longitudinal mediation model, the latter effect was fully mediated by stigma stress reduction at T1. HOP further showed significant positive effects on self-stigma, disclosure-related distress, secrecy, help-seeking intentions, attitudes to disclosure, recovery, and depressive symptoms. Effects at T1 remained stable or improved further at follow-up. In a limited economic evaluation HOP was cost-efficient in relation to gains in quality of life. As HOP is a compact three-session program and showed positive effects on stigma and disclosure variables as well as on symptoms and quality of life, it could help to reduce stigma's negative impact among adolescents with MI. © 2017 Association for Child and Adolescent Mental Health.

Tailorable Exciton Transport in Doped Peptide–Amphiphile Assemblies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solomon, Lee A.; Sykes, Matthew E.; Wu, Yimin A.

Light-harvesting biomaterials are an attractive target in photovoltaics, photocatalysis, and artificial photosynthesis. Through peptide self-assembly, complex nanostructures can be engineered to study the role of chromophore organization during light absorption and energy transport. To this end, we demonstrate the one-dimensional transport of excitons along naturally occurring, light-harvesting, Zn-protoporphyrin IX chromophores within self-assembled peptide-amphiphile nanofibers. The internal structure of the nanofibers induces packing of the porphyrins into linear chains. We find that this peptide assembly can enable long-range exciton diffusion, yet it also induces the formation of excimers between adjacent molecules, which serve as exciton traps. Electronic coupling between neighboring porphyrinmore » molecules is confirmed by various spectroscopic methods. The exciton diffusion process is then probed through transient photoluminescence and absorption measurements and fit to a model for one-dimensional hopping. Because excimer formation impedes exciton hopping, increasing the interchromophore spacing allows for improved diffusivity, which we control through porphyrin doping levels. We show that diffusion lengths of over 60 nm are possible at low porphyrin doping, representing an order of magnitude improvement over the highest doping fractions.« less

On Prolonging Network Lifetime through Load-Similar Node Deployment in Wireless Sensor Networks

PubMed Central

Li, Qiao-Qin; Gong, Haigang; Liu, Ming; Yang, Mei; Zheng, Jun

2011-01-01

This paper is focused on the study of the energy hole problem in the Progressive Multi-hop Rotational Clustered (PMRC)-structure, a highly scalable wireless sensor network (WSN) architecture. Based on an analysis on the traffic load distribution in PMRC-based WSNs, we propose a novel load-similar node distribution strategy combined with the Minimum Overlapping Layers (MOL) scheme to address the energy hole problem in PMRC-based WSNs. In this strategy, sensor nodes are deployed in the network area according to the load distribution. That is, more nodes shall be deployed in the range where the average load is higher, and then the loads among different areas in the sensor network tend to be balanced. Simulation results demonstrate that the load-similar node distribution strategy prolongs network lifetime and reduces the average packet latency in comparison with existing nonuniform node distribution and uniform node distribution strategies. Note that, besides the PMRC structure, the analysis model and the proposed load-similar node distribution strategy are also applicable to other multi-hop WSN structures. PMID:22163809

Tailorable Exciton Transport in Doped Peptide-Amphiphile Assemblies.

PubMed

Solomon, Lee A; Sykes, Matthew E; Wu, Yimin A; Schaller, Richard D; Wiederrecht, Gary P; Fry, H Christopher

2017-09-26

Light-harvesting biomaterials are an attractive target in photovoltaics, photocatalysis, and artificial photosynthesis. Through peptide self-assembly, complex nanostructures can be engineered to study the role of chromophore organization during light absorption and energy transport. To this end, we demonstrate the one-dimensional transport of excitons along naturally occurring, light-harvesting, Zn-protoporphyrin IX chromophores within self-assembled peptide-amphiphile nanofibers. The internal structure of the nanofibers induces packing of the porphyrins into linear chains. We find that this peptide assembly can enable long-range exciton diffusion, yet it also induces the formation of excimers between adjacent molecules, which serve as exciton traps. Electronic coupling between neighboring porphyrin molecules is confirmed by various spectroscopic methods. The exciton diffusion process is then probed through transient photoluminescence and absorption measurements and fit to a model for one-dimensional hopping. Because excimer formation impedes exciton hopping, increasing the interchromophore spacing allows for improved diffusivity, which we control through porphyrin doping levels. We show that diffusion lengths of over 60 nm are possible at low porphyrin doping, representing an order of magnitude improvement over the highest doping fractions.

Hops (Humulus lupulus) Content in Beer Modulates Effects of Beer on the Liver After Acute Ingestion in Female Mice.

PubMed

Landmann, Marianne; Sellmann, Cathrin; Engstler, Anna Janina; Ziegenhardt, Doreen; Jung, Finn; Brombach, Christine; Bergheim, Ina

2017-01-01

Using a binge-drinking mouse model, we aimed to determine whether hops (Humulus lupulus) in beer is involved in the less damaging effects of acute beer consumption on the liver in comparison with ethanol. Female C57BL/6 J mice were either fed one iso-alcoholic and iso-caloric bolus dose of ethanol, beer, beer without hops (6 g ethanol/kg body weight) or an iso-caloric bolus of maltodextrin control solution. Markers of steatosis, intestinal barrier function, activation of toll-like receptor 4 signaling cascades, lipid peroxidation and lipogenesis were determined in liver, small intestine and plasma 2 h and 12 h after acute alcohol ingestion. Alcohol-induced hepatic fat accumulation was significantly attenuated in mice fed beer whereas in those fed beer without hops, hepatic fat accumulation was similar to that found in ethanol-fed mice. While markers of intestinal barrier function e.g. portal endotoxin levels and lipogenesis only differed slightly between groups, hepatic concentrations of myeloid differentiation primary response gene 88, inducible nitric oxide synthase (iNOS) and plasminogen-activator inhibitor 1 protein as well as of 4-hydroxynonenal and 3-nitrotyrosine protein adducts were similarly elevated in livers of mice fed ethanol or beer without hops when compared with controls. Induction of these markers was markedly attenuated in mice fed hops-containing beer. Taken together, our data suggest that hops in beer markedly attenuated acute alcohol-induced liver steatosis in female mice through mechanisms involving a suppression of iNOS induction in the liver. © The Author 2016. Medical Council on Alcohol and Oxford University Press. All rights reserved.

Non-adiabatic dynamics around a conical intersection with surface-hopping coupled coherent states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

A surface-hopping extension of the coupled coherent states-method [D. Shalashilin and M. Child, Chem. Phys. 304, 103-120 (2004)] for simulating non-adiabatic dynamics with quantum effects of the nuclei is put forward. The time-dependent Schrödinger equation for the motion of the nuclei is solved in a moving basis set. The basis set is guided by classical trajectories, which can hop stochastically between different electronic potential energy surfaces. The non-adiabatic transitions are modelled by a modified version of Tully’s fewest switches algorithm. The trajectories consist of Gaussians in the phase space of the nuclei (coherent states) combined with amplitudes for an electronicmore » wave function. The time-dependent matrix elements between different coherent states determine the amplitude of each trajectory in the total multistate wave function; the diagonal matrix elements determine the hopping probabilities and gradients. In this way, both interference effects and non-adiabatic transitions can be described in a very compact fashion, leading to the exact solution if convergence with respect to the number of trajectories is achieved and the potential energy surfaces are known globally. The method is tested on a 2D model for a conical intersection [A. Ferretti, J. Chem. Phys. 104, 5517 (1996)], where a nuclear wavepacket encircles the point of degeneracy between two potential energy surfaces and interferes with itself. These interference effects are absent in classical trajectory-based molecular dynamics but can be fully incorpo rated if trajectories are replaced by surface hopping coupled coherent states.« less

Majorana zero modes in the hopping-modulated one-dimensional p-wave superconducting model.

PubMed

Gao, Yi; Zhou, Tao; Huang, Huaixiang; Huang, Ran

2015-11-20

We investigate the one-dimensional p-wave superconducting model with periodically modulated hopping and show that under time-reversal symmetry, the number of the Majorana zero modes (MZMs) strongly depends on the modulation period. If the modulation period is odd, there can be at most one MZM. However if the period is even, the number of the MZMs can be zero, one and two. In addition, the MZMs will disappear as the chemical potential varies. We derive the condition for the existence of the MZMs and show that the topological properties in this model are dramatically different from the one with periodically modulated potential.

A Crystal-Physical Model of Electrotransfer in the Superionic Conductor Pb1 - x Sc x F2 + x ( x = 0.1)

NASA Astrophysics Data System (ADS)

Sorokin, N. I.

2018-04-01

The frequency (ν = 10-1-107 Hz) dependences of electrical conductivity σ(ν) of single crystals of superionic conductor Pb0.9Sc0.1F2.1 (10 mol % ScF3) with fluorite type structure (CaF2) in the temperature range 153-410 K have been investigated. The static bulk conductivity σ dc =1.5 × 10-4 S/cm and average hopping frequency ν h = 1.5 × 107 Hz of charge carriers (mobile ions F-) at room temperature (293 K) have been defined from the σ dc (ν) experimental curves. Enthalpies of thermoactivated processes of ionic conductivity σ dc ( T) (Δ H σ = 0.393 ± 0.005 eV) and dielectric relaxation ν h ( T) (Δ H h = 0.37 ± 0.03 eV) coincide within their errors. A crystal-physical model of fluorine-ion transport in a Pb0.9Sc0.1F2.1 crystal lattice has been proposed. The characteristic parameters of charge carriers have been calculated: concentration n mob = 2.0 × 1021 cm-3, the distance of the hopping d ≈ 0.5 nm and mobility μmob = 4.5 × 10-7 cm2/s V (293 K).

Advanced teleprocessing systems

NASA Astrophysics Data System (ADS)

Kleinrock, L.; Gerla, M.

1983-03-01

This Semi-Annual Technical Report covers research covering the period from October 1, 1982 to March 31, 1983. This contract has three primary designated research areas: packet radio systems, resource sharing and allocation, and distributed processing and control. This report contains abstracts of publications which summarize research results in these areas followed by the main body of the report which is devoted to a treatment of single- and multi-hop packet radio systems. In particular, the main body consists of a Ph.D. dissertation, Analysis of Throughput and Delay for Single- and Multi-Hop Packet Radio Networks. The work presents a new approach to evaluating the performance of multi-hop packet radio networks, namely, a study of the times between successful transmissions. Also studied is the behavior of packets in a multi-hop system when a fixed transmission radius is specified and this radius is then optimized for throughput. A Markov chain model is also introduced and solved numerically to evaluate transmission and flow control strategies in these systems.

Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.

PubMed

Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F

2006-10-01

Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.

Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

PubMed Central

Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

2010-01-01

AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

Salmonella exploits the host endolysosomal tethering factor HOPS complex to promote its intravacuolar replication

PubMed Central

Sindhwani, Aastha; Kaur, Harmeet; Tuli, Amit

2017-01-01

Salmonella enterica serovar typhimurium extensively remodels the host late endocytic compartments to establish its vacuolar niche within the host cells conducive for its replication, also known as the Salmonella-containing vacuole (SCV). By maintaining a prolonged interaction with late endosomes and lysosomes of the host cells in the form of interconnected network of tubules (Salmonella-induced filaments or SIFs), Salmonella gains access to both membrane and fluid-phase cargo from these compartments. This is essential for maintaining SCV membrane integrity and for bacterial intravacuolar nutrition. Here, we have identified the multisubunit lysosomal tethering factor—HOPS (HOmotypic fusion and Protein Sorting) complex as a crucial host factor facilitating delivery of late endosomal and lysosomal content to SCVs, providing membrane for SIF formation, and nutrients for intravacuolar bacterial replication. Accordingly, depletion of HOPS subunits significantly reduced the bacterial load in non-phagocytic and phagocytic cells as well as in a mouse model of Salmonella infection. We found that Salmonella effector SifA in complex with its binding partner; SKIP, interacts with HOPS subunit Vps39 and mediates recruitment of this tethering factor to SCV compartments. The lysosomal small GTPase Arl8b that binds to, and promotes membrane localization of Vps41 (and other HOPS subunits) was also required for HOPS recruitment to SCVs and SIFs. Our findings suggest that Salmonella recruits the host late endosomal and lysosomal membrane fusion machinery to its vacuolar niche for access to host membrane and nutrients, ensuring its intracellular survival and replication. PMID:29084291

Multi-hop teleportation based on W state and EPR pairs

NASA Astrophysics Data System (ADS)

Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

2016-05-01

Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

Confined diffusion of transmembrane proteins and lipids induced by the same actin meshwork lining the plasma membrane

PubMed Central

Fujiwara, Takahiro K.; Iwasawa, Kokoro; Kalay, Ziya; Tsunoyama, Taka A.; Watanabe, Yusuke; Umemura, Yasuhiro M.; Murakoshi, Hideji; Suzuki, Kenichi G. N.; Nemoto, Yuri L.; Morone, Nobuhiro; Kusumi, Akihiro

2016-01-01

The mechanisms by which the diffusion rate in the plasma membrane (PM) is regulated remain unresolved, despite their importance in spatially regulating the reaction rates in the PM. Proposed models include entrapment in nanoscale noncontiguous domains found in PtK2 cells, slow diffusion due to crowding, and actin-induced compartmentalization. Here, by applying single-particle tracking at high time resolutions, mainly to the PtK2-cell PM, we found confined diffusion plus hop movements (termed “hop diffusion”) for both a nonraft phospholipid and a transmembrane protein, transferrin receptor, and equal compartment sizes for these two molecules in all five of the cell lines used here (actual sizes were cell dependent), even after treatment with actin-modulating drugs. The cross-section size and the cytoplasmic domain size both affected the hop frequency. Electron tomography identified the actin-based membrane skeleton (MSK) located within 8.8 nm from the PM cytoplasmic surface of PtK2 cells and demonstrated that the MSK mesh size was the same as the compartment size for PM molecular diffusion. The extracellular matrix and extracellular domains of membrane proteins were not involved in hop diffusion. These results support a model of anchored TM-protein pickets lining actin-based MSK as a major mechanism for regulating diffusion. PMID:26864625

Solution to the sign problem in a frustrated quantum impurity model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hann, Connor T., E-mail: connor.hann@yale.edu; Huffman, Emilie; Chandrasekharan, Shailesh

2017-01-15

In this work we solve the sign problem of a frustrated quantum impurity model consisting of three quantum spin-half chains interacting through an anti-ferromagnetic Heisenberg interaction at one end. We first map the model into a repulsive Hubbard model of spin-half fermions hopping on three independent one dimensional chains that interact through a triangular hopping at one end. We then convert the fermion model into an inhomogeneous one dimensional model and express the partition function as a weighted sum over fermion worldline configurations. By imposing a pairing of fermion worldlines in half the space we show that all negative weightmore » configurations can be eliminated. This pairing naturally leads to the original frustrated quantum spin model at half filling and thus solves its sign problem.« less

The infinite range Heisenberg model and high temperature superconductivity

NASA Astrophysics Data System (ADS)

Tahir-Kheli, Jamil

1992-01-01

The thesis deals with the theory of high temperature superconductivity from the standpoint of three-band Hubbard models.Chapter 1 of the thesis proposes a strongly coupled variational wavefunction that has the three-spin system of an oxygen hole and its two neighboring copper spins in a doublet and the background Cu spins in an eigenstate of the infinite range antiferromagnet. This wavefunction is expected to be a good "zeroth order" wavefunction in the superconducting regime of dopings. The three-spin polaron is stabilized by the hopping terms rather than the copper-oxygen antiferromagnetic coupling Jpd. Considering the effect of the copper-copper antiferromagnetic coupling Jdd, we show that the three-spin polaron cannot be pure Emery (Dg), but must have a non-negligible amount of doublet-u (Du) character for hopping stabilization. Finally, an estimate is made for the magnitude of the attractive coupling of oxygen holes.Chapter 2 presents an exact solution to a strongly coupled Hamiltonian for the motion of oxygen holes in a 1-D Cu-O lattice. The Hamiltonian separates into two pieces: one for the spin degrees of freedom of the copper and oxygen holes, and the other for the charge degrees of freedom of the oxygen holes. The spinon part becomes the Heisenberg antiferromagnet in 1-D that is soluble by the Bethe Ansatz. The holon piece is also soluble by a Bethe Ansatz with simple algebraic relations for the phase shifts.Finally, we show that the nearest neighbor Cu-Cu spin correlation increases linearly with doping and becomes positive at x [...] 0.70.

Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

ERIC Educational Resources Information Center

Adjapong, Edmund S.; Emdin, Christopher

2015-01-01

A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

Redirected charge transport arising from diazonium grafting of carbon coated LiFePO4.

PubMed

Madec, L; Seid, K A; Badot, J-C; Humbert, B; Moreau, P; Dubrunfaut, O; Lestriez, B; Guyomard, D; Gaubicher, J

2014-11-07

The morphological and the electrical properties of carbon coated LiFePO4 (LFPC) active material functionalized by 4-ethynylbenzene tetrafluoroboratediazonium salt were investigated. For this purpose, FTIR, Raman, XPS, High Resolution Transmission Electron Microscopy (HRTEM) and Broadband Dielectric Spectroscopy (BDS) were considered. Electronic conductivities of LFPC samples at room temperature were found to decrease in a large frequency range upon simple immersion in polar solvents and to decrease further upon functionalization. Due to their high dipole moment, strongly physisorbed molecules detected by XPS likely add barriers to electron hopping. Significant alteration of the carbon coating conductivity was only observed, however, upon functionalization. This effect is most presumably associated with an increase in the sp(3) content determined by Raman spectroscopy, which is a strong indication of the formation of a covalent bond between the organic layer and the carbon coating. In this case, the electron flux appears to be redirected and relayed by short-range (intra chain) and long-range (inter chain) electron transport through molecular oligomers anchored at the LFPC surface. The latter are controlled by tunnelling and slightly activated hopping, which enable higher conductivity at low temperature (T < 250 K). Alteration of the electron transport within the carbon coating also allows detection of a relaxation phenomenon that corresponds to small polaron hopping in bulk LiFePO4. XPS and HRTEM images allow a clear correlation of these findings with the island type oligomeric structure of grafted molecules.

Dopant driven tunability of dielectric relaxation in MxCo(1-x)Fe2O4 (M: Zn2+, Mn2+, Ni2+) nano-ferrites

NASA Astrophysics Data System (ADS)

Datt, Gopal; Abhyankar, A. C.

2017-07-01

Nano-ferrites with tunable dielectric and magnetic properties are highly desirable in modern electronics industries. This work reports the effect of ferromagnetic (Ni), anti-ferromagnetic (Mn), and non-magnetic (Zn) substitution on cobalt-ferrites' dielectric and magnetic properties. The Rietveld analysis of XRD data and the Raman spectroscopic study reveals that all the samples are crystallized in the Fd-3m space group. The T2g Raman mode was observed to split into branches, which is due to the presence of different cations (with different vibrational frequencies) at crystallographic A and B-sites. The magnetization study shows that the MnCoFe2O4 sample has the highest saturation magnetization of 87 emu/g, which is attributed to the presence of Mn2+ cations at the B-site with a magnetic moment of 5 μB. The dielectric permittivity of these nanoparticles (NPs) obeys the modified Debye model, which is further supported by Cole-Cole plots. The dielectric constant of MnCoFe2O4 ferrite is found to be one order higher than that of the other two ferrites. The increased bond length of the Mn2+-O2- bond along with the enhanced d-d electron transition between Mn 2 +/Co 2 +⇋Fe 3 + cations at the B-site are found to be the main contributing factors for the enhanced dielectric constant of MnCoFe2O4 ferrite. We find evidence of variable-range hopping of localized polarons in these ferrite NPs. The activation energy, hopping range, and density of states N (" separators="|EF ), of these polarons were calculated using Motts' 1/4th law. The estimated activation energies of these polarons at 300 K were found to be 288 meV, 426 meV, and 410 meV, respectively, for the MnCoFe2O4, NiCoFe2O4, and ZnCoFe2O4 ferrite NPs, while the hopping range of these polarons were found to be 27.14 Å, 11.66 Å, and 8.17 Å, respectively. Observation of a low dielectric loss of ˜0.04, in the frequency range of 0.1-1 MHz, in these NPs makes them potential candidates for energy harvesting devices in the modern electronics industry.

Determinant quantum Monte Carlo study of d -wave pairing in the plaquette Hubbard hamiltonian

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ying, T.; Mondaini, R.; Sun, X. D.

2014-08-13

We used the determinant Quantum Monte Carlo (DQMC) to determine the pairing and magnetic response for a Hubbard model built up from four-site clusters - a two-dimensional square lattice consisting of elemental 2x2 plaquettes with hopping t and on-site repulsion U coupled by an interplaquette hopping t' ≤ t. Superconductivity in this geometry has previously been studied by a variety of analytic and numeric methods, with differing conclusions concerning whether the pairing correlations and transition temperature are raised near half-filling by the inhomogeneous hopping or not. For U/t = 4, DQMC indicates an optimal t'/t ≈ 0.4 at which themore » pairing vertex is most attractive. We also found that optimal t'/t increases with U/t. We then contrast our results for this plaquette model with a Hamiltonian which instead involves a regular pattern of site energies whose large site energy limit is the three band CuO 2 model; we show that there the inhomogeneity rapidly, and monotonically, suppresses pairing.« less

CONSISTENCY OF FIELD-BASED MEASURES OF NEUROMUSCULAR CONTROL USING FORCE PLATE DIAGNOSTICS IN ELITE MALE YOUTH SOCCER PLAYERS

PubMed Central

READ, PAUL; OLIVER, JON L.; DE STE CROIX, MARK B.A.; MYER, GREGORY D.; LLOYD, RHODRI S.

2016-01-01

Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players and reliability data is sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force plate diagnostics in this cohort. Twenty six pre-peak height velocity (PHV) and twenty five post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single leg 75% horizontal hop and stick (75%HOP) and single leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilisation (TTS), time to pVGRF, and pVGRF asymmetry were recorded. A test, re-test design was used and reliability statistics included: change in mean, intraclass correlation coefficient (ICC) and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the three protocols (CV range = 13.8 – 49.7%). ICC values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be utilized to support a screening battery for elite male youth soccer players and for test re-test comparison. PMID:27075641

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

AURP: An AUV-Aided Underwater Routing Protocol for Underwater Acoustic Sensor Networks

PubMed Central

Yoon, Seokhoon; Azad, Abul K.; Oh, Hoon; Kim, Sunghwan

2012-01-01

Deploying a multi-hop underwater acoustic sensor network (UASN) in a large area brings about new challenges in reliable data transmissions and survivability of network due to the limited underwater communication range/bandwidth and the limited energy of underwater sensor nodes. In order to address those challenges and achieve the objectives of maximization of data delivery ratio and minimization of energy consumption of underwater sensor nodes, this paper proposes a new underwater routing scheme, namely AURP (AUV-aided underwater routing protocol), which uses not only heterogeneous acoustic communication channels but also controlled mobility of multiple autonomous underwater vehicles (AUVs). In AURP, the total data transmissions are minimized by using AUVs as relay nodes, which collect sensed data from gateway nodes and then forward to the sink. Moreover, controlled mobility of AUVs makes it possible to apply a short-range high data rate underwater channel for transmissions of a large amount of data. To the best to our knowledge, this work is the first attempt to employ multiple AUVs as relay nodes in a multi-hop UASN to improve the network performance in terms of data delivery ratio and energy consumption. Simulations, which are incorporated with a realistic underwater acoustic communication channel model, are carried out to evaluate the performance of the proposed scheme, and the results indicate that a high delivery ratio and low energy consumption can be achieved. PMID:22438740

AURP: an AUV-aided underwater routing protocol for underwater acoustic sensor networks.

PubMed

Yoon, Seokhoon; Azad, Abul K; Oh, Hoon; Kim, Sunghwan

2012-01-01

Deploying a multi-hop underwater acoustic sensor network (UASN) in a large area brings about new challenges in reliable data transmissions and survivability of network due to the limited underwater communication range/bandwidth and the limited energy of underwater sensor nodes. In order to address those challenges and achieve the objectives of maximization of data delivery ratio and minimization of energy consumption of underwater sensor nodes, this paper proposes a new underwater routing scheme, namely AURP (AUV-aided underwater routing protocol), which uses not only heterogeneous acoustic communication channels but also controlled mobility of multiple autonomous underwater vehicles (AUVs). In AURP, the total data transmissions are minimized by using AUVs as relay nodes, which collect sensed data from gateway nodes and then forward to the sink. Moreover, controlled mobility of AUVs makes it possible to apply a short-range high data rate underwater channel for transmissions of a large amount of data. To the best to our knowledge, this work is the first attempt to employ multiple AUVs as relay nodes in a multi-hop UASN to improve the network performance in terms of data delivery ratio and energy consumption. Simulations, which are incorporated with a realistic underwater acoustic communication channel model, are carried out to evaluate the performance of the proposed scheme, and the results indicate that a high delivery ratio and low energy consumption can be achieved.

Organogenic nodule formation in hop: a tool to study morphogenesis in plants with biotechnological and medicinal applications.

PubMed

Fortes, Ana M; Santos, Filipa; Pais, Maria S

2010-01-01

The usage of Humulus lupulus for brewing increased the demand for high-quality plant material. Simultaneously, hop has been used in traditional medicine and recently recognized with anticancer and anti-infective properties. Tissue culture techniques have been reported for a wide range of species, and open the prospect for propagation of disease-free, genetically uniform and massive amounts of plants in vitro. Moreover, the development of large-scale culture methods using bioreactors enables the industrial production of secondary metabolites. Reliable and efficient tissue culture protocol for shoot regeneration through organogenic nodule formation was established for hop. The present review describes the histological, and biochemical changes occurring during this morphogenic process, together with an analysis of transcriptional and metabolic profiles. We also discuss the existence of common molecular factors among three different morphogenic processes: organogenic nodules and somatic embryogenesis, which strictly speaking depend exclusively on intrinsic developmental reprogramming, and legume nitrogen-fixing root nodules, which arises in response to symbiosis. The review of the key factors that participate in hop nodule organogenesis and the comparison with other morphogenic processes may have merit as a study presenting recent advances in complex molecular networks occurring during morphogenesis and together, these provide a rich framework for biotechnology applications.

AC conduction of Ba1-xCaxTiO3 and BZT-BCTx

NASA Astrophysics Data System (ADS)

Khien, Nguyen Van; Huy, Than Trong; Hong, Le Van

2018-03-01

Ba1-xCaxTiO3 (BCTx), (x =0.0-0.3) and Ba0.8Zr0.2TiO3-Ba1-xCaxTiO3 (BZT-BCTx), (x=0.15-0.35) were fabricated by the solid state reaction method. Phase structure of the material samples was identified by X-ray diffraction. The impedance versus frequency in a range of 100 Hz to 2.5 MHz was measured for all the samples at room temperature. AC conductivity versus frequency of the BCTx and BZT-BCTx was evaluated and fitted by using the extended Universal Dielectric Response (UDR) equations. The fitting results were discussed in detail and shown that the localized reorientation polarization-based mechanism is most contributed in BCTx matrial samples. Basically both two the hopping polaron and polarization mechanisms play roles in BZT-BCTx material samples. In contrary the short-range polaron hopping is dominated in ac conductivity of BZT-BCTx material samples in low frequency range.

Dielectric relaxation and localized electron hopping in colossal dielectric (Nb,In)-doped TiO2 rutile nanoceramics.

PubMed

Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A

2017-03-28

Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO 2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.

Hopping and the Stokes–Einstein relation breakdown in simple glass formers

PubMed Central

Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco

2014-01-01

One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition—like that of other statistical systems—is exact when the spatial dimension d→∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions, d=2,3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes–Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses. PMID:25288722

Hopping and the Stokes-Einstein relation breakdown in simple glass formers.

PubMed

Charbonneau, Patrick; Jin, Yuliang; Parisi, Giorgio; Zamponi, Francesco

2014-10-21

One of the most actively debated issues in the study of the glass transition is whether a mean-field description is a reasonable starting point for understanding experimental glass formers. Although the mean-field theory of the glass transition--like that of other statistical systems--is exact when the spatial dimension d → ∞, the evolution of systems properties with d may not be smooth. Finite-dimensional effects could dramatically change what happens in physical dimensions,d = 2, 3. For standard phase transitions finite-dimensional effects are typically captured by renormalization group methods, but for glasses the corrections are much more subtle and only partially understood. Here, we investigate hopping between localized cages formed by neighboring particles in a model that allows to cleanly isolate that effect. By bringing together results from replica theory, cavity reconstruction, void percolation, and molecular dynamics, we obtain insights into how hopping induces a breakdown of the Stokes-Einstein relation and modifies the mean-field scenario in experimental systems. Although hopping is found to supersede the dynamical glass transition, it nonetheless leaves a sizable part of the critical regime untouched. By providing a constructive framework for identifying and quantifying the role of hopping, we thus take an important step toward describing dynamic facilitation in the framework of the mean-field theory of glasses.

Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

PubMed Central

Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

2017-01-01

The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

PubMed

Reeb-Whitaker, Carolyn K; Bonauto, David K

2014-11-01

There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Clinical Effects of Dry Needling Among Asymptomatic Individuals With Hamstring Tightness: A Randomized Controlled Trial.

PubMed

Geist, Kathleen; Bradley, Claire; Hofman, Alan; Koester, Rob; Roche, Fenella; Shields, Annalise; Frierson, Elizabeth; Rossi, Ainsley; Johanson, Marie

2017-11-01

Randomized controlled trial. The aim of this study was to determine the effects of dry needling on hamstring extensibility and functional performance tests among asymptomatic individuals with hamstring muscle tightness. Dry needling has been shown to increase range of motion in the upper quarter and may have similar effects in the lower quarter. 27 subjects with hamstring extensibility deficits were randomly assigned to side of treatment (dominant or nondominant) and group (blunt needling or dry needling). The first session included measurement of hamstring extensibility and performance on 4 unilateral hop tests, instruction in home hamstring stretching exercises and needling distal to the ischial tuberosity and midbellies of the medial and lateral hamstrings. A second session, 3-5 days following the first session, included outcome measures and a second needling intervention, and a third session, 4-6 weeks following the first session, included outcome measures only. A 2 × 3 × 2 ANOVA was used to statistically analyze the data. Hamstring extensibility showed a significant side × time interaction (P < .05). The single hop for distance, timed 6-meter hop, and the crossover hop test had a significant main effect of time (P < .05). The triple hop for distance showed a significant side × time × group interaction (P < .05). It does not appear dry needling results in increased extensibility beyond that of stretching alone in asymptomatic individuals. Our study findings suggest that dry needling may improve certain dimensions of functional performance, although no clear conclusion can be made. Intervention, level 2b.

AC conductivity and dielectric behavior of bulk Furfurylidenemalononitrile

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Ali, H. A. M.

2012-06-01

AC conductivity and dielectric behavior for bulk Furfurylidenemalononitrile have been studied over a temperature range (293-333 K) and frequency range (50-5×106 Hz). The frequency dependence of ac conductivity, σac, has been investigated by the universal power law, σac(ω)=Aωs. The variation of the frequency exponent (s) with temperature was analyzed in terms of different conduction mechanisms, and it was found that the correlated barrier hopping (CBH) model is the predominant conduction mechanism. The temperature dependence of σac(ω) showed a linear increase with the increase in temperature at different frequencies. The ac activation energy was determined at different frequencies. Dielectric data were analyzed using complex permittivity and complex electric modulus for bulk Furfurylidenemalononitrile at various temperatures.

Dominant source of disorder in graphene: charged impurities or ripples?

NASA Astrophysics Data System (ADS)

Fan, Zheyong; Uppstu, Andreas; Harju, Ari

2017-06-01

Experimentally produced graphene sheets exhibit a wide range of mobility values. Both extrinsic charged impurities and intrinsic ripples (corrugations) have been suggested to induce long-range disorder in graphene and could be a candidate for the dominant source of disorder. Here, using large-scale molecular dynamics and quantum transport simulations, we find that the hopping disorder and the gauge and scalar potentials induced by the ripples are short-ranged, in strong contrast with predictions by continuous models, and the transport fingerprints of the ripple disorder are very different from those of charged impurities. We conclude that charged impurities are the dominant source of disorder in most graphene samples, whereas scattering by ripples is mainly relevant in the high carrier density limit of ultraclean graphene samples (with a charged impurity concentration less than about 10 ppm) at room and higher temperatures. Our finding is valuable to theoretical modelling of transport properties of not only graphene, but also other two-dimensional materials, as the thermal ripples are universal.

Spin-orbit interaction and negative magnetoresistance for localized electrons in InSb quantum wells

NASA Astrophysics Data System (ADS)

Ishida, S.; Manago, T.; Nishizako, N.; Geka, H.; Shibasaki, I.

2010-02-01

Weak-field magnetoresistance (MR) in the variable-range hopping (VRH) in the presence of spin-orbit interaction (SOI) for 2DEGs at the hetero-interface of InSb quantum wells was examined in view of the quantum interference (QI) effect. Samples with the sheet resistance, ρ> ρc= h/ e2, exhibit VRH, while those with ρ< ρc exhibit weak localiz ation (WL) at low temperatures, where h/ e2 is the quantum resistance. In the WL regime, a positive magnetoresistance (MR) peak due to the weak anti-localization (WAL) with SOI is clearly observed in low magnetic field. In contrast, the low-field hopping MR remains entirely negative surviving the SOI, indicating that the hopping MR due to the QI is completely negative regardless of the SOI. This result supports the predictions based on the directed-path approach for forward-scattering paths ignoring the back-scattering return loops for the QI in the VRH.

Piezo activated mode tracking system for widely tunable mode-hop-free external cavity mid-IR semiconductor lasers

NASA Technical Reports Server (NTRS)

Tittel, Frank K. (Inventor); Curl, Robert F. (Inventor); Wysocki, Gerard (Inventor)

2010-01-01

A widely tunable, mode-hop-free semiconductor laser operating in the mid-IR comprises a QCL laser chip having an effective QCL cavity length, a diffraction grating defining a grating angle and an external cavity length with respect to said chip, and means for controlling the QCL cavity length, the external cavity length, and the grating angle. The laser of claim 1 wherein said chip may be tuned over a range of frequencies even in the absence of an anti-reflective coating. The diffraction grating is controllably pivotable and translatable relative to said chip and the effective QCL cavity length can be adjusted by varying the injection current to the chip. The laser can be used for high resolution spectroscopic applications and multi species trace-gas detection. Mode-hopping is avoided by controlling the effective QCL cavity length, the external cavity length, and the grating angle so as to replicate a virtual pivot point.

Quantum confinement and dielectric profiles of colloidal nanoplatelets of halide inorganic and hybrid organic-inorganic perovskites

NASA Astrophysics Data System (ADS)

Sapori, Daniel; Kepenekian, Mikaël; Pedesseau, Laurent; Katan, Claudine; Even, Jacky

2016-03-01

Quantum confinement as well as high frequency ε∞ and static εs dielectric profiles are described for nanoplatelets of halide inorganic perovskites CsPbX3 (X = I, Br, Cl) and hybrid organic-inorganic perovskites (HOP) in two-dimensional (2D) and three-dimensional (3D) structures. 3D HOP are currently being sought for their impressive photovoltaic ability. Prior to this sudden popularity, 2D HOP materials were driving intense activity in the field of optoelectronics. Such developments have been enriched by the recent ability to synthesize colloidal nanostructures of controlled sizes of 2D and 3D HOP. This raises the need to achieve a thorough description of the electronic structure and dielectric properties of these systems. In this work, we go beyond the abrupt dielectric interface model and reach the atomic scale description. We examine the influence of the nature of the halogen and of the cation on the band structure and dielectric constants. Similarly, we survey the effect of dimensionality and shape of the perovskite. In agreement with recent experimental results, we show an increase of the band gap and a decrease of ε∞ when the size of a nanoplatelet reduces. By inspecting 2D HOP, we find that it cannot be described as a simple superposition of independent inorganic and organic layers. Finally, the dramatic impact of ionic contributions on the dielectric constant εs is analysed.Quantum confinement as well as high frequency ε∞ and static εs dielectric profiles are described for nanoplatelets of halide inorganic perovskites CsPbX3 (X = I, Br, Cl) and hybrid organic-inorganic perovskites (HOP) in two-dimensional (2D) and three-dimensional (3D) structures. 3D HOP are currently being sought for their impressive photovoltaic ability. Prior to this sudden popularity, 2D HOP materials were driving intense activity in the field of optoelectronics. Such developments have been enriched by the recent ability to synthesize colloidal nanostructures of controlled sizes of 2D and 3D HOP. This raises the need to achieve a thorough description of the electronic structure and dielectric properties of these systems. In this work, we go beyond the abrupt dielectric interface model and reach the atomic scale description. We examine the influence of the nature of the halogen and of the cation on the band structure and dielectric constants. Similarly, we survey the effect of dimensionality and shape of the perovskite. In agreement with recent experimental results, we show an increase of the band gap and a decrease of ε∞ when the size of a nanoplatelet reduces. By inspecting 2D HOP, we find that it cannot be described as a simple superposition of independent inorganic and organic layers. Finally, the dramatic impact of ionic contributions on the dielectric constant εs is analysed. Electronic supplementary information (ESI) available: Complementary results on the electronic structure and dielectric constants of CsPbX3 and CH3NH3PbX3 (X = I, Br, Cl). See DOI: 10.1039/c5nr07175e

Anomalous diffusion for bed load transport with a physically-based model

NASA Astrophysics Data System (ADS)

Fan, N.; Singh, A.; Foufoula-Georgiou, E.; Wu, B.

2013-12-01

Diffusion of bed load particles shows both normal and anomalous behavior for different spatial-temporal scales. Understanding and quantifying these different types of diffusion is important not only for the development of theoretical models of particle transport but also for practical purposes, e.g., river management. Here we extend a recently proposed physically-based model of particle transport by Fan et al. [2013] to further develop an Episodic Langevin equation (ELE) for individual particle motion which reproduces the episodic movement (start and stop) of sediment particles. Using the proposed ELE we simulate particle movements for a large number of uniform size particles, incorporating different probability distribution functions (PDFs) of particle waiting time. For exponential PDFs of waiting times, particles reveal ballistic motion in short time scales and turn to normal diffusion at long time scales. The PDF of simulated particle travel distances also shows a change in its shape from exponential to Gamma to Gaussian with a change in timescale implying different diffusion scaling regimes. For power-law PDF (with power - μ) of waiting times, the asymptotic behavior of particles at long time scales reveals both super-diffusion and sub-diffusion, however, only very heavy tailed waiting times (i.e. 1.0 < μ < 1.5) could result in sub-diffusion. We suggest that the contrast between our results and previous studies (for e.g., studies based on fractional advection-diffusion models of thin/heavy tailed particle hops and waiting times) results could be due the assumption in those studies that the hops are achieved instantaneously, but in reality, particles achieve their hops within finite times (as we simulate here) instead of instantaneously, even if the hop times are much shorter than waiting times. In summary, this study stresses on the need to rethink the alternative models to the previous models, such as, fractional advection-diffusion equations, for studying the anomalous diffusion of bed load particles. The implications of these results for modeling sediment transport are discussed.

BLUECOM+ project: Connecting Humans and Systems at Ocean Remote Areas using Cost-effective Broadband Communications field

NASA Astrophysics Data System (ADS)

Brito, Pedro; Terrinha, Pedro; Magalhães, Vitor; Santos, Joana; Duarte, Débora; Campos, Rui

2017-04-01

The BLUECOM + project (Connecting Humans and Systems at Remote Ocean Areas using Cost-effective Broadband Communications) aims at developing an innovative communications solution that will enable broadband, cost-effective Internet access in remote ocean areas (ideally beyond 100 km from shore), using standard wireless access technologies - e.g., Wi-Fi and LTE. BLUECOM+ is an EEA Grants PT02 project developed by INESC TEC (Institute for Systems and Computer Engineering, Technology and Science), IPMA (Portuguese Institute for the Sea and the Atmosphere), and MARLO (Transport and Logistics Consultants). The BLUECOM+ key idea and innovation lies on deploying a long-term communications infrastructure, which will extend broadband communications from shore to remote ocean areas by leveraging (1) Helikites - a combination of a helium balloon and kite - that can be tethered to existing or new land and ocean platforms, (2) long range line of sight wireless communications using TV white spaces, and (3) multi-hop relaying techniques to further increase range. At this stage the communications protocols were defined and tested in lab conditions and two sea trials for demonstration of the system were carried out in July/2016 and September/2016 using research vessels. Results of the cruises: 1st cruise corresponded to the first sea-trials of the project. Single-hop communications were established between a land base station deployed at Cabo Espichel lighthouse and the Sea Station deployed in a Helikite launched from the vessel and flying at an altitude of 120m. Successful communications between the two stations were established at a maximum distance of 40km with a data rate in excess of 1Mbit/s. 2nd cruise corresponded to the second sea-trials. During this trial single-hop and two-hop land-sea communications were tested. For two-hop communications tests two Helikites were launched at 120m from two vessels. The first was launched from a vessel closer to shore; the other was launched from the second vessel and connected to the first to have Internet access. The tests were performed at increasing distances up to a maximum distance of 45km from the land station and the first hop, and up to 10km between the two Helikites. The main results achieved were: • Single-hop data rates in excess of 1Mbit/s up to 45km; • Two-hop data rates in excess of 500kbit/s up to 55km; • Video conference with land at 42km offshore without a glitch; • Real-time upload of data collected by an autonomous vehicle offshore to the cloud. A 3rd cruise will be done this year to test video streaming to shore of sea bottom images acquired from the ship with a drop down video system. This will include the integration of the BLUECOM+ network with the drop down video system, in order to demonstrate real-time underwater video transmission offshore. Acknowledgements: This work was developed as part of the BLUECOM+ project (PT02_Aviso4_0005) funded by the EEA Grants and Norway Grants.

Random hopping fermions on bipartite lattices: density of states, inverse participation ratios, and their correlations in a strong disorder regime

NASA Astrophysics Data System (ADS)

Yamada, Hiroki; Fukui, Takahiro

2004-02-01

We study Anderson localization of non-interacting random hopping fermions on bipartite lattices in two dimensions, focusing our attention to strong disorder features of the model. We concentrate ourselves on specific models with a linear dispersion in the vicinity of the band center, which can be described by a Dirac fermion in the continuum limit. Based on the recent renormalization group method developed by Carpentier and Le Doussal for the XY gauge glass model, we calculate the density of states, inverse participation ratios, and their spatial correlations. It turns out that their behavior is quite different from those expected within naive weak disorder approaches.

Positive magnetoresistance in Fe3Se4 nanowires

NASA Astrophysics Data System (ADS)

Li, D.; Jiang, J. J.; Liu, W.; Zhang, Z. D.

2011-04-01

We report the magnetotransport properties of Fe3Se4 nanowire arrays in anodic aluminum oxide (AAO) porous membrane. The temperature dependence of resistance of Fe3Se4 nanowires at a zero field shows thermal activated behavior below 295 K. The exponential relationship in resistance is consistent with the model of strong localization with variable-range hopping (VRH) for a finite one-dimensional wire. Resistance versus magnetic field curves below 100 K show small positive magnetoresistance (MR). The field dependencies of log[R(H)/R(0)] explain the positive MR as the effect of magnetic field on the VRH conduction.

Cutaneous Uptake of 14C-HD Vapor by the Hairless Guinea Pig.

DTIC Science & Technology

1996-10-01

guinea pig (HGP) is used by our laboratory to model the human cutaneous response to sulfur mustard (HD) exposure. We have determined the HD content in the skin of HOP after 7-minute exposures to vapors saturated with a mixture of HD and 14C-HD. Concentration/time (C1) values in the range of 2 mg/sq cm/min were determined by counting skin 14C disintegrations per minute (dpm) in animals euthanized immediately after exposure. These values are similar to human penetration rates obtained by other investigators. A direct relationship between C1 and relative humidity was

Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.

PubMed

Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

2016-09-12

In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).

Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program

PubMed Central

Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

2016-01-01

Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968

HopBase: a unified resource for Humulus genomics

PubMed Central

Hill, Steven T.; Sudarsanam, Ramcharan

2017-01-01

Abstract Hop (Humulus lupulus L. var lupulus) is a dioecious plant of worldwide significance, used primarily for bittering and flavoring in brewing beer. Studies on the medicinal properties of several unique compounds produced by hop have led to additional interest from pharmacy and healthcare industries as well as livestock production as a natural antibiotic. Genomic research in hop has resulted a published draft genome and transcriptome assemblies. As research into the genomics of hop has gained interest, there is a critical need for centralized online genomic resources. To support the growing research community, we report the development of an online resource "HopBase.org." In addition to providing a gene annotation to the existing Shinsuwase draft genome, HopBase makes available genome assemblies and annotations for both the cultivar “Teamaker” and male hop accession number USDA 21422M. These genome assemblies, gene annotations, along with other common data, coupled with a genome browser and BLAST database enable the hop community to enter the genomic age. The HopBase genomic resource is accessible at http://hopbase.org and http://hopbase.cgrb.oregonstate.edu. PMID:28415075

Generalized trajectory surface hopping method based on the Zhu-Nakamura theory

NASA Astrophysics Data System (ADS)

Oloyede, Ponmile; Mil'nikov, Gennady; Nakamura, Hiroki

2006-04-01

We present a generalized formulation of the trajectory surface hopping method applicable to a general multidimensional system. The method is based on the Zhu-Nakamura theory of a nonadiabatic transition and therefore includes the treatment of classically forbidden hops. The method uses a generalized recipe for the conservation of angular momentum after forbidden hops and an approximation for determining a nonadiabatic transition direction which is crucial when the coupling vector is unavailable. This method also eliminates the need for a rigorous location of the seam surface, thereby ensuring its applicability to a wide class of chemical systems. In a test calculation, we implement the method for the DH2+ system, and it shows a remarkable agreement with the previous results of C. Zhu, H. Kamisaka, and H. Nakamura, [J. Chem. Phys. 116, 3234 (2002)]. We then apply it to a diatomic-in-molecule model system with a conical intersection, and the results compare well with exact quantum calculations. The successful application to the conical intersection system confirms the possibility of directly extending the present method to an arbitrary potential of general topology.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

A Study on Coexistence Capability Evaluations of the Enhanced Channel Hopping Mechanism in WBANs

PubMed Central

Wei, Zhongcheng; Sun, Yongmei; Ji, Yuefeng

2017-01-01

As an important coexistence technology, channel hopping can reduce the interference among Wireless Body Area Networks (WBANs). However, it simultaneously brings some issues, such as energy waste, long latency and communication interruptions, etc. In this paper, we propose an enhanced channel hopping mechanism that allows multiple WBANs coexisted in the same channel. In order to evaluate the coexistence performance, some critical metrics are designed to reflect the possibility of channel conflict. Furthermore, by taking the queuing and non-queuing behaviors into consideration, we present a set of analysis approaches to evaluate the coexistence capability. On the one hand, we present both service-dependent and service-independent analysis models to estimate the number of coexisting WBANs. On the other hand, based on the uniform distribution assumption and the additive property of Possion-stream, we put forward two approximate methods to compute the number of occupied channels. Extensive simulation results demonstrate that our estimation approaches can provide an effective solution for coexistence capability estimation. Moreover, the enhanced channel hopping mechanism can significantly improve the coexistence capability and support a larger arrival rate of WBANs. PMID:28098818

Let Me Blow Your Mind: Hip Hop Feminist Futures in Theory and Praxis

ERIC Educational Resources Information Center

Lindsey, Treva B.

2015-01-01

This essay brings together key theoretical interventions in hip-hop feminism to explore the continued, but undervalued, significance of hip-hop feminism in urban education. More specifically, the essay challenges narrow conceptualizations of the "hip hop subject" as Black and male by using hip-hop feminist theory to incorporate the lived…

Altered biomechanical strategies and medio-lateral control of the knee represent incomplete recovery of individuals with injury during single leg hop.

PubMed

Roos, Paulien E; Button, Kate; Sparkes, Valerie; van Deursen, Robert W M

2014-02-07

Anterior cruciate ligament (ACL) injury can result in failure to return to pre-injury activity levels and future osteoarthritis predisposition. Single leg hop is used in late rehabilitation to evaluate recovery and inform treatment but biomechanical understanding of this activity is insufficient. This study investigated single leg hop for distance aiming to evaluate if ACL patients had recovered: (1) landing strategies and (2) medio-lateral knee control. We hypothesized that patients with reconstructive surgery (ACLR) would have more similar landing strategies and knee control to healthy controls than patients treated conservatively (ACLD). 16 ACLD and 23 ACLR subjects were compared to 20 healthy controls (CONT). Kinematic and ground reaction force data were collected while subjects hopped their maximum distance. The main output parameters were hop distance, peak knee flexor angles and extensor moments and Fluency (a measure introduced to represent medio-lateral knee control). Statistical differences between ACL and control groups were analyzed using a general linear model univariate analysis, with COM velocity prior to landing as covariate. Hop distance was the smallest for ACLD and largest for CONT (p<0.001; ACLD 57.1±14.1; ACLR 75.1±17.8; CONT 77.7±14.07% height). ACLR used a similar kinematic strategy to CONT, but had a reduced peak knee extensor moment (p<0.001; ACLD 0.32±0.14; ACLR 0.31±0.16; CONT 0.42±0.13 BW.height). Fluency was reduced in both ACLD and ACLR (p=0.006; ACLD 0.13±0.34; ACLR 0.14±0.34; CONT 0.17±0.41s). Clinical practice uses hopping distance to evaluate ACL patients' recovery. This study demonstrated that aspects such as movement strategies and knee control need to be evaluated. © 2013 Published by Elsevier Ltd.

Low-coverage surface diffusion in complex periodic energy landscapes: Analytical solution for systems with symmetric hops and application to intercalation in topological insulators

NASA Astrophysics Data System (ADS)

Gosálvez, Miguel A.; Otrokov, Mikhail M.; Ferrando, Nestor; Ryabishchenkova, Anastasia G.; Ayuela, Andres; Echenique, Pedro M.; Chulkov, Evgueni V.

2016-02-01

This is the first of two papers that introduce a general expression for the tracer diffusivity in complex, periodic energy landscapes with M distinct hop rates in one-, two-, and three-dimensional diluted systems (low-coverage, single-tracer limit). The present report focuses on the analysis of diffusion in systems where the end sites of the hops are located symmetrically with respect to the hop origins (symmetric hops), as encountered in many ideal surfaces and bulk materials. For diffusion in two dimensions, a number of formulas are presented for complex combinations of the different hops in systems with triangular, rectangular, and square symmetry. The formulas provide values in excellent agreement with kinetic Monte Carlo simulations, concluding that the diffusion coefficient can be directly determined from the proposed expressions without performing the simulations. Based on the diffusion barriers obtained from first-principles calculations and a physically meaningful estimate of the attempt frequencies, the proposed formulas are used to analyze the diffusion of Cu, Ag, and Rb adatoms on the surface and within the van der Waals (vdW) gap of a model topological insulator, Bi2Se3 . Considering the possibility of adsorbate intercalation from the terraces to the vdW gaps at morphological steps, we infer that, at low coverage and room temperature, (i) a majority of the Rb atoms bounce back at the steps and remain on the terraces, (ii) Cu atoms mostly intercalate into the vdW gap, the remaining fraction staying at the steps, and (iii) Ag atoms essentially accumulate at the steps and gradually intercalate into the vdW gap. These conclusions are in good qualitative agreement with previous experiments. The companion report (M. A. Gosálvez et al., Phys. Rev. B, submitted] extends the present study to the description of systems that contain asymmetric hops.

Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

NASA Astrophysics Data System (ADS)

Moktan, Hem; Pezza, Roberto; Zhou, Donghua

2015-03-01

The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

Featherless Dinosaurs and the Hip-Hop Simulacrum: Reconsidering Hip-Hop's Appropriateness for the Music Classroom

ERIC Educational Resources Information Center

Kruse, Adam J.

2016-01-01

This article offers considerations for music teachers interested in including hip-hop music in their classrooms but who might feel concerned with or overwhelmed by issues of appropriateness. Two concerns related to hip-hop music are examined: language and negative social themes. Commercial interests in hip-hop music have created a simulacrum (or…

The Formation of "Hip-Hop Academicus"--How American Scholars Talk about the Academisation of Hip-Hop

ERIC Educational Resources Information Center

Soderman, Johan

2013-01-01

Social activism and education have been associated with hip-hop since it emerged in New York City 38 years ago. Therefore, it might not be surprising that universities have become interested in hip-hop. This article aims to highlight this "hip-hop academisation" and analyse the discursive mechanisms that manifest in these academisation…

Quantum phase transitions of the one-dimensional Peierls-Hubbard model with next-nearest-neighbor hopping integrals

NASA Astrophysics Data System (ADS)

Otsuka, Hiromi

1998-06-01

We investigate two kinds of quantum phase transitions observed in the one-dimensional half-filled Peierls-Hubbard model with the next-nearest-neighbor hopping integral in the strong-coupling region U>>t, t' [t (t'), nearest- (next-nearest-) neighbor hopping; U, on-site Coulomb repulsion]. In the uniform case, with the help of the conformal field theory prediction, we numerically determine a phase boundary t'c(U/t) between the spin-fluid and the dimer states, where a bare coupling of the marginal operator vanishes and the low-energy and long-distance behaviors of the spin part are described by a free-boson model. To exhibit the conformal invariance of the systems on the phase boundary, a multiplet structure of the excitation spectrum of finite-size systems and a value of the central charge are also examined. The critical phenomenological aspect of the spin-Peierls transitions accompanied by the lattice dimerization is then argued for the systems on the phase boundary; the existence of logarithmic corrections to the power-law behaviors of the energy gain and the spin gap (i.e., the Cross-Fisher scaling law) are discussed.

Hip-hop as a resource for understanding the urban context

NASA Astrophysics Data System (ADS)

Brown, Bryan

2010-06-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to his work. First, he contends that students develop communal relationships and collective identities based on the common experiences expressed in hip-hop. Second, he identifies how the conscious recognition of institutional oppression serves a central feature in urban schools. Emdin's rich, and personal call for a greater understanding of hip-hop culture provides the text with an unmatched strength. He skillfully uses personal narratives from his own experience as well as quotes and references from hip-hop songs to make the nuances of hip hop transparent to science educators. Conversely, the limitation of this text is found in its unfulfilled promise to provide pragmatic examples of how to engage in a hip-hop based science education. Emdin's work is ultimately valuable as it extends our current knowledge about urban students and hip-hop in meaningful ways.

Where Is My Stuff? Conceptualizing Hip Hop as "Play"

ERIC Educational Resources Information Center

Broughton, Anthony

2017-01-01

Cultural continuity between home and school has been emphasized in a range of research concerning diversity and multicultural education [Colombo, M. (2005). "Reflections from teachers of culturally diverse children." "Young Children, Beyond the Journal," 60(6). Retrieved from…

Treatment of homozygous familial hypercholesterolaemia in paediatric patients: A monocentric experience.

PubMed

Buonuomo, Paola S; Macchiaiolo, Marina; Leone, Giovanna; Valente, Paola; Mastrogiorgio, Gerarda; Gnazzo, Maria; Rana, Ippolita; Gonfiantini, Michaela V; Gagliardi, Maria G; Romano, Francesca; Bartuli, Andrea

2018-01-01

Background Homozygous familial hypercholesterolaemia is a rare life-threatening disease characterized by markedly elevated low-density lipoprotein cholesterol (LDL-C) concentrations and accelerated atherosclerosis. The presence of double gene defects in the LDL-Receptor, either the same defect (homozygous) or two different LDL-raising mutations (compound heterozygotes) or other variants, identify the homozygous phenotype (HopFH). Apheresis is a procedure in which plasma is separated from red blood cells before the physical removal of LDL-C or the LDL-C is directly removed from whole blood. It is currently the treatment of choice for patients with HopFH whose LDL-C levels are not able to be reduced to target levels with conventional lipid-lowering drug therapy. Design The aim of this study is to report a cohort of six paediatric patients and to evaluate the long term efficacy of combined medical therapy and LDL-apheresis on LDL-C reduction. Methods We collected data from six children with confirmed diagnosis of HopFH (two females and four males; age range at diagnosis 3-8 years, mean 6 ± 1 years) from a single clinical hospital in Italy from 2007 to 2017. Results Clinical manifestations and outcomes may greatly vary in children with HopFH. Medical therapy and LDL-apheresis for the severe form should be started promptly in order to prevent cardiovascular disease. Conclusions Lipoprotein apheresis is a very important tool in managing patients with HopFH at high risk of cardiovascular disease. Based on our experience and the literature data, the method is feasible in very young children, efficient regarding biological results and cardiac events, and safe with minor side-effects and technical problems. We advise treating homozygous and compound heterozygous children as soon as possible.

AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

PubMed

Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

2015-06-01

In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

Chemical function based pharmacophore generation of endothelin-A selective receptor antagonists.

PubMed

Funk, Oliver F; Kettmann, Viktor; Drimal, Jan; Langer, Thierry

2004-05-20

Both quantitative and qualitative chemical function based pharmacophore models of endothelin-A (ET(A)) selective receptor antagonists were generated by using the two algorithms HypoGen and HipHop, respectively, which are implemented in the Catalyst molecular modeling software. The input for HypoGen is a training set of 18 ET(A) antagonists exhibiting IC(50) values ranging between 0.19 nM and 67 microM. The best output hypothesis consists of five features: two hydrophobic (HY), one ring aromatic (RA), one hydrogen bond acceptor (HBA), and one negative ionizable (NI) function. The highest scoring Hip Hop model consists of six features: three hydrophobic (HY), one ring aromatic (RA), one hydrogen bond acceptor (HBA), and one negative ionizable (NI). It is the result of an input of three highly active, selective, and structurally diverse ET(A) antagonists. The predictive power of the quantitative model could be approved by using a test set of 30 compounds, whose activity values spread over 6 orders of magnitude. The two pharmacophores were tested according to their ability to extract known endothelin antagonists from the 3D molecular structure database of Derwent's World Drug Index. Thereby the main part of selective ET(A) antagonistic entries was detected by the two hypotheses. Furthermore, the pharmacophores were used to screen the Maybridge database. Six compounds were chosen from the output hit lists for in vitro testing of their ability to displace endothelin-1 from its receptor. Two of these are new potential lead compounds because they are structurally novel and exhibit satisfactory activity in the binding assay.

Ionization equilibrium at the transition from valence-band to acceptor-band migration of holes in boron-doped diamond

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poklonski, N. A., E-mail: poklonski@bsu.by; Vyrko, S. A.; Poklonskaya, O. N.

A quasi-classical model of ionization equilibrium in the p-type diamond between hydrogen-like acceptors (boron atoms which substitute carbon atoms in the crystal lattice) and holes in the valence band (v-band) is proposed. The model is applicable on the insulator side of the insulator–metal concentration phase transition (Mott transition) in p-Dia:B crystals. The densities of the spatial distributions of impurity atoms (acceptors and donors) and of holes in the crystal are considered to be Poissonian, and the fluctuations of their electrostatic potential energy are considered to be Gaussian. The model accounts for the decrease in thermal ionization energy of boron atomsmore » with increasing concentration, as well as for electrostatic fluctuations due to the Coulomb interaction limited to two nearest point charges (impurity ions and holes). The mobility edge of holes in the v-band is assumed to be equal to the sum of the threshold energy for diffusion percolation and the exchange energy of the holes. On the basis of the virial theorem, the temperature T{sub j} is determined, in the vicinity of which the dc band-like conductivity of holes in the v-band is approximately equal to the hopping conductivity of holes via the boron atoms. For compensation ratio (hydrogen-like donor to acceptor concentration ratio) K ≈ 0.15 and temperature T{sub j}, the concentration of “free” holes in the v-band and their jumping (turbulent) drift mobility are calculated. Dependence of the differential energy of thermal ionization of boron atoms (at the temperature 3T{sub j}/2) as a function of their concentration N is calculated. The estimates of the extrapolated into the temperature region close to T{sub j} hopping drift mobility of holes hopping from the boron atoms in the charge states (0) to the boron atoms in the charge states (−1) are given. Calculations based on the model show good agreement with electrical conductivity and Hall effect measurements for p-type diamond with boron atom concentrations in the range from 3 × 10{sup 17} to 3 × 10{sup 20 }cm{sup −3}, i.e., up to the Mott transition. The model uses no fitting parameters.« less

Basin Hopping Graph: a computational framework to characterize RNA folding landscapes

PubMed Central

Kucharík, Marcel; Hofacker, Ivo L.; Stadler, Peter F.; Qin, Jing

2014-01-01

Motivation: RNA folding is a complicated kinetic process. The minimum free energy structure provides only a static view of the most stable conformational state of the system. It is insufficient to give detailed insights into the dynamic behavior of RNAs. A sufficiently sophisticated analysis of the folding free energy landscape, however, can provide the relevant information. Results: We introduce the Basin Hopping Graph (BHG) as a novel coarse-grained model of folding landscapes. Each vertex of the BHG is a local minimum, which represents the corresponding basin in the landscape. Its edges connect basins when the direct transitions between them are ‘energetically favorable’. Edge weights endcode the corresponding saddle heights and thus measure the difficulties of these favorable transitions. BHGs can be approximated accurately and efficiently for RNA molecules well beyond the length range accessible to enumerative algorithms. Availability and implementation: The algorithms described here are implemented in C++ as standalone programs. Its source code and supplemental material can be freely downloaded from http://www.tbi.univie.ac.at/bhg.html. Contact: qin@bioinf.uni-leipzig.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24648041

Modeling and Performance Optimization of Large-Scale Data-Communication Networks.

DTIC Science & Technology

1981-06-01

IT-17, no. 1, pp. 71-76, 1971. 12. Y. Ho, M. Kastner, and E. Wong, "Teams, market signalling, and information theory," IEEE Trans. Automat. Contr...modifies the flow assignment to satisfy end-to-end delay constraints. 3.2.1 Rationale for Min-Hop Strategr The Min-Hop algorithm proposed in this...Prentice-Hall, 1980. Ho, Y., M. Kostner and E. Wong, "Teams, market signalling, and information theory," IEEE Trans. Automat. Contr., vol. AC-23, pp

Starting with Style: Toward a Second Wave of Hip-Hop Education Research and Practice

ERIC Educational Resources Information Center

Petchauer, Emery

2015-01-01

One fundamental breakthrough in the field of hip-hop education in recent years is the shift from understanding hip-hop solely as content to understanding hip-hop also as aesthetic form. In this article, I chart the roots of this shift across disciplines and focus on what it might mean for the future of hip-hop education, pedagogy, and research in…

Study of Exciton Hopping Transport in PbS Colloidal Quantum Dot Thin Films Using Frequency- and Temperature-Scanned Photocarrier Radiometry

NASA Astrophysics Data System (ADS)

Hu, Lilei; Mandelis, Andreas; Melnikov, Alexander; Lan, Xinzheng; Hoogland, Sjoerd; Sargent, Edward H.

2017-01-01

Solution-processed colloidal quantum dots (CQDs) are promising materials for realizing low-cost, large-area, and flexible photovoltaic devices. The study of charge carrier transport in quantum dot solids is essential for understanding energy conversion mechanisms. Recently, solution-processed two-layer oleic-acid-capped PbS CQD solar cells with one layer treated with tetrabutylammonium iodide (TBAI) serving as the main light-absorbing layer and the other treated with 1,2-ethanedithiol (EDT) acting as an electron-blocking/hole-extraction layer were reported. These solar cells demonstrated a significant improvement in power conversion efficiency of 8.55% and long-term air stability. Coupled with photocarrier radiometry measurements, this work used a new trap-state mediated exciton hopping transport model, specifically for CQD thin films, to unveil and quantify exciton transport mechanisms through the extraction of hopping transport parameters including exciton lifetimes, hopping diffusivity, exciton detrapping time, and trap-state density. It is shown that PbS-TBAI has higher trap-state density than PbS-EDT that results in higher PbS-EDT exciton lifetimes. Hopping diffusivities of both CQD thin film types show similar temperature dependence, particularly higher temperatures yield higher hopping diffusivity. The higher diffusivity of PbS-TBAI compared with PbS-EDT indicates that PbS-TBAI is a much better photovoltaic material than PbS-EDT. Furthermore, PCR temperature spectra and deep-level photothermal spectroscopy provided additional insights to CQD surface trap states: PbS-TBAI thin films exhibit a single dominant trap level, while PbS-EDT films with lower trap-state densities show multiple trap levels.

Generalized trajectory surface-hopping method for internal conversion and intersystem crossing

NASA Astrophysics Data System (ADS)

Cui, Ganglong; Thiel, Walter

2014-09-01

Trajectory-based fewest-switches surface-hopping (FSSH) dynamics simulations have become a popular and reliable theoretical tool to simulate nonadiabatic photophysical and photochemical processes. Most available FSSH methods model internal conversion. We present a generalized trajectory surface-hopping (GTSH) method for simulating both internal conversion and intersystem crossing processes on an equal footing. We consider hops between adiabatic eigenstates of the non-relativistic electronic Hamiltonian (pure spin states), which is appropriate for sufficiently small spin-orbit coupling. This choice allows us to make maximum use of existing electronic structure programs and to minimize the changes to available implementations of the traditional FSSH method. The GTSH method is formulated within the quantum mechanics (QM)/molecular mechanics framework, but can of course also be applied at the pure QM level. The algorithm implemented in the GTSH code is specified step by step. As an initial GTSH application, we report simulations of the nonadiabatic processes in the lowest four electronic states (S0, S1, T1, and T2) of acrolein both in vacuo and in acetonitrile solution, in which the acrolein molecule is treated at the ab initio complete-active-space self-consistent-field level. These dynamics simulations provide detailed mechanistic insight by identifying and characterizing two nonadiabatic routes to the lowest triplet state, namely, direct S1 → T1 hopping as major pathway and sequential S1 → T2 → T1 hopping as minor pathway, with the T2 state acting as a relay state. They illustrate the potential of the GTSH approach to explore photoinduced processes in complex systems, in which intersystem crossing plays an important role.

Overcoming the research-to-practice gap: A randomized trial with two brief homework and organization interventions for students with ADHD as implemented by school mental health providers.

PubMed

Langberg, Joshua M; Dvorsky, Melissa R; Molitor, Stephen J; Bourchtein, Elizaveta; Eddy, Laura D; Smith, Zoe R; Oddo, Lauren E; Eadeh, Hana-May

2018-01-01

To evaluate the effectiveness of 2 brief school-based interventions targeting the homework problems of adolescents with attention-deficit/hyperactivity disorder (ADHD)-the Homework, Organization, and Planning Skills (HOPS) intervention and the Completing Homework by Improving Efficiency and Focus (CHIEF) intervention, as implemented by school mental health providers during the school day. A secondary goal was to use moderator analyses to identify student characteristics that may differentially predict intervention response. Two-hundred and eighty middle school students with ADHD were randomized to the HOPS or CHIEF interventions or to waitlist, and parent and teacher ratings were collected pre, post, and at a 6-month follow-up. Both interventions were implemented with fidelity by school mental health providers. Participants were pulled from elective periods and sessions averaged less than 20 min. Participants in HOPS and CHIEF demonstrated significantly greater improvements in comparison with waitlist on parent ratings of homework problems and organizational skills and effect sizes were large. HOPS participants also demonstrated moderate effect size improvements on materials management and organized action behaviors according to teachers. HOPS participants made significantly greater improvements in parent- and teacher-rated use of organized actions in comparison with CHIEF, but not on measures of homework problems. Moderation analyses revealed that participants with more severe psychopathology and behavioral dysregulation did significantly better with the HOPS intervention as compared to the CHIEF intervention. Brief school-based interventions implemented by school providers can be effective. This type of service delivery model may facilitate overcoming the oft cited research-to-practice gap. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

High-Speed On-Board Data Processing for Science Instruments: HOPS

NASA Technical Reports Server (NTRS)

Beyon, Jeffrey

2015-01-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 â€" April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

Sufficient Amounts of Functional HOP2/MND1 Complex Promote Interhomolog DNA Repair but Are Dispensable for Intersister DNA Repair during Meiosis in Arabidopsis[W

PubMed Central

Uanschou, Clemens; Ronceret, Arnaud; Von Harder, Mona; De Muyt, Arnaud; Vezon, Daniel; Pereira, Lucie; Chelysheva, Liudmila; Kobayashi, Wataru; Kurumizaka, Hitoshi; Schlögelhofer, Peter; Grelon, Mathilde

2013-01-01

During meiosis, homologous recombination (HR) is essential to repair programmed DNA double-strand breaks (DSBs), and a dedicated protein machinery ensures that the homologous chromosome is favored over the nearby sister chromatid as a repair template. The HOMOLOGOUS-PAIRING PROTEIN2/MEIOTIC NUCLEAR DIVISION PROTEIN1 (HOP2/MND1) protein complex has been identified as a crucial factor of meiotic HR in Arabidopsis thaliana, since loss of either MND1 or HOP2 results in failure of DNA repair. We isolated two mutant alleles of HOP2 (hop2-2 and hop2-3) that retained the capacity to repair meiotic DSBs via the sister chromatid but failed to use the homologous chromosome. We show that in these alleles, the recombinases RADIATION SENSITIVE51 (RAD51) and DISRUPTED MEIOTIC cDNA1 (DMC1) are loaded, but only the intersister DNA repair pathway is activated. The hop2-2 phenotype is correlated with a decrease in HOP2/MND1 complex abundance. In hop2-3, a truncated HOP2 protein is produced that retains its ability to bind to DMC1 and DNA but forms less stable complexes with MND1 and fails to efficiently stimulate DMC1-driven D-loop formation. Genetic analyses demonstrated that in the absence of DMC1, HOP2/MND1 is dispensable for RAD51-mediated intersister DNA repair, while in the presence of DMC1, a minimal amount of functional HOP2/MND1 is essential to drive intersister DNA repair. PMID:24363313

Hopping Robot with Wheels

NASA Technical Reports Server (NTRS)

Barlow, Edward; Marzwell, Nevellie; Fuller, Sawyer; Fionni, Paolo; Tretton, Andy; Burdick, Joel; Schell, Steve

2003-01-01

A small prototype mobile robot is capable of (1) hopping to move rapidly or avoid obstacles and then (2) moving relatively slowly and precisely on the ground by use of wheels in the manner of previously reported exploratory robots of the "rover" type. This robot is a descendant of a more primitive hopping robot described in "Minimally Actuated Hopping Robot" (NPO- 20911), NASA Tech Briefs, Vol. 26, No. 11 (November 2002), page 50. There are many potential applications for robots with hopping and wheeled-locomotion (roving) capabilities in diverse fields of endeavor, including agriculture, search-and-rescue operations, general military operations, removal or safe detonation of land mines, inspection, law enforcement, and scientific exploration on Earth and remote planets. The combination of hopping and roving enables this robot to move rapidly over very rugged terrain, to overcome obstacles several times its height, and then to position itself precisely next to a desired target. Before a long hop, the robot aims itself in the desired hopping azimuth and at a desired takeoff angle above horizontal. The robot approaches the target through a series of hops and short driving operations utilizing the steering wheels for precise positioning.

Field-dependent hopping conduction

NASA Astrophysics Data System (ADS)

Hayashi, T.; Tokura, Y.; Fujiwara, A.

2018-07-01

We have numerically calculated transport characteristics on a Miller-Abraham network in a non-linear regime by solving the Kirchhoff's current law at each site. Assuming the Mott model, we obtained the relation between current density and electric field, J ∝exp(γ√{ E}) , which has often been observed in low-mobility materials and whose mechanism has been a source of controversy for over half a century. Our numerical calculation makes it possible to analyze the energy configuration of relevant hopping sites and visualize percolation networks. Following the percolation theory proposed by Shklovskii [Shklovskii, Sov. Phys. Semicond. 10, 855 (1976)], we show that the main mechanism of the field dependence is the replacement of dominating resistances accompanied by the geometrical evolution of the percolation networks. Our calculation is so general that it can be applied to hopping transport in a variety of systems.

Hopping and band mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) from first principle calculations.

PubMed

Kobayashi, Hajime; Kobayashi, Norihito; Hosoi, Shizuka; Koshitani, Naoki; Murakami, Daisuke; Shirasawa, Raku; Kudo, Yoshihiro; Hobara, Daisuke; Tokita, Yuichi; Itabashi, Masao

2013-07-07

Hopping and band mobilities of holes in organic semiconductors at room temperature were estimated from first principle calculations. Relaxation times of charge carriers were evaluated using the acoustic deformation potential model. It is found that van der Waals interactions play an important role in determining accurate relaxation times. The hopping mobilities of pentacene, rubrene, and 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) in bulk single crystalline structures were found to be smaller than 4 cm(2)∕Vs, whereas the band mobilities were estimated between 36 and 58 cm(2)∕Vs, which are close to the maximum reported experimental values. This strongly suggests that band conductivity is dominant in these materials even at room temperature.

Disruption of prion protein-HOP engagement impairs glioblastoma growth and cognitive decline and improves overall survival.

PubMed

Lopes, M H; Santos, T G; Rodrigues, B R; Queiroz-Hazarbassanov, N; Cunha, I W; Wasilewska-Sampaio, A P; Costa-Silva, B; Marchi, F A; Bleggi-Torres, L F; Sanematsu, P I; Suzuki, S H; Oba-Shinjo, S M; Marie, S K N; Toulmin, E; Hill, A F; Martins, V R

2015-06-01

Glioblastomas (GBMs) are resistant to current therapy protocols and identification of molecules that target these tumors is crucial. Interaction of secreted heat-shock protein 70 (Hsp70)-Hsp90-organizing protein (HOP) with cellular prion protein (PrP(C)) triggers a large number of trophic effects in the nervous system. We found that both PrP(C) and HOP are highly expressed in human GBM samples relative to non-tumoral tissue or astrocytoma grades I-III. High levels of PrP(C) and HOP were associated with greater GBM proliferation and lower patient survival. HOP-PrP(C) binding increased GBM proliferation in vitro via phosphatidylinositide 3-kinase and extracellular-signal-regulated kinase pathways, and a HOP peptide mimicking the PrP(C) binding site (HOP230-245) abrogates this effect. PrP(C) knockdown impaired tumor growth and increased survival of mice with tumors. In mice, intratumor delivery of HOP230-245 peptide impaired proliferation and promoted apoptosis of GBM cells. In addition, treatment with HOP230-245 peptide inhibited tumor growth, maintained cognitive performance and improved survival. Thus, together, the present results indicate that interfering with PrP(C)-HOP engagement is a promising approach for GBM therapy.

Systematic characterization of a 1550 nm microelectromechanical (MEMS)-tunable vertical-cavity surface-emitting laser (VCSEL) with 7.92 THz tuning range for terahertz photomixing systems

NASA Astrophysics Data System (ADS)

Haidar, M. T.; Preu, S.; Cesar, J.; Paul, S.; Hajo, A. S.; Neumeyr, C.; Maune, H.; Küppers, F.

2018-01-01

Continuous-wave (CW) terahertz (THz) photomixing requires compact, widely tunable, mode-hop-free driving lasers. We present a single-mode microelectromechanical system (MEMS)-tunable vertical-cavity surface-emitting laser (VCSEL) featuring an electrothermal tuning range of 64 nm (7.92 THz) that exceeds the tuning range of commercially available distributed-feedback laser (DFB) diodes (˜4.8 nm) by a factor of about 13. We first review the underlying theory and perform a systematic characterization of the MEMS-VCSEL, with particular focus on the parameters relevant for THz photomixing. These parameters include mode-hop-free CW tuning with a side-mode-suppression-ratio >50 dB, a linewidth as narrow as 46.1 MHz, and wavelength and polarization stability. We conclude with a demonstration of a CW THz photomixing setup by subjecting the MEMS-VCSEL to optical beating with a DFB diode driving commercial photomixers. The achievable THz bandwidth is limited only by the employed photomixers. Once improved photomixers become available, electrothermally actuated MEMS-VCSELs should allow for a tuning range covering almost the whole THz domain with a single system.

Mode Tracker for Mode-Hop-Free Operation of a Laser

NASA Technical Reports Server (NTRS)

Wysocki, Gerard; Tittel, Frank K.; Curl, Robert F.

2010-01-01

A mode-tracking system that includes a mode-controlling subsystem has been incorporated into an external-cavity (EC) quantum cascade laser that operates in a mid-infrared wavelength range. The mode-tracking system makes it possible to perform mode-hop-free wavelength scans, as needed for high-resolution spectroscopy and detection of trace gases. The laser includes a gain chip, a beam-collimating lens, and a diffraction grating. The grating is mounted on a platform, the position of which can be varied to effect independent control of the EC length and the grating angle. The position actuators include a piezoelectric stage for translation control and a motorized stage for coarse rotation control equipped with a piezoelectric actuator for fine rotation control. Together, these actuators enable control of the EC length over a range of about 90 m with a resolution of 0.9 nm, and control of the grating angle over a coarse-tuning range of +/-6.3deg and a fine-tuning range of +/-520 microrad with a resolution of 10 nrad. A mirror mounted on the platform with the grating assures always the same direction of the output laser beam.

Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy.

PubMed

Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L

2016-12-01

Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD 0-200ms , and the knee extension moment was positively associated with RTD 0-200ms . At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD 0-200ms , and RTD 0-peak torque . Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance.

Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy

PubMed Central

Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.

2016-01-01

Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD0-200ms, and the knee extension moment was positively associated with RTD0-200ms. At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD0-200ms, and RTD0–peak torque. Conclusion: Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Clinical Relevance: Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance. PMID:28210647

Low-frequency dielectric properties of intrinsic and Al-doped rutile TiO{sub 2} thin films grown by the atomic layer deposition technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kassmi, M.; LMOP, El Manar University, Tunis 2092; Pointet, J.

2016-06-28

Dielectric spectroscopy is carried out for intrinsic and aluminum-doped TiO{sub 2} rutile films which are deposited on RuO{sub 2} by the atomic layer deposition technique. Capacitance and conductance are measured in the 0.1 Hz–100 kHz range, for ac electric fields up to 1 MV{sub rms}/cm. Intrinsic films have a much lower dielectric constant than rutile crystals. This is ascribed to the presence of oxygen vacancies which depress polarizability. When Al is substituted for Ti, the dielectric constant further decreases. By considering Al-induced modification of polarizability, a theoretical relationship between the dielectric constant and the Al concentration is proposed. Al doping drastically decreasesmore » the loss in the very low frequency part of the spectrum. However, Al doping has almost no effect on the loss at high frequencies. The effect of Al doping on loss is discussed through models of hopping transport implying intrinsic oxygen vacancies and Al related centers. When increasing the ac electric field in the MV{sub rms}/cm range, strong voltage non-linearities are evidenced in undoped films. The conductance increases exponentially with the ac field and the capacitance displays negative values (inductive behavior). Hopping barrier lowering is proposed to explain high-field effects. Finally, it is shown that Al doping strongly improves the high-field dielectric behavior.« less

Electrical and magnetic properties of La0.67Ba0.33Mn1- x (Me) x O3 perovskite manganites: case of manganese substituted by trivalent (Me = Cr) and tetravalent (Me = Ti) elements

NASA Astrophysics Data System (ADS)

Oumezzine, Marwène; Peña, Octavio; Kallel, Sami; Kallel, Nabil; Guizouarn, Thierry; Gouttefangeas, Francis; Oumezzine, Mohamed

2014-03-01

The effects of non-magnetic Ti4+ substitution on the structural, electrical and magnetic properties of La0.67Ba0.33Mn1- x Ti x O3 (0≤ x≤0.1) are investigated and compared to those existing in La0.67Ba0.33Mn1- x Cr x O3 (magnetic Cr3+). The structural refinement by the Rietveld method revealed that Ti-doped samples crystallize in the cubic lattice with space group , while samples with Cr crystallize in the hexagonal setting of the rhombohedral space group for identical contents of dopant. The most relevant structural features are an increase of the lattice parameters, of the cell volume and of the inter-ionic distances with increasing Ti doping level. Both series of samples show a decrease of the paramagnetic-ferromagnetic transition temperature when the amount of chromium or titanium increases. Transport measurements show that when increasing the metal doping, the resistivity increases whereas the metallic behavior of the parent compound La0.67Ba0.33MnO3 is destroyed. For a substitution higher than 5 at.% of Ti and 10 at.% of Cr, the samples exhibit a semiconducting behavior in the whole range of temperature, for which the electronic transport can be explained by variable range hopping and/or small polaron hopping models.

Scheduling with hop-by-hop priority increasing in meshed optical burst-switched network

NASA Astrophysics Data System (ADS)

Chang, Hao; Luo, Jiangtao; Zhang, Zhizhong; Xia, Da; Gong, Jue

2006-09-01

In OBS, JET (Just-Enough-Time) is the classical wavelength reservation scheme. But there is a phenomenon that the burst priority decreasing hop-by-hop in multi-hop networks that will waste the bandwidth that was used in the upstream. Based on the HPI (Hop-by-hop Priority Increasing) proposed in the former research, this paper will do an unprecedented simulation in 4×4 meshed topology, which is closer to the real network environment with the help of a NS2-based OBSN simulation platform constructed by ourselves. By contrasting, the drop probability and throughput on one of the longest end-to-end path lengths in the whole networks, it shows that the HPI scheme can improve the utilance of bandwidth better.

Is scaffold hopping a reliable indicator for the ability of computational methods to identify structurally diverse active compounds?

NASA Astrophysics Data System (ADS)

Dimova, Dilyana; Bajorath, Jürgen

2017-07-01

Computational scaffold hopping aims to identify core structure replacements in active compounds. To evaluate scaffold hopping potential from a principal point of view, regardless of the computational methods that are applied, a global analysis of conventional scaffolds in analog series from compound activity classes was carried out. The majority of analog series was found to contain multiple scaffolds, thus enabling the detection of intra-series scaffold hops among closely related compounds. More than 1000 activity classes were found to contain increasing proportions of multi-scaffold analog series. Thus, using such activity classes for scaffold hopping analysis is likely to overestimate the scaffold hopping (core structure replacement) potential of computational methods, due to an abundance of artificial scaffold hops that are possible within analog series.

Adsorption and dynamics of Si atoms at the monolayer Pb/Si(111) surface

NASA Astrophysics Data System (ADS)

Kumar, Rakesh; Fang, Chuang-Kai; Lee, Chih-Hao; Hwang, Ing-Shouh

2017-06-01

In this work, we studied the adsorption behavior of deposited Si atoms along with their diffusion and other dynamic processes on a Pb monolayer-covered Si(111) surface from 125 to 230 K using a variable-temperature scanning tunneling microscope. The Pb-covered Si(111) surface forms a low-symmetry rowlike (√{7 }×√{3 } ) structure in this temperature range and the Si atoms bind favorably to two specific on-top sites (T1 A and T1 B) on the trimer row after deposition at the sample temperature of ˜125 K . The Si atoms were immobile at low temperatures and started to switch between the two neighboring T1 A and T1 B sites within the same trimer when the temperature was raised to ˜150 K . When the temperature was raised above ˜160 K , the adsorbed Si atoms could hop to other trimers along the same trimer row. Below ˜170 K , short hops to adjacent trimers dominated, but long hops dominated at temperatures above ˜170 K . The activation energy and prefactor for the Si atoms diffusion were derived through analysis of continuous-time imaging at temperatures from 160 to 174 K. In addition, irreversible aggregation of single Si atoms into Si clusters started to occur at the phase boundaries or defective sites at temperatures above ˜170 K . At temperature above ˜180 K , nearly all Si atoms aggregated into clusters, which may have important implications for the atomic mechanism of epitaxial growth of Si on the Pb-covered Si(111) surface. In addition, our study provides strong evidence for breaking in the mirror symmetry in the (√{7 }×√{3 } )-Pb structure, which has implications for the atomic model of this controversial structure.

Structural, magnetic and spectral properties of Gd and Dy co-doped dielectrically modified Co-Ni (Ni0.4Co0.6Fe2O4) ferrites

NASA Astrophysics Data System (ADS)

Ditta, Allah; Khan, Muhammad Azhar; Junaid, Muhammad; Khalil, R. M. Arif; Warsi, Muhammad Farooq

2017-02-01

Gadolinium (Gd) and Dysprosium (Dy) co-doped Ni-Co (Ni0.4Co0.6Fe2O4) ferrites were prepared by micro-emulsion route. X-ray diffraction (XRD) analysis indicated the development of cubic spinel structure. The lattice parameter and X-ray density were found to increase from 8.24 to 8.31 Å and 5.57 to 5.91 (gm/cm3) respectively as the Gd-Dy contents increased in nickel-cobalt ferrites. The crystallite size calculated from the Scherrer's formula exhibited the formation of nanocrystalline ferrites (13-26 nm). Two foremost absorption bands observed in FTIR spectra within 400 cm-1 (υ2) to 600 cm-1 (υ1) which correspond to stretching vibrations of tetrahedral and octahedral complexes respectively. The dielectric constant (ε) and dielectric loss (tanδ) were decreased by the optimization of frequency and abrupt decrease in the low frequency region and higher values in the high frequency region were observed. The dielectric dispersion was due to rapid decrease of dielectric constant in the low frequency region. This variation of dielectric dispersion was explicated in the light of space charge polarization model of Maxwell-Wagner. The dielectric loss occurs in these ferrites due to electron hopping and defects in the dipoles. The electron hopping was possible at low frequency range but at higher frequency the dielectric loss was decreased with the decrease of electron hopping. Magnetic properties were observed by measuring M-H loops. Due to low dielectric loss and dielectric constant these materials were appropriate in the fabrication of switching and memory storage devices.

Hop crop wild relatives

USDA-ARS?s Scientific Manuscript database

The versatile hop plant, Humulus L., is a climbing, vine with a perennial root. The genus includes three species, H. japonicus, H. lupulus, and H. yunnanensis. The European hops (H. lupulus) is the species of primary economic importance from which most hop cultivars have been selected. This species ...

Quantifying exciton hopping in disordered media with quenching sites: Application to arrays of quantum dots

NASA Astrophysics Data System (ADS)

Miyazaki, Jun

2013-10-01

We present an analytical method for quantifying exciton hopping in an energetically disordered system with quenching sites. The method is subsequently used to provide a quantitative understanding of exciton hopping in a quantum dot (QD) array. Several statistical quantities that characterize the dynamics (survival probability, average number of distinct sites visited, average hopping distance, and average hopping rate in the initial stage) are obtained experimentally by measuring time-resolved fluorescence intensities at various temperatures. The time evolution of these quantities suggests in a quantitative way that at low temperature an exciton tends to be trapped at a local low-energy site, while at room temperature, exciton hopping occurs repeatedly, leading to a large hopping distance. This method will serve to facilitate highly efficient optoelectronic devices using QDs such as photovoltaic cells and light-emitting diodes, since exciton hopping is considered to strongly influence their operational parameters. The presence of a dark QD (quenching site) that exhibits fast decay is also quantified.

Scaffold-hopping from xanthines to tricyclic guanines: A case study of dipeptidyl peptidase 4 (DPP4) inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pissarnitski, Dmitri A.; Zhao, Zhiqiang; Cole, David

2016-11-01

Molecular modeling of unbound tricyclic guanine scaffolds indicated that they can serve as effective bioisosteric replacements of xanthines. This notion was further confirmed by a combination of X-ray crystallography and SAR studies, indicating that tricyclic guanine DPP4 inhibitors mimic the binding mode of xanthine inhibitors, exemplified by linagliptin. Realization of the bioisosteric relationship between these scaffolds potentially will lead to a wider application of cyclic guanines as xanthine replacements in drug discovery programs for a variety of biological targets. Newly designed DPP4 inhibitors achieved sub-nanomolar potency range and demonstrated oral activity in vivo in mouse glucose tolerance test.

Time synchronization of a frequency-hopped MFSK communication system

NASA Technical Reports Server (NTRS)

Simon, M. K.; Polydoros, A.; Huth, G. K.

1981-01-01

In a frequency-hopped (FH) multiple-frequency-shift-keyed (MFSK) communication system, frequency hopping causes the necessary frequency transitions for time synchronization estimation rather than the data sequence as in the conventional (nonfrequency-hopped) system. Making use of this observation, this paper presents a fine synchronization (i.e., time errors of less than a hop duration) technique for estimation of FH timing. The performance degradation due to imperfect FH time synchronization is found in terms of the effect on bit error probability as a function of full-band or partial-band noise jamming levels and of the number of hops used in the FH timing estimate.

Hop/STI1 modulates retinal proliferation and cell death independent of PrP{sup C}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arruda-Carvalho, Maithe; Njaine, Brian; Silveira, Mariana S.

Hop/STI1 is a co-chaperone adaptor protein for Hsp70/Hsp90 complexes. Hop/STI1 is found extracellularly and modulates cell death and differentiation through interaction with the prion protein (PrP{sup C}). Here, we investigated the expression of hop/STI1 and its role upon cell proliferation and cell death in the developing retina. Hop/STI1 is more expressed in developing rat retina than in the mature tissue. Hop/STI1 blocks retinal cell death in the neuroblastic layer (NBL) in a PrP{sup C} dependent manner, but failed to protect ganglion cells against axotomy-induced cell death. An antibody raised against hop/STI1 ({alpha}-STI1) blocked both ganglion cell and NBL cell deathmore » independent of PrP{sup C}. cAMP/PKA, ERK, PI3K and PKC signaling pathways were not involved in these effects. Hop/STI1 treatment reduced proliferation, while {alpha}-STI1 increased proliferation in the developing retina, both independent of PrP{sup C}. We conclude that hop/STI1 can modulate both proliferation and cell death in the developing retina independent of PrP{sup C}.« less

Varietal discrimination of hop pellets by near and mid infrared spectroscopy.

PubMed

Machado, Julio C; Faria, Miguel A; Ferreira, Isabel M P L V O; Páscoa, Ricardo N M J; Lopes, João A

2018-04-01

Hop is one of the most important ingredients of beer production and several varieties are commercialized. Therefore, it is important to find an eco-real-time-friendly-low-cost technique to distinguish and discriminate hop varieties. This paper describes the development of a method based on vibrational spectroscopy techniques, namely near- and mid-infrared spectroscopy, for the discrimination of 33 commercial hop varieties. A total of 165 samples (five for each hop variety) were analysed by both techniques. Principal component analysis, hierarchical cluster analysis and partial least squares discrimination analysis were the chemometric tools used to discriminate positively the hop varieties. After optimizing the spectral regions and pre-processing methods a total of 94.2% and 96.6% correct hop varieties discrimination were obtained for near- and mid-infrared spectroscopy, respectively. The results obtained demonstrate the suitability of these vibrational spectroscopy techniques to discriminate different hop varieties and consequently their potential to be used as an authenticity tool. Compared with the reference procedures normally used for hops variety discrimination these techniques are quicker, cost-effective, non-destructive and eco-friendly. Copyright © 2017 Elsevier B.V. All rights reserved.

Hospital and urban effluent waters as a source of accumulation of toxic metals in the sediment receiving system of the Cauvery River, Tiruchirappalli, Tamil Nadu, India.

PubMed

Devarajan, Naresh; Laffite, Amandine; Ngelikoto, Patience; Elongo, Vicky; Prabakar, Kandasamy; Mubedi, Josué I; Piana, Pius T M; Wildi, Walter; Poté, John

2015-09-01

Hospital and urban effluents contain a variety of toxic and/or persistent substances in a wide range of concentrations, and most of these compounds belong to the group of emerging contaminants. The release of these substances into the aquatic ecosystem can lead to the pollution of water resources and may place aquatic organisms and human health at risk. Sediments receiving untreated and urban effluent waters from the city of Tiruchirappalli in the state of Tamil Nadu, India, are analyzed for potential environmental and human health risks. The sediment samples were collected from five hospital outlet pipes (HOP) and from the Cauvery River Basin (CRB) both of which receive untreated municipal effluent waters (Tiruchirappalli, Tamil Nadu, India). The samples were characterized for grain size, organic matter, toxic metals, and ecotoxicity. The results highlight the high concentration of toxic metals in HOP, reaching values (mg kg(-1)) of 1851 (Cr), 210 (Cu), 986 (Zn), 82 (Pb), and 17 (Hg). In contrast, the metal concentrations in sediments from CRB were lower than the values found in the HOP (except for Cu, Pb), with maximum values (mg kg(-1)) of 75 (Cr), 906 (Cu), 649 (Zn), 111 (Pb), and 0.99 (Hg). The metal concentrations in all sampling sites largely exceed the Sediment Quality Guidelines (SQGs) and the Probable Effect Concentration (PEC) for the Protection of Aquatic Life recommendation. The ecotoxicity test with ostracods exposed to the sediment samples presents a mortality rate ranging from 22 to 100 % (in sediments from HOP) and 18-87 % (in sediments from CRB). The results of this study show the variation of toxic metal levels as well as toxicity in sediment composition related to both the type of hospital and the sampling period. The method of elimination of hospital and urban effluents leads to the pollution of water resources and may place aquatic organisms and human health at risk.

Relationships between postural orientation and self reported function, hop performance and muscle power in subjects with anterior cruciate ligament injury.

PubMed

Trulsson, Anna; Roos, Ewa M; Ageberg, Eva; Garwicz, Martin

2010-07-01

Injury to the anterior cruciate ligament (ACL) is associated not only with knee instability and impaired neuromuscular control, but also with altered postural orientation manifested as observable "substitution patterns". However, tests currently used to evaluate knee function in subjects with ACL injury are not designed to assess postural orientation. Therefore, we are in the process of developing an observational test set that measures postural orientation in terms of the ability to stabilize body segments in relation to each other and to the environment. The aim of the present study was to characterise correlations between this novel test set, called the Test for Substitution Patterns (TSP) and commonly used tests of knee function. In a blinded set-up, 53 subjects (mean age 30 years, range 20-39, with 2-5 years since ACL injury) were assessed using the TSP, the Knee Injury and Osteoarthritis Outcome Score subscale sport/recreation (KOOS sport/rec), 3 hop tests and 3 muscle power tests. Correlations between the scores of the TSP and the other tests were determined. Moderate correlations were found between TSP scores and KOOS sport/rec (rs = -0.43; p = 0.001) and between TSP scores and hop test results (rs = -0.40 to -0.46; p < or = 0.003), indicating that altered postural orientation was associated with worse self-reported KOOS sport/rec function and worse hop performance. No significant correlations were found between TSP scores and muscle power results. Subjects had higher TSP scores on their injured side than on their uninjured side (median 4 and 1 points; interquartile range 2-6 and 0-1.5, respectively; p < 0.0001). We conclude that the Test for Substitution Patterns is of relevance to the patient and measures a specific aspect of neuromuscular control not quantified by the other tests investigated. We suggest that the TSP may be a valuable complement in the assessment of neuromuscular control in the rehabilitation of subjects with ACL injury.

Consistency of Field-Based Measures of Neuromuscular Control Using Force-Plate Diagnostics in Elite Male Youth Soccer Players.

PubMed

Read, Paul J; Oliver, Jon L; Croix, Mark Ba De Ste; Myer, Gregory D; Lloyd, Rhodri S

2016-12-01

Read, P, Oliver, JL, Croix, MD, Myer, GD, and Lloyd, RS. Consistency of field-based measures of neuromuscular control using force-plate diagnostics in elite male youth soccer players. J Strength Cond Res 30(12): 3304-3311, 2016-Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players, and reliability data are sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force-plate diagnostics in this cohort. Twenty-six pre-peak height velocity (PHV) and 25 post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single-leg 75% horizontal hop and stick (75%HOP), and single-leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilization, time to pVGRF, and pVGRF asymmetry were recorded. A test-retest design was used, and reliability statistics included change in mean, intraclass correlation coefficient, and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the 3 protocols (CV range = 13.8-49.7%). Intraclass correlation coefficient values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be used to support a screening battery for elite male youth soccer players and for test-retest comparison.

Topological Sachdev-Ye-Kitaev model

NASA Astrophysics Data System (ADS)

Zhang, Pengfei; Zhai, Hui

2018-05-01

In this Rapid Communication, we construct a large-N exactly solvable model to study the interplay between interaction and topology, by connecting the Sachdev-Ye-Kitaev (SYK) model with constant hopping. The hopping forms a band structure that can exhibit both topologically trivial and nontrivial phases. Starting from a topologically trivial insulator with zero Hall conductance, we show that the interaction can drive a phase transition to a topologically nontrivial insulator with quantized nonzero Hall conductance, and a single gapless Dirac fermion emerges when the interaction is fine tuned to the critical point. The finite temperature effect is also considered, and we show that the topological phase with a stronger interaction is less stable against temperature. Our model provides a concrete example to illustrate the interacting topological phases and phase transitions, and can shed light on similar problems in physical systems.

Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn; School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ

Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loadingmore » concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.« less

Significance of the gate voltage-dependent mobility in the electrical characterization of organic field effect transistors

NASA Astrophysics Data System (ADS)

Kim, Jong Beom; Lee, Dong Ryeol

2018-04-01

We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.

Theoretical and Experimental Investigations of the Potential of Osmotic Energy for Power Production †

PubMed Central

Sharif, Adel O.; Merdaw, Ali A.; Aryafar, Maryam; Nicoll, Peter

2014-01-01

This paper presents a study on the potential of osmotic energy for power production. The study includes both pilot plant testing and theoretical modelling as well as cost estimation. A projected cost of £30/MWh of clean electricity could be achieved by using a Hydro-Osmotic Power (HOP) plant if a suitable membrane is used and the osmotic potential difference between the two solutions is greater than 25 bar; a condition that can be readily found in many sites around the world. Results have shown that the membrane system accounts for 50%–80% of the HOP plant cost depending on the salinity difference level. Thus, further development in membrane technology and identifying suitable membranes would have a significant impact on the feasibility of the process and the route to market. As the membrane permeability determines the HOP process feasibility, this paper also describes the effect of the interaction between the fluid and the membrane on the system permeability. It has been shown that both the fluid physical properties as well as the membrane micro-structural parameters need to be considered if further development of the HOP process is to be achieved. PMID:25110959

Theoretical and experimental investigations of the potential of osmotic energy for power production.

PubMed

Sharif, Adel O; Merdaw, Ali A; Aryafar, Maryam; Nicoll, Peter

2014-08-08

This paper presents a study on the potential of osmotic energy for power production. The study includes both pilot plant testing and theoretical modelling as well as cost estimation. A projected cost of £30/MWh of clean electricity could be achieved by using a Hydro-Osmotic Power (HOP) plant if a suitable membrane is used and the osmotic potential difference between the two solutions is greater than 25 bar; a condition that can be readily found in many sites around the world. Results have shown that the membrane system accounts for 50%-80% of the HOP plant cost depending on the salinity difference level. Thus, further development in membrane technology and identifying suitable membranes would have a significant impact on the feasibility of the process and the route to market. As the membrane permeability determines the HOP process feasibility, this paper also describes the effect of the interaction between the fluid and the membrane on the system permeability. It has been shown that both the fluid physical properties as well as the membrane micro-structural parameters need to be considered if further development of the HOP process is to be achieved.

Composite operators in the hopping parameter expansion in the free quark model

NASA Astrophysics Data System (ADS)

Kunszt, Z.

1983-11-01

I have calculated hopping parameter series of meson and baryon propagators up to O(K32) in the Wilson formulation of the free quark model. The position of branch point singularities has been found with the help of Padé approximants. The values of the position of the singularities in K agreed with the exact values within 1-2% in case of mesons and 4-5% in case of baryons. It is argued that in QCD at the cross-over region the systematic errors of the method must be even smaller. Part of this work has been done while the author was visiting the Rutherford and Appleton Laboratories, UK.

Research on synchronization technology of frequency hopping communication system

NASA Astrophysics Data System (ADS)

Zhao, Xiangwu; Quan, Houde; Cui, Peizhang

2018-05-01

Frequency Hopping (FH) communication is a technology of spread spectrum communication. It has strong anti-interference, anti-interception and security capabilities, and has been widely applied in the field of communications. Synchronization technology is one of the most crucial technologies in frequency hopping communication. The speed of synchronization establishment and the reliability of synchronous system directly affect the performance of frequency hopping communication system. Therefore, the research of synchronization technology in frequency hopping communication has important value.

Hip-Hop as a Resource for Understanding the Urban Context: A Review of Christopher Edmin's--Science Education for the Hip-Hop Generation, Sense Publishers, Rotterdam, 2010

ERIC Educational Resources Information Center

Brown, Bryan

2010-01-01

This review explores Edmin's "Science education for the hip-hop generation" by documenting how he frames hip-hop as a means to access urban student culture. He argues that hip-hop is more than a mere music genre, but rather a culture that provides young people with ways of connecting to the world. Two primary ideas emerged as central to…

Model for using hip-hop music for small group HIV/AIDS prevention counseling with African American adolescents and young adults.

PubMed

Stephens, T; Braithwaite, R L; Taylor, S E

1998-10-01

Currently little attention has been directed, with the exception of peer education efforts, to constructively develop new and innovative ways to promote HIV/AIDS primary prevention among African American (AA) adolescents and young adults. With this in mind, the aim of this conceptual effort is to present a HIV/AIDS preventive counseling protocol developed for use with AA young adults that makes use of hip-hop music, a form of music popularized by young AAs. The author contend that an increased understanding of the relationships that many AA young adults have with hip-hop music may be used by disease prevention personnel to educate these populations about protective factors for HIV. Making use of hip-hop music is one strategy for integrating counseling in prevention and health maintenance. The overall implications of using hip-hop music in health promotion are unlimited. First, this method makes use of cultural relevant materials to address the educational and health needs of the target community. Second, it is grounded in an approach that serves to stimulate cooperative learning based on peer developed content. Moreover, the use of this medium can be applied to other health promotion activities such as violence/harm reduction and substance abuse prevention, upon reviews of songs for appropriate content. The authors contend that such an approach holds heuristic value in dealing with HIV/AIDS prevention among AA young adults. Additional testing of the intervention is warranted in the refinement of this innovative intervention.

A new method of hybrid frequency hopping signals selection and blind parameter estimation

NASA Astrophysics Data System (ADS)

Zeng, Xiaoyu; Jiao, Wencheng; Sun, Huixian

2018-04-01

Frequency hopping communication is widely used in military communications at home and abroad. In the case of single-channel reception, it is scarce to process multiple frequency hopping signals both effectively and simultaneously. A method of hybrid FH signals selection and blind parameter estimation is proposed. The method makes use of spectral transformation, spectral entropy calculation and PRI transformation basic theory to realize the sorting and parameter estimation of the components in the hybrid frequency hopping signal. The simulation results show that this method can correctly classify the frequency hopping component signal, and the estimated error of the frequency hopping period is about 5% and the estimated error of the frequency hopping frequency is less than 1% when the SNR is 10dB. However, the performance of this method deteriorates seriously at low SNR.

Chemical transformations of characteristic hop secondary metabolites in relation to beer properties and the brewing process: a review.

PubMed

Steenackers, Bart; De Cooman, Luc; De Vos, Dirk

2015-04-01

The annual production of hops (Humulus lupulus L.) exceeds 100,000 mt and is almost exclusively consumed by the brewing industry. The value of hops is attributed to their characteristic secondary metabolites; these metabolites are precursors which are transformed during the brewing process into important bittering, aromatising and preservative components with rather low efficiency. By selectively transforming these components off-line, both their utilisation efficiency and functionality can be significantly improved. Therefore, the chemical transformations of these secondary metabolites will be considered with special attention to recent advances in the field. The considered components are the hop alpha-acids, hop beta-acids and xanthohumol, which are components unique to hops, and alpha-humulene and beta-caryophyllene, sesquiterpenes which are highly characteristic of hops. Copyright © 2014 Elsevier Ltd. All rights reserved.

Harvesting electricity from human hair.

PubMed

Tulachan, Brindan; Singh, Sushil K; Philip, Deepu; Das, Mainak

2016-01-01

Electrical conductivity of human hair is a debatable issue among hair experts and scientists. There are unsubstantiated claims that hair conducts electricity. However, hair experts provided ample evidence that hair is an insulator. Although wet hair exhibited drastic reduction in resistivity; scientists regarded hair as a proton semiconductor at the best. Here, we demonstrate that hair filaments generate electricity on absorbing water vapor between 50 degrees and 80 degrees C. This electricity can operate low power electronic systems. Essentially, we are exposing the hydrated hair polymer to a high temperature (50 degrees-80 degrees C). It has long been speculated that when certain biopolymers are simultaneously hydrated and exposed to high temperature, they exhibit significant proton hopping at a specific temperature regime. This happens due to rapid movement of water molecules on the polymer surface. This lead us to speculate that the observed flow of current is partly ionic and partly due to "proton hopping" in the hydrated nano spaces of hair filament. Such proton hopping is exceptionally high when the hydrated hair polymer is exposed to a temperature between 50 degrees and 80 degrees C. Differential scanning calorimetry data further corroborated the results and indicated that indeed at this temperature range, there is an enormous movement of water molecules on the hair polymer surface. This enormously rapid movement of water molecules lead to the "making and breaking" of innumerable hydrogen bonds and thus resulting in hopping of the protons. What is challenging is "how to tap these hopping protons to obtain useful electricity?" We achieved this by placing a bundle of hair between two different electrodes having different electro negativities, and exposing it to water vapor (water + heat). The two different electrodes offered directionality to the hopping protons and the existing ions and thus resulting in the generation of useful current. Further, by continuously hydrating the polymer with water vapor, we prolonged the process. If this interesting aspect of polymer is exploited further and fine tuned, then it will open new avenues for development of sophisticated polymer-based systems, which could be used to harvest electricity from waste heat.

High-Speed On-Board Data Processing Platform for LIDAR Projects at NASA Langley Research Center

NASA Astrophysics Data System (ADS)

Beyon, J.; Ng, T. K.; Davis, M. J.; Adams, J. K.; Lin, B.

2015-12-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program during April, 2012 - April, 2015. HOPS is an enabler for science missions with extremely high data processing rates. In this three-year effort of HOPS, Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) and 3-D Winds were of interest in particular. As for ASCENDS, HOPS replaces time domain data processing with frequency domain processing while making the real-time on-board data processing possible. As for 3-D Winds, HOPS offers real-time high-resolution wind profiling with 4,096-point fast Fourier transform (FFT). HOPS is adaptable with quick turn-around time. Since HOPS offers reusable user-friendly computational elements, its FPGA IP Core can be modified for a shorter development period if the algorithm changes. The FPGA and memory bandwidth of HOPS is 20 GB/sec while the typical maximum processor-to-SDRAM bandwidth of the commercial radiation tolerant high-end processors is about 130-150 MB/sec. The inter-board communication bandwidth of HOPS is 4 GB/sec while the effective processor-to-cPCI bandwidth of commercial radiation tolerant high-end boards is about 50-75 MB/sec. Also, HOPS offers VHDL cores for the easy and efficient implementation of ASCENDS and 3-D Winds, and other similar algorithms. A general overview of the 3-year development of HOPS is the goal of this presentation.

Hip-Hopping across China: Intercultural Formulations of Local Identities

ERIC Educational Resources Information Center

Barrett, Catrice

2012-01-01

The linguistic dimensions of globalized hip-hop cannot be understood simply as a byproduct of English as an American export. As hip-hop mobilizes, it is common (and arguably necessary) for global hip-hop communities to struggle through purposeful, semiotically rooted dialectics over what constitutes "authentic" and respectable forms of…

Revolutionizing Environmental Education through Indigenous Hip Hop Culture

ERIC Educational Resources Information Center

Gorlewski, Julie; Porfilio, Brad J.

2012-01-01

Based upon the life histories of six Indigenous hip hop artists of the Beat Nation artist collective, this essay captures how Indigenous hip hop has the potential to revolutionize environmental education. Hip hop provides Indigenous youth an emancipatory space to raise their opposition to neocolonial controls of Indigenous territories that…

Operational environmental assessment "Prestige" (a recent application of the MOCASSIM system).

NASA Astrophysics Data System (ADS)

Vitorino, J.; Rusu, E.; Almeida, S.; Monteiro, M.; Lermusiaux, P.; Haley, P.; Leslie, W.; Miller, P.; Coelho, E.; Signell, R.

2003-04-01

The sinking of tanker "Prestige", on the 19th November 2002, offshore the northwestern coasts of Spain and Portugal, has lead to a major environmental disaster. In this contribution we present several aspects of the operational environmental assessment "Prestige" conducted by Instituto Hidrografico (IH) in close colaboration with Instituto de Meteorologia (IM), the Harvard University, the Plymouth Marine Laboratory (PML) and the Saclancentre. The operational system MOCASSIM, which is presently being developed at IH, was used to provide forecasts of the evolution of oceanographic conditions offshore the NW Iberian coast. The system integrates a primitive equation model with data assimilation (the Harvard Ocean Prediction System - HOPS) and two wave models (the SWAN and WW3 models). The numerical domains used in both HOPS and SWAN models covered the area bewteen 40ºN and 46ºN and from 7ºW to 15ºW, and included the sinking area as well as the coastal regions more directly exposed to the oil spill. The models were run with atmospheric forcing conditions provided by the limited area model ALADIN, run operationally at IM, complemented with NOGAPS wind fields from the NATO METOC site of Rota. The HOPS simulations included assimilation of several data available for region. These data sets included CTD casts from the Northern Spanish shelf and slope (made available by University of Baleares) and SST data processed at the Remote Sensing Group of the PML. Results from both models were used in oil spill models and allowed an estimation of the impacts on the coastal areas.

Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

Biphasic Allometry of Cardiac Growth in the Developing Kangaroo Macropus fuliginosus.

PubMed

Snelling, Edward P; Taggart, David A; Maloney, Shane K; Farrell, Anthony P; Seymour, Roger S

2015-01-01

Interspecific studies of adult mammals show that heart mass (M(h), g) increases in direct proportion to body mass (M(b), kg), such that M(h) ∝ M(b)(1.00). However, intraspecific studies on heart mass in mammals at different stages of development reveal considerable variation between species, M(h) ∝ M(b)(0.70-1.00). Part of this variation may arise as a result of the narrow body size range of growing placental mammals, from birth to adulthood. Marsupial mammals are born relatively small and offer an opportunity to examine the ontogeny of heart mass over a much broader body size range. Data from 29 western grey kangaroos Macropus fuliginosus spanning 800-fold in body mass (0.084-67.5 kg) reveal the exponent for heart mass decreases significantly when the joey leaves the pouch (ca. 5-6 kg body mass). In the pouch, the heart mass of joeys scales with hyperallometry, M(h(in-pouch)) = 6.39 M(b)(1.10 ± 0.05), whereas in free-roaming juveniles and adults, heart mass scales with hypoallometry, M(h(postpouch)) = 14.2 Mb(0.77 ± 0.08). Measurements of heart height, width, and depth support this finding. The relatively steep heart growth allometry during in-pouch development is consistent with the increase in relative cardiac demands as joeys develop endothermy and the capacity for hopping locomotion. Once out of the pouch, the exponent decreases sharply, possibly because the energy required for hopping is independent of speed, and the efficiency of energy storage during hopping increases as the kangaroo grows. The right:left ventricular mass ratios (0.30-0.35) do not change over the body mass range and are similar to those of other mammals, reflecting the principle of Laplace for the heart.

Vacancy–Vacancy Interaction Induced Oxygen Diffusivity Enhancement in Undoped Nonstoichiometric Ceria

DOE PAGES

Yuan, Fenglin; Zhang, Yanwen; Weber, William J.

2015-05-19

In this paper, molecular dynamics simulations and molecular static calculations have been used to systematically study oxygen vacancy transport in undoped nonstoichiometric ceria. A strong oxygen diffusivity enhancement appears in the vacancy concentration range of 2–4% over the temperature range from 1000 to 2000 K. An Arrhenius ion diffusion mechanism by vacancy hopping along the (100) direction is unambiguously identified, and an increasing trend of both the oxygen migration barrier and the prefactor with increasing vacancy concentration is observed. Within the framework of classical diffusion theory, a weak concentration dependence of the prefactor in oxygen vacancy migration is shown tomore » be crucial for explaining the unusual fast oxygen ion migration in the low concentration range and consequently the appearance of a maximum in oxygen diffusivity. Finally, a representative (100) direction interaction model is constructed to identify long-range vacancy–vacancy interaction as the structural origin of the positive correlation between oxygen migration barrier and vacancy concentration.« less

The effects of brain lesions on the "hopping reaction" in newborn and adult rabbits: a model for studying age dependent recovery.

PubMed

van Hof, M W; Hobbelen, J F; Gramsbergen, A

1990-01-01

In 5 groups of rabbits (0-1, 2-3, 4-5, 6-7 and 12-13 weeks old) the left frontal, parieto-temporal and occipital cortex were removed. Beginning two weeks after the operations the hopping reaction was tested during 15 weeks. It was found in the groups operated 0-1, 2-3 and 4-5 weeks after birth, that the hopping reaction developed normally. This was not the case in the animals operated 6-7 and 12-13 weeks after birth. Brightness descrimination with the left and right eye was tested in the same animals, beginning 12 weeks after the operation. Contrary to the motor system, no age-development recovery was found in the visual system. In all age groups, brightness discrimination with the eye contralateral to the lesion was impaired.

Differences between the insulating limit quasiparticles of one-band and three-band cuprate models

NASA Astrophysics Data System (ADS)

Ebrahimnejad, H.; Sawatzky, G. A.; Berciu, M.

2016-03-01

We study the charge dynamics of the quasiparticle that forms when a single hole is doped in a two-dimensional antiferromagnet as described by the one-band t-{{t}\\prime} -{{t}\\prime \\prime} -J model, using a variational approximation that includes spin fluctuations in the vicinity of the hole. We explain why the spin fluctuations and the longer range hopping have complementary contributions to the quasiparticle dynamics, and thus why both are essential to obtain a dispersion in agreement with that measured experimentally. This is very different from the three-band Emery model in the strongly-correlated limit, where the same variational approximation shows that spin fluctuations have a minor effect on the quasiparticle dynamics. This difference proves that these one-band and three-band models describe qualitatively different quasiparticles in the insulating limit, and therefore that they cannot both be suitable to describe the physics of very underdoped cuprates.

Effects of compositional defects on small polaron hopping in micas.

PubMed

Rosso, Kevin M; Ilton, Eugene S

2005-06-22

Hartree-Fock calculations and electron transfer (ET) theory were used to model the effects of compositional defects on ET in the brucite-like octahedral sheet of mica. ET was modeled as an Fe(IIIII) valence interchange reaction across shared octahedral edges of the M2-M2 iron sublattice. The model entails the hopping of localized electrons and small polaron behavior. Hartree-Fock calculations indicate that substitution of F for structural OH bridges increases the reorganization energy lambda, decreases the electronic coupling matrix element V(AB), and thereby substantially decreases the hopping rate. The lambda increase arises from modification of the metal-ligand bond force constants, and the V(AB) decrease arises from reduction of superexchange interaction through anion bridges. Deprotonation of an OH bridge, consistent with a possible mechanism of maintaining charge neutrality during net oxidation, yields a net increase in the ET rate. Although substitution of Al or Mg for Fe in M1 sites distorts the structure of adjacent Fe-occupied M2 sites, the distortion has little net impact on ET rates through these M2 sites. Hence the main effect of Al or Mg substitution for Fe, should it occur in the M2 sublattice, is to block ET pathways. Collectively, these findings pave the way for larger-scale oxidation/reduction models to be constructed for realistic, compositionally diverse micas.

Electronically nonadiabatic wave packet propagation using frozen Gaussian scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kondorskiy, Alexey D., E-mail: kondor@sci.lebedev.ru; Nanbu, Shinkoh, E-mail: shinkoh.nanbu@sophia.ac.jp

2015-09-21

We present an approach, which allows to employ the adiabatic wave packet propagation technique and semiclassical theory to treat the nonadiabatic processes by using trajectory hopping. The approach developed generates a bunch of hopping trajectories and gives all additional information to incorporate the effect of nonadiabatic coupling into the wave packet dynamics. This provides an interface between a general adiabatic frozen Gaussian wave packet propagation method and the trajectory surface hopping technique. The basic idea suggested in [A. D. Kondorskiy and H. Nakamura, J. Chem. Phys. 120, 8937 (2004)] is revisited and complemented in the present work by the elaborationmore » of efficient numerical algorithms. We combine our approach with the adiabatic Herman-Kluk frozen Gaussian approximation. The efficiency and accuracy of the resulting method is demonstrated by applying it to popular benchmark model systems including three Tully’s models and 24D model of pyrazine. It is shown that photoabsorption spectrum is successfully reproduced by using a few hundreds of trajectories. We employ the compact finite difference Hessian update scheme to consider feasibility of the ab initio “on-the-fly” simulations. It is found that this technique allows us to obtain the reliable final results using several Hessian matrix calculations per trajectory.« less

Classification of Scaffold Hopping Approaches

PubMed Central

Sun, Hongmao; Tawa, Gregory; Wallqvist, Anders

2012-01-01

The general goal of drug discovery is to identify novel compounds that are active against a preselected biological target with acceptable pharmacological properties defined by marketed drugs. Scaffold hopping has been widely applied by medicinal chemists to discover equipotent compounds with novel backbones that have improved properties. In this review, scaffold hopping is classified into four major categories, namely heterocycle replacements, ring opening or closure, peptidomimetics, and topology-based hopping. The structural diversity of original and final scaffolds with respect to each category will be reviewed. The advantages and limitations of small, medium, and large-step scaffold hopping will also be discussed. Software that is frequently used to facilitate different kinds of scaffold hopping methods will be summarized. PMID:22056715

Spread spectrum communications. Volume 1, 2 & 3

NASA Technical Reports Server (NTRS)

Simon, M. K.; Levitt, B. K.; Omura, J. K.; Scholtz, R. A.

1985-01-01

The design and operation of spread-spectrum (SS) communication systems are examined in an introductory text intended for graduate engineering students and practicing engineers. Chapters are devoted to an overview of SS systems, the historical origins of SS, basic concepts and system models, antijam communication systems, pseudonoise generators, coherent direct-sequence systems, noncoherent frequency-hopped systems, coherent and differentially coherent modulation techniques, pseudonoise acquisition and tracking in direct-sequence receivers, time and frequency synchronization of frequency-hopped receivers, low-probability-of-intercept communication, and multiple-access communication. Graphs, diagrams, and photographs are provided.

Deterministic Multi-hop Controlled Teleportation of Arbitrary Single-Qubit State

NASA Astrophysics Data System (ADS)

Peng, Jia-yin; Bai, Ming-qiang; Mo, Zhi-wen

2017-10-01

Multi-hop teleportation is of great significance due to long-distance delivery of quantum information and wireless quantum communication networks. In existing protocols of multi-hop teleportation, the more nodes, the smaller the success probability. In this paper, fusing the ideas of multi-hop teleportation and controlled teleportation, we put forward a scheme for implementing multi-hop controlled teleportation of single-qubit state. A set of ingenious three-qubit non-maximally entangled states are constructed to serve as the quantum channels. The information is perfectly transmitted hop by hop through teleportation under the control of the supervisors. Unit success probability can be achieved independent of channel's entanglement degree and the number of intermediate nodes. Only Pauli operations, single-qubit rotation, Hadamard gate, controlled-NOT gate, Bell-state measurement and single-qubit measurement are used in our scheme, so this scheme is easily realized in physical experiment.

Conformation-selective resonant photoelectron imaging from dipole-bound states of cold 3-hydroxyphenoxide

NASA Astrophysics Data System (ADS)

Zhu, Guo-Zhu; Huang, Dao-Ling; Wang, Lai-Sheng

2017-07-01

We report a photoelectron imaging and photodetachment study of cryogenically cooled 3-hydroxyphenoxide (3HOP) anions, m-HO(C6H4)O-. In a previous preliminary study, two conformations of the cold 3HOP anions with different dipole bound states were observed [D. L. Huang et al., J. Phys. Chem. Lett. 6, 2153 (2015)]. Five near-threshold vibrational resonances were revealed in the photodetachment spectrum from the dipole-bound excited states of the two conformations. Here, we report a more extensive investigation of the two conformers with observation of thirty above-threshold vibrational resonances in a wide spectral range between 18 850 and 19 920 cm-1 (˜1000 cm-1 above the detachment thresholds). By tuning the detachment laser to the vibrational resonances in the photodetachment spectrum, high-resolution conformation-selective resonant photoelectron images are obtained. Using information of the autodetachment channels and theoretical vibrational frequencies, we are able to assign the resonant peaks in the photodetachment spectrum: seventeen are assigned to vibrational levels of anti-3HOP, eight to syn-3HOP, and five to overlapping vibrational levels of both conformers. From the photodetachment spectrum and the conformation-selective resonant photoelectron spectra, we have obtained fourteen fundamental vibrational frequencies for the neutral syn- and anti-m-HO(C6H4)Oṡ radicals. The possibility to produce conformation-selected neutral beams using resonant photodetachment via dipole-bound excited states of anions is discussed.

An implementation of a data-transmission pipelining algorithm on Imote2 platforms

NASA Astrophysics Data System (ADS)

Li, Xu; Dorvash, Siavash; Cheng, Liang; Pakzad, Shamim

2011-04-01

Over the past several years, wireless network systems and sensing technologies have been developed significantly. This has resulted in the broad application of wireless sensor networks (WSNs) in many engineering fields and in particular structural health monitoring (SHM). The movement of traditional SHM toward the new generation of SHM, which utilizes WSNs, relies on the advantages of this new approach such as relatively low costs, ease of implementation and the capability of onboard data processing and management. In the particular case of long span bridge monitoring, a WSN should be capable of transmitting commands and measurement data over long network geometry in a reliable manner. While using single-hop data transmission in such geometry requires a long radio range and consequently a high level of power supply, multi-hop communication may offer an effective and reliable way for data transmissions across the network. Using a multi-hop communication protocol, the network relays data from a remote node to the base station via intermediary nodes. We have proposed a data-transmission pipelining algorithm to enable an effective use of the available bandwidth and minimize the energy consumption and the delay performance by the multi-hop communication protocol. This paper focuses on the implementation aspect of the pipelining algorithm on Imote2 platforms for SHM applications, describes its interaction with underlying routing protocols, and presents the solutions to various implementation issues of the proposed pipelining algorithm. Finally, the performance of the algorithm is evaluated based on the results of an experimental implementation.

1THz synchronous tuning of two optical synthesizers

NASA Astrophysics Data System (ADS)

Neuhaus, Rudolf; Rohde, Felix; Benkler, Erik; Puppe, Thomas; Raab, Christoph; Unterreitmayer, Reinhard; Zach, Armin; Telle, Harald R.; Stuhler, Jürgen

2016-04-01

Single-frequency optical synthesizers (SFOS) provide an optical field with arbitrarily adjustable frequency and phase which is phase-coherently linked to a reference signal. Ideally, they combine the spectral resolution of narrow linewidth frequency stabilized lasers with the broad spectral coverage of frequency combs in a tunable fashion. In state-of-the-art SFOSs tuning across comb lines requires comb line order switching,1, 2 which imposes technical overhead with problems like forbidden frequency gaps or strong phase glitches. Conventional tunable lasers often tune over only tens of GHz before mode-hops occur. Here, we present a novel type of SFOSs, which relies on a serrodyne technique with conditional flyback,3 shifting the carrier frequency of the employed frequency comb without an intrusion into the comb generator. It utilizes a new continuously tunable diode laser that tunes mode-hop-free across the full gain spectrum of the integrated laser diode. We investigate the tuning behavior of two identical SFOSs that share a common reference, by comparing the phases of their output signals. Previously, we achieved phase-stable and cycle-slip free frequency tuning over 28.1 GHz with a maximum zero-to-peak phase deviation of 62 mrad4 when sharing a common comb generator. With the new continuously tunable lasers, the SFOSs tune synchronously across nearly 17800 comb lines (1 THz). The tuning range in this approach can be extended to the full bandwidth of the frequency comb and the 110 nm mode-hop-free tuning range of the diode laser.

Conduction mechanism and dielectric relaxation in high dielectric KxTiyNi1-x-yO

NASA Astrophysics Data System (ADS)

Jana, Pradip Kumar; Sarkar, Sudipta; Karmakar, Shilpi; Chaudhuri, B. K.

2007-10-01

Complex impedance spectroscopic study has been made to elucidate the conductivity mechanism and dielectric relaxations in a low loss giant dielectric (ɛ'˜104) KxTiyNi1-x-yO (KTNO) system with x =0.05-0.30 and y =0.02 over a wide temperature range (200-400K). Below ambient temperature (300K), dc conductivity follows variable range hopping mechanism. The estimated activation energy for dielectric relaxation is found to be higher than the corresponding polaron hopping energy, which is attributed to the combined effect of K-doped grains and highly disordered grain boundary (GB) contributions in KTNO. Observed sharp fall of ɛ' below ˜270K is ascribed to the freezing of charge carriers. Comparatively lower value of relaxation time distribution parameter β of KTNO than that of the CaCu3Ti4O12 (CCTO) system reveals more disorder in KTNO. It is also found that KTNO is structurally more stable compared to the CCTO system, both having giant ɛ' value.

Origin of colossal permittivity in (In1/2Nb1/2)TiO2via broadband dielectric spectroscopy.

PubMed

Zhao, Xiao-gang; Liu, Peng; Song, Yue-Chan; Zhang, An-ping; Chen, Xiao-ming; Zhou, Jian-ping

2015-09-21

(In1/2Nb1/2)TiO2 (IN-T) ceramics were prepared via a solid-state reaction route. X-ray diffraction (XRD) and Raman spectroscopy were used for the structural and compositional characterization of the synthesized compounds. The results indicated that the sintered ceramics have a single phase of rutile TiO2. Dielectric spectroscopy (frequency range from 20 Hz to 1 MHz and temperature range from 10 K to 270 K) was performed on these ceramics. The IN-T ceramics showed extremely high permittivities of up to ∼10(3), which can be referred to as colossal permittivity, with relatively low dielectric losses of ∼0.05. Most importantly, detailed impedance data analyses of IN-T demonstrated that electron-pinned defect-dipoles, interfacial polarization and polaron hopping polarization contribute to the colossal permittivity at high temperatures (270 K); however, only the complexes (pinned electron) and polaron hopping polarization are active at low temperatures (below 180 K), which is consistent with UDR analysis.

Wish to Live: The Hip-Hop Feminism Pedagogy Reader. Educational Psychology. Volume 3

ERIC Educational Resources Information Center

Brown, Ruth Nicole, Ed.; Kwakye, Chamara Jewel, Ed.

2012-01-01

"Wish To Live: The Hip-hop Feminism Pedagogy Reader" moves beyond the traditional understanding of the four elements of hip-hop culture--rapping, breakdancing, graffiti art, and deejaying--to articulate how hip-hop feminist scholarship can inform educational practices and spark, transform, encourage, and sustain local and global youth…

Precision QTL mapping of downy mildew resistance in Hop (Humulus lupulus L.)

USDA-ARS?s Scientific Manuscript database

Hop Downy mildew (DM) is an obligate parasite causing severe losses in hop if not controlled. Resistance to this pathogen is a primary goal for hop breeding programs. The objective of this study was to identify QTLs linked to DM resistance. Next-generation-sequencing was performed on a mapping po...

Genomics of the hop psuedo-autosomal regions

USDA-ARS?s Scientific Manuscript database

Hop is one of the few crop species with female and male plants with sex being determined by either XX or XY chromosomes. Hop cones are only produced in female hops with or without fertilization. This has lead to most genomic research being directed toward female plants. Very little work has been don...

Behind Beats and Rhymes: Working Class from a Hampton Roads Hip Hop Homeplace

ERIC Educational Resources Information Center

Durham, Aisha S.

2009-01-01

The film documentary titled "Hip Hop: beyond beats and rhymes" captures ongoing conversations among scholars, cultural critics, and hip hop insiders about the state of African Americans by interrogating distinct expressive forms associated with hip hop culture. Durham draws from two scenes to describe her memories as the researched…

Flipping the Misogynist Script: Gender, Agency, Hip Hop and Music Education

ERIC Educational Resources Information Center

Tobias, Evan S.

2014-01-01

Excluding Hip Hop culture and rap music from music education misses opportunities for addressing key aspects of popular culture, society, and students' lives. This article addresses intersections of Hip Hop, gender, and music education to forward potential Hip Hop praxis. After tracing related scholarship, I discuss and problematize…

Electronic phase separation in insulating (Ga, Mn) As with low compensation: super-paramagnetism and hopping conduction

NASA Astrophysics Data System (ADS)

Yuan, Ye; Wang, Mao; Xu, Chi; Hübner, René; Böttger, Roman; Jakiela, Rafal; Helm, Manfred; Sawicki, Maciej; Zhou, Shengqiang

2018-03-01

In the present work, low compensated insulating (Ga,Mn)As with 0.7% Mn is obtained by ion implantation combined with pulsed laser melting. The sample shows variable-range hopping transport behavior with a Coulomb gap in the vicinity of the Fermi energy, and the activation energy is reduced by an external magnetic field. A blocking super-paramagnetism is observed rather than ferromagnetism. Below the blocking temperature, the sample exhibits a colossal negative magnetoresistance. Our studies confirm that the disorder-induced electronic phase separation occurs in (Ga,Mn)As samples with a Mn concentration in the insulator-metal transition regime, and it can account for the observed superparamagnetism and the colossal magnetoresistance.

Solvent Dependence of Lateral Charge Transfer in a Porphyrin Monolayer

DOE PAGES

Brennan, Bradley J.; Regan, Kevin P.; Durrell, Alec C.; ...

2016-12-19

Lateral charge transport in a redox)active monolayer can be utilized for solar energy harvesting. We chose the porphyrin system to study the influence of the solvent on lateral hole hopping, which plays a crucial role in the charge)transfer kinetics. We also examined the influence of water, acetonitrile, and propylene carbonate as solvents. Hole)hopping lifetimes varied by nearly three orders of magnitude among solvents, ranging from 3 ns in water to 2800 ns in propylene carbonate, and increased nonlinearly as a function of added acetonitrile in aqueous solvent mixtures. Our results elucidate the important roles of solvation, molecular packing dynamics, andmore » lateral charge)transfer mechanisms that have implications for all dye)sensitized photoelectrochemical device designs.« less

3-Sulfanyl-4-methylpentan-1-ol in Dry-Hopped Beers: First Evidence of Glutathione S-Conjugates in Hop (Humulus lupulus L.).

PubMed

Kankolongo Cibaka, Marie-Lucie; Decourrière, Laura; Lorenzo-Alonso, Celso-José; Bodart, Etienne; Robiette, Raphaël; Collin, Sonia

2016-11-16

Monovarietal dry-hopped beers were produced with the dual-purpose hop cultivars Amarillo, Hallertau Blanc, and Mosaic. The grapefruit-like 3-sulfanyl-4-methylpentan-1-ol was found in all three beers at concentrations much higher than expected on the basis of the free thiol content in hop. Even cysteinylated precursors proved unable to explain our results. As observed in wine, the occurrence of S-glutathione precursors was therefore suspected in hop. The analytical standards of S-3-(4-methyl-1-hydroxypentyl)glutathione, never described before, and of S-3-(1-hydroxyhexyl)glutathione, previously evidenced in grapes, were chemically synthesized. An optimized extraction of glutathionylated precursors was then applied to Amarillo, Hallertau Blanc, and Mosaic hop samples. HPLC-ESI(+)MS/MS revealed, for the first time, the occurrence of S-3-(1-hydroxyhexyl)glutathione and S-3-(4-methyl-1-hydroxypentyl)glutathione in hop, at levels well above those reported for their cysteinylated counterparts. S-3-(1-Hydroxyhexyl)glutathione emerged in all cases as the major adduct in hop. Yet, although 3-sulfanylhexan-1-ol seems relatively ubiquitous in free, cysteinylated, and glutathionylated forms, the glutathione adduct of 3-sulfanyl-4-methylpentan-1-ol, never evidenced in other plants up to now, was found only in the Hallertau Blanc variety.

A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

PubMed

Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

2018-06-01

African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

The Pseudomonas syringae type III effector HopG1 targets mitochondria, alters plant development, and suppresses plant innate immunity

PubMed Central

Block, Anna; Guo, Ming; Li, Guangyong; Elowsky, Christian; Clemente, Thomas E.; Alfano, James R.

2009-01-01

Summary The bacterial plant pathogen Pseudomonas syringae uses a type III protein secretion system to inject type III effectors into plant cells. Primary targets of these effectors appear to be effector-triggered immunity (ETI) and pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). The type III effector HopG1 is a suppressor of ETI that is broadly conserved in bacterial plant pathogens. Here we show that HopG1 from P. syringae pv. tomato DC3000 also suppresses PTI. Interestingly, HopG1 localizes to plant mitochondria, suggesting that its suppression of innate immunity may be linked to a perturbation of mitochondrial function. While HopG1 possesses no obvious mitochondrial signal peptide, its N-terminal two-thirds was sufficient for mitochondrial localization. A HopG1-GFP fusion lacking HopG1’s N-terminal 13 amino acids was not localized to the mitochondria reflecting the importance of the N-terminus for targeting. Constitutive expression of HopG1 in Arabidopsis thaliana, Nicotiana tabacum (tobacco) and Lycopersicon esculentum (tomato) dramatically alters plant development resulting in dwarfism, increased branching and infertility. Constitutive expression of HopG1 in planta leads to reduced respiration rates and an increased basal level of reactive oxygen species. These findings suggest that HopG1’s target is mitochondrial and that effector/target interaction promotes disease by disrupting mitochondrial functions. PMID:19863557

Differential regulation of detoxification enzymes in hepatic and mammary tissue by hops (Humulus lupulus) in vitro and in vivo

PubMed Central

Dietz, Birgit M.; Hagos, Ghenet K.; Eskra, Jillian N.; Wijewickrama, Gihani T.; Anderson, Jeffrey R.; Nikolic, Dejan; Guo, Jian; Wright, Brian; Chen, Shao-Nong; Pauli, Guido F.; van Breemen, Richard B.; Bolton, Judy L.

2013-01-01

Scope Hops contain the phytoestrogen, 8-prenylnaringenin, and the cytoprotective compound, xanthohumol (XH). XH induces the detoxification enzyme, NAD(P)H-quinone oxidoreductase (NQO1) in vitro; however, the tissue distribution of XH and 8-prenylnaringenin and their tissue specific activity have not been analyzed. Methods and results A standardized hop extract (p.o.) and XH (s.c.) were administered to Sprague-Dawley rats over four days. LC-MS-MS analysis of plasma, liver and mammary gland revealed that XH accumulated in liver and mammary glands. Compared with the low level in the original extract, 8-prenylnaringenin was enriched in the tissues. Hops and XH induced NQO1 in the liver, while only hops reduced NQO1 activity in the mammary gland. Mechanistic studies revealed that hops modulated NQO1 through three mechanisms. In liver cells, 1) XH modified Keap1 leading to Nrf2 translocation and antioxidant response element (ARE) activation; 2) hop-mediated ARE induction was partially mediated through phosphorylation of Nrf2 by PKC; 3) in breast cells, 8-prenylnaringenin reduced NQO1 likely through binding to ERα, recruiting Nrf2, and downregulating ARE-regulated genes. Conclusions XH and 8-prenylnaringenin in dietary hops are bioavailable to the target tissues. While hops and XH might be cytoprotective in the liver, 8-prenylnaringenin seems responsible for hop-mediated NQO1 reduction in the mammary gland. PMID:23512484

Hip external rotation strength predicts hop performance after anterior cruciate ligament reconstruction.

PubMed

Kline, Paul W; Burnham, Jeremy; Yonz, Michael; Johnson, Darren; Ireland, Mary Lloyd; Noehren, Brian

2018-04-01

Quadriceps strength and single-leg hop performance are commonly evaluated prior to return to sport after anterior cruciate ligament reconstruction (ACLR). However, few studies have documented potential hip strength deficits after ACLR, or ascertained the relative contribution of quadriceps and hip strength to hop performance. Patients cleared for return to sports drills after ACLR were compared to a control group. Participants' peak isometric knee extension, hip abduction, hip extension, and hip external rotation (HER) strength were measured. Participants also performed single-leg hops, timed hops, triple hops, and crossover hops. Between-limb comparisons for the ACLR to control limb and the non-operative limb were made using independent two-sample and paired sample t tests. Pearson's correlations and stepwise multiple linear regression were used to determine the relationships and predictive ability of limb strength, graft type, sex, and limb dominance to hop performance. Sixty-five subjects, 20 ACLR [11F, age 22.8 (15-45) years, 8.3 ± 2 months post-op, mass 70.47 ± 12.95 kg, height 1.71 ± 0.08 m, Tegner 5.5 (3-9)] and 45 controls [22F, age 25.8 (15-45) years, mass 74.0 ± 15.2 kg, height 1.74 ± 0.1 m, Tegner 6 (3-7)], were tested. Knee extension (4.4 ± 1.5 vs 5.4 ± 1.8 N/kg, p = 0.02), HER (1.4 ± 0.4 vs 1.7 ± 0.5 N/kg, p = 0.04), single-leg hop (146 ± 37 vs 182 ± 38% limb length, p < 0.01), triple hop (417 ± 106 vs 519 ± 102% limb length, p < 0.01), timed hop (3.3 ± 2.0 vs 2.3 ± 0.6 s, p < 0.01), and crossover hop (364 ± 107 vs 446 ± 123% limb length, p = 0.01) were significantly impaired in the operative versus control subject limbs. Similar deficits existed between the operative and non-operative limbs. Knee extension and HER strength were significantly correlated with each of the hop tests, but only HER significantly predicted hop performance. After ACLR, patients have persistent HER strength, knee extension strength, and hop test deficits in the operative limb compared to the control and non-operative limbs, even after starting sport-specific drills. Importantly, HER strength independently predicted hop performance. Based on these findings, to resolve between-limb deficits in strength and hop performance clinicians should include HER strengthening exercises in post-operative rehabilitation. Prognostic Study, Level II.

Electrical conductivity and dielectric relaxation of 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile

NASA Astrophysics Data System (ADS)

El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.

2014-03-01

The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.

Study of electrical conductivity and memory switching in the zinc-vanadium-phosphate glasses

NASA Astrophysics Data System (ADS)

Mirzayi, M.; Hekmatshoar, M. H.

2013-07-01

Vanadium zinc phosphate glasses were prepared by the conventional melt quenching technique and effect of V2O5 concentration on d.c. conductivity of prepared samples were investigated. X-ray diffraction patterns confirmed the glassy character of the samples. The d.c. conductivity increased with increase in V2O5 content. Results showed that activation energy has a single value in the investigated range of temperature, which can be explained in accordance with Mott small pollaron hopping model. I-V characteristics at high electric field showed that switching in these glasses was memory type. The threshold field of switching was found to decrease with increase in V2O5 content. Non-linear behavior and switching phenomenon was explained by Pool-Frenkel effect and thermal model.

QTL examination of a bi-parental mapping population segregating for “short-stature” in hop (Humulus lupulus L.)

USDA-ARS?s Scientific Manuscript database

Increasing labor costs and reduced labor pools for hop production have resulted in the necessity to develop strategies to improve efficiency and automate hop production and harvest. One solution for reducing labor inputs is the use and production of “low-trellis” hop varieties optimized for mechani...

Hip-Hop(e): The Cultural Practice and Critical Pedagogy of International Hip-Hop. Adolescent Cultures, School, and Society. Volume 56

ERIC Educational Resources Information Center

Porfilio, Brad J., Ed.; Viola, Michael J., Ed.

2012-01-01

Illuminating hip-hop as an important cultural practice and a global social movement, this collaborative project highlights the emancipatory messages and cultural work generated by the organic intellectuals of global hip-hop. Contributors describe the social realities--globalization, migration, poverty, criminalization, and racism--youth are…

Hip-Hop and the Academic Canon

ERIC Educational Resources Information Center

Abe, Daudi

2009-01-01

Over the last 30 years, the hip-hop movement has risen from the margins to become the preeminent force in US popular culture. In more recent times academics have begun to harness the power of hip-hop culture and use it as a means of infusing transformative knowledge into the mainstream academic discourse. On many college campuses, hip-hop's…

21 CFR 173.270 - Hexane.

Code of Federal Regulations, 2010 CFR

2010-04-01

..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...

21 CFR 173.270 - Hexane.

Code of Federal Regulations, 2011 CFR

2011-04-01

..., at a level not to exceed 25 parts per million. (b) In hops extract as a residue from the extraction of hops, at a level not to exceed 2.2 percent by weight; Provided, That: (1) The hops extract is added to the wort before or during cooking in the manufacture of beer. (2) The label of the hops extract...

Charge carrier coherence and Hall effect in organic semiconductors.

PubMed

Yi, H T; Gartstein, Y N; Podzorov, V

2016-03-30

Hall effect measurements are important for elucidating the fundamental charge transport mechanisms and intrinsic mobility in organic semiconductors. However, Hall effect studies frequently reveal an unconventional behavior that cannot be readily explained with the simple band-semiconductor Hall effect model. Here, we develop an analytical model of Hall effect in organic field-effect transistors in a regime of coexisting band and hopping carriers. The model, which is supported by the experiments, is based on a partial Hall voltage compensation effect, occurring because hopping carriers respond to the transverse Hall electric field and drift in the direction opposite to the Lorentz force acting on band carriers. We show that this can lead in particular to an underdeveloped Hall effect observed in organic semiconductors with substantial off-diagonal thermal disorder. Our model captures the main features of Hall effect in a variety of organic semiconductors and provides an analytical description of Hall mobility, carrier density and carrier coherence factor.

Magnetic and superconducting competition within the Hubbard dimer. Exact solution

NASA Astrophysics Data System (ADS)

Matlak, M.; Somska, T.; Grabiec, B.

2005-02-01

We express the Hubbard dimer Hamiltonian in the second quantization with theuse of the Hubbard and spin operators. We consider the case of positive and negative U. We decompose the resulting Hamiltonian into several parts collecting all the terms belonging to the same energy level. Such a decomposition visualizes explicitely all intrinsic interactions competing together and deeply hidden in the original form of the dimer Hamiltonian. Among them are competitive ferromagnetic and antiferromagnetic interactions. There are also hopping terms present which describe Cooper pairs hopping between sites 1 and 2 with positive and negative coupling constants (similar as in Kulik-Pedan, Penson-Kolb models). We show that the competition between intrinsic interactions strongly depends on the model parametrs and the averaged occupation number of electrons n [0, 4] resulting in different regimes of the model (as e.g. t-J model regime, etc.).

Scaffold hopping in drug discovery using inductive logic programming.

PubMed

Tsunoyama, Kazuhisa; Amini, Ata; Sternberg, Michael J E; Muggleton, Stephen H

2008-05-01

In chemoinformatics, searching for compounds which are structurally diverse and share a biological activity is called scaffold hopping. Scaffold hopping is important since it can be used to obtain alternative structures when the compound under development has unexpected side-effects. Pharmaceutical companies use scaffold hopping when they wish to circumvent prior patents for targets of interest. We propose a new method for scaffold hopping using inductive logic programming (ILP). ILP uses the observed spatial relationships between pharmacophore types in pretested active and inactive compounds and learns human-readable rules describing the diverse structures of active compounds. The ILP-based scaffold hopping method is compared to two previous algorithms (chemically advanced template search, CATS, and CATS3D) on 10 data sets with diverse scaffolds. The comparison shows that the ILP-based method is significantly better than random selection while the other two algorithms are not. In addition, the ILP-based method retrieves new active scaffolds which were not found by CATS and CATS3D. The results show that the ILP-based method is at least as good as the other methods in this study. ILP produces human-readable rules, which makes it possible to identify the three-dimensional features that lead to scaffold hopping. A minor variant of a rule learnt by ILP for scaffold hopping was subsequently found to cover an inhibitor identified by an independent study. This provides a successful result in a blind trial of the effectiveness of ILP to generate rules for scaffold hopping. We conclude that ILP provides a valuable new approach for scaffold hopping.

Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials.

PubMed

Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang

2009-02-28

To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. H pylori reference strain 26695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-(3)H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression.

Standardization of Weed Pollen Extracts, Japanese Hop and Mugwort, in Korea

PubMed Central

Jeong, Kyoung Yong; Son, Mina; Choi, Soo-Young; Park, Kyung Hee; Park, Hye Jung; Hong, Chein-Soo; Lee, Jae-Hyun

2016-01-01

Purpose Japanese hop (Humulus spp.) and mugwort (Artemisia spp.) are notable causes of autumn pollinosis in East Asia. However, Japanese hop and mugwort pollen extracts, which are widely used for the diagnosis, have not been standardized. This study was performed to standardize Japanese hop and mugwort pollen extracts. Materials and Methods Allergen extracts were prepared in a standardized way using locally collected Humulus japonicus and purchased Artemisia vulgaris pollens. The immunoglobulin E (IgE) reactivities of prepared extracts were compared with commercial extracts via IgE immunoblotting and inhibition analyses. Intradermal skin tests were performed to determine the bioequivalent allergy unit (BAU). Results The IgE reactive components of the extracts via IgE immunoblotting were similar to those of commercial extracts. A 11-kDa allergen showed the strongest IgE reactivity in Japanese hop, as did a 28-kDa allergen in mugwort pollen extracts. Allergenic potencies of the investigatory Japanese hop and mugwort extracts were essentially indistinguishable from the commercial ones. Sums of erythema of 50 mm by the intradermal skin test (ΣED50) were calculated to be 14.4th and 13.6th three-fold dilutions for Japanese hop and mugwort extracts, respectively. Therefore, the allergenic activity of the prepared extracts was 90827.4 BAU/mg for Japanese hop and 34412 BAU/mg for mugwort. Conclusion We produced Japanese hop and mugwort pollen extracts using a standardized method. Standardized Japanese hop and mugwort pollen extracts will facilitate the production of improved diagnostic and immunotherapeutic reagents. PMID:26847293

Implementation of a School Nurse-led Intervention for Children With Severe Obesity in New York City Schools.

PubMed

Schroeder, Krista; Jia, Haomiao; Wang, Y Claire; Smaldone, Arlene

The Healthy Options and Physical Activity Program (HOP) is a school nurse-led intervention for children with severe obesity. HOP was developed by experts at the New York City Department of Health and Mental Hygiene and implemented in New York City schools beginning in 2012. The purpose of this study was to evaluate HOP implementation with the goal of informing HOP refinement and potential future HOP dissemination. This study entailed a retrospective analysis of secondary data. Analytic methods included descriptive statistics, Wilcoxon rank sum and Chi square tests, and multivariate logistic regression. During the 2012-2013 school year, 20,518 children were eligible for HOP. Of these, 1054 (5.1%) were enrolled in the program. On average, enrolled children attended one HOP session during the school year. Parent participation was low (3.2% of HOP sessions). Low nurse workload, low school poverty, higher grade level, higher BMI percentile, and chronic illness diagnosis were associated with student enrollment in HOP. As currently delivered, HOP is not likely to be efficacious. Lessons learned from this evaluation are applicable to future nurse-led obesity interventions. Prior to implementing a school nurse-led obesity intervention, nursing workload and available support must be carefully considered. Interventions should be designed to facilitate (and possibly require) parent involvement. Nurses who deliver obesity interventions may require additional training in obesity treatment. With attention to these lessons learned, evidence-based school nurse-led obesity interventions can be developed. Copyright © 2017 Elsevier Inc. All rights reserved.

Genetic interactions between the chromosome axis-associated protein Hop1 and homologous recombination determinants in Schizosaccharomyces pombe.

PubMed

Brown, Simon David; Jarosinska, Olga Dorota; Lorenz, Alexander

2018-03-17

Hop1 is a component of the meiosis-specific chromosome axis and belongs to the evolutionarily conserved family of HORMA domain proteins. Hop1 and its orthologs in higher eukaryotes are a major factor in promoting double-strand DNA break formation and inter-homolog recombination. In budding yeast and mammals, they are also involved in a meiotic checkpoint kinase cascade monitoring the completion of double-strand DNA break repair. We used the fission yeast, Schizosaccharomyces pombe, which lacks a canonical synaptonemal complex to test whether Hop1 has a role beyond supporting the generation of double-strand DNA breaks and facilitating inter-homolog recombination events. We determined how mutants of homologous recombination factors genetically interact with hop1, studied the role(s) of the HORMA domain of Hop1, and characterized a bio-informatically predicted interactor of Hop1, Aho1 (SPAC688.03c). Our observations indicate that in fission yeast, Hop1 does require its HORMA domain to support wild-type levels of meiotic recombination and localization to meiotic chromatin. Furthermore, we show that hop1∆ only weakly interacts genetically with mutants of homologous recombination factors, and in fission yeast likely has no major role beyond break formation and promoting inter-homolog events. We speculate that after the evolutionary loss of the synaptonemal complex, Hop1 likely has become less important for modulating recombination outcome during meiosis in fission yeast, and that this led to a concurrent rewiring of genetic pathways controlling meiotic recombination.

Generalization of fewest-switches surface hopping for coherences

NASA Astrophysics Data System (ADS)

Tempelaar, Roel; Reichman, David R.

2018-03-01

Fewest-switches surface hopping (FSSH) is perhaps the most widely used mixed quantum-classical approach for the modeling of non-adiabatic processes, but its original formulation is restricted to (adiabatic) population terms of the quantum density matrix, leaving its implementations with an inconsistency in the treatment of populations and coherences. In this article, we propose a generalization of FSSH that treats both coherence and population terms on equal footing and which formally reduces to the conventional FSSH algorithm for the case of populations. This approach, coherent fewest-switches surface hopping (C-FSSH), employs a decoupling of population relaxation and pure dephasing and involves two replicas of the classical trajectories interacting with two active surfaces. Through extensive benchmark calculations of a spin-boson model involving a Debye spectral density, we demonstrate the potential of C-FSSH to deliver highly accurate results for a large region of parameter space. Its uniform description of populations and coherences is found to resolve incorrect behavior observed for conventional FSSH in various cases, in particular at low temperature, while the parameter space regions where it breaks down are shown to be quite limited. Its computational expenses are virtually identical to conventional FSSH.

The Habc Domain of the SNARE Vam3 Interacts with the HOPS Tethering Complex to Facilitate Vacuole Fusion*

PubMed Central

Lürick, Anna; Kuhlee, Anne; Bröcker, Cornelia; Kümmel, Daniel; Raunser, Stefan; Ungermann, Christian

2015-01-01

Membrane fusion at vacuoles requires a consecutive action of the HOPS tethering complex, which is recruited by the Rab GTPase Ypt7, and vacuolar SNAREs to drive membrane fusion. It is assumed that the Sec1/Munc18-like Vps33 within the HOPS complex is largely responsible for SNARE chaperoning. Here, we present direct evidence for HOPS binding to SNAREs and the Habc domain of the Vam3 SNARE protein, which may explain its function during fusion. We show that HOPS interacts strongly with the Vam3 Habc domain, assembled Q-SNAREs, and the R-SNARE Ykt6, but not the Q-SNARE Vti1 or the Vam3 SNARE domain. Electron microscopy combined with Nanogold labeling reveals that the binding sites for vacuolar SNAREs and the Habc domain are located in the large head of the HOPS complex, where Vps16 and Vps33 have been identified before. Competition experiments suggest that HOPS bound to the Habc domain can still interact with assembled Q-SNAREs, whereas Q-SNARE binding prevents recognition of the Habc domain. In agreement, membranes carrying Vam3ΔHabc fuse poorly unless an excess of HOPS is provided. These data suggest that the Habc domain of Vam3 facilitates the assembly of the HOPS/SNARE machinery at fusion sites and thus supports efficient membrane fusion. PMID:25564619

Influence of Ag, Cd or Pb Addition on Electrical and Dielectric Properties of Bulk Glassy Se-Ge

NASA Astrophysics Data System (ADS)

El-Metwally, E. G.; Shakra, A. M.

2018-05-01

Bulk glassy samples of Se0.7Ge0.3 and Se0.7Ge0.25 X 0.05 (X = Ag, Cd or Pb) chalcogenide glass have been prepared by melt-quenching method. The studied compositions were examined in powder form by x-ray diffraction analysis. The direct-current (dc) conductivity σ_{{dc}} was measured for bulk samples in the temperature range from 303 K to 433 K, revealing enhancement with temperature for all samples. The results indicate two values of activation energy ( Δ E_{{σ1 }} and Δ E_{{σ2 }} ) due to two conduction mechanisms. Measurements of the alternating-current (ac) conductivity σ_{{ac}} ( ω ) and dielectric properties for bulk samples were carried out in the temperature range from 303 K to 433 K and frequency range from 1 kHz to 1 MHz. The ac conductivity σ_{{ac}} ( ω ) was temperature dependent and proportional to ωS , where S is the frequency exponent, which reduced with rising temperature, and ω is the angular frequency. These results are discussed based on a correlated barrier hopping model. The calculated values of the maximum height of the barrier W_{{M}} for each composition are consistent with carrier hopping over a potential barrier. The density of localized states N( {E_{{F}} } ) at the Fermi level lay in the range from 1019 eV-1 cm-3 to 1020 eV-1 cm-3, and increased with temperature. The dielectric constant ɛ1 ( ω ) and loss ɛ2 ( ω ) increased with temperature but decreased with frequency. The values of σ_{{dc}} , σ_{{ac}} ( ω ) , ɛ1 ( ω ) , and ɛ2 ( ω ) increased with temperature and with addition of Ag, Cd or Pb. The observed increase was greater for Se0.7Ge0.25Pb0.05 than for Se0.7Ge0.25Cd0.05, which was greater than for Se0.7Ge0.25Ag0.05.

Hip-Hop Is My Passport! Using Hip-Hop and Digital Literacies to Understand Global Citizenship Education

ERIC Educational Resources Information Center

Horton, Akesha Monique

2013-01-01

Hip-hop has exploded around the world among youth. It is not simply an American source of entertainment; it is a global cultural movement that provides a voice for youth worldwide who have not been able to express their "cultural world" through mainstream media. The emerging field of critical hip-hop pedagogy has produced little…

"Deeper than Rap": Gifted Males and Their Relationship with Hip Hop Culture

ERIC Educational Resources Information Center

Callahan, J. Sean; Grantham, Tarek C.

2012-01-01

One would be hard-pressed to deny the impact that hip hop is having on gifted students. More specifically, because hip hop is a creative and exciting male-dominated culture, gifted males gravitate to hip hop culture. From the perspective of two Black men from two different generations, this article was inspired by discussions about the role of hip…

HPLC Analysis of [Alpha]- and [Beta]-Acids in Hops

ERIC Educational Resources Information Center

Danenhower, Travis M.; Force, Leyna J.; Petersen, Kenneth J.; Betts, Thomas A.; Baker, Gary A.

2008-01-01

Hops have been used for centuries to impart aroma and bitterness to beer. The cones of the female hop plant contain both essential oils, which include many of the fragrant components of hops, and a collection of compounds known as [alpha]- and [beta]-acids that are the precursors to bittering agents. In order for brewers to predict the ultimate…

Complex Personhood of Hip Hop & the Sensibilities of the Culture That Fosters Knowledge of Self & Self-Determination

ERIC Educational Resources Information Center

Love, Bettina L.

2016-01-01

Hip hop music and culture have a complex identity in that hip hop is based in self-determination, resistance, and the long enduring fight for Black freedom, but was also created alongside the seductiveness of the material and psychological conditions of capitalism, sexism, and patriarchy. Hip hop pedagogy (HHP) as a pedagogical framework is…

Advances and Promises of Layered Halide Hybrid Perovskite Semiconductors.

PubMed

Pedesseau, Laurent; Sapori, Daniel; Traore, Boubacar; Robles, Roberto; Fang, Hong-Hua; Loi, Maria Antonietta; Tsai, Hsinhan; Nie, Wanyi; Blancon, Jean-Christophe; Neukirch, Amanda; Tretiak, Sergei; Mohite, Aditya D; Katan, Claudine; Even, Jacky; Kepenekian, Mikaël

2016-11-22

Layered halide hybrid organic-inorganic perovskites (HOP) have been the subject of intense investigation before the rise of three-dimensional (3D) HOP and their impressive performance in solar cells. Recently, layered HOP have also been proposed as attractive alternatives for photostable solar cells and revisited for light-emitting devices. In this review, we combine classical solid-state physics concepts with simulation tools based on density functional theory to overview the main features of the optoelectronic properties of layered HOP. A detailed comparison between layered and 3D HOP is performed to highlight differences and similarities. In the same way as the cubic phase was established for 3D HOP, here we introduce the tetragonal phase with D 4h symmetry as the reference phase for 2D monolayered HOP. It allows for detailed analysis of the spin-orbit coupling effects and structural transitions with corresponding electronic band folding. We further investigate the effects of octahedral tilting on the band gap, loss of inversion symmetry and possible Rashba effect, quantum confinement, and dielectric confinement related to the organic barrier, up to excitonic properties. Altogether, this paper aims to provide an interpretive and predictive framework for 3D and 2D layered HOP optoelectronic properties.

Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment.

PubMed

Traore, Boubacar; Pedesseau, Laurent; Assam, Linda; Che, Xiaoyang; Blancon, Jean-Christophe; Tsai, Hsinhan; Nie, Wanyi; Stoumpos, Constantinos C; Kanatzidis, Mercouri G; Tretiak, Sergei; Mohite, Aditya D; Even, Jacky; Kepenekian, Mikaël; Katan, Claudine

2018-04-24

Layered hybrid organic-inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers' confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignments becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Thus, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.

Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment

DOE PAGES

Traore, Boubacar; Pedesseau, Laurent; Assam, Linda; ...

2018-02-26

Layered hybrid organic–inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers’ confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignmentsmore » becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Furthermore, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.« less

Force feedback effects on single molecule hopping and pulling experiments

NASA Astrophysics Data System (ADS)

Rico-Pasto, M.; Pastor, I.; Ritort, F.

2018-03-01

Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.

Composite Nature of Layered Hybrid Perovskites: Assessment on Quantum and Dielectric Confinements and Band Alignment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Traore, Boubacar; Pedesseau, Laurent; Assam, Linda

Layered hybrid organic–inorganic perovskites (HOPs) have re-emerged as potential technological solutions for next-generation photovoltaic and optoelectronic applications. Their two-dimensional (2D) nature confers them a significant flexibility and results in the appearance of quantum and dielectric confinements. Such confinements are at the origin of their fascinating properties, and understanding them from a fundamental level is of paramount importance for optimization. Here, we provide an in-depth investigation of band alignments of 2D HOP allowing access to carriers’ confinement potentials. 2D HOPs are conceptualized as composite materials in which pseudoinorganic and -organic components are defined. In this way, computational modeling of band alignmentsmore » becomes affordable using first-principles methods. First, we show that the composite approach is suitable to study the position-dependent dielectric profiles and enables clear differentiation of the respective contributions of inorganic and organic components. Then we apply the composite approach to a variety of 2D HOPs, assessing the impact on the confinement potentials of well and barrier thickness, of the nature of the inorganic well, and of structural transitions. Using the deduced potentials, we further discuss the limitations of the effective mass approximation, scrutinizing the electronic properties of this family of composite materials. Our simulations demonstrate type-I dominant band alignment in 2D HOPs. Finally, we outline design principles on band alignment toward achieving specific optoelectronic properties. Furthermore, we present alternative theoretical methods to inspect the properties of 2D hybrid perovskites and expect that the composite approach will be applicable to other classes of layered materials.« less

Force feedback effects on single molecule hopping and pulling experiments.

PubMed

Rico-Pasto, M; Pastor, I; Ritort, F

2018-03-28

Single-molecule experiments with optical tweezers have become an important tool to study the properties and mechanisms of biological systems, such as cells and nucleic acids. In particular, force unzipping experiments have been used to extract the thermodynamics and kinetics of folding and unfolding reactions. In hopping experiments, a molecule executes transitions between the unfolded and folded states at a preset value of the force [constant force mode (CFM) under force feedback] or trap position [passive mode (PM) without feedback] and the force-dependent kinetic rates extracted from the lifetime of each state (CFM) and the rupture force distributions (PM) using the Bell-Evans model. However, hopping experiments in the CFM are known to overestimate molecular distances and folding free energies for fast transitions compared to the response time of the feedback. In contrast, kinetic rate measurements from pulling experiments have been mostly done in the PM while the CFM is seldom implemented in pulling protocols. Here, we carry out hopping and pulling experiments in a short DNA hairpin in the PM and CFM at three different temperatures (6 °C, 25 °C, and 45 °C) exhibiting largely varying kinetic rates. As expected, we find that equilibrium hopping experiments in the CFM and PM perform well at 6 °C (where kinetics are slow), whereas the CFM overestimates molecular parameters at 45 °C (where kinetics are fast). In contrast, nonequilibrium pulling experiments perform well in both modes at all temperatures. This demonstrates that the same kind of feedback algorithm in the CFM leads to more reliable determination of the folding reaction parameters in irreversible pulling experiments.

An Energy Efficient Power Control Protocol for Ad Hoc Networks Using Directional Antennas

NASA Astrophysics Data System (ADS)

Quiroz-Perez, Carlos; Gulliver, T. Aaron

A wireless ad hoc network is a collection of mobile nodes that can communicate with each other. Typically, nodes employ omnidirectional antennas. The use of directional antennas can increase spatial reuse, reduce the number of hops to a destination, reduce interference, and increase the transmission range in a specific direction. This is because omnidirectional antennas radiate equally in all directions, limiting the transmission range.

Coupled catastrophes: sudden shifts cascade and hop among interdependent systems

PubMed Central

Barnett, George; D'Souza, Raissa M.

2015-01-01

An important challenge in several disciplines is to understand how sudden changes can propagate among coupled systems. Examples include the synchronization of business cycles, population collapse in patchy ecosystems, markets shifting to a new technology platform, collapses in prices and in confidence in financial markets, and protests erupting in multiple countries. A number of mathematical models of these phenomena have multiple equilibria separated by saddle-node bifurcations. We study this behaviour in its normal form as fast–slow ordinary differential equations. In our model, a system consists of multiple subsystems, such as countries in the global economy or patches of an ecosystem. Each subsystem is described by a scalar quantity, such as economic output or population, that undergoes sudden changes via saddle-node bifurcations. The subsystems are coupled via their scalar quantity (e.g. trade couples economic output; diffusion couples populations); that coupling moves the locations of their bifurcations. The model demonstrates two ways in which sudden changes can propagate: they can cascade (one causing the next), or they can hop over subsystems. The latter is absent from classic models of cascades. For an application, we study the Arab Spring protests. After connecting the model to sociological theories that have bistability, we use socioeconomic data to estimate relative proximities to tipping points and Facebook data to estimate couplings among countries. We find that although protests tend to spread locally, they also seem to ‘hop' over countries, like in the stylized model; this result highlights a new class of temporal motifs in longitudinal network datasets. PMID:26559684

A rapid isothermal assay for the detection of Hop stunt viroid in hop plants (Humulus lupulus), and its application in disease surveys.

PubMed

Kappagantu, Madhu; Villamor, Dan Edward V; Bullock, Jeff M; Eastwell, Kenneth C

2017-07-01

Hop stunt disease caused by Hop stunt viroid (HSVd) is a growing threat to hop cultivation globally. HSVd spreads mainly by use of contaminated planting material and by mechanical means. Thorough testing of hop yards and removal of infected bines are critical components of efforts to control the spread of the disease. Reverse transcription-polymerase chain reaction (RT-PCR) has become the primary technique used for HSVd detection; however, sample handling and analysis are technically challenging. In this study, a robust reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed to facilitate analysis of multiple samples. The assay was optimized with all major variants of HSVd from other host species in addition to hop variants. Used in conjunction with sample collection cards, RT-RPA accommodates large sample numbers. Greenhouse and farm samples tested with RT-RPA were also tested with RT-PCR and a 100% correlation between the two techniques was found. Copyright © 2017. Published by Elsevier B.V.

Crossover from Polaronic to Magnetically Phase-Separated Behavior in La1-xSrxCoO3

NASA Astrophysics Data System (ADS)

Phelan, D.; El Khatib, S.; Wang, S.; Barker, J.; Zhao, J.; Zheng, H.; Mitchell, J. F.; Leighton, C.

2013-03-01

Dilute hole-doping in La1-xSrxCoO3 leads to the formation of ``spin-state polarons'' where a non-zero spin-state is stabilized on the nearest Co3+ ions surrounding a hole. Here, we discuss the development of electronic/magnetic properties of this system from non-magnetic x=0, through the regime of spin-state polarons, and into the region where longer-range spin correlations and phase separation develop. We present magnetometry, transport, heat capacity, and small-angle neutron scattering (SANS) on single crystals. Magnetometry indicates a crossover with x from Langevin-like behavior (polaronic) to a state with a freezing temperature and finite coercivity. Fascinating correlations with this behavior are seen in transport measurements, the evolution from polaronic to clustered states being accompanied by a crossover from Mott variable range hopping to intercluster hopping. SANS data shows Lorentzian scattering from short-range ferromagnetic clusters first emerging around x = 0.03 with correlation lengths of order two unit cells. We argue that this system provides a unique opportunity to understand in detail the crossover from polaronic to truly phase-separated states.

Transport and charging mechanisms in Ta2O5 thin films for capacitive RF MEMS switches application

NASA Astrophysics Data System (ADS)

Persano, A.; Quaranta, F.; Martucci, M. C.; Cretı, P.; Siciliano, P.; Cola, A.

2010-06-01

The potential of sputtered Ta2O5 thin films to be used as dielectric layers in capacitive radio frequency microelectromechanical system switches is evaluated by investigating two factors of crucial importance for the performance of these devices which are the transport mechanisms and the charging effects in the dielectric layer. We find that Ta2O5 films show good electrical and dielectrical properties for the considered application in terms of a low leakage current density of 4 nA/cm2 for E =1 MV/cm, a high breakdown field of 4 MV/cm and a high dielectric constant of 32. For electric fields lower than 1 MV/cm the conduction mechanism is found to be variable-range hopping in the temperature range 300-400 K, while nearest-neighbor hopping is observed at higher temperatures. For fields in the range 1-4 MV/cm Poole-Frenkel becomes the dominant conduction mechanism. Current and capacitance transients used to investigate the charging effects show a decay which is well described by the stretched-exponential law, thus providing further insights on capture and emission processes.

Antifeedant activity of xanthohumol and supercritical carbon dioxide extract of spent hops against stored product pests.

PubMed

Jackowski, J; Hurej, M; Rój, E; Popłoński, J; Kośny, L; Huszcza, E

2015-08-01

Xanthohumol, a prenylated flavonoid from hops, and a supercritical carbon dioxide extract of spent hops were studied for their antifeedant activity against stored product insect pests: Sitophilus granarius L., Tribolium confusum Duv. and Trogoderma granarium Everts. Xanthohumol exhibited medium deterrent activity against the adults of S. granarius L. and larvae of T. confusum Duv. The spent hops extract was more active than xanthohumol towards the adults of T. confusum Duv. The potential application of the crude spent hops extract as a feeding deterrent against the stored product pests is proposed.

Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes

PubMed Central

Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

2017-01-01

Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types. Conclusion: The single-leg hop tests and isokinetic strength measurements were both useful for a bilateral comparison of knee functional performance and strength. Knee flexion strength deficits and flexion-to-extension ratios seemed to be correlated with single-leg hop test performance. There was no difference in postoperative hop test performance or knee strength according to graft type. PMID:29164167

Collective motion in animal groups

NASA Astrophysics Data System (ADS)

Couzin, Iain

2004-03-01

In recent years there has been a growing interest in the relationship between individual behavior and population-level properties in animal groups. One of the fundamental problems is related to spatial scale; how do interactions over a local range result in population properties at larger, averaged, scales, and how can we integrate the properties of aggregates over these scales? Many group-living animals exhibit complex, and coordinated, spatio-temporal patterns which despite their ubiquity and ecological importance are very poorly understood. This is largely due to the difficulties associated with quantifying the motion of, and interactions among, many animals simultaneously. It is on how these behaviors scale to collective behaviors that I will focus here. Using a combined empirical approach (using novel computer vision techniques) and individual-based computer models, I investigate pattern formation in both invertebrate and vertebrate systems, including - Collective memory and self-organized group structure in vertebrate groups (Couzin, I.D., Krause, J., James, R., Ruxton, G.D. & Franks, N.R. (2002) Journal of Theoretical Biology 218, 1-11. (2) Couzin, I.D. & Krause, J. (2003) Advances in the Study of Behavior 32, 1-75. (3) Hoare, D.J., Couzin, I.D. Godin, J.-G. & Krause, J. (2003) Animal Behaviour, in press.) - Self-organized lane formation and optimized traffic flow in army ants (Couzin, I.D. & Franks, N.R. (2003) Proceedings of the Royal Society of London, Series B 270, 139-146) - Leadership and information transfer in flocks, schools and swarms. - Why do hoppers hop? Hopping and the generation of long-range order in some of the largest animal groups in nature, locust hopper bands.

Tourette Syndrome in the Classroom

ERIC Educational Resources Information Center

Coffman, Amanda

2012-01-01

Tourette syndrome is a neurodevelopmental disorder believed to be genetic. The most visible symptom is the presence of tics. These involuntary movements or sounds can range from simple (sniffing, throat clearing, blinking) to complex (words or phrases, hopping, body contortions). They may be frequent for a few weeks, then fade away almost…

Hip Hop Culture's OGs: A Narrative Inquiry into the Intersection of Hip Hop Culture, Black Males and Their Schooling Experiences

ERIC Educational Resources Information Center

Buchanan, Ian P.

2013-01-01

Using a critical race lens, this narrative study employs a focus group design to explore the intersections between black males, hip hop culture and schooling experiences. To provide a sociocultural grounding, this study first reviews the research literature around hip hop culture.s sociocultural development and its impact as a culture force that…

Beats, Rhymes, and Classroom Life: Hip-Hop Pedagogy and the Politics of Identity

ERIC Educational Resources Information Center

Hill, Marc Lamont

2009-01-01

For over a decade, educators have looked to capitalize on the appeal of hip-hop culture, sampling its language, techniques, and styles as a way of reaching out to students. But beyond a fashionable hipness, what does hip-hop have to offer our schools? In this revelatory new book, Marc Lamont Hill shows how a serious engagement with hip-hop culture…

Engaging Black Males on Their Own Terms: What Schools Can Learn from Black Males Who Produce Hip-Hop

ERIC Educational Resources Information Center

Irby, Decoteau J.; Petchauer, Emery; Kirkland, David

2013-01-01

Education scholars and practitioners have much to learn about engagement and motivation of Black males by directing their inquiries to more organic sites of hip-hop cultural production outside of schools. One such site is the hip-hop's informal labor economy where Black males engage in earning money through hip-hop cultural production. Labor…

Bringing Back Sweet (and Not so Sweet) Memories: The Cultural Politics of Memory, Hip-Hop, and Generational Identities

ERIC Educational Resources Information Center

Hill, Marc Lamont

2009-01-01

This article examines the salience of collective "memory" and "remembering" among a group of students in Hip-Hop Lit, a hip-hop centered English literature course that I co-taught at "Howard High School," an urban high school in the Northeastern United States. Specifically, this article examines the memory work that occurred within Hip-Hop Lit in…

Migration of CT triplet excitons in TCNB-biphenyl and TCNB-HMB crystals

NASA Astrophysics Data System (ADS)

Kozankiewicz, BolesAw

1994-01-01

Delayed fluorescence decay curves of charge transfer (CT) crystals of tetracyanobenzene with biphenyl (TCNB-B) and with hexamethylbenzene (TCNB-HMB) have been studied over a wide temperature range (5-200 K). The decay curves have been adequately described by decay expressions derived for different mechanisms of triplet-triplet annihilation. This analysis points to one-dimensional, thermally activated motion of CT triplet excitons. The estimated activation energies for the exciton hopping are 360±60 and 650±100 cm -1 (or 550±150 cm -1 depending on the applied model) for the TCNB-B and TCNB-HMB crystals, respectively. The results seem to confirm the self-trapping of triplet CT excitons.

Absolute frequency atlas from 915 nm to 985 nm based on laser absorption spectroscopy of iodine

NASA Astrophysics Data System (ADS)

Nölleke, Christian; Raab, Christoph; Neuhaus, Rudolf; Falke, Stephan

2018-04-01

This article reports on laser absorption spectroscopy of iodine gas between 915 nm and 985 nm. This wavelength range is scanned utilizing a narrow linewidth and mode-hop-free tunable diode-laser whose frequency is actively controlled using a calibrated wavelength meter. This allows us to provide an iodine atlas that contains almost 10,000 experimentally observed reference lines with an uncertainty of 50 MHz. For common lines, good agreement is found with a publication by Gerstenkorn and Luc (1978). The new rich dataset allows existing models of the iodine molecule to be refined and can serve as a reference for laser frequency calibration and stabilization.

Hop/Sti1 – A Two-Faced Cochaperone Involved in Pattern Recognition Receptor Maturation and Viral Infection

PubMed Central

Lamm, Christian E.; Kraner, Max. E.; Hofmann, Jörg; Börnke, Frederik; Mock, Hans-Peter; Sonnewald, Uwe

2017-01-01

Perception of pathogens by host pattern recognition receptors (PRRs) or R proteins is a prerequisite to promote successful immune responses. The Hsp70/Hsp90 organizing protein Hop/Sti1, a multifunctional cochaperone, has been implicated in the maturation of a receptor-like kinase (RLK) necessary for chitin sensing. However, it remains unknown whether Hop/Sti1 is generally participating in PRR genesis. Using RNA-interference (RNAi), we silenced Hop/Sti1 expression in Nicotiana tabacum to gain further insight into the role of the cochaperone in plant defense responses. As expected, transgenic plants do not respond to chitin treatment anymore. In contrast to this, trafficking and functionality of the flagellin PRR FLS2 were unaltered, suggesting a selective involvement of Hop/Sti1 during PRR maturation. Furthermore, Hop/Sti1 was identified as a cellular determinant of Potato virus Y (PVY) symptom development in tobacco, since PVY was able to accumulate to near wild-type level without provoking the usual veinal necrosis phenotype. In addition, typical antiviral host defense responses were suppressed in the transgenic plants. These data suggest that perception of PVY is dependent on Hop/Sti1-mediated receptor maturation, while viral symptoms represent a failing attempt to restrict PVY spread. In addition, Hop/Sti1 colocalized with virus-induced membrane aggregates in wild-type plants. The retention of Hop/Sti1 in potential viral replication complexes suggests a role during viral translation/replication, explaining why RNAi-lines do not exhibit increased susceptibility to PVY. This study provides evidence for a dual role of Hop/Sti1 in PRR maturation and pathogen perception as well as in promoting viral proliferation. PMID:29075278

Aspirin increases susceptibility of Helicobacter pylori to metronidazole by augmenting endocellular concentrations of antimicrobials

PubMed Central

Zhang, Xiao-Ping; Wang, Wei-Hong; Tian, Yu; Gao, Wen; Li, Jiang

2009-01-01

AIM: To investigate the mechanisms of aspirin increasing the susceptibility of Helicobacter pylori (H pylori) to metronidazole. METHODS: H pylori reference strain 26 695 and two metronidazole-resistant isolates of H pylori were included in this study. Strains were incubated in Brucella broth with or without aspirin (1 mmol/L). The rdxA gene of H pylori was amplified by PCR and sequenced. The permeability of H pylori to antimicrobials was determined by analyzing the endocellular radioactivity of the cells after incubated with [7-3H]-tetracycline. The outer membrane proteins (OMPs) of H pylori 26 695 were depurated and analyzed by SDS-PAGE. The expression of 5 porins (hopA, hopB, hopC, hopD and hopE) and the putative RND efflux system (hefABC) of H pylori were analyzed using real-time quantitative PCR. RESULTS: The mutations in rdxA gene did not change in metronidazole resistant isolates treated with aspirin. The radioactivity of H pylori increased when treated with aspirin, indicating that aspirin improved the permeability of the outer membrane of H pylori. However, the expression of two OMP bands between 55 kDa and 72 kDa altered in the presence of aspirin. The expression of the mRNA of hopA, hopB, hopC, hopD, hopE and hefA, hefB, hefC of H pylori did not change when treated with aspirin. CONCLUSION: Although aspirin increases the susceptibility of H pylori to metronidazole, it has no effect on the mutations of rdxA gene of H pylori. Aspirin increases endocellular concentrations of antimicrobials probably by altering the OMP expression. PMID:19248190

Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip

PubMed Central

Nelson, Gregory M.; Huffman, Holly; Smith, David F.

2003-01-01

Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function. PMID:14627198

Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

PubMed

Nelson, Gregory M; Huffman, Holly; Smith, David F

2003-01-01

Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

Vehicle Density Based Forwarding Protocol for Safety Message Broadcast in VANET

PubMed Central

Huang, Jiawei; Wang, Jianxin

2014-01-01

In vehicular ad hoc networks (VANETs), the medium access control (MAC) protocol is of great importance to provide time-critical safety applications. Contemporary multihop broadcast protocols in VANETs usually choose the farthest node in broadcast range as the forwarder to reduce the number of forwarding hops. However, in this paper, we demonstrate that the farthest forwarder may experience large contention delay in case of high vehicle density. We propose an IEEE 802.11-based multihop broadcast protocol VDF to address the issue of emergency message dissemination. To achieve the tradeoff between contention delay and forwarding hops, VDF adaptably chooses the forwarder according to the vehicle density. Simulation results show that, due to its ability to decrease the transmission collisions, the proposed protocol can provide significantly lower broadcast delay. PMID:25121125

Microhard MHX2420 Orbital Performance Evaluation Using RT Logic T400CS

NASA Technical Reports Server (NTRS)

TintoreGazulla, Oriol; Lombardi, Mark

2012-01-01

RT Logic allows simulation of Ground Station - satellite communications: Static tests have been successful. Dynamic tests have been performed for simple passes. Future dynamic tests are needed to simulate real orbit communications. Satellite attitude changes antenna gain. Atmospheric and rain losses need to be added. STK Plug-in will be the next step to improve the dynamic tests. There is a possibility of running longer simulations. Simulation of different losses available in the STK Plug-in. Microhard optimization: Effect of Microhard settings on the data throughput have been understood. Optimized settings improve data throughput for LEO communications. Longer hop intervals make transfer of larger packets more efficient (more time between hops in frequency). Use of FEC (Reed-Solomon) reduces the number of retransmissions for long-range or noisy communications.

Quantum connectivity optimization algorithms for entanglement source deployment in a quantum multi-hop network

NASA Astrophysics Data System (ADS)

Zou, Zhen-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

2018-04-01

At first, the entanglement source deployment problem is studied in a quantum multi-hop network, which has a significant influence on quantum connectivity. Two optimization algorithms are introduced with limited entanglement sources in this paper. A deployment algorithm based on node position (DNP) improves connectivity by guaranteeing that all overlapping areas of the distribution ranges of the entanglement sources contain nodes. In addition, a deployment algorithm based on an improved genetic algorithm (DIGA) is implemented by dividing the region into grids. From the simulation results, DNP and DIGA improve quantum connectivity by 213.73% and 248.83% compared to random deployment, respectively, and the latter performs better in terms of connectivity. However, DNP is more flexible and adaptive to change, as it stops running when all nodes are covered.

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics

PubMed Central

2018-01-01

As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation. PMID:29329248

Characterization of the Mammalian CORVET and HOPS Complexes and Their Modular Restructuring for Endosome Specificity*

PubMed Central

van der Kant, Rik; Jonker, Caspar T. H.; Wijdeven, Ruud H.; Bakker, Jeroen; Janssen, Lennert; Klumperman, Judith; Neefjes, Jacques

2015-01-01

Trafficking of cargo through the endosomal system depends on endosomal fusion events mediated by SNARE proteins, Rab-GTPases, and multisubunit tethering complexes. The CORVET and HOPS tethering complexes, respectively, regulate early and late endosomal tethering and have been characterized in detail in yeast where their sequential membrane targeting and assembly is well understood. Mammalian CORVET and HOPS subunits significantly differ from their yeast homologues, and novel proteins with high homology to CORVET/HOPS subunits have evolved. However, an analysis of the molecular interactions between these subunits in mammals is lacking. Here, we provide a detailed analysis of interactions within the mammalian CORVET and HOPS as well as an additional endosomal-targeting complex (VIPAS39-VPS33B) that does not exist in yeast. We show that core interactions within CORVET and HOPS are largely conserved but that the membrane-targeting module in HOPS has significantly changed to accommodate binding to mammalian-specific RAB7 interacting lysosomal protein (RILP). Arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome-associated mutations in VPS33B selectively disrupt recruitment to late endosomes by RILP or binding to its partner VIPAS39. Within the shared core of CORVET/HOPS, we find that VPS11 acts as a molecular switch that binds either CORVET-specific TGFBRAP1 or HOPS-specific VPS39/RILP thereby allowing selective targeting of these tethering complexes to early or late endosomes to time fusion events in the endo/lysosomal pathway. PMID:26463206

Performance Analysis of Millimeter-Wave Multi-hop Machine-to-Machine Networks Based on Hop Distance Statistics.

PubMed

Jung, Haejoon; Lee, In-Ho

2018-01-12

As an intrinsic part of the Internet of Things (IoT) ecosystem, machine-to-machine (M2M) communications are expected to provide ubiquitous connectivity between machines. Millimeter-wave (mmWave) communication is another promising technology for the future communication systems to alleviate the pressure of scarce spectrum resources. For this reason, in this paper, we consider multi-hop M2M communications, where a machine-type communication (MTC) device with the limited transmit power relays to help other devices using mmWave. To be specific, we focus on hop distance statistics and their impacts on system performances in multi-hop wireless networks (MWNs) with directional antenna arrays in mmWave for M2M communications. Different from microwave systems, in mmWave communications, wireless channel suffers from blockage by obstacles that heavily attenuate line-of-sight signals, which may result in limited per-hop progress in MWNs. We consider two routing strategies aiming at different types of applications and derive the probability distributions of their hop distances. Moreover, we provide their baseline statistics assuming the blockage-free scenario to quantify the impact of blockages. Based on the hop distance analysis, we propose a method to estimate the end-to-end performances (e.g., outage probability, hop count, and transmit energy) of the mmWave MWNs, which provides important insights into mmWave MWN design without time-consuming and repetitive end-to-end simulation.

A Novel Absorbable Radiopaque Hydrogel Spacer to Separate the Head of the Pancreas and Duodenum in Radiation Therapy for Pancreatic Cancer.

PubMed

Rao, Avani D; Feng, Ziwei; Shin, Eun Ji; He, Jin; Waters, Kevin M; Coquia, Stephanie; DeJong, Robert; Rosati, Lauren M; Su, Lin; Li, Dengwang; Jackson, Juan; Clark, Stephen; Schultz, Jeffrey; Hutchings, Danielle; Kim, Seong-Hun; Hruban, Ralph H; DeWeese, Theodore L; Wong, John; Narang, Amol; Herman, Joseph M; Ding, Kai

2017-12-01

We assessed the feasibility and theoretical dosimetric advantages of an injectable hydrogel to increase the space between the head of the pancreas (HOP) and duodenum in a human cadaveric model. Using 3 human cadaveric specimens, an absorbable radiopaque hydrogel was injected between the HOP and duodenum by way of open laparotomy in 1 case and endoscopic ultrasound (EUS) guidance in 2 cases. The cadavers were subsequently imaged using computed tomography and dissected for histologic confirmation of hydrogel placement. The duodenal dose reduction and planning target volume (PTV) coverage were characterized using pre- and postspacer injection stereotactic body radiation therapy (SBRT) plans for the 2 cadavers with EUS-guided placement, the delivery method that appeared the most clinically desirable. Modeling studies were performed using 60 SBRT plans consisting of 10 previously treated patients with unresectable pancreatic cancer, each with 6 different HOP-duodenum separation distances. The duodenal volume receiving 15 Gy (V15), 20 Gy (V20), and 33 Gy (V33) was assessed for each iteration. In the 3 cadaveric studies, an average of 0.9 cm, 1.1 cm, and 0.9 cm HOP-duodenum separation was achieved. In the 2 EUS cases, the V20 decreased from 3.86 cm 3 to 0.36 cm 3 and 3.75 cm 3 to 1.08 cm 3 (treatment constraint <3 cm 3 ), and the V15 decreased from 7.07 cm 3 to 2.02 cm 3 and 9.12 cm 3 to 3.91 cm 3 (treatment constraint <9 cm 3 ). The PTV coverage improved or was comparable between the pre- and postinjection studies. Modeling studies demonstrated that a separation of 8 mm was sufficient to consistently reduce the V15, V20, and V33 to acceptable clinical constraints. Currently, dose escalation has been limited owing to radiosensitive structures adjacent to the pancreas. We demonstrated the feasibility of hydrogel separation of the HOP and duodenum. Future studies will evaluate the safety and efficacy of this technique with the potential for more effective dose escalation using SBRT or intensity-modulated radiation therapy to improve the outcomes in patients with unresectable pancreatic cancer. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Robust hopping based on virtual pendulum posture control.

PubMed

Sharbafi, Maziar A; Maufroy, Christophe; Ahmadabadi, Majid Nili; Yazdanpanah, Mohammad J; Seyfarth, Andre

2013-09-01

A new control approach to achieve robust hopping against perturbations in the sagittal plane is presented in this paper. In perturbed hopping, vertical body alignment has a significant role for stability. Our approach is based on the virtual pendulum concept, recently proposed, based on experimental findings in human and animal locomotion. In this concept, the ground reaction forces are pointed to a virtual support point, named virtual pivot point (VPP), during motion. This concept is employed in designing the controller to balance the trunk during the stance phase. New strategies for leg angle and length adjustment besides the virtual pendulum posture control are proposed as a unified controller. This method is investigated by applying it on an extension of the spring loaded inverted pendulum (SLIP) model. Trunk, leg mass and damping are added to the SLIP model in order to make the model more realistic. The stability is analyzed by Poincaré map analysis. With fixed VPP position, stability, disturbance rejection and moderate robustness are achieved, but with a low convergence speed. To improve the performance and attain higher robustness, an event-based control of the VPP position is introduced, using feedback of the system states at apexes. Discrete linear quartic regulator is used to design the feedback controller. Considerable enhancements with respect to stability, convergence speed and robustness against perturbations and parameter changes are achieved.

Factorial Validity of the Movement Assessment Battery for Children-2nd Edition (MABC-2) in 7-16-Year-Olds.

PubMed

Psotta, Rudolf; Abdollahipour, Reza

2017-12-01

The Movement Assessment Battery for Children-2nd Edition (MABC-2) is a test of motor development, widely used in clinical and research settings. To address which motor abilities are actually captured by the motor tasks in the two age versions of the MABC-2, the AB2 for 7- 10-year-olds and the AB3 for 11- 16-year-olds, we examined AB2 and AB3 factorial validity. We conducted confirmatory factor analysis (SPSS AMOS 22.0) on data from the test's standardization samples of children aged 7-10, n = 483, and 11-16, n = 674, in order to find the best fitting models. The covariance matrix of AB2 and AB3 fit a three-factor model that included tasks of manual dexterity, aiming and catching, and balance. However, factor analytic models fitting AB2 and AB3 did not involve the dynamic balance tasks of hopping with the better leg and hopping with the other leg; and the drawing trail showed very low factor validity. In sum, both AB2 and AB3 of the MABC-2 test are able to discriminate between the three specific motor abilities; but due to questionable psychometric quality, the drawing trail and hopping tasks should be modified to improve the construct validity for both age versions of the MABC-2.

Hip-Hop--What's in It for the Academy? Self-Understanding, Pedagogy and Aesthetical Learning Processes in Everyday Cultural Praxis

ERIC Educational Resources Information Center

Söderman, Johan; Sernhede, Ove

2016-01-01

Since hip-hop first appeared in New York over 35 years ago, it has been associated with social activism and education. Accordingly, it is not surprising that academic institutions in universities and K-12 schools are interested in hip-hop. In this article, we will highlight the "hip-hop academisation" and map out a new direction in a…

Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

PubMed

Liu, Zechang; Wang, Liping; Liu, Yumei

2018-01-18

Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Real-Time On-Board Airborne Demonstration of High-Speed On-Board Data Processing for Science Instruments (HOPS)

NASA Technical Reports Server (NTRS)

Beyon, Jeffrey Y.; Ng, Tak-Kwong; Davis, Mitchell J.; Adams, James K.; Bowen, Stephen C.; Fay, James J.; Hutchinson, Mark A.

2015-01-01

The project called High-Speed On-Board Data Processing for Science Instruments (HOPS) has been funded by NASA Earth Science Technology Office (ESTO) Advanced Information Systems Technology (AIST) program since April, 2012. The HOPS team recently completed two flight campaigns during the summer of 2014 on two different aircrafts with two different science instruments. The first flight campaign was in July, 2014 based at NASA Langley Research Center (LaRC) in Hampton, VA on the NASA's HU-25 aircraft. The science instrument that flew with HOPS was Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) CarbonHawk Experiment Simulator (ACES) funded by NASA's Instrument Incubator Program (IIP). The second campaign was in August, 2014 based at NASA Armstrong Flight Research Center (AFRC) in Palmdale, CA on the NASA's DC-8 aircraft. HOPS flew with the Multifunctional Fiber Laser Lidar (MFLL) instrument developed by Excelis Inc. The goal of the campaigns was to perform an end-to-end demonstration of the capabilities of the HOPS prototype system (HOPS COTS) while running the most computationally intensive part of the ASCENDS algorithm real-time on-board. The comparison of the two flight campaigns and the results of the functionality tests of the HOPS COTS are presented in this paper.

Co-chaperone Hsp70/Hsp90-organizing protein (Hop) is required for transposon silencing and Piwi-interacting RNA (piRNA) biogenesis.

PubMed

Karam, Joseph A; Parikh, Rasesh Y; Nayak, Dhananjaya; Rosenkranz, David; Gangaraju, Vamsi K

2017-04-14

Piwi-interacting RNAs (piRNAs) are 26-30-nucleotide germ line-specific small non-coding RNAs that have evolutionarily conserved function in mobile genetic element (transposons) silencing and maintenance of genome integrity. Drosophila Hsp70/90-organizing protein homolog (Hop), a co-chaperone, interacts with piRNA-binding protein Piwi and mediates silencing of phenotypic variations. However, it is not known whether Hop has a direct role in piRNA biogenesis and transposon silencing. Here, we show that knockdown of Hop in the germ line nurse cells (GLKD) of Drosophila ovaries leads to activation of transposons. Hop GLKD females can lay eggs at the same rate as wild-type counterparts, but the eggs do not hatch into larvae. Hop GLKD leads to the accumulation of γ-H2Av foci in the germ line, indicating increased DNA damage in the ovary. We also show that Hop GLKD-induced transposon up-regulation is due to inefficient piRNA biogenesis. Based on these results, we conclude that Hop is a critical component of the piRNA pathway and that it maintains genome integrity by silencing transposons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Selective binding of meiosis-specific yeast Hop1 protein to the holliday junctions distorts the DNA structure and its implications for junction migration and resolution.

PubMed

Tripathi, Pankaj; Anuradha, S; Ghosal, Gargi; Muniyappa, K

2006-12-08

Saccharomyces cerevisiae HOP1, which encodes a component of synaptonemal complex (SC), plays an important role in both gene conversion and crossing over between homologs, as well as enforces meiotic recombination checkpoint control over the progression of recombination intermediates. In hop1Delta mutants, meiosis-specific double-strand breaks (DSBs) are reduced to 10% of the wild-type level, and at aberrantly late times, these DSBs are processed into inter-sister recombination intermediates. However, the underlying mechanism by which Hop1 protein regulates these nuclear events remains obscure. Here we show that Hop1 protein interacts selectively with the Holliday junction, changes its global conformation and blocks the dissolution of the junction by a RecQ helicase. The Holliday junction-Hop1 protein complexes are significantly more stable at higher ionic strengths and molar excess of unlabeled competitor DNA than complexes containing other recombination intermediates. Structural analysis of the Holliday junction using 2-aminopurine fluorescence emission, DNase I footprinting and KMnO4 probing provide compelling evidence that Hop1 protein binding induces significant distortion at the center of the Holliday junction. We propose that Hop1 protein might coordinate the physical monitoring of meiotic recombination intermediates with the process of branch migration of Holliday junction.

Role of electrostatic fluctuations in doped semiconductors upon the transition from band to hopping conduction (by the example of p-Ge:Ga)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poklonski, N. A., E-mail: poklonski@bsu.by; Vyrko, S. A.; Poklonskaya, O. N.

The electrostatic model of ionization equilibrium between hydrogen-like acceptors and v-band holes in crystalline covalent p-type semiconductors is developed. The range of applicability of the model is the entire insulator side of the insulator–metal (Mott) phase transition. The density of the spatial distribution of acceptor- and donor-impurity atoms and holes over a crystal was assumed to be Poissonian and the fluctuations of their electrostatic potential energy, to be Gaussian. The model takes into account the effect of a decrease in the energy of affinity of an ionized acceptor to a v-band hole due to Debye–Hückel ion screening by both freemore » v-band holes and localized holes hopping over charge states (0) and (–1) of acceptors in the acceptor band. All donors are in charge state (+1) and are not directly involved in the screening, but ensure the total electroneutrality of a sample. In the quasiclassical approximation, analytical expressions for the root-mean-square fluctuation of the v-band hole energy W{sub p} and effective acceptor bandwidth W{sub a} are obtained. In calculating W{sub a}, only fluctuations caused by the Coulomb interaction between two nearest point charges (impurity ions and holes) are taken into account. It is shown that W{sub p} is lower than W{sub a}, since electrostatic fluctuations do not manifest themselves on scales smaller than the average de Broglie wavelength of a free hole. The delocalization threshold for v-band holes is determined as the sum of the diffusive-percolation threshold and exchange energy of holes. The concentration of free v-band holes is calculated at the temperature T{sub j} of the transition from dc band conductivity to conductivity implemented via hopping over acceptor states, which is determined from the virial theorem. The dependence of the differential energy of the thermal ionization of acceptors at the temperature 3T{sub j}/2 on their concentration N and degree of compensation K (the ratio between the donor and acceptor concentrations) is determined. Good quantitative agreement between the results of the calculation and data on the series of neutron transmutation doped p-Ge samples is obtained up to the Mott transition without using any fitting parameters.« less

Optimization of conditions for supercritical fluid extraction of flavonoids from hops (Humulus lupulus L.)*

PubMed Central

He, Guo-qing; Xiong, Hao-ping; Chen, Qi-he; Ruan, Hui; Wang, Zhao-yue; Traoré, Lonseny

2005-01-01

Waste hops are good sources of flavonoids. Extraction of flavonoids from waste hops (SC-CO2 extracted hops) using supercritical fluids technology was investigated. Various temperatures, pressures and concentrations of ethanol (modifier) and the ratio (w/w) of solvent to material were tested in this study. The results of single factor and orthogonal experiments showed that at 50 °C, 25 MPa, the ratio of solvent to material (50%), ethanol concentration (80%) resulted in maximum extraction yield flavonoids (7.8 mg/g). HPLC-MS analysis of the extracts indicated that flavonoids obtained were xanthohumol, the principal prenylflavonoid in hops. PMID:16187413

Urban hopper.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xavier, Patrick Gordon; Feddema, John Todd; Little, Charles Quentin

2010-03-01

Hopping robots provide the possibility of breaking the link between the size of a ground vehicle and the largest obstacle that it can overcome. For more than a decade, DARPA and Sandia National Laboratories have been developing small-scale hopping robot technology, first as part of purely hopping platforms and, more recently, as part of platforms that are capable of both wheeled and hopping locomotion. In this paper we introduce the Urban Hopper robot and summarize its capabilities. The advantages of hopping for overcoming certain obstacles are discussed. Several configurations of the Urban Hopper are described, as are intelligent capabilities ofmore » the system. Key challenges are discussed.« less

Temperature dependent simulation of diamond depleted Schottky PIN diodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hathwar, Raghuraj; Dutta, Maitreya; Chowdhury, Srabanti

2016-06-14

Diamond is considered as an ideal material for high field and high power devices due to its high breakdown field, high lightly doped carrier mobility, and high thermal conductivity. The modeling and simulation of diamond devices are therefore important to predict the performances of diamond based devices. In this context, we use Silvaco{sup ®} Atlas, a drift-diffusion based commercial software, to model diamond based power devices. The models used in Atlas were modified to account for both variable range and nearest neighbor hopping transport in the impurity bands associated with high activation energies for boron doped and phosphorus doped diamond.more » The models were fit to experimentally reported resistivity data over a wide range of doping concentrations and temperatures. We compare to recent data on depleted diamond Schottky PIN diodes demonstrating low turn-on voltages and high reverse breakdown voltages, which could be useful for high power rectifying applications due to the low turn-on voltage enabling high forward current densities. Three dimensional simulations of the depleted Schottky PIN diamond devices were performed and the results are verified with experimental data at different operating temperatures.« less

An Efficient Next Hop Selection Algorithm for Multi-Hop Body Area Networks

PubMed Central

Ayatollahitafti, Vahid; Ngadi, Md Asri; Mohamad Sharif, Johan bin; Abdullahi, Mohammed

2016-01-01

Body Area Networks (BANs) consist of various sensors which gather patient’s vital signs and deliver them to doctors. One of the most significant challenges faced, is the design of an energy-efficient next hop selection algorithm to satisfy Quality of Service (QoS) requirements for different healthcare applications. In this paper, a novel efficient next hop selection algorithm is proposed in multi-hop BANs. This algorithm uses the minimum hop count and a link cost function jointly in each node to choose the best next hop node. The link cost function includes the residual energy, free buffer size, and the link reliability of the neighboring nodes, which is used to balance the energy consumption and to satisfy QoS requirements in terms of end to end delay and reliability. Extensive simulation experiments were performed to evaluate the efficiency of the proposed algorithm using the NS-2 simulator. Simulation results show that our proposed algorithm provides significant improvement in terms of energy consumption, number of packets forwarded, end to end delay and packet delivery ratio compared to the existing routing protocol. PMID:26771586

Signaling induced by hop/STI-1 depends on endocytosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Americo, Tatiana A.; Chiarini, Luciana B.; Linden, Rafael

The co-chaperone hop/STI-1 is a ligand of the cell surface prion protein (PrP{sup C}), and their interaction leads to signaling and biological effects. Among these, hop/STI-1 induces proliferation of A172 glioblastoma cells, dependent on both PrP{sup C} and activation of the Erk pathway. We tested whether clathrin-mediated endocytosis affects signaling induced by hop/STI-1. Both hyperosmolarity induced by sucrose and monodansyl-cadaverine blocked Erk activity induced by hop/STI-1, without affecting the high basal Akt activity typical of A172. The endocytosis inhibitors also affected the sub-cellular distribution of phosphorylated Erk, consistent with blockade of the latter's activity. The data indicate that signaling inducedmore » by hop/STI-1 depends on endocytosis. These findings are consistent with a role of sub-cellular trafficking in signal transduction following engagement by PrP{sup C} by ligands such as hop/STI-1, and may help help unravel both the functions of the prion protein, as well as possible loss-of-function components of prion diseases.« less

Chemical Characterization of Beer Aging Products Derived from Hard Resin Components in Hops (Humulus lupulus L.).

PubMed

Taniguchi, Yoshimasa; Yamada, Makiko; Taniguchi, Harumi; Matsukura, Yasuko; Shindo, Kazutoshi

2015-11-25

The bitter taste of beer originates from resins in hops (Humulus lupulus L.), which are classified into two subtypes (soft and hard). Whereas the nature and reactivity of soft-resin-derived compounds, such as α-, β-, and iso-α-acids, are well studied, there is only a little information on the compounds in hard resin. For this work, hard resin was prepared from stored hops and investigated for its compositional changes in an experimental model of beer aging. The hard resin contained a series of α-acid oxides. Among them, 4'-hydroxyallohumulinones were unstable under beer storage conditions, and their transformation induced primary compositional changes of the hard resin during beer aging. The chemical structures of the products, including novel polycyclic compounds scorpiohumulinols A and B and dicyclohumulinols A and B, were determined by HRMS and NMR analyses. These compounds were proposed to be produced via proton-catalyzed cyclization reactions of 4'-hydroxyallohumulinones. Furthermore, they were more stable than their precursor 4'-hydroxyallohumulinones during prolonged storage periods.

Thermopower of molecular junctions: Tunneling to hopping crossover in DNA

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2016-12-01

We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].

Occurrence of Theaspirane and its Odorant Degradation Products in Hop and Beer.

PubMed

Scholtes, Caroline; Nizet, Sabrina; Massart, Hadrien; Gerbaux, Pascal; Collin, Sonia

2015-09-23

In model oxidized media, six theaspirane-derived compounds were identified by gas chromatography-high resolution mass spectrometry: 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, dihydrodehydro-β-ionone, two monoepoxides, and a derived alcohol. Only 4-hydroxy-7,8-dihydro-β-ionone and dihydrodehydro-β-ionone have been described previously in the literature. Investigation of hop revealed five of these compounds in free form together with theaspirane (especially in the Mosaic variety), while the Citra and Amarillo hop varieties emerged as very interesting for the release of theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone from glucoside precursors. For the first time, theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, 6-hydroxy-7,8-dihydro-α-ionone, and both monoepoxides were found in a fresh commercial top fermentation beer (only theaspirane, 4-hydroxy-7,8-dihydro-β-ionone, and dihydrodehydro-β-ionone have recently been mentioned as Gueuze constituents).

Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

PubMed

Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

2016-05-19

Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

Effect of structural distortion on the electronic band structure of NaOsO3 studied within density functional theory and a three-orbital model

NASA Astrophysics Data System (ADS)

Mohapatra, Shubhajyoti; Bhandari, Churna; Satpathy, Sashi; Singh, Avinash

2018-04-01

Effects of the structural distortion associated with the OsO6 octahedral rotation and tilting on the electronic band structure and magnetic anisotropy energy for the 5 d3 compound NaOsO3 are investigated using the density functional theory (DFT) and within a three-orbital model. Comparison of the essential features of the DFT band structures with the three-orbital model for both the undistorted and distorted structures provides insight into the orbital and directional asymmetry in the electron hopping terms resulting from the structural distortion. The orbital mixing terms obtained in the transformed hopping Hamiltonian resulting from the octahedral rotations are shown to account for the fine features in the DFT band structure. Staggered magnetization and the magnetic character of states near the Fermi energy indicate weak coupling behavior.

Resistance distribution in the hopping percolation model.

PubMed

Strelniker, Yakov M; Havlin, Shlomo; Berkovits, Richard; Frydman, Aviad

2005-07-01

We study the distribution function P (rho) of the effective resistance rho in two- and three-dimensional random resistor networks of linear size L in the hopping percolation model. In this model each bond has a conductivity taken from an exponential form sigma proportional to exp (-kappar) , where kappa is a measure of disorder and r is a random number, 0< or = r < or =1 . We find that in both the usual strong-disorder regime L/ kappa(nu) >1 (not sensitive to removal of any single bond) and the extreme-disorder regime L/ kappa(nu) <1 (very sensitive to such a removal) the distribution depends only on L/kappa(nu) and can be well approximated by a log-normal function with dispersion b kappa(nu) /L , where b is a coefficient which depends on the type of lattice, and nu is the correlation critical exponent.

Theoretical models for Computing VLF wave amplitude and phase and their applications

NASA Astrophysics Data System (ADS)

Pal, Sujay; Chakrabarti, S. K.

2010-10-01

We present a review of the present theoretical models for computing the amplitude and phase of the VLF signal at any given point on earth. We present the basics of the wave hop theory and the Mode theory. We compute the signal amplitudes as a function of distance from a transmitter using both the theories and compare them. We also repeat a similar exercise for the diurnal signal. We note that the signal variation by wave hop theory gives more detailed information in the day time. As an example of using LWPC code, we compute the variation of the effective height h' and steepness β parameters for a solar flare and obtain the time dependence of the electron number density along both VTX-Kolkata and NWC-Kolkata propagation paths.

Dielectric and impedance spectral characteristics of bulk ZnIn2Se4

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Attia, A. A.; Salem, G. F.; Ali, H. A. M.; Ismail, M. I.

2014-02-01

The frequency and temperature dependence of ac conductivity, dielectric constant and dielectric loss of ZnIn2Se4 in a pellet form were investigated in the frequency range of 102-106 Hz and temperature range of 293-356 K. The behavior of ac conductivity was interpreted by the correlated barrier hopping (CBH) model. Temperature dependence of ac conductivity indicates that ac conduction is a thermally activated process. The density of localized states N(EF) and ac activation energy were estimated for various frequencies. Dielectric constant and dielectric loss showed a decrease with increasing frequency and an increase with increasing in temperature. The frequency dependence of real and imaginary parts of the complex impedance was investigated. The relaxation time decreases with the increase in temperature. The impedance spectrum exhibits the appearance of the single semicircular arc. The radius of semicircular arcs decreases with increasing temperature which suggests a mechanism of temperature-dependent on relaxation.

Accurate description of charge transport in organic field effect transistors using an experimentally extracted density of states

NASA Astrophysics Data System (ADS)

Roelofs, W. S. C.; Mathijssen, S. G. J.; Janssen, R. A. J.; de Leeuw, D. M.; Kemerink, M.

2012-02-01

The width and shape of the density of states (DOS) are key parameters to describe the charge transport of organic semiconductors. Here we extract the DOS using scanning Kelvin probe microscopy on a self-assembled monolayer field effect transistor (SAMFET). The semiconductor is only a single monolayer which has allowed extraction of the DOS over a wide energy range, pushing the methodology to its fundamental limit. The measured DOS consists of an exponential distribution of deep states with additional localized states on top. The charge transport has been calculated in a generic variable range-hopping model that allows any DOS as input. We show that with the experimentally extracted DOS an excellent agreement between measured and calculated transfer curves is obtained. This shows that detailed knowledge of the density of states is a prerequisite to consistently describe the transfer characteristics of organic field effect transistors.

The influence of oxidation time on the properties of oxidized zinc films

NASA Astrophysics Data System (ADS)

Rambu, A. P.

2012-09-01

The effect of oxidation time on the structural characteristics and electronic transport mechanism of zinc oxide thin films prepared by thermal oxidation, have been investigated. Zinc metallic films were deposited by thermal evaporation under vacuum, the subsequent oxidation of Zn films being carried out in open atmosphere. XRD and AFM analysis indicate that obtained films posses a polycrystalline structure, the crystallites having a preferential orientation. Structural analysis reveals that microstructure of the films (crystallite size, surface roughness, internal stress) is depending on the oxidation time of metallic films. The electrical behavior of ZnO films was investigated, during a heat treatment (two heating/cooling cycles). It was observed that after the first heating, the temperature dependences of electrical conductivity become reversible. Mott variable range hopping model was proposed to analyze the temperature dependence of the electrical conductivity, in low temperature ranges. Values of some characteristic parameters were calculated.

Homothallism in Pseudoperonospora humuli

USDA-ARS?s Scientific Manuscript database

The hop downy mildew pathogen, Pseudoperonospora humuli, forms oospores abundantly in diseased hop tissue. Diverse monosporangial isolates of P. humuli collected from Japan, Germany, and five states in the USA readily formed oospores within hop leaves when inoculated singly, suggesting homothallism....

"Makin' Somethin' Outta Little-to-Nufin'': Racism, Revision and Rotating Records--The Hip-Hop DJ in Composition Praxis

ERIC Educational Resources Information Center

Craig, Todd

2015-01-01

Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…

"Words of Wisdom": An Expectancy-Value Examination of Relationships among Hip-Hop Racial Socialization and Racial Identity of African-American College Students

ERIC Educational Resources Information Center

Gangloff-Bailey, Felicia

2017-01-01

The influence of hip hop culture and music on African-American youth is profound and can be used as a tool to shape positive outcomes in education. Hip hop has been used effectively in the classroom to engage students and enhance their critical thinking (Gangloff-Bailey & Freeman, 2014). In addition, hip hop has been described as a socializer…

Evaluation of 1-hydroxypyrene as a biological marker of industrial exposure to polycyclic aromatic hydrocarbons

NASA Astrophysics Data System (ADS)

Calderon, Francisco M.

1993-03-01

One hundred twenty-two workers (sixteen from a coke production plant and 106 from a graphite electrode manufacturing plant) agreed to participate in this study evaluating the relationship between exposure to polycyclic aromatic hydrocarbons (PAHs) and urinary excretion of 1-hydroxypyrene (1-HOP), the main metabolite of pyrene. The results show that the concentration of pyrene in air is highly correlated with total PAHs (r equals 0.83, P < 0.0001). The correlation coefficient between pyrene in air and 1-HOP is (r equals 0.69, P < 0.0001) and between 1-HOP and total PAHs is (r equals 0.77, P < 0.0001). The biological half life of the 1-HOP was determined (18 hrs) and the noninterference of smoking habits in relation to 1-HOP urinary excretion was established, concluding that 1-HOP is a suitable bioindicator of the occupational exposure to PAHs.

Confined diffusion of transmembrane proteins and lipids induced by the same actin meshwork lining the plasma membrane.

PubMed

Fujiwara, Takahiro K; Iwasawa, Kokoro; Kalay, Ziya; Tsunoyama, Taka A; Watanabe, Yusuke; Umemura, Yasuhiro M; Murakoshi, Hideji; Suzuki, Kenichi G N; Nemoto, Yuri L; Morone, Nobuhiro; Kusumi, Akihiro

2016-04-01

The mechanisms by which the diffusion rate in the plasma membrane (PM) is regulated remain unresolved, despite their importance in spatially regulating the reaction rates in the PM. Proposed models include entrapment in nanoscale noncontiguous domains found in PtK2 cells, slow diffusion due to crowding, and actin-induced compartmentalization. Here, by applying single-particle tracking at high time resolutions, mainly to the PtK2-cell PM, we found confined diffusion plus hop movements (termed "hop diffusion") for both a nonraft phospholipid and a transmembrane protein, transferrin receptor, and equal compartment sizes for these two molecules in all five of the cell lines used here (actual sizes were cell dependent), even after treatment with actin-modulating drugs. The cross-section size and the cytoplasmic domain size both affected the hop frequency. Electron tomography identified the actin-based membrane skeleton (MSK) located within 8.8 nm from the PM cytoplasmic surface of PtK2 cells and demonstrated that the MSK mesh size was the same as the compartment size for PM molecular diffusion. The extracellular matrix and extracellular domains of membrane proteins were not involved in hop diffusion. These results support a model of anchored TM-protein pickets lining actin-based MSK as a major mechanism for regulating diffusion. © 2016 Fujiwara et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Microscopic theory of Dzyaloshinsky-Moriya interaction in pyrochlore oxides with spin-orbit coupling

NASA Astrophysics Data System (ADS)

Arakawa, Naoya

2016-10-01

Pyrochlore oxides show several fascinating phenomena, such as the formation of heavy fermions and the thermal Hall effect. Although a key to understanding some phenomena may be the Dzyaloshinsky-Moriya (DM) interaction, its microscopic origin is unclear. To clarify the microscopic origin, we constructed a t2 g-orbital model with the kinetic energy, the trigonal-distortion potential, the multiorbital Hubbard interactions, and the L S coupling, and derived the low-energy effective Hamiltonian for a d1 Mott insulator with the weak L S coupling. We first show that lack of the inversion center of each nearest-neighbor V-V bond causes the odd-mirror interorbital hopping integrals. Those are qualitatively different from the even-mirror hopping integrals, existing even with the inversion center. We next show that the second-order perturbation using the kinetic terms leads to the ferromagnetic and the antiferromagnetic superexchange interactions, whose competition is controllable by tuning the Hubbard interactions. Then, we show the most important result: the third-order perturbation terms using the combination of the even-mirror hopping integral, the odd-mirror hopping integral, and the L S coupling causes the DM interaction due to the mirror-mixing effect, where those hopping integrals are necessary to obtain the antisymmetric kinetic exchange and the L S coupling is necessary to excite the orbital angular momentum at one of two sites. We also show that the magnitude and sign of the DM interaction can be controlled by changing the positions of the O ions and the strength of the Hubbard interactions. We discuss the advantages in comparison with the phenomenological theory and Moriya's microscopic theory, applicability of our mechanism, and the similarities and differences between our case and the strong-L S -coupling case.

Evidence of a Cell Surface Role for Hsp90 Complex Proteins Mediating Neuroblast Migration in the Subventricular Zone.

PubMed

Miyakoshi, Leo M; Marques-Coelho, Diego; De Souza, Luiz E R; Lima, Flavia R S; Martins, Vilma R; Zanata, Silvio M; Hedin-Pereira, Cecilia

2017-01-01

In most mammalian brains, the subventricular zone (SVZ) is a germinative layer that maintains neurogenic activity throughout adulthood. Neuronal precursors arising from this region migrate through the rostral migratory stream (RMS) and reach the olfactory bulbs where they differentiate and integrate into the local circuitry. Recently, studies have shown that heat shock proteins have an important role in cancer cell migration and blocking Hsp90 function was shown to hinder cell migration in the developing cerebellum. In this work, we hypothesize that chaperone complexes may have an important function regulating migration of neuronal precursors from the subventricular zone. Proteins from the Hsp90 complex are present in the postnatal SVZ as well as in the RMS. Using an in vitro SVZ explant model, we have demonstrated the expression of Hsp90 and Hop/STI1 by migrating neuroblasts. Treatment with antibodies against Hsp90 and co-chaperone Hop/STI1, as well as Hsp90 and Hsp70 inhibitors hinder neuroblast chain migration. Time-lapse videomicroscopy analysis revealed that cell motility and average migratory speed was decreased after exposure to both antibodies and inhibitors. Antibodies recognizing Hsp90, Hsp70, and Hop/STI1 were found bound to the membranes of cells from primary SVZ cultures and biotinylation assays demonstrated that Hsp70 and Hop/STI1 could be found on the external leaflet of neuroblast membranes. The latter could also be detected in conditioned medium samples obtained from cultivated SVZ cells. Our results suggest that chaperones Hsp90, Hsp70, and co-chaperone Hop/STI1, components of the Hsp90 complex, regulate SVZ neuroblast migration in a concerted manner through an extracellular mechanism.

Structure and Charge Hopping Dynamics in Green Rust

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wander, Matthew C; Rosso, Kevin M; Schoonen, Martin A

Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe 2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH) 2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mössbauer spectra show a characteristic signature for intermediate valence on the iron atoms inmore » this sheet, indicative of a Fe 2+-Fe 3+ valence interchange reaction faster than approximately 10 7 s -1. Using Fe(OH) 2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe 3+ hole polarons in this material, providing a first principles assessment of the Fe 2+-Fe 3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6 Å is the fastest. The predicted rate is on the order of 10 12 s -1 consistent the Mössbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 10 7 s -1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe 2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.« less

Sensitive photo-thermal response of graphene oxide for mid-infrared detection

NASA Astrophysics Data System (ADS)

Bae, Jung Jun; Yoon, Jung Hyun; Jeong, Sooyeon; Moon, Byoung Hee; Han, Joong Tark; Jeong, Hee Jin; Lee, Geon-Woong; Hwang, Ha Ryong; Lee, Young Hee; Jeong, Seung Yol; Lim, Seong Chu

2015-09-01

This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability.This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04039f

Identification of Mott insulators and Anderson insulators in self-assembled gold nanoparticles thin films

NASA Astrophysics Data System (ADS)

Jiang, Cheng-Wei; Ni, I.-Chih; Tzeng, Shien-Der; Wu, Cen-Shawn; Kuo, Watson

2014-05-01

How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction.How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr06627d

The HOPS/Class C Vps Complex Tethers High-Curvature Membranes via a Direct Protein-Membrane Interaction.

PubMed

Ho, Ruoya; Stroupe, Christopher

2016-10-01

Membrane tethering is a physical association of two membranes before their fusion. Many membrane tethering factors have been identified, but the interactions that mediate inter-membrane associations remain largely a matter of conjecture. Previously, we reported that the homotypic fusion and protein sorting/Class C vacuolar protein sorting (HOPS/Class C Vps) complex, which has two binding sites for the yeast vacuolar Rab GTPase Ypt7p, can tether two low-curvature liposomes when both membranes bear Ypt7p. Here, we show that HOPS tethers highly curved liposomes to Ypt7p-bearing low-curvature liposomes even when the high-curvature liposomes are protein-free. Phosphorylation of the curvature-sensing amphipathic lipid-packing sensor (ALPS) motif from the Vps41p HOPS subunit abrogates tethering of high-curvature liposomes. A HOPS complex without its Vps39p subunit, which contains one of the Ypt7p binding sites in HOPS, lacks tethering activity, though it binds high-curvature liposomes and Ypt7p-bearing low-curvature liposomes. Thus, HOPS tethers highly curved membranes via a direct protein-membrane interaction. Such high-curvature membranes are found at the sites of vacuole tethering and fusion. There, vacuole membranes bend sharply, generating large areas of vacuole-vacuole contact. We propose that HOPS localizes via the Vps41p ALPS motif to these high-curvature regions. There, HOPS binds via Vps39p to Ypt7p in an apposed vacuole membrane. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Leg exoskeleton reduces the metabolic cost of human hopping.

PubMed

Grabowski, Alena M; Herr, Hugh M

2009-09-01

During bouncing gaits such as hopping and running, leg muscles generate force to enable elastic energy storage and return primarily from tendons and, thus, demand metabolic energy. In an effort to reduce metabolic demand, we designed two elastic leg exoskeletons that act in parallel with the wearer's legs; one exoskeleton consisted of a multiple leaf (MLE) and the other of a single leaf (SLE) set of fiberglass springs. We hypothesized that hoppers, hopping on both legs, would adjust their leg stiffness while wearing an exoskeleton so that the combination of the hopper and exoskeleton would behave as a linear spring-mass system with the same total stiffness as during normal hopping. We also hypothesized that decreased leg force generation while wearing an exoskeleton would reduce the metabolic power required for hopping. Nine subjects hopped in place at 2.0, 2.2, 2.4, and 2.6 Hz with and without an exoskeleton while we measured ground reaction forces, exoskeletal compression, and metabolic rates. While wearing an exoskeleton, hoppers adjusted their leg stiffness to maintain linear spring-mass mechanics and a total stiffness similar to normal hopping. Without accounting for the added weight of each exoskeleton, wearing the MLE reduced net metabolic power by an average of 6% and wearing the SLE reduced net metabolic power by an average of 24% compared with hopping normally at frequencies between 2.0 and 2.6 Hz. Thus, when hoppers used external parallel springs, they likely decreased the mechanical work performed by the legs and substantially reduced metabolic demand compared with hopping without wearing an exoskeleton.

Knee Joint Loading during Single-Leg Forward Hopping.

PubMed

Krupenevich, Rebecca L; Pruziner, Alison L; Miller, Ross H

2017-02-01

Increased or abnormal loading on the intact limb is thought to contribute to the relatively high risk of knee osteoarthritis in this limb for individuals with unilateral lower limb loss. This theory has been assessed previously by studying walking, but knee joint loading during walking is often similar between individuals with and without limb loss, prompting assessment of other movements that may place unusual loads on the knee. One such movement, hopping, is a form of locomotion that individuals with unilateral lower limb loss may situationally use instead of walking, but the mechanical effects of hopping on the intact limb are unknown. Compare knee joint kinetics of healthy adults during single-leg forward hopping compared to walking, a more traditional form of locomotion. Twenty-four healthy adults walked and hopped at self-selected speeds of 1.5 and 2.3 m·s, respectively. Joint moments were calculated using inverse dynamics. A paired Student's t-test was utilized to compare peak, impulse, and loading rate (LR) of knee adduction moment (KAM), and peak knee flexion moment (KFM) between walking and hopping. Peak KFM and KAM LR were greater during hopping compared to walking (peak KFM: 20.73% vs 5.51% body weight (BW) × height (Ht), P < 0.001; KAM LR: 0.47 vs. 0.33 BW·Ht·s, P = 0.01). Kinetic measures affecting knee joint loading are greater in hopping compared to walking. It may be advisable to limit single-leg forward hopping in the limb loss population until it is known if these loads increase knee osteoarthritis risk.

Beer spoilage bacteria and hop resistance.

PubMed

Sakamoto, Kanta; Konings, Wil N

2003-12-31

For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However, some potential hop-resistant strains cannot grow in beer unless they have first been exposed to subinhibitory concentration of hop compounds. The beer spoilage ability of Pectinatus spp. and M. cerevisiae has been poorly studied. Since all the strains have been reported to be capable of beer spoiling, species identification is sufficient for the breweries. However, with the current trend of beer flavor (lower alcohol and bitterness), there is the potential risk that not yet reported bacteria will contribute to beer spoilage. Investigation of the beer spoilage ability of especially Gram-negative bacteria may be useful to reduce this risk.

Strain effects on oxygen migration in perovskites.

PubMed

Mayeshiba, Tam; Morgan, Dane

2015-01-28

Fast oxygen transport materials are necessary for a range of technologies, including efficient and cost-effective solid oxide fuel cells, gas separation membranes, oxygen sensors, chemical looping devices, and memristors. Strain is often proposed as a method to enhance the performance of oxygen transport materials, but the magnitude of its effect and its underlying mechanisms are not well-understood, particularly in the widely-used perovskite-structured oxygen conductors. This work reports on an ab initio prediction of strain effects on migration energetics for nine perovskite systems of the form LaBO3, where B = [Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Ga]. Biaxial strain, as might be easily produced in epitaxial systems, is predicted to lead to approximately linear changes in migration energy. We find that tensile biaxial strain reduces the oxygen vacancy migration barrier across the systems studied by an average of 66 meV per percent strain for a single selected hop, with a low of 36 and a high of 89 meV decrease in migration barrier per percent strain across all systems. The estimated range for the change in migration barrier within each system is ±25 meV per percent strain when considering all hops. These results suggest that strain can significantly impact transport in these materials, e.g., a 2% tensile strain can increase the diffusion coefficient by about three orders of magnitude at 300 K (one order of magnitude at 500 °C or 773 K) for one of the most strain-responsive materials calculated here (LaCrO3). We show that a simple elasticity model, which assumes only dilative or compressive strain in a cubic environment and a fixed migration volume, can qualitatively but not quantitatively model the strain dependence of the migration energy, suggesting that factors not captured by continuum elasticity play a significant role in the strain response.

Intervention for Young Children Displaying Coordination Disorders

ERIC Educational Resources Information Center

Chambers, Mary E.; Sugden, David A.

2016-01-01

The years from 3 to 6 are a time when children develop fundamental movement skills that are the building blocks for the functional movements they use throughout their lives. By 6 years of age, a typically developing child will have in place a full range of movement skills, including, running, jumping, hopping, skipping, climbing, throwing,…

Remixing Old and New Literacies = Motivated Students

ERIC Educational Resources Information Center

Gainer, Jesse S.; Lapp, Diane

2010-01-01

Although not a new concept, remix has recently gained popularity in mainstream sources ranging from video games to newspaper columns and television commercials for airline tickets, fried chicken, and soft drinks. All these examples draw on a concept that originates from hip-hop culture and refers to the creative blending of materials from…

Thermally activated charge transport in microbial protein nanowires

PubMed Central

Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

2016-01-01

The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors. PMID:27009596

Thermally activated charge transport in microbial protein nanowires

NASA Astrophysics Data System (ADS)

Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

2016-03-01

The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

Thermally activated charge transport in microbial protein nanowires.

PubMed

Lampa-Pastirk, Sanela; Veazey, Joshua P; Walsh, Kathleen A; Feliciano, Gustavo T; Steidl, Rebecca J; Tessmer, Stuart H; Reguera, Gemma

2016-03-24

The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

Decoding Hip-Hop's Cultural Impact: Scholars Are Poised to Take a Close Look at the Influence of Hip-Hop on the Social Identity, Values of Today's Youth

ERIC Educational Resources Information Center

Roach, Ronald

2004-01-01

As a cultural movement, hip-hop manages to get billed as both a positive and negative influence on young people, especially on Black and Latino youth. On one hand, there are African American activists, artists and entrepreneurs, such as Russell Simmons, who seek to build a progressive political movement among young hip-hop fans and who have had…

Relay-aided free-space optical communications using α - μ distribution over atmospheric turbulence channels with misalignment errors

NASA Astrophysics Data System (ADS)

Upadhya, Abhijeet; Dwivedi, Vivek K.; Singh, G.

2018-06-01

In this paper, we have analyzed the performance of dual hop radio frequency (RF)/free-space optical (FSO) fixed gain relay environment confined by atmospheric turbulence induced fading channel over FSO link and modeled using α - μ distribution. The RF hop of the amplify-and-forward scheme undergoes the Rayleigh fading and the proposed system model also considers the pointing error effect on the FSO link. A novel and accurate mathematical expression of the probability density function for a FSO link experiencing α - μ distributed atmospheric turbulence in the presence of pointing error is derived. Further, we have presented analytical expressions of outage probability and bit error rate in terms of Meijer-G function. In addition to this, a useful and mathematically tractable closed-form expression for the end-to-end ergodic capacity of the dual hop scheme in terms of bivariate Fox's H function is derived. The atmospheric turbulence, misalignment errors and various binary modulation schemes for intensity modulation on optical wireless link are considered to yield the results. Finally, we have analyzed each of the three performance metrics for high SNR in order to represent them in terms of elementary functions and the achieved analytical results are supported by computer-based simulations.

Charge carrier coherence and Hall effect in organic semiconductors

DOE PAGES

Yi, H. T.; Gartstein, Y. N.; Podzorov, V.

2016-03-30

Hall effect measurements are important for elucidating the fundamental charge transport mechanisms and intrinsic mobility in organic semiconductors. However, Hall effect studies frequently reveal an unconventional behavior that cannot be readily explained with the simple band-semiconductor Hall effect model. Here, we develop an analytical model of Hall effect in organic field-effect transistors in a regime of coexisting band and hopping carriers. The model, which is supported by the experiments, is based on a partial Hall voltage compensation effect, occurring because hopping carriers respond to the transverse Hall electric field and drift in the direction opposite to the Lorentz force actingmore » on band carriers. We show that this can lead in particular to an underdeveloped Hall effect observed in organic semiconductors with substantial off-diagonal thermal disorder. Lastly, our model captures the main features of Hall effect in a variety of organic semiconductors and provides an analytical description of Hall mobility, carrier density and carrier coherence factor.« less

Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

DOE PAGES

Ha, Dong -Gwang; Kim, Jang -Joo; Baldo, Marc A.

2016-04-29

Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl) amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl) benzene (BmPyPb)more » mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. Furthermore, the analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ha, Dong-Gwang; Kim, Jang-Joo; Baldo, Marc A.

2016-04-01

Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl)amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl)benzene (BmPyPb) mixtures withmore » different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

Charge carrier coherence and Hall effect in organic semiconductors

PubMed Central

Yi, H. T.; Gartstein, Y. N.; Podzorov, V.

2016-01-01

Hall effect measurements are important for elucidating the fundamental charge transport mechanisms and intrinsic mobility in organic semiconductors. However, Hall effect studies frequently reveal an unconventional behavior that cannot be readily explained with the simple band-semiconductor Hall effect model. Here, we develop an analytical model of Hall effect in organic field-effect transistors in a regime of coexisting band and hopping carriers. The model, which is supported by the experiments, is based on a partial Hall voltage compensation effect, occurring because hopping carriers respond to the transverse Hall electric field and drift in the direction opposite to the Lorentz force acting on band carriers. We show that this can lead in particular to an underdeveloped Hall effect observed in organic semiconductors with substantial off-diagonal thermal disorder. Our model captures the main features of Hall effect in a variety of organic semiconductors and provides an analytical description of Hall mobility, carrier density and carrier coherence factor. PMID:27025354

Energetics and biomechanics of locomotion by red kangaroos (Macropus rufus).

PubMed

Kram, R; Dawson, T J

1998-05-01

As red kangaroos hop faster over level ground, their rate of oxygen consumption (indicating metabolic energy consumption) remains nearly the same. This phenomenon has been attributed to exceptional elastic energy storage and recovery via long compliant tendons in the legs. Alternatively, red kangaroos may have exceptionally efficient muscles. To estimate efficiency, we measured the metabolic cost of uphill hopping, where muscle fibers must perform mechanical work against gravity. We found that uphill hopping was much more expensive than level hopping. The maximal rate of oxygen consumption measured (3 ml O2 kg-1 s-1) exceeds all but a few vertebrate species. However, efficiency values were normal, approximately 30%. At faster level hopping speeds the effective mechanical advantage of the extensor muscles of the ankle joint remained the same. Thus, kangaroos generate the same muscular force at all speeds but do so more rapidly at faster hopping speeds. This contradicts a recent hypothesis for what sets the cost of locomotion. The cost of transport (J kg-1 m-1) decreases at faster hopping speeds, yet red kangaroos prefer to use relatively slow speeds that avoid high levels of tendon stress.

Gold Binding by Native and Chemically Modified Hops Biomasses

PubMed Central

López, M. Laura; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.

2005-01-01

Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass (Humulus lupulus) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively. PMID:18365087

Rice Protein Matrix Enhances Circulating Levels of Xanthohumol Following Acute Oral Intake of Spent Hops in Humans.

PubMed

O'Connor, Annalouise; Konda, Veera; Reed, Ralph L; Christensen, J Mark; Stevens, Jan F; Contractor, Nikhat

2018-03-01

Xanthohumol (XN), a prenylated flavonoid found in hops, exhibits anti-inflammatory and antioxidant properties. However, poor bioavailability may limit therapeutic applications. As food components are known to modulate polyphenol absorption, the objective is to determine whether a protein matrix could enhance the bioavailability of XN post oral consumption in humans. This is a randomized, double-blind, crossover study in healthy participants (n = 6) evaluating XN and its major metabolites (isoxanthohumol [IX], 6- and 8-prenylnaringenin [6-PN, 8-PN]) for 6 h following consumption of 12.4 mg of XN delivered via a spent hops-rice protein matrix preparation or a control spent hops preparation. Plasma XN and metabolites are measured by LC-MS/MS. C max , T max , and area-under-the-curve (AUC) values were determined. Circulating XN and metabolite response to each treatment was not bioequivalent. Plasma concentrations of XN and XN + metabolites (AUC) are greater with consumption of the spent hops-rice protein matrix preparation. Compared to a standard spent hops powder, a protein-rich spent hops matrix demonstrates enhanced plasma levels of XN and metabolites following acute oral intake. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sequence analyses reveal that a TPR-DP module, surrounded by recombinable flanking introns, could be at the origin of eukaryotic Hop and Hip TPR-DP domains and prokaryotic GerD proteins.

PubMed

Hernández Torres, Jorge; Papandreou, Nikolaos; Chomilier, Jacques

2009-05-01

The co-chaperone Hop [heat shock protein (HSP) organising protein] is known to bind both Hsp70 and Hsp90. Hop comprises three repeats of a tetratricopeptide repeat (TPR) domain, each consisting of three TPR motifs. The first and last TPR domains are followed by a domain containing several dipeptide (DP) repeats called the DP domain. These analyses suggest that the hop genes result from successive recombination events of an ancestral TPR-DP module. From a hydrophobic cluster analysis of homologous Hop protein sequences derived from gene families, we can postulate that shifts in the open reading frames are at the origin of the present sequences. Moreover, these shifts can be related to the presence or absence of biological function. We propose to extend the family of Hop co-chaperons into the kingdom of bacteria, as several structurally related genes have been identified by hydrophobic cluster analysis. We also provide evidence of common structural characteristics between hop and hip genes, suggesting a shared precursor of ancestral TPR-DP domains.

Condom use and hip hop culture: the case of urban young men in New York City.

PubMed

Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

2008-06-01

We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

Development of NTD Ge Sensors for Superconducting Bolometer

NASA Astrophysics Data System (ADS)

Garai, A.; Mathimalar, S.; Singh, V.; Dokania, N.; Nanal, V.; Pillay, R. G.; Ramakrishnan, S.; Shrivastava, A.; Jagadeesan, K. C.; Thakare, S. V.

2016-08-01

Neutron transmutation-doped (NTD) Ge sensors have been prepared by irradiating device-grade Ge with thermal neutrons at Dhruva reactor, BARC, Mumbai. These sensors are intended to be used for the study of neutrinoless double beta decay in ^{124}Sn with a superconducting Tin bolometer. Resistance measurements are performed on NTD Ge sensors in the temperature range 100-350 mK. The observed temperature dependence is found to be consistent with the variable-range hopping mechanism.

Hybrid spread spectrum radio system

DOEpatents

Smith, Stephen F.; Dress, William B.

2010-02-02

Systems and methods are described for hybrid spread spectrum radio systems. A method includes modulating a signal by utilizing a subset of bits from a pseudo-random code generator to control an amplification circuit that provides a gain to the signal. Another method includes: modulating a signal by utilizing a subset of bits from a pseudo-random code generator to control a fast hopping frequency synthesizer; and fast frequency hopping the signal with the fast hopping frequency synthesizer, wherein multiple frequency hops occur within a single data-bit time.

Energy landscape in frustrated systems: Cation hopping in pyrochlores

NASA Astrophysics Data System (ADS)

Brooks Hinojosa, Beverly; Asthagiri, Aravind; Nino, Juan C.

2013-07-01

We investigate the dynamics of the local environment and electronic structure in inherently dipolar frustrated pyrochlore compounds to help identify the fundamental nature of dipolar disorder in pyrochlore systems and determine the necessary and sufficient conditions for dielectric relaxation. We map out the energy landscape associated with cation hopping events in three compounds and correlate the hopping pathway with experimental dielectric response. Comprehensive analysis of the calculations allows us to postulate rules to predict the occurrence of relaxation and cation hopping pathways.

Time Correlations in Mode Hopping of Coupled Oscillators

NASA Astrophysics Data System (ADS)

Heltberg, Mathias L.; Krishna, Sandeep; Jensen, Mogens H.

2017-05-01

We study the dynamics in a system of coupled oscillators when Arnold Tongues overlap. By varying the initial conditions, the deterministic system can be attracted to different limit cycles. Adding noise, the mode hopping between different states become a dominating part of the dynamics. We simplify the system through a Poincare section, and derive a 1D model to describe the dynamics. We explain that for some parameter values of the external oscillator, the time distribution of occupancy in a state is exponential and thus memoryless. In the general case, on the other hand, it is a sum of exponential distributions characteristic of a system with time correlations.

Metastable self-trapping of positrons in MgO

NASA Astrophysics Data System (ADS)

Monge, M. A.; Pareja, R.; González, R.; Chen, Y.

1997-01-01

Low-temperature positron annihilation measurements have been performed on MgO single crystals containing either cation or anion vacancies. The temperature dependence of the S parameter is explained in terms of metastable self-trapped positrons which thermally hop through the crystal lattice. The experimental results are analyzed using a three-state trapping model assuming transitions from both delocalized and self-trapped states to deep trapped states at vacancies. The energy level of the self-trapped state was determined to be (62+/-5) meV above the delocalized state. The activation enthalpy for the hopping process of self-trapped positrons appears to depend on the kind of defect present in the crystals.

Transparent lattices and their solitary waves.

PubMed

Sadurní, E

2014-09-01

We provide a family of transparent tight-binding models with nontrivial potentials and site-dependent hopping parameters. Their feasibility is discussed in electromagnetic resonators, dielectric slabs, and quantum-mechanical traps. In the second part of the paper, the arrays are obtained through a generalization of supersymmetric quantum mechanics in discrete variables. The formalism includes a finite-difference Darboux transformation applied to the scattering matrix of a periodic array. A procedure for constructing a hierarchy of discrete Hamiltonians is indicated and a particular biparametric family is given. The corresponding potentials and hopping functions are identified as solitary waves, pointing to a discrete spinorial generalization of the Korteweg-deVries family.

Variable-range-hopping magnetoresistance

NASA Astrophysics Data System (ADS)

Azbel, Mark Ya

1991-03-01

The hopping magnetoresistance R of a two-dimensional insulator with metallic impurities is considered. In sufficiently weak magnetic fields it increases or decreases depending on the impurity density n: It decreases if n is low and increases if n is high. In high magnetic fields B, it always exponentially increases with √B . Such fields yield a one-dimensional temperature dependence: lnR~1/ √T . The calculation provides an accurate leading approximation for small impurities with one eigenstate in their potential well. In the limit of infinitesimally small impurities, an impurity potential is described by a generalized function. This function, similar to a δ function, is localized at a point, but, contrary to a δ function in the dimensionality above 1, it has finite eigenenergies. Such functions may be helpful in the study of scattering and localization of any waves.

Spin diffusion in disordered organic semiconductors

NASA Astrophysics Data System (ADS)

Li, Ling; Gao, Nan; Lu, Nianduan; Liu, Ming; Bässler, Heinz

2015-12-01

An analytical theory for spin diffusion in disordered organic semiconductors is derived. It is based on percolation theory and variable range hopping in a disordered energy landscape with a Gaussian density of states. It describes universally the dependence of the spin diffusion on temperature, carrier density, material disorder, magnetic field, and electric field at the arbitrary magnitude of the Hubbard energy of charge pairs. It is found that, compared to the spin transport carried by carriers hopping, the spin exchange will hinder the spin diffusion process at low carrier density, even under the condition of a weak electric field. Importantly, under the influence of a bias voltage, anomalous spreading of the spin packet will lead to an abnormal temperature dependence of the spin diffusion coefficient and diffusion length. This explains the recent experimental data for spin diffusion length observed in Alq3.

Mode selection in square resonator microlasers for widely tunable single mode lasing.

PubMed

Tang, Ming-Ying; Sui, Shao-Shuai; Yang, Yue-De; Xiao, Jin-Long; Du, Yun; Huang, Yong-Zhen

2015-10-19

Mode selection in square resonator semiconductor microlasers is demonstrated by adjusting the width of the output waveguide coupled to the midpoint of one side. The simulation and experimental results reveal that widely tunable single mode lasing can be realized in square resonator microlasers. Through adjusting the width of the output waveguide, the mode interval of the high-Q modes can reach four times of the longitudinal mode interval. Therefore, mode hopping can be efficiently avoided and the lasing wavelength can be tuned continuously by tuning the injection current. For a 17.8-μm-side-length square microlaser with a 1.4-μm-width output waveguide, mode-hopping-free single-mode operation is achieved with a continuous tuning range of 9.2 nm. As a result, the control of the lasing mode is realized for the square microlasers.

[Abnormal growth of spine in patients with adolescent idiopathic thoracic scoliosis].

PubMed

Bao, Hongda; Liu, Zhen; Qiu, Yong; Zhu, Feng; Zhu, Zezhang; Zhang, Wen

2014-05-01

To investigate if the growth patterns of the spine and pelvis are consistent in adolescent idiopathic scoliosis (AIS) patients with single thoracic curves. Forty-eight thoracic adolescent idiopathic scoliosis (T-AIS) female patients and 48 healthy age-matched adolescents were recruited consecutively between December 2011 and October 2012. Radiographic parameters including height of spine (HOS), length of spine (LOS), height of thoracic spine (HOT), length of thoracic spine (LOT), height of pelvis (HOP), width of pelvis (WOP) and width of thorax (WOT) were measured on the long-cassette posteroanterior standing radiographs. In addition, ratios including HOS/HOP, LOS/HOP, HOT/HOP, LOT/HOP, LOS/LOT, WOT/WOP were also calculated. Independent t-test was performed to compare the radiographic parameters and ratios between the two groups. Compared to the age-matched healthy adolescents, T-AIS patients had a significantly higher LOS and LOT (t = -2.364 and -1.495, P = 0.020 and 0.043) and smaller HOS and HOT (t = 2.060 and 3.359, P = 0.042 and 0.001). Yet, all of HOP, WOP and WOT showed no significant difference between T-AIS patients and healthy adolescents. Similarly, LOS/HOP and LOT/HOP were significantly higher in T-AIS patients as may be expected with an average LOS/HOP of 2.26 ± 0.14 in normal controls.In addition, LOS/LOT in normal controls had a trend of increase with age which was different from the stable LOS/LOT in T-AIS patients, indicating an increased growth of thoracic vertebra compared to lumbar vertebra. Compared to the age-matched healthy adolescents, T-AIS patients have an abnormal growth characteristics with longer spine. The growth of pelvis and thorax show no significant differences between T-AIS patients and healthy adolescents.

Nuclear magnetic resonance and high-performance liquid chromatography techniques for the characterization of bioactive compounds from Humulus lupulus L. (hop).

PubMed

Bertelli, Davide; Brighenti, Virginia; Marchetti, Lucia; Reik, Anna; Pellati, Federica

2018-06-01

Humulus lupulus L. (hop) represents one of the most cultivated crops, it being a key ingredient in the brewing process. Many health-related properties have been described for hop extracts, making this plant gain more interest in the field of pharmaceutical and nutraceutical research. Among the analytical tools available for the phytochemical characterization of plant extracts, quantitative nuclear magnetic resonance (qNMR) represents a new and powerful technique. In this ambit, the present study was aimed at the development of a new, simple, and efficient qNMR method for the metabolite fingerprinting of bioactive compounds in hop cones, taking advantage of the novel ERETIC 2 tool. To the best of our knowledge, this is the first attempt to apply this method to complex matrices of natural origin, such as hop extracts. The qNMR method set up in this study was applied to the quantification of both prenylflavonoids and bitter acids in eight hop cultivars. The performance of this analytical method was compared with that of HPLC-UV/DAD, which represents the most frequently used technique in the field of natural product analysis. The quantitative data obtained for hop samples by means of the two aforementioned techniques highlighted that the amount of bioactive compounds was slightly higher when qNMR was applied, although the order of magnitude of the values was the same. The accuracy of qNMR was comparable to that of the chromatographic method, thus proving to be a reliable tool for the analysis of these secondary metabolites in hop extracts. Graphical abstract Graphical abstract related to the extraction and analytical methods applied in this work for the analysis of bioactive compounds in Humulus lupulus L. (hop) cones.

Performance on the Functional Movement Screen™ is related to hop performance, but not to hip and knee strength in collegiate football players

PubMed Central

Willigenburg, Nienke; Hewett, Timothy E.

2016-01-01

Objective To define the relationship between FMS™ scores and hop performance, hip strength, and knee strength in collegiate football players. Design Cross-sectional cohort. Participants Freshmen of a division I collegiate American football team (n=59). Main Outcome Measures The athletes performed the FMS™, as well as a variety of hop tests, isokinetic knee strength and isometric hip strength tasks. We recorded total FMS™ score, peak strength and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman’s correlation coefficients quantified the relationships these measures, and chi-square analyses compared the number of athletes with asymmetries on the different tasks. Results We observed significant correlations (r=0.38–0.56, p≤0.02) between FMS™ scores and hop distance, but not between FMS™ scores and hip or knee strength (all p≥0.21). The amount of asymmetry on the FMS™ test was significantly correlated to the amount of asymmetry on the timed 6m hop (r=0.44, p<0.01), but not to hip or knee strength asymmetries between limbs (all p≥0.34). Conclusions FMS™ score was positively correlated to hop distance, and limb asymmetry in FMS™ tasks was correlated to limb asymmetry in 6m hop time in football players. No significant correlations were observed between FMS™ score and hip and knee strength, or between FMS™ asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time and cost efficient alternative to FMS™ testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries. PMID:26886801

Performance on the Functional Movement Screen Is Related to Hop Performance But Not to Hip and Knee Strength in Collegiate Football Players.

PubMed

Willigenburg, Nienke; Hewett, Timothy E

2017-03-01

To define the relationship between Functional Movement Screen (FMS) scores and hop performance, hip strength, and knee strength in collegiate football players. Cross-sectional cohort. Freshmen of a Division I collegiate American football team (n = 59). The athletes performed the FMS, and also a variety of hop tests, isokinetic knee strength, and isometric hip strength tasks. We recorded total FMS score, peak strength, and hop performance, and we calculated asymmetries between legs on the different tasks. Spearman correlation coefficients quantified the relationships between these measures, and χ analyses compared the number of athletes with asymmetries on the different tasks. We observed significant correlations (r = 0.38-0.56, P ≤ 0.02) between FMS scores and hop distance but not between FMS scores and hip or knee strength (all P ≥ 0.21). The amount of asymmetry on the FMS test was significantly correlated to the amount of asymmetry on the timed 6-m hop (r = 0.44, P < 0.01) but not to hip or knee strength asymmetries between limbs (all P ≥ 0.34). Functional Movement Screen score was positively correlated to hop distance, and limb asymmetry in FMS tasks was correlated to limb asymmetry in 6-m hop time in football players. No significant correlations were observed between FMS score and hip and knee strength or between FMS asymmetry and asymmetries in hip and knee strength between limbs. These results indicate that a simple hop for distance test may be a time-efficient and cost-efficient alternative to FMS testing in athletes and that functional asymmetries between limbs do not coincide with strength asymmetries.

Plasmodium falciparum Hop (PfHop) Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

PubMed

Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore

2015-01-01

Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.

Mode Hopping in Semiconductor Lasers

NASA Astrophysics Data System (ADS)

Heumier, Timothy Alan

Semiconductor lasers have found widespread use in fiberoptic communications, merchandising (bar-code scanners), entertainment (videodisc and compact disc players), and in scientific inquiry (spectroscopy, laser cooling). Some uses require a minimum degree of stability of wavelength which is not met by these lasers: Under some conditions, semiconductor lasers can discontinuously switch wavelengths in a back-and-forth manner. This is called mode hopping. We show that mode hopping is directly correlated to noise in the total intensity, and that this noise is easily detected by a photodiode. We also show that there are combinations of laser case temperature and injection current which lead to mode hopping. Conversely, there are other combinations for which the laser is stable. These results are shown to have implications for controlling mode hopping.

Hop powdery mildew control through alteration of spring pruning practices

USDA-ARS?s Scientific Manuscript database

Since 1997, Podosphaera macularis, the causal agent of hop powdery mildew, has become a recurrent threat to hops in the Pacific Northwest because of the potential to reduce cone yield and quality. Disease management practices often involve preventative fungicide applications, but alternative approac...

Pseudomonas HopU1 modulates plant immune receptor levels by blocking the interaction of their mRNAs with GRP7.

PubMed

Nicaise, Valerie; Joe, Anna; Jeong, Byeong-ryool; Korneli, Christin; Boutrot, Freddy; Westedt, Isa; Staiger, Dorothee; Alfano, James R; Zipfel, Cyril

2013-03-06

Pathogens target important components of host immunity to cause disease. The Pseudomonas syringae type III-secreted effector HopU1 is a mono-ADP-ribosyltransferase required for full virulence on Arabidopsis thaliana. HopU1 targets several RNA-binding proteins including GRP7, whose role in immunity is still unclear. Here, we show that GRP7 associates with translational components, as well as with the pattern recognition receptors FLS2 and EFR. Moreover, GRP7 binds specifically FLS2 and EFR transcripts in vivo through its RNA recognition motif. HopU1 does not affect the protein-protein associations between GRP7, FLS2 and translational components. Instead, HopU1 blocks the interaction between GRP7 and FLS2 and EFR transcripts in vivo. This inhibition correlates with reduced FLS2 protein levels upon Pseudomonas infection in a HopU1-dependent manner. Our results reveal a novel virulence strategy used by a microbial effector to interfere with host immunity.

HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis.

PubMed

Kang, Yongsung; Jelenska, Joanna; Cecchini, Nicolas M; Li, Yujie; Lee, Min Woo; Kovar, David R; Greenberg, Jean T

2014-06-01

A central mechanism of virulence of extracellular bacterial pathogens is the injection into host cells of effector proteins that modify host cellular functions. HopW1 is an effector injected by the type III secretion system that increases the growth of the plant pathogen Pseudomonas syringae on the Columbia accession of Arabidopsis. When delivered by P. syringae into plant cells, HopW1 causes a reduction in the filamentous actin (F-actin) network and the inhibition of endocytosis, a known actin-dependent process. When directly produced in plants, HopW1 forms complexes with actin, disrupts the actin cytoskeleton and inhibits endocytosis as well as the trafficking of certain proteins to vacuoles. The C-terminal region of HopW1 can reduce the length of actin filaments and therefore solubilize F-actin in vitro. Thus, HopW1 acts by disrupting the actin cytoskeleton and the cell biological processes that depend on actin, which in turn are needed for restricting P. syringae growth in Arabidopsis.