Science.gov

Sample records for rare missense alleles

  1. Systematic Cell-Based Phenotyping of Missense Alleles Empowers Rare Variant Association Studies: A Case for LDLR and Myocardial Infarction

    PubMed Central

    Schuberth, Christian; Won, Hong-Hee; Blattmann, Peter; Joggerst-Thomalla, Brigitte; Theiss, Susanne; Asselta, Rosanna; Duga, Stefano; Merlini, Pier Angelica; Ardissino, Diego; Lander, Eric S.; Gabriel, Stacey; Rader, Daniel J.; Peloso, Gina M.; Kathiresan, Sekar; Runz, Heiko

    2015-01-01

    A fundamental challenge to contemporary genetics is to distinguish rare missense alleles that disrupt protein functions from the majority of alleles neutral on protein activities. High-throughput experimental tools to securely discriminate between disruptive and non-disruptive missense alleles are currently missing. Here we establish a scalable cell-based strategy to profile the biological effects and likely disease relevance of rare missense variants in vitro. We apply this strategy to systematically characterize missense alleles in the low-density lipoprotein receptor (LDLR) gene identified through exome sequencing of 3,235 individuals and exome-chip profiling of 39,186 individuals. Our strategy reliably identifies disruptive missense alleles, and disruptive-allele carriers have higher plasma LDL-cholesterol (LDL-C). Importantly, considering experimental data refined the risk of rare LDLR allele carriers from 4.5- to 25.3-fold for high LDL-C, and from 2.1- to 20-fold for early-onset myocardial infarction. Our study generates proof-of-concept that systematic functional variant profiling may empower rare variant-association studies by orders of magnitude. PMID:25647241

  2. Most of rare missense alleles in humans are deleterious:implications for evolution of complex disease and associationstudies

    SciTech Connect

    Kryukov, Gregory V.; Pennacchio, Len A.; Sunyaev, Shamil R.

    2006-10-24

    The accumulation of mildly deleterious missense mutations inindividual human genomes has been proposed to be a genetic basis forcomplex diseases. The plausibility of this hypothesis depends onquantitative estimates of the prevalence of mildly deleterious de novomutations and polymorphic variants in humans and on the intensity ofselective pressure against them. We combined analysis of mutationscausing human Mendelian diseases, human-chimpanzee divergence andsystematic data on human SNPs and found that about 20 percent of newmissense mutations in humans result in a loss of function, while about 27percent are effectively neutral. Thus, more than half of new missensemutations have mildly deleterious effects. These mutations give rise tomany low frequency deleterious allelic variants in the human populationas evident from a new dataset of 37 genes sequenced in over 1,500individual human chromosomes. Surprisingly, up to 70 percent of lowfrequency missense alleles are mildly deleterious and associated with aheterozygous fitness loss in the range 0.001-0.003. Thus, the low allelefrequency of an amino acid variant can by itself serve as a predictor ofits functional significance. Several recent studies have reported asignificant excess of rare missense variants in disease populationscompared to controls in candidate genes or pathways. These studies wouldbe unlikely to work if most rare variants were neutral or if rarevariants were not a significant contributor to the genetic component ofphenotypic inheritance. Our results provide a justification for thesetypes of candidate gene (pathway) association studies and imply thatmutation-selection balance may be a feasible mechanism for evolution ofsome common diseases.

  3. A new h allele detected in Europe has a missense mutationin alpha(1,2)-fucosyltransferase motif II.

    PubMed

    Wagner, T; Vadon, M; Staudacher, E; Schmarda, A; Gassner, C; Helmberg, W; Lanzer, G; Flegel, W A; Wagner, F F

    2001-01-01

    The FUT1 gene encodes an alpha(1,2)-fucosyltransferase (H transferase), which determines the blood group H. Nonfunctional alleles of this gene, called h alleles and carrying loss-of-function mutations, are observed in the exceedingly rare Bombay phenotype. Twenty-three distinct h alleles have been characterized at the molecular level in various populations. The FUT2 (SE) gene is highly homologous to FUT1 (H:). The FUT1 gene of an Austrian proband with the Bombay phenotype was characterized by nucleotide sequencing of the full-length coding sequence. A PCR method using sequence-specific primers for FUT2 genotyping in whites was developed. The plasma alpha(1,2)-fucosyltransferase activity was determined. The distribution of the mutations underlying 24 h alleles and 7 se alleles was analyzed. The proband carried a new h allele. Two nucleotide changes, G785A and C786A, in codon 262 of the FUT1 gene resulted in the replacement of serine by lysine. No alpha(1,2)-fucosyltransferase activity was detected in the proband's plasma. The proband was homozygous for the seG428A allele. Six of 17 missense mutations in nonfunctional h and se alleles occurred in highly conserved fucosyltransferase motifs. No loss-of-function mutation was observed in the aminoterminal section encompassing the transmembraneous helix. The missense mutation S262K in the FUT1 gene caused the loss of H transferase activity. The analysis of the distribution of mutations in nonfunctional FUT1 and FUT2 genes can point to functionally important domains in the H transferase.

  4. Rare missense variants within a single gene form yin yang haplotypes.

    PubMed

    Curtis, David

    2016-01-01

    Yin yang haplotype pairs differ at every SNP. They would not be accounted for by population models that incorporate sequential mutation, with or without recombination. Previous reports have claimed that there is a tendency for common SNPs to form yin yang haplotypes more often than would be expected by sequential mutation or by a random sample of all possible haplotypic arrangements of alleles. In the course of analysing next-generation sequencing data, instances of yin yang haplotypes being formed by very rare variants within a single gene were observed. As an example, this report describes a completely yin yang haplotype formed by eight rare missense variants in the ABCA13 gene. Of 1000 genome subjects, 21 have a copy of the alternate allele at all eight of these positions and a single subject is homozygous for all of them. None of the other 1070 subjects possesses any of the altetrnates. Thus, the eight alternate alleles are always found together and never occur separately. The existence of such yin yang haplotypes has important implications for statistical methods for analysing rare variants. Also, they may be of use for gaining a better understanding of the history of human populations.

  5. Classification of rare missense substitutions, using risk surfaces, with genetic- and molecular-epidemiology applications.

    PubMed

    Tavtigian, Sean V; Byrnes, Graham B; Goldgar, David E; Thomas, Alun

    2008-11-01

    Many individually rare missense substitutions are encountered during deep resequencing of candidate susceptibility genes and clinical mutation screening of known susceptibility genes. BRCA1 and BRCA2 are among the most resequenced of all genes, and clinical mutation screening of these genes provides an extensive data set for analysis of rare missense substitutions. Align-GVGD is a mathematically simple missense substitution analysis algorithm, based on the Grantham difference, which has already contributed to classification of missense substitutions in BRCA1, BRCA2, and CHEK2. However, the distribution of genetic risk as a function of Align-GVGD's output variables Grantham variation (GV) and Grantham deviation (GD) has not been well characterized. Here, we used data from the Myriad Genetic Laboratories database of nearly 70,000 full-sequence tests plus two risk estimates, one approximating the odds ratio and the other reflecting strength of selection, to display the distribution of risk in the GV-GD plane as a series of surfaces. We abstracted contours from the surfaces and used the contours to define a sequence of missense substitution grades ordered from greatest risk to least risk. The grades were validated internally using a third, personal and family history-based, measure of risk. The Align-GVGD grades defined here are applicable to both the genetic epidemiology problem of classifying rare missense substitutions observed in known susceptibility genes and the molecular epidemiology problem of analyzing rare missense substitutions observed during case-control mutation screening studies of candidate susceptibility genes.

  6. Rare, Evolutionarily Unlikely Missense Substitutions in ATM Confer Increased Risk of Breast Cancer

    PubMed Central

    Tavtigian, Sean V.; Oefner, Peter J.; Babikyan, Davit; Hartmann, Anne; Healey, Sue; Le Calvez-Kelm, Florence; Lesueur, Fabienne; Byrnes, Graham B.; Chuang, Shu-Chun; Forey, Nathalie; Feuchtinger, Corinna; Gioia, Lydie; Hall, Janet; Hashibe, Mia; Herte, Barbara; McKay-Chopin, Sandrine; Thomas, Alun; Vallée, Maxime P.; Voegele, Catherine; Webb, Penelope M.; Whiteman, David C.; Sangrajrang, Suleeporn; Hopper, John L.; Southey, Melissa C.; Andrulis, Irene L.; John, Esther M.; Chenevix-Trench, Georgia

    2009-01-01

    The susceptibility gene for ataxia telangiectasia, ATM, is also an intermediate-risk breast-cancer-susceptibility gene. However, the spectrum and frequency distribution of ATM mutations that confer increased risk of breast cancer have been controversial. To assess the contribution of rare variants in this gene to risk of breast cancer, we pooled data from seven published ATM case-control mutation-screening studies, including a total of 1544 breast cancer cases and 1224 controls, with data from our own mutation screening of an additional 987 breast cancer cases and 1021 controls. Using an in silico missense-substitution analysis that provides a ranking of missense substitutions from evolutionarily most likely to least likely, we carried out analyses of protein-truncating variants, splice-junction variants, and rare missense variants. We found marginal evidence that the combination of ATM protein-truncating and splice-junction variants contribute to breast cancer risk. There was stronger evidence that a subset of rare, evolutionarily unlikely missense substitutions confer increased risk. On the basis of subset analyses, we hypothesize that rare missense substitutions falling in and around the FAT, kinase, and FATC domains of the protein may be disproportionately responsible for that risk and that a subset of these may confer higher risk than do protein-truncating variants. We conclude that a comparison between the graded distributions of missense substitutions in cases versus controls can complement analyses of truncating variants and help identify susceptibility genes and that this approach will aid interpretation of the data emerging from new sequencing technologies. PMID:19781682

  7. Severe hypertriglyceridemia in a patient heterozygous for a lipoprotein lipase gene allele with two novel missense variants.

    PubMed

    Kassner, Ursula; Salewsky, Bastian; Wühle-Demuth, Marion; Szijarto, Istvan Andras; Grenkowitz, Thomas; Binner, Priska; März, Winfried; Steinhagen-Thiessen, Elisabeth; Demuth, Ilja

    2015-09-01

    Rare monogenic hyperchylomicronemia is caused by loss-of-function mutations in genes involved in the catabolism of triglyceride-rich lipoproteins, including the lipoprotein lipase gene, LPL. Clinical hallmarks of this condition are eruptive xanthomas, recurrent pancreatitis and abdominal pain. Patients with LPL deficiency and severe or recurrent pancreatitis are eligible for the first gene therapy treatment approved by the European Union. Therefore the precise molecular diagnosis of familial hyperchylomicronemia may affect treatment decisions. We present a 57-year-old male patient with excessive hypertriglyceridemia despite intensive lipid-lowering therapy. Abdominal sonography showed signs of chronic pancreatitis. Direct DNA sequencing and cloning revealed two novel missense variants, c.1302A>T and c.1306G>A, in exon 8 of the LPL gene coexisting on the same allele. The variants result in the amino-acid exchanges p.(Lys434Asn) and p.(Gly436Arg). They are located in the carboxy-terminal domain of lipoprotein lipase that interacts with the glycosylphosphatidylinositol-anchored HDL-binding protein (GPIHBP1) and are likely of functional relevance. No further relevant mutations were found by direct sequencing of the genes for APOA5, APOC2, LMF1 and GPIHBP1. We conclude that heterozygosity for damaging mutations of LPL may be sufficient to produce severe hypertriglyceridemia and that chylomicronemia may be transmitted in a dominant manner, at least in some families.

  8. Severe hypertriglyceridemia in a patient heterozygous for a lipoprotein lipase gene allele with two novel missense variants

    PubMed Central

    Kassner, Ursula; Salewsky, Bastian; Wühle-Demuth, Marion; Szijarto, Istvan Andras; Grenkowitz, Thomas; Binner, Priska; März, Winfried; Steinhagen-Thiessen, Elisabeth; Demuth, Ilja

    2015-01-01

    Rare monogenic hyperchylomicronemia is caused by loss-of-function mutations in genes involved in the catabolism of triglyceride-rich lipoproteins, including the lipoprotein lipase gene, LPL. Clinical hallmarks of this condition are eruptive xanthomas, recurrent pancreatitis and abdominal pain. Patients with LPL deficiency and severe or recurrent pancreatitis are eligible for the first gene therapy treatment approved by the European Union. Therefore the precise molecular diagnosis of familial hyperchylomicronemia may affect treatment decisions. We present a 57-year-old male patient with excessive hypertriglyceridemia despite intensive lipid-lowering therapy. Abdominal sonography showed signs of chronic pancreatitis. Direct DNA sequencing and cloning revealed two novel missense variants, c.1302A>T and c.1306G>A, in exon 8 of the LPL gene coexisting on the same allele. The variants result in the amino-acid exchanges p.(Lys434Asn) and p.(Gly436Arg). They are located in the carboxy-terminal domain of lipoprotein lipase that interacts with the glycosylphosphatidylinositol-anchored HDL-binding protein (GPIHBP1) and are likely of functional relevance. No further relevant mutations were found by direct sequencing of the genes for APOA5, APOC2, LMF1 and GPIHBP1. We conclude that heterozygosity for damaging mutations of LPL may be sufficient to produce severe hypertriglyceridemia and that chylomicronemia may be transmitted in a dominant manner, at least in some families. PMID:25585702

  9. Rare ATAD5 missense variants in breast and ovarian cancer patients.

    PubMed

    Maleva Kostovska, Ivana; Wang, Jing; Bogdanova, Natalia; Schürmann, Peter; Bhuju, Sabin; Geffers, Robert; Dürst, Matthias; Liebrich, Clemens; Klapdor, Rüdiger; Christiansen, Hans; Park-Simon, Tjoung-Won; Hillemanns, Peter; Plaseska-Karanfilska, Dijana; Dörk, Thilo

    2016-06-28

    ATAD5/ELG1 is a protein crucially involved in replication and maintenance of genome stability. ATAD5 has recently been identified as a genomic risk locus for both breast and ovarian cancer through genome-wide association studies. We aimed to investigate the spectrum of coding ATAD5 germ-line mutations in hospital-based series of patients with triple-negative breast cancer or serous ovarian cancer compared with healthy controls. The ATAD5 coding and adjacent splice site regions were analyzed by targeted next-generation sequencing of DNA samples from 273 cancer patients, including 114 patients with triple-negative breast cancer and 159 patients with serous epithelial ovarian cancer, and from 276 healthy females. Among 42 different variants identified, twenty-two were rare missense substitutions, of which 14 were classified as pathogenic by at least one in silico prediction tool. Three of four novel missense substitutions (p.S354I, p.H974R and p.K1466N) were predicted to be pathogenic and were all identified in ovarian cancer patients. Overall, rare missense variants with predicted pathogenicity tended to be enriched in ovarian cancer patients (14/159) versus controls (11/276) (p = 0.05, 2df). While truncating germ-line variants in ATAD5 were not detected, it remains possible that several rare missense variants contribute to genetic susceptibility toward epithelial ovarian carcinomas. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Silvicultural management and the manipulation of rare alleles

    Treesearch

    Paul G. Schaberg; Gary J. Hawley; Donald H. DeHayes; Samuel E. Nijensohn

    2004-01-01

    Because rare alleles provide a means for adaptation to environmental change they are often considered important to long-term forest health. Through the selective removal of trees (and genes), silvicultural management may alter the genetic structure of forests, with rare alleles perhaps being uniquely vulnerable to manipulation due to their low frequencies or...

  11. Evaluation of autosomal dominant retinal dystrophy genes in an unaffected cohort suggests rare or private missense variants may often be benign

    PubMed Central

    Strom, Samuel P.

    2013-01-01

    Background Many genes have been reported as harboring autosomal dominant mutations causing retinal dystrophy. As newly available gene panel sequencing and whole exome sequencing will open these genes up to greater scrutiny, we assess the rate of rare coding variation in these genes among unaffected individuals to provide context for variants that will be discovered when clinical subjects are sequenced. Methods Publicly available data from the Exome Variant Project were analyzed, focusing on 36 genes known to harbor mutations causing autosomal dominant macular dystrophy. Results Rates of rare (minor allele frequency ≤0.1%) and private missense variants within autosomal dominant retinal dystrophy genes were found to occur at a high frequency in unaffected individuals, while nonsense variants were not. Conclusions We conclude that rare missense variations in most of these genes identified in individuals with retinal dystrophy cannot be confidently classified as disease-causing in the absence of additional information such as linkage or functional validation. PMID:23687434

  12. Nonfrequent but well-documented, rare and very rare HLA alleles observed in the Croatian population.

    PubMed

    Grubic, Z; Burek Kamenaric, M; Maskalan, M; Stingl Jankovic, K; Zunec, R

    2014-12-01

    The aim of the study was to evaluate the presence of nonfrequent, rare and very rare alleles among Croats and to estimate whether they are associated with specific alleles at other human leukocyte antigen (HLA) loci. This retrospective study included the typing results from the last 10 years; total number of individuals included was approximately 45,000. Among 17 alleles so far observed only once in our population, 6 (A*24:41, B*07:02:28, B*35:03:03, B*39:40N, DRB1*13:23 and DRB1*14:111) belong to very rare alleles, 2 (B*44:16 and DRB1*01:31) belong to rare alleles according to the 'Rare Alleles Detector' tool ( www.allelefrequencies.net), while for the B*35:101:01 allele published data exist only in the IMGT/HLA database. The remaining eight HLA alleles observed only once among Croats are considered as frequent according to the 'Rare Alleles Detector'. Those 17 HLA alleles are not declared as common well defined (CWD) alleles in the CWD allele catalogue 2.0.0. Haplotype analysis of nonfrequent alleles detected in our sample supports the idea that different populations, although similar in some aspects regarding HLA allele and haplotype distribution, still have some unique characteristics. This is the case for A*01:02, B*39:10 and DRB1*13:32 which form haplotypes unreported to date among our subjects.

  13. Rare allelic forms of PRDM9 associated with childhood leukemogenesis

    PubMed Central

    Hussin, Julie; Sinnett, Daniel; Casals, Ferran; Idaghdour, Youssef; Bruat, Vanessa; Saillour, Virginie; Healy, Jasmine; Grenier, Jean-Christophe; de Malliard, Thibault; Busche, Stephan; Spinella, Jean-François; Larivière, Mathieu; Gibson, Greg; Andersson, Anna; Holmfeldt, Linda; Ma, Jing; Wei, Lei; Zhang, Jinghui; Andelfinger, Gregor; Downing, James R.; Mullighan, Charles G.; Awadalla, Philip

    2013-01-01

    One of the most rapidly evolving genes in humans, PRDM9, is a key determinant of the distribution of meiotic recombination events. Mutations in this meiotic-specific gene have previously been associated with male infertility in humans and recent studies suggest that PRDM9 may be involved in pathological genomic rearrangements. In studying genomes from families with children affected by B-cell precursor acute lymphoblastic leukemia (B-ALL), we characterized meiotic recombination patterns within a family with two siblings having hyperdiploid childhood B-ALL and observed unusual localization of maternal recombination events. The mother of the family carries a rare PRDM9 allele, potentially explaining the unusual patterns found. From exomes sequenced in 44 additional parents of children affected with B-ALL, we discovered a substantial and significant excess of rare allelic forms of PRDM9. The rare PRDM9 alleles are transmitted to the affected children in half the cases; nonetheless there remains a significant excess of rare alleles among patients relative to controls. We successfully replicated this latter observation in an independent cohort of 50 children with B-ALL, where we found an excess of rare PRDM9 alleles in aneuploid and infant B-ALL patients. PRDM9 variability in humans is thought to influence genomic instability, and these data support a potential role for PRDM9 variation in risk of acquiring aneuploidies or genomic rearrangements associated with childhood leukemogenesis. PMID:23222848

  14. Rare allelic forms of PRDM9 associated with childhood leukemogenesis.

    PubMed

    Hussin, Julie; Sinnett, Daniel; Casals, Ferran; Idaghdour, Youssef; Bruat, Vanessa; Saillour, Virginie; Healy, Jasmine; Grenier, Jean-Christophe; de Malliard, Thibault; Busche, Stephan; Spinella, Jean-François; Larivière, Mathieu; Gibson, Greg; Andersson, Anna; Holmfeldt, Linda; Ma, Jing; Wei, Lei; Zhang, Jinghui; Andelfinger, Gregor; Downing, James R; Mullighan, Charles G; Awadalla, Philip

    2013-03-01

    One of the most rapidly evolving genes in humans, PRDM9, is a key determinant of the distribution of meiotic recombination events. Mutations in this meiotic-specific gene have previously been associated with male infertility in humans and recent studies suggest that PRDM9 may be involved in pathological genomic rearrangements. In studying genomes from families with children affected by B-cell precursor acute lymphoblastic leukemia (B-ALL), we characterized meiotic recombination patterns within a family with two siblings having hyperdiploid childhood B-ALL and observed unusual localization of maternal recombination events. The mother of the family carries a rare PRDM9 allele, potentially explaining the unusual patterns found. From exomes sequenced in 44 additional parents of children affected with B-ALL, we discovered a substantial and significant excess of rare allelic forms of PRDM9. The rare PRDM9 alleles are transmitted to the affected children in half the cases; nonetheless there remains a significant excess of rare alleles among patients relative to controls. We successfully replicated this latter observation in an independent cohort of 50 children with B-ALL, where we found an excess of rare PRDM9 alleles in aneuploid and infant B-ALL patients. PRDM9 variability in humans is thought to influence genomic instability, and these data support a potential role for PRDM9 variation in risk of acquiring aneuploidies or genomic rearrangements associated with childhood leukemogenesis.

  15. A Saccharomyces Cerevisiae Rad52 Allele Expressing a C-Terminal Truncation Protein: Activities and Intragenic Complementation of Missense Mutations

    PubMed Central

    Boundy-Mills, K. L.; Livingston, D. M.

    1993-01-01

    A nonsense allele of the yeast RAD52 gene, rad52-327, which expresses the N-terminal 65% of the protein was compared to two missense alleles, rad52-1 and rad52-2, and to a deletion allele. While the rad52-1 and the deletion mutants have severe defects in DNA repair, recombination and sporulation, the rad52-327 and rad52-2 mutants retain either partial or complete capabilities in repair and recombination. These two mutants behave similarly in most tests of repair and recombination during mitotic growth. One difference between these two alleles is that a homozygous rad52-2 diploid fails to sporulate, whereas the homozygous rad52-327 diploid sporulates weakly. The low level of sporulation by the rad52-327 diploid is accompanied by a low percentage of spore viability. Among these viable spores the frequency of crossing over for markers along chromosome VII is the same as that found in wild-type spores. rad52-327 complements rad52-2 for repair and sporulation. Weaker intragenic complementation occurs between rad52-327 and rad52-1. PMID:8417987

  16. Mapping rare and common causal alleles for complex human diseases

    PubMed Central

    Raychaudhuri, Soumya

    2011-01-01

    Advances in genotyping and sequencing technologies have revolutionized the genetics of complex disease by locating rare and common variants that influence an individual’s risk for diseases, such as diabetes, cancers, and psychiatric disorders. However, to capitalize on this data for prevention and therapies requires the identification of causal alleles and a mechanistic understanding for how these variants contribute to the disease. After discussing the strategies currently used to map variants for complex diseases, this Primer explores how variants may be prioritized for follow-up functional studies and the challenges and approaches for assessing the contributions of rare and common variants to disease phenotypes. PMID:21962507

  17. Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype-phenotype relationships.

    PubMed

    Krasnov, Kristina V; Tzetis, Maria; Cheng, Jie; Guggino, William B; Cutting, Garry R

    2008-11-01

    We have been investigating the functional consequences of rare disease-associated amino acid substitutions in the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations of the arginine residue at codon 1070 have been associated with different disease consequences; R1070P and R1070Q with "severe" pancreatic insufficient cystic fibrosis (CF) and R1070W with "mild" pancreatic sufficient CF or congenital bilateral absence of the vas deferens. Intriguingly, CFTR bearing each of these mutations is functional when expressed in nonpolarized cells. To determine whether R1070 mutations cause disease by affecting CFTR localization, we created polarized Madin Darby canine kidney (MDCK) cell lines that express either wild-type or mutant CFTR from the same genomic integration site. Confocal microscopy and biotinylation studies revealed that R1070P was not inserted into the apical membrane, R1070W was inserted at levels reduced from wild-type while R1070Q was present in the apical membrane at levels comparable to wild-type. The abnormal localization of CFTR bearing R1070P and R1070W was consistent with deleterious consequences in patients; however, the profile of CFTR R1070Q was inconsistent with a "severe" phenotype. Reanalysis of 16 patients with the R1070Q mutation revealed that 11 carried an in cis nonsense mutation, S466X. All 11 patients carrying the complex allele R1070Q-S466X had severe disease, while 4 out of 5 patients with R1070Q had "mild" disease, thereby reconciling the apparent discrepancy between the localization studies of R1070Q and the phenotype of patients bearing this mutation. Our results emphasize that localization studies in relevant model systems can greatly assist the interpretation of the disease-causing potential of rare missense mutations.

  18. Rare key functional domain missense substitutions in MRE11A, RAD50, and NBN contribute to breast cancer susceptibility: results from a Breast Cancer Family Registry case-control mutation-screening study

    PubMed Central

    2014-01-01

    Introduction The MRE11A-RAD50-Nibrin (MRN) complex plays several critical roles related to repair of DNA double-strand breaks. Inherited mutations in the three components predispose to genetic instability disorders and the MRN genes have been implicated in breast cancer susceptibility, but the underlying data are not entirely convincing. Here, we address two related questions: (1) are some rare MRN variants intermediate-risk breast cancer susceptibility alleles, and if so (2) do the MRN genes follow a BRCA1/BRCA2 pattern wherein most susceptibility alleles are protein-truncating variants, or do they follow an ATM/CHEK2 pattern wherein half or more of the susceptibility alleles are missense substitutions? Methods Using high-resolution melt curve analysis followed by Sanger sequencing, we mutation screened the coding exons and proximal splice junction regions of the MRN genes in 1,313 early-onset breast cancer cases and 1,123 population controls. Rare variants in the three genes were pooled using bioinformatics methods similar to those previously applied to ATM, BRCA1, BRCA2, and CHEK2, and then assessed by logistic regression. Results Re-analysis of our ATM, BRCA1, and BRCA2 mutation screening data revealed that these genes do not harbor pathogenic alleles (other than modest-risk SNPs) with minor allele frequencies >0.1% in Caucasian Americans, African Americans, or East Asians. Limiting our MRN analyses to variants with allele frequencies of <0.1% and combining protein-truncating variants, likely spliceogenic variants, and key functional domain rare missense substitutions, we found significant evidence that the MRN genes are indeed intermediate-risk breast cancer susceptibility genes (odds ratio (OR) = 2.88, P = 0.0090). Key domain missense substitutions were more frequent than the truncating variants (24 versus 12 observations) and conferred a slightly higher OR (3.07 versus 2.61) with a lower P value (0.029 versus 0.14). Conclusions These data establish

  19. A prospective study of brachytelephalangic chondrodysplasia punctata: identification of arylsulfatase E mutations, functional analysis of novel missense alleles, and determination of potential phenocopies.

    PubMed

    Matos-Miranda, Claudia; Nimmo, Graeme; Williams, Bradley; Tysoe, Carolyn; Owens, Martina; Bale, Sherri; Braverman, Nancy

    2013-08-01

    The only known genetic cause of brachytelephalangic chondrodysplasia punctata is X-linked chondrodysplasia punctata 1 (CDPX1), which results from a deficiency of arylsulfatase E (ARSE). Historically, ARSE mutations have been identified in only 50% of male patients, and it was proposed that the remainder might represent phenocopies due to maternal-fetal vitamin K deficiency and maternal autoimmune diseases. To further evaluate causes of brachytelephalangic chondrodysplasia punctata, we established a Collaboration Education and Test Translation program for CDPX1 from 2008 to 2010. Of the 29 male probands identified, 17 had ARSE mutations that included 10 novel missense alleles and one single-codon deletion. To determine pathogenicity of these and additional missense alleles, we transiently expressed them in COS cells and measured arylsulfatase E activity using the artificial substrate, 4-methylumbelliferyl sulfate. In addition, clinical data were collected to investigate maternal effects and genotype-phenotype correlations. In this study, 58% of males had ARSE mutations. All mutant alleles had negligible arylsulfatase E activity. There were no obvious genotype-phenotype correlations. Maternal etiologies were not reported in most patients. CDPX1 is caused by loss of arylsulfatase E activity. Around 40% of male patients with brachytelephalangic chondrodysplasia punctata do not have detectable ARSE mutations or known maternal etiological factors. Improved understanding of arylsulfatase E function is predicted to illuminate other etiologies for brachytelephalangic chondrodysplasia punctata.

  20. Demographic history and rare allele sharing among human populations

    PubMed Central

    Gravel, Simon; Henn, Brenna M.; Gutenkunst, Ryan N.; Indap, Amit R.; Marth, Gabor T.; Clark, Andrew G.; Yu, Fuli; Gibbs, Richard A.; Bustamante, Carlos D.; Altshuler, David L.; Durbin, Richard M.; Abecasis, Gonçalo R.; Bentley, David R.; Chakravarti, Aravinda; Clark, Andrew G.; Collins, Francis S.; De La Vega, Francisco M.; Donnelly, Peter; Egholm, Michael; Flicek, Paul; Gabriel, Stacey B.; Gibbs, Richard A.; Knoppers, Bartha M.; Lander, Eric S.; Lehrach, Hans; Mardis, Elaine R.; McVean, Gil A.; Nickerson, Debbie A.; Peltonen, Leena; Schafer, Alan J.; Sherry, Stephen T.; Wang, Jun; Wilson, Richard K.; Gibbs, Richard A.; Deiros, David; Metzker, Mike; Muzny, Donna; Reid, Jeff; Wheeler, David; Wang, Jun; Li, Jingxiang; Jian, Min; Li, Guoqing; Li, Ruiqiang; Liang, Huiqing; Tian, Geng; Wang, Bo; Wang, Jian; Wang, Wei; Yang, Huanming; Zhang, Xiuqing; Zheng, Huisong; Lander, Eric S.; Altshuler, David L.; Ambrogio, Lauren; Bloom, Toby; Cibulskis, Kristian; Fennell, Tim J.; Gabriel, Stacey B.; Jaffe, David B.; Shefler, Erica; Sougnez, Carrie L.; Bentley, David R.; Gormley, Niall; Humphray, Sean; Kingsbury, Zoya; Koko-Gonzales, Paula; Stone, Jennifer; McKernan, Kevin J.; Costa, Gina L.; Ichikawa, Jeffry K.; Lee, Clarence C.; Sudbrak, Ralf; Lehrach, Hans; Borodina, Tatiana A.; Dahl, Andreas; Davydov, Alexey N.; Marquardt, Peter; Mertes, Florian; Nietfeld, Wilfiried; Rosenstiel, Philip; Schreiber, Stefan; Soldatov, Aleksey V.; Timmermann, Bernd; Tolzmann, Marius; Egholm, Michael; Affourtit, Jason; Ashworth, Dana; Attiya, Said; Bachorski, Melissa; Buglione, Eli; Burke, Adam; Caprio, Amanda; Celone, Christopher; Clark, Shauna; Conners, David; Desany, Brian; Gu, Lisa; Guccione, Lorri; Kao, Kalvin; Kebbel, Andrew; Knowlton, Jennifer; Labrecque, Matthew; McDade, Louise; Mealmaker, Craig; Minderman, Melissa; Nawrocki, Anne; Niazi, Faheem; Pareja, Kristen; Ramenani, Ravi; Riches, David; Song, Wanmin; Turcotte, Cynthia; Wang, Shally; Mardis, Elaine R.; Wilson, Richard K.; Dooling, David; Fulton, Lucinda; Fulton, Robert; Weinstock, George; Durbin, Richard M.; Burton, John; Carter, David M.; Churcher, Carol; Coffey, Alison; Cox, Anthony; Palotie, Aarno; Quail, Michael; Skelly, Tom; Stalker, James; Swerdlow, Harold P.; Turner, Daniel; De Witte, Anniek; Giles, Shane; Gibbs, Richard A.; Wheeler, David; Bainbridge, Matthew; Challis, Danny; Sabo, Aniko; Yu, Fuli; Yu, Jin; Wang, Jun; Fang, Xiaodong; Guo, Xiaosen; Li, Ruiqiang; Li, Yingrui; Luo, Ruibang; Tai, Shuaishuai; Wu, Honglong; Zheng, Hancheng; Zheng, Xiaole; Zhou, Yan; Li, Guoqing; Wang, Jian; Yang, Huanming; Marth, Gabor T.; Garrison, Erik P.; Huang, Weichun; Indap, Amit; Kural, Deniz; Lee, Wan-Ping; Leong, Wen Fung; Quinlan, Aaron R.; Stewart, Chip; Stromberg, Michael P.; Ward, Alistair N.; Wu, Jiantao; Lee, Charles; Mills, Ryan E.; Shi, Xinghua; Daly, Mark J.; DePristo, Mark A.; Altshuler, David L.; Ball, Aaron D.; Banks, Eric; Bloom, Toby; Browning, Brian L.; Cibulskis, Kristian; Fennell, Tim J.; Garimella, Kiran V.; Grossman, Sharon R.; Handsaker, Robert E.; Hanna, Matt; Hartl, Chris; Jaffe, David B.; Kernytsky, Andrew M.; Korn, Joshua M.; Li, Heng; Maguire, Jared R.; McCarroll, Steven A.; McKenna, Aaron; Nemesh, James C.; Philippakis, Anthony A.; Poplin, Ryan E.; Price, Alkes; Rivas, Manuel A.; Sabeti, Pardis C.; Schaffner, Stephen F.; Shefler, Erica; Shlyakhter, Ilya A.; Cooper, David N.; Ball, Edward V.; Mort, Matthew; Phillips, Andrew D.; Stenson, Peter D.; Sebat, Jonathan; Makarov, Vladimir; Ye, Kenny; Yoon, Seungtai C.; Bustamante, Carlos D.; Clark, Andrew G.; Boyko, Adam; Degenhardt, Jeremiah; Gravel, Simon; Gutenkunst, Ryan N.; Kaganovich, Mark; Keinan, Alon; Lacroute, Phil; Ma, Xin; Reynolds, Andy; Clarke, Laura; Flicek, Paul; Cunningham, Fiona; Herrero, Javier; Keenen, Stephen; Kulesha, Eugene; Leinonen, Rasko; McLaren, William M.; Radhakrishnan, Rajesh; Smith, Richard E.; Zalunin, Vadim; Zheng-Bradley, Xiangqun; Korbel, Jan O.; Stütz, Adrian M.; Humphray, Sean; Bauer, Markus; Cheetham, R. Keira; Cox, Tony; Eberle, Michael; James, Terena; Kahn, Scott; Murray, Lisa; Chakravarti, Aravinda; Ye, Kai; De La Vega, Francisco M.; Fu, Yutao; Hyland, Fiona C. L.; Manning, Jonathan M.; McLaughlin, Stephen F.; Peckham, Heather E.; Sakarya, Onur; Sun, Yongming A.; Tsung, Eric F.; Batzer, Mark A.; Konkel, Miriam K.; Walker, Jerilyn A.; Sudbrak, Ralf; Albrecht, Marcus W.; Amstislavskiy, Vyacheslav S.; Herwig, Ralf; Parkhomchuk, Dimitri V.; Sherry, Stephen T.; Agarwala, Richa; Khouri, Hoda M.; Morgulis, Aleksandr O.; Paschall, Justin E.; Phan, Lon D.; Rotmistrovsky, Kirill E.; Sanders, Robert D.; Shumway, Martin F.; Xiao, Chunlin; McVean, Gil A.; Auton, Adam; Iqbal, Zamin; Lunter, Gerton; Marchini, Jonathan L.; Moutsianas, Loukas; Myers, Simon; Tumian, Afidalina; Desany, Brian; Knight, James; Winer, Roger; Craig, David W.; Beckstrom-Sternberg, Steve M.; Christoforides, Alexis; Kurdoglu, Ahmet A.; Pearson, John V.; Sinari, Shripad A.; Tembe, Waibhav D.; Haussler, David; Hinrichs, Angie S.; Katzman, Sol J.; Kern, Andrew; Kuhn, Robert M.; Przeworski, Molly; Hernandez, Ryan D.; Howie, Bryan; Kelley, Joanna L.; Melton, S. Cord; Abecasis, Gonçalo R.; Li, Yun; Anderson, Paul; Blackwell, Tom; Chen, Wei; Cookson, William O.; Ding, Jun; Kang, Hyun Min; Lathrop, Mark; Liang, Liming; Moffatt, Miriam F.; Scheet, Paul; Sidore, Carlo; Snyder, Matthew; Zhan, Xiaowei; Zöllner, Sebastian; Awadalla, Philip; Casals, Ferran; Idaghdour, Youssef; Keebler, John; Stone, Eric A.; Zilversmit, Martine; Jorde, Lynn; Xing, Jinchuan; Eichler, Evan E.; Aksay, Gozde; Alkan, Can; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Kidd, Jeffrey M.; Sahinalp, S. Cenk; Sudmant, Peter H.; Mardis, Elaine R.; Chen, Ken; Chinwalla, Asif; Ding, Li; Koboldt, Daniel C.; McLellan, Mike D.; Dooling, David; Weinstock, George; Wallis, John W.; Wendl, Michael C.; Zhang, Qunyuan; Durbin, Richard M.; Albers, Cornelis A.; Ayub, Qasim; Balasubramaniam, Senduran; Barrett, Jeffrey C.; Carter, David M.; Chen, Yuan; Conrad, Donald F.; Danecek, Petr; Dermitzakis, Emmanouil T.; Hu, Min; Huang, Ni; Hurles, Matt E.; Jin, Hanjun; Jostins, Luke; Keane, Thomas M.; Le, Si Quang; Lindsay, Sarah; Long, Quan; MacArthur, Daniel G.; Montgomery, Stephen B.; Parts, Leopold; Stalker, James; Tyler-Smith, Chris; Walter, Klaudia; Zhang, Yujun; Gerstein, Mark B.; Snyder, Michael; Abyzov, Alexej; Balasubramanian, Suganthi; Bjornson, Robert; Du, Jiang; Grubert, Fabian; Habegger, Lukas; Haraksingh, Rajini; Jee, Justin; Khurana, Ekta; Lam, Hugo Y. K.; Leng, Jing; Mu, Xinmeng Jasmine; Urban, Alexander E.; Zhang, Zhengdong; Li, Yingrui; Luo, Ruibang; Marth, Gabor T.; Garrison, Erik P.; Kural, Deniz; Quinlan, Aaron R.; Stewart, Chip; Stromberg, Michael P.; Ward, Alistair N.; Wu, Jiantao; Lee, Charles; Mills, Ryan E.; Shi, Xinghua; McCarroll, Steven A.; Banks, Eric; DePristo, Mark A.; Handsaker, Robert E.; Hartl, Chris; Korn, Joshua M.; Li, Heng; Nemesh, James C.; Sebat, Jonathan; Makarov, Vladimir; Ye, Kenny; Yoon, Seungtai C.; Degenhardt, Jeremiah; Kaganovich, Mark; Clarke, Laura; Smith, Richard E.; Zheng-Bradley, Xiangqun; Korbel, Jan O.; Humphray, Sean; Cheetham, R. Keira; Eberle, Michael; Kahn, Scott; Murray, Lisa; Ye, Kai; De La Vega, Francisco M.; Fu, Yutao; Peckham, Heather E.; Sun, Yongming A.; Batzer, Mark A.; Konkel, Miriam K.; Walker, Jerilyn A.; Xiao, Chunlin; Iqbal, Zamin; Desany, Brian; Blackwell, Tom; Snyder, Matthew; Xing, Jinchuan; Eichler, Evan E.; Aksay, Gozde; Alkan, Can; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Kidd, Jeffrey M.; Chen, Ken; Chinwalla, Asif; Ding, Li; McLellan, Mike D.; Wallis, John W.; Hurles, Matt E.; Conrad, Donald F.; Walter, Klaudia; Zhang, Yujun; Gerstein, Mark B.; Snyder, Michael; Abyzov, Alexej; Du, Jiang; Grubert, Fabian; Haraksingh, Rajini; Jee, Justin; Khurana, Ekta; Lam, Hugo Y. K.; Leng, Jing; Mu, Xinmeng Jasmine; Urban, Alexander E.; Zhang, Zhengdong; Gibbs, Richard A.; Bainbridge, Matthew; Challis, Danny; Coafra, Cristian; Dinh, Huyen; Kovar, Christie; Lee, Sandy; Muzny, Donna; Nazareth, Lynne; Reid, Jeff; Sabo, Aniko; Yu, Fuli; Yu, Jin; Marth, Gabor T.; Garrison, Erik P.; Indap, Amit; Leong, Wen Fung; Quinlan, Aaron R.; Stewart, Chip; Ward, Alistair N.; Wu, Jiantao; Cibulskis, Kristian; Fennell, Tim J.; Gabriel, Stacey B.; Garimella, Kiran V.; Hartl, Chris; Shefler, Erica; Sougnez, Carrie L.; Wilkinson, Jane; Clark, Andrew G.; Gravel, Simon; Grubert, Fabian; Clarke, Laura; Flicek, Paul; Smith, Richard E.; Zheng-Bradley, Xiangqun; Sherry, Stephen T.; Khouri, Hoda M.; Paschall, Justin E.; Shumway, Martin F.; Xiao, Chunlin; McVean, Gil A.; Katzman, Sol J.; Abecasis, Gonçalo R.; Blackwell, Tom; Mardis, Elaine R.; Dooling, David; Fulton, Lucinda; Fulton, Robert; Koboldt, Daniel C.; Durbin, Richard M.; Balasubramaniam, Senduran; Coffey, Allison; Keane, Thomas M.; MacArthur, Daniel G.; Palotie, Aarno; Scott, Carol; Stalker, James; Tyler-Smith, Chris; Gerstein, Mark B.; Balasubramanian, Suganthi; Chakravarti, Aravinda; Knoppers, Bartha M.; Abecasis, Gonçalo R.; Bustamante, Carlos D.; Gharani, Neda; Gibbs, Richard A.; Jorde, Lynn; Kaye, Jane S.; Kent, Alastair; Li, Taosha; McGuire, Amy L.; McVean, Gil A.; Ossorio, Pilar N.; Rotimi, Charles N.; Su, Yeyang; Toji, Lorraine H.; TylerSmith, Chris; Brooks, Lisa D.; Felsenfeld, Adam L.; McEwen, Jean E.; Abdallah, Assya; Juenger, Christopher R.; Clemm, Nicholas C.; Collins, Francis S.; Duncanson, Audrey; Green, Eric D.; Guyer, Mark S.; Peterson, Jane L.; Schafer, Alan J.; Abecasis, Gonçalo R.; Altshuler, David L.; Auton, Adam; Brooks, Lisa D.; Durbin, Richard M.; Gibbs, Richard A.; Hurles, Matt E.; McVean, Gil A.

    2011-01-01

    High-throughput sequencing technology enables population-level surveys of human genomic variation. Here, we examine the joint allele frequency distributions across continental human populations and present an approach for combining complementary aspects of whole-genome, low-coverage data and targeted high-coverage data. We apply this approach to data generated by the pilot phase of the Thousand Genomes Project, including whole-genome 2–4× coverage data for 179 samples from HapMap European, Asian, and African panels as well as high-coverage target sequencing of the exons of 800 genes from 697 individuals in seven populations. We use the site frequency spectra obtained from these data to infer demographic parameters for an Out-of-Africa model for populations of African, European, and Asian descent and to predict, by a jackknife-based approach, the amount of genetic diversity that will be discovered as sample sizes are increased. We predict that the number of discovered nonsynonymous coding variants will reach 100,000 in each population after ∼1,000 sequenced chromosomes per population, whereas ∼2,500 chromosomes will be needed for the same number of synonymous variants. Beyond this point, the number of segregating sites in the European and Asian panel populations is expected to overcome that of the African panel because of faster recent population growth. Overall, we find that the majority of human genomic variable sites are rare and exhibit little sharing among diverged populations. Our results emphasize that replication of disease association for specific rare genetic variants across diverged populations must overcome both reduced statistical power because of rarity and higher population divergence. PMID:21730125

  1. Demographic history and rare allele sharing among human populations.

    PubMed

    Gravel, Simon; Henn, Brenna M; Gutenkunst, Ryan N; Indap, Amit R; Marth, Gabor T; Clark, Andrew G; Yu, Fuli; Gibbs, Richard A; Bustamante, Carlos D

    2011-07-19

    High-throughput sequencing technology enables population-level surveys of human genomic variation. Here, we examine the joint allele frequency distributions across continental human populations and present an approach for combining complementary aspects of whole-genome, low-coverage data and targeted high-coverage data. We apply this approach to data generated by the pilot phase of the Thousand Genomes Project, including whole-genome 2-4× coverage data for 179 samples from HapMap European, Asian, and African panels as well as high-coverage target sequencing of the exons of 800 genes from 697 individuals in seven populations. We use the site frequency spectra obtained from these data to infer demographic parameters for an Out-of-Africa model for populations of African, European, and Asian descent and to predict, by a jackknife-based approach, the amount of genetic diversity that will be discovered as sample sizes are increased. We predict that the number of discovered nonsynonymous coding variants will reach 100,000 in each population after ∼1,000 sequenced chromosomes per population, whereas ∼2,500 chromosomes will be needed for the same number of synonymous variants. Beyond this point, the number of segregating sites in the European and Asian panel populations is expected to overcome that of the African panel because of faster recent population growth. Overall, we find that the majority of human genomic variable sites are rare and exhibit little sharing among diverged populations. Our results emphasize that replication of disease association for specific rare genetic variants across diverged populations must overcome both reduced statistical power because of rarity and higher population divergence.

  2. HRAS1 rare minisatellite alleles and breast cancer in Australian women under age forty years.

    PubMed

    Firgaira, F A; Seshadri, R; McEvoy, C R; Dite, G S; Giles, G G; McCredie, M R; Southey, M C; Venter, D J; Hopper, J L

    1999-12-15

    A recent meta-analysis of 23 studies supported the empirically derived hypothesis that women who lack one of the four common minisatellite alleles at the HRAS1 locus are at increased risk of breast cancer. These studies relied on visual sizing of alleles on electrophoretic gels and may have underreported rare alleles. We determined whether this hypothesis applied to early-onset breast cancer by using a new method to size minisatellite alleles. We conducted a population-based, case-control-family study of 249 Australian women under 40 years old at diagnosis of a first primary breast cancer and 234 randomly selected women, frequency matched for age. We sized HRAS1 minisatellite alleles with an Applied Biosystems model 373 automated DNA sequencer and GENESCAN(TM) software. All P values are two-sided. We found no association of rare alleles with breast cancer, before or after adjustment for risk factors and irrespective of how their effects were modeled (crude odds ratio = 1.04; 95% confidence interval [CI] = 0.071-1.53; P =.8). The rare allele frequency was 0. 173 (95% CI = 0.149-0.197), three times the pooled estimate of 0.058 (95% CI = 0.050-0.066) from previous studies (P<.001), and was similar for case subjects, 0.177 (95% CI = 0.143-0.221), and control subjects, 0.169 (95% CI = 0.135-0.203) (P =.7). There was no support for an association between rare HRAS1 alleles and the risk of early-onset breast cancer, despite 80% power to detect effects of the magnitude of those associations (1.7-fold) previously suggested. The question of whether cancer risk is associated with rare minisatellite HRAS1 alleles needs to be revisited with the use of new methods that have a greater ability to distinguish rare alleles from similarly sized common alleles.

  3. Autosomal-Recessive Hearing Impairment Due to Rare Missense Variants within S1PR2

    PubMed Central

    Santos-Cortez, Regie Lyn P.; Faridi, Rabia; Rehman, Atteeq U.; Lee, Kwanghyuk; Ansar, Muhammad; Wang, Xin; Morell, Robert J.; Isaacson, Rivka; Belyantseva, Inna A.; Dai, Hang; Acharya, Anushree; Qaiser, Tanveer A.; Muhammad, Dost; Ali, Rana Amjad; Shams, Sulaiman; Hassan, Muhammad Jawad; Shahzad, Shaheen; Raza, Syed Irfan; Bashir, Zil-e-Huma; Smith, Joshua D.; Nickerson, Deborah A.; Bamshad, Michael J.; Riazuddin, Sheikh; Ahmad, Wasim; Friedman, Thomas B.; Leal, Suzanne M.

    2016-01-01

    The sphingosine-1-phosphate receptors (S1PRs) are a well-studied class of transmembrane G protein-coupled sphingolipid receptors that mediate multiple cellular processes. However, S1PRs have not been previously reported to be involved in the genetic etiology of human traits. S1PR2 lies within the autosomal-recessive nonsyndromic hearing impairment (ARNSHI) locus DFNB68 on 19p13.2. From exome sequence data we identified two pathogenic S1PR2 variants, c.323G>C (p.Arg108Pro) and c.419A>G (p.Tyr140Cys). Each of these variants co-segregates with congenital profound hearing impairment in consanguineous Pakistani families with maximum LOD scores of 6.4 for family DEM4154 and 3.3 for family PKDF1400. Neither S1PR2 missense variant was reported among ∼120,000 chromosomes in the Exome Aggregation Consortium database, in 76 unrelated Pakistani exomes, or in 720 Pakistani control chromosomes. Both DNA variants affect highly conserved residues of S1PR2 and are predicted to be damaging by multiple bioinformatics tools. Molecular modeling predicts that these variants affect binding of sphingosine-1-phosphate (p.Arg108Pro) and G protein docking (p.Tyr140Cys). In the previously reported S1pr2−/− mice, stria vascularis abnormalities, organ of Corti degeneration, and profound hearing loss were observed. Additionally, hair cell defects were seen in both knockout mice and morphant zebrafish. Family PKDF1400 presents with ARNSHI, which is consistent with the lack of gross malformations in S1pr2−/− mice, whereas family DEM4154 has lower limb malformations in addition to hearing loss. Our findings suggest the possibility of developing therapies against hair cell damage (e.g., from ototoxic drugs) through targeted stimulation of S1PR2. PMID:26805784

  4. Gene-based rare allele analysis identified a risk gene of Alzheimer's disease.

    PubMed

    Kim, Jong Hun; Song, Pamela; Lim, Hyunsun; Lee, Jae-Hyung; Lee, Jun Hong; Park, Sun Ah

    2014-01-01

    Alzheimer's disease (AD) has a strong propensity to run in families. However, the known risk genes excluding APOE are not clinically useful. In various complex diseases, gene studies have targeted rare alleles for unsolved heritability. Our study aims to elucidate previously unknown risk genes for AD by targeting rare alleles. We used data from five publicly available genetic studies from the Alzheimer's Disease Neuroimaging Initiative (ADNI) and the database of Genotypes and Phenotypes (dbGaP). A total of 4,171 cases and 9,358 controls were included. The genotype information of rare alleles was imputed using 1,000 genomes. We performed gene-based analysis of rare alleles (minor allele frequency≤3%). The genome-wide significance level was defined as meta P<1.8×10(-6) (0.05/number of genes in human genome = 0.05/28,517). ZNF628, which is located at chromosome 19q13.42, showed a genome-wide significant association with AD. The association of ZNF628 with AD was not dependent on APOE ε4. APOE and TREM2 were also significantly associated with AD, although not at genome-wide significance levels. Other genes identified by targeting common alleles could not be replicated in our gene-based rare allele analysis. We identified that rare variants in ZNF628 are associated with AD. The protein encoded by ZNF628 is known as a transcription factor. Furthermore, the associations of APOE and TREM2 with AD were highly significant, even in gene-based rare allele analysis, which implies that further deep sequencing of these genes is required in AD heritability studies.

  5. A unique missense allele of BAF155, a core BAF chromatin remodeling complex protein, causes neural tube closure defects in mice.

    PubMed

    Harmacek, Laura; Watkins-Chow, Dawn E; Chen, Jianfu; Jones, Kenneth L; Pavan, William J; Salbaum, J Michael; Niswander, Lee

    2014-05-01

    Failure of embryonic neural tube closure results in the second most common class of birth defects known as neural tube defects (NTDs). While NTDs are likely the result of complex multigenic dysfunction, it is not known whether polymorphisms in epigenetic regulators may be risk factors for NTDs. Here we characterized Baf155(msp3) , a unique ENU-induced allele in mice. Homozygous Baf155(mps3) embryos exhibit highly penetrant exencephaly, allowing us to investigate the roles of an assembled, but malfunctional BAF chromatin remodeling complex in vivo at the time of neural tube closure. Evidence of defects in proliferation and apoptosis were found within the neural tube. RNA-Seq analysis revealed that surprisingly few genes showed altered expression in Baf155 mutant neural tissue, given the broad epigenetic role of the BAF complex, but included genes involved in neural development and cell survival. Moreover, gene expression changes between individual mutants were variable even though the NTD was consistently observed. This suggests that inconsistent gene regulation contributes to failed neural tube closure. These results shed light on the role of the BAF complex in the process of neural tube closure and highlight the importance of studying missense alleles to understand epigenetic regulation during critical phases of development.

  6. Common vs. Rare Allele Hypotheses for Complex Diseases

    PubMed Central

    Schork, Nicholas J.; Murray, Sarah S.; Frazer, Kelly A.; Topol, Eric J.

    2010-01-01

    There has been growing debate over the nature of the genetic contribution to individual susceptibility to common complex diseases such as diabetes, osteoporosis, and cancer. The ‘Common Disease, Common Variant (CDCV)’ hypothesis argues that genetic variations with appreciable frequency in the population at large, but relatively low ‘penetrance’ (or the probability that a carrier of the relevant variants will express the disease), are the major contributors to genetic susceptibility to common diseases. The ‘Common Disease, Rare Variant (CDRV)’ hypothesis, on the other hand, argues that multiple rare DNA sequence variations, each with relatively high penetrance, are the major contributors to genetic susceptibility to common diseases. Both hypotheses have their place in current research efforts. PMID:19481926

  7. A viable Arabidopsis pex13 missense allele confers severe peroxisomal defects and decreases PEX5 association with peroxisomes

    PubMed Central

    Woodward, Andrew W.; Fleming, Wendell A.; Burkhart, Sarah E.; Ratzel, Sarah E.; Bjornson, Marta; Bartel, Bonnie

    2014-01-01

    Peroxisomes are organelles that catabolize fatty acids and compartmentalize other oxidative metabolic processes in eukaryotes. Using a forward-genetic screen designed to recover severe peroxisome-defective mutants, we isolated a viable allele of the peroxisome biogenesis gene PEX13 with striking peroxisomal defects. The pex13-4 mutant requires an exogenous source of fixed carbon for pre-photosynthetic development and is resistant to the protoauxin indole-3-butyric acid. Delivery of peroxisome-targeted matrix proteins depends on the PEX5 receptor docking with PEX13 at the peroxisomal membrane, and we found severely reduced import of matrix proteins and less organelle-associated PEX5 in pex13-4 seedlings. Moreover, pex13-4 physiological and molecular defects were partially ameliorated when PEX5 was overexpressed, suggesting that PEX5 docking is partially compromised in this mutant and can be improved by increasing PEX5 levels. Because previously described Arabidopsis pex13 alleles either are lethal or confer only subtle defects, the pex13-4 mutant provides valuable insight into plant peroxisome receptor docking and matrix protein import. PMID:25008153

  8. A viable Arabidopsis pex13 missense allele confers severe peroxisomal defects and decreases PEX5 association with peroxisomes.

    PubMed

    Woodward, Andrew W; Fleming, Wendell A; Burkhart, Sarah E; Ratzel, Sarah E; Bjornson, Marta; Bartel, Bonnie

    2014-09-01

    Peroxisomes are organelles that catabolize fatty acids and compartmentalize other oxidative metabolic processes in eukaryotes. Using a forward-genetic screen designed to recover severe peroxisome-defective mutants, we isolated a viable allele of the peroxisome biogenesis gene PEX13 with striking peroxisomal defects. The pex13-4 mutant requires an exogenous source of fixed carbon for pre-photosynthetic development and is resistant to the protoauxin indole-3-butyric acid. Delivery of peroxisome-targeted matrix proteins depends on the PEX5 receptor docking with PEX13 at the peroxisomal membrane, and we found severely reduced import of matrix proteins and less organelle-associated PEX5 in pex13-4 seedlings. Moreover, pex13-4 physiological and molecular defects were partially ameliorated when PEX5 was overexpressed, suggesting that PEX5 docking is partially compromised in this mutant and can be improved by increasing PEX5 levels. Because previously described Arabidopsis pex13 alleles either are lethal or confer only subtle defects, the pex13-4 mutant provides valuable insight into plant peroxisome receptor docking and matrix protein import.

  9. Rare missense neuronal cadherin gene (CDH2) variants in specific obsessive-compulsive disorder and Tourette disorder phenotypes.

    PubMed

    Moya, Pablo R; Dodman, Nicholas H; Timpano, Kiara R; Rubenstein, Liza M; Rana, Zaker; Fried, Ruby L; Reichardt, Louis F; Heiman, Gary A; Tischfield, Jay A; King, Robert A; Galdzicka, Marzena; Ginns, Edward I; Wendland, Jens R

    2013-08-01

    The recent finding that the neuronal cadherin gene CDH2 confers a highly significant risk for canine compulsive disorder led us to investigate whether missense variants within the human ortholog CDH2 are associated with altered susceptibility to obsessive-compulsive disorder (OCD), Tourette disorder (TD) and related disorders. Exon resequencing of CDH2 in 320 individuals identified four non-synonymous single-nucleotide variants, which were subsequently genotyped in OCD probands, Tourette disorder probands and relatives, and healthy controls (total N=1161). None of the four variants was significantly associated with either OCD or TD. One variant, N706S, was found only in the OCD/TD groups, but not in controls. By examining clinical data, we found there were significant TD-related phenotype differences between those OCD probands with and without the N845S variant with regard to the co-occurrence of TD (Fisher's exact test P=0.014, OR=6.03). Both N706S and N845S variants conferred reduced CDH2 protein expression in transfected cells. Although our data provide no overall support for association of CDH2 rare variants in these disorders considered as single entities, the clinical features and severity of probands carrying the uncommon non-synonymous variants suggest that CDH2, along with other cadherin and cell adhesion genes, is an interesting gene to pursue as a plausible contributor to OCD, TD and related disorders with repetitive behaviors, including autism spectrum disorders.

  10. Haplotype associations of 90 rare alleles from the National Marrow Donor Program.

    PubMed

    Kempenich, J H; Setterholm, M; Maiers, M

    2006-04-01

    The National Marrow Donor Program maintains an HLA database of over 4.1 million US adult volunteers, 43,000 cord blood units, and 111,000 patients from which we identified 1,999,424 samples having allele-level HLA-A, HLA-B, or HLA-DRB1 results. We analyzed 811 rare alleles reported at a frequency of less than 1 in 50,000 in this study pool and found strong predicted haplotype associations for 90 of them. The data set includes the number of times the allele was seen, the predicted haplotypes, and the racial or ethnic groups in which it was identified. This information can be helpful in designing search strategies for patients with rare alleles requiring hematopoietic stem cell therapy.

  11. The effect of wild card designations and rare alleles in forensic DNA database searches.

    PubMed

    Tvedebrink, Torben; Bright, Jo-Anne; Buckleton, John S; Curran, James M; Morling, Niels

    2015-05-01

    Forensic DNA databases are powerful tools used for the identification of persons of interest in criminal investigations. Typically, they consist of two parts: (1) a database containing DNA profiles of known individuals and (2) a database of DNA profiles associated with crime scenes. The risk of adventitious or chance matches between crimes and innocent people increases as the number of profiles within a database grows and more data is shared between various forensic DNA databases, e.g. from different jurisdictions. The DNA profiles obtained from crime scenes are often partial because crime samples may be compromised in quantity or quality. When an individual's profile cannot be resolved from a DNA mixture, ambiguity is introduced. A wild card, F, may be used in place of an allele that has dropped out or when an ambiguous profile is resolved from a DNA mixture. Variant alleles that do not correspond to any marker in the allelic ladder or appear above or below the extent of the allelic ladder range are assigned the allele designation R for rare allele. R alleles are position specific with respect to the observed/unambiguous allele. The F and R designations are made when the exact genotype has not been determined. The F and R designation are treated as wild cards for searching, which results in increased chance of adventitious matches. We investigated the probability of adventitious matches given these two types of wild cards. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Identification of rare alleles and their carriers using compressed se(que)nsing

    PubMed Central

    Shental, Noam; Amir, Amnon; Zuk, Or

    2010-01-01

    Identification of rare variants by resequencing is important both for detecting novel variations and for screening individuals for known disease alleles. New technologies enable low-cost resequencing of target regions, although it is still prohibitive to test more than a few individuals. We propose a novel pooling design that enables the recovery of novel or known rare alleles and their carriers in groups of individuals. The method is based on a Compressed Sensing (CS) approach, which is general, simple and efficient. CS allows the use of generic algorithmic tools for simultaneous identification of multiple variants and their carriers. We model the experimental procedure and show via computer simulations that it enables the recovery of rare alleles and their carriers in larger groups than were possible before. Our approach can also be combined with barcoding techniques to provide a feasible solution based on current resequencing costs. For example, when targeting a small enough genomic region (∼100 bp) and using only ∼10 sequencing lanes and ∼10 distinct barcodes per lane, one recovers the identity of 4 rare allele carriers out of a population of over 4000 individuals. We demonstrate the performance of our approach over several publicly available experimental data sets. PMID:20699269

  13. In silico calculated affinity of FVIII-derived peptides for HLA class II alleles predicts inhibitor development in haemophilia A patients with missense mutations in the F8 gene.

    PubMed

    Pashov, A D; Calvez, T; Gilardin, L; Maillère, B; Repessé, Y; Oldenburg, J; Pavlova, A; Kaveri, S V; Lacroix-Desmazes, S

    2014-03-01

    Forty per cent of haemophilia A (HA) patients have missense mutations in the F8 gene. Yet, all patients with identical mutations are not at the same risk of developing factor VIII (FVIII) inhibitors. In severe HA patients, human leucocyte antigen (HLA) haplotype was identified as a risk factor for onset of FVIII inhibitors. We hypothesized that missense mutations in endogenous FVIII alter the affinity of the mutated peptides for HLA class II, thus skewing FVIII-specific T-cell tolerance and increasing the risk that the corresponding wild-type FVIII-derived peptides induce an anti-FVIII immune response during replacement therapy. Here, we investigated whether affinity for HLA class II of wild-type FVIII-derived peptides that correspond to missense mutations described in the Haemophilia A Mutation, Structure, Test and Resource database is associated with inhibitor development. We predicted the mean affinity for 10 major HLA class II alleles of wild-type FVIII-derived peptides that corresponded to 1456 reported cases of missense mutations. Linear regression analysis confirmed a significant association between the predicted mean peptide affinity and the mutation inhibitory status (P = 0.006). Significance was lost after adjustment on mutation position on FVIII domains. Although analysis of the A1-A2-A3-C1 domains yielded a positive correlation between predicted HLA-binding affinity and inhibitory status (OR = 0.29 [95% CI: 0.14-0.60] for the high affinity tertile, P = 0.002), the C2 domain-restricted analysis indicated an inverse correlation (OR = 3.56 [1.10-11.52], P = 0.03). Our data validate the importance of the affinity of FVIII peptides for HLA alleles to the immunogenicity of therapeutic FVIII in patients with missense mutations.

  14. Subcortical band heterotopia in rare affected males can be caused by missense mutations in DCX (XLIS) or LIS1.

    PubMed

    Pilz, D T; Kuc, J; Matsumoto, N; Bodurtha, J; Bernadi, B; Tassinari, C A; Dobyns, W B; Ledbetter, D H

    1999-09-01

    Subcortical band heterotopia (SBH) are bilateral and symmetric ribbons of gray matter found in the central white matter between the cortex and the ventricular surface, which comprises the less severe end of the lissencephaly (agyria-pachygyria-band) spectrum of malformations. Mutations in DCX (also known as XLIS ) have previously been described in females with SBH. We have now identified mutations in either the DCX or LIS1 gene in three of 11 boys studied, demonstrating for the first time that mutations of either DCX or LIS1 can cause SBH or mixed pachygyria-SBH (PCH-SBH) in males. All three changes detected are missense mutations, predicted to be of germline origin. They include a missense mutation in exon 4 of DCX in a boy with PCH-SBH (R78H), a different missense mutation in exon 4 of DCX in a boy with mild SBH and in his mildly affected mother (R89G) and a missense mutation in exon 6 of LIS1 in a boy with SBH (S169P). The missense mutations probably account for the less severe brain malformations, although other patients with missense mutations in the same exons have had diffuse lissencephaly. Therefore, it appears likely that the effect of the specific amino acid change on the protein determines the severity of the phenotype, with some mutations enabling residual protein function and allowing normal migration in a larger proportion of neurons. However, we expect that somatic mosaic mutations of both LIS1 and DCX will also prove to be an important mechanism in causing SBH in males.

  15. Identification of a rare off-ladder allele of the D13S325 locus during paternity testing.

    PubMed

    Chen, Wenjing; Cheng, Jianding; Tong, Dayue; Liu, Sujuan; Zhang, Yinming; Sun, Hongyu

    2014-01-01

    This study demonstrates an unusual rare allele of D13S325 that was falsely categorized as an allele of D12S391 under the STRtyper™-10F/G system. The parentage cases with these rare alleles were analyzed using the Sinofiler™ system and singleplex amplification system, and the alleles of D13S325 extracted from the electrophoresis gel were sequenced. 5 Cases with the rare alleles misread as allele 20 of D12S391 were identified in total 2618 cases (including 3200 unrelated parents). This rare allele was designated as allele 5.1 of D13S325 based on its DNA sequence. Its frequency in the Chinese population was 1.6×10(-3). Because the rare allele 5.1 of D13S325 locus tends to be incorrectly labeled in the STRtyper™-10F/G system, particular attention should be paid when the system is used in paternity testing, personal identification, and DNA database comparisons.

  16. Microsatellite variation and rare alleles in a bottlenecked Hawaiian Islands endemic: implications for reintroductions

    USGS Publications Warehouse

    Reynolds, Michelle H.; Pearce, John M.; Lavretsky, Philip; Seixas, Pedro P.; Courtot, Karen

    2015-01-01

    Conservation of genetic biodiversity in endangered wildlife populations is an important challenge to address since the loss of alleles and genetic drift may influence future adaptability. Reintroduction aims to re-establish species to restored or protected ecosystems; however, moving a subset of individuals may result in loss of gene variants during the management-induced bottleneck (i.e. translocation). The endangered Laysan teal Anas laysanensis was once widespread across the Hawaiian archipelago, but became isolated on Laysan Island (415 ha) from the mid-1800s until 2004 when a translocation to Midway Atoll (596 ha) was undertaken to reduce extinction risks. We compared genetic diversity and quantified variation at microsatellite loci sampled from 230 individuals from the wild populations at Laysan (1999 to 2009) and Midway (2007 to 2010; n = 133 Laysan, n = 96 Midway birds). We identified polymorphic markers by screening nuclear microsatellites (N = 83). Low nuclear variation was detected, consistent with the species’ insular isolation and historical bottleneck. Six of 83 microsatellites were polymorphic. We found limited but similar estimates of allelic richness (2.58 alleles per locus) and heterozygosity within populations. However, 2 rare alleles found in the Laysan source population were not present in Midway’s reintroduced population, and a unique allele was discovered in an individual on Midway. Differentiation between island populations was low (FST = 0.6%), but statistically significant. Our results indicate that genetic drift had little effect on offspring generations 3 to 6 yr post-release and demonstrate the utility of using known founder events to help quantify genetic capture during translocations and to inform management decisions.

  17. Examination of rare missense variants in the CHRNA5-A3-B4 gene cluster to level of response to alcohol in the San Diego Sibling Pair study.

    PubMed

    Choquet, Hélène; Joslyn, Geoff; Lee, Andrew; Kasberger, Jay; Robertson, Margaret; Brush, Gerry; Schuckit, Marc A; White, Ray; Jorgenson, Eric

    2013-08-01

    Common variants in the CHRNA5-A3-B4 gene cluster have been shown to be associated with nicotine dependence and alcohol use disorders (AUDs) and related traits, including the level of response (LR) to alcohol. Recently, rare variants (MAF < 0.05) in CHRNB4 have been reported to be associated with a decreased risk of developing nicotine dependence. However, the role of rare variants in the CHRNA5-A3-B4 gene cluster to the LR to alcohol has not yet been established. To determine whether rare variants in the CHRNA5-A3-B4 gene cluster contribute to the LR to alcohol, the coding regions of these 3 genes were sequenced in 538 subjects from the San Diego Sibling Pair study. The analyses identified 16 rare missense variants, 9 of which were predicted to be damaging using in silico analysis tools. Carriers of these variants were compared to noncarriers using a family-based design for each gene and for the gene cluster as a whole. In these analyses, a CHRNA5 carrier status was significantly associated with the phenotype related to the feeling of intoxication experienced during the alcohol challenge (p = 0.039). These results indicate that rare genetic variation in the CHRNA5-A3-B4 gene cluster contributes modestly to the LR to alcohol in the San Diego Sibling Pair study and may protect against AUDs. However, replication studies are needed to confirm our findings. Copyright © 2013 by the Research Society on Alcoholism.

  18. Impact of rare variants in ARHGAP29 to the etiology of oral clefts: role of loss-of-function vs missense variants.

    PubMed

    Savastano, C P; Brito, L A; Faria, Á C; Setó-Salvia, N; Peskett, E; Musso, C M; Alvizi, L; Ezquina, S A M; James, C; GOSgene; Beales, P; Lees, M; Moore, G E; Stanier, P; Passos-Bueno, M R

    2017-05-01

    Non-syndromic cleft lip with or without cleft palate (NSCL/P) is a prevalent, complex congenital malformation. Genome-wide association studies (GWAS) on NSCL/P have consistently identified association for the 1p22 region, in which ARHGAP29 has emerged as the main candidate gene. ARHGAP29 re-sequencing studies in NSCL/P patients have identified rare variants; however, their clinical impact is still unclear. In this study we identified 10 rare variants in ARHGAP29, including five missense, one in-frame deletion, and four loss-of-function (LoF) variants, in a cohort of 188 familial NSCL/P cases. A significant mutational burden was found for LoF (Sequence Kernel Association Test, p = 0.0005) but not for missense variants in ARHGAP29, suggesting that only LoF variants contribute to the etiology of NSCL/P. Penetrance was estimated as 59%, indicating that heterozygous LoF variants in ARHGAP29 confer a moderate risk to NSCL/P. The GWAS hits in IRF6 (rs642961) and 1p22 (rs560426 and rs4147811) do not seem to contribute to the penetrance of the phenotype, based on co-segregation analysis. Our data show that rare variants leading to haploinsufficiency of ARHGAP29 represent an important etiological clefting mechanism, and genetic testing for this gene might be taken into consideration in genetic counseling of familial cases. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Novel deletion and a new missense mutation (Glu 217 Lys) at the catalytic site in two adenosine deaminase alleles of a patient with neonatal onset adenosine deaminase severe combined immunodeficiency

    SciTech Connect

    Hirschhorn, R.; Nicknam, M.N.; Eng, F.; Yang, D.R.; Borkowsky, W. )

    1992-11-01

    Mutations at the adenosine deaminase (ADA) locus result in a spectrum of disorders, encompassing a fulminant neonatal onset severe combined immunodeficiency (SCID) and childhood onset immunodeficiency, as well as apparently normal immune function. The extent of accumulation of the toxic metabolite, deoxyATP, correlates directly with severity of disease. The authors have now determined the mutations on both alleles of a child with fulminant, neonatal onset ADA SCID and accumulation of extremely high concentrations of deoxyATP. The genotype was consistent with the severely affected phenotype. One allele carried a large deletion that arose by non-homologous recombination and included the first five exons and promoter region. The second allele carried a missense mutation (G[sup 649]A) resulting in replacement of Glu[sup 217], an amino acid involved in the catalytic site, by Lys and predicting a major alteration in charge. Expression of the mutant cDNA on Cos cells confirmed that the mutation abolished enzyme activity. The authors have previously reported that a missense mutation at the preceding codon is similarly associated with neonatal onset ADA SCID and accumulation of extremely high deoxyATP. These findings suggest that genotype-phenotype correlations may be apparent for ADA SCID, despite the role that random variation in exposure to environmental pathogens may play in the initial phenotype. Such genotype-phenotype correlations may be important to consider in evaluating results of ongoing trials of [open quotes]gene[close quotes] and enzyme replacement therapy. 50 refs., 5 figs., 2 tabs.

  20. The effect of rare alleles on estimated genomic relationships from whole genome sequence data.

    PubMed

    Eynard, Sonia E; Windig, Jack J; Leroy, Grégoire; van Binsbergen, Rianne; Calus, Mario P L

    2015-03-12

    Relationships between individuals and inbreeding coefficients are commonly used for breeding decisions, but may be affected by the type of data used for their estimation. The proportion of variants with low Minor Allele Frequency (MAF) is larger in whole genome sequence (WGS) data compared to Single Nucleotide Polymorphism (SNP) chips. Therefore, WGS data provide true relationships between individuals and may influence breeding decisions and prioritisation for conservation of genetic diversity in livestock. This study identifies differences between relationships and inbreeding coefficients estimated using pedigree, SNP or WGS data for 118 Holstein bulls from the 1000 Bull genomes project. To determine the impact of rare alleles on the estimates we compared three scenarios of MAF restrictions: variants with a MAF higher than 5%, variants with a MAF higher than 1% and variants with a MAF between 1% and 5%. We observed significant differences between estimated relationships and, although less significantly, inbreeding coefficients from pedigree, SNP or WGS data, and between MAF restriction scenarios. Computed correlations between pedigree and genomic relationships, within groups with similar relationships, ranged from negative to moderate for both estimated relationships and inbreeding coefficients, but were high between estimates from SNP and WGS (0.49 to 0.99). Estimated relationships from genomic information exhibited higher variation than from pedigree. Inbreeding coefficients analysis showed that more complete pedigree records lead to higher correlation between inbreeding coefficients from pedigree and genomic data. Finally, estimates and correlations between additive genetic (A) and genomic (G) relationship matrices were lower, and variances of the relationships were larger when accounting for allele frequencies than without accounting for allele frequencies. Using pedigree data or genomic information, and including or excluding variants with a MAF below 5

  1. Contraction of fully expanded FMR1 alleles to the normal range: predisposing haplotype or rare events?

    PubMed

    Maia, Nuno; Loureiro, Joana R; Oliveira, Bárbara; Marques, Isabel; Santos, Rosário; Jorge, Paula; Martins, Sandra

    2017-02-01

    Fragile X syndrome (FXS), the most common cause of inherited intellectual disability, is due to the expansion over 200 CGGs and methylation of this polymorphic region, in the 5'-UTR (untranslated region) of FMR1 (Xq27.3). We have identified four FXS mosaic males: M1-(CGG)35/(CGG)>200; M2-(CGG)26/(CGG)>200; M3-(CGG)39/(CGG)>200; and M4-(CGG)18/(CGG)125/(CGG)>200. After genotyping their respective mothers, we suggested that normal alleles of these patients resulted from post-zygotic contractions of full expansions. The detection of these four rare independent cases led us to hypothesize the existence of a large-contraction predisposing haplotype in our population. Next, we questioned whether other normal pure CGGs would have arisen through similar contractions from fully expanded alleles. To address these questions, we identified stable single-nucleotide polymorphism (SNP) lineages and related short tandem repeat (STR) haplotypes (DXS998-DXS548-FRAXAC1-FRAXAC2) of the four mosaics, 123 unrelated FXS patients and 212 controls. An extended flanking haplotype (34-44-38-336) shared by mosaics from lineage A suggested a risk lineage-specific haplotype more prone to large contractions. Other normal pure FMR1 alleles from this SNP background also shared phylogenetically close STR haplotypes, although a single (CGG)exp>(CGG)24 contraction or the loss of AGG interruptions may explain their origin. In both scenarios, multistep FMR1 mutations involving the gain or loss of several CGGs seem to underlie the evolution of the repeat.

  2. Rare allele of HvLox-1 associated with lipoxygenase activity in barley (Hordeum vulgare L.).

    PubMed

    Guo, Ganggang; Dondup, Dawa; Yuan, Xingmiao; Gu, Fanghong; Wang, Deliang; Jia, Fengchao; Lin, Zhiping; Baum, Michael; Zhang, Jing

    2014-10-01

    Identification and allele-specific marker development of a functional SNP of HvLox - 1 which associated with barley lipoxygenase activity. Improving the stability of the flavor of beer is one of the main objectives in breeding barley for malting, and lipoxygenase-1 (LOX-1) is a key enzyme controlling this trait. In this study, a modified LOX activity assay was used for null LOX-1 mutant screening. Four barley landraces with no detected level of LOX-1 activity were screened from 1,083 barley germplasm accessions from China. The genomic sequence diversity of the HvLox-1 gene of the four null LOX-1 Chinese landraces was compared with that of a further 76 accessions. A total of 104 nucleotide polymorphisms were found, which contained 83 single-nucleotide polymorphisms (SNPs), 7 multiple-nucleotide polymorphisms, and 14 insertions and deletions. Most notably, we found a rare C/G mutation (SNP-61) in the second intron which led to null LOX-1 activity through an altered splicing acceptor site. In addition, an allele-specific polymerase chain reaction marker was developed for the genotyping of SNP-61, which could be used in breeding programs for barley to be used for malting. The objective was to improve beer quality.

  3. Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction.

    PubMed

    Do, Ron; Stitziel, Nathan O; Won, Hong-Hee; Jørgensen, Anders Berg; Duga, Stefano; Angelica Merlini, Pier; Kiezun, Adam; Farrall, Martin; Goel, Anuj; Zuk, Or; Guella, Illaria; Asselta, Rosanna; Lange, Leslie A; Peloso, Gina M; Auer, Paul L; Girelli, Domenico; Martinelli, Nicola; Farlow, Deborah N; DePristo, Mark A; Roberts, Robert; Stewart, Alexander F R; Saleheen, Danish; Danesh, John; Epstein, Stephen E; Sivapalaratnam, Suthesh; Hovingh, G Kees; Kastelein, John J; Samani, Nilesh J; Schunkert, Heribert; Erdmann, Jeanette; Shah, Svati H; Kraus, William E; Davies, Robert; Nikpay, Majid; Johansen, Christopher T; Wang, Jian; Hegele, Robert A; Hechter, Eliana; Marz, Winfried; Kleber, Marcus E; Huang, Jie; Johnson, Andrew D; Li, Mingyao; Burke, Greg L; Gross, Myron; Liu, Yongmei; Assimes, Themistocles L; Heiss, Gerardo; Lange, Ethan M; Folsom, Aaron R; Taylor, Herman A; Olivieri, Oliviero; Hamsten, Anders; Clarke, Robert; Reilly, Dermot F; Yin, Wu; Rivas, Manuel A; Donnelly, Peter; Rossouw, Jacques E; Psaty, Bruce M; Herrington, David M; Wilson, James G; Rich, Stephen S; Bamshad, Michael J; Tracy, Russell P; Cupples, L Adrienne; Rader, Daniel J; Reilly, Muredach P; Spertus, John A; Cresci, Sharon; Hartiala, Jaana; Tang, W H Wilson; Hazen, Stanley L; Allayee, Hooman; Reiner, Alex P; Carlson, Christopher S; Kooperberg, Charles; Jackson, Rebecca D; Boerwinkle, Eric; Lander, Eric S; Schwartz, Stephen M; Siscovick, David S; McPherson, Ruth; Tybjaerg-Hansen, Anne; Abecasis, Goncalo R; Watkins, Hugh; Nickerson, Deborah A; Ardissino, Diego; Sunyaev, Shamil R; O'Donnell, Christopher J; Altshuler, David; Gabriel, Stacey; Kathiresan, Sekar

    2015-02-05

    Myocardial infarction (MI), a leading cause of death around the world, displays a complex pattern of inheritance. When MI occurs early in life, genetic inheritance is a major component to risk. Previously, rare mutations in low-density lipoprotein (LDL) genes have been shown to contribute to MI risk in individual families, whereas common variants at more than 45 loci have been associated with MI risk in the population. Here we evaluate how rare mutations contribute to early-onset MI risk in the population. We sequenced the protein-coding regions of 9,793 genomes from patients with MI at an early age (≤50 years in males and ≤60 years in females) along with MI-free controls. We identified two genes in which rare coding-sequence mutations were more frequent in MI cases versus controls at exome-wide significance. At low-density lipoprotein receptor (LDLR), carriers of rare non-synonymous mutations were at 4.2-fold increased risk for MI; carriers of null alleles at LDLR were at even higher risk (13-fold difference). Approximately 2% of early MI cases harbour a rare, damaging mutation in LDLR; this estimate is similar to one made more than 40 years ago using an analysis of total cholesterol. Among controls, about 1 in 217 carried an LDLR coding-sequence mutation and had plasma LDL cholesterol > 190 mg dl(-1). At apolipoprotein A-V (APOA5), carriers of rare non-synonymous mutations were at 2.2-fold increased risk for MI. When compared with non-carriers, LDLR mutation carriers had higher plasma LDL cholesterol, whereas APOA5 mutation carriers had higher plasma triglycerides. Recent evidence has connected MI risk with coding-sequence mutations at two genes functionally related to APOA5, namely lipoprotein lipase and apolipoprotein C-III (refs 18, 19). Combined, these observations suggest that, as well as LDL cholesterol, disordered metabolism of triglyceride-rich lipoproteins contributes to MI risk.

  4. Identification of a novel SBF2 missense mutation associated with a rare case of thrombocytopenia using whole-exome sequencing.

    PubMed

    Abuzenadah, Adel M; Zaher, Galila F; Dallol, Ashraf; Damanhouri, Ghazi A; Chaudhary, Adeel G; Al-Sayes, Faten; Gari, Mamdooh A; AlZahrani, Mofareh; Hindawi, Salwa; Al-Qahtani, Mohammed H

    2013-11-01

    We describe in this report a case of a 6-years-old female who presented at the age of 1 month with a mucocutaneous bleeding and suspected thrombocytopenia. The patient's condition was refractory to the known idiopathic thrombocytopenic purpura treatments and congenital form of Thrombocytopenia was suspected following the delivery of a male sibling with the same phenotype. The patient also manifested fair colored hair and skin relative to her family however she did not have any detectable neurologic or other immunologic abnormalities. In order to further understand this condition, we have used whole-exome sequencing of the patient's DNA as well as her father's with the assumption that her condition is transmitted in an autosomal recessive manner. We have identified a missense change c.659C>G (p.Thr220Arg) in the SBF2 (also known as MTMR13) gene that causes a mutation in the DENN domain of the protein. This mutation was validated by traditional Sanger sequencing and analyzed in the remaining family members were it was found to segregate in the homozygous state in the affected siblings and in the heterozygous state in both parents. This novel mutation in the DENN domain of SBF2 maybe interfering with its putative association with the Rab family of small GTPases which are important mediators of vesicle transport and membrane trafficking. In conclusion, we have identified a novel mutation that is associated with severe thrombocytopenia. The fact that this mutation is found in SBF2 gene may indicate that the underlying cause of thrombocytopenia in our patient is either a new variant form of Griscelli syndrome (through the Rab GTPases action) or a variant Charcot-Marie-Tooth type 4 disease as SBF2 truncating mutations were previously identified in sufferers of this disease. This finding will help to accurately diagnose and classify similar cases of congenital thrombocytopenia and provide further proof to the power of whole-exome sequencing in personalizing patients

  5. A Rare Allele of GS2 Enhances Grain Size and Grain Yield in Rice.

    PubMed

    Hu, Jiang; Wang, Yuexing; Fang, Yunxia; Zeng, Longjun; Xu, Jie; Yu, Haiping; Shi, Zhenyuan; Pan, Jiangjie; Zhang, Dong; Kang, Shujing; Zhu, Li; Dong, Guojun; Guo, Longbiao; Zeng, Dali; Zhang, Guangheng; Xie, Lihong; Xiong, Guosheng; Li, Jiayang; Qian, Qian

    2015-10-05

    Grain size determines grain weight and affects grain quality. Several major quantitative trait loci (QTLs) regulating grain size have been cloned; however, our understanding of the underlying mechanism that regulates the size of rice grains remains fragmentary. Here, we report the cloning and characterization of a dominant QTL, grain size on chromosome 2 (GS2), which encodes Growth-Regulating Factor 4 (OsGRF4), a transcriptional regulator. GS2 localizes to the nucleus and may act as a transcription activator. A rare mutation of GS2 affecting the binding site of a microRNA, OsmiR396c, causes elevated expression of GS2/OsGRF4. The increase in GS2 expression leads to larger cells and increased numbers of cells, which thus enhances grain weight and yield. The introduction of this rare allele of GS2/OsGRF4 into rice cultivars could significantly enhance grain weight and increase grain yield, with possible applications in breeding high-yield rice varieties.

  6. Multiple rare alleles at LDLR and APOA5 confer risk for early-onset myocardial infarction

    PubMed Central

    Do, Ron; Stitziel, Nathan O.; Won, Hong-Hee; Jørgensen, Anders Berg; Duga, Stefano; Merlini, Pier Angelica; Kiezun, Adam; Farrall, Martin; Goel, Anuj; Zuk, Or; Guella, Illaria; Asselta, Rosanna; Lange, Leslie A.; Peloso, Gina M.; Auer, Paul L.; Girelli, Domenico; Martinelli, Nicola; Farlow, Deborah N.; DePristo, Mark A.; Roberts, Robert; Stewart, Alexander F.R.; Saleheen, Danish; Danesh, John; Epstein, Stephen E.; Sivapalaratnam, Suthesh; Hovingh, G. Kees; Kastelein, John J.; Samani, Nilesh J.; Schunkert, Heribert; Erdmann, Jeanette; Shah, Svati H.; Kraus, William E.; Davies, Robert; Nikpay, Majid; Johansen, Christopher T.; Wang, Jian; Hegele, Robert A.; Hechter, Eliana; Marz, Winfried; Kleber, Marcus E.; Huang, Jie; Johnson, Andrew D.; Li, Mingyao; Burke, Greg L.; Gross, Myron; Liu, Yongmei; Assimes, Themistocles L.; Heiss, Gerardo; Lange, Ethan M.; Folsom, Aaron R.; Taylor, Herman A.; Olivieri, Oliviero; Hamsten, Anders; Clarke, Robert; Reilly, Dermot F.; Yin, Wu; Rivas, Manuel A.; Donnelly, Peter; Rossouw, Jacques E.; Psaty, Bruce M.; Herrington, David M.; Wilson, James G.; Rich, Stephen S.; Bamshad, Michael J.; Tracy, Russell P.; Cupples, L. Adrienne; Rader, Daniel J.; Reilly, Muredach P.; Spertus, John A.; Cresci, Sharon; Hartiala, Jaana; Tang, W.H. Wilson; Hazen, Stanley L.; Allayee, Hooman; Reiner, Alex P.; Carlson, Christopher S.; Kooperberg, Charles; Jackson, Rebecca D.; Boerwinkle, Eric; Lander, Eric S.; Schwartz, Stephen M.; Siscovick, David S.; McPherson, Ruth; Tybjaerg-Hansen, Anne; Abecasis, Goncalo R.; Watkins, Hugh; Nickerson, Deborah A.; Ardissino, Diego; Sunyaev, Shamil R.; O’Donnell, Christopher J.; Altshuler, David; Gabriel, Stacey; Kathiresan, Sekar

    2014-01-01

    Summary Myocardial infarction (MI), a leading cause of death around the world, displays a complex pattern of inheritance1,2. When MI occurs early in life, the role of inheritance is substantially greater1. Previously, rare mutations in low-density lipoprotein (LDL) genes have been shown to contribute to MI risk in individual families3–8 whereas common variants at more than 45 loci have been associated with MI risk in the population9–15. Here, we evaluate the contribution of rare mutations to MI risk in the population. We sequenced the protein-coding regions of 9,793 genomes from patients with MI at an early age (≤50 years in males and ≤60 years in females) along with MI-free controls. We identified two genes where rare coding-sequence mutations were more frequent in cases versus controls at exome-wide significance. At low-density lipoprotein receptor (LDLR), carriers of rare, damaging mutations (3.1% of cases versus 1.3% of controls) were at 2.4-fold increased risk for MI; carriers of null alleles at LDLR were at even higher risk (13-fold difference). This sequence-based estimate of the proportion of early MI cases due to LDLR mutations is remarkably similar to an estimate made more than 40 years ago using total cholesterol16. At apolipoprotein A-V (APOA5), carriers of rare nonsynonymous mutations (1.4% of cases versus 0.6% of controls) were at 2.2-fold increased risk for MI. When compared with non-carriers, LDLR mutation carriers had higher plasma LDL cholesterol whereas APOA5 mutation carriers had higher plasma triglycerides. Recent evidence has connected MI risk with coding sequence mutations at two genes functionally related to APOA5, namely lipoprotein lipase15,17 and apolipoprotein C318,19. When combined, these observations suggest that, beyond LDL cholesterol, disordered metabolism of triglyceride-rich lipoproteins contributes to MI risk. PMID:25487149

  7. Association of rare missense variants in the second intracellular loop of NaV1.7 sodium channels with familial autism.

    PubMed

    Rubinstein, M; Patowary, A; Stanaway, I B; McCord, E; Nesbitt, R R; Archer, M; Scheuer, T; Nickerson, D; Raskind, W H; Wijsman, E M; Bernier, R; Catterall, W A; Brkanac, Z

    2016-12-13

    Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder often accompanied by intellectual disability, language impairment and medical co-morbidities. The heritability of autism is high and multiple genes have been implicated as causal. However, most of these genes have been identified in de novo cases. To further the understanding of familial autism, we performed whole-exome sequencing on five families in which second- and third-degree relatives were affected. By focusing on novel and protein-altering variants, we identified a small set of candidate genes. Among these, a novel private missense C1143F variant in the second intracellular loop of the voltage-gated sodium channel NaV1.7, encoded by the SCN9A gene, was identified in one family. Through electrophysiological analysis, we show that NaV1.7(C1143F) exhibits partial loss-of-function effects, resulting in slower recovery from inactivation and decreased excitability in cultured cortical neurons. Furthermore, for the same intracellular loop of NaV1.7, we found an excess of rare variants in a case-control variant-burden study. Functional analysis of one of these variants, M932L/V991L, also demonstrated reduced firing in cortical neurons. However, although this variant is rare in Caucasians, it is frequent in Latino population, suggesting that genetic background can alter its effects on phenotype. Although the involvement of the SCN1A and SCN2A genes encoding NaV1.1 and NaV1.2 channels in de novo ASD has previously been demonstrated, our study indicates the involvement of inherited SCN9A variants and partial loss-of-function of NaV1.7 channels in the etiology of rare familial ASD.Molecular Psychiatry advance online publication, 13 December 2016; doi:10.1038/mp.2016.222.

  8. Severe fluoropyrimidine toxicity due to novel and rare DPYD missense mutations, deletion and genomic amplification affecting DPD activity and mRNA splicing.

    PubMed

    van Kuilenburg, André B P; Meijer, Judith; Maurer, Dirk; Dobritzsch, Doreen; Meinsma, Rutger; Los, Maartje; Knegt, Lia C; Zoetekouw, Lida; Jansen, Rob L H; Dezentjé, Vincent; van Huis-Tanja, Lieke H; van Kampen, Roel J W; Hertz, Jens Michael; Hennekam, Raoul C M

    2017-03-01

    Dihydropyrimidine dehydrogenase (DPD) is the initial and rate-limiting enzyme in the catabolism of 5-fluorouracil (5FU). Genetic variations in DPD have emerged as predictive risk factors for severe fluoropyrimidine toxicity. Here, we report novel and rare genetic variants underlying DPD deficiency in 9 cancer patients presenting with severe fluoropyrimidine-associated toxicity. All patients possessed a strongly reduced DPD activity, ranging from 9 to 53% of controls. Analysis of the DPD gene (DPYD) showed the presence of 21 variable sites including 4 novel and 4 very rare aberrations: 3 missense mutations, 2 splice-site mutations, 1 intronic mutation, a deletion of 21 nucleotides and a genomic amplification of exons 9-12. Two novel/rare variants (c.2843T>C, c.321+1G>A) were present in multiple, unrelated patients. Functional analysis of recombinantly-expressed DPD mutants carrying the p.I948T and p.G284V mutation showed residual DPD activities of 30% and 0.5%, respectively. Analysis of a DPD homology model indicated that the p.I948T and p.G284V mutations may affect electron transfer and the binding of FAD, respectively. cDNA analysis showed that the c.321+1G>A mutation in DPYD leads to skipping of exon 4 immediately upstream of the mutated splice-donor site in the process of DPD pre-mRNA splicing. A lethal toxicity in two DPD patients suggests that fluoropyrimidines combined with other therapies such as radiotherapy might be particularly toxic for DPD deficient patients. Our study advocates a more comprehensive genotyping approach combined with phenotyping strategies for upfront screening for DPD deficiency to ensure the safe administration of fluoropyrimidines.

  9. Molecular identification of rare FY*Null and FY*X alleles in Caucasian thalassemic family from Sardinia.

    PubMed

    Manfroi, Silvia; Scarcello, Antonio; Pagliaro, Pasqualepaolo

    2015-10-01

    Molecular genetic studies on Duffy blood group antigens have identified mutations underlying rare FY*Null and FY*X alleles. FY*Null has a high frequency in Blacks, especially from sub-Saharan Africa, while its frequency is not defined in Caucasians. FY*X allele, associated with Fy(a-b+w) phenotype, has a frequency of 2-3.5% in Caucasian people while it is absent in Blacks. During the project of extensive blood group genotyping in patients affected by hemoglobinopathies, we identified FY*X/FY*Null and FY*A/FY*Null genotypes in a Caucasian thalassemic family from Sardinia. We speculate on the frequency of FY*X and FY*Null alleles in Caucasian and Black people; further, we focused on the association of FY*X allele with weak Fyb antigen expression on red blood cells and its identification performing high sensitivity serological typing methods or genotyping.

  10. Genome-wide assessment of worldwide chicken SNP genetic diversity indicates significant absence of rare alleles in commercial breeds.

    PubMed

    Muir, William M; Wong, Gane Ka-Shu; Zhang, Yong; Wang, Jun; Groenen, Martien A M; Crooijmans, Richard P M A; Megens, Hendrik-Jan; Zhang, Huanmin; Okimoto, Ron; Vereijken, Addie; Jungerius, Annemieke; Albers, Gerard A A; Lawley, Cindy Taylor; Delany, Mary E; MacEachern, Sean; Cheng, Hans H

    2008-11-11

    Breed utilization, genetic improvement, and industry consolidation are predicted to have major impacts on the genetic composition of commercial chickens. Consequently, the question arises as to whether sufficient genetic diversity remains within industry stocks to address future needs. With the chicken genome sequence and more than 2.8 million single-nucleotide polymorphisms (SNPs), it is now possible to address biodiversity using a previously unattainable metric: missing alleles. To achieve this assessment, 2551 informative SNPs were genotyped on 2580 individuals, including 1440 commercial birds. The proportion of alleles lacking in commercial populations was assessed by (1) estimating the global SNP allele frequency distribution from a hypothetical ancestral population as a reference, then determining the portion of the distribution lost, and then (2) determining the relationship between allele loss and the inbreeding coefficient. The results indicate that 50% or more of the genetic diversity in ancestral breeds is absent in commercial pure lines. The missing genetic diversity resulted from the limited number of incorporated breeds. As such, hypothetically combining stocks within a company could recover only preexisting within-breed variability, but not more rare ancestral alleles. We establish that SNP weights act as sentinels of biodiversity and provide an objective assessment of the strains that are most valuable for preserving genetic diversity. This is the first experimental analysis investigating the extant genetic diversity of virtually an entire agricultural commodity. The methods presented are the first to characterize biodiversity in terms of allelic diversity and to objectively link rate of allele loss with the inbreeding coefficient.

  11. Mining the LIPG allelic spectrum reveals the contribution of rare and common regulatory variants to HDL cholesterol.

    PubMed

    Khetarpal, Sumeet A; Edmondson, Andrew C; Raghavan, Avanthi; Neeli, Hemanth; Jin, Weijun; Badellino, Karen O; Demissie, Serkalem; Manning, Alisa K; DerOhannessian, Stephanie L; Wolfe, Megan L; Cupples, L Adrienne; Li, Mingyao; Kathiresan, Sekar; Rader, Daniel J

    2011-12-01

    Genome-wide association studies (GWAS) have successfully identified loci associated with quantitative traits, such as blood lipids. Deep resequencing studies are being utilized to catalogue the allelic spectrum at GWAS loci. The goal of these studies is to identify causative variants and missing heritability, including heritability due to low frequency and rare alleles with large phenotypic impact. Whereas rare variant efforts have primarily focused on nonsynonymous coding variants, we hypothesized that noncoding variants in these loci are also functionally important. Using the HDL-C gene LIPG as an example, we explored the effect of regulatory variants identified through resequencing of subjects at HDL-C extremes on gene expression, protein levels, and phenotype. Resequencing a portion of the LIPG promoter and 5' UTR in human subjects with extreme HDL-C, we identified several rare variants in individuals from both extremes. Luciferase reporter assays were used to measure the effect of these rare variants on LIPG expression. Variants conferring opposing effects on gene expression were enriched in opposite extremes of the phenotypic distribution. Minor alleles of a common regulatory haplotype and noncoding GWAS SNPs were associated with reduced plasma levels of the LIPG gene product endothelial lipase (EL), consistent with its role in HDL-C catabolism. Additionally, we found that a common nonfunctional coding variant associated with HDL-C (rs2000813) is in linkage disequilibrium with a 5' UTR variant (rs34474737) that decreases LIPG promoter activity. We attribute the gene regulatory role of rs34474737 to the observed association of the coding variant with plasma EL levels and HDL-C. Taken together, the findings show that both rare and common noncoding regulatory variants are important contributors to the allelic spectrum in complex trait loci.

  12. Systematic Functional Interrogation of Rare Cancer Variants Identifies Oncogenic Alleles | Office of Cancer Genomics

    Cancer.gov

    Cancer genome characterization efforts now provide an initial view of the somatic alterations in primary tumors. However, most point mutations occur at low frequency, and the function of these alleles remains undefined. We have developed a scalable systematic approach to interrogate the function of cancer-associated gene variants. We subjected 474 mutant alleles curated from 5,338 tumors to pooled in vivo tumor formation assays and gene expression profiling. We identified 12 transforming alleles, including two in genes (PIK3CB, POT1) that have not been shown to be tumorigenic.

  13. Genome-wide assessment of worldwide chicken SNP genetic diversity indicates significant absence of rare alleles in commercial breeds

    PubMed Central

    Muir, William M.; Wong, Gane Ka-Shu; Zhang, Yong; Wang, Jun; Groenen, Martien A. M.; Crooijmans, Richard P. M. A.; Megens, Hendrik-Jan; Zhang, Huanmin; Okimoto, Ron; Vereijken, Addie; Jungerius, Annemieke; Albers, Gerard A. A.; Lawley, Cindy Taylor; Delany, Mary E.; MacEachern, Sean; Cheng, Hans H.

    2008-01-01

    Breed utilization, genetic improvement, and industry consolidation are predicted to have major impacts on the genetic composition of commercial chickens. Consequently, the question arises as to whether sufficient genetic diversity remains within industry stocks to address future needs. With the chicken genome sequence and more than 2.8 million single-nucleotide polymorphisms (SNPs), it is now possible to address biodiversity using a previously unattainable metric: missing alleles. To achieve this assessment, 2551 informative SNPs were genotyped on 2580 individuals, including 1440 commercial birds. The proportion of alleles lacking in commercial populations was assessed by (1) estimating the global SNP allele frequency distribution from a hypothetical ancestral population as a reference, then determining the portion of the distribution lost, and then (2) determining the relationship between allele loss and the inbreeding coefficient. The results indicate that 50% or more of the genetic diversity in ancestral breeds is absent in commercial pure lines. The missing genetic diversity resulted from the limited number of incorporated breeds. As such, hypothetically combining stocks within a company could recover only preexisting within-breed variability, but not more rare ancestral alleles. We establish that SNP weights act as sentinels of biodiversity and provide an objective assessment of the strains that are most valuable for preserving genetic diversity. This is the first experimental analysis investigating the extant genetic diversity of virtually an entire agricultural commodity. The methods presented are the first to characterize biodiversity in terms of allelic diversity and to objectively link rate of allele loss with the inbreeding coefficient. PMID:18981413

  14. Rare alleles of the HRAS polymorphism do not modify the risk of breast or ovarian cancer in BRCA1 carriers

    SciTech Connect

    Phelan, C.; Tonin, P.; Lynch, H.T.

    1994-09-01

    The presence of one of the rare alleles of a minisatellite polymorphism at the HRAS locus on chromosome 11p15 has been associated with a roughly two-fold increase in the risk of breast cancer. The BRCA1 gene on chromosome 17q12-21 is responsible for the majority of the families with the breast-ovarian cancer syndrome. It is estimated that 87% of BRCA1 carriers will be affected with breast cancer by age 70. The relative risk for premenopausal breast cancer in carriers, compared to non-carriers, is roughly 100. Because of the wide range in ages of onset of cancer among BRCA1 carriers, it is likely that additional factors modify the risk of cancer. The role of other modifying genetic loci has not been studied. Through haplotype analysis we have identified 199 female BRCA1 carriers above the age of 20 years in 25 linked families. 127 of these women have been diagnosed with cancer and 72 are currently healthy. DNA was available on 59 carriers. Each sample was typed for the HRAS polymorphism by PCR, using primers flanking the minisatellite. Rare alleles were identified in 18 carriers. The penetrance of the BRCA1 gene was not higher among those women who carried a rare HRAS allele (mean age of onset 49 years) than among those who carried two common alleles (mean age of onset 43 years) (p= 0.59; log rank test). Similar results were obtained for ovarian cancer. These data do not support the hypothesis that the HRAS locus modified the risk of cancer among carriers of mutations in BRCA1.

  15. Insights Into the Pathogenicity of Rare Missense GCK Variants From the Identification and Functional Characterization of Compound Heterozygous and Double Mutations Inherited in Cis

    PubMed Central

    Beer, Nicola L.; Osbak, Kara K.; van de Bunt, Martijn; Tribble, Nicholas D.; Steele, Anna M.; Wensley, Kirsty J.; Edghill, Emma L.; Colcough, Kevin; Barrett, Amy; Valentínová, Lucia; Rundle, Jana K.; Raimondo, Anne; Grimsby, Joseph; Ellard, Sian; Gloyn, Anna L.

    2012-01-01

    OBJECTIVE To demonstrate the importance of using a combined genetic and functional approach to correctly interpret a genetic test for monogenic diabetes. RESEARCH DESIGN AND METHODS We identified three probands with a phenotype consistent with maturity-onset diabetes of the young (MODY) subtype GCK-MODY, in whom two potential pathogenic mutations were identified: [R43H/G68D], [E248 K/I225M], or [G261R/D217N]. Allele-specific PCR and cosegregation were used to determine phase. Single and double mutations were kinetically characterized. RESULTS The mutations occurred in cis (double mutants) in two probands and in trans in one proband. Functional studies of all double mutants revealed inactivating kinetics. The previously reported GCK-MODY mutations R43H and G68D were inherited from an affected father and unaffected mother, respectively. Both our functional and genetic studies support R43H as the cause of GCK-MODY and G68D as a neutral rare variant. CONCLUSIONS These data highlight the need for family/functional studies, even for previously reported pathogenic mutations. PMID:22611063

  16. Genotyping of 28 blood group alleles in blood donors from Mali: Prediction of rare phenotypes.

    PubMed

    Ba, Alhassane; Bagayoko, Seydou; Chiaroni, Jacques; Baiily, Pascal; Silvy, Monique

    2016-04-01

    We determined the frequencies of clinically relevant blood group alleles in 300 blood donors from Mali. Multiplex test based on xMAP technology was used to investigate six blood group systems (RH, KEL, MNS, FY, JK, DO, HPA) and complementary analysis were conducted for MNS and RH systems. Polymorphisms that affect the specificity of molecular tests leading to discrepant genotype results are discussed. Antigen expressions were predicted showing that 50% of donors expressed at least one traditional low prevalence antigen, and 11.6% lacked the ability to express at least one high prevalence antigen compatible with Dob-, HPA1a-, S-s-U-, Jsb-, RH:-31 and/or RH:-34 phenotypes.

  17. Evidence of low genetic variation and rare alleles in a bottlenecked endangered island endemic, the Lasan Teal (Anas laysanensis)

    USGS Publications Warehouse

    Reynolds, Michelle H.; Pearce, John M.; Lavretsky, Philip; Peters Jeffrey L,; Courtot, Karen; Seixas, Pedro P.

    2015-01-01

    Genetic diversity is assumed to reflect the evolutionary potential and adaptability of populations, and thus quantifying the genetic diversity of endangered species is useful for recovery programs. In particular, if conservation strategies include reintroductions, periodic genetic assessments are useful to evaluate whether management efforts have resulted in the maximization or loss of genetic variation within populations over generations. In this study, we collected blood, feather, and tissue samples during 1999–2009 and quantified genetic diversity for a critically endangered waterfowl species endemic to the Hawaiian archipelago, the Laysan teal or duck (Anas laysanensis; n = 239 individual birds sampled). The last extant population of this species at Laysan Island was sourced in 2004–2005 for a ‘wild to wild’ translocation of 42 individuals for an experimental reintroduction to Midway Atoll. To inform future management strategies, we compared genetic diversity sampled from the source population (n = 133 Laysan birds) including 23 of Midway’s founders and offspring of the translocated population 2–5 years post release (n = 96 Midway birds). We attempted to identify polymorphic markers by screening nuclear microsatellite (N = 83) and intronic loci (N = 19), as well as the mitochondrial control region (mtDNA) for a subset of samples. Among 83 microsatellite loci screened, six were variable. We found low nuclear variation consistent with the species’ historical population bottlenecks and sequence variation was observed at a single intron locus. We detected no variation within the mtDNA. We found limited but similar estimates of allelic richness (2.58 alleles per locus) and heterozygosity within islands. Two rare alleles found in the Laysan Island source population were not present in the Midway translocated group, and a rare allele was discovered in an individual on Midway in 2008. We found similar genetic diversity and low, but statistically

  18. Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice.

    PubMed

    Song, Xian Jun; Kuroha, Takeshi; Ayano, Madoka; Furuta, Tomoyuki; Nagai, Keisuke; Komeda, Norio; Segami, Shuhei; Miura, Kotaro; Ogawa, Daisuke; Kamura, Takumi; Suzuki, Takamasa; Higashiyama, Tetsuya; Yamasaki, Masanori; Mori, Hitoshi; Inukai, Yoshiaki; Wu, Jianzhong; Kitano, Hidemi; Sakakibara, Hitoshi; Jacobsen, Steven E; Ashikari, Motoyuki

    2015-01-06

    Grain weight is an important crop yield component; however, its underlying regulatory mechanisms are largely unknown. Here, we identify a grain-weight quantitative trait locus (QTL) encoding a new-type GNAT-like protein that harbors intrinsic histone acetyltransferase activity (OsglHAT1). Our genetic and molecular evidences pinpointed the QTL-OsglHAT1's allelic variations to a 1.2-kb region upstream of the gene body, which is consistent with its function as a positive regulator of the traits. Elevated OsglHAT1 expression enhances grain weight and yield by enlarging spikelet hulls via increasing cell number and accelerating grain filling, and increases global acetylation levels of histone H4. OsglHAT1 localizes to the nucleus, where it likely functions through the regulation of transcription. Despite its positive agronomical effects on grain weight, yield, and plant biomass, the rare allele elevating OsglHAT1 expression has so far escaped human selection. Our findings reveal the first example, to our knowledge, of a QTL for a yield component trait being due to a chromatin modifier that has the potential to improve crop high-yield breeding.

  19. Rare allele of a previously unidentified histone H4 acetyltransferase enhances grain weight, yield, and plant biomass in rice

    PubMed Central

    Song, Xian Jun; Kuroha, Takeshi; Ayano, Madoka; Furuta, Tomoyuki; Nagai, Keisuke; Komeda, Norio; Segami, Shuhei; Miura, Kotaro; Ogawa, Daisuke; Kamura, Takumi; Suzuki, Takamasa; Higashiyama, Tetsuya; Yamasaki, Masanori; Mori, Hitoshi; Inukai, Yoshiaki; Wu, Jianzhong; Kitano, Hidemi; Sakakibara, Hitoshi; Jacobsen, Steven E.; Ashikari, Motoyuki

    2015-01-01

    Grain weight is an important crop yield component; however, its underlying regulatory mechanisms are largely unknown. Here, we identify a grain-weight quantitative trait locus (QTL) encoding a new-type GNAT-like protein that harbors intrinsic histone acetyltransferase activity (OsglHAT1). Our genetic and molecular evidences pinpointed the QTL-OsglHAT1’s allelic variations to a 1.2-kb region upstream of the gene body, which is consistent with its function as a positive regulator of the traits. Elevated OsglHAT1 expression enhances grain weight and yield by enlarging spikelet hulls via increasing cell number and accelerating grain filling, and increases global acetylation levels of histone H4. OsglHAT1 localizes to the nucleus, where it likely functions through the regulation of transcription. Despite its positive agronomical effects on grain weight, yield, and plant biomass, the rare allele elevating OsglHAT1 expression has so far escaped human selection. Our findings reveal the first example, to our knowledge, of a QTL for a yield component trait being due to a chromatin modifier that has the potential to improve crop high-yield breeding. PMID:25535376

  20. Enhanced Ratio of Signals Enables Digital Mutation Scanning for Rare Allele Detection

    PubMed Central

    Castellanos-Rizaldos, Elena; Paweletz, Cloud; Song, Chen; Oxnard, Geoffrey R.; Mamon, Harvey; Jänne, Pasi A.; Makrigiorgos, G. Mike

    2016-01-01

    The use of droplet digital PCR (ddPCR) for low-level DNA mutation detection in cancer, prenatal diagnosis, and infectious diseases is growing rapidly. However, although ddPCR has been implemented successfully for detection of rare mutations at pre-determined positions, no ddPCR adaptation for mutation scanning exists. Yet, frequently, clinically relevant mutations reside on multiple sequence positions in tumor suppressor genes or complex hotspot mutations in oncogenes. Here, we describe a combination of coamplification at lower denaturation temperature PCR (COLD-PCR) with ddPCR that enables digital mutation scanning within approximately 50-bp sections of a target amplicon. Two FAM/HEX-labeled hydrolysis probes matching the wild-type sequence are used during ddPCR. The ratio of FAM/HEX-positive droplets is constant when wild-type amplicons are amplified but deviates when mutations anywhere under the FAM or HEX probes are present. To enhance the change in FAM/HEX ratio, we employed COLD-PCR cycling conditions that enrich mutation-containing amplicons anywhere on the sequence. We validated COLD-ddPCR on multiple mutations in TP53 and in EGFR using serial mutation dilutions and cell-free circulating DNA samples, and demonstrate detection down to approximately 0.2% to 1.2% mutation abundance. COLD-ddPCR enables a simple, rapid, and robust two-fluorophore detection method for the identification of multiple mutations during ddPCR and potentially can identify unknown DNA variants present in the target sequence. PMID:25772705

  1. Swedish spring wheat varieties with the rare high grain protein allele of NAM-B1 differ in leaf senescence and grain mineral content.

    PubMed

    Asplund, Linnéa; Bergkvist, Göran; Leino, Matti W; Westerbergh, Anna; Weih, Martin

    2013-01-01

    Some Swedish spring wheat varieties have recently been shown to carry a rare wildtype (wt) allele of the gene NAM-B1, known to affect leaf senescence and nutrient retranslocation to the grain. The wt allele is believed to increase grain protein concentration and has attracted interest from breeders since it could contribute to higher grain quality and more nitrogen-efficient varieties. This study investigated whether Swedish varieties with the wt allele differ from varieties with one of the more common, non-functional alleles in order to examine the effect of the gene in a wide genetic background, and possibly explain why the allele has been retained in Swedish varieties. Forty varieties of spring wheat differing in NAM-B1 allele type were cultivated under controlled conditions. Senescence was monitored and grains were harvested and analyzed for mineral nutrient concentration. Varieties with the wt allele reached anthesis earlier and completed senescence faster than varieties with the non-functional allele. The wt varieties also had more ears, lighter grains and higher yields of P and K. Contrary to previous information on effects of the wt allele, our wt varieties did not have increased grain N concentration or grain N yield. In addition, temporal studies showed that straw length has decreased but grain N yield has remained unaffected over a century of Swedish spring wheat breeding. The faster development of wt varieties supports the hypothesis of NAM-B1 being preserved in Fennoscandia, with its short growing season, because of accelerated development conferred by the NAM-B1 wt allele. Although the possible effects of other gene actions were impossible to distinguish, the genetic resource of Fennoscandian spring wheats with the wt NAM-B1 allele is interesting to investigate further for breeding purposes.

  2. A Comprehensive Study of Genic Variation in Natural Populations of Drosophila melanogaster. I. Estimates of Gene Flow from Rare Alleles

    PubMed Central

    Singh, Rama S.; Rhomberg, Lorenz R.

    1987-01-01

    In order to assess the evolutionary significance of molecular variation in natural populations of Drosophila melanogaster, we have started a comprehensive genetic variation study program employing a relatively large number of gene-protein loci and an array of populations obtained from various geographic locations throughout the world. In this first report we provide estimates of gene flow based on the spatial distributions of rare alleles at 117 gene loci in 15 worldwide populations of D. melanogaster . Estimates of Nm (number of migrants exchanged per generation among populations) range from 1.09 in East-Asian populations (Taiwan, Vietnam and Australia) to 2.66 in West-Coast populations of North America. These estimates, among geographic populations separated by hundreds or even thousands of miles, suggest that gene flow among neighboring populations of D. melanogaster is quite extensive. This means that, for selectively neutral genes, we should expect little differentiation among neighboring populations. A survey of eight West-Coast populations of D. melanogaster (geographically comparable to Drosophila pseudoobscura) showed that in spite of extensive gene flow, populations of D. melanogaster show much more geographic differentiation than comparable populations of D. pseudoobscura. From this we conclude that migration in combination with natural selection rather than migration alone is responsible for the geographic uniformity of molecular polymorphisms in D. pseudoobscura. PMID:17246368

  3. Rare mutations and potentially damaging missense variants in genes encoding fibrillar collagens and proteins involved in their production are candidates for risk for preterm premature rupture of membranes

    PubMed Central

    Teves, Maria E.; Pearson, Laurel N.; Parikh, Hardik I.; Chaemsaithong, Piya; Sheth, Nihar U.; York, Timothy P.; Romero, Roberto; Strauss, Jerome F.

    2017-01-01

    Preterm premature rupture of membranes (PPROM) is the leading identifiable cause of preterm birth with ~ 40% of preterm births being associated with PPROM and occurs in 1% - 2% of all pregnancies. We hypothesized that multiple rare variants in fetal genes involved in extracellular matrix synthesis would associate with PPROM, based on the assumption that impaired elaboration of matrix proteins would reduce fetal membrane tensile strength, predisposing to unscheduled rupture. We performed whole exome sequencing (WES) on neonatal DNA derived from pregnancies complicated by PPROM (49 cases) and healthy term deliveries (20 controls) to identify candidate mutations/variants. Genotyping for selected variants from the WES study was carried out on an additional 188 PPROM cases and 175 controls. All mothers were self-reported African Americans, and a panel of ancestry informative markers was used to control for genetic ancestry in all genetic association tests. In support of the primary hypothesis, a statistically significant genetic burden (all samples combined, SKAT-O p-value = 0.0225) of damaging/potentially damaging rare variants was identified in the genes of interest—fibrillar collagen genes, which contribute to fetal membrane strength and integrity. These findings suggest that the fetal contribution to PPROM is polygenic, and driven by an increased burden of rare variants that may also contribute to the disparities in rates of preterm birth among African Americans. PMID:28346524

  4. [Alpha-1-antitrypsin phenotypes in togolese population: description of high frequency of rare allele Pi(F) in isolated ethnic group].

    PubMed

    Tete-Benissan, A; Gbeassor, M

    2011-10-01

    The study, which is a ethnobiologic characterization, investigated α(1)-antitrypsin gene polymorphism in the togolese ethnic groups. We aimed to determine the existence of rare or deficient alleles predisposing to pulmonary or hepatic genetic diseases. We focused our study on healthy subjects of two samples by comparing 205 Adélé from relative isolated ethnic group alive in mountain region and 255 subjects from pluriethnic population living on Atlantic coastal region. Data analysis was performed by α(1)-antitrypsin level quantification and serum isoelectric focusing. The two alleles Pi(M) et Pi(F) frequencies are respectively 0.834 and 0.166 in Adélé; 0.989 and 0.011 in the subjects from pluriethnic population. Phenotypes MM and FM distribution in the two groups is significantly different (p<0.001). However, α(1)-antitrypsin polymorphism does not significantly influence proteinic and lipidic profiles of the subjects in the two samples. The Pi(F) allele of α(1) antitrypsin is rare allele in the world global populations. Its very high frequency in Adélé explained by preferential endogamic marriage in this ethnic group. Compared to the subjects from pluriethnic population, more than 30 Adélé subjects present a higher risk to develop pulmonary diseases according to isoform F properties. Copyright © 2009 Elsevier Masson SAS. All rights reserved.

  5. Missense mutation in exon 11 (Codon 378) of the presenilin-1 gene in a French family with early-onset Alzheimer's disease and transmission study by mismatch enhanced allele specific amplification. Mutations in brief no. 141. Online. besancon@rockefeller1.univ.lyon1.fr.

    PubMed

    Besançon, R; Lorenzi, A; Cruts, M; Radawiec, S; Sturtz, F; Broussolle, E; Chazot, G; van Broeckhoven, C; Chamba, G; Vandenberghe, A

    1998-01-01

    Mutations in the presenilin-1 (PS1) gene account for the majority of familial early-onset Alzheimer's disease (EOAD) cases. We screened the coding part of the PS1 gene for the present of mutations in a French family with EOAD, using single strand conformation polymorphism (SSCP) analysis. Patients in the pedigree showed a missense mutation in exon 11 of the PS1 gene involving a transition of G to A, altering glycine to glutamate at codon 378. The cosegregation of the mutation with EOAD in the family was studied by allele specific amplification, enhanced by the introduction of a mismatch at the penultimate position near the 3' primer end. The mutation has not been described before and is located within the third large cytoplasmic loop and may lead to the appearance of a short additional a-helix.

  6. Functional consequences of PRODH missense mutations.

    PubMed

    Bender, Hans-Ulrich; Almashanu, Shlomo; Steel, Gary; Hu, Chien-An; Lin, Wei-Wen; Willis, Alecia; Pulver, Ann; Valle, David

    2005-03-01

    PRODH maps to 22q11 in the region deleted in the velocardiofacial syndrome/DiGeorge syndrome (VCFS/DGS) and encodes proline oxidase (POX), a mitochondrial inner-membrane enzyme that catalyzes the first step in the proline degradation pathway. At least 16 PRODH missense mutations have been identified in studies of type I hyperprolinemia (HPI) and schizophrenia, 10 of which are present at polymorphic frequencies. The functional consequences of these missense mutations have been inferred by evolutionary conservation, but none have been tested directly. Here, we report the effects of these mutations on POX activity. We find that four alleles (R185Q, L289M, A455S, and A472T) result in mild (<30%), six (Q19P, A167V, R185W, D426N, V427M, and R431H) in moderate (30%-70%), and five (P406L, L441P, R453C, T466M, and Q521E) in severe (>70%) reduction in POX activity, whereas one (Q521R) increases POX activity. The POX encoded by one severe allele (T466M) shows in vitro responsiveness to high cofactor (flavin adenine dinucleotide) concentrations. Although there is limited information on plasma proline levels in individuals of known PRODH genotype, extant data suggest that severe hyperprolinemia (>800 microM) occurs in individuals with large deletions and/or PRODH missense mutations with the most-severe effect on function (L441P and R453C), whereas modest hyperprolinemia (300-500 microM) is associated with PRODH alleles with a moderate reduction in activity. Interestingly, three of the four alleles associated with or found in schizophrenia (V427M, L441P, and R453C) resulted in severe reduction of POX activity and hyperprolinemia. These observations plus the high degree of polymorphism at the PRODH locus are consistent with the hypothesis that reduction in POX function is a risk factor for schizophrenia.

  7. Functional Analysis of Missense Variants in the Putative Breast Cancer Susceptibility Gene XRCC2.

    PubMed

    Hilbers, Florentine S; Luijsterburg, Martijn S; Wiegant, Wouter W; Meijers, Caro M; Völker-Albert, Moritz; Boonen, Rick A; van Asperen, Christi J; Devilee, Peter; van Attikum, Haico

    2016-09-01

    XRCC2 genetic variants have been associated with breast cancer susceptibility. However, association studies have been complicated because XRCC2 variants are extremely rare and consist mainly of amino acid substitutions whose grouping is sensitive to misclassification by the predictive algorithms. We therefore functionally characterized variants in XRCC2 by testing their ability to restore XRCC2-DNA repair deficient phenotypes using a cDNA-based complementation approach. While the protein-truncating variants p.Leu117fs, p.Arg215*, and p.Cys217* were unable to restore XRCC2 deficiency, 19 out of 23 missense variants showed no or just a minor (<25%) reduction in XRCC2 function. The remaining four (p.Cys120Tyr, p.Arg91Trp, p.Leu133Pro, and p.Ile95Leu) had a moderate effect. Overall, measured functional effects correlated poorly with those predicted by in silico analysis. After regrouping variants from published case-control studies based on the functional effect found in this study and reanalysis of the prevalence data, there was no longer evidence for an association with breast cancer. This suggests that if breast cancer susceptibility alleles of XRCC2 exist, they are likely restricted to protein-truncating variants and a minority of missense changes. Our study emphasizes the use of functional analyses of missense variants to support variant classification in association studies.

  8. Searching for missing heritability: Designing rare variant association studies

    PubMed Central

    Zuk, Or; Schaffner, Stephen F.; Samocha, Kaitlin; Do, Ron; Hechter, Eliana; Kathiresan, Sekar; Daly, Mark J.; Neale, Benjamin M.; Sunyaev, Shamil R.; Lander, Eric S.

    2014-01-01

    Genetic studies have revealed thousands of loci predisposing to hundreds of human diseases and traits, revealing important biological pathways and defining novel therapeutic hypotheses. However, the genes discovered to date typically explain less than half of the apparent heritability. Because efforts have largely focused on common genetic variants, one hypothesis is that much of the missing heritability is due to rare genetic variants. Studies of common variants are typically referred to as genomewide association studies, whereas studies of rare variants are often simply called sequencing studies. Because they are actually closely related, we use the terms common variant association study (CVAS) and rare variant association study (RVAS). In this paper, we outline the similarities and differences between RVAS and CVAS and describe a conceptual framework for the design of RVAS. We apply the framework to address key questions about the sample sizes needed to detect association, the relative merits of testing disruptive alleles vs. missense alleles, frequency thresholds for filtering alleles, the value of predictors of the functional impact of missense alleles, the potential utility of isolated populations, the value of gene-set analysis, and the utility of de novo mutations. The optimal design depends critically on the selection coefficient against deleterious alleles and thus varies across genes. The analysis shows that common variant and rare variant studies require similarly large sample collections. In particular, a well-powered RVAS should involve discovery sets with at least 25,000 cases, together with a substantial replication set. PMID:24443550

  9. HLAProfiler utilizes k-mer profiles to improve HLA calling accuracy for rare and common alleles in RNA-seq data.

    PubMed

    Buchkovich, Martin L; Brown, Chad C; Robasky, Kimberly; Chai, Shengjie; Westfall, Sharon; Vincent, Benjamin G; Weimer, Eric T; Powers, Jason G

    2017-09-27

    The human leukocyte antigen (HLA) system is a genomic region involved in regulating the human immune system by encoding cell membrane major histocompatibility complex (MHC) proteins that are responsible for self-recognition. Understanding the variation in this region provides important insights into autoimmune disorders, disease susceptibility, oncological immunotherapy, regenerative medicine, transplant rejection, and toxicogenomics. Traditional approaches to HLA typing are low throughput, target only a few genes, are labor intensive and costly, or require specialized protocols. RNA sequencing promises a relatively inexpensive, high-throughput solution for HLA calling across all genes, with the bonus of complete transcriptome information and widespread availability of historical data. Existing tools have been limited in their ability to accurately and comprehensively call HLA genes from RNA-seq data. We created HLAProfiler ( https://github.com/ExpressionAnalysis/HLAProfiler ), a k-mer profile-based method for HLA calling in RNA-seq data which can identify rare and common HLA alleles with > 99% accuracy at two-field precision in both biological and simulated data. For 68% of novel alleles not present in the reference database, HLAProfiler can correctly identify the two-field precision or exact coding sequence, a significant advance over existing algorithms. HLAProfiler allows for accurate HLA calls in RNA-seq data, reliably expanding the utility of these data in HLA-related research and enabling advances across a broad range of disciplines. Additionally, by using the observed data to identify potential novel alleles and update partial alleles, HLAProfiler will facilitate further improvements to the existing database of reference HLA alleles. HLAProfiler is available at https://expressionanalysis.github.io/HLAProfiler/ .

  10. Missense Mutations in the MEFV Gene Are Associated with Fibromyalgia Syndrome and Correlate with Elevated IL-1β Plasma Levels

    PubMed Central

    Li, Wenyan; Shen, Xiaoming; Song, Wenjia; Yang, Chunmei; Chang, Frances; Longmate, Jeffrey; Marek, Claudia; St. Amand, R. Paul; Krontiris, Theodore G.; Shively, John E.; Sommer, Steve S.

    2009-01-01

    Background Fibromyalgia syndrome (FMS), a common, chronic, widespread musculoskeletal pain disorder found in 2% of the general population and with a preponderance of 85% in females, has both genetic and environmental contributions. Patients and their parents have high plasma levels of the chemokines MCP-1 and eotaxin, providing evidence for both a genetic and an immunological/inflammatory origin for the syndrome (Zhang et al., 2008, Exp. Biol. Med. 233: 1171–1180). Methods and Findings In a search for a candidate gene affecting inflammatory pathways, among five screened in our patient samples (100 probands with FMS and their parents), we found 10 rare and one common alleles for MEFV, a gene in which various compound heterozygous mutations lead to Familial Mediterranean Fever (FMF). A total of 2.63 megabases of genomic sequence of the MEFV gene were scanned by direct sequencing. The collection of rare missense mutations (all heterozygotes and tested in the aggregate) had a significant elevated frequency of transmission to affecteds (p = 0.0085, one-sided, exact binomial test). Our data provide evidence that rare missense variants of the MEFV gene are, collectively, associated with risk of FMS and are present in a subset of 15% of FMS patients. This subset had, on average, high levels of plasma IL-1β (p = 0.019) compared to FMS patients without rare variants, unaffected family members with or without rare variants, and unrelated controls of unknown genotype. IL-1β is a cytokine associated with the function of the MEFV gene and thought to be responsible for its symptoms of fever and muscle aches. Conclusions Since misregulation of IL-1β expression has been predicted for patients with mutations in the MEFV gene, we conclude that patients heterozygous for rare missense variants of this gene may be predisposed to FMS, possibly triggered by environmental factors. PMID:20041150

  11. A study of the average effect of the 3'APOB-VNTR polymorphism on lipidemic parameters could explain why the short alleles (<35 repeats) are rare in centenarians

    PubMed Central

    Garasto, Sabrina; Berardelli, Maurizio; DeRango, Francesco; Mari, Vincenzo; Feraco, Emidio; De Benedictis, Giovanna

    2004-01-01

    Background In studies on the genetics of human aging, we observed an age-related variation of the 3'APOB-VNTR genotypic pool (alleles: Short, S, <35 repeats; Medium, M, 35–39 repeats; Long, L, >39 repeats) with the homozygous SS genotype showing a convex frequency trajectory in a healthy aging population. This genotype was rare in centenarians, thus indicating that the S alleles are unfavorable to longevity, while common in adults, thus indicating a protective role at middle age. This apparent paradox could be due to possible effects exerted by the above polymorphism on lipidemic parameters. Aim of the work was to get insights into these puzzling findings Methods We followed a double strategy. Firstly, we analyzed the average effects of S (αS), M (αM), and L (αL) alleles on lipidemic parameters in a sample of healthy people (409 subjects aged 20–102 years) recruited in Calabria (southern Italy). The (αS), (αM), and (αL) values were estimated by relating 3'APOB-VNTR genotypes to lipidemic parameters, after adjustment for age, sex and body mass index (multiple regression). Then, we analyzed the S alleles as susceptibility factors of Cardiovascular Atherosclerotic Disease (CD) in CD patients characterized either by low serum HDL-Cholesterol or by high serum LDL-Cholesterol (CD-H and CD-L patients, 40 and 40 subjects respectively). The Odds Ratios (OR) were computed for carriers of S alleles in CD-H and CD-L patients matched for origin, sex and age with controls extracted from the sample of healthy subjects. Results By the analysis of the healthy sample group we found that the S alleles lower the average values of serum Total Cholesterol (αS = -5.98 mg/dL with [-11.62 ÷ -0.74] 95% confidence interval) and LDL-Cholesterol (αS = -4.41 mg/dL with [-8.93 ÷ -0.20] 95% confidence interval) while the alleles M and L have no significant effect on the lipidemic phenotype. In line with these findings, the analysis of CD patients showed that the S alleles are

  12. Analyzing effects of naturally occurring missense mutations.

    PubMed

    Zhang, Zhe; Miteva, Maria A; Wang, Lin; Alexov, Emil

    2012-01-01

    Single-point mutation in genome, for example, single-nucleotide polymorphism (SNP) or rare genetic mutation, is the change of a single nucleotide for another in the genome sequence. Some of them will produce an amino acid substitution in the corresponding protein sequence (missense mutations); others will not. This paper focuses on genetic mutations resulting in a change in the amino acid sequence of the corresponding protein and how to assess their effects on protein wild-type characteristics. The existing methods and approaches for predicting the effects of mutation on protein stability, structure, and dynamics are outlined and discussed with respect to their underlying principles. Available resources, either as stand-alone applications or webservers, are pointed out as well. It is emphasized that understanding the molecular mechanisms behind these effects due to these missense mutations is of critical importance for detecting disease-causing mutations. The paper provides several examples of the application of 3D structure-based methods to model the effects of protein stability and protein-protein interactions caused by missense mutations as well.

  13. Two locus inheritance of non-syndromic midline craniosynostosis via rare SMAD6 and common BMP2 alleles

    PubMed Central

    Timberlake, Andrew T; Choi, Jungmin; Zaidi, Samir; Lu, Qiongshi; Nelson-Williams, Carol; Brooks, Eric D; Bilguvar, Kaya; Tikhonova, Irina; Mane, Shrikant; Yang, Jenny F; Sawh-Martinez, Rajendra; Persing, Sarah; Zellner, Elizabeth G; Loring, Erin; Chuang, Carolyn; Galm, Amy; Hashim, Peter W; Steinbacher, Derek M; DiLuna, Michael L; Duncan, Charles C; Pelphrey, Kevin A; Zhao, Hongyu; Persing, John A; Lifton, Richard P

    2016-01-01

    Premature fusion of the cranial sutures (craniosynostosis), affecting 1 in 2000 newborns, is treated surgically in infancy to prevent adverse neurologic outcomes. To identify mutations contributing to common non-syndromic midline (sagittal and metopic) craniosynostosis, we performed exome sequencing of 132 parent-offspring trios and 59 additional probands. Thirteen probands (7%) had damaging de novo or rare transmitted mutations in SMAD6, an inhibitor of BMP – induced osteoblast differentiation (p<10−20). SMAD6 mutations nonetheless showed striking incomplete penetrance (<60%). Genotypes of a common variant near BMP2 that is strongly associated with midline craniosynostosis explained nearly all the phenotypic variation in these kindreds, with highly significant evidence of genetic interaction between these loci via both association and analysis of linkage. This epistatic interaction of rare and common variants defines the most frequent cause of midline craniosynostosis and has implications for the genetic basis of other diseases. DOI: http://dx.doi.org/10.7554/eLife.20125.001 PMID:27606499

  14. Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension.

    PubMed

    Surendran, Praveen; Drenos, Fotios; Young, Robin; Warren, Helen; Cook, James P; Manning, Alisa K; Grarup, Niels; Sim, Xueling; Barnes, Daniel R; Witkowska, Kate; Staley, James R; Tragante, Vinicius; Tukiainen, Taru; Yaghootkar, Hanieh; Masca, Nicholas; Freitag, Daniel F; Ferreira, Teresa; Giannakopoulou, Olga; Tinker, Andrew; Harakalova, Magdalena; Mihailov, Evelin; Liu, Chunyu; Kraja, Aldi T; Nielsen, Sune Fallgaard; Rasheed, Asif; Samuel, Maria; Zhao, Wei; Bonnycastle, Lori L; Jackson, Anne U; Narisu, Narisu; Swift, Amy J; Southam, Lorraine; Marten, Jonathan; Huyghe, Jeroen R; Stančáková, Alena; Fava, Cristiano; Ohlsson, Therese; Matchan, Angela; Stirrups, Kathleen E; Bork-Jensen, Jette; Gjesing, Anette P; Kontto, Jukka; Perola, Markus; Shaw-Hawkins, Susan; Havulinna, Aki S; Zhang, He; Donnelly, Louise A; Groves, Christopher J; Rayner, N William; Neville, Matt J; Robertson, Neil R; Yiorkas, Andrianos M; Herzig, Karl-Heinz; Kajantie, Eero; Zhang, Weihua; Willems, Sara M; Lannfelt, Lars; Malerba, Giovanni; Soranzo, Nicole; Trabetti, Elisabetta; Verweij, Niek; Evangelou, Evangelos; Moayyeri, Alireza; Vergnaud, Anne-Claire; Nelson, Christopher P; Poveda, Alaitz; Varga, Tibor V; Caslake, Muriel; de Craen, Anton J M; Trompet, Stella; Luan, Jian'an; Scott, Robert A; Harris, Sarah E; Liewald, David C M; Marioni, Riccardo; Menni, Cristina; Farmaki, Aliki-Eleni; Hallmans, Göran; Renström, Frida; Huffman, Jennifer E; Hassinen, Maija; Burgess, Stephen; Vasan, Ramachandran S; Felix, Janine F; Uria-Nickelsen, Maria; Malarstig, Anders; Reilly, Dermot F; Hoek, Maarten; Vogt, Thomas F; Lin, Honghuang; Lieb, Wolfgang; Traylor, Matthew; Markus, Hugh S; Highland, Heather M; Justice, Anne E; Marouli, Eirini; Lindström, Jaana; Uusitupa, Matti; Komulainen, Pirjo; Lakka, Timo A; Rauramaa, Rainer; Polasek, Ozren; Rudan, Igor; Rolandsson, Olov; Franks, Paul W; Dedoussis, George; Spector, Timothy D; Jousilahti, Pekka; Männistö, Satu; Deary, Ian J; Starr, John M; Langenberg, Claudia; Wareham, Nick J; Brown, Morris J; Dominiczak, Anna F; Connell, John M; Jukema, J Wouter; Sattar, Naveed; Ford, Ian; Packard, Chris J; Esko, Tõnu; Mägi, Reedik; Metspalu, Andres; de Boer, Rudolf A; van der Meer, Peter; van der Harst, Pim; Gambaro, Giovanni; Ingelsson, Erik; Lind, Lars; de Bakker, Paul I W; Numans, Mattijs E; Brandslund, Ivan; Christensen, Cramer; Petersen, Eva R B; Korpi-Hyövälti, Eeva; Oksa, Heikki; Chambers, John C; Kooner, Jaspal S; Blakemore, Alexandra I F; Franks, Steve; Jarvelin, Marjo-Riitta; Husemoen, Lise L; Linneberg, Allan; Skaaby, Tea; Thuesen, Betina; Karpe, Fredrik; Tuomilehto, Jaakko; Doney, Alex S F; Morris, Andrew D; Palmer, Colin N A; Holmen, Oddgeir Lingaas; Hveem, Kristian; Willer, Cristen J; Tuomi, Tiinamaija; Groop, Leif; Käräjämäki, AnneMari; Palotie, Aarno; Ripatti, Samuli; Salomaa, Veikko; Alam, Dewan S; Majumder, Abdulla Al Shafi; Di Angelantonio, Emanuele; Chowdhury, Rajiv; McCarthy, Mark I; Poulter, Neil; Stanton, Alice V; Sever, Peter; Amouyel, Philippe; Arveiler, Dominique; Blankenberg, Stefan; Ferrières, Jean; Kee, Frank; Kuulasmaa, Kari; Müller-Nurasyid, Martina; Veronesi, Giovanni; Virtamo, Jarmo; Deloukas, Panos; Elliott, Paul; Zeggini, Eleftheria; Kathiresan, Sekar; Melander, Olle; Kuusisto, Johanna; Laakso, Markku; Padmanabhan, Sandosh; Porteous, David J; Hayward, Caroline; Scotland, Generation; Collins, Francis S; Mohlke, Karen L; Hansen, Torben; Pedersen, Oluf; Boehnke, Michael; Stringham, Heather M; Frossard, Philippe; Newton-Cheh, Christopher; Tobin, Martin D; Nordestgaard, Børge Grønne; Caulfield, Mark J; Mahajan, Anubha; Morris, Andrew P; Tomaszewski, Maciej; Samani, Nilesh J; Saleheen, Danish; Asselbergs, Folkert W; Lindgren, Cecilia M; Danesh, John; Wain, Louise V; Butterworth, Adam S; Howson, Joanna M M; Munroe, Patricia B

    2016-10-01

    High blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low-frequency and common genetic variants in up to 192,763 individuals and used ∼155,063 samples for independent replication. We identified 30 new blood pressure- or hypertension-associated genetic regions in the general population, including 3 rare missense variants in RBM47, COL21A1 and RRAS with larger effects (>1.5 mm Hg/allele) than common variants. Multiple rare nonsense and missense variant associations were found in A2ML1, and a low-frequency nonsense variant in ENPEP was identified. Our data extend the spectrum of allelic variation underlying blood pressure traits and hypertension, provide new insights into the pathophysiology of hypertension and indicate new targets for clinical intervention.

  15. Trans-ancestry meta-analyses identify rare and common variants associated with blood pressure and hypertension

    PubMed Central

    Barnes, Daniel R; Witkowska, Kate; Staley, James R; Tragante, Vinicius; Tukiainen, Taru; Yaghootkar, Hanieh; Masca, Nicholas; Freitag, Daniel F; Ferreira, Teresa; Giannakopoulou, Olga; Tinker, Andrew; Harakalova, Magdalena; Mihailov, Evelin; Liu, Chunyu; Kraja, Aldi T; Fallgaard Nielsen, Sune; Rasheed, Asif; Samuel, Maria; Zhao, Wei; Bonnycastle, Lori L; Jackson, Anne U; Narisu, Narisu; Swift, Amy J; Southam, Lorraine; Marten, Jonathan; Huyghe, Jeroen R; Stančáková, Alena; Fava, Cristiano; Ohlsson, Therese; Matchan, Angela; Stirrups, Kathleen E; Bork-Jensen, Jette; Gjesing, Anette P; Kontto, Jukka; Perola, Markus; Shaw-Hawkins, Susan; Havulinna, Aki S; Zhang, He; Donnelly, Louise A; Groves, Christopher J; Rayner, N William; Neville, Matt J; Robertson, Neil R; Yiorkas, Andrianos M; Herzig, Karl-Heinz; Kajantie, Eero; Zhang, Weihua; Willems, Sara M; Lannfelt, Lars; Malerba, Giovanni; Soranzo, Nicole; Trabetti, Elisabetta; Verweij, Niek; Evangelou, Evangelos; Moayyeri, Alireza; Vergnaud, Anne-Claire; Nelson, Christopher P; Poveda, Alaitz; Varga, Tibor V; Caslake, Muriel; de Craen, Anton JM; Trompet, Stella; Luan, Jian’an; Scott, Robert A; Harris, Sarah E; Liewald, David CM; Marioni, Riccardo; Menni, Cristina; Farmaki, Aliki-Eleni; Hallmans, Göran; Renström, Frida; Huffman, Jennifer E; Hassinen, Maija; Burgess, Stephen; Vasan, Ramachandran S; Felix, Janine F; Uria-Nickelsen, Maria; Malarstig, Anders; Reily, Dermot F; Hoek, Maarten; Vogt, Thomas; Lin, Honghuang; Lieb, Wolfgang; Traylor, Matthew; Markus, Hugh F; Highland, Heather M; Justice, Anne E; Marouli, Eirini; Lindström, Jaana; Uusitupa, Matti; Komulainen, Pirjo; Lakka, Timo A; Rauramaa, Rainer; Polasek, Ozren; Rudan, Igor; Rolandsson, Olov; Franks, Paul W; Dedoussis, George; Spector, Timothy D; Jousilahti, Pekka; Männistö, Satu; Deary, Ian J; Starr, John M; Langenberg, Claudia; Wareham, Nick J; Brown, Morris J; Dominiczak, Anna F; Connell, John M; Jukema, J Wouter; Sattar, Naveed; Ford, Ian; Packard, Chris J; Esko, Tõnu; Mägi, Reedik; Metspalu, Andres; de Boer, Rudolf A; van der Meer, Peter; van der Harst, Pim; Gambaro, Giovanni; Ingelsson, Erik; Lind, Lars; de Bakker, Paul IW; Numans, Mattijs E; Brandslund, Ivan; Christensen, Cramer; Petersen, Eva RB; Korpi-Hyövälti, Eeva; Oksa, Heikki; Chambers, John C; Kooner, Jaspal S; Blakemore, Alexandra IF; Franks, Steve; Jarvelin, Marjo-Riitta; Husemoen, Lise L; Linneberg, Allan; Skaaby, Tea; Thuesen, Betina; Karpe, Fredrik; Tuomilehto, Jaakko; Doney, Alex SF; Morris, Andrew D; Palmer, Colin NA; Holmen, Oddgeir Lingaas; Hveem, Kristian; Willer, Cristen J; Tuomi, Tiinamaija; Groop, Leif; Käräjämäki, AnneMari; Palotie, Aarno; Ripatti, Samuli; Salomaa, Veikko; Alam, Dewan S; Shafi Majumder, Abdulla al; Di Angelantonio, Emanuele; Chowdhury, Rajiv; McCarthy, Mark I; Poulter, Neil; Stanton, Alice V; Sever, Peter; Amouyel, Philippe; Arveiler, Dominique; Blankenberg, Stefan; Ferrières, Jean; Kee, Frank; Kuulasmaa, Kari; Müller-Nurasyid, Martina; Veronesi, Giovanni; Virtamo, Jarmo; Deloukas, Panos; Elliott, Paul; Zeggini, Eleftheria; Kathiresan, Sekar; Melander, Olle; Kuusisto, Johanna; Laakso, Markku; Padmanabhan, Sandosh; Porteous, David; Hayward, Caroline; Scotland, Generation; Collins, Francis S; Mohlke, Karen L; Hansen, Torben; Pedersen, Oluf; Boehnke, Michael; Stringham, Heather M; Frossard, Philippe; Newton-Cheh, Christopher; Tobin, Martin D; Nordestgaard, Børge Grønne; Caulfield, Mark J; Mahajan, Anubha; Morris, Andrew P; Tomaszewski, Maciej; Samani, Nilesh J

    2016-01-01

    High blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low-frequency and common genetic variants in up to ~192,000 individuals, and used ~155,063 samples for independent replication. We identified 31 novel blood pressure or hypertension associated genetic regions in the general population, including three rare missense variants in RBM47, COL21A1 and RRAS with larger effects (>1.5mmHg/allele) than common variants. Multiple rare, nonsense and missense variant associations were found in A2ML1 and a low-frequency nonsense variant in ENPEP was identified. Our data extend the spectrum of allelic variation underlying blood pressure traits and hypertension, provide new insights into the pathophysiology of hypertension and indicate new targets for clinical intervention. PMID:27618447

  16. Fine-Mapping the HOXB Region Detects Common Variants Tagging a Rare Coding Allele: Evidence for Synthetic Association in Prostate Cancer

    PubMed Central

    Saunders, Edward J.; Dadaev, Tokhir; Leongamornlert, Daniel A.; Jugurnauth-Little, Sarah; Tymrakiewicz, Malgorzata; Wiklund, Fredrik; Al Olama, Ali Amin; Benlloch, Sara; Xu, Jianfeng; Mikropoulos, Christos; Goh, Chee; Govindasami, Koveela; Guy, Michelle; Wilkinson, Rosemary A.; Sawyer, Emma J.; Morgan, Angela; Easton, Douglas F.; Muir, Ken; Eeles, Rosalind A.; Kote-Jarai, Zsofia

    2014-01-01

    The HOXB13 gene has been implicated in prostate cancer (PrCa) susceptibility. We performed a high resolution fine-mapping analysis to comprehensively evaluate the association between common genetic variation across the HOXB genetic locus at 17q21 and PrCa risk. This involved genotyping 700 SNPs using a custom Illumina iSelect array (iCOGS) followed by imputation of 3195 SNPs in 20,440 PrCa cases and 21,469 controls in The PRACTICAL consortium. We identified a cluster of highly correlated common variants situated within or closely upstream of HOXB13 that were significantly associated with PrCa risk, described by rs117576373 (OR 1.30, P = 2.62×10−14). Additional genotyping, conditional regression and haplotype analyses indicated that the newly identified common variants tag a rare, partially correlated coding variant in the HOXB13 gene (G84E, rs138213197), which has been identified recently as a moderate penetrance PrCa susceptibility allele. The potential for GWAS associations detected through common SNPs to be driven by rare causal variants with higher relative risks has long been proposed; however, to our knowledge this is the first experimental evidence for this phenomenon of synthetic association contributing to cancer susceptibility. PMID:24550738

  17. Familial granulomatosis with polyangiitis: three cases of this rare disorder in one Indoasian family carrying an identical HLA DPB1 allele

    PubMed Central

    Tanna, Anisha; Salama, Alan D; Brookes, Paul; Pusey, Charles D

    2012-01-01

    The aetiology of granulomatosis with polyangiitis (GPA) remains unclear. There is likely a complex interplay between environmental triggers and genetic predisposition. Early diagnosis and treatment improve outcome in this condition with an untreated reported mortality of 90%. There are a few cases of familial GPA in the literature, but we report here the interesting and rare scenario of three members of the same Indoasian family with GPA who share an identical human leucocyte antigen (HLA) haplotype. In particular, all three members of the family share the HLADPB1 allele *04 : 01. This is the first reported Indoasian family with GPA. The HLA antigens found on genotyping our family and, in particular, HLADPB1 has been linked with GPA in previous studies. Genome-wide association studies in Anti Neutrophil Cytoplasm Antibody (ANCA) associated vasculitis (AAV) are currently in progress and should improve understanding of the genetic aspects of this disease. There may be important implications for patients with GPA and for their relatives. PMID:23144337

  18. Molecular genetic analysis of the Jk(a-b-) phenotype in Chinese: A novel silent recessive JK allele.

    PubMed

    Zhang, Ai; Chi, Quan; Lin, Hongkeng; She, Yimin

    2016-04-01

    The Jk(a-b-) phenotype, referred to as Jknull, is rare in most populations. This blood type is characterized by the absence of Kidd glycoprotein on the surface of red blood cells (RBCs) and moderately reduced ability to concentrate urine. The molecular basis for Jknull phenotype includes splice-site mutations, missense mutations, and a partial gene deletion in the JK(SLC14A1) gene that encodes the human urea transporter protein. In this study, we have analyzed 10 Chinese Jknull samples to determine their molecular bases. In addition to the well known Polynesian Jknull allele, three Jknull alleles were detected including one novel Jknull allele: JKA (130A, 220G).

  19. Proteasomal Inhibition Restores Biological Function of Mis-sense Mutated Dysferlin in Patient-derived Muscle Cells*

    PubMed Central

    Azakir, Bilal A.; Di Fulvio, Sabrina; Kinter, Jochen; Sinnreich, Michael

    2012-01-01

    Dysferlin is a transmembrane protein implicated in surface membrane repair of muscle cells. Mutations in dysferlin cause the progressive muscular dystrophies Miyoshi myopathy, limb girdle muscular dystrophy 2B, and distal anterior compartment myopathy. Dysferlinopathies are inherited in an autosomal recessive manner, and many patients with this disease harbor mis-sense mutations in at least one of their two pathogenic DYSF alleles. These patients have significantly reduced or absent dysferlin levels in skeletal muscle, suggesting that dysferlin encoded by mis-sense alleles is rapidly degraded by the cellular quality control system. We reasoned that mis-sense mutated dysferlin, if salvaged from degradation, might be biologically functional. We used a dysferlin-deficient human myoblast culture harboring the common R555W mis-sense allele and a DYSF-null allele, as well as control human myoblast cultures harboring either two wild-type or two null alleles. We measured dysferlin protein and mRNA levels, resealing kinetics of laser-induced plasmalemmal wounds, myotube formation, and cellular viability after treatment of the human myoblast cultures with the proteasome inhibitors lactacystin or bortezomib (Velcade). We show that endogenous R555W mis-sense mutated dysferlin is degraded by the proteasomal system. Inhibition of the proteasome by lactacystin or Velcade increases the levels of R555W mis-sense mutated dysferlin. This salvaged protein is functional as it restores plasma membrane resealing in patient-derived myoblasts and reverses their deficit in myotube formation. Bortezomib and lactacystin did not cause cellular toxicity at the regimen used. Our results raise the possibility that inhibition of the degradation pathway of mis-sense mutated dysferlin could be used as a therapeutic strategy for patients harboring certain dysferlin mis-sense mutations. PMID:22318734

  20. Proteasomal inhibition restores biological function of mis-sense mutated dysferlin in patient-derived muscle cells.

    PubMed

    Azakir, Bilal A; Di Fulvio, Sabrina; Kinter, Jochen; Sinnreich, Michael

    2012-03-23

    Dysferlin is a transmembrane protein implicated in surface membrane repair of muscle cells. Mutations in dysferlin cause the progressive muscular dystrophies Miyoshi myopathy, limb girdle muscular dystrophy 2B, and distal anterior compartment myopathy. Dysferlinopathies are inherited in an autosomal recessive manner, and many patients with this disease harbor mis-sense mutations in at least one of their two pathogenic DYSF alleles. These patients have significantly reduced or absent dysferlin levels in skeletal muscle, suggesting that dysferlin encoded by mis-sense alleles is rapidly degraded by the cellular quality control system. We reasoned that mis-sense mutated dysferlin, if salvaged from degradation, might be biologically functional. We used a dysferlin-deficient human myoblast culture harboring the common R555W mis-sense allele and a DYSF-null allele, as well as control human myoblast cultures harboring either two wild-type or two null alleles. We measured dysferlin protein and mRNA levels, resealing kinetics of laser-induced plasmalemmal wounds, myotube formation, and cellular viability after treatment of the human myoblast cultures with the proteasome inhibitors lactacystin or bortezomib (Velcade). We show that endogenous R555W mis-sense mutated dysferlin is degraded by the proteasomal system. Inhibition of the proteasome by lactacystin or Velcade increases the levels of R555W mis-sense mutated dysferlin. This salvaged protein is functional as it restores plasma membrane resealing in patient-derived myoblasts and reverses their deficit in myotube formation. Bortezomib and lactacystin did not cause cellular toxicity at the regimen used. Our results raise the possibility that inhibition of the degradation pathway of mis-sense mutated dysferlin could be used as a therapeutic strategy for patients harboring certain dysferlin mis-sense mutations.

  1. A-TWinnipeg: Pathogenesis of rare ATM missense mutation c.6200C>A with decreased protein expression and downstream signaling, early-onset dystonia, cancer, and life-threatening radiotoxicity.

    PubMed

    Nakamura, Kotoka; Fike, Francesca; Haghayegh, Sara; Saunders-Pullman, Rachel; Dawson, Angelika J; Dörk, Thilo; Gatti, Richard A

    2014-07-01

    We studied 10 Mennonite patients who carry the c.6200C>A missense mutation (p.A2067D) in the ATM gene, all of whom exhibited a phenotypic variant of ataxia-telangiectasia (A-T) that is characterized by early-onset dystonia and late-onset mild ataxia, as previously described. This report provides the pathogenetic evidence for this mutation on cellular functions. Several patients have developed cancer and subsequently experienced life-threatening adverse reactions to radiation (radiotoxicity) and/or chemotherapy. As the c.6200C>A mutation is, thus far, unique to the Mennonite population and is always associated with the same haplotype or haplovariant, it was important to rule out any possible confounding DNA variant on the same haplotype. Lymphoblastoid cells derived from Mennonite patients expressed small amounts of ATM protein, which had no autophosphorylation activity at ATM Ser1981, and trace-to-absent transphosphorylation of downstream ATM targets. A-T lymphoblastoid cells stably transfected with ATM cDNA which had been mutated for c.6200C>A did not show a detectable amount of ATM protein. The same stable cell line with mutated ATM cDNA also showed a trace-to-absent transphosphorylation of downstream ATM targets SMC1pSer966 and KAP1pSer824. From these results, we conclude that c.6200A is the disease-causing ATM mutation on this haplotype. The presence of at least trace amounts of ATM kinase activity on some immunoblots may account for the late-onset, mild ataxia of these patients. The cause of the dystonia remains unclear. Because this dystonia-ataxia phenotype is often encountered in the Mennonite population in association with cancer and adverse reactions to chemotherapy, an early diagnosis is important.

  2. A-TWinnipeg: Pathogenesis of rare ATM missense mutation c.6200C>A with decreased protein expression and downstream signaling, early-onset dystonia, cancer, and life-threatening radiotoxicity

    PubMed Central

    Nakamura, Kotoka; Fike, Francesca; Haghayegh, Sara; Saunders-Pullman, Rachel; Dawson, Angelika J; Dörk, Thilo; Gatti, Richard A

    2014-01-01

    We studied 10 Mennonite patients who carry the c.6200C>A missense mutation (p.A2067D) in the ATM gene, all of whom exhibited a phenotypic variant of ataxia-telangiectasia (A-T) that is characterized by early-onset dystonia and late-onset mild ataxia, as previously described. This report provides the pathogenetic evidence for this mutation on cellular functions. Several patients have developed cancer and subsequently experienced life-threatening adverse reactions to radiation (radiotoxicity) and/or chemotherapy. As the c.6200C>A mutation is, thus far, unique to the Mennonite population and is always associated with the same haplotype or haplovariant, it was important to rule out any possible confounding DNA variant on the same haplotype. Lymphoblastoid cells derived from Mennonite patients expressed small amounts of ATM protein, which had no autophosphorylation activity at ATM Ser1981, and trace-to-absent transphosphorylation of downstream ATM targets. A-T lymphoblastoid cells stably transfected with ATM cDNA which had been mutated for c.6200C>A did not show a detectable amount of ATM protein. The same stable cell line with mutated ATM cDNA also showed a trace-to-absent transphosphorylation of downstream ATM targets SMC1pSer966 and KAP1pSer824. From these results, we conclude that c.6200A is the disease-causing ATM mutation on this haplotype. The presence of at least trace amounts of ATM kinase activity on some immunoblots may account for the late-onset, mild ataxia of these patients. The cause of the dystonia remains unclear. Because this dystonia-ataxia phenotype is often encountered in the Mennonite population in association with cancer and adverse reactions to chemotherapy, an early diagnosis is important. PMID:25077176

  3. Natural Isolates of Salmonella enterica Serovar Dublin Carry a Single nadA Missense Mutation

    PubMed Central

    Bergthorsson, Ulfar; Roth, John R.

    2005-01-01

    Nicotinic acid is required by most isolates of Salmonella enterica (serovar Dublin), a pathogen of cattle. A single nadA missense mutation causes the nutritional requirement of all serovar Dublin isolates tested. Models for persistence of this allele are tested and discussed. PMID:15601727

  4. Natural isolates of Salmonella enterica serovar Dublin carry a single nadA missense mutation.

    PubMed

    Bergthorsson, Ulfar; Roth, John R

    2005-01-01

    Nicotinic acid is required by most isolates of Salmonella enterica (serovar Dublin), a pathogen of cattle. A single nadA missense mutation causes the nutritional requirement of all serovar Dublin isolates tested. Models for persistence of this allele are tested and discussed.

  5. A yeast model reveals biochemical severity associated with each of three variant alleles of galactose-1P uridylyltransferase segregating in a single family.

    PubMed

    Chhay, J S; Openo, K K; Eaton, J S; Gentile, M; Fridovich-Keil, J L

    2008-02-01

    Classic galactosaemia is a potentially lethal inborn error of metabolism that results from profound impairment of galactose-1P uridylyltransferase (GALT). Like many autosomal recessive disorders, classic galactosaemia demonstrates marked allelic heterogeneity; many if not most patients are compound heterozygotes. Owing in part to the fact that most GALT mutations are never observed in patients in the homozygous state, in part to concerns of possible allelic interaction, and in part to the broad range of GALT activity levels associated with the affected, carrier, and control states, definition of the specific functional consequence of individual variant GALT alleles from studies of clinical samples alone can be a challenging task. To overcome this problem we previously developed and applied a null-background yeast system to enable functional analyses of human GALT alleles expressed individually or in defined pairs. We report here the application of this system to characterize three distinct variant alleles of GALT identified within a single family. Of these alleles, one carried a missense mutation (K285N) that has previously been reported and characterized, one carried a nonsense mutation (R204X) that has previously been reported but not characterized, and the third carried a missense substitution (T268N) that was novel. Our studies reported here reconfirm the profound nature of the K285N mutation, demonstrate that the R204X mutation severely compromises both expression and function of human GALT, and finally implicate T268N as one of a very small number of naturally occurring rare but neutral missense polymorphisms in human GALT.

  6. A common missense variant in BRCA2 predisposes to early onset breast cancer.

    PubMed

    Górski, Bohdan; Narod, Steven A; Lubinski, Jan

    2005-01-01

    Mutations in the BRCA2 gene are one of the two major causes of hereditary breast cancer. Protein-truncating mutations of BRCA2 are usually deleterious and increase the risk of breast cancer up to 80% over a lifetime. A few missense mutations in BRCA2 are believed to have a similarly high penetrance, apart from more common neutral polymorphisms. It is often difficult to classify a particular sequence variant as a mutation or a polymorphism. For a deleterious variant, one would expect a greater allele frequency in breast cancer cases than in ethnic-matched controls. In contrast, neutral polymorphic variants should be equally frequent in the two groups. We genotyped 3,241 cases of breast cancer diagnosed at under 51 years of age, unselected for family history, from 18 hospitals throughout Poland and 2,791 ethnic-matched controls for a single BRCA2 C5972T variant. The variant was present in approximately 6% of the Polish population. In the study, 13 women (11 cases and two controls (OR = 4.7; p = 0.02)) were homozygous for the variant allele. The overall odds ratio for breast cancer in women with a single copy of the BRCA2 C5972T variant was 1.1 (p = 0.7); however, the effect was significant for patients diagnosed at or before age 40 (OR = 1.4; p = 0.04). We reviewed the association between the BRCA2 variant in different histologic subgroups and found the effect most pronounced in women who had ductal carcinoma in situ (DCIS) with micro-invasion (OR = 2.8; p < 0.0001). The BRCA2 C5972T allele is a common variant in Poland that increases the risk of DCIS with micro-invasion. The homozygous state is rare but increases the risk of breast cancer five-fold.

  7. Distinguishing cancer-associated missense mutations from common polymorphisms.

    PubMed

    Kaminker, Joshua S; Zhang, Yan; Waugh, Allison; Haverty, Peter M; Peters, Brock; Sebisanovic, Dragan; Stinson, Jeremy; Forrest, William F; Bazan, J Fernando; Seshagiri, Somasekar; Zhang, Zemin

    2007-01-15

    Missense variants are commonly identified in genomic sequence but only a small fraction directly contribute to oncogenesis. The ability to distinguish those missense changes that contribute to cancer progression from those that do not is a difficult problem usually only accomplished through functional in vivo analyses. Using two computational algorithms, Sorting Intolerant from Tolerant (SIFT) and the Pfam-based LogR.E-value method, we have identified features that distinguish cancer-associated missense mutations from other classes of missense change. Our data reveal that cancer mutants behave similarly to Mendelian disease mutations, but are clearly distinct from either complex disease mutations or common single-nucleotide polymorphisms. We show that both activating and inactivating oncogenic mutations are predicted to be deleterious, although activating changes are likely to increase protein activity. Using the Gene Ontology and data from the SIFT and LogR.E-value metrics, a classifier was built that predicts cancer-associated missense mutations with a very low false-positive rate. The classifier does remarkably well in a number of different experiments designed to distinguish polymorphisms from true cancer-associated mutations. We also show that recurrently observed mutations are much more likely to be predicted to be cancer-associated than rare mutations, suggesting that our classifier will be useful in distinguishing causal from passenger mutations. In addition, from an expressed sequence tag-based screen, we identified a previously unknown germ line change (P1104A) in tumor tissues that is predicted to disrupt the function of the TYK2 protein. The data presented here show that this novel bioinformatics approach to classifying cancer-associated variants is robust and can be used for large-scale analyses.

  8. Expression of a novel missense mutation found in the A4GALT gene of Amish individuals with the p phenotype.

    PubMed

    Hellberg, Asa; Schmidt-Melbye, Anne-Christine; Reid, Marion E; Olsson, Martin L

    2008-03-01

    The rare p phenotype is found at a higher frequency in Amish people than in other populations. Different mutations in the 4-alpha-galactosyltransferase gene (A4GALT), responsible for synthesis of P(k) (Gb(3)) antigen, have been found to cause the P(k)-deficient p phenotype. The aim of this study was to explore the molecular background of the p phenotype in people of Amish origin. Twenty blood samples with the p phenotype, 19 of them from Amish individuals and 1 Pakistani, were investigated. Amplification of genomic DNA by polymerase chain reaction (PCR) and sequencing by capillary electrophoresis were performed. Blood donors of different geographic origin were screened with PCR-allele-specific primer to investigate whether the novel mutation occurs among individuals with common phenotypes. The mutation was also cloned into an expression vector and transfected to Namalwa cells, which do not normally express P(k). P(k) expression on the transfected cells and P/P(k) on red blood cells (RBCs), both with p and with common phenotypes, were analyzed by flow cytometry. All 20 samples were homozygous for 299C>T changing serine to leucine in a region that is highly conserved in homologous genes across species borders. The mutation was not found in any of the 500 alleles of blood donors investigated. P(k) expression was neither observed by serology and flow cytometry on p RBCs from Amish individuals nor following transfection of cells with constructs containing the novel missense mutation. A novel A4GALT missense mutation causes the p phenotype in Amish individuals.

  9. Multiple rare variants as a cause of a common phenotype: several different lactase persistence associated alleles in a single ethnic group.

    PubMed

    Ingram, Catherine J E; Raga, Tamiru Oljira; Tarekegn, Ayele; Browning, Sarah L; Elamin, Mohamed F; Bekele, Endashaw; Thomas, Mark G; Weale, Michael E; Bradman, Neil; Swallow, Dallas M

    2009-12-01

    Persistence of intestinal lactase into adulthood allows humans to use milk from other mammals as a source of food and water. This genetic trait has arisen by convergent evolution and the derived alleles of at least three different single nucleotide polymorphisms (-13910C>T, -13915T>G, -14010G>C) are associated with lactase persistence in different populations. Each allele occurs on an extended haplotype, consistent with positive directional selection. The SNPs are located in an 'enhancer' sequence in an intron of a neighboring gene (MCM6) and modulate lactase transcription in vitro. However, a number of lactase persistent individuals carry none of these alleles, but other low-frequency single nucleotide polymorphisms have been observed in the same region. Here we examine a cohort of 107 milk-drinking Somali camel-herders from Ethiopia. Eight polymorphic sites are identified in the enhancer. -13915*G and -13907*G (a previously reported candidate) are each significantly associated with lactase persistence. A new allele, -14009*G, has borderline association with lactase persistence, but loses significance after correction for multiple testing. Sequence diversity of the enhancer is significantly higher in the lactase persistent members of this and a second cohort compared with non-persistent members of the two groups (P = 7.7 x 10(-9) and 1.0 x 10(-3)). By comparing other loci, we show that this difference is not due to population sub-structure, demonstrating that increased diversity can accompany selection. This contrasts with the well-documented observation that positive selection decreases diversity by driving up the frequency of a single advantageous allele, and has implications for association studies.

  10. Two affected siblings with nuclear cataract associated with a novel missense mutation in the CRYGD gene.

    PubMed

    Messina-Baas, Olga Maud; Gonzalez-Huerta, Luz Maria; Cuevas-Covarrubias, Sergio Alberto

    2006-08-24

    To identify the disease locus for nuclear congenital cataract in a nonconsanguineous family with two affected members. One family with two affected members with congenital cataract and 170 normal controls were examined. DNA from leukocytes and bucal swabs was isolated to analyze the CRYGA-D cluster genes and microsatellite markers D2S325, D2S2382, and D2S126, and to discard paternity through gene scan with several highly polymorphic markers. DNA sequencing analysis of the CRYGA-D cluster genes of the two affected members showed a novel heterozygous missense mutation c.320A > C within exon 3 of the CRYGD gene. This transversion mutation resulted in the substitution of glutamic acid 107 by an alanine (E107A). Analysis of the two unaffected members of the family and the normal parents showed a normal sequence of the CRYGA-D cluster genes. This mutation was not found in a group of 170 unrelated controls. We consider that it is unlikely that this abnormal allele represents a rare polymorphism. DNA analysis showed no evidence for non-paternity while genotyping indicated that the haplotype of the mother co-segregated with the disease. In this study we describe the mutation c.320A > C (E107A) in the CRYGD gene associated with nuclear congenital cataract. Haplotype analysis strongly suggests that the origin of the mutation was transmitted through the mother.

  11. Phenotypic Characterization of a Comprehensive Set of MAPK1/ERK2 Missense Mutants.

    PubMed

    Brenan, Lisa; Andreev, Aleksandr; Cohen, Ofir; Pantel, Sasha; Kamburov, Atanas; Cacchiarelli, Davide; Persky, Nicole S; Zhu, Cong; Bagul, Mukta; Goetz, Eva M; Burgin, Alex B; Garraway, Levi A; Getz, Gad; Mikkelsen, Tarjei S; Piccioni, Federica; Root, David E; Johannessen, Cory M

    2016-10-18

    Tumor-specific genomic information has the potential to guide therapeutic strategies and revolutionize patient treatment. Currently, this approach is limited by an abundance of disease-associated mutants whose biological functions and impacts on therapeutic response are uncharacterized. To begin to address this limitation, we functionally characterized nearly all (99.84%) missense mutants of MAPK1/ERK2, an essential effector of oncogenic RAS and RAF. Using this approach, we discovered rare gain- and loss-of-function ERK2 mutants found in human tumors, revealing that, in the context of this assay, mutational frequency alone cannot identify all functionally impactful mutants. Gain-of-function ERK2 mutants induced variable responses to RAF-, MEK-, and ERK-directed therapies, providing a reference for future treatment decisions. Tumor-associated mutations spatially clustered in two ERK2 effector-recruitment domains yet produced mutants with opposite phenotypes. This approach articulates an allele-characterization framework that can be scaled to meet the goals of genome-guided oncology.

  12. Rare alleles within the CYP2E1 (MEOS system) could be associated with better short-term health outcome after acute methanol poisoning.

    PubMed

    Hubacek, Jaroslav A; Pelclova, Daniela; Seidl, Zdenek; Vaneckova, Manuela; Klempir, Jiri; Ruzicka, Evzen; Ridzon, Petr; Urban, Pavel; Fenclova, Zdenka; Petrik, Vit; Diblik, Pavel; Kuthan, Pavel; Miovsky, Michal; Janikova, Barbara; Adamkova, Vera; Zakharov, Sergey

    2015-02-01

    Genetic polymorphisms influence the metabolism of ethanol and methanol, but the potential effects of genetic predisposition on the clinical course, outcome and short-term health sequelae of acute methanol poisoning are unknown. To evaluate the role of the MEOS system in methanol poisoning, we analysed the effect of three polymorphisms (RsaI - rs2031920; PstI - rs3813867; insertion/deletion I/D) within the CYP2E1 enzyme (MEOS system) in 50 adult survivors of methanol poisoning and compared their genotype frequencies with 460 controls. The minor allele frequencies of all three polymorphisms were below 5% in both groups. We did not detect significant differences in the genotype frequencies between survivors of methanol poisoning and controls (p = 0.34 for the RsaI variant; p = 0.59 for the PstI variant and p = 0.21 for the I/D polymorphism). The carriers of at least one minor allele in the CYP2E1 gene had less severe clinical symptoms and better short-term outcome after acute poisoning. Variants within the CYP2E1 gene are likely not significant genetic determinants of acute methanol poisoning (if survivors are analysed), but they may influence the severity of methanol poisoning and its visual/central nervous system (CNS) outcome.

  13. Orphan Missense Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator

    PubMed Central

    Fresquet, Fleur; Clement, Romain; Norez, Caroline; Sterlin, Adélaïde; Melin, Patricia; Becq, Frédéric; Kitzis, Alain; Thoreau, Vincent; Bilan, Frédéric

    2011-01-01

    More than 1860 mutations have been found within the human cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence. These mutations can be classified according to their degree of severity in CF disease. Although the most common mutations are well characterized, few data are available for rare mutations. Thus, genetic counseling is particularly difficult when fetuses or patients with CF present these orphan variations. We describe a three-step in vitro assay that can evaluate rare missense CFTR mutation consequences to establish a correlation between genotype and phenotype. By using a green fluorescent protein–tagged CFTR construct, we expressed mutated proteins in COS-7 cells. CFTR trafficking was visualized by confocal microscopy, and the cellular localization of CFTR was determined using intracellular markers. We studied the CFTR maturation process using Western blot analysis and evaluated CFTR channel activity by automated iodide efflux assays. Of six rare mutations that we studied, five have been isolated in our laboratory. The cellular and functional impact that we observed in each case was compared with the clinical data concerning the patients in whom we encountered these mutations. In conclusion, we propose that performing this type of analysis for orphan CFTR missense mutations can improve CF genetic counseling. PMID:21708286

  14. Identification of CHRNA5 rare variants in African-American heavy smokers

    PubMed Central

    Doyle, Glenn A.; Chou, Andrew D.; Saung, Wint Thu; Lai, Alison T.; Lohoff, Falk W.; Berrettini, Wade H.

    2014-01-01

    The common CHRNA5 mis-sense coding single nucleotide polymorphism (SNP) rs16969968:G>A (D398N) has been shown repeatedly to confer risk for heavy smoking in individuals who carry the ‘A’ allele (encoding the 398N amino acid). The mis-sense SNP has a minor allele frequency (MAF) of ~40% in European-Americans, but only ~7% in African-Americans (http://www.ncbi.nlm.nih.gov/projects/SNP/). We reasoned that there might be other mis-sense variants among African-Americans that could confer the heavy smoking phenotype (defined here as ≥20 cigarettes per day), perhaps in a similar manner to that of the D398N polymorphism in Europeans. As such, we re-sequenced 250 African-American heavy smokers, most of whom were homozygous ‘G’ at rs16969968:G>A (MAF of 9.6% within the population). Although many novel coding SNPs were not observed, we report an interesting, although rare (perhaps personal) variant in CHRNA5 that could result in nonsense-mediated decay of the aberrant transcript. PMID:24682045

  15. Underexpression and abnormal localization of ATM products in ataxia telangiectasia patients bearing ATM missense mutations

    PubMed Central

    Jacquemin, Virginie; Rieunier, Guillaume; Jacob, Sandrine; Bellanger, Dorine; d'Enghien, Catherine Dubois; Laugé, Anthony; Stoppa-Lyonnet, Dominique; Stern, Marc-Henri

    2012-01-01

    Ataxia telangiectasia (A-T) is a rare autosomal recessive disorder characterized by progressive cerebellar ataxia, oculocutaneous telangiectasia, immune defects and predisposition to malignancies. A-T is caused by biallelic inactivation of the ATM gene, in most cases by frameshift or nonsense mutations. More rarely, ATM missense mutations with unknown consequences on ATM function are found, making definitive diagnosis more challenging. In this study, a series of 15 missense mutations, including 11 not previously reported, were identified in 16 patients with clinical diagnosis of A-T belonging to 14 families and 1 patient with atypical clinical features. ATM function was evaluated in patient lymphoblastoid cell lines by measuring H2AX and KAP1 phosphorylation in response to ionizing radiation, confirming the A-T diagnosis for 16 cases. In accordance with previous studies, we showed that missense mutations associated with A-T often lead to ATM protein underexpression (15 out of 16 cases). In addition, we demonstrated that most missense mutations lead to an abnormal cytoplasmic localization of ATM, correlated with its decreased expression. This new finding highlights ATM mislocalization as a new mechanism of ATM dysfunction, which may lead to therapeutic strategies for missense mutation associated A-T. PMID:22071889

  16. Underexpression and abnormal localization of ATM products in ataxia telangiectasia patients bearing ATM missense mutations.

    PubMed

    Jacquemin, Virginie; Rieunier, Guillaume; Jacob, Sandrine; Bellanger, Dorine; d'Enghien, Catherine Dubois; Laugé, Anthony; Stoppa-Lyonnet, Dominique; Stern, Marc-Henri

    2012-03-01

    Ataxia telangiectasia (A-T) is a rare autosomal recessive disorder characterized by progressive cerebellar ataxia, oculocutaneous telangiectasia, immune defects and predisposition to malignancies. A-T is caused by biallelic inactivation of the ATM gene, in most cases by frameshift or nonsense mutations. More rarely, ATM missense mutations with unknown consequences on ATM function are found, making definitive diagnosis more challenging. In this study, a series of 15 missense mutations, including 11 not previously reported, were identified in 16 patients with clinical diagnosis of A-T belonging to 14 families and 1 patient with atypical clinical features. ATM function was evaluated in patient lymphoblastoid cell lines by measuring H2AX and KAP1 phosphorylation in response to ionizing radiation, confirming the A-T diagnosis for 16 cases. In accordance with previous studies, we showed that missense mutations associated with A-T often lead to ATM protein underexpression (15 out of 16 cases). In addition, we demonstrated that most missense mutations lead to an abnormal cytoplasmic localization of ATM, correlated with its decreased expression. This new finding highlights ATM mislocalization as a new mechanism of ATM dysfunction, which may lead to therapeutic strategies for missense mutation associated A-T.

  17. Feline congenital erythropoietic porphyria: two homozygous UROS missense mutations cause the enzyme deficiency and porphyrin accumulation.

    PubMed

    Clavero, Sonia; Bishop, David F; Giger, Urs; Haskins, Mark E; Desnick, Robert J

    2010-01-01

    The first feline model of human congenital erythropoietic porphyria (CEP) due to deficient uroporphyrinogen III synthase (URO-synthase) activity was identified by its characteristic clinical phenotype, and confirmed by biochemical and molecular genetic studies. The proband, an adult domestic shorthair cat, had dark-red urine and brownish discolored teeth with red fluorescence under ultraviolet light. Biochemical studies demonstrated markedly increased uroporphyrinogen I in urine and plasma (2,650- and 10,700-fold greater than wild type, respectively), whereas urinary 5-aminolevulinic acid and porphobilinogen were lower than normal. Erythrocytic URO-synthase activity was <1% of mean wild-type activity, confirming the diagnosis and distinguishing it from feline phenocopies having acute intermittent porphyria. Sequencing of the affected cat's UROS gene revealed two missense mutations, c.140C>T (p.S47F) in exon 3 and c.331G>A (p.G111S) in exon 6, both of which were homozygous, presumably owing to parental consanguinity. Neither was present in 100 normal cat alleles. Prokaryotic expression and thermostability studies of the purified monomeric wild-type, p.S47F, p.G111S, and p.S47F/G111S enzymes showed that the p.S47F enzyme had 100% of wild-type specific activity but ~50% decreased thermostability, whereas the p.G111S and p.S47F/G111S enzymes had about 60% and 20% of wild-type specific activity, respectively, and both were markedly thermolabile. Molecular modeling results indicated that the less active/less stable p.G111S enzyme was further functionally impaired by a structural interaction induced by the presence of the S47F substitution. Thus, the synergistic interaction of two rare amino acid substitutions in the URO-synthase polypeptide caused the feline model of human CEP.

  18. Novel missense mutation of the UGT1A1 gene in Thai siblings with Gilbert's syndrome.

    PubMed

    Sutomo, Retno; Laosombat, Vichai; Sadewa, Ahmad Hamim; Yokoyama, Naoki; Nakamura, Hajime; Matsuo, Masafumi; Nishio, Hisahide

    2002-08-01

    Gilbert's syndrome is a common inherited disorder of bilirubin metabolism contributing to the development of neonatal jaundice and causing recurrent jaundice after the neonatal period. In the patients with Gilbert's syndrome, mutations have been reported in the promoter and exons of the uridine diphosphate-glucuronosyl transferase 1 (UGT1A1) gene on chromsome 2q37, which encodes bilirubin uridine diphosphate-glucuronosyltransferase. However, the genetic basis of Gilbert's syndrome, including its inheritance trait, remains to be clarified. Patients 1 and 2 were Thai sisters with Gilbert's syndrome. They had a history of prolonged neonatal jaundice and showed recurrent jaundice after their infancy, while the parents showed no symptoms. To search for the mutation in the patients, all exons of the UGT1A1 gene were amplified by polymerase chain reaction (PCR) and sequenced directly. The frequency of the mutation in controls was studied by PCR-restriction enzyme digestion method. The patients were homozygous for a novel single transition of T to C at nucleotide position 247 (exon 1), which would predict a substitution of leucine for phenylalanine at codon 83 of the enzyme protein. No other mutation was detected in any regions except exon 1. The parents with no symptoms showed heterozygosity for the mutation. Among the 110 Japanese controls, no homozygous individuals and three heterozygous individuals for the mutation were identified, giving a mutated allele frequency of 0.0136. A novel missense mutation in the UGT1A1 gene was identified in two Thai siblings with Gilbert's syndrome. The affected family showed that homozygosity for the mutation may lead to apparent symptoms and that the syndrome was inherited as an autosomal recessive trait. The mutation does not explain a high incidence of neonatal jaundice in Japan, because it is very rare in the Japanese population.

  19. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    PubMed

    Soderlund, Carol A; Nelson, William M; Goff, Stephen A

    2014-01-01

    Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor), where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense), and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available from https://code.google.com/p/allele

  20. Genetic characterization of Greek population isolates reveals strong genetic drift at missense and trait-associated variants

    PubMed Central

    Panoutsopoulou, Kalliope; Hatzikotoulas, Konstantinos; Xifara, Dionysia Kiara; Colonna, Vincenza; Farmaki, Aliki-Eleni; Ritchie, Graham R. S.; Southam, Lorraine; Gilly, Arthur; Tachmazidou, Ioanna; Fatumo, Segun; Matchan, Angela; Rayner, Nigel W.; Ntalla, Ioanna; Mezzavilla, Massimo; Chen, Yuan; Kiagiadaki, Chrysoula; Zengini, Eleni; Mamakou, Vasiliki; Athanasiadis, Antonis; Giannakopoulou, Margarita; Kariakli, Vassiliki-Eirini; Nsubuga, Rebecca N.; Karabarinde, Alex; Sandhu, Manjinder; McVean, Gil; Tyler-Smith, Chris; Tsafantakis, Emmanouil; Karaleftheri, Maria; Xue, Yali; Dedoussis, George; Zeggini, Eleftheria

    2014-01-01

    Isolated populations are emerging as a powerful study design in the search for low-frequency and rare variant associations with complex phenotypes. Here we genotype 2,296 samples from two isolated Greek populations, the Pomak villages (HELIC-Pomak) in the North of Greece and the Mylopotamos villages (HELIC-MANOLIS) in Crete. We compare their genomic characteristics to the general Greek population and establish them as genetic isolates. In the MANOLIS cohort, we observe an enrichment of missense variants among the variants that have drifted up in frequency by more than fivefold. In the Pomak cohort, we find novel associations at variants on chr11p15.4 showing large allele frequency increases (from 0.2% in the general Greek population to 4.6% in the isolate) with haematological traits, for example, with mean corpuscular volume (rs7116019, P=2.3 × 10−26). We replicate this association in a second set of Pomak samples (combined P=2.0 × 10−36). We demonstrate significant power gains in detecting medical trait associations. PMID:25373335

  1. Identification of Two Missense Mutations of ERCC6 in Three Chinese Sisters with Cockayne Syndrome by Whole Exome Sequencing

    PubMed Central

    Ye, Lili; Fei, Lingna; Tang, Wei; Tian, Yujiao; Geng, Qian

    2014-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive disorder, the primary manifestations of which are poor growth and neurologic abnormality. Mutations of the ERCC6 and ERCC8 genes are the predominant cause of Cockayne syndrome, and the ERCC6 gene mutation is present in approximately 65% of cases. The present report describes a case of Cockayne syndrome in a Chinese family, with the patients carrying two missense mutations (c.1595A>G, p.Asp532Gly and c.1607T>G, p.Leu536Trp) in the ERCC6 gene in an apparently compound heterozygote status, especially, p.Asp532Gly has never been reported. The compound heterozygote mutation was found in three patients in the family using whole exome sequencing. The patients’ father and mother carried a heterozygous allele at different locations of the ERCC6 gene, which was confirmed by Sanger DNA sequencing. The two mutations are both located in the highly conserved motif I of ATP-binding helicase and are considered “Damaging,” “Probably Damaging,” “Disease Causing,” and “Conserved”, indicating the role of DNA damage in the pathogenetic process of the disease. The results not only enrich the ERCC6 mutations database, but also indicate that whole exome sequencing will be a powerful tool for discovering the disease causing mutations in clinical diagnosis. PMID:25463447

  2. Hypofibrinogenaemia caused by a novel FGG missense mutation (W253C) in the γ chain globular domain impairing fibrinogen secretion

    PubMed Central

    Vu, D; de Moerloose, P; Batorova, A; Lazur, J; Palumbo, L; Neerman-Arbez, M

    2005-01-01

    Background: Inherited disorders of fibrinogen are rare and affect either the quantity (hypofibrinogenaemia and afibrinogenaemia) or the quality of the circulating fibrinogen (dysfibrinogenaemia). Extensive allelic heterogeneity has been found for all three disorders: in congenital afibrinogenaemia >30 mutations, the majority in FGA, have been identified in homozygosity or in compound heterozygosity. Several mutations have also been identified in patients with hypofibrinogenaemia; many of these are heterozygous carriers of afibrinogenaemia null mutations. Objective: To report the case of a patient from Slovakia diagnosed with hypofibrinogenaemia characterised by fibrinogen concentrations of around 0.7 g/l. Results: The patient was found to be heterozygous for a novel missense mutation W253C (W227C in the mature protein) in the C-terminal globular domain of the fibrinogen γ chain. Co-expression of the W253C FGG mutant cDNA (fibrinogen Bratislava) in combination with wild-type FGA and FGB cDNAs showed that fibrinogen molecules containing the mutant γ chain can assemble intracellularly but are not secreted into the media, confirming the causative nature of the identified mutation. Conclusions: Current analysis of fibrinogen Bratislava indicates that the domains important for the processes of hexamer assembly and hexamer secretion should not be considered as strictly restricted to one or other fibrinogen chain. PMID:16141000

  3. Hypomorphic NOTCH3 alleles do not cause CADASIL in humans.

    PubMed

    Rutten, Julie W; Boon, Elles M J; Liem, Michael K; Dauwerse, Johannes G; Pont, Margot J; Vollebregt, Ellen; Maat-Kievit, Anneke J; Ginjaar, Hendrika B; Lakeman, Phillis; van Duinen, Sjoerd G; Terwindt, Gisela M; Lesnik Oberstein, Saskia A J

    2013-11-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is caused by stereotyped missense mutations in NOTCH3. Whether these mutations lead to the CADASIL phenotype via a neomorphic effect, or rather by a hypomorphic effect, is subject of debate. Here, we report two novel NOTCH3 mutations, both leading to a premature stop codon with predicted loss of NOTCH3 function. The first mutation, c.307C>T, p.Arg103*, was detected in two brothers aged 50 and 55 years, with a brain MRI and skin biopsy incompatible with CADASIL. The other mutation was found in a 40-year-old CADASIL patient compound heterozygous for a pathogenic NOTCH3 mutation (c.2129A>G, p.Tyr710Cys) and an intragenic frameshift deletion. The deletion was inherited from his father, who did not have the skin biopsy abnormalities seen in CADASIL patients. These individuals with rare NOTCH3 mutations indicate that hypomorphic NOTCH3 alleles do not cause CADASIL.

  4. Two novel CYP21A2 missense mutations in Italian patients with 21-hydroxylase deficiency: Identification and functional characterisation.

    PubMed

    Concolino, Paola; Vendittelli, Francesca; Mello, Enrica; Carelli Alinovi, Cristiana; Minucci, Angelo; Carrozza, Cinzia; Santini, Stefano Angelo; Zuppi, Cecilia; Capoluongo, Ettore

    2009-03-01

    Steroid 21-hydroxylase deficiency is present in more than 90% of patients with congenital adrenal hyperplasia (CAH), an inherited metabolic disorder of adrenal steroidogenesis. Impaired enzymatic activity leads to the accumulation of metabolic intermediates (progesterone and 17-hydroxyprogesterone), which results in excessive androgen production and varied signs of virilisation. CYP21A2 is an active gene and encodes for the steroid 21-hydroxylase enzyme, whereas CYP21A1P is an inactive pseudogene that contains a series of deleterious mutations. The major part of disease- causing mutations in CYP21A2 alleles are CYP21A1P-derived sequence transferred to the active gene by macro or microconversion events. Only around 5% of all disease-causing CYP21A2 alleles harbour rare mutations that do not originate from the pseudogene. In this report, we report the characterisation of two novel CYP21A2 missense mutations (p.H119R and p.I194N) found in two unrelated Italian patients with nonclassic (NC) CAH clinical diagnosis. Functional in vitro assays for mutagenized CYP21 enzymes were performed in transiently transfected mammalian cells to test the residual enzyme activity and the apparent kinetic values. The residual activities obtained for p.H119R and p.I194N mutants allowed to classify them as NC-CAH associated mutations. These results correlate with the rate of severity of the patients' disease. Finally, the new p.H119R and p.I194N mutations should be included in the panel of those already listed for association with the NC form of 21-hydroxylase deficiency. (c) 2009 IUBMB IUBMB Life 61(3): 229-235, 2009.

  5. Pooled Association Tests for Rare Variants in Exon-Resequencing Studies

    PubMed Central

    Price, Alkes L.; Kryukov, Gregory V.; de Bakker, Paul I.W.; Purcell, Shaun M.; Staples, Jeff; Wei, Lee-Jen; Sunyaev, Shamil R.

    2010-01-01

    Deep sequencing will soon generate comprehensive sequence information in large disease samples. Although the power to detect association with an individual rare variant is limited, pooling variants by gene or pathway into a composite test provides an alternative strategy for identifying susceptibility genes. We describe a statistical method for detecting association of multiple rare variants in protein-coding genes with a quantitative or dichotomous trait. The approach is based on the regression of phenotypic values on individuals' genotype scores subject to a variable allele-frequency threshold, incorporating computational predictions of the functional effects of missense variants. Statistical significance is assessed by permutation testing with variable thresholds. We used a rigorous population-genetics simulation framework to evaluate the power of the method, and we applied the method to empirical sequencing data from three disease studies. PMID:20471002

  6. Alternative splicing of exon 17 and a missense mutation in exon 20 of the insulin receptor gene in two brothers with a novel syndrome of insulin resistance (congenital fiber-type disproportion myopathy).

    PubMed

    Vorwerk, P; Christoffersen, C T; Müller, J; Vestergaard, H; Pedersen, O; De Meyts, P

    1999-01-01

    The insulin receptor (IR) in two brothers with a rare syndrome of congenital muscle fiber type disproportion myopathy (CFTDM) associated with diabetes and severe insulin resistance was studied. By direct sequencing of Epstein-Barr virus-transformed lymphocytes both patients were found to be compound heterozygotes for mutations in the IR gene. The maternal allele was alternatively spliced in exon 17 due to a point mutation in the -1 donor splice site of the exon. The abnormal skipping of exon 17 shifts the amino acid reading frame and leads to a truncated IR, missing the entire tyrosine kinase domain. In the correct spliced variant, the point mutation is silent and results in a normally translated IR. The paternal allele carries a missense mutation in the tyrosine kinase domain. All three cDNA variants were present in the lymphocytes of the patients. Purified IR from 293 cells overexpressing either of the two mutated receptors lacked basal or stimulated IR beta-subunit autophosphorylation. A third brother who inherited both normal alleles has an normal muscle phenotype and insulin sensitivity, suggesting a direct linkage of these IR mutations with the CFTDM phenotype.

  7. Functional study in a yeast model of a novel succinate dehydrogenase subunit B gene germline missense mutation (C191Y) diagnosed in a patient affected by a glomus tumor.

    PubMed

    Goffrini, Paola; Ercolino, Tonino; Panizza, Elena; Giachè, Valentino; Cavone, Leonardo; Chiarugi, Alberto; Dima, Veronica; Ferrero, Iliana; Mannelli, Massimo

    2009-05-15

    Mutations of succinate dehydrogenase (SDH) subunits B, C and D are associated to pheochromocytoma/paraganglioma (PGL) development. The mechanisms linking SDH mutations to tumorigenesis are currently unknown. We report a novel germline missense SDHB mutation (C191Y) in a patient affected by a glomus tumor. The missense mutation hits an amino acid residue conserved from mammals to the yeast Saccharomyces cerevisiae. The pathogenic significance of the human mutation was validated in a yeast model. SDH2(C184Y) mutant allele equivalent to human SDHB(C191Y) did not restore the OXPHOS phenotype of the Deltasdh2 null mutant. In the mutant, SDH activity was also abolished along with a reduction in respiration. Sensitivity to oxidative stress was increased in the mutant, as revealed by reduced growth in the presence of menadione. Remarkably, the frequency of petite colony formation was increased in the mutant yeast strain, indicating an increased mtDNA mutability. Histochemistry demonstrates that SDH activity was selectively absent in the patient tumor tissue. Overall, our results demonstrate that the C191Y SDHB mutation suppresses SDH enzyme activity leading to increased ROS formation and mtDNA mutability in our yeast model. These findings further our understanding of the mechanisms underlying PGL development and point to the yeast model as a valid tool to investigate on the possible pathogenic relevance of SDH novel mutations and/or rare polymorphism.

  8. Determination of Cancer Risk Associated with Germ Line BRCA1 Missense Variants by Functional Analysis

    PubMed Central

    Carvalho, Marcelo A.; Marsillac, Sylvia M.; Karchin, Rachel; Manoukian, Siranoush; Grist, Scott; Swaby, Ramona F.; Urmenyi, Turan P.; Rondinelli, Edson; Silva, Rosane; Gayol, Luis; Baumbach, Lisa; Sutphen, Rebecca; Pickard-Brzosowicz, Jennifer L.; Nathanson, Katherine L.; Sali, Andrej; Goldgar, David; Couch, Fergus J.; Radice, Paolo; Monteiro, Alvaro N.A.

    2010-01-01

    Germ line inactivating mutations in BRCA1 confer susceptibility for breast and ovarian cancer. However, the relevance of the many missense changes in the gene for which the effect on protein function is unknown remains unclear. Determination of which variants are causally associated with cancer is important for assessment of individual risk. We used a functional assay that measures the transactivation activity of BRCA1 in combination with analysis of protein modeling based on the structure of BRCA1 BRCT domains. In addition, the information generated was interpreted in light of genetic data. We determined the predicted cancer association of 22 BRCA1 variants and verified that the common polymorphism S1613G has no effect on BRCA1 function, even when combined with other rare variants. We estimated the specificity and sensitivity of the assay, and by meta-analysis of 47 variants, we show that variants with <45% of wild-type activity can be classified as deleterious whereas variants with >50% can be classified as neutral. In conclusion, we did functional and structure-based analyses on a large series of BRCA1 missense variants and defined a tentative threshold activity for the classification missense variants. By interpreting the validated functional data in light of additional clinical and structural evidence, we conclude that it is possible to classify all missense variants in the BRCA1 COOH-terminal region. These results bring functional assays for BRCA1 closer to clinical applicability. PMID:17308087

  9. Rare Variants in PLD3 Do Not Affect Risk for Early-Onset Alzheimer Disease in a European Consortium Cohort.

    PubMed

    Cacace, Rita; Van den Bossche, Tobi; Engelborghs, Sebastiaan; Geerts, Nathalie; Laureys, Annelies; Dillen, Lubina; Graff, Caroline; Thonberg, Håkan; Chiang, Huei-Hsin; Pastor, Pau; Ortega-Cubero, Sara; Pastor, Maria A; Diehl-Schmid, Janine; Alexopoulos, Panagiotis; Benussi, Luisa; Ghidoni, Roberta; Binetti, Giuliano; Nacmias, Benedetta; Sorbi, Sandro; Sanchez-Valle, Raquel; Lladó, Albert; Gelpi, Ellen; Almeida, Maria Rosário; Santana, Isabel; Tsolaki, Magda; Koutroumani, Maria; Clarimon, Jordi; Lleó, Alberto; Fortea, Juan; de Mendonça, Alexandre; Martins, Madalena; Borroni, Barbara; Padovani, Alessandro; Matej, Radoslav; Rohan, Zdenek; Vandenbulcke, Mathieu; Vandenberghe, Rik; De Deyn, Peter P; Cras, Patrick; van der Zee, Julie; Sleegers, Kristel; Van Broeckhoven, Christine

    2015-12-01

    Rare variants in the phospholipase D3 gene (PLD3) were associated with increased risk for late-onset Alzheimer disease (LOAD). We identified a missense mutation in PLD3 in whole-genome sequence data of a patient with autopsy confirmed Alzheimer disease (AD) and onset age of 50 years. Subsequently, we sequenced PLD3 in a Belgian early-onset Alzheimer disease (EOAD) patient (N = 261) and control (N = 319) cohort, as well as in European EOAD patients (N = 946) and control individuals (N = 1,209) ascertained in different European countries. Overall, we identified 22 rare variants with a minor allele frequency <1%, 20 missense and two splicing mutations. Burden analysis did not provide significant evidence for an enrichment of rare PLD3 variants in EOAD patients in any of the patient/control cohorts. Also, meta-analysis of the PLD3 data, including a published dataset of a German EOAD cohort, was not significant (P = 0.43; OR = 1.53, 95% CI 0.60-3.31). Consequently, our data do not support a role for PLD3 rare variants in the genetic etiology of EOAD in European EOAD patients. Our data corroborate the negative replication data obtained in LOAD studies and therefore a genetic role of PLD3 in AD remains to be demonstrated.

  10. Rare Variants in PLD3 Do Not Affect Risk for Early‐Onset Alzheimer Disease in a European Consortium Cohort

    PubMed Central

    Cacace, Rita; Van den Bossche, Tobi; Engelborghs, Sebastiaan; Geerts, Nathalie; Laureys, Annelies; Dillen, Lubina; Graff, Caroline; Thonberg, Håkan; Chiang, Huei‐Hsin; Pastor, Pau; Ortega‐Cubero, Sara; Pastor, Maria A.; Diehl‐Schmid, Janine; Alexopoulos, Panagiotis; Benussi, Luisa; Ghidoni, Roberta; Binetti, Giuliano; Nacmias, Benedetta; Sorbi, Sandro; Sanchez‐Valle, Raquel; Lladó, Albert; Gelpi, Ellen; Almeida, Maria Rosário; Santana, Isabel; Tsolaki, Magda; Koutroumani, Maria; Clarimon, Jordi; Lleó, Alberto; Fortea, Juan; de Mendonça, Alexandre; Martins, Madalena; Borroni, Barbara; Padovani, Alessandro; Matej, Radoslav; Rohan, Zdenek; Vandenbulcke, Mathieu; Vandenberghe, Rik; De Deyn, Peter P.; Cras, Patrick; van der Zee, Julie; Sleegers, Kristel

    2015-01-01

    ABSTRACT Rare variants in the phospholipase D3 gene (PLD3) were associated with increased risk for late‐onset Alzheimer disease (LOAD). We identified a missense mutation in PLD3 in whole‐genome sequence data of a patient with autopsy confirmed Alzheimer disease (AD) and onset age of 50 years. Subsequently, we sequenced PLD3 in a Belgian early‐onset Alzheimer disease (EOAD) patient (N = 261) and control (N = 319) cohort, as well as in European EOAD patients (N = 946) and control individuals (N = 1,209) ascertained in different European countries. Overall, we identified 22 rare variants with a minor allele frequency <1%, 20 missense and two splicing mutations. Burden analysis did not provide significant evidence for an enrichment of rare PLD3 variants in EOAD patients in any of the patient/control cohorts. Also, meta‐analysis of the PLD3 data, including a published dataset of a German EOAD cohort, was not significant (P = 0.43; OR = 1.53, 95% CI 0.60–3.31). Consequently, our data do not support a role for PLD3 rare variants in the genetic etiology of EOAD in European EOAD patients. Our data corroborate the negative replication data obtained in LOAD studies and therefore a genetic role of PLD3 in AD remains to be demonstrated. PMID:26411346

  11. A personalised approach to prostate cancer screening based on genotyping of risk founder alleles

    PubMed Central

    Cybulski, C; Wokołorczyk, D; Kluźniak, W; Kashyap, A; Gołąb, A; Słojewski, M; Sikorski, A; Puszyński, M; Soczawa, M; Borkowski, T; Borkowski, A; Antczak, A; Przybyła, J; Sosnowski, M; Małkiewicz, B; Zdrojowy, R; Domagała, P; Piotrowski, K; Menkiszak, J; Krzystolik, K; Gronwald, J; Jakubowska, A; Górski, B; Dębniak, T; Masojć, B; Huzarski, T; Muir, K R; Lophatananon, A; Lubiński, J; Narod, S A

    2013-01-01

    Background: To evaluate whether genotyping for 18 prostate cancer founder variants is helpful in identifying high-risk individuals and for determining optimal screening regimens. Methods: A serum PSA level was measured and a digital rectal examination (DRE) was performed on 2907 unaffected men aged 40–90. Three hundred and twenty-three men with an elevated PSA (⩾4 ng ml−1) or an abnormal DRE underwent a prostate biopsy. All men were genotyped for three founder alleles in BRCA1 (5382insC, 4153delA and C61G), for four alleles in CHEK2 (1100delC, IVS2+1G>A, del5395 and I157T), for one allele in NBS1 (657del5), for one allele in HOXB13 (G84E), and for nine low-risk single-nucleotide polymorphisms (SNPs). Results: On the basis of an elevated PSA or an abnormal DRE, prostate cancer was diagnosed in 135 of 2907 men (4.6%). In men with a CHEK2 missense mutation I157T, the cancer detection rate among men with an elevated PSA or an abnormal DRE was much higher (10.2%, P=0.0008). The cancer detection rate rose with the number of SNP risk genotypes observed from 1.2% for men with no variant to 8.6% for men who carried six or more variants (P=0.04). No single variant was helpful on its own in predicting the presence of prostate cancer, however, the combination of all rare mutations and SNPs improved predictive power (area under the curve=0.59; P=0.03). Conclusion: These results suggest that testing for germline CHEK2 mutations improves the ability to predict the presence of prostate cancer in screened men, however, the clinical utility of incorporating DNA variants in the screening process is marginal. PMID:23722471

  12. [Discovery of a novel A2 allel in ABO blood group system and investigation of its distribution in Han population of Chinese Fujian province].

    PubMed

    Zhang, Ai; Chi, Quan; Ren, Ben-Chun

    2012-10-01

    This study was aimed to investigate the distribution of A2 subgroup in Han Population of Chinese Fujian province and its molecular mechanisms. One individual with serologic ABO blood grouping discrepancy was identified with commercially available monoclonal and polyclonal antibodies and lectin: anti-A, anti-B, anti-AB, anti-A1, and anti-H reagents according to the routine laboratory methods. DNA sequences of exon 6, 7 and intron 6 of ABO gene were analyzed by polymerase chain reaction using genomic DNA and direct DNA sequencing or sequencing after gene cloning. Red cells of 3 176 A or AB unrelated individuals were tested with anti-A1. The results showed that this individual was identified as A2 subgroup by serological technology, sequencing analysis indicated the A2 subgroup with novel A variant allele, the novel A allele being different from the allele A101 by 467C > T and 607G > A missense mutation in exon 7, no A2 subgroup was identified from the 3 176 individuals by using standard serological technology. It is concluded that a novel A allele responsible for A2 subgroup composing of 467C > T and 607G > A has been firstly confirmed, and the A2 subgroup is very rare in Chinese Fujian Han population.

  13. Functional and computational assessment of missense variants in the ataxia-telangiectasia mutated (ATM) gene: mutations with increased cancer risk.

    PubMed

    Mitui, M; Nahas, S A; Du, L T; Yang, Z; Lai, C H; Nakamura, K; Arroyo, S; Scott, S; Purayidom, A; Concannon, P; Lavin, M; Gatti, R A

    2009-01-01

    The functional consequences of missense variants are often difficult to predict. This becomes especially relevant when DNA sequence changes are used to determine a diagnosis or prognosis. To analyze the consequences of 12 missense variants in patients with mild forms of ataxia-telangiectasia (A-T), we employed site-directed mutagenesis of ataxia-telangiectasia mutated (ATM) cDNA followed by stable transfections into a single A-T cell line to isolate the effects of each allele on the cellular phenotype. After induction of the transfected cells with CdCl2, we monitored for successful ATM transcription and subsequently assessed: 1) intracellular ATM protein levels; 2) ionizing radiation (IR)-induced ATM kinase activity; and 3) cellular radiosensitivity. We then calculated SIFT and PolyPhen scores for the missense changes. Nine variants produced little or no correction of the A-T cellular phenotype and were interpreted to be ATM mutations; SIFT/PolyPhen scores supported this. Three variants corrected the cellular phenotype, suggesting that they represented benign variants or polymorphisms. SIFT and PolyPhen scores supported the functional analyses for one of these variants (c.1709T>C); the other two were predicted to be "not tolerated" (c.6188G>A and c.6325T>G) and were classified as "operationally neutral." Genotype/phenotype relationships were compared: three deleterious missense variants were associated with an increased risk of cancer (c.6679C>T, c.7271T>G, and c.8494C>T). In situ mutagenesis represents an effective experimental approach for distinguishing deleterious missense mutations from benign or operationally neutral missense variants. Copyright 2008 Wiley-Liss, Inc.

  14. Molecular genetic analysis of para-Bombay phenotypes in Chinese: a novel non-functional FUT1 allele is identified.

    PubMed

    Yip, S P; Chee, K Y; Chan, P Y; Chow, E Y D; Wong, H F

    2002-10-01

    The para-Bombay phenotype (also known as H-deficient secretor) is characterized by a lack of ABH antigens on red cells, but ABH substances are found in saliva. Molecular genetic analysis was performed for five Chinese individuals serologically typed as para-Bombay. ABO genotyping and mutational analysis of both FUT1 (or H) and FUT2 (or Se) loci were performed for these individuals using the polymerase chain reaction, single-strand conformation polymorphism analysis and direct DNA sequencing. The ABO genotypes of these para-Bombay individuals correlated with the types of ABH substances found in the saliva. Their FUT1 genotypes were h1h2 (three individuals), h2h2 (one individual) and h2h6 (one individual). Alleles h1 (547-552delAG) and h2 (880-882delTT) were known frameshift mutations, while h6 (522C > A) was a missense mutation (Phe174Leu) not previously reported. These three mutations were rare sequence variations, each with an allele frequency of less than 0.005. Phe174 might be functionally important because this residue is conserved from mouse to human. Their FUT2 genotypes were Se357se357,385 for the h2h6 individual and Se357Se357) for the others. Both FUT2 alleles were known: one functional (Se357) and one weakly functional (se357,385). That they carried at least one copy of a functional FUT2 allele was consistent with their secretor status. As FUT1 and FUT2 are adjacent on 19q13.3, there are three possible haplotypes in these para-Bombay individuals: h1-Se357; h2-Se357; and h6-se357,385. A novel non-functional FUT1 allele (522C > A, or Phe174Leu) was identified in a para-Bombay individual and on a se357,385 haplotype background.

  15. First missense mutation outside of SERAC1 lipase domain affecting intracellular cholesterol trafficking.

    PubMed

    Rodríguez-García, María Elena; Martín-Hernández, Elena; de Aragón, Ana Martínez; García-Silva, María Teresa; Quijada-Fraile, Pilar; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

    2016-01-01

    We report the clinical and genetic findings in a Spanish boy who presented MEGDEL syndrome, a very rare inborn error of metabolism. Whole-exome sequencing uncovered a new homozygous mutation in the serine active site containing 1 (SERAC1) gene, which is essential for both mitochondrial function and intracellular cholesterol trafficking. Functional studies in patient fibroblasts showed that p.D224G mutation affects the intracellular cholesterol trafficking. Only three missense mutations in this gene have been described before, being p.D224G the first missense mutation outside of the SERAC1 serine-lipase domain. Therefore, we conclude that the defect in cholesterol trafficking is not limited to alterations in this specific part of the protein.

  16. Enrichment of putatively damaging rare variants in the DYX2 locus and the reading-related genes CCDC136 and FLNC.

    PubMed

    Adams, Andrew K; Smith, Shelley D; Truong, Dongnhu T; Willcutt, Erik G; Olson, Richard K; DeFries, John C; Pennington, Bruce F; Gruen, Jeffrey R

    2017-09-02

    Eleven loci with prior evidence for association with reading and language phenotypes were sequenced in 96 unrelated subjects with significant impairment in reading performance drawn from the Colorado Learning Disability Research Center collection. Out of 148 total individual missense variants identified, the chromosome 7 genes CCDC136 and FLNC contained 19. In addition, a region corresponding to the well-known DYX2 locus for RD contained 74 missense variants. Both allele sets were filtered for a minor allele frequency ≤0.01 and high Polyphen-2 scores. To determine if observations of these alleles are occurring more frequently in our cases than expected by chance in aggregate, counts from our sample were compared to the number of observations in the European subset of the 1000 Genomes Project using Fisher's exact test. Significant P values were achieved for both CCDC136/FLNC (P = 0.0098) and the DYX2 locus (P = 0.012). Taken together, this evidence further supports the influence of these regions on reading performance. These results also support the influence of rare variants in reading disability.

  17. Prefoldin Promotes Proteasomal Degradation of Cytosolic Proteins with Missense Mutations by Maintaining Substrate Solubility

    PubMed Central

    Young, Barry P.; Loewen, Christopher J.; Mayor, Thibault

    2016-01-01

    Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations. PMID:27448207

  18. Prefoldin Promotes Proteasomal Degradation of Cytosolic Proteins with Missense Mutations by Maintaining Substrate Solubility.

    PubMed

    Comyn, Sophie A; Young, Barry P; Loewen, Christopher J; Mayor, Thibault

    2016-07-01

    Misfolded proteins challenge the ability of cells to maintain protein homeostasis and can accumulate into toxic protein aggregates. As a consequence, cells have adopted a number of protein quality control pathways to prevent protein aggregation, promote protein folding, and target terminally misfolded proteins for degradation. In this study, we employed a thermosensitive allele of the yeast Guk1 guanylate kinase as a model misfolded protein to investigate degradative protein quality control pathways. We performed a flow cytometry based screen to identify factors that promote proteasomal degradation of proteins misfolded as the result of missense mutations. In addition to the E3 ubiquitin ligase Ubr1, we identified the prefoldin chaperone subunit Gim3 as an important quality control factor. Whereas the absence of GIM3 did not impair proteasomal function or the ubiquitination of the model substrate, it led to the accumulation of the poorly soluble model substrate in cellular inclusions that was accompanied by delayed degradation. We found that Gim3 interacted with the Guk1 mutant allele and propose that prefoldin promotes the degradation of the unstable model substrate by maintaining the solubility of the misfolded protein. We also demonstrated that in addition to the Guk1 mutant, prefoldin can stabilize other misfolded cytosolic proteins containing missense mutations.

  19. Missense Variant in MAPK Inactivator PTPN5 Is Associated with Decreased Severity of Post-Burn Hypertrophic Scarring.

    PubMed

    Sood, Ravi F; Arbabi, Saman; Honari, Shari; Gibran, Nicole S

    2016-01-01

    Hypertrophic scarring (HTS) is hypothesized to have a genetic mechanism, yet its genetic determinants are largely unknown. The mitogen-activated protein kinase (MAPK) pathways are important mediators of inflammatory signaling, and experimental evidence implicates MAPKs in HTS formation. We hypothesized that single-nucleotide polymorphisms (SNPs) in MAPK-pathway genes would be associated with severity of post-burn HTS. We analyzed data from a prospective-cohort genome-wide association study of post-burn HTS. We included subjects with deep-partial-thickness burns admitted to our center who provided blood for genotyping and had at least one Vancouver Scar Scale (VSS) assessment. After adjusting for HTS risk factors and population stratification, we tested MAPK-pathway gene SNPs for association with the four VSS variables in a joint regression model. In addition to individual-SNP analysis, we performed gene-based association testing. Our study population consisted of 538 adults (median age 40 years) who were predominantly White (76%) males (71%) admitted to our center from 2007-2014 with small-to-moderate-sized burns (median burn size 6% total body surface area). Of 2,146 SNPs tested, a rare missense variant in the PTPN5 gene (rs56234898; minor allele frequency 1.5%) was significantly associated with decreased severity of post-burn HTS (P = 1.3×10-6). In gene-based analysis, PTPN5 (P = 1.2×10-5) showed a significant association and BDNF (P = 9.5×10-4) a borderline-significant association with HTS severity. We report PTPN5 as a novel genetic locus associated with HTS severity. PTPN5 is a MAPK inhibitor expressed in neurons, suggesting a potential role for neurotrophic factors and neuroinflammatory signaling in HTS pathophysiology.

  20. Spectrum of mutations in MMACHC, allelic expression, and evidence for genotype-phenotype correlations.

    PubMed

    Lerner-Ellis, Jordan P; Anastasio, Natascia; Liu, Junhui; Coelho, David; Suormala, Terttu; Stucki, Martin; Loewy, Amanda D; Gurd, Scott; Grundberg, Elin; Morel, Chantal F; Watkins, David; Baumgartner, Matthias R; Pastinen, Tomi; Rosenblatt, David S; Fowler, Brian

    2009-07-01

    Methylmalonic aciduria and homocystinuria, cblC type, is a rare disorder of intracellular vitamin B(12) (cobalamin [Cbl]) metabolism caused by mutations in the MMACHC gene. MMACHC was sequenced from the gDNA of 118 cblC individuals. Eleven novel mutations were identified, as well as 23 mutations that were observed previously. Six sequence variants capture haplotype diversity in individuals across the MMACHC interval. Genotype-phenotype correlations of common mutations were apparent; individuals with c.394C>T tend to present with late-onset disease whereas patients with c.331C>T and c.271dupA tend to present in infancy. Other missense variants were also associated with late- or early-onset disease. Allelic expression analysis was carried out on human cblC fibroblasts compound heterozygous for different combinations of mutations including c.271dupA, c.331C>T, c.394C>T, and c.482G>A. The early-onset c.271dupA mutation was consistently underexpressed when compared to control alleles and the late-onset c.394C>T and c.482G>A mutations. The early-onset c.331C>T mutation was also underexpressed when compared to control alleles and the c.394C>T mutation. Levels of MMACHC mRNA transcript in cell lines homozygous for c.271dupA, c.331C>T, and c.394C>T were assessed using quantitative real-time RT-PCR. Cell lines homozygous for the late onset c.394C>T mutation had significantly higher levels of transcript when compared to cell lines homozygous for the early-onset mutations. Differential or preferential MMACHC transcript levels may provide a clue as to why individuals carrying c.394C>T generally present later in life. (c) 2009 Wiley-Liss, Inc.

  1. Two novel alleles of tottering with distinct Ca(v)2.1 calcium channel neuropathologies.

    PubMed

    Miki, T; Zwingman, T A; Wakamori, M; Lutz, C M; Cook, S A; Hosford, D A; Herrup, K; Fletcher, C F; Mori, Y; Frankel, W N; Letts, V A

    2008-07-31

    The calcium channel CACNA1A gene encodes the pore-forming, voltage-sensitive subunit of the voltage-dependent calcium Ca(v)2.1 type channel. Mutations in this gene have been linked to several human disorders, including familial hemiplegic migraine, episodic ataxia 2 and spinocerebellar ataxia type 6. The mouse homologue, Cacna1a, is associated with the tottering, Cacna1a(tg), mutant series. Here we describe two new missense mutant alleles, Cacna1a(tg-4J) and Cacna1a(Tg-5J). The Cacna1a(tg-4J) mutation is a valine to alanine mutation at amino acid 581, in segment S5 of domain II. The recessive Cacna1a(tg-4J) mutant exhibited the ataxia, paroxysmal dyskinesia and absence seizures reminiscent of the original tottering mouse. The Cacna1a(tg-4J) mutant also showed altered activation and inactivation kinetics of the Ca(v)2.1 channel, not previously reported for other tottering alleles. The semi-dominant Cacna1a(Tg-5J) mutation changed a conserved arginine residue to glutamine at amino acid 1252 within segment S4 of domain III. The heterozygous mouse was ataxic and homozygotes rarely survived. The Cacna1a(Tg-5J) mutation caused a shift in both voltage activation and inactivation to lower voltages, showing that this arginine residue is critical for sensing Ca(v)2.1 voltage changes. These two tottering mouse models illustrate how novel allelic variants can contribute to functional studies of the Ca(v)2.1 calcium channel.

  2. Two novel alleles of tottering with distinct Ca(v)2.1 calcium channel neuropathologies

    PubMed Central

    Miki, Takafumi; Zwingman, Theresa A.; Wakamori, Minoru; Lutz, Cathy M.; Cook, Susan A.; Hosford, David A.; Herrup, Karl; Fletcher, Colin F.; Mori, Yasuo; Frankel, Wayne N.; Letts, Verity A.

    2008-01-01

    The calcium channel CACNA1A gene encodes the pore-forming, voltage-sensitive subunit of the voltage-dependent calcium Ca(v)2.1 type channel. Mutations in this gene have been linked to several human disorders, including familial hemiplegic migraine, episodic ataxia 2 and spinocerebellar ataxia type 6. The mouse homologue, Cacna1a, is associated with the tottering, Cacna1atg, mutant series. Here we describe two new missense mutant alleles, Cacna1atg-4J and Cacna1aTg-5J. The Cacna1atg-4J mutation is a valine to alanine mutation at amino acid 581, in segment S5 of domain II. The recessive Cacna1atg-4J mutant exhibited the ataxia, paroxysmal dyskinesia and absence seizures reminiscent of the original tottering mouse. The Cacna1atg-4J mutant also showed altered activation and inactivation kinetics of the Ca(v)2.1 channel, not previously reported for other tottering alleles. The semi-dominant Cacna1aTg-5J mutation changed a conserved arginine residue to glutamine at amino acid 1252 within segment S4 of domain III. The heterozygous mouse was ataxic and homozygotes rarely survived. The Cacna1aTg-5J mutation caused a shift in both voltage activation and inactivation to lower voltages, showing that this arginine residue is critical for sensing Ca(v)2.1 voltage changes. These two tottering mouse models illustrate how novel allelic variants can contribute to functional studies of the Ca(v)2.1 calcium channel. PMID:18597946

  3. Atypical Progeroid Syndrome due to Heterozygous Missense LMNA Mutations

    PubMed Central

    Garg, Abhimanyu; Subramanyam, Lalitha; Agarwal, Anil K.; Simha, Vinaya; Levine, Benjamin; D'Apice, Maria Rosaria; Novelli, Giuseppe; Crow, Yanick

    2009-01-01

    Context: Hutchinson-Gilford progeria syndrome (HGPS) and mandibuloacral dysplasia are well-recognized allelic autosomal dominant and recessive progeroid disorders, respectively, due to mutations in lamin A/C (LMNA) gene. Heterozygous LMNA mutations have also been reported in a small number of patients with a less well-characterized atypical progeroid syndrome (APS). Objective: The objective of the study was to investigate the underlying genetic and molecular basis of the phenotype of patients presenting with APS. Results: We report 11 patients with APS from nine families, many with novel heterozygous missense LMNA mutations, such as, P4R, E111K, D136H, E159K, and C588R. These and previously reported patients now reveal a spectrum of clinical features including progeroid manifestations such as short stature, beaked nose, premature graying, partial alopecia, high-pitched voice, skin atrophy over the hands and feet, partial and generalized lipodystrophy with metabolic complications, and skeletal anomalies such as mandibular hypoplasia and mild acroosteolysis. Skin fibroblasts from these patients when assessed for lamin A/C expression using epifluorescence microscopy revealed variable nuclear morphological abnormalities similar to those observed in patients with HGPS. However, these nuclear abnormalities in APS patients could not be rescued with 48 h treatment with farnesyl transferase inhibitors, geranylgeranyl transferase inhibitors or trichostatin-A, a histone deacetylase inhibitor. Immunoblots of cell lysates from fibroblasts did not reveal prelamin A accumulation in any of these patients. Conclusions: APS patients have a few overlapping but some distinct clinical features as compared with HGPS and mandibuloacral dysplasia. The pathogenesis of clinical manifestations in APS patients seems not to be related to accumulation of mutant farnesylated prelamin A. PMID:19875478

  4. The spectrum of Familial Mediterranean Fever gene (MEFV) mutations and genotypes in Iran, and report of a novel missense variant (R204H).

    PubMed

    Ebadi, Nader; Shakoori, Abbas; Razipour, Masoumeh; Salmaninejad, Arash; Yeganeh, Razieh Zarifian; Mehrabi, Saman; RezaRaees Karami, Seyed; Khaleghian, Malihea; Azhideh, Hamidreza

    2017-09-21

    Familial Mediterranean Fever (FMF) is an autosomal recessive disorder, characterized by recurrent and self-limited episodes of fever, abdominal pain, synovitis and pleuritis. FMF as the most common inherited monogenic autoinflammatory disease mainly affects ethnic groups of the Mediterranean basin, Arab, Jewish, Turkish, Armenian North Africans and Arabic descent. In the present study, we selected 390 unrelated FMF patients according to the Tel-Hashomer criteria, and analyzed all patients for 12 most common mutations of MEFV gene by reverse hybridization assay (FMF strip assay). We also investigated exon 2 and 10 of MEFV gene in 78 patients by Sanger sequencing. According to strip assay results, at least one mutation was found in 234 patients (60%), and no mutation was found in other 156 patients (40%). The five most common mutations and allelic frequencies were M694V (13.6%), E148Q (10.4%), M694I (6.5%), V726A (4.1%), and M680I (3.8%). Moreover, we detected a novel missense variant (R204H, c.611 G > A) (SCV000297822) and following rare mutations among sequenced samples; R202Q, P115T, G304R, and E230K. This study describes the MEFV mutations spectrum and distribution in Iranian population, and shows different mutation patterns among Iranian ethnicities. Moreover, M694V is the most common MEFV mutation in Iran. Copyright © 2017. Published by Elsevier Masson SAS.

  5. Five novel missense mutations of the Lewis gene (FUT3) in African (Xhosa) and Caucasian populations in South Africa.

    PubMed

    Pang, H; Liu, Y; Koda, Y; Soejima, M; Jia, J; Schlaphoff, T; Du Toit, E D; Kimura, H

    1998-06-01

    Five novel missense mutations, viz., C304 A, T370 G, G484 A, G667 A, and G808 A, in the Lewis gene (FUT3) were detected in African (Xhosa) and Caucasian individuals in South Africa. These single base substitutions may result in changes in amino acid residues from Gln102 to Lys in the 304 mutation, Ser124 to Ala in the 370 mutation, Asp162 to Asn in the 484 mutation, Gly223 to Arg in the 667 mutation, and Val270 to Met in the 808 mutation. Out of the five novel mutations identified in this investigation, four new alleles (le484,667, le484,667,808, Le304, and Le370) were determined in the Xhosa population and two new alleles (le202,314,484 and Le304) in the Caucasian population. The determination of alpha(1,3/1,4)fucosyltransferase activity, after transfection of plasmids containing the new alleles into COS7 cells, suggested that alleles le484,667 and le484,667,808 encoded an inactive enzyme, and that alleles Le304 and Le370 encoded a functional enzyme. In addition, we also examined the incidence of five common alleles, Le59, le59,508 le59,1067, le202,314, and le1067 in two populations by the polymerase chain reaction/restriction fragment length polymorphism method and compared differences in the allele frequencies of FUT3 among three ethnic groups (Orientals, Africans, and Caucasians).

  6. Rare coding variants pinpoint genes that control human hematological traits

    PubMed Central

    Ntritsos, Georgios; Chen, Ming-Huei; Psaty, Bruce M.; Auer, Paul L.

    2017-01-01

    The identification of rare coding or splice site variants remains the most straightforward strategy to link genes with human phenotypes. Here, we analyzed the association between 137,086 rare (minor allele frequency (MAF) <1%) coding or splice site variants and 15 hematological traits in up to 308,572 participants. We found 56 such rare coding or splice site variants at P<5x10-8, including 31 that are associated with a blood-cell phenotype for the first time. All but one of these 31 new independent variants map to loci previously implicated in hematopoiesis by genome-wide association studies (GWAS). This includes a rare splice acceptor variant (rs146597587, MAF = 0.5%) in interleukin 33 (IL33) associated with reduced eosinophil count (P = 2.4x10-23), and lower risk of asthma (P = 2.6x10-7, odds ratio [95% confidence interval] = 0.56 [0.45–0.70]) and allergic rhinitis (P = 4.2x10-4, odds ratio = 0.55 [0.39–0.76]). The single new locus identified in our study is defined by a rare p.Arg172Gly missense variant (rs145535174, MAF = 0.05%) in plasminogen (PLG) associated with increased platelet count (P = 6.8x10-9), and decreased D-dimer concentration (P = 0.018) and platelet reactivity (P<0.03). Finally, our results indicate that searching for rare coding or splice site variants in very large sample sizes can help prioritize causal genes at many GWAS loci associated with complex human diseases and traits. PMID:28787443

  7. Patterns and functional implications of rare germline variants across 12 cancer types

    PubMed Central

    Lu, Charles; Xie, Mingchao; Wendl, Michael C.; Wang, Jiayin; McLellan, Michael D.; Leiserson, Mark D. M.; Huang, Kuan-lin; Wyczalkowski, Matthew A.; Jayasinghe, Reyka; Banerjee, Tapahsama; Ning, Jie; Tripathi, Piyush; Zhang, Qunyuan; Niu, Beifang; Ye, Kai; Schmidt, Heather K.; Fulton, Robert S.; McMichael, Joshua F.; Batra, Prag; Kandoth, Cyriac; Bharadwaj, Maheetha; Koboldt, Daniel C.; Miller, Christopher A.; Kanchi, Krishna L.; Eldred, James M.; Larson, David E.; Welch, John S.; You, Ming; Ozenberger, Bradley A.; Govindan, Ramaswamy; Walter, Matthew J.; Ellis, Matthew J.; Mardis, Elaine R.; Graubert, Timothy A.; Dipersio, John F.; Ley, Timothy J.; Wilson, Richard K.; Goodfellow, Paul J.; Raphael, Benjamin J.; Chen, Feng; Johnson, Kimberly J.; Parvin, Jeffrey D.; Ding, Li

    2015-01-01

    Large-scale cancer sequencing data enable discovery of rare germline cancer susceptibility variants. Here we systematically analyse 4,034 cases from The Cancer Genome Atlas cancer cases representing 12 cancer types. We find that the frequency of rare germline truncations in 114 cancer-susceptibility-associated genes varies widely, from 4% (acute myeloid leukaemia (AML)) to 19% (ovarian cancer), with a notably high frequency of 11% in stomach cancer. Burden testing identifies 13 cancer genes with significant enrichment of rare truncations, some associated with specific cancers (for example, RAD51C, PALB2 and MSH6 in AML, stomach and endometrial cancers, respectively). Significant, tumour-specific loss of heterozygosity occurs in nine genes (ATM, BAP1, BRCA1/2, BRIP1, FANCM, PALB2 and RAD51C/D). Moreover, our homology-directed repair assay of 68 BRCA1 rare missense variants supports the utility of allelic enrichment analysis for characterizing variants of unknown significance. The scale of this analysis and the somatic-germline integration enable the detection of rare variants that may affect individual susceptibility to tumour development, a critical step toward precision medicine. PMID:26689913

  8. Genome-wide allelic methylation analysis reveals disease-specific susceptibility to multiple methylation defects in imprinting syndromes.

    PubMed

    Court, Franck; Martin-Trujillo, Alex; Romanelli, Valeria; Garin, Intza; Iglesias-Platas, Isabel; Salafsky, Ira; Guitart, Miriam; Perez de Nanclares, Guiomar; Lapunzina, Pablo; Monk, David

    2013-04-01

    Genomic imprinting is the parent-of-origin-specific allelic transcriptional silencing observed in mammals, which is governed by DNA methylation established in the gametes and maintained throughout the development. The frequency and extent of epimutations associated with the nine reported imprinting syndromes varies because it is evident that aberrant preimplantation maintenance of imprinted differentially methylated regions (DMRs) may affect multiple loci. Using a custom Illumina GoldenGate array targeting 27 imprinted DMRs, we profiled allelic methylation in 65 imprinting defect patients. We identify multilocus hypomethylation in numerous Beckwith-Wiedemann syndrome, transient neonatal diabetes mellitus (TNDM), and pseudohypoparathyroidism 1B patients, and an individual with Silver-Russell syndrome. Our data reveal a broad range of epimutations exist in certain imprinting syndromes, with the exception of Prader-Willi syndrome and Angelman syndrome patients that are associated with solitary SNRPN-DMR defects. A mutation analysis identified a 1 bp deletion in the ZFP57 gene in a TNDM patient with methylation defects at multiple maternal DMRs. In addition, we observe missense variants in ZFP57, NLRP2, and NLRP7 that are not consistent with maternal effect and aberrant establishment or methylation maintenance, and are likely benign. This work illustrates that further extensive molecular characterization of these rare patients is required to fully understand the mechanism underlying the etiology of imprint establishment and maintenance.

  9. Molecular definition of an allelic series of mutations disrupting the mouse Lmx1a (dreher) gene.

    PubMed

    Chizhikov, Victor; Steshina, Ekaterina; Roberts, Richard; Ilkin, Yesim; Washburn, Linda; Millen, Kathleen J

    2006-10-01

    Mice homozygous for the dreher (dr) mutation are characterized by pigmentation and skeletal abnormalities and striking behavioral phenotypes, including ataxia, vestibular deficits, and hyperactivity. The ataxia is associated with a cerebellar malformation that is remarkably similar to human Dandy-Walker malformation. Previously, positional cloning identified mutations in LIM homeobox transcription factor 1 alpha gene (Lmx1a) in three dr alleles. Two of these alleles, however, are extinct and unavailable for further analysis. In this article we report a new spontaneous dr allele and describe the Lmx1a mutations in this and six additional dr alleles. Strikingly, deletion null, missense, and frameshift mutations in these alleles all cause similar cerebellar malformations, suggesting that all dr mutations analyzed to date are null alleles.

  10. [Evaluation of performance of five bioinformatics software for the prediction of missense mutations].

    PubMed

    Chen, Qianting; Dai, Congling; Zhang, Qianjun; Du, Juan; Li, Wen

    2016-10-01

    To study the prediction performance evaluation with five kinds of bioinformatics software (SIFT, PolyPhen2, MutationTaster, Provean, MutationAssessor). From own database for genetic mutations collected over the past five years, Chinese literature database, Human Gene Mutation Database, and dbSNP, 121 missense mutations confirmed by functional studies, and 121 missense mutations suspected to be pathogenic by pedigree analysis were used as positive gold standard, while 242 missense mutations with minor allele frequency (MAF)>5% in dominant hereditary diseases were used as negative gold standard. The selected mutations were predicted with the five software. Based on the results, the performance of the five software was evaluated for their sensitivity, specificity, positive predict value, false positive rate, negative predict value, false negative rate, false discovery rate, accuracy, and receiver operating characteristic curve (ROC). In terms of sensitivity, negative predictive value and false negative rate, the rank was MutationTaster, PolyPhen2, Provean, SIFT, and MutationAssessor. For specificity and false positive rate, the rank was MutationTaster, Provean, MutationAssessor, SIFT, and PolyPhen2. For positive predict value and false discovery rate, the rank was MutationTaster, Provean, MutationAssessor, PolyPhen2, and SIFT. For area under the ROC curve (AUC) and accuracy, the rank was MutationTaster, Provean, PolyPhen2, MutationAssessor, and SIFT. The prediction performance of software may be different when using different parameters. Among the five software, MutationTaster has the best prediction performance.

  11. Mice with missense and nonsense NF1 mutations display divergent phenotypes compared with human neurofibromatosis type I.

    PubMed

    Li, Kairong; Turner, Ashley N; Chen, Min; Brosius, Stephanie N; Schoeb, Trenton R; Messiaen, Ludwine M; Bedwell, David M; Zinn, Kurt R; Anastasaki, Corina; Gutmann, David H; Korf, Bruce R; Kesterson, Robert A

    2016-07-01

    Neurofibromatosis type 1 (NF1) is a common genetic disorder characterized by the occurrence of nerve sheath tumors and considerable clinical heterogeneity. Some translational studies have been limited by the lack of animal models available for assessing patient-specific mutations. In order to test therapeutic approaches that might restore function to the mutated gene or gene product, we developed mice harboring NF1 patient-specific mutations including a nonsense mutation (c.2041C>T; p.Arg681*) and a missense mutation (c.2542G>C; p.Gly848Arg). The latter is associated with the development of multiple plexiform neurofibromas along spinal nerve roots. We demonstrate that the human nonsense NF1(Arg681*) and missense NF1(Gly848Arg) mutations have different effects on neurofibromin expression in the mouse and each recapitulates unique aspects of the NF1 phenotype, depending upon the genetic context when assessed in the homozygous state or when paired with a conditional knockout allele. Whereas the missense Nf1(Gly848Arg) mutation fails to produce an overt phenotype in the mouse, animals homozygous for the nonsense Nf1(Arg681*) mutation are not viable. Mice with one Nf1(Arg681*) allele in combination with a conditional floxed Nf1 allele and the DhhCre transgene (Nf1(4F/Arg681*); DhhCre) display disorganized nonmyelinating axons and neurofibromas along the spinal column, which leads to compression of the spinal cord and paralysis. This model will be valuable for preclinical testing of novel nonsense suppression therapies using drugs to target in-frame point mutations that create premature termination codons in individuals with NF1.

  12. Mice with missense and nonsense NF1 mutations display divergent phenotypes compared with human neurofibromatosis type I

    PubMed Central

    Li, Kairong; Turner, Ashley N.; Chen, Min; Brosius, Stephanie N.; Schoeb, Trenton R.; Messiaen, Ludwine M.; Bedwell, David M.; Zinn, Kurt R.; Anastasaki, Corina; Gutmann, David H.; Korf, Bruce R.

    2016-01-01

    ABSTRACT Neurofibromatosis type 1 (NF1) is a common genetic disorder characterized by the occurrence of nerve sheath tumors and considerable clinical heterogeneity. Some translational studies have been limited by the lack of animal models available for assessing patient-specific mutations. In order to test therapeutic approaches that might restore function to the mutated gene or gene product, we developed mice harboring NF1 patient-specific mutations including a nonsense mutation (c.2041C>T; p.Arg681*) and a missense mutation (c.2542G>C; p.Gly848Arg). The latter is associated with the development of multiple plexiform neurofibromas along spinal nerve roots. We demonstrate that the human nonsense NF1Arg681* and missense NF1Gly848Arg mutations have different effects on neurofibromin expression in the mouse and each recapitulates unique aspects of the NF1 phenotype, depending upon the genetic context when assessed in the homozygous state or when paired with a conditional knockout allele. Whereas the missense Nf1Gly848Arg mutation fails to produce an overt phenotype in the mouse, animals homozygous for the nonsense Nf1Arg681* mutation are not viable. Mice with one Nf1Arg681* allele in combination with a conditional floxed Nf1 allele and the DhhCre transgene (Nf14F/Arg681*; DhhCre) display disorganized nonmyelinating axons and neurofibromas along the spinal column, which leads to compression of the spinal cord and paralysis. This model will be valuable for preclinical testing of novel nonsense suppression therapies using drugs to target in-frame point mutations that create premature termination codons in individuals with NF1. PMID:27482814

  13. A missense mutation in melanocortin 1 receptor is associated with the red coat colour in donkeys.

    PubMed

    Abitbol, M; Legrand, R; Tiret, L

    2014-12-01

    The seven donkey breeds recognised by the French studbook are characterised by few coat colours: black, bay and grey. Normand bay donkeys seldom give birth to red foals, a colour more commonly seen and recognised in American miniature donkeys. Red resembles the equine chestnut colour, previously attributed to a mutation in the melanocortin 1 receptor gene (MC1R). We used a panel of 124 donkeys to identify a recessive missense c.629T>C variant in MC1R that showed a perfect association with the red coat colour. This variant leads to a methionine to threonine substitution at position 210 in the protein. We showed that methionine 210 is highly conserved among vertebrate melanocortin receptors. Previous in silico and in vitro analyses predicted this residue to lie within a functional site. Our in vivo results emphasised the pivotal role played by this residue, the alteration of which yielded a phenotype fully compatible with a loss of function of MC1R. We thus propose to name the c.629T>C allele in donkeys the e allele, which further enlarges the panel of recessive MC1R loss-of-function alleles described in animals and humans.

  14. Comprehensive functional annotation of 18 missense mutations found in suspected hemochromatosis type 4 patients.

    PubMed

    Callebaut, Isabelle; Joubrel, Rozenn; Pissard, Serge; Kannengiesser, Caroline; Gérolami, Victoria; Ged, Cécile; Cadet, Estelle; Cartault, François; Ka, Chandran; Gourlaouen, Isabelle; Gourhant, Lénaick; Oudin, Claire; Goossens, Michel; Grandchamp, Bernard; De Verneuil, Hubert; Rochette, Jacques; Férec, Claude; Le Gac, Gérald

    2014-09-01

    Hemochromatosis type 4 is a rare form of primary iron overload transmitted as an autosomal dominant trait caused by mutations in the gene encoding the iron transport protein ferroportin 1 (SLC40A1). SLC40A1 mutations fall into two functional categories (loss- versus gain-of-function) underlying two distinct clinical entities (hemochromatosis type 4A versus type 4B). However, the vast majority of SLC40A1 mutations are rare missense variations, with only a few showing strong evidence of causality. The present study reports the results of an integrated approach collecting genetic and phenotypic data from 44 suspected hemochromatosis type 4 patients, with comprehensive structural and functional annotations. Causality was demonstrated for 10 missense variants, showing a clear dichotomy between the two hemochromatosis type 4 subtypes. Two subgroups of loss-of-function mutations were distinguished: one impairing cell-surface expression and one altering only iron egress. Additionally, a new gain-of-function mutation was identified, and the degradation of ferroportin on hepcidin binding was shown to probably depend on the integrity of a large extracellular loop outside of the hepcidin-binding domain. Eight further missense variations, on the other hand, were shown to have no discernible effects at either protein or RNA level; these were found in apparently isolated patients and were associated with a less severe phenotype. The present findings illustrate the importance of combining in silico and biochemical approaches to fully distinguish pathogenic SLC40A1 mutations from benign variants. This has profound implications for patient management.

  15. Rare coding variants and breast cancer risk: Evaluation of susceptibility loci identified in genome-wide association studies

    PubMed Central

    Zhang, Yanfeng; Long, Jirong; Lu, Wei; Shu, Xiao-Ou; Cai, Qiuyin; Zheng, Ying; Li, Chun; Li, Bingshan; Gao, Yu-Tang; Zheng, Wei

    2014-01-01

    Background To date, common genetic variants in ~70 loci have been identified for breast cancer via genome-wide association studies (GWAS). It is unknown whether rare variants in these loci are also associated with breast cancer risk. Methods We investigated rare missense/nonsense variants with minor allele frequency (MAF) ≤ 5% located in flanking 500 kb of each of the index SNPs in 67 GWAS loci. Included in the study were 3,472 cases and 3,595 controls from the Shanghai Breast Cancer Study. Both single marker and gene-based analyses were conducted to investigate the associations. Results Single marker analyses identified 38 missense variants being association with breast cancer risk at P < 0.05 after adjusting for the index SNP. SNP rs146217902 in the EDEM1 gene and rs200340088 in the EFEMP2 gene were only observed in 8 cases (P = 0.004 for both). SNP rs200995432 in the EFEMP2 gene was associated with increased risk with an odds ratio (OR) of 6.2 (95% CI: 1.4–27.6, P = 6.2×10−3). SNP rs80358978 in the BRCA2 gene was associated with 16.5-fold elevated risk (95% CI: 2.2–124.5, P = 2.2×10−4). Gene-based analyses suggested eight genes associated with breast cancer risk at P < 0.05, including the EFEMP2 gene (P = 0.002) and the FBXO18 gene (P = 0.008). Conclusion Our results identified association of several rare coding variants neighboring common GWAS loci with breast cancer risk. Further investigation of these rare variants and genes would help to understand the biological mechanisms underlying the associations. Impact Independent studies with larger sample size are warranted to clarify the relationship between these rare variants and breast cancer risk. PMID:24470074

  16. Missense exchanges in the TTBK2 gene mutated in SCA11.

    PubMed

    Edener, Ulf; Kurth, Ingo; Meiner, Annechristin; Hoffmann, Frank; Hübner, Christian A; Bernard, Veronica; Gillessen-Kaesbach, Gabriele; Zühlke, Christine

    2009-11-01

    The spinocerebellar ataxias (SCAs) with autosomal dominant inheritance are a clinically and genetically heterogeneous group of neurological disorders with overlapping as well as highly variable phenotypes primarily affecting the cerebellum. To date, 28 different loci have been identified. Nine SCAs are caused by repeat expansions; for 14 only the chromosomal localisation is known. Recently, two frameshift mutations in the tau tubulin kinase 2 gene (TTBK2) were reported to cause SCA11. To evaluate the frequency of mutations in the TTBK2 gene, we performed molecular genetic analyses in 49 unrelated familial cases with ataxia. Sequencing all coding exons revealed, amongst others, two novel missense exchanges at evolutionarily conserved amino acid positions. Although being unique in 98 alleles of ataxia patients, a disease causing effect can be excluded with high probability for both variations. This result demonstrates the challenges in diagnostic testing for SCA11.

  17. Population-based estimate of prostate cancer risk for carriers of the HOXB13 missense mutation G84E.

    PubMed

    MacInnis, Robert J; Severi, Gianluca; Baglietto, Laura; Dowty, James G; Jenkins, Mark A; Southey, Melissa C; Hopper, John L; Giles, Graham G

    2013-01-01

    The HOXB13 missense mutation G84E (rs138213197) is associated with increased risk of prostate cancer, but the current estimate of increased risk has a wide confidence interval (width of 95% confidence interval (CI) >200-fold) so the point estimate of 20-fold increased risk could be misleading. Population-based family studies can be more informative for estimating risks for rare variants, therefore, we screened for mutations in an Australian population-based series of early-onset prostate cancer cases (probands). We found that 19 of 1,384 (1.4%) probands carried the missense mutation, and of these, six (32%) had a family history of prostate cancer. We tested the 22 relatives of carriers diagnosed from 1998 to 2008 for whom we had a DNA sample, and found seven more carriers and one obligate carrier. The age-specific incidence for carriers was estimated to be, on average, 16.4 (95% CI 2.5-107.2) times that for the population over the time frame when the relatives were at risk prior to baseline. We then estimated the age and birth year- specific cumulative risk of prostate cancer (penetrance) for carriers. For example, the penetrance for an unaffected male carrier born in 1950 was 19% (95% CI 5-46%) at age 60 years, 44% (95% CI 18-74%) at age 70 years and 60% (95% CI 30-85%) at age 80 years. Our study has provided a population-based estimate of the average risk of prostate cancer for HOXB13 missense mutation G84E carriers that can be used to guide clinical practice and research. This study has also shown that the majority of hereditary prostate cancers due to the HOXB13 missense mutation are 'sporadic' in the sense that unselected cases with the missense mutation do not typically report having a family history of prostate cancer.

  18. Population-Based Estimate of Prostate Cancer Risk for Carriers of the HOXB13 Missense Mutation G84E

    PubMed Central

    Baglietto, Laura; Dowty, James G.; Jenkins, Mark A.; Southey, Melissa C.; Hopper, John L.; Giles, Graham G.

    2013-01-01

    The HOXB13 missense mutation G84E (rs138213197) is associated with increased risk of prostate cancer, but the current estimate of increased risk has a wide confidence interval (width of 95% confidence interval (CI) >200-fold) so the point estimate of 20-fold increased risk could be misleading. Population-based family studies can be more informative for estimating risks for rare variants, therefore, we screened for mutations in an Australian population-based series of early-onset prostate cancer cases (probands). We found that 19 of 1,384 (1.4%) probands carried the missense mutation, and of these, six (32%) had a family history of prostate cancer. We tested the 22 relatives of carriers diagnosed from 1998 to 2008 for whom we had a DNA sample, and found seven more carriers and one obligate carrier. The age-specific incidence for carriers was estimated to be, on average, 16.4 (95% CI 2.5–107.2) times that for the population over the time frame when the relatives were at risk prior to baseline. We then estimated the age and birth year- specific cumulative risk of prostate cancer (penetrance) for carriers. For example, the penetrance for an unaffected male carrier born in 1950 was 19% (95% CI 5–46%) at age 60 years, 44% (95% CI 18–74%) at age 70 years and 60% (95% CI 30–85%) at age 80 years. Our study has provided a population-based estimate of the average risk of prostate cancer for HOXB13 missense mutation G84E carriers that can be used to guide clinical practice and research. This study has also shown that the majority of hereditary prostate cancers due to the HOXB13 missense mutation are ‘sporadic’ in the sense that unselected cases with the missense mutation do not typically report having a family history of prostate cancer. PMID:23457453

  19. A Platform for Interrogating Cancer-Associated p53 Alleles

    PubMed Central

    D’Brot, Alejandro; Kurtz, Paula; Regan, Erin; Jakubowski, Brandon; Abrams, John M

    2016-01-01

    p53 is the most frequently mutated gene in human cancer. Compelling evidence argues that full transformation involves loss of growth suppression encoded by wild-type p53 together with poorly understood oncogenic activity encoded by missense mutations. Furthermore, distinguishing disease alleles from natural polymorphisms is an important clinical challenge. To interrogate the genetic activity of human p53 variants, we leveraged the Drosophila model as an in vivo platform. We engineered strains that replace the fly p53 gene with human alleles, producing a collection of stocks that are, in effect, ‘humanized’ for p53 variants. Like the fly counterpart, human p53 transcriptionally activated a biosensor and induced apoptosis after DNA damage. However, all humanized strains representing common alleles found in cancer patients failed to complement in these assays. Surprisingly, stimulus-dependent activation of hp53 occurred without stabilization, demonstrating that these two processes can be uncoupled. Like its fly counterpart, hp53 formed prominent nuclear foci in germline cells but cancer-associated p53 variants did not. Moreover, these same mutant alleles disrupted hp53 foci and inhibited biosensor activity, suggesting that these properties are functionally linked. Together these findings establish a functional platform for interrogating human p53 alleles and suggest that simple phenotypes could be used to stratify disease variants. PMID:26996664

  20. KD4v: comprehensible knowledge discovery system for missense variant

    PubMed Central

    Luu, Tien-Dao; Rusu, Alin; Walter, Vincent; Linard, Benjamin; Poidevin, Laetitia; Ripp, Raymond; Moulinier, Luc; Muller, Jean; Raffelsberger, Wolfgang; Wicker, Nicolas; Lecompte, Odile; Thompson, Julie D.; Poch, Olivier; Nguyen, Hoan

    2012-01-01

    A major challenge in the post-genomic era is a better understanding of how human genetic alterations involved in disease affect the gene products. The KD4v (Comprehensible Knowledge Discovery System for Missense Variant) server allows to characterize and predict the phenotypic effects (deleterious/neutral) of missense variants. The server provides a set of rules learned by Induction Logic Programming (ILP) on a set of missense variants described by conservation, physico-chemical, functional and 3D structure predicates. These rules are interpretable by non-expert humans and are used to accurately predict the deleterious/neutral status of an unknown mutation. The web server is available at http://decrypthon.igbmc.fr/kd4v. PMID:22641855

  1. Molecular mechanisms of disease-causing missense mutations

    PubMed Central

    Stefl, Shannon; Nishi, Hafumi; Petukh, Marharyta; Panchenko, Anna R.; Alexov, Emil

    2013-01-01

    Genetic variations resulting in a change of amino acid sequence can have a dramatic effect on stability, hydrogen bond network, conformational dynamics, activity and many other physiologically important properties of proteins. The substitutions of only one residue in a protein sequence, so-called missense mutations, can be related to many pathological conditions, and may influence susceptibility to disease and drug treatment. The plausible effects of missense mutations range from affecting the macromolecular stability to perturbing macromolecular interactions and cellular localization. Here we review the individual cases and genome-wide studies which illustrate the association between missense mutations and diseases. In addition we emphasize that the molecular mechanisms of effects of mutations should be revealed in order to understand the disease origin. Finally we report the current state-of-the-art methodologies which predict the effects of mutations on protein stability, the hydrogen bond network, pH-dependence, conformational dynamics and protein function. PMID:23871686

  2. Contribution of common and rare variants of the PTCHD1 gene to autism spectrum disorders and intellectual disability

    PubMed Central

    Torrico, Bàrbara; Fernàndez-Castillo, Noèlia; Hervás, Amaia; Milà, Montserrat; Salgado, Marta; Rueda, Isabel; Buitelaar, Jan K; Rommelse, Nanda; Oerlemans, Anoek M; Bralten, Janita; Freitag, Christine M; Reif, Andreas; Battaglia, Agatino; Mazzone, Luigi; Maestrini, Elena; Cormand, Bru; Toma, Claudio

    2015-01-01

    Recent findings revealed rare copy number variants and missense changes in the X-linked gene PTCHD1 in autism spectrum disorder (ASD) and intellectual disability (ID). Here, we aim to explore the contribution of common PTCHD1 variants in ASD and gain additional evidence for the role of rare variants of this gene in ASD and ID. A two-stage case–control association study investigated 28 tag single nucleotide polymorphisms (SNPs) in 994 ASD cases and 1035 controls from four European populations. Mutation screening was performed in 673 individuals who included 240 ASD cases, 183 ID patients and 250 controls. The case–control association study showed a significant association with rs7052177 (P=6.13E-4) in the ASD discovery sample that was replicated in an independent sample (P=0.03). A Mantel-Haenszel meta-analysis for rs7052177T considering the four European populations showed an odds ratio of 0.58 (P=7E-05). This SNP is predicted to be located in a transcription factor binding site. No rare missense PTCHD1 variants were found in our ASD cohort and only one was identified in the ID sample. A duplication (27 bp) in the promoter region, absent from 590 controls, was found in three ASD patients (Fisher exact test, P=0.024). A gene reporter assay showed a significant decrease in the transcriptional activity (26%) driven by this variant. Moreover, we found that the longest allele of a trinucleotide repeat located upstream from PTCHD1 was associated with ASD (P=0.003, permP=0.0186). Our results further support the involvement of PTCHD1 in ASD, suggesting that both common and rare variants contribute to the disorder. PMID:25782667

  3. Contribution of common and rare variants of the PTCHD1 gene to autism spectrum disorders and intellectual disability.

    PubMed

    Torrico, Bàrbara; Fernàndez-Castillo, Noèlia; Hervás, Amaia; Milà, Montserrat; Salgado, Marta; Rueda, Isabel; Buitelaar, Jan K; Rommelse, Nanda; Oerlemans, Anoek M; Bralten, Janita; Freitag, Christine M; Reif, Andreas; Battaglia, Agatino; Mazzone, Luigi; Maestrini, Elena; Cormand, Bru; Toma, Claudio

    2015-12-01

    Recent findings revealed rare copy number variants and missense changes in the X-linked gene PTCHD1 in autism spectrum disorder (ASD) and intellectual disability (ID). Here, we aim to explore the contribution of common PTCHD1 variants in ASD and gain additional evidence for the role of rare variants of this gene in ASD and ID. A two-stage case-control association study investigated 28 tag single nucleotide polymorphisms (SNPs) in 994 ASD cases and 1035 controls from four European populations. Mutation screening was performed in 673 individuals who included 240 ASD cases, 183 ID patients and 250 controls. The case-control association study showed a significant association with rs7052177 (P=6.13E-4) in the ASD discovery sample that was replicated in an independent sample (P=0.03). A Mantel-Haenszel meta-analysis for rs7052177T considering the four European populations showed an odds ratio of 0.58 (P=7E-05). This SNP is predicted to be located in a transcription factor binding site. No rare missense PTCHD1 variants were found in our ASD cohort and only one was identified in the ID sample. A duplication (27 bp) in the promoter region, absent from 590 controls, was found in three ASD patients (Fisher exact test, P=0.024). A gene reporter assay showed a significant decrease in the transcriptional activity (26%) driven by this variant. Moreover, we found that the longest allele of a trinucleotide repeat located upstream from PTCHD1 was associated with ASD (P=0.003, permP=0.0186). Our results further support the involvement of PTCHD1 in ASD, suggesting that both common and rare variants contribute to the disorder.

  4. A Novel Homozygous Missense Mutation in HOXC13 Leads to Autosomal Recessive Pure Hair and Nail Ectodermal Dysplasia.

    PubMed

    Li, Xiaoxiao; Orseth, Meredith Lee; Smith, J Michael; Brehm, Mary Abigail; Agim, Nnenna Gebechi; Glass, Donald Alexander

    2017-03-01

    Pure hair and nail ectodermal dysplasia (PHNED) is a rare disorder that presents with hypotrichosis and nail dystrophy while sparing other ectodermal structures such as teeth and sweat glands. We describe a homozygous novel missense mutation in the HOXC13 gene that resulted in autosomal recessive PHNED in a Hispanic child. The mutation c.812A>G (p.Gln271Arg) is located within the DNA-binding domain of the HOXC13 gene, cosegregates within the family, and is predicted to be maximally damaging. This is the first reported case of a missense HOXC13 mutation resulting in PHNED and the first reported case of PHNED identified in a North American family. Our findings illustrate the critical role of HOXC13 in human hair and nail development.

  5. Allelic genealogies in sporophytic self-incompatibility systems in plants.

    PubMed Central

    Schierup, M H; Vekemans, X; Christiansen, F B

    1998-01-01

    Expectations for the time scale and structure of allelic genealogies in finite populations are formed under three models of sporophytic self-incompatibility. The models differ in the dominance interactions among the alleles that determine the self-incompatibility phenotype: In the SSIcod model, alleles act codominantly in both pollen and style, in the SSIdom model, alleles form a dominance hierarchy, and in SSIdomcod, alleles are codominant in the style and show a dominance hierarchy in the pollen. Coalescence times of alleles rarely differ more than threefold from those under gametophytic self-incompatibility, and transspecific polymorphism is therefore expected to be equally common. The previously reported directional turnover process of alleles in the SSIdomcod model results in coalescence times lower and substitution rates higher than those in the other models. The SSIdom model assumes strong asymmetries in allelic action, and the most recessive extant allele is likely to be the most recent common ancestor. Despite these asymmetries, the expected shape of the allele genealogies does not deviate markedly from the shape of a neutral gene genealogy. The application of the results to sequence surveys of alleles, including interspecific comparisons, is discussed. PMID:9799270

  6. Assortative mating can impede or facilitate fixation of underdominant alleles.

    PubMed

    Newberry, Mitchell G; McCandlish, David M; Plotkin, Joshua B

    2016-12-01

    Underdominant mutations have fixed between divergent species, yet classical models suggest that rare underdominant alleles are purged quickly except in small or subdivided populations. We predict that underdominant alleles that also influence mate choice, such as those affecting coloration patterns visible to mates and predators alike, can fix more readily. We analyze a mechanistic model of positive assortative mating in which individuals have n chances to sample compatible mates. This one-parameter model naturally spans random mating (n=1) and complete assortment (n→∞), yet it produces sexual selection whose strength depends non-monotonically on n. This sexual selection interacts with viability selection to either inhibit or facilitate fixation. As mating opportunities increase, underdominant alleles fix as frequently as neutral mutations, even though sexual selection and underdominance independently each suppress rare alleles. This mechanism allows underdominant alleles to fix in large populations and illustrates how life history can affect evolutionary change.

  7. Deleterious Alleles in the Human Genome Are on Average Younger Than Neutral Alleles of the Same Frequency

    PubMed Central

    Kiezun, Adam; Pulit, Sara L.; Francioli, Laurent C.; van Dijk, Freerk; Swertz, Morris; Boomsma, Dorret I.; van Duijn, Cornelia M.; Slagboom, P. Eline; van Ommen, G. J. B.; Wijmenga, Cisca; de Bakker, Paul I. W.; Sunyaev, Shamil R.

    2013-01-01

    Large-scale population sequencing studies provide a complete picture of human genetic variation within the studied populations. A key challenge is to identify, among the myriad alleles, those variants that have an effect on molecular function, phenotypes, and reproductive fitness. Most non-neutral variation consists of deleterious alleles segregating at low population frequency due to incessant mutation. To date, studies characterizing selection against deleterious alleles have been based on allele frequency (testing for a relative excess of rare alleles) or ratio of polymorphism to divergence (testing for a relative increase in the number of polymorphic alleles). Here, starting from Maruyama's theoretical prediction (Maruyama T (1974), Am J Hum Genet USA 6:669–673) that a (slightly) deleterious allele is, on average, younger than a neutral allele segregating at the same frequency, we devised an approach to characterize selection based on allelic age. Unlike existing methods, it compares sets of neutral and deleterious sequence variants at the same allele frequency. When applied to human sequence data from the Genome of the Netherlands Project, our approach distinguishes low-frequency coding non-synonymous variants from synonymous and non-coding variants at the same allele frequency and discriminates between sets of variants independently predicted to be benign or damaging for protein structure and function. The results confirm the abundance of slightly deleterious coding variation in humans. PMID:23468643

  8. Deleterious alleles in the human genome are on average younger than neutral alleles of the same frequency.

    PubMed

    Kiezun, Adam; Pulit, Sara L; Francioli, Laurent C; van Dijk, Freerk; Swertz, Morris; Boomsma, Dorret I; van Duijn, Cornelia M; Slagboom, P Eline; van Ommen, G J B; Wijmenga, Cisca; de Bakker, Paul I W; Sunyaev, Shamil R

    2013-01-01

    Large-scale population sequencing studies provide a complete picture of human genetic variation within the studied populations. A key challenge is to identify, among the myriad alleles, those variants that have an effect on molecular function, phenotypes, and reproductive fitness. Most non-neutral variation consists of deleterious alleles segregating at low population frequency due to incessant mutation. To date, studies characterizing selection against deleterious alleles have been based on allele frequency (testing for a relative excess of rare alleles) or ratio of polymorphism to divergence (testing for a relative increase in the number of polymorphic alleles). Here, starting from Maruyama's theoretical prediction (Maruyama T (1974), Am J Hum Genet USA 6:669-673) that a (slightly) deleterious allele is, on average, younger than a neutral allele segregating at the same frequency, we devised an approach to characterize selection based on allelic age. Unlike existing methods, it compares sets of neutral and deleterious sequence variants at the same allele frequency. When applied to human sequence data from the Genome of the Netherlands Project, our approach distinguishes low-frequency coding non-synonymous variants from synonymous and non-coding variants at the same allele frequency and discriminates between sets of variants independently predicted to be benign or damaging for protein structure and function. The results confirm the abundance of slightly deleterious coding variation in humans.

  9. Ultrasensitive allele-specific PCR reveals rare preexisting drug-resistant variants and a large replicating virus population in macaques infected with a simian immunodeficiency virus containing human immunodeficiency virus reverse transcriptase.

    PubMed

    Boltz, Valerie F; Ambrose, Zandrea; Kearney, Mary F; Shao, Wei; Kewalramani, Vineet N; Maldarelli, Frank; Mellors, John W; Coffin, John M

    2012-12-01

    It has been proposed that most drug-resistant mutants, resulting from a single-nucleotide change, exist at low frequency in human immunodeficiency virus type 1 (HIV-1) and simian immunodeficiency virus (SIV) populations in vivo prior to the initiation of antiretroviral therapy (ART). To test this hypothesis and to investigate the emergence of resistant mutants with drug selection, we developed a new ultrasensitive allele-specific PCR (UsASP) assay, which can detect drug resistance mutations at a frequency of ≥0.001% of the virus population. We applied this assay to plasma samples obtained from macaques infected with an SIV variant containing HIV-1 reverse transcriptase (RT) (RT-simian-human immunodeficiency [SHIV](mne)), before and after they were exposed to a short course of efavirenz (EFV) monotherapy. We detected RT inhibitor (RTI) resistance mutations K65R and M184I but not K103N in 2 of 2 RT-SHIV-infected macaques prior to EFV exposure. After three doses over 4 days of EFV monotherapy, 103N mutations (AAC and AAT) rapidly emerged and increased in the population to levels of ∼20%, indicating that they were present prior to EFV exposure. The rapid increase of 103N mutations from <0.001% to 20% of the viral population indicates that the replicating virus population size in RT-SHIV-infected macaques must be 10(6) or more infected cells per replication cycle.

  10. Homozygosity and Heterozygosity for Null Col5a2 Alleles Produce Embryonic Lethality and a Novel Classic Ehlers-Danlos Syndrome-Related Phenotype.

    PubMed

    Park, Arick C; Phillips, Charlotte L; Pfeiffer, Ferris M; Roenneburg, Drew A; Kernien, John F; Adams, Sheila M; Davidson, Jeffrey M; Birk, David E; Greenspan, Daniel S

    2015-07-01

    Null alleles for the COL5A1 gene and missense mutations for COL5A1 or the COL5A2 gene underlie cases of classic Ehlers-Danlos syndrome, characterized by fragile, hyperextensible skin and hypermobile joints. However, no classic Ehlers-Danlos syndrome case has yet been associated with COL5A2 null alleles, and phenotypes that might result from such alleles are unknown. We describe mice with null alleles for the Col5a2. Col5a2(-/-) homozygosity is embryonic lethal at approximately 12 days post conception. Unlike previously described mice null for Col5a1, which die at 10.5 days post conception and virtually lack collagen fibrils, Col5a2(-/-) embryos have readily detectable collagen fibrils, thicker than in wild-type controls. Differences in Col5a2(-/-) and Col5a1(-/-) fibril formation and embryonic survival suggest that α1(V)3 homotrimers, a rare collagen V isoform that occurs in the absence of sufficient levels of α2(V) chains, serve functional roles that partially compensate for loss of the most common collagen V isoform. Col5a2(+/-) adults have skin with marked hyperextensibility and reduced tensile strength at high strain but not at low strain. Col5a2(+/-) adults also have aortas with increased compliance and reduced tensile strength. Results thus suggest that COL5A2(+/-) humans, although unlikely to present with frank classic Ehlers-Danlos syndrome, are likely to have fragile connective tissues with increased susceptibility to trauma and certain chronic pathologic conditions.

  11. WDR73 missense mutation causes infantile onset intellectual disability and cerebellar hypoplasia in a consanguineous family.

    PubMed

    Jiang, Chen; Gai, Nan; Zou, Yongyi; Zheng, Yu; Ma, Ruiyu; Wei, Xianda; Liang, Desheng; Wu, Lingqian

    2017-01-01

    Galloway-Mowat syndrome (GMS) is a very rare autosomal-recessive disorder characterized by nephrotic syndrome associated with microcephaly, and various central nervous system abnormalities, mostly cerebral hypoplasia or cerebellar atrophy, intellectual disability and neural-migration defects. WDR73 is the only gene known to cause GMS, and has never been implicated in other disease. Here we present a Chinese consanguineous family with infantile onset intellectual disability and cerebellar hypoplasia but no microcephaly. Whole exome sequencing identified a WDR73 p.W371G missense mutation. The mutation is confirmed to be segregated in this family by Sanger sequencing according to a recessive inheritance pattern. It is predicted to be deleterious by multiple algorithms and affect highly conserved site. Structural modeling revealed conformational differences between the wild type protein and the p.W371G protein. Real-time PCR and Western blotting revealed altered mRNA and protein levels in mutated samples. Our study indicates the novel WDR73 p.W371G missense mutation causes infantile onset intellectual disability and cerebellar hypoplasia in recessive mode of inheritance. Our findings imply that microcephaly is a variable phenotype in WDR73-related disease, suggest WDR73 to be a candidate gene of severe intellectual disability and cerebellar hypoplasia, and expand the molecular spectrum of WDR73-related disease.

  12. A novel missense mutation in the paired domain of PAX9 causes non-syndromic oligodontia.

    PubMed

    Jumlongras, Dolrudee; Lin, Jenn-Yih; Chapra, Anas; Seidman, Christine E; Seidman, Jonathan G; Maas, Richard L; Olsen, Bjorn R

    2004-02-01

    PAX9, a paired domain transcription factor, has important functions in craniofacial and limb development. Heterozygous mutations of PAX9, including deletion, nonsense, or frameshift mutations that lead to a premature stop codon, and missense mutations, were previously shown to be associated with autosomal dominant oligodontia. Here, we report a novel missense mutation that lies in the highly conserved paired domain of PAX9 and that is associated with non-syndromic oligodontia in one family. The mutation, 83G-->C, is predicted to result in the substitution of arginine by proline (R28P) in the N-terminal subdomain of PAX9 paired domain. To rule out the possibility that this substitution is a rare polymorphism and to test whether the predicted amino acid substitution disrupts protein-DNA binding, we analyzed the binding of wild-type and mutant PAX9 paired domain to double-stranded DNA targets. The R28P mutation dramatically reduces DNA binding of the PAX9 paired domain and supports the hypothesis that loss of DNA binding is the pathogenic mechanism by which the mutation causes oligodontia.

  13. A novel missense mutation in MVK associated with MK deficiency and dyserythropoietic anemia.

    PubMed

    Samkari, Ayman; Borzutzky, Arturo; Fermo, Elisa; Treaba, Diana O; Dedeoglu, Fatma; Altura, Rachel A

    2010-04-01

    Mevalonate kinase deficiency (MKD) is a rare inborn error of metabolism caused by mutations in the mevalonate kinase (MVK) gene. The clinical phenotype is variable, ranging from the hyperimmunoglobulinemia D and periodic fever syndrome (HIDS) to mevalonic aciduria (MA), a severe metabolic disease. We report here for the first time (to our knowledge) the case of a patient with MKD and congenital dyserythropoietic anemia. Clinical and laboratory characteristics of inflammatory attacks were compatible with HIDS, but mild dysmorphic features and elevated urinary mevalonic acid levels in the absence of an inflammatory attack suggested an intermediate phenotype between HIDS and MA. Genomic sequencing of the MVK gene revealed compound heterozygosity for a missense mutation previously described in MA (V310M) and a novel missense mutation (Y116H). By contrast, sequencing of the novel CDAII (SEC23B) gene revealed no mutations, suggesting that the bone marrow abnormalities were causally related to the MKD. Treatment with corticosteroids and colchicine directed at controlling the autoinflammatory disease resulted in improvement of the anemia.

  14. A Novel Missense Mutation of the DDHD1 Gene Associated with Juvenile Amyotrophic Lateral Sclerosis

    PubMed Central

    Wu, Chujun; Fan, Dongsheng

    2016-01-01

    Background: Juvenile amyotrophic lateral sclerosis (jALS) is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients. Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS) technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis. Results: We identified a novel c.1483A>G (p.Met495Val) homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the database of dbSNP, ExAC and 1000G. Conclusion: The novel c.1483A>G (p.Met495Val) missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS. PMID:27999540

  15. Intellectual disability associated with a homozygous missense mutation in THOC6

    PubMed Central

    2013-01-01

    Background We recently described a novel autosomal recessive neurodevelopmental disorder with intellectual disability in four patients from two related Hutterite families. Identity-by-descent mapping localized the gene to a 5.1 Mb region at chromosome 16p13.3 containing more than 170 known or predicted genes. The objective of this study was to identify the causative gene for this rare disorder. Methods and results Candidate gene sequencing followed by exome sequencing identified a homozygous missense mutation p.Gly46Arg, in THOC6. No other potentially causative coding variants were present within the critical region on chromosome 16. THOC6 is a member of the THO/TREX complex which is involved in coordinating mRNA processing with mRNA export from the nucleus. In situ hybridization showed that thoc6 is highly expressed in the midbrain and eyes. Cellular localization studies demonstrated that wild-type THOC6 is present within the nucleus as is the case for other THO complex proteins. However, mutant THOC6 was predominantly localized to the cytoplasm, suggesting that the mutant protein is unable to carry out its normal function. siRNA knockdown of THOC6 revealed increased apoptosis in cultured cells. Conclusion Our findings associate a missense mutation in THOC6 with intellectual disability, suggesting the THO/TREX complex plays an important role in neurodevelopment. PMID:23621916

  16. Congenital afibrinogenemia: identification and expression of a missense mutation in FGB impairing fibrinogen secretion.

    PubMed

    Vu, Dung; Bolton-Maggs, Paula H B; Parr, Jeremy R; Morris, Michael A; de Moerloose, Philippe; Neerman-Arbez, Marguerite

    2003-12-15

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by complete absence of detectable fibrinogen. We previously identified the first causative mutations for this disease: a homozygous deletion of approximately 11 kb of the fibrinogen alpha-chain gene (FGA). Subsequent studies revealed that the great majority of afibrinogenemia mutations are localized in FGA, but mutations were also found in FGG and FGB. Apart from 3 missense mutations identified in the C-terminal portion of FGB, all fibrinogen gene mutations responsible for afibrinogenemia are null. In this study, a young boy with afibrinogenemia was found to be a compound heterozygote for 2 mutations in FGB: an N-terminal nonsense mutation W47X (exon 2) and a missense mutation (G444S, exon 8). Coexpression of the FGB G444S mutant cDNA in combination with wild-type FGA and FGG cDNAs demonstrated that fibrinogen molecules containing the mutant beta chain are able to assemble but are not secreted into the media, confirming the pathogenic nature of the identified mutation.

  17. Exome-chip association analysis reveals an Asian-specific missense variant in PAX4 associated with type 2 diabetes in Chinese individuals.

    PubMed

    Cheung, Chloe Y Y; Tang, Clara S; Xu, Aimin; Lee, Chi-Ho; Au, Ka-Wing; Xu, Lin; Fong, Carol H Y; Kwok, Kelvin H M; Chow, Wing-Sun; Woo, Yu-Cho; Yuen, Michele M A; Hai, JoJo S H; Jin, Ya-Li; Cheung, Bernard M Y; Tan, Kathryn C B; Cherny, Stacey S; Zhu, Feng; Zhu, Tong; Thomas, G Neil; Cheng, Kar-Keung; Jiang, Chao-Qiang; Lam, Tai-Hing; Tse, Hung-Fat; Sham, Pak-Chung; Lam, Karen S L

    2017-01-01

    Genome-wide association studies (GWASs) have identified many common type 2 diabetes-associated variants, mostly at the intronic or intergenic regions. Recent advancements of exome-array genotyping platforms have opened up a novel means for detecting the associations of low-frequency or rare coding variants with type 2 diabetes. We conducted an exomechip association analysis to identify additional type 2 diabetes susceptibility variants in the Chinese population. An exome-chip association study was conducted by genotyping 5640 Chinese individuals from Hong Kong, using a custom designed exome array, the Asian Exomechip. Single variant association analysis was conducted on 77,468 single nucleotide polymorphisms (SNPs). Fifteen SNPs were subsequently genotyped for replication analysis in an independent Chinese cohort comprising 12,362 individuals from Guangzhou. A combined analysis involving 7189 cases and 10,813 controls was performed. In the discovery stage, an Asian-specific coding variant rs2233580 (p.Arg192His) in PAX4, and two variants at the known loci, CDKN2B-AS1 and KCNQ1, were significantly associated with type 2 diabetes with exome-wide significance (p discovery < 6.45 × 10(-7)). The risk allele (T) of PAX4 rs2233580 was associated with a younger age at diabetes diagnosis. This variant was replicated in an independent cohort and demonstrated a stronger association that reached genome-wide significance (p meta-analysis [p meta] = 3.74 × 10(-15)) in the combined analysis. We identified the association of a PAX4 Asian-specific missense variant rs2233580 with type 2 diabetes in an exome-chip association analysis, supporting the involvement of PAX4 in the pathogenesis of type 2 diabetes. Our findings suggest PAX4 is a possible effector gene of the 7q32 locus, previously identified from GWAS in Asians.

  18. A novel common large genomic deletion and two new missense mutations identified in the Romanian phenylketonuria population.

    PubMed

    Gemperle-Britschgi, Corinne; Iorgulescu, Daniela; Mager, Monica Alina; Anton-Paduraru, Dana; Vulturar, Romana; Thöny, Beat

    2016-01-15

    The mutation spectrum for the phenylalanine hydroxylase (PAH) gene was investigated in a cohort of 84 hyperphenylalaninemia (HPA) patients from Romania identified through newborn screening or neurometabolic investigations. Differential diagnosis identified 81 patients with classic PAH deficiency while 3 had tetrahydropterin-cofactor deficiency and/or remained uncertain due to insufficient specimen. PAH-genetic analysis included a combination of Sanger sequencing of exons and exon–intron boundaries, MLPA and NGS with genomic DNA, and cDNA analysis from immortalized lymphoblasts. A diagnostic efficiency of 99.4% was achieved, as for one allele (out of a total of 162 alleles) no mutation could be identified. The most prevalent mutation was p.Arg408Trp which was found in ~ 38% of all PKU alleles. Three novel mutations were identified, including the two missense mutations p.Gln226Lys and p.Tyr268Cys that were both disease causing by prediction algorithms, and the large genomic deletion EX6del7831 (c.509 + 4140_706 + 510del7831) that resulted in skipping of exon 6 based on PAH-cDNA analysis in immortalized lymphocytes. The genomic deletion was present in a heterozygous state in 12 patients, i.e. in ~ 8% of all the analyzed PKU alleles, and might have originated from a Romanian founder.

  19. A critical functional missense mutation (H173R) in the bovine PROP1 gene significantly affects growth traits in cattle.

    PubMed

    Pan, Chuanying; Wu, Chongyang; Jia, Wenchao; Xu, Yao; Lei, Chuzhao; Hu, Shenrong; Lan, Xianyong; Chen, Hong

    2013-12-01

    The PROP1 protein, encoded by the prophet of Pit-1 (PROP1) gene, exhibits both DNA-binding and transcriptional activation abilities. Its expression leads to the ontogenesis of growth hormone (GH), prolactin (PRL), thyroid-stimulating hormone (TSH), and pituitary hormone. The missense mutation H173R in PROP1 may result in deficiencies of GH, PRL, TSH, and Pit-1, thereby affecting growth traits. The objective of this study was to characterize the H173R mutation within the PROP1 gene and examine its associations with growth traits in cattle. Accordingly, the H173R mutation was genotyped in 1207 cows belonging to five Chinese native breeds. Three genotypes were identified among the specimens, with genotype AA being the major one. Consequently, the "G" allele was the minor allele. Association testing revealed that the H173R mutation was significantly associated with body weight, average daily weight gain and physical parameters in the analyzed breeds. Interestingly, the cows with genotype AG and/or AA had superior growth traits compared with those expressing the GG genotype, in all tested breeds. These findings revealed that the "A" allele had positive effects on growth traits, which was consistent with the increasing binding ability and enhanced activation capacity associated with the bovine isoform PROP1-173H, representing the "A" allele. Therefore, the H173R mutation can be considered as a DNA marker for selecting individuals with superior growth traits, thereby contributing to research on breeding and genetics in the beef industry.

  20. The molecular basis of variable phenotypic severity among common missense mutations causing Rett syndrome

    PubMed Central

    Brown, Kyla; Selfridge, Jim; Lagger, Sabine; Connelly, John; De Sousa, Dina; Kerr, Alastair; Webb, Shaun; Guy, Jacky; Merusi, Cara; Koerner, Martha V.; Bird, Adrian

    2016-01-01

    Rett syndrome is caused by mutations in the X-linked MECP2 gene, which encodes a chromosomal protein that binds to methylated DNA. Mouse models mirror the human disorder and therefore allow investigation of phenotypes at a molecular level. We describe an Mecp2 allelic series representing the three most common missense Rett syndrome (RTT) mutations, including first reports of Mecp2[R133C] and Mecp2[T158M] knock-in mice, in addition to Mecp2[R306C] mutant mice. Together these three alleles comprise ∼25% of all RTT mutations in humans, but they vary significantly in average severity. This spectrum is mimicked in the mouse models; R133C being least severe, T158M most severe and R306C of intermediate severity. Both R133C and T158M mutations cause compound phenotypes at the molecular level, combining compromised DNA binding with reduced stability, the destabilizing effect of T158M being more severe. Our findings contradict the hypothesis that the R133C mutation exclusively abolishes binding to hydroxymethylated DNA, as interactions with DNA containing methyl-CG, methyl-CA and hydroxymethyl-CA are all reduced in vivo. We find that MeCP2[T158M] is significantly less stable than MeCP2[R133C], which may account for the divergent clinical impact of the mutations. Overall, this allelic series recapitulates human RTT severity, reveals compound molecular aetiologies and provides a valuable resource in the search for personalized therapeutic interventions. PMID:26647311

  1. The molecular basis of variable phenotypic severity among common missense mutations causing Rett syndrome.

    PubMed

    Brown, Kyla; Selfridge, Jim; Lagger, Sabine; Connelly, John; De Sousa, Dina; Kerr, Alastair; Webb, Shaun; Guy, Jacky; Merusi, Cara; Koerner, Martha V; Bird, Adrian

    2016-02-01

    Rett syndrome is caused by mutations in the X-linked MECP2 gene, which encodes a chromosomal protein that binds to methylated DNA. Mouse models mirror the human disorder and therefore allow investigation of phenotypes at a molecular level. We describe an Mecp2 allelic series representing the three most common missense Rett syndrome (RTT) mutations, including first reports of Mecp2[R133C] and Mecp2[T158M] knock-in mice, in addition to Mecp2[R306C] mutant mice. Together these three alleles comprise ∼25% of all RTT mutations in humans, but they vary significantly in average severity. This spectrum is mimicked in the mouse models; R133C being least severe, T158M most severe and R306C of intermediate severity. Both R133C and T158M mutations cause compound phenotypes at the molecular level, combining compromised DNA binding with reduced stability, the destabilizing effect of T158M being more severe. Our findings contradict the hypothesis that the R133C mutation exclusively abolishes binding to hydroxymethylated DNA, as interactions with DNA containing methyl-CG, methyl-CA and hydroxymethyl-CA are all reduced in vivo. We find that MeCP2[T158M] is significantly less stable than MeCP2[R133C], which may account for the divergent clinical impact of the mutations. Overall, this allelic series recapitulates human RTT severity, reveals compound molecular aetiologies and provides a valuable resource in the search for personalized therapeutic interventions.

  2. Missense mutation (E150K) of rhodopsin in autosomal recessive retinitis pigmentosa

    SciTech Connect

    Orth, U.; Oehlmann, R.; Gal, A.

    1994-09-01

    Missense or nonsense mutations of the rhodopsin gene have been implied in the pathogenesis of at least 3 different traits; autosomal dominant retinitis pigmentosa (adRP), congenital stationary night blindness (CSNB), and autosomal recessive retinitis pigmentosa (arRP). For the latter, a single patient has been reported with a nonsense mutation at codon 249 on both alleles. Heterozygous carriers of missense mutations of rhodopsin develop either adRP or CSNB depending on the particular amino acid substitution. Four of the 9 siblings from a consanguineous marriage in southern India were reported the have arRP. Mutational screening and sequencing of the rhodopsin gene revealed a G-to-A transition of the first nucleotide at codon 150 in exon II, which alters glutamate to lysine. The E150K mutation was present in the 4 patients in homozygous form, whereas the parents and 2 of the siblings were heterozygotes. Two-point analysis produced a Zmax=3.46 at theta=0.00. Two unaffected siblings who are heterozygotes for the E150K mutation underwent a thorough ophthalmological and psychophysical examination. No clinical abnormalities were found although these individuals were over forty, whereas the onset of RP in their affected siblings was in the second decade. Collectively, both the genetic and clinical findings strongly suggest that the E150K mutation of rhodopsin is recessive in this family. Glu150 forms part of the CD cytoplasmic loop of rhodopsin, which has been implicated in the binding and activation of transducin. We speculate that E150K leads to RP because the mutant protein may be incapable of activating transducin. It is tempting to speculate that, in addition to mutations in the genes for rhodopsin and the {beta}-subunit of PDE, mutations in the genes for transducin may also result in arRP.

  3. Molecular analysis of the VP7, VP4, VP6, NSP4, and NSP5/6 genes of a buffalo rotavirus strain: identification of the rare P[3] rhesus rotavirus-like VP4 gene allele.

    PubMed

    Martella, V; Ciarlet, M; Pratelli, A; Arista, S; Terio, V; Elia, G; Cavalli, A; Gentile, M; Decaro, N; Greco, G; Cafiero, M A; Tempesta, M; Buonavoglia, C

    2003-12-01

    We report the detection and molecular characterization of a rotavirus strain, 10733, isolated from the feces of a buffalo calf affected with diarrhea in Italy. Strain 10733 was classified as a P[3] rotavirus, as the VP8* trypsin cleavage product of the VP4 protein revealed a high amino acid identity (96.2%) with that of rhesus rotavirus strain RRV (P5B[3]), used as the recipient virus in the human-simian reassortant vaccine. Analysis of the VP7 gene product revealed that strain 10733 possessed G6 serotype specificity, a type common in ruminants, with an amino acid identity to G6 rotavirus strains ranging from 88 to 98%, to Venezuelan bovine strain BRV033, and Hungarian human strain Hun4. Phylogenetic analysis based on the VP7 gene of G6 rotaviruses identified at least four lineages and an apparent linkage between each lineage and the VP4 specificity, suggesting the occurrence of repeated interspecies transmissions and genetic reassortment events between ruminant and human rotaviruses. Moreover, strain 10733 displayed a bovine-like NSP4 and NSP5/6 and a subgroup I VP6 specificity, as well as a long electropherotype pattern. The detection of the rare P[3] genotype in ruminants provides additional evidence for the wide genetic and antigenic diversity of group A rotaviruses.

  4. Novel mutations, including a novel G659A missense mutation, of the FUT1 gene are responsible for the para-Bombay phenotype.

    PubMed

    Sun, C F; Lo, M D; Lee, C H; Chu, D C

    2000-10-01

    Para-Bombay phenotype, with an estimated incidence of 1 in 8000 in Taiwanese residents based on serological analysis, is caused by aberrant alpha(1,2)-fucosyltransferase function and hence diminished H-antigen synthesis. In an individual with para-Bombay phenotype, DNA sequencing revealed two missense mutations previously reported C658T mutation and a novel G659A mutation. Haplotype analysis with restriction enzyme digestion showed that the two mutations are located on opposing alleles of the H (FUT1) gene and lead to compound heterozygosity. Since no other known genetic changes were evident, it appears that the new missense mutation, G659A, is deleterious to the alpha(1,2)-fucosyltransferase function encoded by the H (FUT1) gene.

  5. Exploring Missense Mutations in Tyrosine Kinases Implicated with Neurodegeneration.

    PubMed

    Sami, Neha; Kumar, Vijay; Islam, Asimul; Ali, Sher; Ahmad, Faizan; Hassan, Imtaiyaz

    2017-09-01

    Protein kinases are one of the largest families of evolutionarily related proteins and the third most common protein class of human genome. All the protein kinases share the same structural organization. They are made up of an extracellular domain, transmembrane domain and an intra cellular kinase domain. Missense mutations in these kinases have been studied extensively and correlated with various neurological disorders. Individual mutations in the kinase domain affect the functions of protein. The enhanced or reduced expression of protein leads to hyperactivation or inactivation of the signalling pathways, resulting in neurodegeneration. Here, we present extensive analyses of missense mutations in the tyrosine kinase focussing on the neurodegenerative diseases encompassing structure function relationship. This is envisaged to enhance our understanding about the neurodegeneration and possible therapeutic measures.

  6. Increased prevalence of mutant null alleles that cause hereditary fructose intolerance in the American population.

    PubMed

    Coffee, Erin M; Yerkes, Laura; Ewen, Elizabeth P; Zee, Tiffany; Tolan, Dean R

    2010-02-01

    Mutations in the aldolase B gene (ALDOB) impairing enzyme activity toward fructose-1-phosphate cleavage cause hereditary fructose intolerance (HFI). Diagnosis of the disease is possible by identifying known mutant ALDOB alleles in suspected patients; however, the frequencies of mutant alleles can differ by population. Here, 153 American HFI patients with 268 independent alleles were analyzed to identify the prevalence of seven known HFI-causing alleles (A149P, A174D, N334K, Delta4E4, R59Op, A337V, and L256P) in this population. Allele-specific oligonucleotide hybridization analysis was performed on polymerase chain reaction (PCR)-amplified genomic DNA from these patients. In the American population, the missense mutations A149P and A174D are the two most common alleles, with frequencies of 44% and 9%, respectively. In addition, the nonsense mutations Delta4E4 and R59Op are the next most common alleles, with each having a frequency of 4%. Together, the frequencies of all seven alleles make up 65% of HFI-causing alleles in this population. Worldwide, these same alleles make up 82% of HFI-causing mutations. This difference indicates that screening for common HFI alleles is more difficult in the American population. Nevertheless, a genetic screen for diagnosing HFI in America can be improved by including all seven alleles studied here. Lastly, identification of HFI patients presenting with classic symptoms and who have homozygous null genotypes indicates that aldolase B is not required for proper development or metabolic maintenance.

  7. Increased prevalence of mutant null alleles that cause hereditary fructose intolerance in the American population

    PubMed Central

    Coffee, Erin M.; Yerkes, Laura; Ewen, Elizabeth P.; Zee, Tiffany

    2010-01-01

    Mutations in the aldolase B gene (ALDOB) impairing enzyme activity toward fructose-1-phosphate cleavage cause hereditary fructose intolerance (HFI). Diagnosis of the disease is possible by identifying known mutant ALDOB alleles in suspected patients; however, the frequencies of mutant alleles can differ by population. Here, 153 American HFI patients with 268 independent alleles were analyzed to identify the prevalence of seven known HFI-causing alleles (A149P, A174D, N334K, Δ4E4, R59Op, A337V, and L256P) in this population. Allele-specific oligonucleotide hybridization analysis was performed on polymerase chain reaction (PCR)-amplified genomic DNA from these patients. In the American population, the missense mutations A149P and A174D are the two most common alleles, with frequencies of 44% and 9%, respectively. In addition, the nonsense mutations Δ4E4 and R59Op are the next most common alleles, with each having a frequency of 4%. Together, the frequencies of all seven alleles make up 65% of HFI-causing alleles in this population. Worldwide, these same alleles make up 82% of HFI-causing mutations. This difference indicates that screening for common HFI alleles is more difficult in the American population. Nevertheless, a genetic screen for diagnosing HFI in America can be improved by including all seven alleles studied here. Lastly, identification of HFI patients presenting with classic symptoms and who have homozygous null genotypes indicates that aldolase B is not required for proper development or metabolic maintenance. PMID:20033295

  8. Lack of association to a NRG1 missense polymorphism in schizophrenia or bipolar disorder in a Costa Rican population.

    PubMed

    Moon, Emily; Rollins, Brandi; Mesén, Andrea; Sequeira, Adolfo; Myers, Richard M; Akil, Huda; Watson, Stanley J; Barchas, Jack; Jones, Edward G; Schatzberg, Alan; Bunney, William E; DeLisi, Lynn E; Byerley, William; Vawter, Marquis P

    2011-09-01

    A missense polymorphism in the NRG1 gene, Val>Leu in exon 11, was reported to increase the risk of schizophrenia in selected families from the Central Valley region of Costa Rica (CVCR). The present study investigated the relationship between three NRG1 genetic variants, rs6994992, rs3924999, and Val>Leu missense polymorphism in exon 11, in cases and selected controls from an isolated population from the CVCR. Isolated populations can have less genetic heterogeneity and increase power to detect risk variants in candidate genes. Subjects with bipolar disorder (BD, n=358), schizophrenia (SZ, n=273), or unrelated controls (CO, n=479) were genotyped for three NRG1 variants. The NRG1 promoter polymorphism (rs6994992) was related to altered expression of NRG1 Type IV in other studies. The expression of NRG1 type IV in the dorsolateral prefrontal cortex (DLPFC) and the effect of the rs6994992 genotype on expression were explored in a postmortem cohort of BD, SZ, major depressive disorder (MDD) cases, and controls. The missense polymorphism Val>Leu in exon 11 was not significantly associated with schizophrenia as previously reported in a family sample from this population, the minor allele frequency is 4%, thus our sample size is not large enough to detect an association. We observed however an association of rs6994992 with NRG1 type IV expression in DLPFC and a significantly decreased expression in MDD compared to controls. The present results while negative do not rule out a genetic association of these SNPs with BD and SZ in CVCR, perhaps due to small risk effects that we were unable to detect and potential intergenic epistasis. The previous genetic relationship between expression of a putative brain-specific isoform of NRG1 type IV and SNP variation was replicated in postmortem samples in our preliminary study.

  9. Evidence for selection against human lung cancers bearing p53 missense mutations which occur within the HLA A*0201 peptide consensus motif.

    PubMed

    Wiedenfeld, E A; Fernandez-Viña, M; Berzofsky, J A; Carbone, D P

    1994-03-01

    Short peptide fragments of intracellular proteins that fit a defined sequence motif bind to the most common human major histocompatibility complex class I molecule, HLA A*0201, and mediate killing by cytotoxic T-cells [D.F. Hunt et al., Science (Washington DC), 255: 1261-1263, 1992; K. Falk et al., Nature (Lond.), 351: 290-296, 1991]. The existence of such a motif allows prediction of whether novel peptides derived from mutant oncoporteins might be presented on the surface of cancer cells bearing that HLA allele. Clinical cancer might develop only when these mutations occur outside a major histocompatibility complex binding motif or in those cells that acquire defects in antigen presentation. Here, we find that missense mutations of p53 from a variety of tumors fall within the HLA A*0201 motif less often than would be expected if the location of mutations and motifs were independent. When we analyzed the HLA subtype of lung cancer cell lines with known p53 missense mutations, we found that all of the mutant oncopeptides predicted to be presentable by HLA A*0201 came from tumors that either did not carry the A*0201 allele or had lost that allele in the process of tumorigenesis. Presentation of mutant oncogene peptides on class I major histocompatibility complex might thus represent a physiologically significant selection pressure in the development of human cancer.

  10. Paediatric intestinal cancer and polyposis due to bi-allelic PMS2 mutations: case series, review and follow-up guidelines.

    PubMed

    Herkert, Johanna C; Niessen, Renée C; Olderode-Berends, Maria J W; Veenstra-Knol, Hermine E; Vos, Yvonne J; van der Klift, Heleen M; Scheenstra, Rene; Tops, Carli M J; Karrenbeld, Arend; Peters, Frans T M; Hofstra, Robert M W; Kleibeuker, Jan H; Sijmons, Rolf H

    2011-05-01

    Bi-allelic germline mutations of one of the DNA mismatch repair genes, so far predominantly found in PMS2, cause constitutional MMR-deficiency syndrome. This rare disorder is characterised by paediatric intestinal cancer and other malignancies. We report the clinical, immunohistochemical and genetic characterisation of four families with bi-allelic germline PMS2 mutations. We present an overview of the published gastrointestinal manifestations of CMMR-D syndrome and propose recommendations for gastro-intestinal screening. The first proband developed a cerebral angiosarcoma at age 2 and two colorectal adenomas at age 7. Genetic testing identified a complete PMS2 gene deletion and a frameshift c.736_741delinsTGTGTGTGAAG (p.Pro246CysfsX3) mutation. In the second family, both the proband and her brother had multiple intestinal adenomas, initially wrongly diagnosed as familial adenomatous polyposis. A splice site c.2174+1G>A, and a missense c.137G>T (p.Ser46Ile) mutation in PMS2 were identified. The third patient was diagnosed with multiple colorectal adenomas at age 11; he developed a high-grade dysplastic colorectal adenocarcinoma at age 21. Two intragenic PMS2 deletions were found. The fourth proband developed a cerebral anaplastic ganglioma at age 9 and a high-grade colerectal dysplastic adenoma at age 10 and carries a homozygous c.2174+1G>A mutation. Tumours of all patients showed microsatellite instability and/or loss of PMS2 expression. Our findings show the association between bi-allelic germline PMS2 mutations and severe childhood-onset gastrointestinal manifestations, and support the notion that patients with early-onset gastrointestinal adenomas and cancer should be investigated for CMMR-D syndrome. We recommend yearly follow-up with colonoscopy from age 6 and simultaneous video-capsule small bowel enteroscopy from age 8. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Early onset, non fluctuating spinocerebellar ataxia and a novel missense mutation in CACNA1A gene.

    PubMed

    Tonelli, Alessandra; D'Angelo, Maria Grazia; Salati, Roberto; Villa, Laura; Germinasi, Chiara; Frattini, Tiziano; Meola, Giovanni; Turconi, Anna Carla; Bresolin, Nereo; Bassi, Maria Teresa

    2006-02-15

    Mutations in the brain-specific P/Q type Ca2+ channel alpha1 subunit gene, CACNA1A, have been identified in three clinically distinct disorders, spinocerebellar ataxia type 6 (SCA6), episodic ataxia type 2 (EA2), and familial hemiplegic migraine type 1 (FHM1). SCA6 is associated with small expansions of a CAG repeat at the 3' end of the gene, while point mutations are mostly responsible for its two allelic disorders, FHMI and EA2. From the electrophysiological point of view, while FHMI mutations lead to a gain of function [Tottene A, Fellin T, Pagnutti S, Luvisetto S, Striessnig J, Fletcher C, et al. Familial hemiplegic migraine mutations increase Ca2+ influx through single human CaV2.1 channels and decrease maximal CaV2.1 current density in neurons. Proc Natl Acad Sci 99 (20) (2002) 13284-13289.], EA2 mutations usually generate a loss of channel function [Guida S, Trettel F, Pagnutti S, Mantuano E, Tottene A, Veneziano L, et al. Complete loss of P/Q calcium channel activity caused by a CACNA1A missense mutation carried by patients with episodic ataxia type 2. Am J Hum Genet 68 (3) (2001) 759-764, Wappl E, Koschak A, Poteser M, Sinnegger MJ, Walter D, Eberhart A, et al. Functional consequences of P/Q-type Ca2+ channel Cav2.1 missense mutations associated with episodic ataxia type 2 and progressive ataxia. J Biol Chem 277 (9) (2002) 6960-6966.]. In the present study, we describe a child affected by permanent non-fluctuating limb and trunk ataxia with a quite early age of onset. Interestingly, the size of the CACNA1A triplet repeat region in the patient is within the normal range while he carries a novel de novo missense mutation in this gene, p.R1664Q. Although functional data are not available, based on the literature data indicating that severe reductions in P/Q-type channel activity favour episodic and/or progressive ataxic symptoms [Wappl E, Koschak A, Poteser M, Sinnegger MJ, Walter D, Eberhart A, et al. Functional consequences of P/Q-type Ca2+ channel Cav2

  12. Functional study on a novel missense mutation of the transcription factor FOXL2 causes blepharophimosis-ptosis-epicanthus inversus syndrome (BPES).

    PubMed

    Fan, Jia-Yan; Han, Bing; Qiao, Jie; Liu, Bing-Li; Ji, Yong-Rong; Ge, Sheng-Fang; Song, Huai-Dong; Fan, Xian-Qun

    2011-03-01

    Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a rare autosomal dominant disease caused by FOXL2 gene mutations. However, only one missense mutation has been found in family with BPES type I. Here, we report a novel missense mutation in the forkhead domain of the FOXL2 gene (c.340A > G, NM_023067) resulted in the replacement of lysine by glutamic acid at amino acid position 114 of the FOXL2 protein (p.K114E, NP_075555) that was identified in a Chinese family with BPES type I, members of which displayed clinical symptoms such as shortened palpebral fissures, drooping eyelids, a vertical skin fold arising from the lower eyelid, and premature ovarian failure (POF) in affected females. Based on the patients' clinical features and computational analysis of this missense mutation in a three-dimensional structural model, we hypothesised that the mutation might disturb the intermolecular contacts between FOXL2 and the StAR gene. The disturbance of this interaction might contribute to the POF observed in BPES type I patients. We performed subcellular localisation and functional studies and as expected, observed significant nuclear aggregation and cytoplasmic mislocalization of the mutant type protein and loss-of-function was confirmed by electrophoretic mobility shift assays, transcriptional activity assays and quantitative real-time polymerase chain reaction. This functional study on a novel missense mutation has important implications for the molecular analysis of this gene.

  13. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors.

    PubMed

    Fontanesi, L; Beretti, F; Riggio, V; Gómez González, E; Dall'Olio, S; Davoli, R; Russo, V; Portolano, B

    2009-01-01

    In goats, classical genetic studies reported a large number of alleles at the Agouti locus with effects on coat color and pattern distribution. From these early studies, the dominant A(Wt) (white/tan) allele was suggested to cause the white color of the Saanen breed. Here, we sequenced the coding region of the goat ASIP gene in 6 goat breeds (Girgentana, Maltese, Derivata di Siria, Murciano-Granadina, Camosciata delle Alpi, and Saanen), with different coat colors and patterns. Five single nucleotide polymorphisms (SNPs) were identified, 3 of which caused missense mutations in conserved positions of the cysteine-rich carboxy-terminal domain of the protein (p.Ala96Gly, p.Cys126Gly, and p.Val128Gly). Allele and genotype frequencies suggested that these mutations are not associated or not completely associated with coat color in the investigated goat breeds. Moreover, genotyping and sequencing results, deviation from Hardy-Weinberg equilibrium, as well as allele copy number evaluation from semiquantitative fluorescent multiplex PCR, indicated the presence of copy number variation (CNV) in all investigated breeds. To confirm the presence of CNV and evaluate its extension, we applied a bovine-goat cross-species array comparative genome hybridization (aCGH) experiment using a custom tiling array based on bovine chromosome 13. aCGH results obtained for 8 goat DNA samples confirmed the presence of CNV affecting a region of less that 100 kb including the ASIP and AHCY genes. In Girgentana and Saanen breeds, this CNV might cause the A(Wt) allele, as already suggested for a similar structural mutation in sheep affecting the ASIP and AHCY genes, providing evidence for a recurrent interspecies CNV. However, other mechanisms may also be involved in determining coat color in these 2 breeds.

  14. Identification of 83 novel alpha-mannosidosis-associated sequence variants: functional analysis of MAN2B1 missense mutations.

    PubMed

    Riise Stensland, Hilde Monica Frostad; Klenow, Helle Bagterp; Van Nguyen, Lam; Hansen, Gaute Martin; Malm, Dag; Nilssen, Øivind

    2012-03-01

    The lysosomal storage disorder alpha-mannosidosis is caused by deficiency of the enzyme lysosomal alpha-mannosidase (MAN2B1). In this study, 96 disease-associated sequence variants were identified in 130 unrelated alpha-mannosidosis patients from 30 countries. Eighty-three novel variants were detected, extending the mutation spectrum from 42 to 125. In total, 256 of the 260 mutant alleles (98.5%) were identified. Most of the variants were unique to each family, however, c.2248C>T (p.Arg750Trp) was detected in 50 patients from 16 countries, and accounted for 27.3% of the disease alleles. Haplotype analysis revealed that the c.2248T variant was present on four MAN2B1 haplotype backgrounds, where one major haplotype accounted for 95% of the alleles. The distribution of the c.2248T-associated haplotypes differed remarkably from those of the control populations, suggesting that c.2248C>T has occurred on a few ancestral haplotypes where the major haplotype subsequently has spread by founder effects. The disease-associated missense mutations were introduced into the human MAN2B1 cDNA, expressed in cell culture and assayed for MAN2B1 activity. The majority of the variants were inactive, however, ten showed MAN2B1 activity above background, and more detailed studies are necessary to further evaluate the pathogenicity of these variants. © 2011 Wiley Periodicals, Inc.

  15. Characterization of pathogenic human MSH2 missense mutations using yeast as a model system: a laboratory course in molecular biology.

    PubMed

    Gammie, Alison E; Erdeniz, Naz

    2004-01-01

    This work describes the project for an advanced undergraduate laboratory course in cell and molecular biology. One objective of the course is to teach students a variety of cellular and molecular techniques while conducting original research. A second objective is to provide instruction in science writing and data presentation by requiring comprehensive laboratory reports modeled on the primary literature. The project for the course focuses on a gene, MSH2, implicated in the most common form of inherited colorectal cancer. Msh2 is important for maintaining the fidelity of genetic material where it functions as an important component of the DNA mismatch repair machinery. The goal of the project has two parts. The first part is to create mapped missense mutation listed in the human databases in the cognate yeast MSH2 gene and to assay for defects in DNA mismatch repair. The second part of the course is directed towards understanding in what way are the variant proteins defective for mismatch repair. Protein levels are analyzed to determine if the missense alleles display decreased expression. Furthermore, the students establish whether the Msh2p variants are properly localized to the nucleus using indirect immunofluorescence and whether the altered proteins have lost their ability to interact with other subunits of the MMR complex by creating recombinant DNA molecules and employing the yeast 2-hybrid assay.

  16. Missense Mutations in the Copper Transporter Gene ATP7A Cause X-Linked Distal Hereditary Motor Neuropathy

    PubMed Central

    Kennerson, Marina L.; Nicholson, Garth A.; Kaler, Stephen G.; Kowalski, Bartosz; Mercer, Julian F.B.; Tang, Jingrong; Llanos, Roxana M.; Chu, Shannon; Takata, Reinaldo I.; Speck-Martins, Carlos E.; Baets, Jonathan; Almeida-Souza, Leonardo; Fischer, Dirk; Timmerman, Vincent; Taylor, Philip E.; Scherer, Steven S.; Ferguson, Toby A.; Bird, Thomas D.; De Jonghe, Peter; Feely, Shawna M.E.; Shy, Michael E.; Garbern, James Y.

    2010-01-01

    Distal hereditary motor neuropathies comprise a clinically and genetically heterogeneous group of disorders. We recently mapped an X-linked form of this condition to chromosome Xq13.1-q21 in two large unrelated families. The region of genetic linkage included ATP7A, which encodes a copper-transporting P-type ATPase mutated in patients with Menkes disease, a severe infantile-onset neurodegenerative condition. We identified two unique ATP7A missense mutations (p.P1386S and p.T994I) in males with distal motor neuropathy in two families. These molecular alterations impact highly conserved amino acids in the carboxyl half of ATP7A and do not directly involve the copper transporter's known critical functional domains. Studies of p.P1386S revealed normal ATP7A mRNA and protein levels, a defect in ATP7A trafficking, and partial rescue of a S. cerevisiae copper transport knockout. Although ATP7A mutations are typically associated with severe Menkes disease or its milder allelic variant, occipital horn syndrome, we demonstrate here that certain missense mutations at this locus can cause a syndrome restricted to progressive distal motor neuropathy without overt signs of systemic copper deficiency. This previously unrecognized genotype-phenotype correlation suggests an important role of the ATP7A copper transporter in motor-neuron maintenance and function. PMID:20170900

  17. Characterization of Pathogenic Human MSH2 Missense Mutations Using Yeast as a Model System: A Laboratory Course in Molecular Biology

    PubMed Central

    Gammie, Alison E.; Erdeniz, Naz

    2004-01-01

    This work describes the project for an advanced undergraduate laboratory course in cell and molecular biology. One objective of the course is to teach students a variety of cellular and molecular techniques while conducting original research. A second objective is to provide instruction in science writing and data presentation by requiring comprehensive laboratory reports modeled on the primary literature. The project for the course focuses on a gene, MSH2, implicated in the most common form of inherited colorectal cancer. Msh2 is important for maintaining the fidelity of genetic material where it functions as an important component of the DNA mismatch repair machinery. The goal of the project has two parts. The first part is to create mapped missense mutation listed in the human databases in the cognate yeast MSH2 gene and to assay for defects in DNA mismatch repair. The second part of the course is directed towards understanding in what way are the variant proteins defective for mismatch repair. Protein levels are analyzed to determine if the missense alleles display decreased expression. Furthermore, the students establish whether the Msh2p variants are properly localized to the nucleus using indirect immunofluorescence and whether the altered proteins have lost their ability to interact with other subunits of the MMR complex by creating recombinant DNA molecules and employing the yeast 2-hybrid assay. PMID:22039344

  18. A frequent splicing mutation and novel missense mutations color the updated mutational spectrum of classic galactosemia in Portugal.

    PubMed

    Coelho, Ana I; Ramos, Ruben; Gaspar, Ana; Costa, Cláudia; Oliveira, Anabela; Diogo, Luísa; Garcia, Paula; Paiva, Sandra; Martins, Esmeralda; Teles, Elisa Leão; Rodrigues, Esmeralda; Cardoso, M Teresa; Ferreira, Elena; Sequeira, Sílvia; Leite, Margarida; Silva, Maria João; de Almeida, Isabel Tavares; Vicente, João B; Rivera, Isabel

    2014-01-01

    Classic galactosemia is an autosomal recessive disorder caused by deficient galactose-1-phosphate uridylyltransferase (GALT) activity. Patients develop symptoms in the neonatal period, which can be ameliorated by dietary restriction of galactose. Many patients develop long-term complications, with a broad range of clinical symptoms whose pathophysiology is poorly understood. The high allelic heterogeneity of GALT gene that characterizes this disorder is thought to play a determinant role in biochemical and clinical phenotypes. We aimed to characterize the mutational spectrum of GALT deficiency in Portugal and to assess potential genotype-phenotype correlations. Direct sequencing of the GALT gene and in silico analyses were employed to evaluate the impact of uncharacterized mutations upon GALT functionality. Molecular characterization of 42 galactosemic Portuguese patients revealed a mutational spectrum comprising 14 nucleotide substitutions: ten missense, two nonsense and two putative splicing mutations. Sixteen different genotypic combinations were detected, half of the patients being p.Q188R homozygotes. Notably, the second most frequent variation is a splicing mutation. In silico predictions complemented by a close-up on the mutations in the protein structure suggest that uncharacterized missense mutations have cumulative point effects on protein stability, oligomeric state, or substrate binding. One splicing mutation is predicted to cause an alternative splicing event. This study reinforces the difficulty in establishing a genotype-phenotype correlation in classic galactosemia, a monogenic disease whose complex pathogenesis and clinical features emphasize the need to expand the knowledge on this "cloudy" disorder.

  19. Missense SLC25A38 variations play an important role in autosomal recessive inherited sideroblastic anemia.

    PubMed

    Kannengiesser, Caroline; Sanchez, Mayka; Sweeney, Marion; Hetet, Gilles; Kerr, Briedgeen; Moran, Erica; Fuster Soler, Jose L; Maloum, Karim; Matthes, Thomas; Oudot, Caroline; Lascaux, Axelle; Pondarré, Corinne; Sevilla Navarro, Julian; Vidyatilake, Sudharma; Beaumont, Carole; Grandchamp, Bernard; May, Alison

    2011-06-01

    Congenital sideroblastic anemias are rare disorders with several genetic causes; they are characterized by erythroblast mitochondrial iron overload, differ greatly in severity and some occur within a syndrome. The most common cause of non-syndromic, microcytic sideroblastic anemia is a defect in the X-linked 5-aminolevulinate synthase 2 gene but this is not always present. Recently, variations in the gene for the mitochondrial carrier SLC25A38 were reported to cause a non-syndromic, severe type of autosomal-recessive sideroblastic anemia. Further evaluation of the importance of this gene was required to estimate the proportion of patients affected and to gain further insight into the range and types of variations involved. In three European diagnostic laboratories sequence analysis of SLC25A38 was performed on DNA from patients affected by congenital sideroblastic anemia of a non-syndromic nature not caused by variations in the 5-aminolevulinate synthase 2 gene. Eleven patients whose ancestral origins spread across several continents were homozygous or compound heterozygous for ten different SLC25A38 variations causing premature termination of translation (p.Arg117X, p.Tyr109LeufsX43), predicted splicing alteration (c.625G>C; p.Asp209His) or missense substitution (p.Gln56Lys, p.Arg134Cys, p.Ile147Asn, p.Arg187Gln, p.Pro190Arg, p.Gly228Val, p.Arg278Gly). Only three of these variations have been described previously (p.Arg117X, p.Tyr109LeufsX43 and p.Asp209His). All new variants reported here are missense and affect conserved amino acids. Structure modeling suggests that these variants may influence different aspects of transport as described for mutations in other mitochondrial carrier disorders. Mutations in the SLC25A38 gene cause severe, non-syndromic, microcytic/hypochromic sideroblastic anemia in many populations. Missense mutations are shown to be of importance as are mutations that affect protein production. Further investigation of these mutations should

  20. Missense SLC25A38 variations play an important role in autosomal recessive inherited sideroblastic anemia

    PubMed Central

    Kannengiesser, Caroline; Sanchez, Mayka; Sweeney, Marion; Hetet, Gilles; Kerr, Briedgeen; Moran, Erica; Fuster Soler, Jose L.; Maloum, Karim; Matthes, Thomas; Oudot, Caroline; Lascaux, Axelle; Pondarré, Corinne; Sevilla Navarro, Julian; Vidyatilake, Sudharma; Beaumont, Carole; Grandchamp, Bernard; May, Alison

    2011-01-01

    Background Congenital sideroblastic anemias are rare disorders with several genetic causes; they are characterized by erythroblast mitochondrial iron overload, differ greatly in severity and some occur within a syndrome. The most common cause of non-syndromic, microcytic sideroblastic anemia is a defect in the X-linked 5-aminolevulinate synthase 2 gene but this is not always present. Recently, variations in the gene for the mitochondrial carrier SLC25A38 were reported to cause a non-syndromic, severe type of autosomal-recessive sideroblastic anemia. Further evaluation of the importance of this gene was required to estimate the proportion of patients affected and to gain further insight into the range and types of variations involved. Design and Methods In three European diagnostic laboratories sequence analysis of SLC25A38 was performed on DNA from patients affected by congenital sideroblastic anemia of a non-syndromic nature not caused by variations in the 5-aminolevulinate synthase 2 gene. Results Eleven patients whose ancestral origins spread across several continents were homozygous or compound heterozygous for ten different SLC25A38 variations causing premature termination of translation (p.Arg117X, p.Tyr109LeufsX43), predicted splicing alteration (c.625G>C; p.Asp209His) or missense substitution (p.Gln56Lys, p.Arg134Cys, p.Ile147Asn, p.Arg187Gln, p.Pro190Arg, p.Gly228Val, p.Arg278Gly). Only three of these variations have been described previously (p.Arg117X, p.Tyr109LeufsX43 and p.Asp209His). All new variants reported here are missense and affect conserved amino acids. Structure modeling suggests that these variants may influence different aspects of transport as described for mutations in other mitochondrial carrier disorders. Conclusions Mutations in the SLC25A38 gene cause severe, non-syndromic, microcytic/hypochromic sideroblastic anemia in many populations. Missense mutations are shown to be of importance as are mutations that affect protein production

  1. A Novel Missense Mutation in POMT1 Modulates the Severe Congenital Muscular Dystrophy Phenotype Associated with POMT1 Nonsense Mutations

    PubMed Central

    Wallace, Stephanie E.; Conta, Jessie H.; Winder, Thomas L.; Willer, Tobias; Eskuri, Jamie M.; Haas, Richard; Patterson, Kathleen; Campbell, Kevin P.; Moore, Steven A.; Gospe, Sidney M.

    2014-01-01

    Mutations in POMT1 lead to a group of neuromuscular conditions ranging in severity from Walker-Warburg syndrome to limb girdle muscular dystrophy. We report two male siblings, ages 19 and 14, and an unrelated 6-year old female with early onset muscular dystrophy and intellectual disability with minimal structural brain anomalies and no ocular abnormalities. Compound heterozygous mutations in POMT1 were identified including a previously reported nonsense mutation (c.2167dupG; p.Asp723Glyfs*8) associated with Walker-Warburg syndrome and a novel missense mutation in a highly conserved region of the protein O-mannosyltransferase 1 protein (c.1958C>T; p.Pro653Leu). This novel variant reduces the phenotypic severity compared to patients with homozygous c.2167dupG mutations or compound heterozygous patients with a c.2167dupG mutation and a wide range of other mutant POMT1 alleles. PMID:24491487

  2. Temperature sensitivity caused by missense suppressor supH and amber suppressor supP in Escherichia coli.

    PubMed Central

    Thorbjarnardóttir, S; Björnsson, A; Amundadóttir, L; Eggertsson, G

    1991-01-01

    The temperature-sensitive missense suppressor supH and amber suppressor supP in Escherichia coli are mutations of the serU and leuX genes, respectively. The supH tRNA, tRNA(SerCAA), is expected to recognize UUG codons, which are normally read by tRNA(LeuCAA) and tRNA(LeuUAA), coded for by the leuX gene and the leuZ gene, respectively. We show that supP and supH are incompatible and that strains carrying both supP and a restrictive rpsL allele are temperature sensitive. It is suggested that the temperature sensitivity of both supH and supP strains is caused by deficient reading of UUG codons by tRNA(LeuUAA). PMID:1987132

  3. Missense variants in AIMP1 gene are implicated in autosomal recessive intellectual disability without neurodegeneration.

    PubMed

    Iqbal, Zafar; Püttmann, Lucia; Musante, Luciana; Razzaq, Attia; Zahoor, Muhammad Yasir; Hu, Hao; Wienker, Thomas F; Garshasbi, Masoud; Fattahi, Zohreh; Gilissen, Christian; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Veltman, Joris A; Pfundt, Rolph; Najmabadi, Hossein; Ropers, Hans-Hilger; Riazuddin, Sheikh; Kahrizi, Kimia; van Bokhoven, Hans

    2016-03-01

    AIMP1/p43 is a multifunctional non-catalytic component of the multisynthetase complex. The complex consists of nine catalytic and three non-catalytic proteins, which catalyze the ligation of amino acids to their cognate tRNA isoacceptors for use in protein translation. To date, two allelic variants in the AIMP1 gene have been reported as the underlying cause of autosomal recessive primary neurodegenerative disorder. Here, we present two consanguineous families from Pakistan and Iran, presenting with moderate to severe intellectual disability, global developmental delay, and speech impairment without neurodegeneration. By the combination of homozygosity mapping and next generation sequencing, we identified two homozygous missense variants, p.(Gly299Arg) and p.(Val176Gly), in the gene AIMP1 that co-segregated with the phenotype in the respective families. Molecular modeling of the variants revealed deleterious effects on the protein structure that are predicted to result in reduced AIMP1 function. Our findings indicate that the clinical spectrum for AIMP1 defects is broader than witnessed so far.

  4. Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy

    SciTech Connect

    Roberds, S.L.; Anderson, R.D.; Lim, L.E.

    1994-09-01

    Adhalin, the 50-kDa dystrophin-associated glycoprotein, is deficient in skeletal muscle of patients having severe childhood autosomal recessive muscular dystrophy (SCARMD). In several North African families, SCARMD has been linked to markers in the pericentromeric region of chromosome l3q, but SCARMD has been excluded from linkage to this locus in other families. To determine whether the adhalin gene might be involved in SCARMD, human adhalin cDNA and large portions of the adhalin gene were cloned. Adhalin is a transmembrane glycoprotein with an extracellular domain bearing limited homology to domains of entactin and nerve growth factor receptor, suggesting that adhalin may serve as a receptor for an extracellular matrix protein. The adhalin gene was mapped to chromosome 17q12-q21.33, excluding the gene from involvement in 13q-linked SCARMD. A polymorphic microsatellite was identified within intron 6 of the adhalin gene, and one allelic variant of this marker cosegregated with the disease phenotype in a large French family with a lod score of 3.61 at 0 recombination. Adhalin is undetectable in skeletal muscle from affected members of this family. Missense mutations were identified within the adhalin gene that might cause SCARMD in this family. Thus, genetic defects in at least two components, dystrophin and adhalin, of the dystrophin-glycoprotein complex can independently cause muscular dystrophies.

  5. A missense mutation in ITGB6 causes pitted hypomineralized amelogenesis imperfecta.

    PubMed

    Poulter, James A; Brookes, Steven J; Shore, Roger C; Smith, Claire E L; Abi Farraj, Layal; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

    2014-04-15

    We identified a family in which pitted hypomineralized amelogenesis imperfecta (AI) with premature enamel failure segregated in an autosomal recessive fashion. Whole-exome sequencing revealed a missense mutation (c.586C>A, p.P196T) in the I-domain of integrin-β6 (ITGB6), which is consistently predicted to be pathogenic by all available programmes and is the only variant that segregates with the disease phenotype. Furthermore, a recent study revealed that mice lacking a functional allele of Itgb6 display a hypomaturation AI phenotype. Phenotypic characterization of affected human teeth in this study showed areas of abnormal prismatic organization, areas of low mineral density and severe abnormal surface pitting in the tooth's coronal portion. We suggest that the pathogenesis of this form of AI may be due to ineffective ligand binding of ITGB6 resulting in either compromised cell-matrix interaction or compromised ITGB6 activation of transforming growth factor-β (TGF-β) impacting indirectly on ameloblast-ameloblast interactions and proteolytic processing of extracellular matrix proteins via MMP20. This study adds to the list of genes mutated in AI and further highlights the importance of cell-matrix interactions during enamel formation.

  6. Congenital Insensitivity to Pain: Novel SCN9A Missense and In-Frame Deletion Mutations

    PubMed Central

    Cox, James J; Sheynin, Jony; Shorer, Zamir; Reimann, Frank; Nicholas, Adeline K; Zubovic, Lorena; Baralle, Marco; Wraige, Elizabeth; Manor, Esther; Levy, Jacov; Woods, C Geoffery; Parvari, Ruti

    2010-01-01

    SCN9A encodes the voltage-gated sodium channel Nav1.7, a protein highly expressed in pain-sensing neurons. Mutations in SCN9A cause three human pain disorders: bi-allelic loss of function mutations result in Channelopathy-associated Insensitivity to Pain (CIP), whereas activating mutations cause severe episodic pain in Paroxysmal Extreme Pain Disorder (PEPD) and Primary Erythermalgia (PE). To date, all mutations in SCN9A that cause a complete inability to experience pain are protein truncating and presumably lead to no protein being produced. Here, we describe the identification and functional characterization of two novel non-truncating mutations in families with CIP: a homozygously-inherited missense mutation found in a consanguineous Israeli Bedouin family (Nav1.7-R896Q) and a five amino acid in-frame deletion found in a sporadic compound heterozygote (Nav1.7-ΔR1370-L1374). Both of these mutations map to the pore region of the Nav1.7 sodium channel. Using transient transfection of PC12 cells we found a significant reduction in membrane localization of the mutant protein compared to the wild type. Furthermore, voltage clamp experiments of mutant-transfected HEK293 cells show a complete loss of function of the sodium channel, consistent with the absence of pain phenotype. In summary, this study has identified critical amino acids needed for the normal subcellular localization and function of Nav1.7. © 2010 Wiley-Liss, Inc. PMID:20635406

  7. Missense variants in AIMP1 gene are implicated in autosomal recessive intellectual disability without neurodegeneration

    PubMed Central

    Iqbal, Zafar; Püttmann, Lucia; Musante, Luciana; Razzaq, Attia; Zahoor, Muhammad Yasir; Hu, Hao; Wienker, Thomas F; Garshasbi, Masoud; Fattahi, Zohreh; Gilissen, Christian; Vissers, Lisenka ELM; de Brouwer, Arjan PM; Veltman, Joris A; Pfundt, Rolph; Najmabadi, Hossein; Ropers, Hans-Hilger; Riazuddin, Sheikh; Kahrizi, Kimia; van Bokhoven, Hans

    2016-01-01

    AIMP1/p43 is a multifunctional non-catalytic component of the multisynthetase complex. The complex consists of nine catalytic and three non-catalytic proteins, which catalyze the ligation of amino acids to their cognate tRNA isoacceptors for use in protein translation. To date, two allelic variants in the AIMP1 gene have been reported as the underlying cause of autosomal recessive primary neurodegenerative disorder. Here, we present two consanguineous families from Pakistan and Iran, presenting with moderate to severe intellectual disability, global developmental delay, and speech impairment without neurodegeneration. By the combination of homozygosity mapping and next generation sequencing, we identified two homozygous missense variants, p.(Gly299Arg) and p.(Val176Gly), in the gene AIMP1 that co-segregated with the phenotype in the respective families. Molecular modeling of the variants revealed deleterious effects on the protein structure that are predicted to result in reduced AIMP1 function. Our findings indicate that the clinical spectrum for AIMP1 defects is broader than witnessed so far. PMID:26173967

  8. A missense mutation in ITGB6 causes pitted hypomineralized amelogenesis imperfecta

    PubMed Central

    Poulter, James A.; Brookes, Steven J.; Shore, Roger C.; Smith, Claire E. L.; Abi Farraj, Layal; Kirkham, Jennifer; Inglehearn, Chris F.; Mighell, Alan J.

    2014-01-01

    We identified a family in which pitted hypomineralized amelogenesis imperfecta (AI) with premature enamel failure segregated in an autosomal recessive fashion. Whole-exome sequencing revealed a missense mutation (c.586C>A, p.P196T) in the I-domain of integrin-β6 (ITGB6), which is consistently predicted to be pathogenic by all available programmes and is the only variant that segregates with the disease phenotype. Furthermore, a recent study revealed that mice lacking a functional allele of Itgb6 display a hypomaturation AI phenotype. Phenotypic characterization of affected human teeth in this study showed areas of abnormal prismatic organization, areas of low mineral density and severe abnormal surface pitting in the tooth's coronal portion. We suggest that the pathogenesis of this form of AI may be due to ineffective ligand binding of ITGB6 resulting in either compromised cell–matrix interaction or compromised ITGB6 activation of transforming growth factor-β (TGF-β) impacting indirectly on ameloblast–ameloblast interactions and proteolytic processing of extracellular matrix proteins via MMP20. This study adds to the list of genes mutated in AI and further highlights the importance of cell–matrix interactions during enamel formation. PMID:24319098

  9. A missense variant (P10L) of the melanopsin (OPN4) gene in seasonal affective disorder.

    PubMed

    Roecklein, Kathryn A; Rohan, Kelly J; Duncan, Wallace C; Rollag, Mark D; Rosenthal, Norman E; Lipsky, Robert H; Provencio, Ignacio

    2009-04-01

    Melanopsin, a non-visual photopigment, may play a role in aberrant responses to low winter light levels in Seasonal Affective Disorder (SAD). We hypothesize that functional sequence variation in the melanopsin gene could contribute to increasing the light needed for normal functioning during winter in SAD. Associations between alleles, genotypes, and haplotypes of melanopsin in SAD participants (n=130) were performed relative to controls with no history of psychopathology (n=90). SAD participants had a higher frequency of the homozygous minor genotype (T/T) for the missense variant rs2675703 (P10L) than controls, compared to the combined frequencies of C/C and C/T. Individuals with the T/T genotype were 5.6 times more likely to be in the SAD group than the control group, and all 7 (5%) of individuals with the T/T genotype at P10L were in the SAD group. The study examined only one molecular component of the non-visual light input pathway, and recruitment methods for the comparison groups differed. These findings support the hypothesis that melanopsin variants may predispose some individuals to SAD. Characterizing the genetic basis for deficits in the non-visual light input pathway has the potential to define mechanisms underlying the pathological response to light in SAD, which may improve treatment.

  10. Rare missense mutations in P2RY11 in narcolepsy with cataplexy.

    PubMed

    Degn, Matilda; Dauvilliers, Yves; Dreisig, Karin; Lopez, Régis; Pfister, Corinne; Pradervand, Sylvain; Rahbek Kornum, Birgitte; Tafti, Mehdi

    2017-06-01

    The sleep disorder narcolepsy with cataplexy is characterized by a highly specific loss of hypocretin (orexin) neurons, leading to the hypothesis that the condition is caused by an immune or autoimmune mechanism. All genetic variants associated with narcolepsy are immune-related. Among these are single nucleotide polymorphisms in the P2RY11-EIF3G locus. It is unknown how these genetic variants affect narcolepsy pathogenesis and whether the effect is directly related to P2Y11 signalling or EIF3G function. Exome sequencing in 18 families with at least two affected narcolepsy with cataplexy subjects revealed non-synonymous mutations in the second exon of P2RY11 in two families, and P2RY11 re-sequencing in 250 non-familial cases and 135 healthy control subjects revealed further six different non-synonymous mutations in the second exon of P2RY11 in seven patients. No mutations were found in healthy controls. Six of the eight narcolepsy-associated P2Y11 mutations resulted in significant functional deficits in P2Y11 signalling through both Ca2+ and cAMP signalling pathways. In conclusion, our data show that decreased P2Y11 signalling plays an important role in the development of narcolepsy with cataplexy. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Tri-allelic pattern at the TPOX locus: a familial study.

    PubMed

    Picanço, Juliane Bentes; Raimann, Paulo Eduardo; Paskulin, Giorgio Adriano; Alvarez, Luís; Amorim, António; Batista Dos Santos, Sidney Emanuel; Alho, Clarice Sampaio

    2014-02-10

    Alleles at the TPOX STR locus have 6-14 different numbers of a four-nucleotide (AATG) repeat motif arranged in tandem. Although tri-allelic genotypes are generally rare, the TPOX tri-allelic pattern has a higher frequency, varying widely among populations. Despite this, there are few accurate reports to disclose the nature of the TPOX third allele. In this work we present data obtained from 45 individuals belonging to the same pedigree, in which there are cases of tri-allelic TPOX genotypes. The subjects were apparently healthy with a normal biological development. We noticed six tri-allelic cases in this family, and all of them were women. Karyotype analysis showed no occurrence of partial 2p trisomy. All the tri-allelic cases had the genotype 8-10-11, probably due to three copies of the TPOX STR sequence in all cells (Type 2 tri-allelic pattern). Based on previous data we assumed the allele 10 as the TPOX third allele. The pedigree analyses show evidences that the TPOX extra-allele was the allele10, it is placed far from the main TPOX locus, and that there is a potential linkage of the TPOX extra-allele-10 with Xq. This was the first study that included a large pedigree analysis in order to understand the nature TPOX tri-allelic pattern. © 2013.

  12. The evolution of Sex-linked barring alleles in chickens involves both regulatory and coding changes in CDKN2A.

    PubMed

    Schwochow Thalmann, Doreen; Ring, Henrik; Sundström, Elisabeth; Cao, Xiaofang; Larsson, Mårten; Kerje, Susanne; Höglund, Andrey; Fogelholm, Jesper; Wright, Dominic; Jemth, Per; Hallböök, Finn; Bed'Hom, Bertrand; Dorshorst, Ben; Tixier-Boichard, Michèle; Andersson, Leif

    2017-04-01

    Sex-linked barring is a fascinating plumage pattern in chickens recently shown to be associated with two non-coding and two missense mutations affecting the ARF transcript at the CDKN2A tumor suppressor locus. It however remained a mystery whether all four mutations are indeed causative and how they contribute to the barring phenotype. Here, we show that Sex-linked barring is genetically heterogeneous, and that the mutations form three functionally different variant alleles. The B0 allele carries only the two non-coding changes and is associated with the most dilute barring pattern, whereas the B1 and B2 alleles carry both the two non-coding changes and one each of the two missense mutations causing the Sex-linked barring and Sex-linked dilution phenotypes, respectively. The data are consistent with evolution of alleles where the non-coding changes occurred first followed by the two missense mutations that resulted in a phenotype more appealing to humans. We show that one or both of the non-coding changes are cis-regulatory mutations causing a higher CDKN2A expression, whereas the missense mutations reduce the ability of ARF to interact with MDM2. Caspase assays for all genotypes revealed no apoptotic events and our results are consistent with a recent study indicating that the loss of melanocyte progenitors in Sex-linked barring in chicken is caused by premature differentiation and not apoptosis. Our results show that CDKN2A is a major locus driving the differentiation of avian melanocytes in a temporal and spatial manner.

  13. The evolution of Sex-linked barring alleles in chickens involves both regulatory and coding changes in CDKN2A

    PubMed Central

    Cao, Xiaofang; Larsson, Mårten; Kerje, Susanne; Höglund, Andrey; Wright, Dominic; Jemth, Per; Bed’Hom, Bertrand; Dorshorst, Ben; Tixier-Boichard, Michèle

    2017-01-01

    Sex-linked barring is a fascinating plumage pattern in chickens recently shown to be associated with two non-coding and two missense mutations affecting the ARF transcript at the CDKN2A tumor suppressor locus. It however remained a mystery whether all four mutations are indeed causative and how they contribute to the barring phenotype. Here, we show that Sex-linked barring is genetically heterogeneous, and that the mutations form three functionally different variant alleles. The B0 allele carries only the two non-coding changes and is associated with the most dilute barring pattern, whereas the B1 and B2 alleles carry both the two non-coding changes and one each of the two missense mutations causing the Sex-linked barring and Sex-linked dilution phenotypes, respectively. The data are consistent with evolution of alleles where the non-coding changes occurred first followed by the two missense mutations that resulted in a phenotype more appealing to humans. We show that one or both of the non-coding changes are cis-regulatory mutations causing a higher CDKN2A expression, whereas the missense mutations reduce the ability of ARF to interact with MDM2. Caspase assays for all genotypes revealed no apoptotic events and our results are consistent with a recent study indicating that the loss of melanocyte progenitors in Sex-linked barring in chicken is caused by premature differentiation and not apoptosis. Our results show that CDKN2A is a major locus driving the differentiation of avian melanocytes in a temporal and spatial manner. PMID:28388616

  14. Bioinformatic Analysis of GJB2 Gene Missense Mutations.

    PubMed

    Yilmaz, Akin

    2015-04-01

    Gap junction beta 2 (GJB2) gene is the most commonly mutated connexin gene in patients with autosomal recessive and dominant hearing loss. According to Ensembl (release 74) database, 1347 sequence variations are reported in the GJB2 gene and about 13.5% of them are categorized as missense SNPs or nonsynonymous variant. Because of the high incidence of GJB2 mutations in hearing loss patients, revealing the molecular effect of GJB2 mutations on protein structure may also provide clear point of view regarding the molecular etiology of deafness. Hence, the aim of this study is to analyze structural and functional consequences of all known GJB2 missense variations to the Cx26 protein by applying multiple bioinformatics methods. Two-hundred and eleven nonsynonymous variants were collected from Ensembl release 74, Leiden Open Variation Database (LOVD) and The Human Gene Mutation Database (HGMD). A number of bioinformatic tools were utilized for predicting the effect of GJB2 missense mutations at the sequence, structural, and functional levels. Some of the mutations were found to locate highly conserved regions and have structural and functional properties. Moreover, GJB2 mutations were also found to affect Cx26 protein at the molecular level via loss or gain of disorder, catalytic site, and post-translational modifications, including methylation, glycosylation, and ubiquitination. Findings, presented here, demonstrated the application of bioinformatic algorithms to predict the effects of mutations causing hearing impairment. I expect, this type of analysis will serve as a start point for future experimental evaluation of the GJB2 gene mutations and it will also be helpful in evaluating other deafness-related gene mutations.

  15. A new TRPV3 missense mutation in a patient with Olmsted syndrome and erythromelalgia.

    PubMed

    Duchatelet, Sabine; Pruvost, Solenn; de Veer, Simon; Fraitag, Sylvie; Nitschké, Patrick; Bole-Feysot, Christine; Bodemer, Christine; Hovnanian, Alain

    2014-03-01

    Olmsted syndrome (OS) is a rare keratinizing disorder characterized by excessive epidermal thickening of the palms and soles, with clinical and genetic heterogeneity. Approximately 50 cases have been reported, with the molecular basis described in only 9. Recently, TRPV3 (transient receptor potential vanilloid 3) mutations were identified in autosomal-dominant OS in 7 sporadic cases and 1 familial case, whereas an MBTPS2 (membrane-bound transcription factor protease, site 2) mutation was reported in X-linked recessive OS. We report a new sporadic case of severe, atypical OS and its underlying genetic basis. Our patient is a young girl with severe nonmutilating (palmo)plantar keratoderma without periorificial keratotic plaques associated with intense acute flares of inflammation, itching, burning pain, vasodilatation, and redness of the extremities consistent with erythromelalgia. Whole exome sequencing of patient DNA identified a novel de novo heterozygous missense mutation within TRPV3, p.Leu673Phe, predicted to be damaging. This case study further implicates TRPV3 in OS pathogenesis. In addition, previous reports of OS have not described erythromelalgia as a clinical feature. Its occurrence in our patient could be a chance event, but, if associated with OS, the features of erythromelalgia may expand the phenotypic spectrum of this rare syndrome.

  16. Differential burden of rare protein truncating variants in Alzheimer’s disease patients compared to centenarians

    PubMed Central

    Freudenberg-Hua, Yun; Li, Wentian; Abhyankar, Avinash; Vacic, Vladimir; Cortes, Vanessa; Ben-Avraham, Danny; Koppel, Jeremy; Greenwald, Blaine; Germer, Soren; Darnell, Robert B.; Barzilai, Nir; Freudenberg, Jan; Atzmon, Gil; Davies, Peter

    2016-01-01

    We compared coding region variants of 53 cognitively healthy centenarians and 45 patients with Alzheimer’s disease (AD), all of Ashkenazi Jewish (AJ) ancestry. Despite the small sample size, the known AD risk variant APOE4 reached genome-wide significance, indicating the advantage of utilizing ‘super-controls’. We restricted our subsequent analysis to rare variants observed at most once in the 1000 Genomes database and having a minor allele frequency below 2% in our AJ sample. We compared the burden of predicted protein altering variants between cases and controls as normalized by the level of rare synonymous variants. We observed an increased burden among AD subjects for predicted loss-of-function (LoFs) variants defined as stop-gain, frame shift, initiation codon (INIT) and splice site mutations (n = 930, OR = 1.3, P = 1.5×E−5). There was no enrichment across all rare protein altering variants defined as missense plus LoFs, in frame indels and stop-loss variants (n = 13 014, OR = 0.97, P = 0.47). Among LoFs, the strongest burden was observed for INIT (OR = 2.16, P = 0.0097) and premature stop variants predicted to cause non-sense-mediated decay in the majority of transcripts (NMD) (OR = 1.98, P = 0.02). Notably, this increased burden of NMD, INIT and splice variants was more pronounced in a set of 1397 innate immune genes (OR = 4.55, P = 0.0043). Further comparison to additional exomes indicates that the difference in LoF burden originated both from the AD and centenarian sample. In summary, we observed an overall increased burden of rare LoFs in AD subjects as compared to centenarians, and this enrichment is more pronounced for innate immune genes. PMID:27260402

  17. Novel missense mutation c.2685G>C (p.Q895H) in VWF gene associated with very low levels of VWF mRNA.

    PubMed

    Cabrera, Noelia; Casaña, Pilar; Cid, Ana Rosa; Haya, Saturnino; Moret, Andrés; Aznar, Jose Antonio

    2009-03-01

    Homozygous patients for null alleles in VWF gene show a severe von Willebrand phenotype, whereas compound heterozygous patients only show the phenotype of the expressed allele. Five members of the same family were studied. The two patients showed borderline VWF levels, a mild factor VIII (FVIII) deficiency and a decrease of the binding of VWF to exogenous FVIII. The genetic analyses of the VWF gene confirmed that the patients were compound heterozygous for c.2561G>A (R854Q) and c.2685G>C (p.Q895H) mutations. The latter, is located in the 3' extreme of exon 20, and it has not been previously described. Studies of the cDNA from platelet mRNA were performed to investigate the expression of p.H895 allele. The loss of heterozygosity at the cDNA level suggests a lack of expression of the p.H895 allele. The overall studies can explain the type 2N phenotype of the two patients, since the allele carrying the new missense mutation p.Q895H has shown a low expression of VWF gene.

  18. A heritable missense polymorphism in CDKN2A confers strong risk of childhood acute lymphoblastic leukemia and is preferentially selected during clonal evolution

    PubMed Central

    Walsh, Kyle M.; de Smith, Adam J.; Hansen, Helen M.; Smirnov, Ivan V.; Gonseth, Semira; Endicott, Alyson A.; Xiao, Jianqiao; Rice, Terri; Fu, Cecilia H.; McCoy, Lucie S.; Lachance, Daniel H.; Eckel-Passow, Jeanette E.; Wiencke, John K.; Jenkins, Robert B.; Wrensch, Margaret R.; Ma, Xiaomei; Metayer, Catherine; Wiemels, Joseph L.

    2015-01-01

    Genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) in six genes that are associated with childhood acute lymphoblastic leukemia (ALL). A lead SNP was found to occur on chromosome 9p21.3, a region that is deleted in 30% of childhood ALLs, suggesting the presence of causal polymorphisms linked to ALL risk. We used SNP genotyping and imputation-based fine-mapping of a multiethnic ALL case-control population (Ncases=1464, Ncontrols=3279) to identify variants of large effect within 9p21.3. We identified a CDKN2A missense variant (rs3731249) with 2% allele frequency in controls that confers three-fold increased risk of ALL in children of European-ancestry (OR=2.99; P=1.51×10−9) and Hispanic children (OR=2.77; P=3.78×10−4). Moreover, of 17 patients whose tumors displayed allelic imbalance at CDKN2A, 14 preferentially retained the risk allele and lost the protective allele (PBinomial=0.006), suggesting that the risk allele provides a selective advantage during tumor growth. Notably, the CDKN2A variant was not significantly associated with melanoma, glioblastoma, or pancreatic cancer risk, implying that this polymorphism specifically confers ALL risk but not general cancer risk. Taken together, our findings demonstrate that coding polymorphisms of large effect can underlie GWAS “hits” and that inherited polymorphisms may undergo directional selection during clonal expansion of tumors. PMID:26527286

  19. Severity of alcohol dependence is associated with the fatty acid amide hydrolase Pro129Thr missense variant.

    PubMed

    Sloan, Matthew E; Gowin, Joshua L; Yan, Jia; Schwandt, Melanie L; Spagnolo, Primavera A; Sun, Hui; Hodgkinson, Colin A; Goldman, David; Ramchandani, Vijay A

    2017-02-01

    The endocannabinoid system plays an important role in reward and addiction. One of the two main endocannabinoid neurotransmitters, anandamide, is metabolized by fatty acid amide hydrolase, an enzyme with a functional genetic polymorphism (FAAH Pro129Thr, rs324420). The Thr129 allele has been linked to problem drug and alcohol use, but the association has not been widely replicated and may be stronger for clinical measures of severity rather than categorical diagnosis. In the present study, we sought to determine whether the Thr129 allele was associated with both alcohol dependence (AD) diagnosis and severity in a sample of 1434 European American and African American individuals, 952 of whom were diagnosed with lifetime AD. Participants were genotyped for FAAH rs324420, and ancestry was determined via a genome-wide panel of ancestry informative markers. Subjects participated in Structured Clinical Interviews for psychiatric disorders and 90-day Timeline Followback interviews to assess recent alcohol use. European American participants with current AD had a higher Thr129 allele frequency than non-dependent controls. In European Americans with lifetime AD, there were significantly different distributions of drinking days and binge drinking days between the two genotype groups, with Thr129 carriers reporting a median of 10 fewer abstinent days and 13 more binge drinking days than Pro129/Pro129 homozygotes. In African American participants, there were no significant differences between Thr129 allele frequency in cases and controls and no significant differences in measures of AD severity by genotype. These findings provide evidence that the Pro129Thr missense variant is associated with AD severity in European Americans.

  20. Missense dopamine transporter mutations associate with adult parkinsonism and ADHD

    PubMed Central

    Hansen, Freja H.; Skjørringe, Tina; Yasmeen, Saiqa; Arends, Natascha V.; Sahai, Michelle A.; Erreger, Kevin; Andreassen, Thorvald F.; Holy, Marion; Hamilton, Peter J.; Neergheen, Viruna; Karlsborg, Merete; Newman, Amy H.; Pope, Simon; Heales, Simon J.R.; Friberg, Lars; Law, Ian; Pinborg, Lars H.; Sitte, Harald H.; Loland, Claus; Shi, Lei; Weinstein, Harel; Galli, Aurelio; Hjermind, Lena E.; Møller, Lisbeth B.; Gether, Ulrik

    2014-01-01

    Parkinsonism and attention deficit hyperactivity disorder (ADHD) are widespread brain disorders that involve disturbances of dopaminergic signaling. The sodium-coupled dopamine transporter (DAT) controls dopamine homeostasis, but its contribution to disease remains poorly understood. Here, we analyzed a cohort of patients with atypical movement disorder and identified 2 DAT coding variants, DAT-Ile312Phe and a presumed de novo mutant DAT-Asp421Asn, in an adult male with early-onset parkinsonism and ADHD. According to DAT single-photon emission computed tomography (DAT-SPECT) scans and a fluoro-deoxy-glucose-PET/MRI (FDG-PET/MRI) scan, the patient suffered from progressive dopaminergic neurodegeneration. In heterologous cells, both DAT variants exhibited markedly reduced dopamine uptake capacity but preserved membrane targeting, consistent with impaired catalytic activity. Computational simulations and uptake experiments suggested that the disrupted function of the DAT-Asp421Asn mutant is the result of compromised sodium binding, in agreement with Asp421 coordinating sodium at the second sodium site. For DAT-Asp421Asn, substrate efflux experiments revealed a constitutive, anomalous efflux of dopamine, and electrophysiological analyses identified a large cation leak that might further perturb dopaminergic neurotransmission. Our results link specific DAT missense mutations to neurodegenerative early-onset parkinsonism. Moreover, the neuropsychiatric comorbidity provides additional support for the idea that DAT missense mutations are an ADHD risk factor and suggests that complex DAT genotype and phenotype correlations contribute to different dopaminergic pathologies. PMID:24911152

  1. Identification and functional characterization of three novel alleles for the serotonin transporter-linked polymorphic region.

    PubMed

    Ehli, E A; Hu, Y; Lengyel-Nelson, T; Hudziak, J J; Davies, G E

    2012-02-01

    A promoter polymorphism in the serotonin transporter gene (5-HTTLPR) has been reported to confer relative risk for phenotypes (depression/anxiety) and endophenotypes (amygdala reactivity). In this report, we identify and characterize three rare 5-HTTLPR alleles not previously described in the human literature. The three novel alleles were identified while genotyping 5-HTTLPR in a family-based attention deficit hyperactivity disorder clinical population. Two of the novel alleles are longer than the common 16-repeat long (L) allele (17 and 18 repeats) and the third is significantly smaller than the 14-repeat short (S) allele (11 repeats). The sequence and genetic architecture of each novel allele is described in detail. We report a significant decrease in the expression between the XL₁₇ (17r) allele and the L(A) (16r) allele. The XS₁₁ (11r) allele showed similar expression with the S (14r) allele. A 1.8-fold increase in expression was observed with the L(A)(16r) allele compared with the L(G) (16r) allele, which replicates results from earlier 5-HTTLPR expression experiments. In addition, transcription factor binding site (TFBS) analysis was performed using MatInspector (Genomatix) that showed the presence or absence of different putative TFBSs between the novel alleles and the common L (16r) and S (14r) alleles. The identification of rare variants and elucidation of their functional impact could potentially lead to understanding the contribution that the rare variant may have on the inheritance/susceptibility of multifactorial common diseases.

  2. Missense Variants of Uncertain Significance (VUS) Altering the Phosphorylation Patterns of BRCA1 and BRCA2

    PubMed Central

    Tram, Eric; Savas, Sevtap; Ozcelik, Hilmi

    2013-01-01

    Mutations in BRCA1 and BRCA2 are responsible for a large proportion of breast-ovarian cancer families. Protein-truncating mutations have been effectively used in the clinical management of familial breast cancer due to their deleterious impact on protein function. However, the majority of missense variants identified throughout the genes continue to pose an obstacle for predictive informative testing due to low frequency and lack of information on how they affect BRCA1/2 function. Phosphorylation of BRCA1 and BRCA2 play an important role in their function as regulators of DNA repair, transcription and cell cycle in response to DNA damage but whether missense variants of uncertain significance (VUS) are able to disrupt this important process is not known. Here we employed a novel approach using NetworKIN which predicts in vivo kinase-substrate relationship, and evolutionary conservation algorithms SIFT, PolyPhen and Align-GVGD. We evaluated whether 191 BRCA1 and 43 BRCA2 VUS from the Breast Cancer Information Core (BIC) database can functionally alter the consensus phosphorylation motifs and abolish kinase recognition and binding to sites known to be phosphorylated in vivo. Our results show that 13.09% (25/191) BRCA1 and 13.95% (6/43) BRCA2 VUS altered the phosphorylation of BRCA1 and BRCA2. We highlight six BRCA1 (K309T, S632N, S1143F, Q1144H, Q1281P, S1542C) and three BRCA2 (S196I, T207A, P3292L) VUS as potentially clinically significant. These occurred rarely (n<2 in BIC), mutated evolutionarily conserved residues and abolished kinase binding to motifs established in the literature involved in DNA repair, cell cycle regulation, transcription or response to DNA damage. Additionally in vivo phosphorylation sites identified via through-put methods are also affected by VUS and are attractive targets for studying their biological and functional significance. We propose that rare VUS affecting phosphorylation may be a novel and important mechanism for which BRCA1 and

  3. Combination of Whole Genome Sequencing, Linkage, and Functional Studies Implicates a Missense Mutation in Titin as a Cause of Autosomal Dominant Cardiomyopathy With Features of Left Ventricular Noncompaction

    PubMed Central

    Hastings, Robert; de Villiers, Carin P.; Hooper, Charlotte; Ormondroyd, Liz; Pagnamenta, Alistair; Lise, Stefano; Salatino, Silvia; Knight, Samantha J.L.; Taylor, Jenny C.; Thomson, Kate L.; Arnold, Linda; Chatziefthimiou, Spyros D.; Konarev, Petr V.; Wilmanns, Matthias; Ehler, Elisabeth; Ghisleni, Andrea; Gautel, Mathias; Blair, Edward; Watkins, Hugh

    2016-01-01

    Background— High throughput next-generation sequencing techniques have made whole genome sequencing accessible in clinical practice; however, the abundance of variation in the human genomes makes the identification of a disease-causing mutation on a background of benign rare variants challenging. Methods and Results— Here we combine whole genome sequencing with linkage analysis in a 3-generation family affected by cardiomyopathy with features of autosomal dominant left ventricular noncompaction cardiomyopathy. A missense mutation in the giant protein titin is the only plausible disease-causing variant that segregates with disease among the 7 surviving affected individuals, with interrogation of the entire genome excluding other potential causes. This A178D missense mutation, affecting a conserved residue in the second immunoglobulin-like domain of titin, was introduced in a bacterially expressed recombinant protein fragment and biophysically characterized in comparison to its wild-type counterpart. Multiple experiments, including size exclusion chromatography, small-angle x ray scattering, and circular dichroism spectroscopy suggest partial unfolding and domain destabilization in the presence of the mutation. Moreover, binding experiments in mammalian cells show that the mutation markedly impairs binding to the titin ligand telethonin. Conclusions— Here we present genetic and functional evidence implicating the novel A178D missense mutation in titin as the cause of a highly penetrant familial cardiomyopathy with features of left ventricular noncompaction. This expands the spectrum of titin’s roles in cardiomyopathies. It furthermore highlights that rare titin missense variants, currently often ignored or left uninterpreted, should be considered to be relevant for cardiomyopathies and can be identified by the approach presented here. PMID:27625337

  4. Mice with an NaV1.4 sodium channel null allele have latent myasthenia, without susceptibility to periodic paralysis

    PubMed Central

    Wu, Fenfen; Mi, Wentao; Fu, Yu; Struyk, Arie

    2016-01-01

    Over 60 mutations of SCN4A encoding the NaV1.4 sodium channel of skeletal muscle have been identified in patients with myotonia, periodic paralysis, myasthenia, or congenital myopathy. Most mutations are missense with gain-of-function defects that cause susceptibility to myotonia or periodic paralysis. Loss-of-function from enhanced inactivation or null alleles is rare and has been associated with myasthenia and congenital myopathy, while a mix of loss and gain of function changes has an uncertain relation to hypokalaemic periodic paralysis. To better define the functional consequences for a loss-of-function, we generated NaV1.4 null mice by deletion of exon 12. Heterozygous null mice have latent myasthenia and a right shift of the force-stimulus relation, without evidence of periodic paralysis. Sodium current density was half that of wild-type muscle and no compensation by retained expression of the foetal NaV1.5 isoform was detected. Mice null for NaV1.4 did not survive beyond the second postnatal day. This mouse model shows remarkable preservation of muscle function and viability for haploinsufficiency of NaV1.4, as has been reported in humans, with a propensity for pseudo-myasthenia caused by a marginal Na+ current density to support sustained high-frequency action potentials in muscle. PMID:27048647

  5. Solving a case of allelic dropout in the GNPTAB gene: implications in the molecular diagnosis of mucolipidosis type III alpha/beta.

    PubMed

    Coutinho, Maria Francisca; Encarnação, Marisa; Laranjeira, Francisco; Lacerda, Lúcia; Prata, Maria João; Alves, Sandra

    2016-10-01

    While being well known that the diagnosis of many genetic disorders relies on a combination of clinical suspicion and confirmatory genetic testing, not rarely, however, genetic testing needs much perseverance and cunning strategies to identify the causative mutation(s). Here we present a case of a thorny molecular diagnosis of mucolipidosis type III alpha/beta, which is an autosomal recessive lysosomal storage disorder, caused by a defect in the GNPTAB gene that codes for the α/β-subunits of the GlcNAc-1-phosphotransferase. We used both cDNA and gDNA analyses to characterize a mucolipidosis type III alpha/beta patient whose clinical diagnosis was already confirmed biochemically. In a first stage only one causal mutation was identified in heterozygosity, the already described missense mutation c.1196C>T(p.S399F), both at cDNA and gDNA levels. Only after conducting inhibition of nonsense-mediated mRNA decay (NMD) assays and after the utilization of another pair of primers the second mutation, the c.3503_3504delTC deletion, was identified. Our findings illustrate that allelic dropout due to the presence of polymorphisms and/or of mutations that trigger the NMD pathway can cause difficulties in current molecular diagnosis tests.

  6. Mice with an NaV1.4 sodium channel null allele have latent myasthenia, without susceptibility to periodic paralysis.

    PubMed

    Wu, Fenfen; Mi, Wentao; Fu, Yu; Struyk, Arie; Cannon, Stephen C

    2016-06-01

    Over 60 mutations of SCN4A encoding the NaV1.4 sodium channel of skeletal muscle have been identified in patients with myotonia, periodic paralysis, myasthenia, or congenital myopathy. Most mutations are missense with gain-of-function defects that cause susceptibility to myotonia or periodic paralysis. Loss-of-function from enhanced inactivation or null alleles is rare and has been associated with myasthenia and congenital myopathy, while a mix of loss and gain of function changes has an uncertain relation to hypokalaemic periodic paralysis. To better define the functional consequences for a loss-of-function, we generated NaV1.4 null mice by deletion of exon 12. Heterozygous null mice have latent myasthenia and a right shift of the force-stimulus relation, without evidence of periodic paralysis. Sodium current density was half that of wild-type muscle and no compensation by retained expression of the foetal NaV1.5 isoform was detected. Mice null for NaV1.4 did not survive beyond the second postnatal day. This mouse model shows remarkable preservation of muscle function and viability for haploinsufficiency of NaV1.4, as has been reported in humans, with a propensity for pseudo-myasthenia caused by a marginal Na(+) current density to support sustained high-frequency action potentials in muscle.

  7. Two novel heterozygote missense mutations of the ADAMTS13 gene in a child with recurrent thrombotic thrombocytopenic purpura

    PubMed Central

    Rossio, Raffaella; Ferrari, Barbara; Cairo, Andrea; Mancini, Ilaria; Pisapia, Giovanni; Palazzo, Giulia; Peyvandi, Flora

    2013-01-01

    Background Thrombotic thrombocytopenic purpura is a rare, life-threatening disease characterised by microangiopathic haemolytic anaemia, thrombocytopenia and symptoms related to organ ischaemia, mainly involving the brain and the kidney. It is associated with a deficiency of ADAMTS13, a plasma metalloprotease that cleaves von Willebrand factor. The congenital form (Upshaw-Schulman syndrome) is rare and is associated with mutations of the ADAMTS13 gene on chromosome 9q34. The clinical symptoms of congenital thrombotic thrombocytopenic purpura are variable, with some patients developing their first episode during the neonatal period or childhood and others becoming symptomatic in adulthood. Materials and methods We describe a case of thrombotic thrombocytopenic purpura, who presented to our attention with a relapsing form of the disease: the first episode occurred at the age of 13 months. Phenotype and genotype tests were performed in the patient and his family. Results The undetectable level of ADAMTS13 in the patient was caused by two novel heterozygote missense mutations on the ADAMTS13 gene: one mutation is c.788C > T (p.Ser263Phe) on exon 7 and the second is c.3251G > A (p.Cys1084Tyr) on exon 25 of the ADAMTS13 gene. All the relatives who have been investigated were found to carry one of these missense mutations in a heterozygous state. Discussion Although Upshaw-Schulman syndrome is a rare disease, it should be considered in all children with thrombocytopenia and jaundice in the neonatal period. In fact, once a child is confirmed to carry mutations of the ADAMTS13 gene causing early thrombotic thrombocytopenic purpura, prophylactic treatment should be started to avoid recurrence of symptoms. Genotype tests of relatives would also be important for those women in the family who could be carriers of ADAMTS13 mutations, particularly during pregnancy. PMID:23058857

  8. Clinical features and MUT gene mutation spectrum in Chinese patients with isolated methylmalonic acidemia: identification of ten novel allelic variants.

    PubMed

    Han, Lian-Shu; Huang, Zhuo; Han, Feng; Ye, Jun; Qiu, Wen-Juan; Zhang, Hui-Wen; Wang, Yu; Gong, Zhu-Wen; Gu, Xue-Fan

    2015-11-01

    This study aims to study MUT gene mutation spectrum in Chinese patients with isolated methylmalonic academia (MMA) and their clinical features for the potential genotype-phenotype correlation. Forty-three patients were diagnosed with isolated MMA by elevated blood propionylcarnitine, propionylcarnitine to acetylcarnitine ratio, and urine methylmalonate without hyperhomocysteinemia. The MUT gene was amplified by polymerase chain reaction and directly sequenced. Those patients with at least one variant allele were included. The novel missense mutations were assessed by bioinformatic analysis and screened against alleles sequenced from 50 control participants. Among the 43 patients, 38 had typical clinical presentations, and the majority (30/38) experienced earlyonset MMA. Eight patients died and seven were lost to follow-up. Twenty patients had poor outcomes and eight showed normal development. The 43 identified MUT gene mutations had at least one variant allele, whereas 35 had two mutant alleles. Of the 33 mutations reported before, eight recurrent mutations were identified in 32 patients, and c.729_730insTT (p.D244Lfs*39) was the most common (12/78) in the mutant alleles. Of the 10 novel mutations, six were missense mutations and four were premature termination codon mutations. The six novel missense mutations seemed to be pathogenic. A total of 10 novel MUT mutations were detected in the Chinese population. c.729_730insTT (p.D244Lfs*39) was the most frequent mutation. A genotype-phenotype correlation could not be found, but the genotypic characterization indicated the need of genetic counseling for MMA patients and early prenatal diagnoses for high-risk families.

  9. Missense mutations (p.H371Y, p.D438Y) in gene CHEK2 are associated with breast cancer risk in women of Balochistan origin.

    PubMed

    Baloch, Abdul Hameed; Daud, Shakeela; Raheem, Nafeesa; Luqman, Muhammad; Ahmad, Adeel; Rehman, Abdul; Shuja, Jameela; Rasheed, Saeeda; Ali, Akhtar; Kakar, Naseebullah; Naseeb, Hafiz Khush; Mengal, Mohammad Alam; Awan, Muhammad Arif; Wasim, Muhammad; Baloch, Dost Mohammad; Ahmad, Jamil

    2014-02-01

    CHEK2 encodes a serine/threonine-protein kinase which plays a critical role in DNA damage signaling pathways. CHEK2 directly phosphorylates and regulates the functions of p53 and BRCA1. Most women with breast and/or ovarian cancer are not carriers of mutant BRCA1 or BRCA2. Multiple studies have shown that a CHEK2*1100delC confers about a two-fold increased risk of breast cancer in unselected females and a tenfold increase in males. Moreover, studies have shown that first-degree relatives of bilateral breast cancer cases who carried the CHEK2*1100delC allele had an eight-fold increased risk of breast cancer. It has been suggested that CHEK2 functions as a low-penetrance susceptibility gene for cancers and multiplies the risks associated with other gene(s) to increase cancer risk. The main goal of this study was to evaluate and to compare the role of truncating mutations, splice junction mutations and rare missense substitutions in breast cancer susceptibility gene CHEK2. Present study was performed on 140 individuals including 70 breast cancer patients both with and without family history and 70 normal individuals. Written consent was obtained and 3 ml intravenous blood was drawn from all the subjects. DNA was extracted from all the samples through inorganic method published already. Primers were synthesized for all the 14 exons of CHEK2 gene. Coding and adjacent intronic sequences of CHEK2 gene were amplified and sequenced. Two genetic variants (p.H371Y, p.D438Y) were found in exon 10 and exon 11 of gene CHEK2 which were not found in any of the 70 control individuals from same geographical area and ethnic group. The genetic variant c.1312G>T (p.D438Y) identified in a patient with a family history of breast cancer. To our knowledge, this is first mutation scanning study of gene CHEK2 from Balochistan population.

  10. A novel missense mutation in the EVC gene underlies Ellis-van Creveld syndrome in a Pakistani family.

    PubMed

    Umm-E-Kalsoom; Wasif, Naveed; Tariq, Muhammad; Ahmad, Wasim

    2010-04-01

    Ellis-van Creveld (EVC) syndrome is a rare autosomal recessive disorder characterized by skeletal, ectodermal and cardiac defects. This syndrome is caused by mutations in EVC and EVC2 genes, which are separated by 2.6 kb of genomic sequence on chromosome 4p16. In the present study we ascertained a four-generation pedigree of Pakistani origin with features of EVC. Linkage was searched by genotyping microsatellite markers linked to chromosome 4p16. Affected individuals showed homozygosity to the microsatellite markers tightly linked to EVC and EVC2 genes on chromosome 4p16. It was then subjected to direct sequencing of the EVC and EVC2 genes. Mutation analysis of the EVC and EVC2 genes identified a novel missense change (c.617G>A; p.S206N) in the EVC gene. We herein report on the first family from Pakistan with a large number of individuals affected by EVC. DNA sequence analysis led to the identification of the fifth missense mutation in the EVC gene.

  11. De novo missense mutations in the NAA10 gene cause severe non-syndromic developmental delay in males and females

    PubMed Central

    Popp, Bernt; Støve, Svein I; Endele, Sabine; Myklebust, Line M; Hoyer, Juliane; Sticht, Heinrich; Azzarello-Burri, Silvia; Rauch, Anita; Arnesen, Thomas; Reis, André

    2015-01-01

    Recent studies revealed the power of whole-exome sequencing to identify mutations in sporadic cases with non-syndromic intellectual disability. We now identified de novo missense variants in NAA10 in two unrelated individuals, a boy and a girl, with severe global developmental delay but without any major dysmorphism by trio whole-exome sequencing. Both de novo variants were predicted to be deleterious, and we excluded other variants in this gene. This X-linked gene encodes N-alpha-acetyltransferase 10, the catalytic subunit of the NatA complex involved in multiple cellular processes. A single hypomorphic missense variant p.(Ser37Pro) was previously associated with Ogden syndrome in eight affected males from two different families. This rare disorder is characterized by a highly recognizable phenotype, global developmental delay and results in death during infancy. In an attempt to explain the discrepant phenotype, we used in vitro N-terminal acetylation assays which suggested that the severity of the phenotype correlates with the remaining catalytic activity. The variant in the Ogden syndrome patients exhibited a lower activity than the one seen in the boy with intellectual disability, while the variant in the girl was the most severe exhibiting only residual activity in the acetylation assays used. We propose that N-terminal acetyltransferase deficiency is clinically heterogeneous with the overall catalytic activity determining the phenotypic severity. PMID:25099252

  12. A homozygous HOXD13 missense mutation causes a severe form of synpolydactyly with metacarpal to carpal transformation.

    PubMed

    Ibrahim, Daniel M; Tayebi, Naeimeh; Knaus, Alexej; Stiege, Asita C; Sahebzamani, Afsaneh; Hecht, Jochen; Mundlos, Stefan; Spielmann, Malte

    2016-03-01

    Synpolydactyly (SPD) is a rare congenital limb disorder characterized by syndactyly between the third and fourth fingers and an additional digit in the syndactylous web. In most cases SPD is caused by heterozygous mutations in HOXD13 resulting in the expansion of a N-terminal polyalanine tract. If homozygous, the mutation results in severe shortening of all metacarpals and phalanges with a morphological transformation of metacarpals to carpals. Here, we describe a novel homozygous missense mutation in a family with unaffected consanguineous parents and severe brachydactyly and metacarpal-to-carpal transformation in the affected child. We performed whole exome sequencing on the index patient, followed by Sanger sequencing of parents and patient to investigate cosegregation. The DNA-binding ability of the mutant protein was tested with electrophoretic mobility shift assays. We demonstrate that the c.938C>G (p.313T>R) mutation in the DNA-binding domain of HOXD13 prevents binding to DNA in vitro. Our results show to our knowledge for the first time that a missense mutation in HOXD13 underlies severe brachydactyly with metacarpal-to-carpal transformation. The mutation is non-penetrant in heterozygous carriers. In conjunction with the literature we propose the possibility that the metacarpal-to-carpal transformation results from a homozygous loss of functional HOXD13 protein in humans in combination with an accumulation of non-functional HOXD13 that might be able to interact with other transcription factors in the developing limb. © 2015 Wiley Periodicals, Inc.

  13. A Novel APOC2 Missense Mutation Causing Apolipoprotein C-II Deficiency With Severe Triglyceridemia and Pancreatitis.

    PubMed

    Ueda, Masako; Dunbar, Richard L; Wolska, Anna; Sikora, Tracey U; Escobar, Maria Del Rosario; Seliktar, Naomi; deGoma, Emil; DerOhannessian, Stephanie; Morrell, Linda; McIntyre, Adam D; Burke, Frances; Sviridov, Denis; Amar, Marcelo; Shamburek, Robert D; Freeman, Lita; Hegele, Robert A; Remaley, Alan T; Rader, Daniel J

    2017-05-01

    Familial chylomicronemia syndrome (FCS) is a rare heritable disorder associated with severe hypertriglyceridemia and recurrent pancreatitis. Lipoprotein lipase deficiency and apolipoprotein C-II deficiency are two well-characterized autosomal recessive causes of FCS, and three other genes have been described to cause FCS. Because therapeutic approaches can vary according to the underlying etiology, it is important to establish the molecular etiology of FCS. A man originally from North Africa was referred to the University of Pennsylvania Lipid Clinic for severe hypertriglyceridemia and recurrent pancreatitis, consistent with the clinical diagnosis of FCS. Molecular analyses of FCS-associated genes revealed a homozygous missense variant R72T in APOC2. Molecular modeling of the variant predicted that the apolipoprotein C-II R72T peptide has reduced lipid binding affinity. In vitro studies of the patient's plasma confirmed the lack of functional apoC-II activity. Moreover, the apoC-II protein was undetectable in the patient's plasma, quantitatively as well as qualitatively. We identified a missense APOC2 variant causing apoC-II deficiency in a patient with severe hypertriglyceridemia and recurrent pancreatitis. Beyond dietary management and usual pharmacologic therapies, an apoC-II mimetic peptide may become an optional therapy in patients with apoC-II deficiency in the future.

  14. Vibratory Urticaria Associated with a Missense Variant in ADGRE2

    PubMed Central

    Boyden, Steven E.; Desai, Avanti; Cruse, Glenn; Young, Michael L.; Bolan, Hyejeong C.; Scott, Linda M.; Eisch, A. Robin; Long, R. Daniel; Lee, Chyi-Chia R.; Satorius, Colleen L.; Pakstis, Andrew J.; Olivera, Ana; Mullikin, James C.; Chouery, Eliane; Mégarbané, André; Medlej-Hashim, Myrna; Kidd, Kenneth K.; Kastner, Daniel L.; Metcalfe, Dean D.; Komarow, Hirsh D.

    2016-01-01

    SUMMARY Patients with autosomal dominant vibratory urticaria have localized hives and systemic manifestations in response to dermal vibration, with coincident degranulation of mast cells and increased histamine levels in serum. We identified a previously unknown missense substitution in ADGRE2 (also known as EMR2), which was predicted to result in the replacement of cysteine with tyrosine at amino acid position 492 (p.C492Y), as the only nonsynonymous variant cosegregating with vibratory urticaria in two large kindreds. The ADGRE2 receptor undergoes autocatalytic cleavage, producing an extracellular subunit that noncovalently binds a transmembrane subunit. We showed that the variant probably destabilizes an autoinhibitory subunit interaction, sensitizing mast cells to IgE-independent vibration-induced degranulation. (Funded by the National Institutes of Health.) PMID:26841242

  15. Analysis of elite variety tag SNPs reveals an important allele in upland rice.

    PubMed

    Lyu, Jun; Zhang, Shilai; Dong, Yang; He, Weiming; Zhang, Jing; Deng, Xianneng; Zhang, Yesheng; Li, Xin; Li, Baoye; Huang, Wangqi; Wan, Wenting; Yu, Yang; Li, Qiong; Li, Jun; Liu, Xin; Wang, Bo; Tao, Dayun; Zhang, Gengyun; Wang, Jun; Xu, Xun; Hu, Fengyi; Wang, Wen

    2013-01-01

    Elite crop varieties usually fix alleles that occur at low frequencies within non-elite gene pools. Dissecting these alleles for desirable agronomic traits can be accomplished by comparing the genomes of elite varieties with those from non-elite populations. Here we deep-sequence six elite rice varieties and use two large control panels to identify elite variety tag single-nucleotide polymorphism alleles (ETASs). Guided by this preliminary analysis, we comprehensively characterize one protein-altering ETAS in the 9-cis-epoxycarotenoid dioxygenase gene of the IRAT104 upland rice variety. This allele displays a drastic frequency difference between upland and irrigated rice, and a selective sweep is observed around this allele. Functional analysis indicates that in upland rice, this allele is associated with significantly higher abscisic acid levels and denser lateral roots, suggesting its association with upland rice suitability. This report provides a potential strategy to mine rare, agronomically important alleles.

  16. Missense Mutations in CRYAB Are Liable for Recessive Congenital Cataracts

    PubMed Central

    Irum, Bushra; Khan, Arif O.; Wang, Qiwei; Kabir, Firoz; Khan, Asma A.; Husnain, Tayyab; Akram, Javed; Riazuddin, Sheikh

    2015-01-01

    Purpose This study was initiated to identify causal mutations responsible for autosomal recessive congenital cataracts in consanguineous familial cases. Methods Affected individuals underwent a detailed ophthalmological and clinical examination, and slit-lamp photographs were ascertained for affected individuals who have not yet been operated for the removal of the cataractous lens. Blood samples were obtained, and genomic DNA was extracted from white blood cells. A genome-wide scan was completed with short tandem repeat (STR) markers, and the logarithm of odds (LOD) scores were calculated. Protein coding exons of CRYAB were sequenced, bi-directionally. Evolutionary conservation was investigated by aligning CRYAB orthologues, and the expression of Cryab in embryonic and postnatal mice lens was investigated with TaqMan probe. Results The clinical and ophthalmological examinations suggested that all affected individuals had nuclear cataracts. Genome-wide linkage analysis suggested a potential region on chromosome 11q23 harboring CRYAB. DNA sequencing identified a missense variation: c.34C>T (p.R12C) in CRYAB that segregated with the disease phenotype in the family. Subsequent interrogation of our entire cohort of familial cases identified a second familial case localized to chromosome 11q23 harboring a c.31C>T (p.R11C) mutation. In silico analyses suggested that the mutations identified in familial cases, p.R11C and p.R12C will not be tolerated by the three-dimensional structure of CRYAB. Real-time PCR analysis identified the expression of Cryab in mouse lens as early as embryonic day 15 (E15) that increased significantly until postnatal day 6 (P6) with steady level of expression thereafter. Conclusion Here, we report two novel missense mutations, p.R11C and p.R12C, in CRYAB associated with autosomal recessive congenital nuclear cataracts. PMID:26402864

  17. Computational study of missense mutations in phenylalanine hydroxylase.

    PubMed

    Réblová, Kamila; Kulhánek, Petr; Fajkusová, Lenka

    2015-04-01

    Hyperphenylalaninemia (HPA) is one of the most common metabolic disorders. HPA, which is transmitted by an autosomal recessive mode of inheritance, is caused by mutations of the phenylalanine hydroxylase gene. Most mutations are missense and lead to reduced protein stability and/or impaired catalytic function. The impact of such mutations varies, ranging from classical phenylketonuria (PKU), mild PKU, to non-PKU HPA phenotypes. Despite the fact that HPA is a monogenic disease, clinical data show that one PKU genotype can be associated with more in vivo phenotypes, which indicates the role of other (still unknown) factors. To better understand the phenotype-genotype relationships, we analyzed computationally the impact of missense mutations in homozygotes stored in the BIOPKU database. A total of 34 selected homozygous genotypes was divided into two main groups according to their phenotypes: (A) genotypes leading to non-PKU HPA or combined phenotype non-PKU HPA/mild PKU and (B) genotypes leading to classical PKU, mild PKU or combined phenotype mild PKU/classical PKU. Combining in silico analysis and molecular dynamics simulations (in total 3 μs) we described the structural impact of the mutations, which allowed us to separate 32 out of 34 mutations between groups A and B. Testing the simulation conditions revealed that the outcome of mutant simulations can be modulated by the ionic strength. We also employed programs SNPs3D, Polyphen-2, and SIFT but based on the predictions performed we were not able to discriminate mutations with mild and severe PKU phenotypes.

  18. A hypomorphic allele of Tsc2 highlights the role of TSC1/TSC2 in signaling to AKT and models mild human TSC2 alleles.

    PubMed

    Pollizzi, Kristen; Malinowska-Kolodziej, Izabela; Doughty, Cheryl; Betz, Charles; Ma, Jian; Goto, June; Kwiatkowski, David J

    2009-07-01

    Tuberous sclerosis complex (TSC) is a tumor suppressor gene syndrome in which hamartomas develop in multiple organ systems. Knockout and conditional alleles of Tsc1 and Tsc2 have been previously reported. Here, we describe the generation of a novel hypomorphic allele of Tsc2 (del3), in which exon 3, encoding 37 amino acids near the N terminus of tuberin, is deleted. Embryos homozygous for the del3 allele survive until E13.5, 2 days longer than Tsc2 null embryos. Embryos die from underdevelopment of the liver, deficient hematopoiesis, aberrant vascular development and hemorrhage. Mice that are heterozygous for the del3 allele have a markedly reduced kidney tumor burden in comparison with conventional Tsc2(+/-) mice. Murine embryo fibroblast (MEF) cultures that are homozygous for the del3 allele express mutant tuberin at low levels, and show enhanced activation of mTORC1, similar to Tsc2 null MEFs. Furthermore, the mutant cells show prominent reduction in the activation of AKT. Similar findings were made in the analysis of homozygous del3 embryo lysates. Tsc2-del3 demonstrates GTPase activating protein activity comparable to that of wild-type Tsc2 in a functional assay. These findings indicate that the del3 allele is a hypomorphic allele of Tsc2 with partial function due to reduced expression, and highlight the consistency of AKT downregulation when Tsc1/Tsc2 function is reduced. Tsc2-del3 mice also serve as a model for hypomorphic TSC2 missense mutations reported in TSC patients.

  19. Congenital insensitivity to pain: novel SCN9A missense and in-frame deletion mutations.

    PubMed

    Cox, James J; Sheynin, Jony; Shorer, Zamir; Reimann, Frank; Nicholas, Adeline K; Zubovic, Lorena; Baralle, Marco; Wraige, Elizabeth; Manor, Esther; Levy, Jacov; Woods, C Geoffery; Parvari, Ruti

    2010-09-01

    SCN9Aencodes the voltage-gated sodium channel Na(v)1.7, a protein highly expressed in pain-sensing neurons. Mutations in SCN9A cause three human pain disorders: bi-allelic loss of function mutations result in Channelopathy-associated Insensitivity to Pain (CIP), whereas activating mutations cause severe episodic pain in Paroxysmal Extreme Pain Disorder (PEPD) and Primary Erythermalgia (PE). To date, all mutations in SCN9A that cause a complete inability to experience pain are protein truncating and presumably lead to no protein being produced. Here, we describe the identification and functional characterization of two novel non-truncating mutations in families with CIP: a homozygously-inherited missense mutation found in a consanguineous Israeli Bedouin family (Na(v)1.7-R896Q) and a five amino acid in-frame deletion found in a sporadic compound heterozygote (Na(v)1.7-DeltaR1370-L1374). Both of these mutations map to the pore region of the Na(v)1.7 sodium channel. Using transient transfection of PC12 cells we found a significant reduction in membrane localization of the mutant protein compared to the wild type. Furthermore, voltage clamp experiments of mutant-transfected HEK293 cells show a complete loss of function of the sodium channel, consistent with the absence of pain phenotype. In summary, this study has identified critical amino acids needed for the normal subcellular localization and function of Na(v)1.7.

  20. What Is a Recessive Allele?

    ERIC Educational Resources Information Center

    American Biology Teacher, 1991

    1991-01-01

    Presents four misconceptions students have concerning the concepts of recessive and dominant alleles. Discusses the spectrum of dominant-recessive relationships, different levels of analysis between phenotype and genotype, possible causes of dominance, and an example involving wrinkled peas. (MDH)

  1. What Is a Recessive Allele?

    ERIC Educational Resources Information Center

    American Biology Teacher, 1991

    1991-01-01

    Presents four misconceptions students have concerning the concepts of recessive and dominant alleles. Discusses the spectrum of dominant-recessive relationships, different levels of analysis between phenotype and genotype, possible causes of dominance, and an example involving wrinkled peas. (MDH)

  2. Diversity and Impact of Rare Variants in Genes Encoding the Platelet G Protein-Coupled Receptors

    PubMed Central

    Jones, Matthew L.; Norman, Jane E.; Morgan, Neil V.; Mundell, Stuart J.; Lordkipanidzé, Marie; Lowe, Gillian C.; Daly, Martina E.; Simpson, Michael A.; Drake, Sian; Watson, Steve P.

    2015-01-01

    Summary Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70% had global minor allele frequency (MAF) < 0.05%. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21%) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF<1% and 22 with MAF ≥ 1%). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes. PMID:25567036

  3. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    PubMed

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  4. A missense mutation in the agouti signaling protein gene (ASIP) is associated with the no light points coat phenotype in donkeys.

    PubMed

    Abitbol, Marie; Legrand, Romain; Tiret, Laurent

    2015-04-08

    Seven donkey breeds are recognized by the French studbook and are characterized by a black, bay or grey coat colour including light cream-to-white points (LP). Occasionally, Normand bay donkeys give birth to dark foals that lack LP and display the no light points (NLP) pattern. This pattern is more frequent and officially recognized in American miniature donkeys. The LP (or pangare) phenotype resembles that of the light bellied agouti pattern in mouse, while the NLP pattern resembles that of the mammalian recessive black phenotype; both phenotypes are associated with the agouti signaling protein gene (ASIP). We used a panel of 127 donkeys to identify a recessive missense c.349 T > C variant in ASIP that was shown to be in complete association with the NLP phenotype. This variant results in a cysteine to arginine substitution at position 117 in the ASIP protein. This cysteine is highly-conserved among vertebrate ASIP proteins and was previously shown by mutagenesis experiments to lie within a functional site. Altogether, our results strongly support that the identified mutation is causative of the NLP phenotype. Thus, we propose to name the c.[349 T > C] allele in donkeys, the a(nlp) allele, which enlarges the panel of coat colour alleles in donkeys and ASIP recessive loss-of-function alleles in animals.

  5. Choreography of Ig allelic exclusion.

    PubMed

    Cedar, Howard; Bergman, Yehudit

    2008-06-01

    Allelic exclusion guarantees that each B or T cell only produces a single antigen receptor, and in this way contributes to immune diversity. This process is actually initiated in the early embryo when the immune receptor loci become asynchronously replicating in a stochastic manner with one early and one late allele in each cell. This distinct differential replication timing feature then serves an instructive mark that directs a series of allele-specific epigenetic events in the immune system, including programmed histone modification, nuclear localization and DNA demethylation that ultimately bring about preferred rearrangement on a single allele, and this decision is temporally stabilized by feedback mechanisms that inhibit recombination on the second allele. In principle, these same molecular components are also used for controlling monoallelic expression at other genomic loci, such as those carrying interleukins and olfactory receptor genes that require the choice of one gene out of a large array. Thus, allelic exclusion appears to represent a general epigenetic phenomenon that is modeled on the same basis as X chromosome inactivation.

  6. Using sheep genomes from diverse U.S. breeds to identify missense variants in genes affecting fecundity

    PubMed Central

    Heaton, Michael P.; Smith, Timothy P.L.; Freking, Bradley A.; Workman, Aspen M.; Bennett, Gary L.; Carnahan, Jacky K.; Kalbfleisch, Theodore S.

    2017-01-01

    Background:  Access to sheep genome sequences significantly improves the chances of identifying genes that may influence the health, welfare, and productivity of these animals.   Methods:  A public, searchable DNA sequence resource for U.S. sheep was created with whole genome sequence (WGS) of 96 rams.  The animals shared minimal pedigree relationships and represent nine popular U.S. breeds and a composite line.  The genomes are viewable online with the user-friendly Integrated Genome Viewer environment, and may be used to identify and decode gene variants present in U.S. sheep. Results:  The genomes had a combined average read depth of 16, and an average WGS genotype scoring rate and accuracy exceeding 99%.  The utility of this resource was illustrated by characterizing three genes with 14 known coding variants affecting litter size in global sheep populations:  growth and differentiation factor 9 ( GDF9), bone morphogenetic protein 15 ( BMP15), and bone morphogenetic protein receptor 1B ( BMPR1B).  In the 96 U.S. rams, nine missense variants encoding 11 protein variants were identified.  However, only one was previously reported to affect litter size ( GDF9 V371M, Finnsheep).  Two missense variants in BMP15 were identified that had not previously been reported:  R67Q in Dorset, and L252P in Dorper and White Dorper breeds. Also, two novel missense variants were identified in BMPR1B:  M64I in Katahdin, and T345N in Romanov and Finnsheep breeds.  Based on the strict conservation of amino acid residues across placental mammals, the four variants encoded by BMP15 and BMPR1B are predicted to interfere with their function.  However, preliminary analyses of litter sizes in small samples did not reveal a correlation with variants in BMP15 and BMPR1B with daughters of these rams.  Conclusions: Collectively, this report describes a new resource for discovering protein variants in silico and identifies alleles for further testing of their effects on litter

  7. Genotype-to-phenotype analysis: Search for clinical characteristics of a missense change in the GABA{sub A}-{beta}1 receptor gene

    SciTech Connect

    Sobell, J.L.; Sigurdson, D.C.; Sommer, S.S.

    1996-02-16

    Genotype-to-phenotype analysis reverses the classical approach to genetic disease in which an unknown genotype is sought for a known phenotype. This paper provides an example of genotype-to-phenotype analysis for the possible psychiatric effects of a missense mutation (H396Q) at a highly conserved residue of the {Beta}1 subunit gene of the gamma aminobutyric acid type A receptor. DNA samples from 1,507 Caucasians of Western European descent were screened, and 10 heterozygotes for H396Q were identified. These individuals were matched to homozygous normal individuals by age, gender, and length of available medical records. The complete medical records of these 20 individuals were reviewed blindly by two psychiatrists (D.C.S., L.L.H.) to assess psychiatric symptomatology, with an emphasis on anxiety and related disorders. However, no association was found between this missense change at a conserved amino acid and a dominant neuropsychiatric disease phenotype. Thus, this missense change may be neutral or only mildly deleterious, may only cause recessive disease in rare individuals, or may interact epistatically with some other gene(s). 17 refs.

  8. A novel rare variant R292H in RTN4R affects growth cone formation and possibly contributes to schizophrenia susceptibility.

    PubMed

    Kimura, H; Fujita, Y; Kawabata, T; Ishizuka, K; Wang, C; Iwayama, Y; Okahisa, Y; Kushima, I; Morikawa, M; Uno, Y; Okada, T; Ikeda, M; Inada, T; Branko, A; Mori, D; Yoshikawa, T; Iwata, N; Nakamura, H; Yamashita, T; Ozaki, N

    2017-08-22

    Reticulon 4 receptor (RTN4R) plays an essential role in regulating axonal regeneration and plasticity in the central nervous system through the activation of rho kinase, and is located within chromosome 22q11.2, a region that is known to be a hotspot for schizophrenia (SCZ) and autism spectrum disorder (ASD). Recently, rare variants such as copy-number variants and single-nucleotide variants have been a focus of research because of their large effect size associated with increased susceptibility to SCZ and ASD and the possibility of elucidating the pathophysiology of mental disorder through functional analysis of the discovered rare variants. To discover rare variants with large effect size and to evaluate their role in the etiopathophysiology of SCZ and ASD, we sequenced the RTN4R coding exons with a sample comprising 370 SCZ and 192 ASD patients, and association analysis using a large number of unrelated individuals (1716 SCZ, 382 ASD and 4009 controls). Through this mutation screening, we discovered four rare (minor allele frequency <1%) missense mutations (R68H, D259N, R292H and V363M) of RTN4R. Among these discovered rare mutations, R292H was found to be significantly associated with SCZ (P=0.048). Furthermore, in vitro functional assays showed that the R292H mutation affected the formation of growth cones. This study strengthens the evidence for association between rare variants within RTN4R and SCZ, and may shed light on the molecular mechanisms underlying the neurodevelopmental disorder.

  9. Identification of a De Novo Heterozygous Missense FLNB Mutation in Lethal Atelosteogenesis Type I by Exome Sequencing

    PubMed Central

    Jeon, Ga Won; Lee, Mi-Na; Jung, Ji Mi; Hong, Seong Yeon; Kim, Young Nam; Sin, Jong Beom

    2014-01-01

    Background Atelosteogenesis type I (AO-I) is a rare lethal skeletal dysplastic disorder characterized by severe short-limbed dwarfism and dislocated hips, knees, and elbows. AO-I is caused by mutations in the filamin B (FLNB) gene; however, several other genes can cause AO-like lethal skeletal dysplasias. Methods In order to screen all possible genes associated with AO-like lethal skeletal dysplasias simultaneously, we performed whole-exome sequencing in a female newborn having clinical features of AO-I. Results Exome sequencing identified a novel missense variant (c.517G>A; p.Ala173Thr) in exon 2 of the FLNB gene in the patient. Sanger sequencing validated this variant, and genetic analysis of the patient's parents suggested a de novo occurrence of the variant. Conclusions This study shows that exome sequencing can be a useful tool for the identification of causative mutations in lethal skeletal dysplasia patients. PMID:24624349

  10. Variants of the D{sub 5} dopamine receptor gene found in patients with schizophrenia: Identification of a nonsense mutation and multiple missense changes

    SciTech Connect

    Sobell, J.L.; Lind, T.J.; Sommer, S.S.

    1994-09-01

    To determine whether mutations in the D{sub 5} dopamine receptor (D{sub 5}DR) gene are associated with schizophrenia, the gene was examined in 78 unrelated schizophrenic individuals. After amplification by the polymerase chain reaction, products were examined by dideoxy fingerprinting (ddF), a highly sensitive screening method related to single strand conformational polymorphism analysis. All samples with unusual ddF patterns were sequenced to precisely identify the sequence change. In the 156 D{sub 5}DR alleles examined, nine sequence changes were identified. Four of the nine did not affect protein structure; of these, three were silent changes and one was a transition in the 3{prime} untranslated region. The remaining five sequence changes result in protein alterations: of these, one is a missense change in a non-conserved amino acid, 3 are missense changes in amino acids that are conserved in some dopamine D{sub 5} receptors and the last is a nonsense mutation. To investigate whether the nonsense mutation was associated with schizophrenia, 400 additional schizophrenic cases of western European descent and 1914 ethnically-similar controls were screened for the change. One additional schizophrenic carrier was identified and verified by direct genomic sequencing (allele frequency: .0013), but eight carriers also were found and confirmed among the non-schizophrenics (allele frequency: .0021)(p>.25). The gene was re-examined in all newly identified carriers of the nonsense mutation by direct sequencing and/or ddF in search of additional mutations. None were identified. Family studies also were conducted to investigate possible cosegregation of the mutation with other neuropsychiatric diseases, but this was not demonstrated. Thus, the mutation does not appear to be associated with an increased risk of schizophrenia nor does an initial analysis suggest cosegregation with other neuropsychiatric disorders or symptom complexes.

  11. Rare complement factor H variant associated with age-related macular degeneration in the Amish.

    PubMed

    Hoffman, Joshua D; Cooke Bailey, Jessica N; D'Aoust, Laura; Cade, William; Ayala-Haedo, Juan; Fuzzell, Denise; Laux, Renee; Adams, Larry D; Reinhart-Mercer, Lori; Caywood, Laura; Whitehead-Gay, Patrice; Agarwal, Anita; Wang, Gaofeng; Scott, William K; Pericak-Vance, Margaret A; Haines, Jonathan L

    2014-06-06

    Age-related macular degeneration is the leading cause of blindness among the adult population in the developed world. To further the understanding of this disease, we have studied the genetically isolated Amish population of Ohio and Indiana. Cumulative genetic risk scores were calculated using the 19 known allelic associations. Exome sequencing was performed in three members of a small Amish family with AMD who lacked the common risk alleles in complement factor H (CFH) and ARMS2/HTRA1. Follow-up genotyping and association analysis was performed in a cohort of 973 Amish individuals, including 95 with self-reported AMD. The cumulative genetic risk score analysis generated a mean genetic risk score of 1.12 (95% confidence interval [CI]: 1.10, 1.13) in the Amish controls and 1.18 (95% CI: 1.13, 1.22) in the Amish cases. This mean difference in genetic risk scores is statistically significant (P = 0.0042). Exome sequencing identified a rare variant (P503A) in CFH. Association analysis in the remainder of the Amish sample revealed that the P503A variant is significantly associated with AMD (P = 9.27 × 10(-13)). Variant P503A was absent when evaluated in a cohort of 791 elderly non-Amish controls, and 1456 non-Amish cases. Data from the cumulative genetic risk score analysis suggests that the variants reported by the AMDGene consortium account for a smaller genetic burden of disease in the Amish compared with the non-Amish Caucasian population. Using exome sequencing data, we identified a novel missense mutation that is shared among a densely affected nuclear Amish family and located in a gene that has been previously implicated in AMD risk. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  12. Rare Complement Factor H Variant Associated With Age-Related Macular Degeneration in the Amish

    PubMed Central

    Hoffman, Joshua D.; CookeBailey, Jessica N.; D'Aoust, Laura; Cade, William; Ayala-Haedo, Juan; Fuzzell, Denise; Laux, Renee; Adams, Larry D.; Reinhart-Mercer, Lori; Caywood, Laura; Whitehead-Gay, Patrice; Agarwal, Anita; Wang, Gaofeng; Scott, William K.; Pericak-Vance, Margaret A.; Haines, Jonathan L.

    2014-01-01

    Purpose. Age-related macular degeneration is the leading cause of blindness among the adult population in the developed world. To further the understanding of this disease, we have studied the genetically isolated Amish population of Ohio and Indiana. Methods. Cumulative genetic risk scores were calculated using the 19 known allelic associations. Exome sequencing was performed in three members of a small Amish family with AMD who lacked the common risk alleles in complement factor H (CFH) and ARMS2/HTRA1. Follow-up genotyping and association analysis was performed in a cohort of 973 Amish individuals, including 95 with self-reported AMD. Results. The cumulative genetic risk score analysis generated a mean genetic risk score of 1.12 (95% confidence interval [CI]: 1.10, 1.13) in the Amish controls and 1.18 (95% CI: 1.13, 1.22) in the Amish cases. This mean difference in genetic risk scores is statistically significant (P = 0.0042). Exome sequencing identified a rare variant (P503A) in CFH. Association analysis in the remainder of the Amish sample revealed that the P503A variant is significantly associated with AMD (P = 9.27 × 10−13). Variant P503A was absent when evaluated in a cohort of 791 elderly non-Amish controls, and 1456 non-Amish cases. Conclusions. Data from the cumulative genetic risk score analysis suggests that the variants reported by the AMDGene consortium account for a smaller genetic burden of disease in the Amish compared with the non-Amish Caucasian population. Using exome sequencing data, we identified a novel missense mutation that is shared among a densely affected nuclear Amish family and located in a gene that has been previously implicated in AMD risk. PMID:24906858

  13. A new allele of γ-kafirin gene coding for a protein with high lysine content in Mexican white sorghum germplasm.

    PubMed

    Chiquito-Almanza, Elizabeth; Ochoa-Zarzosa, Alejandra; López-Meza, Joel E; Pecina-Quintero, Víctor; Nuñez-Colín, Carlos A; Anaya-López, José L

    2016-08-01

    Low protein digestibility and lysine content of white sorghum grain limit its use as a foodstuff. The increase in γ-kafirin cross-linking, has an important role in the reduction of protein digestibility. The objective of this study was to characterize the γ-kafirin gene in 12 Mexican tannin-free white sorghum genotypes and its relationship with protein digestibility and lysine content. Two alleles of γ-kafirin gene were identified: alleles 1 and 7. The predicted amino acid sequence of allele 7 showed seven point mutations; six were silent, and one missense (C235G), causing the substitution P79A in the deduced amino acid sequence. In silico analysis showed that γ-kafirin codified by allele 1 has five α-helixes without disulfide bonds, while γ-kafirin coding by allele 7 has four α-helixes and three disulfide bonds. Genotypes with allele 7 had higher lysine content than those with allele 1, showing no differences in the kafirin electrophoretic profile, neither a correlation with the protein content nor the in vitro pepsin digestibility. Mexican tannin-free white sorghum genotypes showed two γ-kafirin alleles, 1 and 7. Allele 7 was associated with higher lysine content; in silico analysis showed that the substitution of P79A in this allele could modify γ-kafirin secondary structure. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  14. Trafficking defects and loss of ligand binding are the underlying causes of all reported DDR2 missense mutations found in SMED-SL patients.

    PubMed

    Ali, Bassam R; Xu, Huifang; Akawi, Nadia A; John, Anne; Karuvantevida, Noushad S; Langer, Ruth; Al-Gazali, Lihadh; Leitinger, Birgit

    2010-06-01

    Spondylo-meta-epiphyseal dysplasia (SMED) with short limbs and abnormal calcifications (SMED-SL) is a rare, autosomal recessive human growth disorder, characterized by disproportionate short stature, short limbs, short broad fingers, abnormal metaphyses and epiphyses, platyspondyly and premature calcifications. Recently, three missense mutations and one splice-site mutation in the DDR2 gene were identified as causative genetic defects for SMED-SL, but the underlying cellular and biochemical mechanisms were not explored. Here we report a novel DDR2 missense mutation, c.337G>A (p.E113K), that causes SMED-SL in two siblings in the United Arab Emirates. Another DDR2 missense mutation, c.2254C>T (p.R752C), matching one of the previously reported SMED-SL mutations, was found in a second affected family. DDR2 is a plasma membrane receptor tyrosine kinase that functions as a collagen receptor. We expressed DDR2 constructs with the identified point mutations in human cell lines and evaluated their localization and functional properties. We found that all SMED-SL missense mutants were defective in collagen-induced receptor activation and that the three previously reported mutants (p.T713I, p.I726R and p.R752C) were retained in the endoplasmic reticulum. The novel mutant (p.E113K), in contrast, trafficked normally, like wild-type DDR2, but failed to bind collagen. This finding is in agreement with our recent structural data identifying Glu113 as an important amino acid in the DDR2 ligand-binding site. Our data thus demonstrate that SMED-SL can result from at least two different loss-of-function mechanisms: namely defects in DDR2 targeting to the plasma membrane or the loss of its ligand-binding activity.

  15. VHL missense mutations in the p53 binding domain show different effects on p53 signaling and HIFα degradation in clear cell renal cell carcinoma

    PubMed Central

    Razafinjatovo, Caroline Fanja; Stiehl, Daniel; Deininger, Eva; Rechsteiner, Markus; Moch, Holger; Schraml, Peter

    2017-01-01

    Clear cell Renal Cell Carcinoma (ccRCC) formation is connected to functional loss of the von Hippel-Lindau (VHL) gene. Recent data identified its gene product, pVHL, as a multifunctional adaptor protein which interacts with HIFα subunits but also with the tumor suppressor p53. p53 is hardly expressed and rarely mutated in most ccRCC. We showed that low and absent p53 expression correlated with the severity of VHL mutations in 262 analyzed ccRCC tissues. In contrast to nonsense and frameshift mutations which abrogate virtually all pVHL functions, missense mutations may rather influence one or few functions. Therefore, we focused on four VHL missense mutations, which affect the overlapping pVHL binding sites of p53 and Elongin C, by investigating their impact on HIFα degradation, p53 expression and signaling, as well as on cellular behavior using ccRCC cell lines and tissues. TP53 mRNA and its effector targets p21, Bax and Noxa, were altered both in engineered cell lines and in tumor tissues which carried the same missense mutations. Two of these mutations were not able to degrade HIFα whereas the remaining two mutations led to HIFα downregulation, suggesting the latter are p53 binding site-specific. The selected VHL missense mutations further enhanced tumor cell survival, but had no effects on cell proliferation. Whereas Sunitinib was able to efficiently reduce cell proliferation, Camptothecin was additionally able to increase apoptotic activity of the tumor cells. It is concluded that systematic characterization of the VHL mutation status may help optimizing targeted therapy for patients with metastatic ccRCC. PMID:28052007

  16. VHL missense mutations in the p53 binding domain show different effects on p53 signaling and HIFα degradation in clear cell renal cell carcinoma.

    PubMed

    Razafinjatovo, Caroline Fanja; Stiehl, Daniel; Deininger, Eva; Rechsteiner, Markus; Moch, Holger; Schraml, Peter

    2017-02-07

    Clear cell Renal Cell Carcinoma (ccRCC) formation is connected to functional loss of the von Hippel-Lindau (VHL) gene. Recent data identified its gene product, pVHL, as a multifunctional adaptor protein which interacts with HIFα subunits but also with the tumor suppressor p53. p53 is hardly expressed and rarely mutated in most ccRCC. We showed that low and absent p53 expression correlated with the severity of VHL mutations in 262 analyzed ccRCC tissues. In contrast to nonsense and frameshift mutations which abrogate virtually all pVHL functions, missense mutations may rather influence one or few functions. Therefore, we focused on four VHL missense mutations, which affect the overlapping pVHL binding sites of p53 and Elongin C, by investigating their impact on HIFα degradation, p53 expression and signaling, as well as on cellular behavior using ccRCC cell lines and tissues. TP53 mRNA and its effector targets p21, Bax and Noxa, were altered both in engineered cell lines and in tumor tissues which carried the same missense mutations. Two of these mutations were not able to degrade HIFα whereas the remaining two mutations led to HIFα downregulation, suggesting the latter are p53 binding site-specific. The selected VHL missense mutations further enhanced tumor cell survival, but had no effects on cell proliferation. Whereas Sunitinib was able to efficiently reduce cell proliferation, Camptothecin was additionally able to increase apoptotic activity of the tumor cells. It is concluded that systematic characterization of the VHL mutation status may help optimizing targeted therapy for patients with metastatic ccRCC.

  17. Trafficking defects and loss of ligand binding are the underlying causes of all reported DDR2 missense mutations found in SMED-SL patients

    PubMed Central

    Ali, Bassam R.; Xu, Huifang; Akawi, Nadia A.; John, Anne; Karuvantevida, Noushad S.; Langer, Ruth; Al-Gazali, Lihadh; Leitinger, Birgit

    2010-01-01

    Spondylo-meta-epiphyseal dysplasia (SMED) with short limbs and abnormal calcifications (SMED-SL) is a rare, autosomal recessive human growth disorder, characterized by disproportionate short stature, short limbs, short broad fingers, abnormal metaphyses and epiphyses, platyspondyly and premature calcifications. Recently, three missense mutations and one splice-site mutation in the DDR2 gene were identified as causative genetic defects for SMED-SL, but the underlying cellular and biochemical mechanisms were not explored. Here we report a novel DDR2 missense mutation, c.337G>A (p.E113K), that causes SMED-SL in two siblings in the United Arab Emirates. Another DDR2 missense mutation, c.2254C>T (p.R752C), matching one of the previously reported SMED-SL mutations, was found in a second affected family. DDR2 is a plasma membrane receptor tyrosine kinase that functions as a collagen receptor. We expressed DDR2 constructs with the identified point mutations in human cell lines and evaluated their localization and functional properties. We found that all SMED-SL missense mutants were defective in collagen-induced receptor activation and that the three previously reported mutants (p.T713I, p.I726R and p.R752C) were retained in the endoplasmic reticulum. The novel mutant (p.E113K), in contrast, trafficked normally, like wild-type DDR2, but failed to bind collagen. This finding is in agreement with our recent structural data identifying Glu113 as an important amino acid in the DDR2 ligand-binding site. Our data thus demonstrate that SMED-SL can result from at least two different loss-of-function mechanisms: namely defects in DDR2 targeting to the plasma membrane or the loss of its ligand-binding activity. PMID:20223752

  18. Cervical artery dissections and type A aortic dissection in a family with a novel missense COL3A1 mutation of vascular type Ehlers-Danlos syndrome.

    PubMed

    Makrygiannis, Georgios; Loeys, Bart; Defraigne, Jean-Olivier; Sakalihasan, Natzi

    2015-11-01

    Cervical artery dissection (CeAD) is a rare condition. One of the causes is the vascular type of Ehlers-Danlos syndrome (vEDS). A novel missense mutation in COL3A1 was found in a young patient with CeAD as the single manifestation of vEDS. This is a heterozygous c.953G > A mutation in exon 14, disrupting the normal Gly-X-Y repeats of type III procollagen, by converting glycine to aspartic acid.

  19. Rare earths

    SciTech Connect

    Vijayan, S.; Melnyk, A.J.; Singh, R.D.; Nuttall, K.

    1989-01-01

    For conventional applications, there is limited demand for rare earth elements as well as yttrium and scandium. But the emergence of new high technology applications such as supermagnets, lasers, and superconductors should result in significant demand for some of these elements. This article examines the anticipated applications and demands for rare earth elements over the next decade. It also looks at the implications on the use of available resources. In the context of a growing demand, process methods are reviewed for the recovery of rare earth elements from conventional and unconventional resources. And the article also discusses the challenges facing the mining industry in meeting this opportunity.

  20. Oncogenic mechanisms of HOXB13 missense mutations in prostate carcinogenesis

    PubMed Central

    Cardoso, Marta; Maia, Sofia; Paulo, Paula; Teixeira, Manuel R.

    2016-01-01

    The recurrent germline mutation HOXB13 p.(Gly84Glu) (G84E) has recently been identified as a risk factor for prostate cancer. In a recent study, we have performed full sequencing of the HOXB13 gene in 462 Portuguese prostate cancer patients with early-onset and/or familial/hereditary disease, and identified two novel missense mutations, p.(Ala128Asp) (A128D) and p.(Phe240Leu) (F240L), that were predicted to be damaging to protein function. In the present work we aimed to investigate the potential oncogenic role of these mutations, comparing to that of the recurrent G84E mutation and wild-type HOXB13. We induced site-directed mutagenesis in a HOXB13 expression vector and established in vitro cell models of prostate carcinogenesis with stable overexpression of either the wild-type or the mutated HOXB13 variants. By performing in vitro assays we observed that, while the wild-type promotes proliferation, also observed with the F240L variant along with a decrease in apoptosis, the A128D mutation decreases apoptosis and promotes anchorage independent growth. No phenotypic impact was observed for the G84E mutation in the cell line model used. Our data show that specific HOXB13 mutations are involved in the acquisition of different cancer-associated capabilities and further support an oncogenic role for HOXB13 in prostate carcinogenesis. PMID:28050579

  1. Disease mutations in RUNX1 and RUNX2 create nonfunctional, dominant-negative, or hypomorphic alleles

    PubMed Central

    Matheny, Christina J; Speck, Maren E; Cushing, Patrick R; Zhou, Yunpeng; Corpora, Takeshi; Regan, Michael; Newman, Miki; Roudaia, Liya; Speck, Caroline L; Gu, Ting-Lei; Griffey, Stephen M; Bushweller, John H; Speck, Nancy A

    2007-01-01

    Monoallelic RUNX1 mutations cause familial platelet disorder with predisposition for acute myelogenous leukemia (FPD/AML). Sporadic mono- and biallelic mutations are found at high frequencies in AML M0, in radiation-associated and therapy-related myelodysplastic syndrome and AML, and in isolated cases of AML M2, M5a, M3 relapse, and chronic myelogenous leukemia in blast phase. Mutations in RUNX2 cause the inherited skeletal disorder cleidocranial dysplasia (CCD). Most hematopoietic missense mutations in Runx1 involve DNA-contacting residues in the Runt domain, whereas the majority of CCD mutations in Runx2 are predicted to impair CBFβ binding or the Runt domain structure. We introduced different classes of missense mutations into Runx1 and characterized their effects on DNA and CBFβ binding by the Runt domain, and on Runx1 function in vivo. Mutations involving DNA-contacting residues severely inactivate Runx1 function, whereas mutations that affect CBFβ binding but not DNA binding result in hypomorphic alleles. We conclude that hypomorphic RUNX2 alleles can cause CCD, whereas hematopoietic disease requires more severely inactivating RUNX1 mutations. PMID:17290219

  2. Identification of 2127 new HLA class I alleles in potential stem cell donors from Germany, the United States and Poland.

    PubMed

    Hernández-Frederick, C J; Giani, A S; Cereb, N; Sauter, J; Silva-González, R; Pingel, J; Schmidt, A H; Ehninger, G; Yang, S Y

    2014-03-01

    We describe 2127 new human leukocyte antigen (HLA) class I alleles found in registered stem cell donors. These alleles represent 28.9% of the currently known class I alleles. Comparing new allele sequences to homologous sequences, we found 68.1% nonsynonymous nucleotide substitutions, 28.9% silent mutations and 3.0% nonsense mutations. Many substitutions occurred at positions that have not been known to be polymorphic before. A large number of HLA alleles and nucleotide variations underline the extreme diversity of the HLA system. Strikingly, 156 new alleles were found not only multiple times, but also in carriers of various parentage, suggesting that some new alleles are not necessarily rare. Moreover, new alleles were found especially often in minority donors. This emphasizes the benefits of specifically recruiting such groups of individuals.

  3. Experimental evolution of a novel sexually antagonistic allele.

    PubMed

    Dean, Rebecca; Perry, Jennifer C; Pizzari, Tommaso; Mank, Judith E; Wigby, Stuart

    2012-01-01

    Evolutionary conflict permeates biological systems. In sexually reproducing organisms, sex-specific optima mean that the same allele can have sexually antagonistic expression, i.e. beneficial in one sex and detrimental in the other, a phenomenon known as intralocus sexual conflict. Intralocus sexual conflict is emerging as a potentially fundamental factor for the genetic architecture of fitness, with important consequences for evolutionary processes. However, no study to date has directly experimentally tested the evolutionary fate of a sexually antagonistic allele. Using genetic constructs to manipulate female fecundity and male mating success, we engineered a novel sexually antagonistic allele (SAA) in Drosophila melanogaster. The SAA is nearly twice as costly to females as it is beneficial to males, but the harmful effects to females are recessive and X-linked, and thus are rarely expressed when SAA occurs at low frequency. We experimentally show how the evolutionary dynamics of the novel SAA are qualitatively consistent with the predictions of population genetic models: SAA frequency decreases when common, but increases when rare, converging toward an equilibrium frequency of ∼8%. Furthermore, we show that persistence of the SAA requires the mating advantage it provides to males: the SAA frequency declines towards extinction when the male advantage is experimentally abolished. Our results empirically demonstrate the dynamics underlying the evolutionary fate of a sexually antagonistic allele, validating a central assumption of intralocus sexual conflict theory: that variation in fitness-related traits within populations can be maintained via sex-linked sexually antagonistic loci.

  4. FBXW7 missense mutation: a novel negative prognostic factor in metastatic colorectal adenocarcinoma

    PubMed Central

    Korphaisarn, Krittiya; Morris, Van Karlyle; Overman, Michael J.; Fogelman, David R.; Kee, Bryan K.; Kanwal Pratap Singh, Raghav; Manuel, Shanequa; Shureiqi, Imad; Wolff, Robert A.; Eng, Cathy; Menter, David; Hamilton, Stanley R.; Kopetz, Scott; Dasari, Arvind

    2017-01-01

    Background FBXW7 functions as a ubiquitin ligase tagging multiple dominant oncogenic proteins and commonly mutates in colorectal cancer. Data suggest missense mutations lead to greater loss of FBXW7 function than other gene aberrations do. However, the clinicopathologic factors and outcomes associated with FBXW7 missense mutations in metastatic colorectal cancer (mCRC) have not been described. Methods Data were obtained from mCRC patients whose tumors were evaluated by next-generation sequencing for hotspot mutations at The University of Texas MD Anderson Cancer Center. Alterations in FBXW7 were identified, and their associations with clinicopathologic features and overall survival (OS) were evaluated. Results Of 855 mCRC patients, 571 had data on FBXW7 status; 43 (7.5%) had FBXW7 mutations, including 37 with missense mutations. R465C mutations in exon 9 were the most common missense mutations (18.6%). PIK3CA mutations were associated with FBXW7 missense mutations (p=0.012). On univariate analysis, patients with FBXW7 missense mutations had significantly worse OS (median 28.7 mo) than those with wild-type FBXW7 (median 46.6 mo; p=0.003). On multivariate analysis including other known prognostic factors such as BRAF mutations, FBXW7 missense mutations were the strongest negative prognostic factor for OS (hazard ratio 2.0; p=0.003). Conclusions In the largest clinical dataset of mCRC to date, FBXW7 missense mutations showed a strong negative prognostic association. PMID:28424412

  5. FAS Haploinsufficiency Caused by Extracellular Missense Mutations Underlying Autoimmune Lymphoproliferative Syndrome.

    PubMed

    de Bielke, María Gabriela Simesen; Perez, Laura; Yancoski, Judith; Oliveira, João Bosco; Danielian, Silvia

    2015-11-01

    Mutations in the FAS gene are the most common cause of Autoimmune Lymphoproliferative Syndrome (ALPS), and the majority of them affect the intracellular domain of FAS protein, particularly the region termed death domain. However, approximately one third of these mutations affect the extracellular region of FAS and most are stop codons, with very few missense changes having been described to date. We previously described 7 patients with a FAS missense extracellular mutation, C107Y, two in homozygozity and 5 in heterozygosity. We investigated here the mechanistic effects of this mutation and observed that the homozygous patients did not show any FAS surface expression, while the heterozygous patients had diminished receptor expression. Aiming to understand why a missense mutation was abolishing receptor expression, we analyzed intracellular FAS protein trafficking using fluorescent fusion proteins of wild type FAS, two missense extracellular mutants (FAS-C107Y and FAS-C104Y) and one missense change localized in the intracellular region, FAS-D260E. The FAS-C107Y and FAS-C104Y mutants failed to reach the cell surface, being retained at the endoplasmic reticulum, unlike the WT or the FAS-D260E which were clearly expressed at the plasma membrane. These results support haploinsufficiency as the underlying mechanism involved in the pathogenesis of ALPS caused by extracellular FAS missense mutations.

  6. Rare coding mutations identified by sequencing of Alzheimer disease genome‐wide association studies loci

    PubMed Central

    Vardarajan, Badri N.; Ghani, Mahdi; Kahn, Amanda; Sheikh, Stephanie; Sato, Christine; Barral, Sandra; Lee, Joseph H.; Cheng, Rong; Reitz, Christiane; Lantigua, Rafael; Reyes‐Dumeyer, Dolly; Medrano, Martin; Jimenez‐Velazquez, Ivonne Z.; Rogaeva, Ekaterina; St George‐Hyslop, Peter

    2015-01-01

    Objective To detect rare coding variants underlying loci detected by genome‐wide association studies (GWAS) of late onset Alzheimer disease (LOAD). Methods We conducted targeted sequencing of ABCA7, BIN1, CD2AP, CLU, CR1, EPHA1, MS4A4A/MS4A6A, and PICALM in 3 independent LOAD cohorts: 176 patients from 124 Caribbean Hispanics families, 120 patients and 33 unaffected individuals from the 129 National Institute on Aging LOAD Family Study; and 263 unrelated Canadian individuals of European ancestry (210 sporadic patients and 53 controls). Rare coding variants found in at least 2 data sets were genotyped in independent groups of ancestry‐matched controls. Additionally, the Exome Aggregation Consortium was used as a reference data set for population‐based allele frequencies. Results Overall we detected a statistically significant 3.1‐fold enrichment of the nonsynonymous mutations in the Caucasian LOAD cases compared with controls (p = 0.002) and no difference in synonymous variants. A stop‐gain mutation in ABCA7 (E1679X) and missense mutation in CD2AP (K633R) were highly significant in Caucasian LOAD cases, and mutations in EPHA1 (P460L) and BIN1 (K358R) were significant in Caribbean Hispanic families with LOAD. The EPHA1 variant segregated completely in an extended Caribbean Hispanic family and was also nominally significant in the Caucasians. Additionally, BIN1 (K358R) segregated in 2 of the 6 Caribbean Hispanic families where the mutations were discovered. Interpretation Targeted sequencing of confirmed GWAS loci revealed an excess burden of deleterious coding mutations in LOAD, with the greatest burden observed in ABCA7 and BIN1. Identifying coding variants in LOAD will facilitate the creation of tractable models for investigation of disease‐related mechanisms and potential therapies. Ann Neurol 2015;78:487–498 PMID:26101835

  7. Molecular basis of recessive congenital methemoglobinemia, types I and II: Exon skipping and three novel missense mutations in the NADH-cytochrome b5 reductase (diaphorase 1) gene.

    PubMed

    Kugler, W; Pekrun, A; Laspe, P; Erdlenbruch, B; Lakomek, M

    2001-04-01

    Hereditary methemoglobinemia due to reduced nicotin amide adenine dinucleotide (NADH)-cytochrome b5 reductase (b5r) deficiency is classified into an erythrocyte type (I) and a generalized type (II). We investigated the b5r gene of three unrelated patients with types I and II and found four novel mutations. The patient with type I was homozygous for a c.535 G-->A exchange in exon 6 (A179T). The patients with type II were found to be homozygous for a c.757 G-->A transition in exon 9 (V253M) and compound heterozygous for two mutations, respectively. One allele presented a c.379 A-->G transition (M127V). The second allele carried a sequence difference at the invariant 3' splice-acceptor dinucleotide of intron 4 (IVS4-2A-->G) resulting in skipping of exon 5. To characterize a possible effect of this mutation on RNA metabolism, poly(A)(+) RNA was analyzed by RT-PCR and sequencing. The results show that RNA is made from the allele harboring the 3'-splice site mutation. Furthermore, western blot analysis revealed a complete absence of immunologically detectable b5r in skin fibroblasts of this patient. The compound heterozygosity for the splice site and the missense mutations apparently caused hereditary methemoglobinemia type II in this patient. Hum Mutat 17:348, 2001. Copyright 2001 Wiley-Liss, Inc.

  8. An atypical 0.73 MB microduplication of 22q11.21 and a novel SALL4 missense mutation associated with thumb agenesis and radioulnar synostosis.

    PubMed

    Diehl, Adam; Mu, Weiyi; Batista, Denise; Gunay-Aygun, Meral

    2015-07-01

    We describe a 0.73 Mb duplication of chromosome 22q11.21 between LCR-B and LCR-D and a missense mutation in a conserved C2H2 zinc finger domain of SALL4 in a cognitively normal patient with multiple skeletal anomalies including radioulnar synostosis, thumb aplasia, butterfly vertebrae, rib abnormalities, and hypoplasia of the humeral and femoral epiphyses. 22q11.21 is a common site for microdeletions and their reciprocal microduplications as a result of non-allelic homologous recombination between its multiple low copy repeat regions (LCR). DiGeorge /Velocardiofacial syndrome (DG/VCFS) is classically caused by a 3 Mb deletion between LCR-A and LCR-D or a 1.5 Mb deletion between LCR-A and LCR-B. The reciprocal syndrome to DG/VCFS is the recently described 22q11.2 microduplication, which usually presents with the typical 3 Mb or 1.5 Mb duplication. Numerous atypical deletions and duplications have been reported between other LCRs. Typically, SALL4-related Duane-radial ray syndrome is caused by deletions or nonsense mutations; the only missense SALL4 mutation described prior was thought to result in gain of function and produced cranial midline defects. The skeletal anomalies presented in this report have not been previously described in association with 22q11.2 microduplication nor SALL4 mutations.

  9. Syndromic parkinsonism and dementia associated with OPA 1 missense mutations

    PubMed Central

    Musumeci, Olimpia; Caporali, Leonardo; Zanna, Claudia; La Morgia, Chiara; Del Dotto, Valentina; Porcelli, Anna Maria; Rugolo, Michela; Valentino, Maria Lucia; Iommarini, Luisa; Maresca, Alessandra; Barboni, Piero; Carbonelli, Michele; Trombetta, Costantino; Valente, Enza Maria; Patergnani, Simone; Giorgi, Carlotta; Pinton, Paolo; Rizzo, Giovanni; Tonon, Caterina; Lodi, Raffaele; Avoni, Patrizia; Liguori, Rocco; Baruzzi, Agostino; Toscano, Antonio; Zeviani, Massimo

    2015-01-01

    Objective Mounting evidence links neurodegenerative disorders such as Parkinson disease and Alzheimer disease with mitochondrial dysfunction, and recent emphasis has focused on mitochondrial dynamics and quality control. Mitochondrial dynamics and mtDNA maintenance is another link recently emerged, implicating mutations in the mitochondrial fusion genes OPA1 and MFN2 in the pathogenesis of multisystem syndromes characterized by neurodegeneration and accumulation of mtDNA multiple deletions in postmitotic tissues. Here, we report 2 Italian families affected by dominant chronic progressive external ophthalmoplegia (CPEO) complicated by parkinsonism and dementia. Methods Patients were extensively studied by optical coherence tomography (OCT) to assess retinal nerve fibers, and underwent muscle and brain magnetic resonance spectroscopy (MRS), and muscle biopsy and fibroblasts were analyzed. Candidate genes were sequenced, and mtDNA was analyzed for rearrangements. Results Affected individuals displayed a slowly progressive syndrome characterized by CPEO, mitochondrial myopathy, sensorineural deafness, peripheral neuropathy, parkinsonism, and/or cognitive impairment, in most cases without visual complains, but with subclinical loss of retinal nerve fibers at OCT. Muscle biopsies showed cytochrome c oxidase‐negative fibers and mtDNA multiple deletions, and MRS displayed defective oxidative metabolism in muscle and brain. We found 2 heterozygous OPA1 missense mutations affecting highly conserved amino acid positions (p.G488R, p.A495V) in the guanosine triphosphatase domain, each segregating with affected individuals. Fibroblast studies showed a reduced amount of OPA1 protein with normal mRNA expression, fragmented mitochondria, impaired bioenergetics, increased autophagy and mitophagy. Interpretation The association of CPEO and parkinsonism/dementia with subclinical optic neuropathy widens the phenotypic spectrum of OPA1 mutations, highlighting the association of

  10. In silico comparative characterization of pharmacogenomic missense variants

    PubMed Central

    2014-01-01

    Background Missense pharmacogenomic (PGx) variants refer to amino acid substitutions that potentially affect the pharmacokinetic (PK) or pharmacodynamic (PD) response to drug therapies. The PGx variants, as compared to disease-associated variants, have not been investigated as deeply. The ability to computationally predict future PGx variants is desirable; however, it is not clear what data sets should be used or what features are beneficial to this end. Hence we carried out a comparative characterization of PGx variants with annotated neutral and disease variants from UniProt, to test the predictive power of sequence conservation and structural information in discriminating these three groups. Results 126 PGx variants of high quality from PharmGKB were selected and two data sets were created: one set contained 416 variants with structural and sequence information, and, the other set contained 1,265 variants with sequence information only. In terms of sequence conservation, PGx variants are more conserved than neutral variants and much less conserved than disease variants. A weighted random forest was used to strike a more balanced classification for PGx variants. Generally structural features are helpful in discriminating PGx variant from the other two groups, but still classification of PGx from neutral polymorphisms is much less effective than between disease and neutral variants. Conclusions We found that PGx variants are much more similar to neutral variants than to disease variants in the feature space consisting of residue conservation, neighboring residue conservation, number of neighbors, and protein solvent accessibility. Such similarity poses great difficulty in the classification of PGx variants and polymorphisms. PMID:25057096

  11. Analysis of a set of missense, frameshift, and in-frame deletion variants of BRCA1

    PubMed Central

    Carvalho, Marcelo; Pino, Maria A.; Karchin, Rachel; Beddor, Jennifer; Godinho-Netto, Martha; Mesquita, Rafael D.; Rodarte, Renato S.; Vaz, Danielle C.; Monteiro, Viviane A.; Manoukian, Siranoush; Colombo, Mara; Ripamonti, Carla B.; Rosenquist, Richard; Suthers, Graeme; Borg, Ake; Radice, Paolo; Grist, Scott A.; Monteiro, Alvaro N.A.; Billack, Blase

    2009-01-01

    Germline mutations that inactivate BRCA1 are responsible for breast and ovarian cancer susceptibility. One possible outcome of genetic testing for BRCA1 is the finding of a genetic variant of uncertain significance for which there is no information regarding its cancer association. This outcome leads to problems in risk assessment, counseling and preventive care. The purpose of the present study was to functionally evaluate seven unclassified variants of BRCA1 including a genomic deletion that leads to the in-frame loss of exons 16/17 (Δ exons 16/17) in the mRNA, an insertion that leads to a frameshift and an extended carboxy-terminus (5673insC), and five missense variants (K1487R, S1613C, M1652I, Q1826H and V1833M). We analyzed the variants using a functional assay based on the transcription activation property of BRCA1 combined with supervised learning computational models. Functional analysis indicated that variants S1613C, Q1826H, and M1652I are likely to be neutral, whereas variants V1833M, Δ exons 16/17, and 5673insC are likely to represent deleterious variants. In agreement with the functional analysis, the results of the computational analysis also indicated that the latter three variants are likely to be deleterious. Taken together, a combined approach of functional and bioinformatics analysis, plus structural modeling, can be utilized to obtain valuable information pertaining to the effect of a rare variant on the structure and function of BRCA1. Such information can, in turn, aid in the classification of BRCA1 variants for which there is a lack of genetic information needed to provide reliable risk assessment. PMID:18992264

  12. Three Novel Missense Mutations within the LHX4 Gene Are Associated with Variable Pituitary Hormone Deficiencies

    PubMed Central

    Pfaeffle, Roland W.; Hunter, Chad S.; Savage, Jesse J.; Duran-Prado, Mario; Mullen, Rachel D.; Neeb, Zachary P.; Eiholzer, Urs; Hesse, Volker; Haddad, Nadine G.; Stobbe, Heike M.; Blum, Werner F.; Weigel, Johannes F. W.; Rhodes, Simon J.

    2008-01-01

    Context: The LHX4 LIM-homeodomain transcription factor has essential roles in pituitary gland and nervous system development. Heterozygous mutations in LHX4 are associated with combined pituitary hormone deficiency. Objectives: Our objectives were to determine the nature and frequency of LHX4 mutations in patients with pituitary hormone deficiency and to examine the functional outcomes of observed mutations. Design: The LHX4 gene sequence was determined from patient DNA. The biochemical and gene regulatory properties of aberrant LHX4 proteins were characterized using structural predictions, pituitary gene transcription assays, and DNA binding experiments. Patients: A total of 253 patients from 245 pedigrees with GH deficiency and deficiency of at least one additional pituitary hormone was included in the study. Results: In five patients, three types of heterozygous missense mutations in LHX4 that result in substitution of conserved amino acids were identified. One substitution is between the LIM domains (R84C); the others are in the homeodomain (L190R; A210P). The patients have GH deficiency; some also display reductions in TSH, LH, FSH, or ACTH, and aberrant pituitary morphology. Structural models predict that the aberrant L190R and A210P LHX4 proteins would have impaired DNA binding and gene activation properties. Consistent with these models, EMSAs and transfection experiments using pituitary gene promoters demonstrate that whereas the R84C form has reduced activity, the L190R and A210P proteins are inactive. Conclusions: LHX4 mutations are a relatively rare cause of combined pituitary hormone deficiency. This report extends the range of phenotypes associated with LHX4 gene mutations and describes three novel exonic mutations in the gene. PMID:18073311

  13. Angiotensinogen (AGT) gene missense polymorphisms (rs699 and rs4762) and diabetic nephropathy in Caucasians with type 2 diabetes mellitus.

    PubMed

    Makuc, Jana; Šeruga, Maja; Završnik, Matej; Cilenšek, Ines; Petrovič, Daniel

    2017-08-20

    Gene polymorphisms associated with the renin-angiotensin-aldosterone system (RAAS) have been extensively studied in diabetic nephropathy (DN) patients, due to therapeutic potential of targeting the RAAS and slowing down the disease progression. The aim of our study was to examine the association between angiotensinogen (AGT) gene polymorphisms (rs699 and rs4762) and DN in Caucasians with type 2 diabetes mellitus (T2DM). A total of 651 unrelated Slovenian (Caucasian) T2DM patients were tested for AGT rs699 and rs4762 polymorphisms using a novel fluorescence-based kompetitive allele-specific polymerase chain reaction (KASPar) assay. A study group consisted of 276 T2DM patients with DN, while control group included 375 patients without DN but who have had T2DM for >10 years. For rs699 polymorphism, the frequencies of GG, GA and AA genotypes were 20.6%, 52.2% and 27.2%, respectively in T2DM patients and 23.4%, 48.1% and 28.5%, respectively in controls. The distributions of GG, GA and AA genotypes for rs4762 polymorphism were 73.9%, 23.2% and 2.9%, respectively in T2DM patients and 70.4%, 27.5% and 2.1%, respectively in controls. No significant differences in the allele frequencies were found between T2DM patients and controls for both polymorphisms. AGT rs699 and rs4762 missense polymorphisms are not associated with DN in our subset of Slovenian T2DM patients.

  14. A neonatal encephalopathy with seizures in standard poodle dogs with a missense mutation in the canine ortholog of ATF2.

    PubMed

    Chen, Xuhua; Johnson, Gary S; Schnabel, Robert D; Taylor, Jeremy F; Johnson, Gayle C; Parker, Heidi G; Patterson, Edward E; Katz, Martin L; Awano, Tomoyuki; Khan, Shahwanaz; O'Brien, Dennis P

    2008-02-01

    Neonatal encephalopathy with seizures (NEWS) is a previously undescribed autosomal recessive disease of standard poodle puppies. Affected puppies are small and weak at birth. Many die in their first week of life. Those surviving past 1 week develop ataxia, a whole-body tremor, and, by 4 to 6 weeks of age, severe generalized clonic-tonic seizures. None have survived to 7 weeks of age. Cerebella from affected puppies were reduced in size and often contained dysplastic foci consisting of clusters of intermixed granule and Purkinje neurons. We used deoxyribonucleic acid samples from related standard poodles to map the NEWS locus to a 2.87-Mb segment of CFA36, which contains the canine ortholog of ATF2. This gene encodes activating transcription factor 2 (ATF-2), which participates in the cellular responses to a wide variety of stimuli. We amplified and sequenced all coding regions of canine ATF2 from a NEWS-affected puppy and identified a T > G transversion that predicts a methionine-to-arginine missense mutation at amino acid position 51. Methionine-51 lies within a hydrophobic docking site for mitogen-activated protein kinases that activate ATF-2 so the arginine substitution is likely to interfere with ATF-2 activation. All 20 NEWS-affected puppies in the standard poodle family were homozygous for the mutant G allele. The 58 clinically normal family members were either G/T heterozygotes or homozygous for the ancestral T allele. There are no previous reports of spontaneous ATF2 mutations in people or animals; however, atf2-knockout mice have cerebellar lesions that are similar to those in puppies with NEWS.

  15. Dombrock genotyping in Brazilian blood donors reveals different regional frequencies of the HY allele

    PubMed Central

    Piassi, Fabiana Chagas Camargos; Santos, Silvana Maria Eloi; de Castilho, Lilian Maria; Baleotti Júnior, Wilson; Suzuki, Rodrigo Buzinaro; da Cunha, Débora Moura

    2013-01-01

    Background Dombrock blood group system genotyping has revealed various rearrangements of the Dombrock gene and identified new variant alleles in Brazil (i.e., DO*A-SH, DO*A-WL and DO*B-WL). Because of the high heterogeneity of the Brazilian population, interregional differences are expected during the investigation of Dombrock genotypes. Objective The present study aims to determine the frequencies of Dombrock genotypes in blood donors from Minas Gerais and compare the frequencies of the HY and JO alleles to those of another population in Brazil. Methods The frequencies of the DO alleles in Minas Gerais, a southeastern state of Brazil, were determined from the genotyping of 270 blood donors. Genotyping involved polymerase chain reaction and restriction fragment length polymorphism analysis to identify the 323G>T, 350C>T, 793A>G, and 898C>G mutations, which are related to the HY, JO, DO*A/DO*B, and DO*A-WL/DO*B-WL alleles, respectively. Moreover, the frequencies of rare HY and JO alleles were statistically compared using the chi-square test with data from another Brazilian region. Results The HY allele frequency in Minas Gerais (2.4%) was almost twice that of the JO allele (1.5%). The frequency of the HY allele was significantly higher (p-value = 0.001) than that in another Brazilian population and includes a rare homozygous donor with the Hy- phenotype. In addition, the DO*A-WL and DO*B-WL alleles, which were first identified in Brazil, were found in the state of Minas Gerais. Conclusions The data confirm that the frequencies of DO alleles differ between regions in Brazil. The population of Minas Gerais could be targeted in a screening strategy to identify the Hy- phenotype in order to develop a rare blood bank. PMID:24478605

  16. Missense Mutation of Brain Derived Neurotrophic Factor (BDNF) Alters Neurocognitive Performance in Patients with Mild Traumatic Brain Injury: A Longitudinal Study

    PubMed Central

    Ahmad-Annuar, Azlina; Ramli, Norlisah; Waran, Vicknes; Chinna, Karuthan; Bondi, Mark William; Delano-Wood, Lisa; Ganesan, Dharmendra

    2016-01-01

    The predictability of neurocognitive outcomes in patients with traumatic brain injury is not straightforward. The extent and nature of recovery in patients with mild traumatic brain injury (mTBI) are usually heterogeneous and not substantially explained by the commonly known demographic and injury-related prognostic factors despite having sustained similar injuries or injury severity. Hence, this study evaluated the effects and association of the Brain Derived Neurotrophic Factor (BDNF) missense mutations in relation to neurocognitive performance among patients with mTBI. 48 patients with mTBI were prospectively recruited and MRI scans of the brain were performed within an average 10.1 (SD 4.2) hours post trauma with assessment of their neuropsychological performance post full Glasgow Coma Scale (GCS) recovery. Neurocognitive assessments were repeated again at 6 months follow-up. The paired t-test, Cohen’s d effect size and repeated measure ANOVA were performed to delineate statistically significant differences between the groups [wildtype G allele (Val homozygotes) vs. minor A allele (Met carriers)] and their neuropsychological performance across the time point (T1 = baseline/ admission vs. T2 = 6th month follow-up). Minor A allele carriers in this study generally performed more poorly on neuropsychological testing in comparison wildtype G allele group at both time points. Significant mean differences were observed among the wildtype group in the domains of memory (M = -11.44, SD = 10.0, p = .01, d = 1.22), executive function (M = -11.56, SD = 11.7, p = .02, d = 1.05) and overall performance (M = -6.89 SD = 5.3, p = .00, d = 1.39), while the minor A allele carriers showed significant mean differences in the domains of attention (M = -11.0, SD = 13.1, p = .00, d = .86) and overall cognitive performance (M = -5.25, SD = 8.1, p = .01, d = .66).The minor A allele carriers in comparison to the wildtype G allele group, showed considerably lower scores at admission and

  17. Analysis of Pseudoxanthoma Elasticum-Causing Missense Mutants of ABCC6 in vivo; Pharmacological Correction of the Mislocalized Proteins

    PubMed Central

    Pomozi, Viola; Brampton, Christopher; Fülöp, Krisztina; Chen, Li-Hsieh; Apana, Ailea; Li, Qiaoli; Uitto, Jouni; Le Saux, Olivier; Váradi, András

    2014-01-01

    Mutations in the ABCC6 gene cause soft tissue calcification in pseudoxanthoma elasticum (PXE) and in some patients generalized arterial calcification of infancy (GACI). PXE is characterized by late-onset and progressive mineralization of elastic fibers in dermal, ocular and cardiovascular tissues. GACI patients present a more severe, often prenatal arterial calcification. We have tested ten frequent disease-causing ABCC6 missense mutants for the transport activity using Sf9 cells, characterized the subcellular localization in MDCKII cells and in mouse liver, and tested the phenotypic rescue in zebrafish. We aimed at identifying mutants with preserved transport activity but with improper plasma membrane localization for rescue by the chemical chaperone 4-phenylbutyrate (4-PBA). Seven of the mutants were transport-competent but mislocalized in mouse liver. The observed divergence in cellular localization of mutants in MDCKII cells vs. mouse liver underlined the limitations of this two-dimensional in vitro cell system. The functionality of ABCC6 mutants was tested in zebrafish and minimal rescue of the morpholino-induced phenotype was found. However, 4-PBA, a drug approved for clinical use, restored the plasma membrane localization of four ABCC6 mutants (R1114P, S1121W, Q1347H, R1314W), suggesting that allele-specific therapy may be useful for selected patients with PXE and GACI. PMID:24352041

  18. A novel missense mutation in POMT1 modulates the severe congenital muscular dystrophy phenotype associated with POMT1 nonsense mutations.

    PubMed

    Wallace, Stephanie E; Conta, Jessie H; Winder, Thomas L; Willer, Tobias; Eskuri, Jamie M; Haas, Richard; Patterson, Kathleen; Campbell, Kevin P; Moore, Steven A; Gospe, Sidney M

    2014-04-01

    Mutations in POMT1 lead to a group of neuromuscular conditions ranging in severity from Walker-Warburg syndrome to limb girdle muscular dystrophy. We report two male siblings, ages 19 and 14, and an unrelated 6-year old female with early onset muscular dystrophy and intellectual disability with minimal structural brain anomalies and no ocular abnormalities. Compound heterozygous mutations in POMT1 were identified including a previously reported nonsense mutation (c.2167dupG; p.Asp723Glyfs*8) associated with Walker-Warburg syndrome and a novel missense mutation in a highly conserved region of the protein O-mannosyltransferase 1 protein (c.1958C>T; p.Pro653Leu). This novel variant reduces the phenotypic severity compared to patients with homozygous c.2167dupG mutations or compound heterozygous patients with a c.2167dupG mutation and a wide range of other mutant POMT1 alleles. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Esophageal cancer in a family with hamartomatous tumors and germline PTEN frameshift and SMAD7 missense mutations.

    PubMed

    Sherman, Scott K; Maxwell, Jessica E; Qian, Qining; Bellizzi, Andrew M; Braun, Terry A; Iannettoni, Mark D; Darbro, Benjamin W; Howe, James R

    2015-01-01

    Germline mutations in the PTEN tumor-suppressor gene cause autosomal-dominant conditions such as Cowden and Bannayan-Riley-Ruvalcaba syndromes with variable presentations, including hamartomatous gastrointestinal tumors, dermatologic abnormalities, neurologic symptoms, and elevated cancer risk. We describe a father and son with extensive hamartomatous gastrointestinal polyposis who both developed early-onset esophageal cancer. Exome sequencing identified a novel germline PTEN frameshift mutation (c.568_569insC, p.V191Sfs*11). In addition, a missense mutation of SMAD7 (c.115G>A, p.G39R) with an allele frequency of 0.3% in the Exome Variant Server was detected in both affected individuals. Fluorescence in situ hybridization for PTEN in the resected esophageal cancer specimen demonstrated no PTEN copy loss in malignant cells; however, results of an immunohistochemical analysis demonstrated a loss of PTEN protein expression. While the risks of many cancers are elevated in the PTEN hamartoma tumor syndromes, association between esophageal adenocarcinoma and these syndromes has not been previously reported. Esophageal adenocarcinoma and extensive polyposis/ganglioneuromatosis could represent less common features of these syndromes, potentially correlating with this novel PTEN frameshift and early protein termination genotype. Alternatively, because simultaneous disruption of both the PTEN and TGF-β/SMAD4 pathways is associated with development of esophageal cancer in a mouse model and because SMAD4 mutations cause gastrointestinal hamartomas in juvenile polyposis syndrome, the SMAD7 mutation may represent an additional modifier of these individuals' PTEN-mutant phenotype.

  20. A missense variant (P10L) of the melanopsin (Opn4) gene is associated with Seasonal Affective Disorder

    PubMed Central

    Roecklein, Kathryn A.; Rohan, Kelly J.; Duncan, Wallace C.; Rollag, Mark D.; Rosenthal, Norman E.; Lipsky, Robert H.; Provencio, Ignacio

    2009-01-01

    Background Melanopsin, a non-visual photopigment, may play a role in aberrant responses to low winter light levels in Seasonal Affective Disorder (SAD). We hypothesized that functional sequence variation in the melanopsin gene (Opn4) could contribute to increasing the light needed for normal functioning during winter in SAD. Methods Associations between alleles, genotypes, and haplotypes of Opn4 in SAD participants (n = 130) were performed relative to controls with no history of psychopathology (n = 90). Results SAD participants had a higher frequency of the homozygous minor genotype (T/T) for the missense variant rs2675703 (P10L) than controls, compared to the combined frequencies of C/C and C/T. Individuals with the T/T genotype were 5.6 times more likely to be in the SAD group than the control group. Limitations The study examined only one molecular component of the non-visual light input pathway, and recruitment methods for the comparison groups differed. Conclusion These findings support the hypothesis that melanopsin variants may predispose some individuals to SAD. Characterizing the genetic basis for deficits in the non-visual light input pathway has the potential to define mechanisms underlying the pathological response to light in SAD, which may improve treatment. PMID:18804284

  1. Esophageal cancer in a family with hamartomatous tumors and germline PTEN frameshift and SMAD7 missense mutations

    PubMed Central

    Sherman, Scott K.; Maxwell, Jessica E.; Qian, Qining; Bellizzi, Andrew M.; Braun, Terry A.; Iannettoni, Mark D.; Darbro, Benjamin W.; Howe, James R.

    2014-01-01

    Germline mutations in the PTEN tumor-suppressor gene cause autosomal-dominant conditions such as Cowden and Bannayan-Riley-Ruvalcaba syndromes with variable presentations, including hamartomatous gastrointestinal tumors, dermatologic abnormalities, neurologic symptoms, and elevated cancer risk. We describe a father and son with extensive hamartomatous gastrointestinal polyposis who both developed early-onset esophageal cancer. Exome sequencing identified a novel germline PTEN frameshift mutation (c.568_569insC, p.V191S_fs*11). In addition, a missense mutation of SMAD7 (c.115G>A, p.G39R) with an allele frequency of 0.3% in the Exome Variant Server was detected in both affected individuals. Fluorescence in-situ hybridization for PTEN in the resected esophageal cancer specimen demonstrated no PTEN copy loss in malignant cells, however, immunohistochemistry demonstrated loss of PTEN protein expression. While the risks of many cancers are elevated in the PTEN hamartoma tumor syndromes, esophageal adenocarcinoma has not been previously reported. Esophageal adenocarcinoma and extensive polyposis/ganglioneuromatosis could represent less-common features of these syndromes, potentially correlating with this novel PTEN frameshift and early protein termination genotype. Alternatively, because simultaneous disruption of both the PTEN and TGF-β/SMAD4 pathways is associated with development of esophageal cancer in a mouse model, and SMAD4 mutations cause gastrointestinal hamartomas in Juvenile Polyposis Syndrome, the SMAD7 mutation may represent an additional modifier of these individuals’ PTEN-mutant phenotype. PMID:25554686

  2. The rare TREM2 R47H variant exerts only a modest effect on Alzheimer disease risk

    PubMed Central

    Hooli, Basavaraj V.; Parrado, Antonio R.; Mullin, Kristina; Yip, Wai-Ki; Liu, Tian; Roehr, Johannes T.; Qiao, Dandi; Jessen, Frank; Peters, Oliver; Becker, Tim; Ramirez, Alfredo; Lange, Christoph; Bertram, Lars

    2014-01-01

    Objectives: Recently, 2 independent studies reported that a rare missense variant, rs75932628 (R47H), in exon 2 of the gene encoding the “triggering receptor expressed on myeloid cells 2” (TREM2) significantly increases the risk of Alzheimer disease (AD) with an effect size comparable to that of the APOE ε4 allele. Methods: In this study, we attempted to replicate the association between rs75932628 and AD risk by directly genotyping rs75932628 in 2 independent Caucasian family cohorts consisting of 927 families (with 1,777 affected and 1,235 unaffected) and in 2 Caucasian case-control cohorts composed of 1,314 cases and 1,609 controls. In addition, we imputed genotypes in 3 independent Caucasian case-control cohorts containing 1,906 cases and 1,503 controls. Results: Meta-analysis of the 2 family-based and the 5 case-control cohorts yielded a p value of 0.0029, while the overall summary estimate (using case-control data only) resulted in an odds ratio of 1.67 (95% confidence interval 0.95–2.92) for the association between the TREM2 R47H and increased AD risk. Conclusions: While our results serve to confirm the association between R47H and risk of AD, the observed effect on risk was substantially smaller than that previously reported. PMID:25186855

  3. Sequencing of SCN5A identifies rare and common variants associated with cardiac conduction

    PubMed Central

    Magnani, Jared W.; Brody, Jennifer A.; Prins, Bram P.; Arking, Dan E.; Lin, Honghuang; Yin, Xiaoyan; Liu, Ching-Ti; Morrison, Alanna C.; Zhang, Feng; Spector, Tim D.; Alonso, Alvaro; Bis, Joshua C.; Heckbert, Susan R.; Lumley, Thomas; Sitlani, Colleen M.; Cupples, L. Adrienne; Lubitz, Steven A.; Soliman, Elsayed Z.; Pulit, Sara L.; Newton-Cheh, Christopher; O'Donnell, Christopher J.; Ellinor, Patrick T.; Benjamin, Emelia J.; Muzny, Donna M.; Gibbs, Richard A.; Santibanez, Jireh; Taylor, Herman A.; Rotter, Jerome I.; Lange, Leslie A.; Psaty, Bruce M.; Jackson, Rebecca; Rich, Stephen S.; Boerwinkle, Eric; Jamshidi, Yalda; Sotoodehnia, Nona

    2014-01-01

    Background The cardiac sodium channel SCN5A regulates atrioventricular and ventricular conduction. Genetic variants in this gene are associated with PR and QRS intervals. We sought to further characterize the contribution of rare and common coding variation in SCN5A to cardiac conduction. Methods and Results In the Cohorts for Heart and Aging Research in Genomic Epidemiology Targeted Sequencing Study (CHARGE), we performed targeted exonic sequencing of SCN5A (n=3699, European-ancestry individuals) and identified 4 common (minor allele frequency >1%) and 157 rare variants. Common and rare SCN5A coding variants were examined for association with PR and QRS intervals through meta-analysis of European ancestry participants from CHARGE, NHLBI’s Exome Sequencing Project (ESP, n=607) and the UK10K (n=1275) and by examining ESP African-ancestry participants (N=972). Rare coding SCN5A variants in aggregate were associated with PR interval in European and African-ancestry participants (P=1.3×10−3). Three common variants were associated with PR and/or QRS interval duration among European-ancestry participants and one among African-ancestry participants. These included two well-known missense variants; rs1805124 (H558R) was associated with PR and QRS shortening in European-ancestry participants (P=6.25×10−4 and P=5.2×10−3 respectively) and rs7626962 (S1102Y) was associated with PR shortening in those of African ancestry (P=2.82×10−3). Among European-ancestry participants, two novel synonymous variants, rs1805126 and rs6599230, were associated with cardiac conduction. Our top signal, rs1805126 was associated with PR and QRS lengthening (P=3.35×10−7 and P=2.69×10−4 respectively), and rs6599230 was associated with PR shortening (P=2.67×10−5). Conclusions By sequencing SCN5A, we identified novel common and rare coding variants associated with cardiac conduction. PMID:24951663

  4. Rare earths

    USGS Publications Warehouse

    Gambogi, J.

    2013-01-01

    Global mine production of rare earths was estimated to have declined slightly in 2012 relative to 2011 (Fig. 1). Production in China was estimated to have decreased to 95 from 105 kt (104,700 from 115,700 st) in 2011, while new mine production in the United States and Australia increased.

  5. Two missense mutations of H type alpha(1,2)fucosyltransferase gene (FUT1) responsible for para-Bombay phenotype.

    PubMed

    Wang, B; Koda, Y; Soejima, M; Kimura, H

    1997-01-01

    Rare individuals (Bombay and para-Bombay phenotypes) fail to express the A, B and H antigens on erythrocyte membranes because of a lack in the H gene (FUT1)-encoded alpha(1,2)fucosyltransferase activity. In this study, we have found a para-Bombay individual (Bmh) who expressed B and H antigens in saliva but not on red blood cells. The FUT1 alleles of this person contained two single base changes (T460C and G1042A) in the coding region relative to the wild type allele. These substitutions may result in changes in two amino acid residues (Y154H and E348K). Since the T460C and G1042A mutations destroy endonuclease RsaI and AvaI sites, respectively, we tested for these mutations using PCR-RFLP. Our findings indicated that this para-Bombay person was homozygous for the T460C and G1042A mutations, and that neither of these mutations was found in 136 randomly selected Japanese individuals. The measurement of the alpha(1,2)fucosyltransferase activity after transient expression of the FUT1 alleles in COS-7 cells indicated that the H-deficient allele-encoded enzyme had no detectable activity. Moreover, transfection by chimera FUT1 allele contains only the T460C mutation, or only the G1042A mutation, and yielded 1.0 or 9.3%, respectively, of the activities compared to transfection by the wild type allele. These results suggest that the two mutations in combination are responsible for the inactivation of the FUT1-encoded enzyme activity.

  6. Exome arrays capture polygenic rare variant contributions to schizophrenia

    PubMed Central

    Richards, A. L.; Leonenko, G.; Walters, J. T.; Kavanagh, D. H.; Rees, E. G.; Evans, A.; Chambert, K. D.; Moran, J. L.; Goldstein, J.; Neale, B. M.; McCarroll, S. A.; Pocklington, A. J.; Holmans, P. A.; Owen, M. J.; O'Donovan, M. C.

    2016-01-01

    Schizophrenia is a highly heritable disorder. Genome-wide association studies based largely on common alleles have identified over 100 schizophrenia risk loci, but it is also evident from studies of copy number variants (CNVs) and from exome-sequencing studies that rare alleles are also involved. Full characterization of the contribution of rare alleles to the disorder awaits the deployment of sequencing technology in very large sample sizes, meanwhile, as an interim measure, exome arrays allow rare non-synonymous variants to be sampled at a fraction of the cost. In an analysis of exome array data from 13 688 individuals (5585 cases and 8103 controls) from the UK, we found that rare (minor allele frequency < 0.1%) variant association signal was enriched among genes that map to autosomal loci that are genome-wide significant (GWS) in common variant studies of schizophrenia genome-wide association study (PGWAS = 0.01) as well as gene sets known to be enriched for rare variants in sequencing studies (PRARE = 0.026). We also identified the gene-wise equivalent of GWS support for WDR88 (WD repeat-containing protein 88), a gene of unknown function (P = 6.5 × 10−7). Rare alleles represented on exome chip arrays contribute to the genetic architecture of schizophrenia, but as is the case for GWAS, very large studies are required to reveal additional susceptibility alleles for the disorder. PMID:26740555

  7. Four novel PEPD alleles causing prolidase deficiency.

    PubMed Central

    Ledoux, P.; Scriver, C.; Hechtman, P.

    1994-01-01

    Mutations at the PEPD locus cause prolidase deficiency (McKusick 170100), a rare autosomal recessive disorder characterized by iminodipeptiduria, skin ulcers, mental retardation, and recurrent infections. Four PEPD mutations from five severely affected individuals were characterized by analysis of reverse-transcribed, PCR-amplified (RT-PCR) cDNA. We used SSCP analysis on four overlapping cDNA fragments covering the entire coding region of the PEPD gene and detected abnormal SSCP bands for the fragment spanning all or part of exons 13-15 in three of the probands. Direct sequencing of the mutant cDNAs showed a G-->A, 1342 substitution (G448R) in two patients and a 3-bp deletion (delta E452 or delta E453) in another. In the other two probands the amplified products were of reduced size. Direct sequencing of these mutant cDNAs revealed a deletion of exon 5 in one patient and of exon 7 in the other. Intronic sequences flanking exons 5 and 7 were identified using inverse PCR followed by direct sequencing. Conventional PCR and direct sequencing then established the intron-exon borders of the mutant genomic DNA revealing two splice acceptor mutations: a G-->C substitution at position -1 of intron 4 and an A-->G substitution at position -2 of intron 6. Our results indicate that the severe form of prolidase deficiency is caused by multiple PEPD alleles. In this report we attempt to begin the process of describing these alleles and cataloging their phenotypic expression. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:8198124

  8. Mapping rare, deleterious mutations in Factor H: Association with early onset, drusen burden, and lower antigenic levels in familial AMD

    PubMed Central

    Wagner, Erin K.; Raychaudhuri, Soumya; Villalonga, Mercedes B.; Java, Anuja; Triebwasser, Michael P.; Daly, Mark J.; Atkinson, John P.; Seddon, Johanna M.

    2016-01-01

    The genetic architecture of age-related macular degeneration (AMD) involves numerous genetic variants, both common and rare, in the coding region of complement factor H (CFH). While these variants explain high disease burden in some families, they fail to explain the pathology in all. We selected families whose AMD was unexplained by known variants and performed whole exome sequencing to probe for other rare, highly penetrant variants. We identified four rare loss-of-function variants in CFH associated with AMD. Missense variant CFH 1:196646753 (C192F) segregated perfectly within a family characterized by advanced AMD and drusen temporal to the macula. Two families, each comprising a pair of affected siblings with extensive extramacular drusen, carried essential splice site variant CFH 1:196648924 (IVS6+1G>A) or missense variant rs139360826 (R175P). In a fourth family, missense variant rs121913058 (R127H) was associated with AMD. Most carriers had early onset bilateral advanced AMD and extramacular drusen. Carriers tended to have low serum Factor H levels, especially carriers of the splice variant. One missense variant (R127H) has been previously shown not to be secreted. The two other missense variants were produced recombinantly: compared to wild type, one (R175P) had no functional activity and the other (C192F) had decreased secretion. PMID:27572114

  9. Two prevalent h alleles in para-Bombay haplotypes among 250,000 Taiwanese.

    PubMed

    Chen, Ding-Ping; Tseng, Ching-Ping; Wang, Wei-Ting; Peng, Chien-Ting; Tsao, Kuo-Chien; Wu, Tsu-Lan; Lin, Kuan-Tsou; Sun, Chien-Feng

    2004-01-01

    Alpha(1,2)-fucosyltransferase catalyzes the transfer of fucose to the C-2 position of galactose on type II precursor substrate Gal beta1-4GlcNAc beta1-R. It plays an important biological role in the formation of H antigen, a precursor oligosaccharide for both A and B antigens on red blood cells. Aberration of alpha(1,2)-fucosyltransferase activity by gene mutations results in decreased synthesis of H antigen, leading to the para-Bombay phenotype. In this study, we collected about 250,000 blood samples in Taiwan during 5 yr and identified the subjects with para-Bombay phenotype. Then we analyzed the sequence of the alpha(1,2)-fucosyltransferase gene by direct sequencing and gene cloning methods, using the blood samples of 30 para-Bombay individuals and 30 control subjects who were randomly selected. The goals of this study were to search for new h alleles, to determine the h allele frequencies, and to test whether the sporadic theory is applicable in Taiwan. Six different h alleles (ha, 547-548 AG-del; hb, 880-881 TT-del; hc, R220C; hd, R220H; he, F174L; and hf, N327T) were observed. Two h alleles, he and hf, were newly discovered in Taiwan. The he allele has a nucleotide 522C>A point mutation, predicting the amino acid 174 substitution of Phe to Leu; the hf allele has missense mutation of nucleotide 980A>C, predicting the amino acid 327 substitution of Asn to Thr. Frequencies of the 6 alleles are ha 46.67%, hb 38.33%, hc 5.00%, hd 1.67%, he 3.33%, and hf 5.00%, respectively. These findings in the Taiwanese population confirm previous observations in other populations that the Bombay and para-Bombay phenotypes are due to diverse, sporadic, nonfunctional alleles, predominantly ha and hb, leading to H deficiency of red blood cells. In contrast to previous reports of non-prevalent associations of h alleles with para-Bombay phenotype, our results suggest a regional allele preference associated with para-Bombay individuals in Taiwan.

  10. Cross Talk Inhibition Nullified by a Receiver Domain Missense Substitution

    PubMed Central

    Huynh, TuAnh Ngoc; Lin, Hsia-Yin; Noriega, Chris E.; Lin, Alice V.

    2015-01-01

    inhibited in part by the high interaction specificity between cognate sensor-response regulator pairs. This study shows that a relatively subtle missense change from Val to Ala nullifies cross talk inhibition, enabling at least two noncognate sensors to enforce an inappropriate output independently of the relevant input. PMID:26260457

  11. Targeted Deep Sequencing Identifies Rare ‘loss-of-function’ Variants in IFNGR1 for Risk of Atopic Dermatitis Complicated by Eczema Herpeticum

    PubMed Central

    Gao, Li; Rafaels, Nicholas M; Huang, Lili; Potee, Joseph; Ruczinski, Ingo; Beaty, Terri H.; Paller, Amy S.; Schneider, Lynda C.; Gallo, Rich; Hanifin, Jon M.; Beck, Lisa A.; Geha, Raif S.; Mathias, Rasika A.; Leung, Donald Y. M.

    2015-01-01

    Background A subset of atopic dermatitis (AD) is associated with increased susceptibility to eczema herpeticum (ADEH+). We previously reported that common single nucleotide polymorphisms (SNPs) in interferon-gamma (IFNG) and receptor 1 (IFNGR1) were associated with ADEH+ phenotype. Objective To interrogate the role of rare variants in IFN-pathway genes for risk of ADEH+. Methods We performed targeted sequencing of interferon-pathway genes (IFNG, IFNGR1, IFNAR1 and IL12RB1) in 228 European American (EA) AD patients selected according to their EH status and severity measured by Eczema Area and Severity Index (EASI). Replication genotyping was performed in independent samples of 219 EA and 333 African Americans (AA). Functional investigation of ‘loss-of-function’ variants was conducted using site-directed mutagenesis. Results We identified 494 single nucleotide variants (SNVs) encompassing 105kb of sequence, including 145 common, 349 (70.6%) rare (minor allele frequency (MAF) <5%) and 86 (17.4%) novel variants, of which 2.8% were coding-synonymous, 93.3% were non-coding (64.6% intronic), and 3.8% were missense. We identified six rare IFNGR1 missense including three damaging variants (Val14Met (V14M), Val61Ile and Tyr397Cys (Y397C)) conferring a higher risk for ADEH+ (P=0.031). Variants V14M and Y397C were confirmed to be deleterious leading to partial IFNGR1 deficiency. Seven common IFNGR1 SNPs, along with common protective haplotypes (2 to 7-SNPs) conferred a reduced risk of ADEH+ (P=0.015-0.002, P=0.0015-0.0004, respectively), and both SNP and haplotype associations were replicated in an independent AA sample (P=0.004-0.0001 and P=0.001-0.0001, respectively). Conclusion Our results provide evidence that both genetic variants in the gene encoding IFNGR1 are implicated in susceptibility to the ADEH+ phenotype. CAPSULE SUMMARY We provided the first evidence that rare functional IFNGR1 mutations contribute to a defective systemic IFN-γ immune response that accounts

  12. Rare, Low-Frequency, and Common Variants in the Protein-Coding Sequence of Biological Candidate Genes from GWASs Contribute to Risk of Rheumatoid Arthritis

    PubMed Central

    Diogo, Dorothée; Kurreeman, Fina; Stahl, Eli A.; Liao, Katherine P.; Gupta, Namrata; Greenberg, Jeffrey D.; Rivas, Manuel A.; Hickey, Brendan; Flannick, Jason; Thomson, Brian; Guiducci, Candace; Ripke, Stephan; Adzhubey, Ivan; Barton, Anne; Kremer, Joel M.; Alfredsson, Lars; Sunyaev, Shamil; Martin, Javier; Zhernakova, Alexandra; Bowes, John; Eyre, Steve; Siminovitch, Katherine A.; Gregersen, Peter K.; Worthington, Jane; Klareskog, Lars; Padyukov, Leonid; Raychaudhuri, Soumya; Plenge, Robert M.

    2013-01-01

    The extent to which variants in the protein-coding sequence of genes contribute to risk of rheumatoid arthritis (RA) is unknown. In this study, we addressed this issue by deep exon sequencing and large-scale genotyping of 25 biological candidate genes located within RA risk loci discovered by genome-wide association studies (GWASs). First, we assessed the contribution of rare coding variants in the 25 genes to the risk of RA in a pooled sequencing study of 500 RA cases and 650 controls of European ancestry. We observed an accumulation of rare nonsynonymous variants exclusive to RA cases in IL2RA and IL2RB (burden test: p = 0.007 and p = 0.018, respectively). Next, we assessed the aggregate contribution of low-frequency and common coding variants to the risk of RA by dense genotyping of the 25 gene loci in 10,609 RA cases and 35,605 controls. We observed a strong enrichment of coding variants with a nominal signal of association with RA (p < 0.05) after adjusting for the best signal of association at the loci (penrichment = 6.4 × 10−4). For one locus containing CD2, we found that a missense variant, rs699738 (c.798C>A [p.His266Gln]), and a noncoding variant, rs624988, reside on distinct haplotypes and independently contribute to the risk of RA (p = 4.6 × 10−6). Overall, our results indicate that variants (distributed across the allele-frequency spectrum) within the protein-coding portion of a subset of biological candidate genes identified by GWASs contribute to the risk of RA. Further, we have demonstrated that very large sample sizes will be required for comprehensively identifying the independent alleles contributing to the missing heritability of RA. PMID:23261300

  13. Tri-allelic patterns at the D7S820 locus detected in two generations of a Chinese family.

    PubMed

    Jiang, Erlie; Pan, Jie; Han, Mingzhe; Chen, Liang; Ma, Qiaoling; Wei, Jialin; Huang, Yong; Feng, Sizhou; Sun, Qin; Xiao, Peili; Zheng, Zhongzheng

    2016-01-01

    Alleles at the D7S820 STR locus have 6-14 different numbers of a four-nucleotide (GATA) repeat motif arranged in tandem. The D7S820 tri-allelic pattern is rare and has not been reported in the Chinese population. In this study we report a three-banded pattern at the D7S820 locus observed in a Chinese family, in which four family members in two generations had tri-allelic D7S820 genotype 10-11-12 and one family member had an abnormal bi-allele genotype 10-11. All of the four tri-allelic cases had the genotype 10-11-12, probably due to three copies of the D7S820 STR sequence in all cells (Type 2 tri-allelic pattern), and deduced alleles 10-11 were a linked inheritance in this family.

  14. Cancer-specific high-throughput annotation of somatic mutations: computational prediction of driver missense mutations.

    PubMed

    Carter, Hannah; Chen, Sining; Isik, Leyla; Tyekucheva, Svitlana; Velculescu, Victor E; Kinzler, Kenneth W; Vogelstein, Bert; Karchin, Rachel

    2009-08-15

    Large-scale sequencing of cancer genomes has uncovered thousands of DNA alterations, but the functional relevance of the majority of these mutations to tumorigenesis is unknown. We have developed a computational method, called Cancer-specific High-throughput Annotation of Somatic Mutations (CHASM), to identify and prioritize those missense mutations most likely to generate functional changes that enhance tumor cell proliferation. The method has high sensitivity and specificity when discriminating between known driver missense mutations and randomly generated missense mutations (area under receiver operating characteristic curve, >0.91; area under Precision-Recall curve, >0.79). CHASM substantially outperformed previously described missense mutation function prediction methods at discriminating known oncogenic mutations in P53 and the tyrosine kinase epidermal growth factor receptor. We applied the method to 607 missense mutations found in a recent glioblastoma multiforme sequencing study. Based on a model that assumed the glioblastoma multiforme mutations are a mixture of drivers and passengers, we estimate that 8% of these mutations are drivers, causally contributing to tumorigenesis.

  15. Targeted sequencing of the Paget's disease associated 14q32 locus identifies several missense coding variants in RIN3 that predispose to Paget's disease of bone

    PubMed Central

    Vallet, Mahéva; Soares, Dinesh C.; Wani, Sachin; Sophocleous, Antonia; Warner, Jon; Salter, Donald M.; Ralston, Stuart H.; Albagha, Omar M.E.

    2015-01-01

    Paget's disease of bone (PDB) is a common disorder with a strong genetic component characterized by increased but disorganized bone remodelling. Previous genome-wide association studies identified a locus on chromosome 14q32 tagged by rs10498635 which was significantly associated with susceptibility to PDB in several European populations. Here we conducted fine-mapping and targeted sequencing of the candidate locus to identify possible functional variants. Imputation in 741 PDB patients and 2699 controls confirmed that the association was confined to a 60 kb region in the RIN3 gene and conditional analysis adjusting for rs10498635 identified no new independent signals. Sequencing of the RIN3 gene identified a common missense variant (p.R279C) that was strongly associated with the disease (OR = 0.64; P = 1.4 × 10−9), and was in strong linkage disequilibrium with rs10498635. A further 13 rare missense variants were identified, seven of which were novel and detected only in PDB cases. When combined, these rare variants were over-represented in cases compared with controls (OR = 3.72; P = 8.9 × 10−10). Most rare variants were located in a region that encodes a proline-rich, intrinsically disordered domain of the protein and many were predicted to be pathogenic. RIN3 was expressed in bone tissue and its expression level was ∼10-fold higher in osteoclasts compared with osteoblasts. We conclude that susceptibility to PDB at the 14q32 locus is mediated by a combination of common and rare coding variants in RIN3 and suggest that RIN3 may contribute to PDB susceptibility by affecting osteoclast function. PMID:25701875

  16. Estimating the age of alleles by use of intraallelic variability

    SciTech Connect

    Slatkin, M.; Rannala, B.

    1997-02-01

    A method is presented for estimating the age of an allele by use of its frequency and the extent of variation among different copies. The method uses the joint distribution of the number of copies in a population sample and the coalescence times of the intraallelic gene genealogy conditioned on the number of copies. The linear birth-death process is used to approximate the dynamics of a rare allele in a finite population. A maximum-likelihood estimate of the age of the allele is obtained by Monte Carlo integration over the coalescence times. The method is applied to two alleles at the cystic fibrosis (CFTR) locus, {Delta}F508 and G542X, for which intraallelic variability at three intronic microsatellite loci has been examined. Our results indicate that G542X is somewhat older than {Delta}F508. Although absolute estimates depend on the mutation rates at the microsatellite loci, our results support the hypothesis that {Delta}F508 arose <500 generations ({approx}10,000 years) ago. 32 refs., 4 figs.

  17. Not so Rare, Rare Diseases

    ERIC Educational Resources Information Center

    Waldman, H. Barry; Perlman, Steven P.; Munter, Beverly L.; Chaudhry, Ramiz A.

    2008-01-01

    A rare disease or condition is defined by federal legislation such that it: (1) affects less than 200,000 persons in the U.S.; or (2) affects more than 200,000 persons in the U.S. but for which there is no reasonable expectation that the cost of developing and making available in the U.S. a drug for such disease or condition will be recovered from…

  18. Not so Rare, Rare Diseases

    ERIC Educational Resources Information Center

    Waldman, H. Barry; Perlman, Steven P.; Munter, Beverly L.; Chaudhry, Ramiz A.

    2008-01-01

    A rare disease or condition is defined by federal legislation such that it: (1) affects less than 200,000 persons in the U.S.; or (2) affects more than 200,000 persons in the U.S. but for which there is no reasonable expectation that the cost of developing and making available in the U.S. a drug for such disease or condition will be recovered from…

  19. Investigation of the role of rare TREM2 variants in frontotemporal dementia subtypes.

    PubMed

    Thelen, Mathias; Razquin, Cristina; Hernández, Isabel; Gorostidi, Ana; Sánchez-Valle, Raquel; Ortega-Cubero, Sara; Wolfsgruber, Steffen; Drichel, Dmitriy; Fliessbach, Klaus; Duenkel, Tanja; Damian, Marinella; Heilmann, Stefanie; Slotosch, Anja; Lennarz, Martina; Seijo-Martínez, Manuel; Rene, Ramón; Kornhuber, Johannes; Peters, Oliver; Luckhaus, Christian; Jahn, Holger; Hüll, Michael; Rüther, Eckart; Wiltfang, Jens; Lorenzo, Elena; Gascon, Jordi; Lleó, Alberto; Lladó, Albert; Campdelacreu, Jaume; Moreno, Fermin; Ahmadzadehfar, Hojjat; Fortea, Juan; Indakoetxea, Begoña; Heneka, Michael T; Wetter, Axel; Pastor, Maria A; Riverol, Mario; Becker, Tim; Frölich, Lutz; Tárraga, Lluís; Boada, Mercè; Wagner, Michael; Jessen, Frank; Maier, Wolfgang; Clarimón, Jordi; López de Munain, Adolfo; Ruiz, Agustín; Pastor, Pau; Ramirez, Alfredo

    2014-11-01

    Frontotemporal dementia (FTD) is a clinically and genetically heterogeneous disorder. Rare TREM2 variants have been recently identified in families affected by FTD-like phenotype. However, genetic studies of the role of rare TREM2 variants in FTD have generated conflicting results possibly because of difficulties on diagnostic accuracy. The aim of the present study was to investigate associations between rare TREM2 variants and specific FTD subtypes (FTD-S). The entire coding sequence of TREM2 was sequenced in FTD-S patients of Spanish (n = 539) and German (n = 63) origin. Genetic association was calculated using Fisher exact test. The minor allele frequency for controls was derived from in-house genotyping data and publicly available databases. Seven previously reported rare coding variants (p.A28V, p.W44X, p.R47H, p.R62H, p.T66M, p.T96K, and p.L211P) and 1 novel missense variant (p.A105T) were identified. The p.R47H variant was found in 4 patients with FTD-S. Two of these patients showed cerebrospinal fluid pattern of amyloid beta, tau, and phosphorylated-tau suggesting underlying Alzheimer's disease (AD) pathology. No association was found between p.R47H and FTD-S. A genetic association was found between p.T96K and FTD-S (p = 0.013, odds ratio = 4.23, 95% Confidence Interval [1.17-14.77]). All 6 p.T96K patients also carried the TREM2 variant p.L211P, suggesting linkage disequilibrium. The remaining TREM2 variants were found in 1 patient, respectively, and were absent in controls. The present findings provide evidence that p.T96K is associated with FTD-S and that p.L211P may contribute to its pathogenic effect. The data also suggest that p.R47H is associated with an FTD phenotype that is characterized by the presence of underlying AD pathology.

  20. Very mild features of dysequilibrium syndrome associated with a novel VLDLR missense mutation.

    PubMed

    Micalizzi, Alessia; Moroni, Isabella; Ginevrino, Monia; Biagini, Tommaso; Mazza, Tommaso; Romani, Marta; Valente, Enza Maria

    2016-07-01

    Dysequilibrium syndrome (DES) is a non-progressive congenital ataxia characterized by severe intellectual deficit, truncal ataxia and markedly delayed, quadrupedal or absent ambulation. Recessive loss-of-function mutations in the very low density lipoprotein receptor (VLDLR) gene represent the most common cause of DES. Only two families have been reported harbouring homozygous missense mutations, both with a similarly severe phenotype. We report an Italian girl with very mild DES caused by the novel homozygous VLDLR missense mutation p.(C419Y). This unusually benign phenotype possibly relates to a less disruptive effect of the mutation, falling within a domain (EGF-B) not predicted as crucial for the protein function.

  1. Genome-wide detection of allelic gene expression in hepatocellular carcinoma cells using a human exome SNP chip.

    PubMed

    Park, Yon Mi; Cheong, Hyun Sub; Lee, Jong-Keuk

    2014-11-10

    Allelic variations in gene expression influence many biological responses and cause phenotypic variations in humans. In this study, Illumina Human Exome BeadChips containing more than 240,000 single nucleotide polymorphisms (SNPs) were used to identify changes in allelic gene expression in hepatocellular carcinoma cells following lipopolysaccharide (LPS) stimulation. We found 17 monoallelically expressed genes, 58 allelic imbalanced genes, and 7 genes showing allele substitution. In addition, we also detected 33 differentially expressed genes following LPS treatment in vitro using these human exome SNP chips. However, alterations in allelic gene expression following LPS treatment were detected in only three genes (MLXIPL, TNC, and MX2), which were observed in one cell line sample only, indicating that changes in allelic gene expression following LPS stimulation of liver cells are rare events. Among a total of 75 genes showing allelic expression in hepatocellular carcinoma cells, either monoallelic or imbalanced, 43 genes (57.33%) had expression quantitative trait loci (eQTL) data, indicating that high-density exome SNP chips are useful and reliable for studying allelic gene expression. Furthermore, most genes showing allelic expression were regulated by cis-acting mechanisms and were also significantly associated with several human diseases. Overall, our study provides a better understanding of allele-specific gene expression in hepatocellular carcinoma cells with and without LPS stimulation and potential clues for the cause of human disease due to alterations in allelic gene expression.

  2. Large-scale profiling and identification of potential regulatory mechanisms for allelic gene expression in colorectal cancer cells.

    PubMed

    Lee, Robin Dong-Woo; Song, Min-Young; Lee, Jong-Keuk

    2013-01-01

    Allelic variation in gene expression is common in humans and this variation is associated with phenotypic variation. In this study, we employed high-density single nucleotide polymorphism (SNP) chips containing 13,900 exonic SNPs to identify genes with allelic gene expression in cells from colorectal cancer cell lines. We found 2 monoallelically expressed genes (ERAP2 and MYLK4), 32 genes with an allelic imbalance in their expression, and 13 genes showing allele substitution by RNA editing. Among a total of 34 allelically expressed genes in colorectal cancer cells, 15 genes (44.1%) were associated with cis-acting eQTL, indicating that large portions of allelically expressed genes are regulated by cis-acting mechanisms of gene expression. In addition, potential regulatory variants present in the proximal promoter regions of genes showing either monoallelic expression or allelic imbalance were not tightly linked with coding SNPs, which were detected with allelic gene expression. These results suggest that multiple rare variants could be involved in the cis-acting regulatory mechanism of allelic gene expression. In the comparison with allelic gene expression data from Centre d'Etude du Polymorphisme Humain (CEPH) family B cells, 12 genes showed B-cell specific allelic imbalance and 1 noncoding SNP showed colorectal cancer cell-specific allelic imbalance. In addition, different patterns of allele substitution were observed between B cells and colorectal cancer cells. Overall, our study not only indicates that allelic gene expression is common in colorectal cancer cells, but our study also provides a better understanding of allele-specific gene expression in colorectal cancer cells.

  3. A missense mutation in the extracellular domain of Fas: the most common change in Argentinean patients with autoimmune lymphoproliferative syndrome represents a founder effect.

    PubMed

    Simesen de Bielke, María Gabriela; Yancoski, Judith; Rocco, Carlos; Pérez, Laura E; Cantisano, Claudio; Pérez, Néstor; Oleastro, Matías; Danielian, Silvia

    2012-12-01

    Mutations in the Fas gene (TNFRSF6) are the most common causes of Autoimmune Lymphoproliferative Syndrome (ALPS-FAS). In Argentina almost a third of patients with ALPS-FAS present a missense mutation affecting the extracellular cysteine rich domain 2 of Fas, p.Cys107Tyr (C107Y). This change was found in homozygous state in 2 patients from a consanguineous family, and heterozygously, in 3 other patients from 3 unrelated families. In these families, 12 relatives were identified as healthy carriers of the mutation. We sought to test the hypothesis that this mutation actually represents a single haplotype of TNFRSF6. DNAs from ALPS-C107Y patients and their families, as well as from 150 Argentinean control subjects were sequenced for the known higher frequency single nucleotide polymorphisms (SNPs) of TNFRSF6. The C107Y-carriers were also genotyped at 5 microsatellites proximal to the Fas gene locus. All C107Y alleles presented a unique intragenic haplotype that could be restricted to this group. Extent of haplotype sharing and variability of microsatellite alleles in C107Y chromosomes support the presence of a single haplotype block including the mutation and encompassing 2.395 Mb. A founder effect for C107Y has been evidenced in this work and the most common recent ancestor to the patients probably lived 350 years ago. This constitutes the first report of a founder event in ALPS.

  4. The eQTL-missense polymorphisms of APOBEC3H are associated with lung cancer risk in a Han Chinese population

    PubMed Central

    Zhu, Meng; Wang, Yuzhuo; Wang, Cheng; Shen, Wei; Liu, Jia; Geng, Liguo; Cheng, Yang; Dai, Juncheng; Jin, Guangfu; Ma, Hongxia; Hu, Zhibin; Shen, Hongbing

    2015-01-01

    APOBEC (Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like) enzymes may involve in mutagenic processes in multiple cancer types, including lung cancer. APOBEC family of cytidine deaminases induces base substitutions with a stringent TCW motif, which is widespread in multiple human cancers. We hypothesized that common missense variants in coding regions of APOBEC genes might damage the structure of proteins and modify lung cancer risk. To test this hypothesis, we systematically screened predicted deleterious polymorphisms in the exon regions of 10 APOBEC core genes (APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4) and evaluated them with a case-control study including 1200 cases and 1253 controls. We found that the T allele of rs139293 in exon 2 of APOBEC3H was significantly associated with decreased risk of lung cancer (odds ratio = 0.76, 95% confidence interval: 0.63–0.91). Similar inverse association of this variant was observed in subgroups. Further study showed that the T allele of rs139293 was associated with the altered expression of APOBEC3H and APOBEC3C and that the two genes were co-expressed in both tumor and adjacent normal tissues. These results indicate that genetic variants in APOBEC3H may contribute to lung cancer susceptibility in Chinese population. PMID:26459911

  5. Short communication: A missense mutation in the PROP1 (prophet of Pit 1) gene affects male fertility and milk production traits in the US Holstein population.

    PubMed

    Lan, X Y; Peñagaricano, F; DeJung, L; Weigel, K A; Khatib, H

    2013-02-01

    In previous studies, we reported significant associations of the POU1F1 pathway genes with reproduction and production traits in several dairy cattle populations. Polymorphisms in genes of this pathway were found to be associated with both female and male fertility traits in dairy cattle. The POU1F1 gene is a direct downstream target for the regulation of the prophet of Pit1 (PROP1) gene, also known as PROP paired-like homeobox 1. Interestingly, the position of PROP1 coincides with a quantitative trait locus affecting ovulation rate in cattle. Therefore, the objective of this study was to investigate whether PROP1 affects fertility and milk production traits in Holstein cattle. Using the DNA pooling sequencing approach, a missense single nucleotide polymorphism that replaces a histidine amino acid with an arginine was detected in exon 3 of PROP1. The arginine allele was found to be associated with a decrease in sire conception rate and an increase in productive life, protein yield, and net merit index in a population of 1,951 Holstein bulls. The transcription factors produced from the histidine and arginine isoforms are known to have different transcription, DNA binding, and regulation activities. As such, we propose that the association of the arginine isoform with decreased bull fertility is likely caused by reduced activity of this allele in male functions. The findings of this study suggest PROP1 polymorphisms as candidates in selection programs for fertility, health, and milk production traits in dairy cattle.

  6. A missense mutation (1278T) in the cystathionine {beta}-synthase gene prevalent in pyridoxine-responsive homocystinuria and associated with mild clinical phenotype

    SciTech Connect

    Shih, V.E.; Fringer, J.M.; Mandell, R.

    1995-07-01

    Cystathionine {beta}-synthase (CBS) deficiency is an autosomal recessive disorder characterized by homocystinuria and multisystem clinical disease. Patients responsive to pyridoxine usually have a milder clinical phenotype than do nonresponsive patients, and we studied the molecular pathology of this disorder in an attempt to understand the molecular basis of the clinical variation. We previously reported a T833C transition in exon 8 causing a substitution of threonine for isoleucine at codon 278 (I278T). By PCR amplification and sequencing of exon 8 from genomic DNA we have now detected the I278T mutation in 7 of 11 patients with in vivo pyridoxine responsiveness and 0 of 27 pyridoxine-nonresponsive patients. Two pyridoxine-responsive patients are homozygous and five are heterozygous for I278T. We have now observed the I278T mutation in 41% (9 of 22) of the independent alleles in pyridoxine-responsive patients of varied ethnic backgrounds. In two of the compound heterozygotes we identified a novel mutation (G139R and E144K) in the other allele. The finding that the two patients who are homozygous for I278T have only ectopia lentis and mild bone demineralization suggests that this mutation is associated with both in vivo pyridoxine responsiveness and mild clinical disease. Compound heterozygous patients who have one copy of this missense mutation are likely to retain some degree of pyridoxine responsiveness. 14 refs., 4 figs., 1 tab.

  7. Distribution of coat-color-associated alleles in the domestic horse population and Przewalski's horse.

    PubMed

    Reissmann, Monika; Musa, Lutfi; Zakizadeh, Sonia; Ludwig, Arne

    2016-11-01

    Considering the hidden mode of inheritance of some coat-color-associated alleles, we investigated the presence/absence of coat-color-associated alleles in 1093 domestic horses of 55 breeds and 20 specimens of Przewalski's horse. For coat-color genotyping, allele specific PCR, pyrosequencing and Li-Cor analyses were conducted on 12 coat-color-associated alleles of five genes. Our data provide deep insight into the distribution of coat-color-associated alleles within breeds. We found that the alleles for the basic colorations (bay, black, and chestnut) are widely distributed and occur in nearly all breeds. Alleles leading to dilutions or patterns are rare in domestic breeds and were not found in Przewalski's horse. Higher frequencies of these alleles are only found in breeds that are selected for their expressed phenotypes (e.g., Kinsky horse, Lewitzer, Tinker). Nevertheless, our study produced strong evidence that molecular testing of the coat color is necessary for well-defined phenotyping to avoid unexpected colorations of offspring that can result in legal action.

  8. Niemann-Pick disease: a frequent missense mutation in the acid sphingomyelinase gene of Ashkenazi Jewish type A and B patients.

    PubMed Central

    Levran, O; Desnick, R J; Schuchman, E H

    1991-01-01

    Although the A and B subtypes of Niemann-Pick disease (NPD) both result from the deficient activity of acid sphingomyelinase (ASM; sphingomyelin cholinephosphohydrolase, EC 3.1.4.12) and the lysosomal accumulation of sphingomyelin, they have remarkably distinct phenotypes. Type A disease is a fatal neurodegenerative disorder of infancy, whereas type B disease has no neurologic manifestations and is characterized primarily by reticuloendothelial involvement and survival into adulthood. Both disorders are more frequent among individual of Ashkenazi Jewish ancestry than in the general population. The recent isolation and characterization of cDNA and genomic sequences encoding ASM has facilitated investigation of the molecular lesions causing the NPD subtypes. Total RNA was reverse-transcribed, and the ASM cDNA from an Ashkenazi Jewish type A patient was specifically amplified by the polymerase chain reaction (PCR). Molecular analysis of the PCR products revealed a G----T transversion of nucleotide 1487, which occurred at a CpG dinucleotide and predicted an Arg----Leu substitution in residue 496. Hybridization of PCR-amplified genomic DNA with allele-specific oligonucleotides indicated that the proband was homoallelic for the Arg----Leu substitution and that both parents and several other relatives were heterozygous. This mutation was detected in 32% (10 of 31) of the Ashkenazi Jewish NPD type A alleles studied and occurred in only 5.6% (2 of 36) of ASM alleles from non-Jewish type A patients. Of interest, the Arg----Leu substitution occurred in one of the ASM alleles from the two Ashkenazi Jewish NPD type B patients studied and in none of the ASM alleles of 15 non-Jewish type B patients. In contrast, the mutation was not present in 180 ASM alleles from normal individuals of Ashkenazi Jewish descent. These findings identify a frequent missense mutation among NPD patients of Ashkenazi Jewish ancestry that results in neuronopathic type A disease when homoallelic and can

  9. Association of Rare Nonsynonymous Variants in PKD1 and PKD2 with Familial Intracranial Aneurysms in a Japanese Population.

    PubMed

    Hirota, Kengo; Akagawa, Hiroyuki; Onda, Hideaki; Yoneyama, Taku; Kawamata, Takakazu; Kasuya, Hidetoshi

    2016-12-01

    Autosomal dominant polycystic kidney disease (ADPKD) caused by deleterious mutations in PKD1 (16p13.3) and PKD2 (4q21) often coexists with intracranial aneurysms (IAs). In this study, we investigated whether IAs without obvious renal diseases were also associated with these ADPKD genes. We performed next-generation sequencing of the ADPKD genes in 150 Japanese familial IA patients and age- and sex-matched 150 non-IA controls without obvious renal diseases. Rare coding variants for the following association analysis were defined according to allelic frequencies of less than .5% either in our controls or in the 1000 genomes database. Association with IA was evaluated using burden and variance component methods: the weighted-sum statistic (WSS) and the sequence kernel association test (SKAT), respectively. A total of 44 rare candidate variants were confirmed by Sanger sequencing; 26 were identified from 33 patients, whereas 21 were identified from 20 controls. The candidate variants were all missense variants, except for 1 patient's nonsense variant (p.Q924X) in PKD2, and showed consistent association with IA in both burden and variance component tests (odds ratio [OR] = 1.80; WSS, P = .026; SKAT, P = .044). This association was largely derived from the variants found in the extracellular structural domains of PKD1 (OR = 2.06; WSS, P = .030; SKAT, P = .029). ADPKD genes are susceptibility genes for IA even in patients without ADPKD. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  10. Pathogenicity of the BRCA1 Missense Variant M1775K is Determined by the Disruption of the BRCT Phosphopeptide-Binding Pocket: a Multi-Modal Approach

    SciTech Connect

    Tischkowitz,M.; Hamel, N.; Carvalho, M.; Birrane, G.; Soni, A.; van Beers, E.; Joosse, S.; Wong, N.; Novak, D.; et al

    2008-01-01

    A number of germ-line mutations in the BRCA1 gene confer susceptibility to breast and ovarian cancer. However, it remains difficult to determine whether many single amino-acid (missense) changes in the BRCA1 protein that are frequently detected in the clinical setting are pathologic or not. Here, we used a combination of functional, crystallographic, biophysical, molecular and evolutionary techniques, and classical genetic segregation analysis to demonstrate that the BRCA1 missense variant M1775K is pathogenic. Functional assays in yeast and mammalian cells showed that the BRCA1 BRCT domains carrying the amino-acid change M1775K displayed markedly reduced transcriptional activity, indicating that this variant represents a deleterious mutation. Importantly, the M1775K mutation disrupted the phosphopeptide-binding pocket of the BRCA1 BRCT domains, thereby inhibiting the BRCA1 interaction with the proteins BRIP1 and CtIP, which are involved in DNA damage-induced checkpoint control. These results indicate that the integrity of the BRCT phosphopeptide-binding pocket is critical for the tumor suppression function of BRCA1. Moreover, this study demonstrates that multiple lines of evidence obtained from a combination of functional, structural, molecular and evolutionary techniques, and classical genetic segregation analysis are required to confirm the pathogenicity of rare variants of disease-susceptibility genes and obtain important insights into the underlying pathogenetic mechanisms.

  11. HER2 missense mutations have distinct effects on oncogenic signaling and migration.

    PubMed

    Zabransky, Daniel J; Yankaskas, Christopher L; Cochran, Rory L; Wong, Hong Yuen; Croessmann, Sarah; Chu, David; Kavuri, Shyam M; Red Brewer, Monica; Rosen, D Marc; Dalton, W Brian; Cimino-Mathews, Ashley; Cravero, Karen; Button, Berry; Kyker-Snowman, Kelly; Cidado, Justin; Erlanger, Bracha; Parsons, Heather A; Manto, Kristen M; Bose, Ron; Lauring, Josh; Arteaga, Carlos L; Konstantopoulos, Konstantinos; Park, Ben Ho

    2015-11-10

    Recurrent human epidermal growth factor receptor 2 (HER2) missense mutations have been reported in human cancers. These mutations occur primarily in the absence of HER2 gene amplification such that most HER2-mutant tumors are classified as "negative" by FISH or immunohistochemistry assays. It remains unclear whether nonamplified HER2 missense mutations are oncogenic and whether they are targets for HER2-directed therapies that are currently approved for the treatment of HER2 gene-amplified breast cancers. Here we functionally characterize HER2 kinase and extracellular domain mutations through gene editing of the endogenous loci in HER2 nonamplified human breast epithelial cells. In in vitro and in vivo assays, the majority of HER2 missense mutations do not impart detectable oncogenic changes. However, the HER2 V777L mutation increased biochemical pathway activation and, in the context of a PIK3CA mutation, enhanced migratory features in vitro. However, the V777L mutation did not alter in vivo tumorigenicity or sensitivity to HER2-directed therapies in proliferation assays. Our results suggest the oncogenicity and potential targeting of HER2 missense mutations should be considered in the context of cooperating genetic alterations and provide previously unidentified insights into functional analysis of HER2 mutations and strategies to target them.

  12. HER2 missense mutations have distinct effects on oncogenic signaling and migration

    PubMed Central

    Zabransky, Daniel J.; Yankaskas, Christopher L.; Cochran, Rory L.; Wong, Hong Yuen; Croessmann, Sarah; Chu, David; Kavuri, Shyam M.; Red Brewer, Monica; Rosen, D. Marc; Dalton, W. Brian; Cimino-Mathews, Ashley; Cravero, Karen; Button, Berry; Kyker-Snowman, Kelly; Cidado, Justin; Erlanger, Bracha; Parsons, Heather A.; Manto, Kristen M.; Bose, Ron; Lauring, Josh; Arteaga, Carlos L.; Konstantopoulos, Konstantinos; Park, Ben Ho

    2015-01-01

    Recurrent human epidermal growth factor receptor 2 (HER2) missense mutations have been reported in human cancers. These mutations occur primarily in the absence of HER2 gene amplification such that most HER2-mutant tumors are classified as “negative” by FISH or immunohistochemistry assays. It remains unclear whether nonamplified HER2 missense mutations are oncogenic and whether they are targets for HER2-directed therapies that are currently approved for the treatment of HER2 gene-amplified breast cancers. Here we functionally characterize HER2 kinase and extracellular domain mutations through gene editing of the endogenous loci in HER2 nonamplified human breast epithelial cells. In in vitro and in vivo assays, the majority of HER2 missense mutations do not impart detectable oncogenic changes. However, the HER2 V777L mutation increased biochemical pathway activation and, in the context of a PIK3CA mutation, enhanced migratory features in vitro. However, the V777L mutation did not alter in vivo tumorigenicity or sensitivity to HER2-directed therapies in proliferation assays. Our results suggest the oncogenicity and potential targeting of HER2 missense mutations should be considered in the context of cooperating genetic alterations and provide previously unidentified insights into functional analysis of HER2 mutations and strategies to target them. PMID:26508629

  13. Neonatal diabetes in an infant of diabetic mother: same novel INS missense mutation in the mother and her offspring.

    PubMed

    Ozturk, Mehmet Adnan; Kurtoglu, Selim; Bastug, Osman; Korkmaz, Levent; Daar, Ghaniya; Memur, Seyma; Halis, Hulya; Günes, Tamer; Hussain, Khalid; Ellard, Sian

    2014-07-01

    Neonatal diabetes is defined as an uncontrolled hyperglycemic state occurring within the first 6 months of life. It is a rare disease with an incidence of 1 to 90,000-250,000. It is usually a disease of genetic origin in which insulin gene mutations play the main role in the disease process. A baby, born to a mother who had previously been diagnosed with type 1 diabetes mellitus at 14 months of age, had a high blood sugar level within the first few hours after birth and was subsequently diagnosed as having neonatal diabetes mellitus. Baby and mother were identified as having a novel heterozygous insulin missense mutation, p.C109R. Difficulties occurred in both follow-up and feeding of the baby. Without the addition of the mother's milk, an appropriate calorie milk formula and isophane insulin were used for the baby during follow-up. Multiple mechanisms are responsible in the pathogenesis of neonatal diabetes mellitus. Insulin gene mutations are one of the factors in the development of neonatal diabetes mellitus. If a resistant hyperglycemic state persists for a long time among babies, especially in those with intrauterine growth retardation whose mothers are diabetic, the baby concerned should be followed-up carefully for the development of neonatal diabetes mellitus.

  14. Recurrent missense mutation of GDF5 (p.R438L) causes proximal symphalangism in a British family

    PubMed Central

    Leonidou, Andreas; Irving, Melita; Holden, Simon; Katchburian, Marcos

    2016-01-01

    Proximal symphalangism (SYM1B) (OMIM 615298) is an autosomal dominant developmental disorder affecting joint fusion. It is characterized by variable fusions of the proximal interphalangeal joints of the hands, typically of the ring and little finger, with the thumb typically being spared. SYM1 is frequently associated with coalition of tarsal bones and conductive hearing loss. Molecular studies have identified two possible genetic aetiologies for this syndrome, NOG and GDF5. We herein present a British caucasian family with SYM1B caused by a mutation of the GDF5 gene. A mother and her three children presented to the orthopaedic outpatient department predominantly for feet related problems. All patients had multiple tarsal coalitions and hand involvement in the form of either brachydactyly or symphalangism of the proximal and middle phalanx of the little fingers. Genetic testing in the eldest child and his mother identified a heterozygous missense mutation in GDF5 c.1313G>T (p.R438L), thereby establishing SYM1B as the cause of the orthopaedic problems in this family. There were no mutations identified in the NOG gene. This report highlights the importance of thorough history taking, including a three generation family history, and detailed clinical examination of children with fixed planovalgus feet and other family members to detect rare skeletal dysplasia conditions causing pain and deformity, and provides details of the spectrum of problems associated with SYM1B. PMID:28032038

  15. Salbutamol-responsive limb-girdle congenital myasthenic syndrome due to a novel missense mutation and heteroallelic deletion in MUSK.

    PubMed

    Gallenmüller, Constanze; Müller-Felber, Wolfgang; Dusl, Marina; Stucka, Rolf; Guergueltcheva, Velina; Blaschek, Astrid; von der Hagen, Maja; Huebner, Angela; Müller, Juliane S; Lochmüller, Hanns; Abicht, Angela

    2014-01-01

    Congenital myasthenic syndromes (CMS) are clinically and genetically heterogeneous disorders characterized by a neuromuscular transmission defect. In recent years, causative mutations have been identified in atleast 15 genes encoding proteins of the neuromuscular junction. Mutations in MUSK are known as a very rare genetic cause of CMS and have been described in only three families, world-wide. Consequently, the knowledge about efficient drug therapy is very limited. We identified a novel missense mutation (p.Asp38Glu) heteroallelic to a genomic deletion affecting exons 2-3 of MUSK as cause of a limb-girdle CMS in two brothers of Turkish origin. Clinical symptoms included fatigable limb weakness from early childhood on. Upon diagnosis of a MUSK-related CMS at the age of 16 and 13years, respectively, treatment with salbutamol was initiated leading to an impressive improvement of clinical symptoms, while treatment with esterase inhibitors did not show any benefit. Our findings highlight the importance of a molecular diagnosis in CMS and demonstrate considerable similarities between patients with MUSK and DOK7-related CMS in terms of clinical phenotype and treatment options. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. In Silico Analysis of Missense Mutations in LPAR6 Reveals Abnormal Phospholipid Signaling Pathway Leading to Hypotrichosis

    PubMed Central

    Raza, Syed Irfan; Muhammad, Dost; Jan, Abid; Ali, Raja Hussain; Hassan, Mubashir; Ahmad, Wasim; Rashid, Sajid

    2014-01-01

    Autosomal recessive hypotrichosis is a rare genetic irreversible hair loss disorder characterized by sparse scalp hair, sparse to absent eyebrows and eyelashes, and sparse axillary and body hair. The study, presented here, established genetic linkage in four families showing similar phenotypes to lysophosphatidic acid receptor 6 (LPAR6) gene on chromosome 13q14.11-q21.32. Subsequently, sequence analysis of the gene revealed two previously reported missense mutations including p.D63V in affected members of one and p.I188F in three other families. Molecular modeling and docking analysis was performed to investigate binding of a ligand oleoyl-L-alpha-lysophosphatidic acid (LPA) to modeled protein structures of normal and mutated (D63V, G146R, I188F, N248Y, S3T, L277P) LPAR6 receptors. The mutant receptors showed a complete shift in orientation of LPA at the binding site. In addition, hydropathy analysis revealed a significant change in the membrane spanning topology of LPAR6 helical segments. The present study further substantiated involvement of LPAR6-LPA signaling in the pathogenesis of hypotrichosis/woolly hair and provided additional insight into the molecular mechanism of hair development. PMID:25119526

  17. Functional analysis of two rare CYP21A2 mutations detected in Italian patients with a mildest form of congenital adrenal hyperplasia.

    PubMed

    Concolino, Paola; Vendittelli, Francesca; Mello, Enrica; Minucci, Angelo; Carrozza, Cinzia; Rossodivita, Aurora; Giardina, Bruno; Zuppi, Cecilia; Capoluongo, Ettore

    2009-10-01

    More than 90% of all cases of congenital adrenal hyperplasia (CAH) result from steroid 21-hydroxylase gene (CYP21A2) mutations. Most of these mutations result from intergenic recombinations between CYP21A2 and closely linked CYP21A1P pseudogene. Rare mutations not generated by gene conversion account for 5-10% of 21-hydroxylase deficiency alleles. Functional analysis of two novel CYP21A2 missense mutations (p.R224W and p.D407N) was performed. Our study was composed of two Italian patients suffering from a very mild form of nonclassic CAH (NC-CAH). To assay the enzymatic activity of mutants, the in vitro analysis was performed in transiently transfected COS-1 cells. The residual activities obtained for p.R224W and p.D407N mutants allow their classification as NC-CAH mutations. These results correlate with the rate of severity of the patients' disease. In this paper, we report two novel CYP21A2 mutations in two Italian individuals affected by 21-hydroxylase deficiency. Based on the functional in vitro analysis we can classify these mutations as NC-CAH variants.

  18. Long-Term Balancing Selection in LAD1 Maintains a Missense Trans-Species Polymorphism in Humans, Chimpanzees, and Bonobos.

    PubMed

    Teixeira, João C; de Filippo, Cesare; Weihmann, Antje; Meneu, Juan R; Racimo, Fernando; Dannemann, Michael; Nickel, Birgit; Fischer, Anne; Halbwax, Michel; Andre, Claudine; Atencia, Rebeca; Meyer, Matthias; Parra, Genís; Pääbo, Svante; Andrés, Aida M

    2015-05-01

    Balancing selection maintains advantageous genetic and phenotypic diversity in populations. When selection acts for long evolutionary periods selected polymorphisms may survive species splits and segregate in present-day populations of different species. Here, we investigate the role of long-term balancing selection in the evolution of protein-coding sequences in the Homo-Pan clade. We sequenced the exome of 20 humans, 20 chimpanzees, and 20 bonobos and detected eight coding trans-species polymorphisms (trSNPs) that are shared among the three species and have segregated for approximately 14 My of independent evolution. Although the majority of these trSNPs were found in three genes of the major histocompatibility locus cluster, we also uncovered one coding trSNP (rs12088790) in the gene LAD1. All these trSNPs show clustering of sequences by allele rather than by species and also exhibit other signatures of long-term balancing selection, such as segregating at intermediate frequency and lying in a locus with high genetic diversity. Here, we focus on the trSNP in LAD1, a gene that encodes for Ladinin-1, a collagenous anchoring filament protein of basement membrane that is responsible for maintaining cohesion at the dermal-epidermal junction; the gene is also an autoantigen responsible for linear IgA disease. This trSNP results in a missense change (Leucine257Proline) and, besides altering the protein sequence, is associated with changes in gene expression of LAD1. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. DNA analysis of an uncommon missense mutation in a Gaucher disease patient of Jewish-Polish-Russian descent

    SciTech Connect

    Choy, F.Y.M.; Wei, C.; Applegarth, D.A.; McGillivray, B.C.

    1994-06-01

    Gaucher disease is the most frequent lysosomal lipid storage disease. It results from deficient glucocerebrosidase activity and is transmitted as an autosomal recessive trait. Three clinical forms of Gaucher disease have been described: type 1, non-neuronopathic; type 2, acute neuronopathic; and type 3, subacute neuronopathic. We have sequenced the full length cDNA of the glucocerebrosidase gene and identified an uncommon mutation in nucleotide position 1604 (genoma DNA nucleotide position 6683) from a Gaucher disease patient of Jewish-Polish-Russian descent with type 1 Gaucher disease. It is a G{yields}A transition in exon 11 that results in {sup 496}Arg{yields}{sup 496}His of glucocerebrosidase. This missense mutation is present in the heterozygous form and creates a new cleavage site for the endonuclease HphI. We have developed a simple method to detect the presence of this mutation by using HphI restriction fragment length polymorphism analysis of glucocerebrosidase genomic DNA or cDNA. The mutation in the other Gaucher allele of this patient is an A{yields}G transition at cDNA nucleotide position 1226 which creates an XhoI cleavage site after PCR mismatch amplification. The presence of this mutation was also confirmed by sequence analysis. Based on previous reports that mutation 1226 is present only in type 1 Gaucher disease and the observation that there is no neurological involvement in this patient, we conclude that our patient with the 1226/1604 genotype is diagnosed as having type 1 Gaucher disease. Since it was also postulated that mutation 1226 in the homozygous form will usually result in a good prognosis, we speculate that the orthopedic complications and the unusual presence of glomerulosclerosis in this patient may be attributable to the mutation at nucleotide 1604. This speculation will require a description of more patients with this mutation for confirmation. 32 refs., 5 figs.

  20. Targeted Deep Sequencing in Multiple-Affected Sibships of European Ancestry Identifies Rare Deleterious Variants in PTPN22 That Confer Risk for Type 1 Diabetes.

    PubMed

    Ge, Yan; Onengut-Gumuscu, Suna; Quinlan, Aaron R; Mackey, Aaron J; Wright, Jocyndra A; Buckner, Jane H; Habib, Tania; Rich, Stephen S; Concannon, Patrick

    2016-03-01

    Despite finding more than 40 risk loci for type 1 diabetes (T1D), the causative variants and genes remain largely unknown. Here, we sought to identify rare deleterious variants of moderate-to-large effects contributing to T1D. We deeply sequenced 301 protein-coding genes located in 49 previously reported T1D risk loci in 70 T1D cases of European ancestry. These cases were selected from putatively high-risk families that had three or more siblings diagnosed with T1D at early ages. A cluster of rare deleterious variants in PTPN22 was identified, including two novel frameshift mutations (ss538819444 and rs371865329) and two missense variants (rs74163663 and rs56048322). Genotyping in 3,609 T1D families showed that rs56048322 was significantly associated with T1D and that this association was independent of the T1D-associated common variant rs2476601. The risk allele at rs56048322 affects splicing of PTPN22, resulting in the production of two alternative PTPN22 transcripts and a novel isoform of LYP (the protein encoded by PTPN22). This isoform competes with the wild-type LYP for binding to CSK and results in hyporesponsiveness of CD4(+) T cells to antigen stimulation in T1D subjects. These findings demonstrate that in addition to common variants, rare deleterious variants in PTPN22 exist and can affect T1D risk. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  1. Spectrum of Atypical Clinical Presentations in Patients with Biallelic PRF1 Missense Mutations.

    PubMed

    Tesi, Bianca; Chiang, Samuel C C; El-Ghoneimy, Dalia; Hussein, Ayad Ahmed; Langenskiöld, Cecilia; Wali, Rabia; Fadoo, Zehra; Silva, João Pinho; Lecumberri, Ramón; Unal, Sule; Nordenskjöld, Magnus; Bryceson, Yenan T; Henter, Jan-Inge; Meeths, Marie

    2015-12-01

    Perforin, encoded by PRF1, is a pore-forming protein crucial for lymphocyte cytotoxicity. Biallelic PRF1 nonsense mutations invariably result in early-onset hemophagocytic lymphohistiocytosis (HLH), termed familial HLH type 2 (FHL2). In contrast, biallelic PRF1 missense mutations may give rise to later-onset disease and more variable manifestations. We retrospectively searched our database for patients from families with siblings carrying biallelic PRF1 missense mutations where at least one sibling did not develop HLH, and for patients with biallelic PRF1 missense mutations and an atypical presentation of disease. We reviewed their clinical, genetic, and immunological characteristics. In all, we identified 10 such patients, including three sibling pairs with discordant manifestations. Interestingly, in two families, siblings of late-onset HLH patients developed Hodgkin lymphoma but no HLH. In a third family, one sibling presented with recurrent HLH episodes, whereas the other remains healthy. Of note, the affected sibling also suffered from systemic lupus erythematosus. Additional unrelated patients with biallelic PRF1 missense mutations were affected by neurological disease without classical signs of HLH, gastrointestinal inflammation as initial presentation of disease, as well as a hematological malignancy. Compared to early-onset FHL2 patients, the patients with an atypical presentation displayed a partial recovery of NK cell cytotoxicity upon IL-2 stimulation in vitro. Our findings substantiate and expand the spectrum of clinical presentations of perforin deficiency, linking PRF1 missense mutations to lymphoma susceptibility and highlighting clinical variability within families. PRF1 mutations should, therefore, be considered as a cause of several diseases disparate to HLH. © 2015 Wiley Periodicals, Inc.

  2. Dominant missense mutations in a novel yeast protein related to mammalian phosphatidylinositol 3-kinase and VPS34 abrogate rapamycin cytotoxicity.

    PubMed Central

    Cafferkey, R; Young, P R; McLaughlin, M M; Bergsma, D J; Koltin, Y; Sathe, G M; Faucette, L; Eng, W K; Johnson, R K; Livi, G P

    1993-01-01

    Rapamycin is a macrolide antifungal agent that exhibits potent immunosuppressive properties. In Saccharomyces cerevisiae, rapamycin sensitivity is mediated by a specific cytoplasmic receptor which is a homolog of human FKBP12 (hFKBP12). Deletion of the gene for yeast FKBP12 (RBP1) results in recessive drug resistance, and expression of hFKBP12 restores rapamycin sensitivity. These data support the idea that FKBP12 and rapamycin form a toxic complex that corrupts the function of other cellular proteins. To identify such proteins, we isolated dominant rapamycin-resistant mutants both in wild-type haploid and diploid cells and in haploid rbp1::URA3 cells engineered to express hFKBP12. Genetic analysis indicated that the dominant mutations are nonallelic to mutations in RBP1 and define two genes, designated DRR1 and DRR2 (for dominant rapamycin resistance). Mutant copies of DRR1 and DRR2 were cloned from genomic YCp50 libraries by their ability to confer drug resistance in wild-type cells. DNA sequence analysis of a mutant drr1 allele revealed a long open reading frame predicting a novel 2470-amino-acid protein with several motifs suggesting an involvement in intracellular signal transduction, including a leucine zipper near the N terminus, two putative DNA-binding sequences, and a domain that exhibits significant sequence similarity to the 110-kDa catalytic subunit of both yeast (VPS34) and bovine phosphatidylinositol 3-kinases. Genomic disruption of DRR1 in a mutant haploid strain restored drug sensitivity and demonstrated that the gene encodes a nonessential function. DNA sequence comparison of seven independent drr1dom alleles identified single base pair substitutions in the same codon within the phosphatidylinositol 3-kinase domain, resulting in a change of Ser-1972 to Arg or Asn. We conclude either that DRR1 (alone or in combination with DRR2) acts as a target of FKBP12-rapamycin complexes or that a missense mutation in DRR1 allows it to compensate for the

  3. A threonine to isoleucine missense mutation in the pericentriolar material 1 gene is strongly associated with schizophrenia.

    PubMed

    Datta, S R; McQuillin, A; Rizig, M; Blaveri, E; Thirumalai, S; Kalsi, G; Lawrence, J; Bass, N J; Puri, V; Choudhury, K; Pimm, J; Crombie, C; Fraser, G; Walker, N; Curtis, D; Zvelebil, M; Pereira, A; Kandaswamy, R; St Clair, D; Gurling, H M D

    2010-06-01

    Markers at the pericentriolar material 1 gene (PCM1) have shown genetic association with schizophrenia in both a University College London (UCL) and a USA-based case-control sample. In this paper we report a statistically significant replication of the PCM1 association in a large Scottish case-control sample from Aberdeen. Resequencing of the genomic DNA from research volunteers who had inherited haplotypes associated with schizophrenia showed a threonine to isoleucine missense mutation in exon 24 which was likely to change the structure and function of PCM1 (rs370429). This mutation was found only as a heterozygote in 98 schizophrenic research subjects and controls out of 2246 case and control research subjects. Among the 98 carriers of rs370429, 67 were affected with schizophrenia. The same alleles and haplotypes were associated with schizophrenia in both the London and Aberdeen samples. Another potential aetiological base pair change in PCM1 was rs445422, which altered a splice site signal. A further mutation, rs208747, was shown by electrophoretic mobility shift assays to create or destroy a promoter transcription factor site. Five further non-synonymous changes in exons were also found. Genotyping of the new variants discovered in the UCL case-control sample strengthened the evidence for allelic and haplotypic association (P=0.02-0.0002). Given the number and identity of the haplotypes associated with schizophrenia, further aetiological base pair changes must exist within and around the PCM1 gene. PCM1 protein has been shown to interact directly with the disrupted-in-schizophrenia 1 (DISC1) protein, Bardet-Biedl syndrome 4, and Huntingtin-associated protein 1, and is important in neuronal cell growth. In a separate study we found that clozapine but not haloperidol downregulated PCM1 expression in the mouse brain. We hypothesize that mutant PCM1 may be responsible for causing a subtype of schizophrenia through abnormal cell division and abnormal regeneration in

  4. Cord blood banks collect units with different HLA alleles and haplotypes to volunteer donor banks: a comparative report from Swiss Blood stem cells.

    PubMed

    Meyer-Monard, S; Passweg, J; Troeger, C; Eberhard, H-P; Roosnek, E; de Faveri, G Nicoloso; Chalandon, Y; Rovo, A; Kindler, V; Irion, O; Holzgreve, W; Gratwohl, A; Müller, C; Tichelli, A; Tiercy, J-M

    2009-05-01

    Allogeneic haematopoietic SCT is a standard therapy for many patients with haematological diseases. A major aim of public umbilical cord blood (UCB) banking is to establish an inventory with a large HLA diversity. Few studies have compared HLA diversity between UCB banks and volunteer unrelated donor (VUD) registries and examined whether UCB banks indeed collect more units with rare alleles and haplotypes. This study compares HLA-A/B/DRB1 allele frequencies and inferred A/B/DRB1-haplotypes in 1602 UCB units and 3093 VUD from two centres in distinct recruitment areas in Switzerland. The results show that the frequencies of HLA-DRB1 alleles as well as of the HLA-A/B/DRB1 haplotypes differ between UCB and VUD. Ten DRB1 alleles occurred at a 2- to 12-fold higher relative frequency in UCB than in VUD and 27 rare alleles were identified in UCB. Out of these 27 alleles, 15 were absent in the entire VUD data set of the national registry. This difference in allele frequencies was found only by intermediate/high-resolution typing. Targeted recruitment of UCB units from non-Caucasian donors could further increase HLA allele and haplotype diversity of available donors. Intermediate or high-resolution DNA typing is essential to identify rare alleles or allele groups.

  5. Frequency of HLA-A alleles in the Syrian population genotyped by sequence-based typing.

    PubMed

    Madania, A; Ghoury, I; Al-Ashkar, W; Nweder, S; Zarzour, H

    2014-10-01

    HLA-A molecules are highly polymorphic. Their accurate typing at a high-resolution level is crucial for successful organ, bone marrow and cord blood transplantation. Furthermore, several HLA alleles have been involved in susceptibility to autoimmune diseases, allergies, cancers and inflammations. In order to determine common HLA-A alleles in Syria and their frequencies, sequence-based typing (SBT) was used to genotype HLA-A alleles at high resolution (four digit level) among one hundred and thirty randomly selected Syrian individuals. Exons 2, 3 and 4 of the HLA-A gene were amplified by PCR and sequenced. The sbt-engine software was used for allele assignment. Ambiguities were solved using group-specific sequencing primers (GSSPs). We could identify 32 different HLA-A alleles which were divided into 3 groups: high frequency (approximately 10%, A*01:01; A*24:02; A*03:01; A*02:01), moderate frequency (approximately 3%, such as A*02:05, A*31:01 and A*33:01), and low frequency (approximately 1%, such as A*02:11, A*29:01, A*02:02 and A*36:01). Homozygosity rate was higher than expected (11.5% vs. 7.15%). For high frequency alleles, our results show similarity to neighbouring countries. However, 15 alleles (such as A*02:04, A*02:06, A*02:11 and A*02:17) found in our cohort in low frequencies were never reported in some or all neighbouring countries. This is the first report on HLA-A allele frequencies in Syria. In spite of the relatively low number of tested subjects, our results revealed a high degree of diversity, with 32 different alleles, reflecting the high ethnic heterogeneity of the Syrian population. The identification of alleles rarely or never reported in neighbouring countries indicates a higher genetic diversity in Syria.

  6. Alleles of the homologous recombination gene, RAD59, identify multiple responses to disrupted DNA replication in Saccharomyces cerevisiae.

    PubMed

    Liddell, Lauren C; Manthey, Glenn M; Owens, Shannon N; Fu, Becky X H; Bailis, Adam M

    2013-10-14

    In Saccharomyces cerevisiae, Rad59 is required for multiple homologous recombination mechanisms and viability in DNA replication-defective rad27 mutant cells. Recently, four rad59 missense alleles were found to have distinct effects on homologous recombination that are consistent with separation-of-function mutations. The rad59-K166A allele alters an amino acid in a conserved α-helical domain, and, like the rad59 null allele diminishes association of Rad52 with double-strand breaks. The rad59-K174A and rad59-F180A alleles alter amino acids in the same domain and have genetically similar effects on homologous recombination. The rad59-Y92A allele alters a conserved amino acid in a separate domain, has genetically distinct effects on homologous recombination, and does not diminish association of Rad52 with double-strand breaks. In this study, rad59 mutant strains were crossed with a rad27 null mutant to examine the effects of the rad59 alleles on the link between viability, growth and the stimulation of homologous recombination in replication-defective cells. Like the rad59 null allele, rad59-K166A was synthetically lethal in combination with rad27. The rad59-K174A and rad59-F180A alleles were not synthetically lethal in combination with rad27, had effects on growth that coincided with decreased ectopic gene conversion, but did not affect mutation, unequal sister-chromatid recombination, or loss of heterozygosity. The rad59-Y92A allele was not synthetically lethal when combined with rad27, stimulated ectopic gene conversion and heteroallelic recombination independently from rad27, and was mutually epistatic with srs2. Unlike rad27, the stimulatory effect of rad59-Y92A on homologous recombination was not accompanied by effects on growth rate, cell cycle distribution, mutation, unequal sister-chromatid recombination, or loss of heterozygosity. The synthetic lethality conferred by rad59 null and rad59-K166A alleles correlates with their inhibitory effect on association

  7. Identification and DNA sequence analysis of 15 new {alpha}{sub 1}-antitrypsin variants, including two PI*QO alleles and one deficient PI*M allele

    SciTech Connect

    Faber, J.P.; Kirchgesser, M.; Schwaab, R.; Bidlingmaier, F.; Poller, W.; Weidinger, S.; Olek, K. |

    1994-12-01

    The authors have investigated the molecular basis of 15 new {alpha}{sub 1}-antitrypsin ({alpha}1AT) variants. Phenotyping by isoelectric focusing (IEF) was used as a screening method to detect {alpha}1AT variants at the protein level. Genotyping was then performed by sequence analysis of all coding exons, exon-intron junctions, and the hepatocyte-specific promotor region including exon Ic. Three of these rare variants are alleles of clinical relevance, associated with undetectable or very low serum levels of {alpha}1AT: the PI*Q0saarbruecken allele generated by a 1-bp C-nucleotide insertion within a stretch of seven cytosines spanning residues 360-362, resulting in a 3{prime} frameshift and the acquisition of a stop codon at residue 376; a point mutation in the PI*Q0lisbon allele, resulting in a single amino acid substitution Thr{sup 68}(ACC){yields}Ile(ATC); and an in-frame trinucleotide deletion {Delta}Phe{sup 51} (TTC) in the highly deficient PI*Mpalermo allele. The remaining 12 alleles are associated with normal {alpha}1AT serum levels and are characterized by point mutations causing single amino acid substitutions in all but one case. This exception is a silent mutation, which does not affect the amino acid sequence. The limitation of IEF compared with DNA sequence analysis, for identification of new variants, their generation by mutagenesis, and the clinical relevance of the three deficiency alleles are discussed.

  8. A novel measurement of allele discrimination for assessment of allele-specific silencing by RNA interference.

    PubMed

    Takahashi, Masaki; Hohjoh, Hirohiko

    2014-11-01

    Allele-specific silencing by RNA interference (ASP-RNAi) is an atypical RNAi that is capable of discriminating target alleles from non-target alleles, and may be therapeutically useful for specific inhibition of disease-causing alleles without affecting their corresponding normal alleles. However, it is difficult to design and select small interfering RNA (siRNAs) that confer ASP-RNAi. A major problem is that there are few appropriate measures in determining optimal allele-specific siRNAs. Here we show two novel formulas for calculating a new measure of allele-discrimination, named "ASP-score". The formulas and ASP-score allow for an unbiased determination of optimal siRNAs, and may contribute to characterizing such allele-specific siRNAs.

  9. In-Frame Deletion and Missense Mutations of the C-Terminal Helicase Domain of SMARCA2 in Three Patients with Nicolaides-Baraitser Syndrome

    PubMed Central

    Wolff, D.; Endele, S.; Azzarello-Burri, S.; Hoyer, J.; Zweier, M.; Schanze, I.; Schmitt, B.; Rauch, A.; Reis, A.; Zweier, C.

    2012-01-01

    Using high-resolution molecular karyotyping with SNP arrays to identify candidate genes for etiologically unexplained intellectual disability, we identified a 32-kb de novo in-frame deletion of the C-terminal helicase domain of the SMARCA2 gene in a patient with severe intellectual disability, epilepsy, sparse hair, prominent joints, and distinct facial anomalies. Sequencing of the gene in patients with a similar phenotype revealed de novo missense mutations in this domain in 2 further patients, pointing to a crucial role of the SMARCA2 C-terminal helicase domain. The clinical features observed in all 3 patients are typical of Nicolaides-Baraitser syndrome, an only rarely reported syndrome with mainly moderate to severe intellectual disability. Notably, one of our patients with a p.Gly1132Asp mutation showed typical morphological features but an exceptional good development with borderline overall IQ and learning difficulties, thus expanding the phenotypic spectrum of Nicolaides-Baraitser syndrome. PMID:22822383

  10. JK null alleles identified from Japanese individuals with Jk(a−b−) phenotype.

    PubMed

    Onodera, T; Sasaki, K; Tsuneyama, H; Isa, K; Ogasawara, K; Satake, M; Tadokoro, K; Uchikawa, M

    2014-05-01

    The Kidd blood group system consists of three common phenotypes: Jk(a+b−), Jk(a−b+) and Jk(a+b+), and one rare phenotype, Jk(a−b−). Jka/Jkb polymorphism is associated with c.838G>A (p.Asp280Asn) in exon 9 of the JK (SLC14A1) gene, and the corresponding alleles are named JK*01 and JK*02. The rare phenotype Jk(a−b−) was first found in a Filipina of Spanish and Chinese ancestry, and to date, several JK null alleles responsible for the Jk(a−b−) phenotype have been reported. We report seven novel JK null alleles, 4 with a JK*01 background and 3 with a JK*02 background, identified from Jk(a−b−) Japanese.

  11. Genetic structure, diversity, and allelic richness in composite collection and reference set in chickpea (Cicer arietinum L.)

    PubMed Central

    Upadhyaya, Hari D; Dwivedi, Sangam L; Baum, Michael; Varshney, Rajeev K; Udupa, Sripada M; Gowda, Cholenahalli LL; Hoisington, David; Singh, Sube

    2008-01-01

    Background Plant genetic resources (PGR) are the basic raw materials for future genetic progress and an insurance against unforeseen threats to agricultural production. An extensive characterization of PGR provides an opportunity to dissect structure, mine allelic variations, and identify diverse accessions for crop improvement. The Generation Challenge Program conceptualized the development of "composite collections" and extraction of "reference sets" from these for more efficient tapping of global crop-related genetic resources. In this study, we report the genetic structure, diversity and allelic richness in a composite collection of chickpea using SSR markers, and formation of a reference set of 300 accessions. Results The 48 SSR markers detected 1683 alleles in 2915 accessions, of which, 935 were considered rare, 720 common and 28 most frequent. The alleles per locus ranged from 14 to 67, averaged 35, and the polymorphic information content was from 0.467 to 0.974, averaged 0.854. Marker polymorphism varied between groups of accessions in the composite collection and reference set. A number of group-specific alleles were detected: 104 in Kabuli, 297 in desi, and 69 in wild Cicer; 114 each in Mediterranean and West Asia (WA), 117 in South and South East Asia (SSEA), and 10 in African region accessions. Desi and kabuli shared 436 alleles, while wild Cicer shared 17 and 16 alleles with desi and kabuli, respectively. The accessions from SSEA and WA shared 74 alleles, while those from Mediterranean 38 and 33 alleles with WA and SSEA, respectively. Desi chickpea contained a higher proportion of rare alleles (53%) than kabuli (46%), while wild Cicer accessions were devoid of rare alleles. A genotype-based reference set captured 1315 (78%) of the 1683 composite collection alleles of which 463 were rare, 826 common, and 26 the most frequent alleles. The neighbour-joining tree diagram of this reference set represents diversity from all directions of the tree diagram of

  12. Genetic structure, diversity, and allelic richness in composite collection and reference set in chickpea (Cicer arietinum L.).

    PubMed

    Upadhyaya, Hari D; Dwivedi, Sangam L; Baum, Michael; Varshney, Rajeev K; Udupa, Sripada M; Gowda, Cholenahalli L L; Hoisington, David; Singh, Sube

    2008-10-16

    Plant genetic resources (PGR) are the basic raw materials for future genetic progress and an insurance against unforeseen threats to agricultural production. An extensive characterization of PGR provides an opportunity to dissect structure, mine allelic variations, and identify diverse accessions for crop improvement. The Generation Challenge Program http://www.generationcp.org conceptualized the development of "composite collections" and extraction of "reference sets" from these for more efficient tapping of global crop-related genetic resources. In this study, we report the genetic structure, diversity and allelic richness in a composite collection of chickpea using SSR markers, and formation of a reference set of 300 accessions. The 48 SSR markers detected 1683 alleles in 2915 accessions, of which, 935 were considered rare, 720 common and 28 most frequent. The alleles per locus ranged from 14 to 67, averaged 35, and the polymorphic information content was from 0.467 to 0.974, averaged 0.854. Marker polymorphism varied between groups of accessions in the composite collection and reference set. A number of group-specific alleles were detected: 104 in Kabuli, 297 in desi, and 69 in wild Cicer; 114 each in Mediterranean and West Asia (WA), 117 in South and South East Asia (SSEA), and 10 in African region accessions. Desi and kabuli shared 436 alleles, while wild Cicer shared 17 and 16 alleles with desi and kabuli, respectively. The accessions from SSEA and WA shared 74 alleles, while those from Mediterranean 38 and 33 alleles with WA and SSEA, respectively. Desi chickpea contained a higher proportion of rare alleles (53%) than kabuli (46%), while wild Cicer accessions were devoid of rare alleles. A genotype-based reference set captured 1315 (78%) of the 1683 composite collection alleles of which 463 were rare, 826 common, and 26 the most frequent alleles. The neighbour-joining tree diagram of this reference set represents diversity from all directions of the tree

  13. Forensic animal DNA typing: Allele nomenclature and standardization of 14 feline STR markers.

    PubMed

    Schury, N; Schleenbecker, U; Hellmann, A P

    2014-09-01

    Since the domestic cat (Felis catus) has become one of the most popular pets and owners usually develop a close relationship to their cats, it is necessary to take traces of cats into account for forensic casework. For this purpose feline short tandem (STR) repeat markers have been investigated in several earlier studies, but no detailed description of sequence data, allelic variations or a repeat-based nomenclature is available. The aim of the study was to provide a suggestion for the allele nomenclature of 14 cat STR markers according to the recommendations of the International Society for Forensic Genetics (ISFG) for human DNA typing and to present a standardized system for a secure DNA typing of samples. Samples of 122 unrelated cats from a local animal shelter and private owners in Germany were used to generate a population database with allele frequencies and to analyze the tandemly repeated sequence variations within the alleles of each STR marker. These markers could be grouped into two STR classes: simple repeat STRs and complex STRs (some with the supplement highly complex), consisting of di- and tetranucleotide repeat motifs. After analyzing the repeat structure and elaborating a repeat based nomenclature, allelic ladders of common and rarely occurring alleles for each marker were designed to enable accurate typing of alleles that differ in fragment length and to facilitate data exchange.

  14. Molecular characterization of the new defective P(brescia) alpha1-antitrypsin allele.

    PubMed

    Medicina, Daniela; Montani, Nadia; Fra, Anna M; Tiberio, Laura; Corda, Luciano; Miranda, Elena; Pezzini, Alessandro; Bonetti, Fausta; Ingrassia, Rosaria; Scabini, Roberta; Facchetti, Fabio; Schiaffonati, Luisa

    2009-08-01

    Alpha1-antitrypsin (alpha(1)AT) deficiency is a hereditary disorder associated with reduced alpha(1)AT serum level, predisposing adults to pulmonary emphysema. Among the known mutations of the alpha(1)AT gene (SERPINA1) causing alpha(1)AT deficiency, a few alleles, particularly the Z allele, may also predispose adults to liver disease. We have characterized a new defective alpha(1)AT allele (c.745G>C) coding for a mutant alpha(1)AT (Gly225Arg), named P(brescia). The P(brescia) alpha(1)AT allele was first identified in combination with the rare defective M(würzburg) allele in an 11-year-old boy showing significantly reduced serum alpha(1)AT level. Subsequently, the P(brescia) allele was found in the heterozygous state with the normal M or the defective Z allele in nine and three adults respectively. In cellular models of the disease, we show that the P(brescia) mutant is retained in the endoplasmic reticulum as ordered polymers and is secreted more slowly than the normal M alpha(1)AT. This behaviour recapitulates the abnormal cellular handling and fate of the Z alpha(1)AT and suggests that the mutation present in the P(brescia) alpha(1)AT causes a conformational change of the protein which, by favouring polymer formation, is etiologic to both severe alpha(1)AT deficiency in the plasma and toxic protein-overload in the liver.

  15. A uniform survey of allele-specific binding and expression over 1000-Genomes-Project individuals

    PubMed Central

    Chen, Jieming; Rozowsky, Joel; Galeev, Timur R.; Harmanci, Arif; Kitchen, Robert; Bedford, Jason; Abyzov, Alexej; Kong, Yong; Regan, Lynne; Gerstein, Mark

    2016-01-01

    Large-scale sequencing in the 1000 Genomes Project has revealed multitudes of single nucleotide variants (SNVs). Here, we provide insights into the functional effect of these variants using allele-specific behaviour. This can be assessed for an individual by mapping ChIP-seq and RNA-seq reads to a personal genome, and then measuring ‘allelic imbalances' between the numbers of reads mapped to the paternal and maternal chromosomes. We annotate variants associated with allele-specific binding and expression in 382 individuals by uniformly processing 1,263 functional genomics data sets, developing approaches to reduce the heterogeneity between data sets due to overdispersion and mapping bias. Since many allelic variants are rare, aggregation across multiple individuals is necessary to identify broadly applicable ‘allelic elements'. We also found SNVs for which we can anticipate allelic imbalance from the disruption of a binding motif. Our results serve as an allele-specific annotation for the 1000 Genomes variant catalogue and are distributed as an online resource (alleledb.gersteinlab.org). PMID:27089393

  16. Uncommon HLA alleles identified by hemizygous ultra-high Sanger sequencing: haplotype associations and reconsideration of their assignment in the Common and Well-Documented catalogue.

    PubMed

    Voorter, Christina E M; Groeneweg, Mathijs; Groeneveld, Lisette; Tilanus, Marcel G J

    2016-02-01

    Although the number of HLA alleles still increases, many of them have been reported being uncommon. This is partly due to lack of full length gene sequencing, especially for those alleles belonging to an allele ambiguity in which the first discovered allele has been assigned as the most frequent one. As members of the working group on Common and Well Documented (CWD) alleles and since we implemented full length group-specific sequencing as standard method routinely, we have investigated the presence of presumably rare alleles in our collection of HLA typing data. We identified 50 alleles, that were not previously encountered as Common or Well Documented. Sixteen of them should be added to the CWD catalogue, since we encountered them in 5 or more unrelated individuals. Another 11 could be added, based upon our results and the data present in the IMGT database and the rare allele section of the allele frequencies database. Furthermore, tight associations were observed between several different alleles even at the level of synonymous and non-coding sequences. In addition, in several cases the uncommon allele was found to be more frequent than its common counterpart.

  17. HLA-DRB1 and -DRB3 allele frequencies and haplotypic associations in Koreans.

    PubMed

    Song, Eun Young; Park, Hyejin; Roh, Eun Youn; Park, Myoung Hee

    2004-03-01

    We have investigated the frequencies of human leukocyte antigen-DRB1 (HLA-DRB1) and -DRB3 alleles and DRB1-DRB3 haplotypic associations in 800 Koreans. DRB1 genotyping was done using polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) and PCR-single strand conformation polymorphism (SSCP) methods. DRB3 genotyping was done on 447 samples carrying DRB3-associated DRB1 alleles (DRB1*03, *11, *12, *13, and *14) using PCR-SSCP method. The allele frequencies of DRB3*0101, DRB3*0202, and DRB3*0301 were 0.073, 0.136, and 0.120, respectively, and we found one case of a probable new allele (DRB3*01new, 0.001). DRB1-DRB3 haplotypes with frequency (HF) > 0.005 exhibited strong associations between DRB3*0101 and DRB1*1201, *1301, and *1403; between DRB3*0301 and DRB1*1202 and *1302; between DRB3*0202 and DRB1*0301, *1101, *1401, *1405, and *1406 alleles. Most of the DRB1 alleles with frequency > 0.005 were exclusively associated with particular DRB3 alleles with relative linkage disequilibrium values of 1.0, except for DRB1*1201, *1202 and *1301; the rare presence (HF < 0.005) of DRB3*0202 associations were observed for these DRB1 alleles. We also investigated and presented rare DRB1-DRB3 associations in additional 6000 Koreans. Comparison with other ethnic groups revealed that DRB1*0301 and *1301 related DRB1-DRB3 haplotypes vary among different populations, in that Koreans and other Asian populations show less diversity compared with Caucasoids or African Americans.

  18. Allelic selection of human IL-2 gene.

    PubMed

    Matesanz, F; Delgado, C; Fresno, M; Alcina, A

    2000-12-01

    The allelic expression of mouse IL-2 cannot be definitely extrapolated to what might happen in humans. Therefore, we investigated the regulation of allelic expression of the IL-2 gene in non-genetically manipulated human T lymphocytes by following natural allelic polymorphisms. We found a phenotypically silent punctual change in the human IL-2 at position 114 after the first nucleotide of the initiation codon, which represents a dimorphic polymorphism at the first exon of the IL-2 gene. This allowed the study by single-cell PCR of the regulation of the human IL-2 allelic expression in heterozygous CD4(+) T cells, which was found to be tightly controlled monoallelically. These findings may be used as a suitable marker for monitoring the IL-2 allelic contribution to effector activities and in immune responses against different infections or in pathological situations.

  19. Hypermethylated SUPERMAN epigenetic alleles in arabidopsis.

    PubMed

    Jacobsen, S E; Meyerowitz, E M

    1997-08-22

    Mutations in the SUPERMAN gene affect flower development in Arabidopsis. Seven heritable but unstable sup epi-alleles (the clark kent alleles) are associated with nearly identical patterns of excess cytosine methylation within the SUP gene and a decreased level of SUP RNA. Revertants of these alleles are largely demethylated at the SUP locus and have restored levels of SUP RNA. A transgenic Arabidopsis line carrying an antisense methyltransferase gene, which shows an overall decrease in genomic cytosine methylation, also contains a hypermethylated sup allele. Thus, disruption of methylation systems may yield more complex outcomes than expected and can result in methylation defects at known genes. The clark kent alleles differ from the antisense line because they do not show a general decrease in genomic methylation.

  20. CNVs: Harbinger of a Rare Variant Revolution in Psychiatric Genetics

    PubMed Central

    Malhotra, Dheeraj; Sebat, Jonathan

    2012-01-01

    The genetic bases of neuropsychiatric disorders are beginning to yield to scientific inquiry. Genome-wide studies of copy number variation (CNV) have given rise to a new understanding of disease etiology, bringing rare variants to the forefront. A proportion of risk for schizophrenia, bipolar disorder and Autism can be explained by rare mutations. Such alleles arise by de novo mutation in the individual or in recent ancestry. Alleles can have specific effects on behavioral and neuroanatomical traits; however expressivity is variable, particularly for neuropsychiatric phenotypes. Knowledge from CNV studies reflects the nature of rare alleles in general and will serve as a guide as we move forward into a new era of whole genome sequencing. PMID:22424231

  1. Structure-function analyses of microsomal triglyceride transfer protein missense mutations in abetalipoproteinemia and hypobetalipoproteinemia subjects.

    PubMed

    Walsh, Meghan T; Di Leo, Enza; Okur, Ilyas; Tarugi, Patrizia; Hussain, M Mahmood

    2016-11-01

    We describe two new hypolipidemic patients with very low plasma triglyceride and apolipoprotein B (apoB) levels with plasma lipid profiles similar to abetalipoproteinemia (ABL) patients. In these patients, we identified two previously uncharacterized missense mutations in the microsomal triglyceride transfer protein (MTP) gene, R46G and D361Y, and studied their functional effects. We also characterized three missense mutations (H297Q, D384A, and G661A) reported earlier in a familial hypobetalipoproteinemia patient. R46G had no effect on MTP expression or function and supported apoB secretion. H297Q, D384A, and G661A mutants also supported apoB secretion similarly to WT MTP. Contrary to these four missense mutations, D361Y was unable to support apoB secretion. Functional analysis revealed that this mutant was unable to bind protein disulfide isomerase (PDI) or transfer lipids. The negative charge at residue 361 was critical for MTP function as D361E was able to support apoB secretion and transfer lipids. D361Y most likely disrupts the tightly packed middle α-helical region of MTP, mitigates PDI binding, abolishes lipid transfer activity, and causes ABL. On the other hand, the hypolipidemia in the other two patients was not due to MTP dysfunction. Thus, in this study of five missense mutations spread throughout MTP's three structural domains found in three hypolipidemic patients, we found that four of the mutations did not affect MTP function. Thus, novel mutations that cause severe hypolipidemia probably exist in other genes in these patients, and their recognition may identify novel proteins involved in the synthesis and/or catabolism of plasma lipoproteins.

  2. Neuroferritinopathy: Missense mutation in FTL causing early-onset bilateral pallidal involvement

    PubMed Central

    Maciel, P.; Cruz, V.T.; Constante, M.; Iniesta, I.; Costa, M.C.; Gallati, S.; Sousa, N.; Sequeiros, J.; Coutinho, P.; Santos, M.M.

    2010-01-01

    The authors identified a missense mutation in the FTL gene (474G>A; A96T) in a 19-year-old man with parkinsonism, ataxia, corticospinal signs, mild nonprogressive cognitive deficit, and episodic psychosis. This mutation was also present in his asymptomatic mother and younger brother, who had abnormally low levels of ferritin in the serum. The patient and his mother displayed bilateral involvement of the pallidum. PMID:16116125

  3. Gene Coexpression Analyses Differentiate Networks Associated with Diverse Cancers Harboring TP53 Missense or Null Mutations

    PubMed Central

    Oros Klein, Kathleen; Oualkacha, Karim; Lafond, Marie-Hélène; Bhatnagar, Sahir; Tonin, Patricia N.; Greenwood, Celia M. T.

    2016-01-01

    In a variety of solid cancers, missense mutations in the well-established TP53 tumor suppressor gene may lead to the presence of a partially-functioning protein molecule, whereas mutations affecting the protein encoding reading frame, often referred to as null mutations, result in the absence of p53 protein. Both types of mutations have been observed in the same cancer type. As the resulting tumor biology may be quite different between these two groups, we used RNA-sequencing data from The Cancer Genome Atlas (TCGA) from four different cancers with poor prognosis, namely ovarian, breast, lung and skin cancers, to compare the patterns of coexpression of genes in tumors grouped according to their TP53 missense or null mutation status. We used Weighted Gene Coexpression Network analysis (WGCNA) and a new test statistic built on differences between groups in the measures of gene connectivity. For each cancer, our analysis identified a set of genes showing differential coexpression patterns between the TP53 missense- and null mutation-carrying groups that was robust to the choice of the tuning parameter in WGCNA. After comparing these sets of genes across the four cancers, one gene (KIR3DL2) consistently showed differential coexpression patterns between the null and missense groups. KIR3DL2 is known to play an important role in regulating the immune response, which is consistent with our observation that this gene's strongly-correlated partners implicated many immune-related pathways. Examining mutation-type-related changes in correlations between sets of genes may provide new insight into tumor biology. PMID:27536319

  4. Novel genes involved in severe early-onset obesity revealed by rare copy number and sequence variants

    PubMed Central

    Flores, Raquel; González, Juan R.; Argente, Jesús; Pérez-Jurado, Luis A.

    2017-01-01

    Obesity is a multifactorial disorder with high heritability (50–75%), which is probably higher in early-onset and severe cases. Although rare monogenic forms and several genes and regions of susceptibility, including copy number variants (CNVs), have been described, the genetic causes underlying the disease still remain largely unknown. We searched for rare CNVs (>100kb in size, altering genes and present in <1/2000 population controls) in 157 Spanish children with non-syndromic early-onset obesity (EOO: body mass index >3 standard deviations above the mean at <3 years of age) using SNP array molecular karyotypes. We then performed case control studies (480 EOO cases/480 non-obese controls) with the validated CNVs and rare sequence variants (RSVs) detected by targeted resequencing of selected CNV genes (n = 14), and also studied the inheritance patterns in available first-degree relatives. A higher burden of gain-type CNVs was detected in EOO cases versus controls (OR = 1.71, p-value = 0.0358). In addition to a gain of the NPY gene in a familial case with EOO and attention deficit hyperactivity disorder, likely pathogenic CNVs included gains of glutamate receptors (GRIK1, GRM7) and the X-linked gastrin-peptide receptor (GRPR), all inherited from obese parents. Putatively functional RSVs absent in controls were also identified in EOO cases at NPY, GRIK1 and GRPR. A patient with a heterozygous deletion disrupting two contiguous and related genes, SLCO4C1 and SLCO6A1, also had a missense RSV at SLCO4C1 on the other allele, suggestive of a recessive model. The genes identified showed a clear enrichment of shared co-expression partners with known genes strongly related to obesity, reinforcing their role in the pathophysiology of the disease. Our data reveal a higher burden of rare CNVs and RSVs in several related genes in patients with EOO compared to controls, and implicate NPY, GRPR, two glutamate receptors and SLCO4C1 in highly penetrant forms of familial obesity

  5. Novel genes involved in severe early-onset obesity revealed by rare copy number and sequence variants.

    PubMed

    Serra-Juhé, Clara; Martos-Moreno, Gabriel Á; Bou de Pieri, Francesc; Flores, Raquel; González, Juan R; Rodríguez-Santiago, Benjamín; Argente, Jesús; Pérez-Jurado, Luis A

    2017-05-01

    Obesity is a multifactorial disorder with high heritability (50-75%), which is probably higher in early-onset and severe cases. Although rare monogenic forms and several genes and regions of susceptibility, including copy number variants (CNVs), have been described, the genetic causes underlying the disease still remain largely unknown. We searched for rare CNVs (>100kb in size, altering genes and present in <1/2000 population controls) in 157 Spanish children with non-syndromic early-onset obesity (EOO: body mass index >3 standard deviations above the mean at <3 years of age) using SNP array molecular karyotypes. We then performed case control studies (480 EOO cases/480 non-obese controls) with the validated CNVs and rare sequence variants (RSVs) detected by targeted resequencing of selected CNV genes (n = 14), and also studied the inheritance patterns in available first-degree relatives. A higher burden of gain-type CNVs was detected in EOO cases versus controls (OR = 1.71, p-value = 0.0358). In addition to a gain of the NPY gene in a familial case with EOO and attention deficit hyperactivity disorder, likely pathogenic CNVs included gains of glutamate receptors (GRIK1, GRM7) and the X-linked gastrin-peptide receptor (GRPR), all inherited from obese parents. Putatively functional RSVs absent in controls were also identified in EOO cases at NPY, GRIK1 and GRPR. A patient with a heterozygous deletion disrupting two contiguous and related genes, SLCO4C1 and SLCO6A1, also had a missense RSV at SLCO4C1 on the other allele, suggestive of a recessive model. The genes identified showed a clear enrichment of shared co-expression partners with known genes strongly related to obesity, reinforcing their role in the pathophysiology of the disease. Our data reveal a higher burden of rare CNVs and RSVs in several related genes in patients with EOO compared to controls, and implicate NPY, GRPR, two glutamate receptors and SLCO4C1 in highly penetrant forms of familial obesity.

  6. Allele frequency of hereditary equine regional dermal asthenia in American Quarter horses in Brazil determined by quantitative real-time PCR with high resolution melting analysis.

    PubMed

    Badial, Peres R; Oliveira-Filho, José P; Winand, Nena J; Borges, Alexandre S

    2014-02-01

    Hereditary equine regional dermal asthenia (HERDA) is a genetic disorder that occurs in the American Quarter horse (AQH) and is caused by a c.115G>A missense mutation in the peptidylprolyl isomerase B (PPIB) gene. Using a quantitative real-time PCR high resolution melting analysis genotyping assay for the PPIB mutation, the estimated HERDA allele and carrier frequencies in a sample of Brazilian AQHs were 2.9% and 5.8%, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. A majority of Huntington's disease patients may be treatable by individualized allele-specific RNA interference.

    PubMed

    Lombardi, Maria Stella; Jaspers, Leonie; Spronkmans, Christine; Gellera, Cinzia; Taroni, Franco; Di Maria, Emilio; Donato, Stefano Di; Kaemmerer, William F

    2009-06-01

    Use of RNA interference to reduce huntingtin protein (htt) expression in affected brain regions may provide an effective treatment for Huntington disease (HD), but it remains uncertain whether suppression of both wild-type and mutant alleles in a heterozygous patient will provide more benefit than harm. Previous research has shown suppression of just the mutant allele is achievable using siRNA targeted to regions of HD mRNA containing single nucleotide polymorphisms (SNPs). To determine whether more than a minority of patients may be eligible for an allele-specific therapy, we genotyped DNA from 327 unrelated European Caucasian HD patients at 26 SNP sites in the HD gene. Over 86% of the patients were found to be heterozygous for at least one SNP among those tested. Because the sites are genetically linked, one cannot use the heterozygosity rates of the individual SNPs to predict how many sites (and corresponding allele-specific siRNA) would be needed to provide at least one treatment possibility for this percentage of patients. By computing all combinations, we found that a repertoire of allele-specific siRNA corresponding to seven sites can provide at least one allele-specific siRNA treatment option for 85.6% of our sample. Moreover, we provide evidence that allele-specific siRNA targeting these sites are readily identifiable using a high throughput screening method, and that allele-specific siRNA identified using this method indeed show selective suppression of endogenous mutant htt protein in fibroblast cells from HD patients. Therefore, allele-specific siRNA are not so rare as to be impractical to find and use therapeutically.

  8. A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins

    PubMed Central

    Cheng, Tammy M. K.; Goehring, Lucas; Jeffery, Linda; Lu, Yu-En; Hayles, Jacqueline; Novák, Béla; Bates, Paul A.

    2012-01-01

    Gauging the systemic effects of non-synonymous single nucleotide polymorphisms (nsSNPs) is an important topic in the pursuit of personalized medicine. However, it is a non-trivial task to understand how a change at the protein structure level eventually affects a cell's behavior. This is because complex information at both the protein and pathway level has to be integrated. Given that the idea of integrating both protein and pathway dynamics to estimate the systemic impact of missense mutations in proteins remains predominantly unexplored, we investigate the practicality of such an approach by formulating mathematical models and comparing them with experimental data to study missense mutations. We present two case studies: (1) interpreting systemic perturbation for mutations within the cell cycle control mechanisms (G2 to mitosis transition) for yeast; (2) phenotypic classification of neuron-related human diseases associated with mutations within the mitogen-activated protein kinase (MAPK) pathway. We show that the application of simplified mathematical models is feasible for understanding the effects of small sequence changes on cellular behavior. Furthermore, we show that the systemic impact of missense mutations can be effectively quantified as a combination of protein stability change and pathway perturbation. PMID:23093928

  9. MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability

    PubMed Central

    Failla, Pinella; Di Marco, Chiara; Grozeva, Detelina; Mencarelli, Maria Antonietta; Spiga, Ottavia; Mari, Francesca; Meloni, Ilaria; Raymond, Lucy; Renieri, Alessandra; Romano, Corrado; Ariani, Francesca

    2015-01-01

    Methyl-CpG binding protein 2 (MeCP2) is a nuclear protein highly expressed in neurons that is involved in transcriptional modulation and chromatin remodeling. Mutations in MECP2 in females are associated with Rett syndrome, a neurological disorder characterized by a normal neonatal period, followed by the arrest of development and regression of acquired skills. Although it was initially thought that MECP2 pathogenic mutations in males were not compatible with life, starting from 1999 about 60 male patients have been identified and their phenotype varies from severe neonatal encephalopathy to mild intellectual disability. Targeted Next Generation Sequencing of a panel of intellectual disability related genes was performed on two unrelated male patients, and two missense variants in MECP2 were identified (p.Gly185Val and p.Arg167Trp). These variants lie outside the canonical MBD and TRD domains, where the pathogenicity of missense variants is more difficult to establish. In both families, variants were found in all affected siblings and were inherited from the asymptomatic mother, showing skewed X-chromosome inactivation. We report here the first missense variant located in AT-hook domain 1 and we underline the importance of MECP2 substitutions outside the canonical MeCP2 domains in X-linked intellectual disability. PMID:26490184

  10. A structural systems biology approach for quantifying the systemic consequences of missense mutations in proteins.

    PubMed

    Cheng, Tammy M K; Goehring, Lucas; Jeffery, Linda; Lu, Yu-En; Hayles, Jacqueline; Novák, Béla; Bates, Paul A

    2012-01-01

    Gauging the systemic effects of non-synonymous single nucleotide polymorphisms (nsSNPs) is an important topic in the pursuit of personalized medicine. However, it is a non-trivial task to understand how a change at the protein structure level eventually affects a cell's behavior. This is because complex information at both the protein and pathway level has to be integrated. Given that the idea of integrating both protein and pathway dynamics to estimate the systemic impact of missense mutations in proteins remains predominantly unexplored, we investigate the practicality of such an approach by formulating mathematical models and comparing them with experimental data to study missense mutations. We present two case studies: (1) interpreting systemic perturbation for mutations within the cell cycle control mechanisms (G2 to mitosis transition) for yeast; (2) phenotypic classification of neuron-related human diseases associated with mutations within the mitogen-activated protein kinase (MAPK) pathway. We show that the application of simplified mathematical models is feasible for understanding the effects of small sequence changes on cellular behavior. Furthermore, we show that the systemic impact of missense mutations can be effectively quantified as a combination of protein stability change and pathway perturbation.

  11. A comprehensive analysis of translational missense errors in the yeast Saccharomyces cerevisiae.

    PubMed

    Kramer, Emily B; Vallabhaneni, Haritha; Mayer, Lauren M; Farabaugh, Philip J

    2010-09-01

    The process of protein synthesis must be sufficiently rapid and sufficiently accurate to support continued cellular growth. Failure in speed or accuracy can have dire consequences, including disease in humans. Most estimates of the accuracy come from studies of bacterial systems, principally Escherichia coli, and have involved incomplete analysis of possible errors. We recently used a highly quantitative system to measure the frequency of all types of misreading errors by a single tRNA in E. coli. That study found a wide variation in error frequencies among codons; a major factor causing that variation is competition between the correct (cognate) and incorrect (near-cognate) aminoacyl-tRNAs for the mutant codon. Here we extend that analysis to measure the frequency of missense errors by two tRNAs in a eukaryote, the yeast Saccharomyces cerevisiae. The data show that in yeast errors vary by codon from a low of 4 x 10(-5) to a high of 6.9 x 10(-4) per codon and that error frequency is in general about threefold lower than in E. coli, which may suggest that yeast has additional mechanisms that reduce missense errors. Error rate again is strongly influenced by tRNA competition. Surprisingly, missense errors involving wobble position mispairing were much less frequent in S. cerevisiae than in E. coli. Furthermore, the error-inducing aminoglycoside antibiotic, paromomycin, which stimulates errors on all error-prone codons in E. coli, has a more codon-specific effect in yeast.

  12. Missense mutation of the {beta}-cardiac myosin heavy-chain gene in hypertrophic cardiomyopathy

    SciTech Connect

    Arai, Shoichi; Matsuoka, Rumiko; Hirayama, Kenji; Sakurai, Hisanao

    1995-09-11

    Hypertrophic cardiomyopathy occurs as an autosomal dominant familial disorder or as a sporadic disease without familial involvement. We describe a missense mutation of the {beta}-cardiac myosin heavy chain (MHC) gene, a G to T transversion (741 Gly{r_arrow}Trp) identified by direct sequencing of exon 20 in four individuals affected with familial hypertrophic cardiomyopathy. Three individuals with sporadic hypertrophic cardiomyopathy, whose parents are clinically and genetically unaffected, had sequence variations of exon 34 of the {alpha}-cardiac MHC gene (a C to T transversion, 1658 Asp{r_arrow}Asp, resulting in FokI site polymorphism), of intron 33 of the {alpha}-cardiac MHC gene (a G to A and an A to T transversion), and also of intron 14 of the {beta}-cardiac MHC gene (a C to T transversion in a patient with Noonan syndrome). Including our case, 30 missense mutations of the {beta}-cardiac MHC gene in 49 families have been reported thus far worldwide. Almost all are located in the region of the gene coding for the globular head of the molecule, and only one mutation was found in both Caucasian and Japanese families. Missense mutations of the {Beta}-cardiac MHC gene in hypertrophic cardiomyopathy may therefore differ according to race. 29 refs., 6 figs., 3 tabs.

  13. C1q deficiency: identification of a novel missense mutation and treatment with fresh frozen plasma.

    PubMed

    Topaloglu, Rezan; Taskiran, Ekim Z; Tan, Cagman; Erman, Baran; Ozaltin, Fatih; Sanal, Ozden

    2012-07-01

    A Turkish patient with C1q deficiency presented with a lupus-like disease, and a new missense mutation at A chain is presented. To characterize the genetic defect, all exons of the genes for the A, B, and C chains of C1q were sequenced in the patient. This revealed a missense mutation in the collagen-like domain of the A chain, p.Gly31 Arg. No other sequence variants, including the common silent mutations, were found in the three chains. Exon 1 of the C1q A chain was sequenced in 105 samples from healthy controls for this particular mutation. None of these carried the mutation. The C1q-deficient patient was treated with fresh frozen plasma infusions. Our findings showed that Turkish patients may have different mutations than the previously described common mutation, and once again, not only nonsense mutations but also missense mutations cause hereditary C1q deficiency. Regular fresh frozen plasma infusions to the patient have been clinically and therapeutically successful.

  14. Proteostasis modulators prolong missense VHL protein activity and halt tumor progression

    PubMed Central

    Yang, Chunzhang; Huntoon, Kristin; Ksendzovsky, Alexander; Zhuang, Zhengping; Lonser, Russell R.

    2012-01-01

    SUMMARY While missense mutations of von Hippel-Lindau disease (VHL) gene are the most common germline mutation underlying this heritable cancer syndrome, the mechanism of tumorigenesis is unknown. We found a quantitative reduction of missense mutant VHL protein (pVHL) in VHL-associated tumors associated with physiologic mRNA expression. While mutant pVHL is unstable and degraded contemporarily with translation, it retains its E3 ligase function, including hypoxia inducible factor degradation. The premature pVHL degradation is due to misfolding and imbalance of chaperonin binding. Histone deacetylase inhibitors (HDACis) can modulate this pathway by inhibiting the HDAC6-Hsp90 chaperone axis, stabilizing pVHL and restoring activity comparable to wild type protein in vitro and in animal models (786-O tumor xenografts). HDACi mediated stabilization of missense pVHL significantly attenuates the growth of 786-O rodent tumor model. These findings provide direct biologic insight into VHL-associated tumors and elucidate a new treatment paradigm for VHL. PMID:23318261

  15. In silico investigation of molecular effects caused by missense mutations in creatine transporter protein

    NASA Astrophysics Data System (ADS)

    Zhang, Zhe; Schwatz, Charles; Alexov, Emil

    2011-03-01

    Creatine transporter (CT) protein, which is encoded by SLC6A8 gene, is essential for taking up the creatine in the cell, which in turn plays a key role in the spatial and temporal maintenance of energy in skeletal and cardiac muscle cells. It was shown that some missense mutations in CT cause mental retardation, while others are harmless non-synonymous single nucleoside polymorphism (nsSNP). Currently fifteen missense mutations in CT are known, among which twelve are disease-causing. Sequence analysis reveals that there is no clear trend distinguishing disease-causing from harmless missense mutations. Because of that, we built 3D model of the CT using highly homologous template and use the model to investigate the effects of mutations of CT stability and hydrogen bond network. It is demonstrated that disease-causing mutations affect the folding free energy and ionization states of titratable group in much greater extend as compared with harmless mutations. Supported by grants from NLM, NIH, grant numbers 1R03LM009748 and 1R03LM009748-S1.

  16. Characterization of the treefrog null allele, 1991

    SciTech Connect

    Guttman, S.I.

    1992-04-01

    Spring peeper (Hyla crucifer) tadpoles collected from the waste storage area during the Biological and Ecological Site Characterization of the Feed Materials Production Center (FEMP) in 1986 and 1987 appeared to be unique. A null (inactive) allele was found at the glucose phosphate isomerase enzyme locus in significant frequencies (approximately 20%) each year; this allele did not appear to occur in the offsite sample collected approximately 15km from the FEMP. Null alleles at this locus have not been reported in other amphibian populations; when they have been found in other organisms they have invariably been lethal in the homozygous condition.

  17. Characterization of the treefrog null allele

    SciTech Connect

    Guttman, S.I. . Dept. of Zoology)

    1990-12-01

    As part of the authors intensive year-long baseline ecological study, they characterized the degree of genetic polymorphism and heterozygosity in selected Feed Materials Production Center (FMPC) populations using electrophoretic techniques. These data are being used as an indicator of stress by comparing populations on and off the FMPC site. The current study was initiated to determine whether this GPI null allele is lethal, when homozygous, in spring peepers. Also, a sampling protocol was implemented to determine whether a linear effect occurs relative to the frequency of the null allele offsite and to determine the origination site of the null allele. 18 refs., 2 figs., 4 tabs.

  18. Role of Survivin in cytokinesis revealed by a separation-of-function allele

    PubMed Central

    Szafer-Glusman, Edith; Fuller, Margaret T.; Giansanti, Maria Grazia

    2011-01-01

    The chromosomal passenger complex (CPC), containing Aurora B kinase, Inner Centromere Protein, Survivin, and Borealin, regulates chromosome condensation and interaction between kinetochores and microtubules at metaphase, then relocalizes to midzone microtubules at anaphase and regulates central spindle organization and cytokinesis. However, the precise role(s) played by the CPC in anaphase have been obscured by its prior functions in metaphase. Here we identify a missense allele of Drosophila Survivin that allows CPC localization and function during metaphase but not cytokinesis. Analysis of mutant cells showed that Survivin is essential to target the CPC and the mitotic kinesin-like protein 1 orthologue Pavarotti (Pav) to the central spindle and equatorial cell cortex during anaphase in both larval neuroblasts and spermatocytes. Survivin also enabled localization of Polo kinase and Rho at the equatorial cortex in spermatocytes, critical for contractile ring assembly. In neuroblasts, in contrast, Survivin function was not required for localization of Rho, Polo, or Myosin II to a broad equatorial cortical band but was required for Myosin II to transition to a compact, fully constricted ring. Analysis of this “separation-of-function” allele demonstrates the direct role of Survivin and the CPC in cytokinesis and highlights striking differences in regulation of cytokinesis in different cell systems. PMID:21865602

  19. Compound heterozygosity of two novel RHAG alleles leads to a considerable disruption of the Rh complex.

    PubMed

    Polin, Helene; Pelc-Klopotowska, Monika; Danzer, Martin; Suessner, Susanne; Gabriel, Christian; Wilflingseder, Julia; Żmudzin, Alicja; Orzińska, Agnieszka; Guz, Katarzyna; Michalewska, Bogumila; Brojer, Ewa

    2016-04-01

    The Rhesus (Rh) complex consists of a core comprising the Rh proteins (RhD/RhCE) and the Rh-associated glycoprotein (RhAG) with accessory chains (GPB, LW, CD47). Molecular defects of the RHAG gene may cause a regulator Rhnull phenotype without Rh antigen expression or a Rhmod phenotype with decreased Rh antigen expression. Blood samples of a donor with strongly diminished Rh antigens and five family members were analyzed by serological phenotyping, flow cytometry, molecular testing, and gene expression analysis of Rh complex candidate genes. RHAG sequencing identified a missense mutation, c.241G>C (p.Gly81Arg) and a splice site mutation, c.640 + 3del14, among the cohort. Compound heterozygosity of these novel alleles identified in the propositus and two siblings gave rise to a strongly diminished expression of RhAG, Rh, and CD47 antigens on the RBC surface. The Rhmod phenotype was caused by a novel RHAG splice site mutation in association with a non-functional allele. The primary depression of RhAG is most likely due to posttranslational events that affect the interaction and processing of the RhAG glycoprotein and gave rise to a secondary depression of RhD, RhCE, and CD47, the major members of the Rh complex. © 2016 AABB.

  20. Theoretical prediction of familial amyotrophic lateral sclerosis missense mutation effects on Cu/Zn superoxide dismutase structural stability

    SciTech Connect

    Potier, M.; Tu, Y.

    1994-09-01

    Cu/Zn superoxide dismutase (SOD) deficiency is associated with the progressive paralytic disorder familial amyotrophic lateral sclerosis (FALS). Fifteen missense mutations in the SOD gene were identified in several patients. These mutations may prevent correct promoter folding or hamper homodimer formation necessary for SOD activity. To understand the effect of the missense mutations on SOD structure and function, we used a theoretical analysis of structural effects based on two predictive methods using the modeled tertiary structure of human SOD. The first method uses the TORSO program which optimizes amino acid side-chains repacking in both wild-type and mutant SODs and calculates protein internal packing energy. The second method uses a hydrophobicity scale of the amino acid residues and considers both solvent accessibility and hydrophobic nature of residue substitutions to compute a stabilization energy change ({delta}E). These predictive methods have been tested in 187 single and multiple missense mutants of 8 proteins (T4 lysozyme, human carbonic anhydrase II, chymotrypsin inhibitor 2, f1 gene V protein, barnase, {lambda}-repressor, chicken and human lysozymes) with experimentally determined thermostability. The overall prediction accuracy with these proteins was 88%. Analysis of FALS missense mutations {delta}E predicts that 14 of 15 mutations destabilize the SOD structure. The other missense mutation is located at the homodimer interface and may hinder dimer formation. This approach is applicable to any protein with known tertiary structure to predict missense mutation effects on protein stability.

  1. Nucleotide variation and identification of novel blast resistance alleles of Pib by allele mining strategy.

    PubMed

    Ramkumar, G; Madhav, M S; Devi, S J S Rama; Prasad, M S; Babu, V Ravindra

    2015-04-01

    Pib is one of significant rice blast resistant genes, which provides resistance to wide range of isolates of rice blast pathogen, Magnaporthe oryzae. Identification and isolation of novel and beneficial alleles help in crop enhancement. Allele mining is one of the best strategies for dissecting the allelic variations at candidate gene and identification of novel alleles. Hence, in the present study, Pib was analyzed by allele mining strategy, and coding and non-coding (upstream and intron) regions were examined to identify novel Pib alleles. Allelic sequences comparison revealed that nucleotide polymorphisms at coding regions affected the amino acid sequences, while the polymorphism at upstream (non-coding) region affected the motifs arrangements. Pib alleles from resistant landraces, Sercher and Krengosa showed better resistance than Pib donor variety, might be due to acquired mutations, especially at LRR region. The evolutionary distance, Ka/Ks and phylogenetic analyzes also supported these results. Transcription factor binding motif analysis revealed that Pib (Sr) had a unique motif (DPBFCOREDCDC3), while five different motifs differentiated the resistance and susceptible Pib alleles. As the Pib is an inducible gene, the identified differential motifs helps to understand the Pib expression mechanism. The identified novel Pib resistant alleles, which showed high resistance to the rice blast, can be used directly in blast resistance breeding program as alternative Pib resistant sources.

  2. Missense and nonsense mutations in melanocortin 1 receptor (MC1R) gene of different goat breeds: association with red and black coat colour phenotypes but with unexpected evidences.

    PubMed

    Fontanesi, Luca; Beretti, Francesca; Riggio, Valentina; Dall'Olio, Stefania; González, Elena Gómez; Finocchiaro, Raffaella; Davoli, Roberta; Russo, Vincenzo; Portolano, Baldassare

    2009-08-25

    Agouti and Extension loci control the relative amount of eumelanin and pheomelanin production in melanocytes that, in turn, affects pigmentation of skin and hair. The Extension locus encodes the melanocortin 1 receptor (MC1R) whose permanent activation, caused by functional mutations, results in black coat colour, whereas other inactivating mutations cause red coat colour in different mammals. The whole coding region of the MC1R gene was sequenced in goats of six different breeds showing different coat colours (Girgentana, white cream with usually small red spots in the face; Maltese, white with black cheeks and ears; Derivata di Siria, solid red; Murciano-Granadina, solid black or solid brown; Camosciata delle Alpi, brown with black stripes; Saanen, white; F1 goats and the parental animals). Five single nucleotide polymorphisms (SNPs) were identified: one nonsense mutation (p.Q225X), three missense mutations (p.A81V, p.F250V, and p.C267W), and one silent mutation. The stop codon at position 225 should cause the production of a shorter MC1R protein whose functionality may be altered. These SNPs were investigated in a larger sample of animals belonging to the six breeds. The Girgentana breed was almost fixed for the p.225X allele. However, there was not complete association between the presence of red spots in the face and the presence of this allele in homozygous condition. The same allele was identified in the Derivata di Siria breed. However, its frequency was only 33%, despite the fact that these animals are completely red. The p.267W allele was present in all Murciano-Granadina black goats, whereas it was never identified in the brown ones. Moreover, the same substitution was present in almost all Maltese goats providing evidence of association between this mutation and black coat colour. According to the results obtained in the investigated goat breeds, MC1R mutations may determine eumelanic and pheomelanic phenotypes. However, they are probably not the only

  3. Missense and nonsense mutations in melanocortin 1 receptor (MC1R) gene of different goat breeds: association with red and black coat colour phenotypes but with unexpected evidences

    PubMed Central

    2009-01-01

    Background Agouti and Extension loci control the relative amount of eumelanin and pheomelanin production in melanocytes that, in turn, affects pigmentation of skin and hair. The Extension locus encodes the melanocortin 1 receptor (MC1R) whose permanent activation, caused by functional mutations, results in black coat colour, whereas other inactivating mutations cause red coat colour in different mammals. Results The whole coding region of the MC1R gene was sequenced in goats of six different breeds showing different coat colours (Girgentana, white cream with usually small red spots in the face; Maltese, white with black cheeks and ears; Derivata di Siria, solid red; Murciano-Granadina, solid black or solid brown; Camosciata delle Alpi, brown with black stripes; Saanen, white; F1 goats and the parental animals). Five single nucleotide polymorphisms (SNPs) were identified: one nonsense mutation (p.Q225X), three missense mutations (p.A81V, p.F250V, and p.C267W), and one silent mutation. The stop codon at position 225 should cause the production of a shorter MC1R protein whose functionality may be altered. These SNPs were investigated in a larger sample of animals belonging to the six breeds. The Girgentana breed was almost fixed for the p.225X allele. However, there was not complete association between the presence of red spots in the face and the presence of this allele in homozygous condition. The same allele was identified in the Derivata di Siria breed. However, its frequency was only 33%, despite the fact that these animals are completely red. The p.267W allele was present in all Murciano-Granadina black goats, whereas it was never identified in the brown ones. Moreover, the same substitution was present in almost all Maltese goats providing evidence of association between this mutation and black coat colour. Conclusion According to the results obtained in the investigated goat breeds, MC1R mutations may determine eumelanic and pheomelanic phenotypes. However

  4. Comparison of HLA allelic imputation programs.

    PubMed

    Karnes, Jason H; Shaffer, Christian M; Bastarache, Lisa; Gaudieri, Silvana; Glazer, Andrew M; Steiner, Heidi E; Mosley, Jonathan D; Mallal, Simon; Denny, Joshua C; Phillips, Elizabeth J; Roden, Dan M

    2017-01-01

    Imputation of human leukocyte antigen (HLA) alleles from SNP-level data is attractive due to importance of HLA alleles in human disease, widespread availability of genome-wide association study (GWAS) data, and expertise required for HLA sequencing. However, comprehensive evaluations of HLA imputations programs are limited. We compared HLA imputation results of HIBAG, SNP2HLA, and HLA*IMP:02 to sequenced HLA alleles in 3,265 samples from BioVU, a de-identified electronic health record database coupled to a DNA biorepository. We performed four-digit HLA sequencing for HLA-A, -B, -C, -DRB1, -DPB1, and -DQB1 using long-read 454 FLX sequencing. All samples were genotyped using both the Illumina HumanExome BeadChip platform and a GWAS platform. Call rates and concordance rates were compared by platform, frequency of allele, and race/ethnicity. Overall concordance rates were similar between programs in European Americans (EA) (0.975 [SNP2HLA]; 0.939 [HLA*IMP:02]; 0.976 [HIBAG]). SNP2HLA provided a significant advantage in terms of call rate and the number of alleles imputed. Concordance rates were lower overall for African Americans (AAs). These observations were consistent when accuracy was compared across HLA loci. All imputation programs performed similarly for low frequency HLA alleles. Higher concordance rates were observed when HLA alleles were imputed from GWAS platforms versus the HumanExome BeadChip, suggesting that high genomic coverage is preferred as input for HLA allelic imputation. These findings provide guidance on the best use of HLA imputation methods and elucidate their limitations.

  5. Comparison of HLA allelic imputation programs

    PubMed Central

    Shaffer, Christian M.; Bastarache, Lisa; Gaudieri, Silvana; Glazer, Andrew M.; Steiner, Heidi E.; Mosley, Jonathan D.; Mallal, Simon; Denny, Joshua C.; Phillips, Elizabeth J.; Roden, Dan M.

    2017-01-01

    Imputation of human leukocyte antigen (HLA) alleles from SNP-level data is attractive due to importance of HLA alleles in human disease, widespread availability of genome-wide association study (GWAS) data, and expertise required for HLA sequencing. However, comprehensive evaluations of HLA imputations programs are limited. We compared HLA imputation results of HIBAG, SNP2HLA, and HLA*IMP:02 to sequenced HLA alleles in 3,265 samples from BioVU, a de-identified electronic health record database coupled to a DNA biorepository. We performed four-digit HLA sequencing for HLA-A, -B, -C, -DRB1, -DPB1, and -DQB1 using long-read 454 FLX sequencing. All samples were genotyped using both the Illumina HumanExome BeadChip platform and a GWAS platform. Call rates and concordance rates were compared by platform, frequency of allele, and race/ethnicity. Overall concordance rates were similar between programs in European Americans (EA) (0.975 [SNP2HLA]; 0.939 [HLA*IMP:02]; 0.976 [HIBAG]). SNP2HLA provided a significant advantage in terms of call rate and the number of alleles imputed. Concordance rates were lower overall for African Americans (AAs). These observations were consistent when accuracy was compared across HLA loci. All imputation programs performed similarly for low frequency HLA alleles. Higher concordance rates were observed when HLA alleles were imputed from GWAS platforms versus the HumanExome BeadChip, suggesting that high genomic coverage is preferred as input for HLA allelic imputation. These findings provide guidance on the best use of HLA imputation methods and elucidate their limitations. PMID:28207879

  6. Carriage of One or Two FMR1 Premutation Alleles Seems to Have No Effect on Illness Severity in a FXTAS Female with an Autozygous FMR1 Premutation Allele.

    PubMed

    Rodriguez-Revenga, Laia; Pagonabarraga, Javier; Gómez-Anson, Beatriz; López-Mourelo, Olga; Izquierdo, Silvia; Alvarez-Mora, Maria Isabel; Granell, Esther; Madrigal, Irene; Milà, Montserrat

    2016-10-01

    Fragile X-associated tremor/ataxia syndrome (FXTAS) is a late-onset neurodegenerative disorder that occurs in FMR1 premutation carriers. The prevalence of FMR1 premutation carriers in the general population is relatively high, and although rare, a premutation in both X chromosomes may occur in females inheriting a premutation allele from each of both parent carriers. Here, we report the first female with an autozygous (homozygous by descendent) FMR1 premutation allele, who fulfills neurological and radiological FXTAS findings/criteria. Molecular characterization included CGG repeat length, AGG interruption pattern, FMR1 messenger RNA (mRNA), fragile X mental retardation protein (FMRP) level quantification, and single-nucleotide polymorphism (SNP) microarray. Neuroradiological assessment of 3-T magnetic resonance imaging and neurological and cognitive/neuropsychological evaluations were performed. Neurological and neuroradiological examination of the female with the same FMR1 allele in the premutation range (77 CGGs) demonstrated FXTAS features. Further familial evaluation showed a similar neuropsychiatric profile, with impairments in cognitive flexibility and visuospatial function, mainly. A unique family with an autozygous FMR1 premutation female is presented. Neurological/cognitive and neuroradiological examinations revealed FXTAS-specific findings in the female with the autozygous FMR1 premutation allele. The consistent molecular and cognitive/psychiatric phenotype in family members suggests that carrying one or two FMR1 premutation alleles has no effect on illness severity.

  7. A COLQ Missense Mutation in Labrador Retrievers Having Congenital Myasthenic Syndrome

    PubMed Central

    Rinz, Caitlin J.; Levine, Jonathan; Minor, Katie M.; Humphries, Hammon D.; Lara, Renee; Starr-Moss, Alison N.; Guo, Ling T.; Williams, D. Colette; Shelton, G. Diane; Clark, Leigh Anne

    2014-01-01

    Congenital myasthenic syndromes (CMSs) are heterogeneous neuromuscular disorders characterized by skeletal muscle weakness caused by disruption of signal transmission across the neuromuscular junction (NMJ). CMSs are rarely encountered in veterinary medicine, and causative mutations have only been identified in Old Danish Pointing Dogs and Brahman cattle to date. Herein, we characterize a novel CMS in 2 Labrador Retriever littermates with an early onset of marked generalized muscle weakness. Because the sire and dam share 2 recent common ancestors, CMS is likely the result of recessive alleles inherited identical by descent (IBD). Genome-wide SNP profiles generated from the Illumina HD array for 9 nuclear family members were used to determine genomic inheritance patterns in chromosomal regions encompassing 18 functional candidate genes. SNP haplotypes spanning 3 genes were consistent with autosomal recessive transmission, and microsatellite data showed that only the segment encompassing COLQ was inherited IBD. COLQ encodes the collagenous tail of acetylcholinesterase, the enzyme responsible for termination of signal transduction in the NMJ. Sequences from COLQ revealed a variant in exon 14 (c.1010T>C) that results in the substitution of a conserved amino acid (I337T) within the C-terminal domain. Both affected puppies were homozygous for this variant, and 16 relatives were heterozygous, while 288 unrelated Labrador Retrievers and 112 dogs of other breeds were wild-type. A recent study in which 2 human CMS patients were found to be homozygous for an identical COLQ mutation (c.1010T>C; I337T) provides further evidence that this mutation is pathogenic. This report describes the first COLQ mutation in canine CMS and demonstrates the utility of SNP profiles from nuclear family members for the identification of private mutations. PMID:25166616

  8. Targeted deep resequencing of ALOX5 and ALOX5AP in patients with diabetes and association of rare variants with leukotriene pathways

    PubMed Central

    POSTULA, MAREK; JANICKI, PIOTR KAZIMIERZ; ROSIAK, MAREK; EYILETEN, CEREN; ZAREMBA, MAŁGORZATA; KAPLON-CIESLICKA, AGNIESZKA; SUGINO, SHIGEKAZU; KOSIOR, DARIUSZ ARTUR; OPOLSKI, GRZEGORZ; FILIPIAK, KRZYSZTOF JERZY; MIROWSKA-GUZEL, DAGMARA

    2016-01-01

    The aim of the present study was to investigate a possible association between the accumulation of rare coding variants in the genes for arachidonate 5-lipoxygenase (ALOX5) and ALOX5-activating protein (ALOX5AP), and corresponding production of leukotrienes (LTs) in patients with type 2 diabetes mellitus (T2DM) receiving acetylsalicylic therapy. Twenty exons and corresponding introns of the selected genes were resequenced in 303 DNA samples from patients with T2DM using pooled polymerase chain reaction amplification and next-generation sequencing, using an Illumina HiSeq 2000 sequencing system. The observed non-synonymous variants were further confirmed by individual genotyping of DNA samples comprising of all individuals from the original discovery pools. The association between the investigated phenotypes was based on LTB4 and LTE4 concentrations, and the accumulation of rare missense variants (genetic burden) in investigated genes was evaluated using statistical collapsing tests. A total of 10 exonic variants were identified for each resequenced gene, including 5 missense and 5 synonymous variants. The rare missense variants did not exhibit statistically significant differences in the accumulation pattern between the patients with low and high LTs concentrations. As the present study only included patients with T2DM, it is unclear whether the absence of observed association between the accumulation of rare missense variants in investigated genes and LT production is associated with diabetic populations only or may also be applied to other populations. PMID:27347071

  9. Natural selection for the Duffy-null allele in the recently admixed people of Madagascar.

    PubMed

    Hodgson, Jason A; Pickrell, Joseph K; Pearson, Laurel N; Quillen, Ellen E; Prista, António; Rocha, Jorge; Soodyall, Himla; Shriver, Mark D; Perry, George H

    2014-08-22

    While gene flow between distantly related populations is increasingly recognized as a potentially important source of adaptive genetic variation for humans, fully characterized examples are rare. In addition, the role that natural selection for resistance to vivax malaria may have played in the extreme distribution of the protective Duffy-null allele, which is nearly completely fixed in mainland sub-Saharan Africa and absent elsewhere, is controversial. We address both these issues by investigating the evolution of the Duffy-null allele in the Malagasy, a recently admixed population with major ancestry components from both East Asia and mainland sub-Saharan Africa. We used genome-wide genetic data and extensive computer simulations to show that the high frequency of the Duffy-null allele in Madagascar can only be explained in the absence of positive natural selection under extreme demographic scenarios involving high genetic drift. However, the observed genomic single nucleotide polymorphism diversity in the Malagasy is incompatible with such extreme demographic scenarios, indicating that positive selection for the Duffy-null allele best explains the high frequency of the allele in Madagascar. We estimate the selection coefficient to be 0.066. Because vivax malaria is endemic to Madagascar, this result supports the hypothesis that malaria resistance drove fixation of the Duffy-null allele in mainland sub-Saharan Africa. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  10. Balancing Selection at a Frog Antimicrobial Peptide Locus: Fluctuating Immune Effector Alleles?

    PubMed Central

    Blouin, Michael S.

    2008-01-01

    Balancing selection is common on many defense genes, but it has rarely been reported for immune effector proteins such as antimicrobial peptides (AMPs). We describe genetic diversity at a brevinin-1 AMP locus in three species of leopard frogs (Rana pipiens, Rana blairi, and Rana palustris). Several highly divergent allelic lineages are segregating at this locus. That this unusual pattern results from balancing selection is demonstrated by multiple lines of evidence, including a ratio of nonsynonymous/synonymous polymorphism significantly higher than 1, the ZnS test, incongruence between the number of segregating sites and haplotype diversity, and significant Tajima's D values. Our data are more consistent with a model of fluctuating selection in which alleles change frequencies over time than with a model of stable balancing selection such as overdominance. Evidence for fluctuating selection includes skewed allele frequencies, low levels of synonymous variation, nonneutral values of Tajima's D within allelic lineages, an inverse relationship between the frequency of an allelic lineage and its degree of polymorphism, and divergent allele frequencies among populations. AMP loci could be important sites of adaptive genetic diversity, with consequences for host–pathogen coevolution and the ability of species to resist disease epidemics. PMID:18799711

  11. Dominant Red Coat Color in Holstein Cattle Is Associated with a Missense Mutation in the Coatomer Protein Complex, Subunit Alpha (COPA) Gene

    PubMed Central

    Dorshorst, Ben; Henegar, Corneliu; Liao, Xiaoping; Sällman Almén, Markus; Rubin, Carl-Johan; Ito, Shosuke; Wakamatsu, Kazumasa; Stothard, Paul; Van Doormaal, Brian; Plastow, Graham; Barsh, Gregory S.; Andersson, Leif

    2015-01-01

    Coat color in Holstein dairy cattle is primarily controlled by the melanocortin 1 receptor (MC1R) gene, a central determinant of black (eumelanin) vs. red/brown pheomelanin synthesis across animal species. The major MC1R alleles in Holsteins are Dominant Black (MC1RD) and Recessive Red (MC1Re). A novel form of dominant red coat color was first observed in an animal born in 1980. The mutation underlying this phenotype was named Dominant Red and is epistatic to the constitutively activated MC1RD. Here we show that a missense mutation in the coatomer protein complex, subunit alpha (COPA), a gene with previously no known role in pigmentation synthesis, is completely associated with Dominant Red in Holstein dairy cattle. The mutation results in an arginine to cysteine substitution at an amino acid residue completely conserved across eukaryotes. Despite this high level of conservation we show that both heterozygotes and homozygotes are healthy and viable. Analysis of hair pigment composition shows that the Dominant Red phenotype is similar to the MC1R Recessive Red phenotype, although less effective at reducing eumelanin synthesis. RNA-seq data similarly show that Dominant Red animals achieve predominantly pheomelanin synthesis by downregulating genes normally required for eumelanin synthesis. COPA is a component of the coat protein I seven subunit complex that is involved with retrograde and cis-Golgi intracellular coated vesicle transport of both protein and RNA cargo. This suggests that Dominant Red may be caused by aberrant MC1R protein or mRNA trafficking within the highly compartmentalized melanocyte, mimicking the effect of the Recessive Red loss of function MC1R allele. PMID:26042826

  12. Dominant Red Coat Color in Holstein Cattle Is Associated with a Missense Mutation in the Coatomer Protein Complex, Subunit Alpha (COPA) Gene.

    PubMed

    Dorshorst, Ben; Henegar, Corneliu; Liao, Xiaoping; Sällman Almén, Markus; Rubin, Carl-Johan; Ito, Shosuke; Wakamatsu, Kazumasa; Stothard, Paul; Van Doormaal, Brian; Plastow, Graham; Barsh, Gregory S; Andersson, Leif

    2015-01-01

    Coat color in Holstein dairy cattle is primarily controlled by the melanocortin 1 receptor (MC1R) gene, a central determinant of black (eumelanin) vs. red/brown pheomelanin synthesis across animal species. The major MC1R alleles in Holsteins are Dominant Black (MC1RD) and Recessive Red (MC1Re). A novel form of dominant red coat color was first observed in an animal born in 1980. The mutation underlying this phenotype was named Dominant Red and is epistatic to the constitutively activated MC1RD. Here we show that a missense mutation in the coatomer protein complex, subunit alpha (COPA), a gene with previously no known role in pigmentation synthesis, is completely associated with Dominant Red in Holstein dairy cattle. The mutation results in an arginine to cysteine substitution at an amino acid residue completely conserved across eukaryotes. Despite this high level of conservation we show that both heterozygotes and homozygotes are healthy and viable. Analysis of hair pigment composition shows that the Dominant Red phenotype is similar to the MC1R Recessive Red phenotype, although less effective at reducing eumelanin synthesis. RNA-seq data similarly show that Dominant Red animals achieve predominantly pheomelanin synthesis by downregulating genes normally required for eumelanin synthesis. COPA is a component of the coat protein I seven subunit complex that is involved with retrograde and cis-Golgi intracellular coated vesicle transport of both protein and RNA cargo. This suggests that Dominant Red may be caused by aberrant MC1R protein or mRNA trafficking within the highly compartmentalized melanocyte, mimicking the effect of the Recessive Red loss of function MC1R allele.

  13. Abnormal segregation of alleles in CEPH pedigree DNAs arising from allele loss in lymphoblastoid DNA

    SciTech Connect

    Royle, N.J.; Armour, J.A.L.; Crosier, M.; Jeffreys, A.J. )

    1993-01-01

    Somatic events that result in the reduction to hemior homozygosity at all loci affected by the event have been identified in lymphoblastoid DNA from mothers of two CEPH families. Using suitably informative probes, the allele deficiencies were detected by the abnormal transmission of alleles from grandparents to grandchildren, with the apparent absence of the alleles from the parent. Undetected somatic deficiencies in family DNAs could result in misscoring of recombination events and consequently introduce errors into linkage analysis. 15 refs., 2 figs.

  14. Ten novel HLA-DRB1 alleles and one novel DRB3 allele.

    PubMed

    Lazaro, A M; Steiner, N K; Moraes, M E; Moraes, J R; Ng, J; Hartzman, R J; Hurley, C K

    2005-10-01

    Ten novel HLA-DRB1 and one DRB3 alleles are described. Eight of the variants are single-nucleotide substitutions, four resulting in an amino acid change (DRB1*1145, *1148, *0828 and *1514) and four with silent substitutions (DRB1*040504, *130103, *160502 and DRB3*020204). Two alleles differ by two nucleotide changes altering one (DRB1*1447 and *1361) amino acid and one allele alters three nucleotides and two amino acids.

  15. [Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified].

    PubMed

    Su, Yu qing; Wei, Tian-li; Yu, Qiong; Liang, Yan-lian; Li, Da-cheng

    2007-10-01

    Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay. Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H. The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status. A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.

  16. Novel splicing, missense, and deletion mutations in seven adenosine deaminase-deficient patients with late/delayed onset of combined immunodeficiency disease. Contribution of genotype to phenotype.

    PubMed Central

    Santisteban, I; Arredondo-Vega, F X; Kelly, S; Mary, A; Fischer, A; Hummell, D S; Lawton, A; Sorensen, R U; Stiehm, E R; Uribe, L

    1993-01-01

    We examined the genetic basis for adenosine deaminase (ADA) deficiency in seven patients with late/delayed onset of immunodeficiency, an underdiagnosed and relatively unstudied condition. Deoxyadenosine-mediated metabolic abnormalities were less severe than in the usual, early-onset disorder. Six patients were compound heterozygotes; 7 of 10 mutations found were novel, including one deletion (delta 1019-1020), three missense (Arg156 > His, Arg101 > Leu, Val177 > Met), and three splicing defects (IVS 5, 5'ss T+6 > A; IVS 10, 5'ss G+1 > A; IVS 10, 3'ss G-34 > A). Four of the mutations generated stop signals at codons 131, 321, 334, and 348; transcripts of all but the last, due to delta 1019-1020, were severely reduced. delta 1019-1020 (like delta 955-959, found in one patient and apparently recurrent) is at a short deletional hot spot. Arg156 > His, the product of which had detectable activity, was found in three patients whose second alleles were unlikely to yield active ADA. The oldest patient diagnosed was homozygous for a single base change in intron 10, which activates a cryptic splice acceptor, resulting in a protein with 100 extra amino acids. We speculate that this "macro ADA," as well as the Arg156 > His, Arg101 > Leu, Ser291 > Leu, and delta 1019-1020 products, may contribute to mild phenotype. Tissue-specific variation in splicing efficiency may also ameliorate disease severity in patients with splicing mutations. Images PMID:8227344

  17. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1.

    PubMed

    Agha, Zehra; Iqbal, Zafar; Azam, Maleeha; Siddique, Maimoona; Willemsen, Marjolein H; Kleefstra, Tjitske; Zweier, Christiane; de Leeuw, Nicole; Qamar, Raheel; van Bokhoven, Hans

    2014-03-15

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy and diabetes mellitus. The two living affected brothers presented with microcephaly, white matter disease of the brain, hyponychia, dysmorphic facial features with synophrys, epilepsy, diabetes mellitus and ID. Genotyping with a 250K SNP array in both affected brothers revealed an 18 MB homozygous region on chromosome 18 p11.21-q12.1 encompassing the SCKL2 locus of the Seckel and Jawad syndromes. Sequencing of the RBBP8 gene, underlying the Seckel and Jawad syndromes, identified the novel mutation c.919A>G, p.Arg307Gly, segregating in a recessive manner in the family. In addition, in the two affected brothers and their mother we have also found a heterozygous 607kb deletion, encompassing exons 13-19 of NRXN1. Bidirectional sequencing of the coding exons of NRXN1 did not reveal any other mutation on the other allele. It thus appears that the phenotype of the mildly affected mother can be explained by the NRXN1 deletion, whereas the more severe and complex microcephalic phenotype of the two affected brothers is due to the simultaneous deletion in NRXN1 and the homozygous missense mutation affecting RBBP8. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Ten Novel HLA-DRB1 Alleles and One Novel DRB3 Allele

    DTIC Science & Technology

    2006-05-31

    BRIEF COMMUNICATION Ten novel HLA-DRB1 alleles and one novel DRB3 allele A. M. Lazaro1, N. K. Steiner1, M. E. Moraes2, J. R. Moraes2, J. Ng1, R. J...accepted for publication 31 May 2005 doi: 10.1111/j.1399-0039.2005.00459.x Abstract Ten novel HLA-DRB1 and one DRB3 alleles are described. Eight of the...substitutions (DRB1*040504, *130103, *160502 and DRB3 *020204). Two alleles differ by two nucleotide changes altering one (DRB1*1447 and *1361) amino acid and

  19. Identification of p.A684V missense mutation in the WFS1 gene as a frequent cause of autosomal dominant optic atrophy and hearing impairment

    PubMed Central

    Rendtorff, Nanna D.; Lodahl, Marianne; Boulahbel, Houda; Johansen, Ida R.; Pandya, Arti; Welch, Katherine O.; Norris, Virginia W.; Arnos, Kathleen S.; Bitner-Glindzicz, Maria; Emery, Sarah B.; Mets, Marilyn B.; Fagerheim, Toril; Eriksson, Kristina; Hansen, Lars; Bruhn, Helene; Möller, Claes; Lindholm, Sture; Ensgård, Stefan; Lesperance, Marci M.; Tranebjærg, Lisbeth

    2011-01-01

    Optic atrophy (OA) and sensorineural hearing loss (SNHL) are key abnormalities in several syndromes, including the recessively inherited Wolfram syndrome, caused by mutations in WFS1. In contrast, the association of autosomal dominant OA and SNHL without other phenotypic abnormalities is rare, and almost exclusively attributed to mutations in the Optic Atrophy-1 gene (OPA1), most commonly the p.R445H mutation. We present eight probands and their families from the US, Sweden, and UK with OA and SNHL, whom we analyzed for mutations in OPA1 and WFS1. Among these families, we found three heterozygous missense mutations in WFS1 segregating with OA and SNHL: p.A684V (six families), and two novel mutations, p.G780S and p.D797Y, all involving evolutionarily conserved amino acids and absent from 298 control chromosomes. Importantly, none of these families harbored the OPA1 p.R445H mutation. No mitochondrial DNA deletions were detected in muscle from one p.A684V patient analyzed. Finally, wolframin p.A684V mutant ectopically expressed in HEK cells showed reduced protein levels compared to wild-type wolframin, strongly indicating that the mutation is disease-causing. Our data support OA and SNHL as a phenotype caused by dominant mutations in WFS1 in these additional eight families. Importantly, our data provide the first evidence that a single, recurrent mutation in WFS1, p.A684V, may be a common cause of ADOA and SNHL, similar to the role played by the p.R445H mutation in OPA1. Our findings suggest that patients who are heterozygous for WFS1 missense mutations should be carefully clinically examined for OA and other manifestations of Wolfram syndrome. PMID:21538838

  20. Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data.

    PubMed

    D'Angelo, Rosalia; Donato, Luigi; Venza, Isabella; Scimone, Concetta; Aragona, Pasquale; Sidoti, Antonina

    2017-04-01

    In the wide horizon of ophthalmologically rare diseases among retinitis pigmentosa forms, Stargardt disease has gradually assumed a significant role due to its heterogeneity. In the present study, we aimed to support one of two opposite hypotheses concerning the causative or protective role of heterozygous c.1268A>G missense variant of the ABCA4 gene in Stargardt disease and in syndromic retinitis pigmentosa. This study was based on a family consisting of three members: proband, age 54, with high myopia, myopic chorioretinitis and retinal dystrophy; wife, age 65, with mild symptoms; daughter, age 29, asymptomatic. After genetic counseling, ABCA4 and RP1 gene analysis was performed. The results highlighted an important genetic picture. The proband was found to carry two variant RP1 SNPs, rs2293869 (c.2953A>T) and rs61739567 (c.6098G>A), and, a wild-type condition for four RP1 polymorphisms, rs444772 (c.2623G>A) and three SNPs in the 'hot-spot' region, exon 4. The proband's wife, instead, showed an opposite condition compared to her husband: a homozygous mutated condition for the first four SNPs analyzed, while the last two were wild-type. Regarding the ABCA4 gene, the proband evidenced a wild-type condition. Furthermore, the wife showed a heterozygous condition of ABCA4 rs3112831 (c.1268A>G). As expected, the daughter presented heterozygosity for all variants of both genes. In conclusion, even though the c.1268A>G missense variant of the ABCA4 gene has often been reported as causative of disease, and in other cases protective of disease, in our family case, the variant appears to reduce or delay the risk of onset of Stargardt disease.

  1. Molecular Genetic and Functional Association of Brugada and Early Repolarization Syndromes with S422L Missense Mutation in KCNJ8

    PubMed Central

    Barajas-Martínez, Hector; Hu, Dan; Ferrer, Tania; Onetti, Carlos G.; Wu, Yuesheng; Burashnikov, Elena; Boyle, Madalene; Surman, Tyler; Urrutia, Janire; Veltmann, Christian; Schimpf, Rainer; Borggrefe, Martin; Wolpert, Christian; Ibrahim, Bassiema B.; Sánchez-Chapula, José Antonio; Winters, Stephen; Haïssaguerre, Michel; Antzelevitch, Charles

    2011-01-01

    Background ATP-sensitive potassium (KATP) cardiac channels consist of inward rectifying channel subunits Kir6.1 or Kir6.2 (encoded by KCNJ8 or KCNJ11) and the sulfonylurea receptor subunits SUR2A (encoded by ABCC9). Objective To examine the association of mutations in KCNJ8 with Brugada (BrS) and early repolarization (ERS) syndromes and elucidate the mechanism underlying the gain of function of KATP channel current (IK-ATP). Methods Direct sequencing of KCNJ8 and other candidate genes was performed on 204 BrS and ERS probands and family members. Whole-cell and inside-out patch clamp methods were used to study mutated channels expressed in TSA201 cells. Results The same missense mutation, p.Ser422Leu (c.1265C>T) in KCNJ8, was identified in 3 BrS and 1 ERS proband, but was absent in 430 alleles from ethnically-matched healthy controls. Additional genetic variants included CACNB2b-D601E. Whole cell patch clamp studies showed a two-fold gain of function of glibenclamide-sensitive IK-ATP when KCNJ8-S422L was co-expressed with SUR2A-wild type. Inside-out patch clamp evaluation yielded a significantly greater IC50 for ATP in the mutant channels (785.5±2 vs. 38.4±3 µM, n=5; p<0.01) pointing to incomplete closing of the KATP channels under normoxic conditions. Patients with a CACNB2b-D601E polymorphism displayed longer QT/QTc intervals, likely due to their effect to induce an increase in ICa-L. Conclusion Our results support the hypothesis that KCNJ8 is a susceptibility gene for Brugada and early repolarization syndromes and point to S422L as a possible hotspot mutation. Our findings suggest that the S422L-induced gain of function in IK-ATP is due to reduced sensitivity to intracellular ATP. PMID:22056721

  2. Molecular genetic and functional association of Brugada and early repolarization syndromes with S422L missense mutation in KCNJ8.

    PubMed

    Barajas-Martínez, Hector; Hu, Dan; Ferrer, Tania; Onetti, Carlos G; Wu, Yuesheng; Burashnikov, Elena; Boyle, Madalene; Surman, Tyler; Urrutia, Janire; Veltmann, Christian; Schimpf, Rainer; Borggrefe, Martin; Wolpert, Christian; Ibrahim, Bassiema B; Sánchez-Chapula, José Antonio; Winters, Stephen; Haïssaguerre, Michel; Antzelevitch, Charles

    2012-04-01

    Adenosine triphosphate (ATP)-sensitive potassium cardiac channels consist of inward-rectifying channel subunits Kir6.1 or Kir6.2 (encoded by KCNJ8 or KCNJ11) and the sulfonylurea receptor subunits SUR2A (encoded by ABCC9). To examine the association of mutations in KCNJ8 with Brugada syndrome (BrS) and early repolarization syndrome (ERS) and to elucidate the mechanism underlying the gain of function of ATP-sensitive potassium channel current. Direct sequencing of KCNJ8 and other candidate genes was performed on 204 BrS and ERS probands and family members. Whole-cell and inside-out patch-clamp methods were used to study mutated channels expressed in TSA201 cells. The same missense mutation, p.Ser422Leu (c.1265C>T) in KCNJ8, was identified in 3 BrS and 1 ERS probands but was absent in 430 alleles from ethnically matched healthy controls. Additional genetic variants included CACNB2b-D601E. Whole-cell patch-clamp studies showed a 2-fold gain of function of glibenclamide-sensitive ATP-sensitive potassium channel current when KCNJ8-S422L was coexpressed with SUR2A-wild type. Inside-out patch-clamp evaluation yielded a significantly greater half maximal inhibitory concentration for ATP in the mutant channels (785.5 ± 2 vs 38.4 ± 3 μM; n = 5; P <.01), pointing to incomplete closing of the ATP-sensitive potassium channels under normoxic conditions. Patients with a CACNB2b-D601E polymorphism displayed longer QT/corrected QT intervals, likely owing to their effect to induce an increase in L-type calcium channel current (I(Ca-L)). Our results support the hypothesis that KCNJ8 is a susceptibility gene for BrS and ERS and point to S422L as a possible hotspot mutation. Our findings suggest that the S422L-induced gain of function in ATP-sensitive potassium channel current is due to reduced sensitivity to intracellular ATP. Copyright © 2012 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

  3. Molecular genetic analysis of ABO blood group variations reveals 29 novel ABO subgroup alleles.

    PubMed

    Cai, Xiaohong; Jin, Sha; Liu, Xi; Fan, Liangfeng; Lu, Qiong; Wang, Jianlian; Shen, Wei; Gong, Songsong; Qiu, Li; Xiang, Dong

    2013-11-01

    Identifying genetic variants of the ABO gene may reveal new biologic mechanisms underlying variant phenotypes of the ABO blood group. We report the molecular genetic analysis of 322 apparently unrelated ABO subgroup individuals in an estimated 2.1 million donors. We performed phenotype investigations by serology studies, analyzed the DNA sequence of the ABO gene by direct sequencing or sequencing after cloning, and evaluated promoter activity by reporter assays. In 62 rare ABO alleles, we identified 29 novel ABO subgroup alleles in 43 apparently unrelated subgroup individuals and their four available pedigrees. Of these alleles, one was a deletion-mutation allele, four were hybrid alleles, and 24 were point-mutation alleles. Most of the point mutations were detected in Exons 6 to 7, while several others were also detected in Exons 1 to 5 or splicing regions. One ABO promoter mutation, -35 to -18 del, was found and verified to reduce promoter activity, as determined by dual luciferase assays. Two mutations, 7G>T and 52C>T, carrying the premature terminal codons E3X and R18X in the 5'-region, were found to be associated with the very weak ABO subgroups "Ael" and "Bel." Twenty-nine ABO subgroup alleles were newly linked to different kinds of ABO variations. We provide the first evidence that promoter abnormality is involved in the formation of weak ABO phenotypes. We also described the first naturally occurring ABO alleles with premature terminal codons in the 5'-region that led to Ael and Bel phenotypes. © 2013 American Association of Blood Banks.

  4. Adenosine deaminase deficiency: genotype-phenotype correlations based on expressed activity of 29 mutant alleles.

    PubMed Central

    Arredondo-Vega, F X; Santisteban, I; Daniels, S; Toutain, S; Hershfield, M S

    1998-01-01

    Adenosine deaminase (ADA) deficiency causes lymphopenia and immunodeficiency due to toxic effects of its substrates. Most patients are infants with severe combined immunodeficiency disease (SCID), but others are diagnosed later in childhood (delayed onset) or as adults (late onset); healthy individuals with "partial" ADA deficiency have been identified. More than 50 ADA mutations are known; most patients are heteroallelic, and most alleles are rare. To analyze the relationship of genotype to phenotype, we quantitated the expression of 29 amino acid sequence-altering alleles in the ADA-deleted Escherichia coli strain SO3834. Expressed ADA activity of wild-type and mutant alleles ranged over five orders of magnitude. The 26 disease-associated alleles expressed 0.001%-0.6% of wild-type activity, versus 5%-28% for 3 alleles from "partials." We related these data to the clinical phenotypes and erythrocyte deoxyadenosine nucleotide (dAXP) levels of 52 patients (49 immunodeficient and 3 with partial deficiency) who had 43 genotypes derived from 42 different mutations, including 28 of the expressed alleles. We reduced this complexity to 13 "genotype categories," ranked according to the potential of their constituent alleles to provide ADA activity. Of 31 SCID patients, 28 fell into 3 genotype categories that could express <=0.05% of wild-type ADA activity. Only 2 of 21 patients with delayed, late-onset, or partial phenotypes had one of these "severe" genotypes. Among 37 patients for whom pretreatment metabolic data were available, we found a strong inverse correlation between red-cell dAXP level and total ADA activity expressed by each patient's alleles in SO3834. Our system provides a quantitative framework and ranking system for relating genotype to phenotype. PMID:9758612

  5. Sequencing of SCN5A identifies rare and common variants associated with cardiac conduction: Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) Consortium.

    PubMed

    Magnani, Jared W; Brody, Jennifer A; Prins, Bram P; Arking, Dan E; Lin, Honghuang; Yin, Xiaoyan; Liu, Ching-Ti; Morrison, Alanna C; Zhang, Feng; Spector, Tim D; Alonso, Alvaro; Bis, Joshua C; Heckbert, Susan R; Lumley, Thomas; Sitlani, Colleen M; Cupples, L Adrienne; Lubitz, Steven A; Soliman, Elsayed Z; Pulit, Sara L; Newton-Cheh, Christopher; O'Donnell, Christopher J; Ellinor, Patrick T; Benjamin, Emelia J; Muzny, Donna M; Gibbs, Richard A; Santibanez, Jireh; Taylor, Herman A; Rotter, Jerome I; Lange, Leslie A; Psaty, Bruce M; Jackson, Rebecca; Rich, Stephen S; Boerwinkle, Eric; Jamshidi, Yalda; Sotoodehnia, Nona

    2014-06-01

    The cardiac sodium channel SCN5A regulates atrioventricular and ventricular conduction. Genetic variants in this gene are associated with PR and QRS intervals. We sought to characterize further the contribution of rare and common coding variation in SCN5A to cardiac conduction. In Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) Consortium Targeted Sequencing Study, we performed targeted exonic sequencing of SCN5A (n=3699, European ancestry individuals) and identified 4 common (minor allele frequency >1%) and 157 rare variants. Common and rare SCN5A coding variants were examined for association with PR and QRS intervals through meta-analysis of European ancestry participants from CHARGE, National Heart, Lung, and Blood Institute's Exome Sequencing Project (n=607), and the UK10K (n=1275) and by examining Exome Sequencing Project African ancestry participants (n=972). Rare coding SCN5A variants in aggregate were associated with PR interval in European and African ancestry participants (P=1.3×10(-3)). Three common variants were associated with PR and QRS interval duration among European ancestry participants and one among African ancestry participants. These included 2 well-known missense variants: rs1805124 (H558R) was associated with PR and QRS shortening in European ancestry participants (P=6.25×10(-4) and P=5.2×10(-3), respectively) and rs7626962 (S1102Y) was associated with PR shortening in those of African ancestry (P=2.82×10(-3)). Among European ancestry participants, 2 novel synonymous variants, rs1805126 and rs6599230, were associated with cardiac conduction. Our top signal, rs1805126 was associated with PR and QRS lengthening (P=3.35×10(-7) and P=2.69×10(-4), respectively) and rs6599230 was associated with PR shortening (P=2.67×10(-5)). By sequencing SCN5A, we identified novel common and rare coding variants associated with cardiac conduction. © 2014 American Heart Association, Inc.

  6. neu mutation in schwannomas induced transplacentally in Syrian golden hamsters by N-nitrosoethylurea: high incidence but low allelic representation.

    PubMed

    Buzard, G S; Enomoto, T; Hongyo, T; Perantoni, A O; Diwan, B A; Devor, D E; Reed, C D; Dove, L F; Rice, J M

    1999-10-01

    Peripheral nerve tumors (PNT) and melanomas induced transplacentally on day 14 of gestation in Syrian golden hamsters by N-nitrosoethylurea were analyzed for activated oncogenes by the NIH 3T3 transfection assay, and for mutations in the neu oncogene by direct sequencing, allele-specific oligonucleotide hybridization, MnlI restriction-fragment-length polymorphism, single-strand conformation polymorphism, and mismatch amplification mutation assays. All (67/67) of the PNT, but none of the melanomas, contained a somatic missense T --> A transversion within the neu oncogene transmembrane domain at a site corresponding to that which also occurs in rat schwannomas transplacentally induced by N-nitrosoethylurea. In only 2 of the 67 individual hamster PNT did the majority of tumor cells appear to carry the mutant neu allele, in contrast to comparable rat schwannomas in which it overwhelmingly predominates. The low fraction of hamster tumor cells carrying the mutation was stable through multiple transplantation passages. In the hamster, as in the rat, specific point-mutational activation of the neu oncogene thus constitutes the major pathway for induction of PNT by transplacental exposure to an alkylating agent, but the low allelic representation of mutant neu in hamster PNT suggests a significant difference in mechanism by which the mutant oncogene acts in this species.

  7. Detection of the MYD88 mutation by the combination of the allele-specific PCR and quenching probe methods.

    PubMed

    Nogami, S; Kawaguchi-Ihara, N; Shiratori, E; Ohtaka, M; Itoh, M; Tohda, S

    2017-04-01

    The MYD88 missense mutation c.794T>C, p.Leu265Pro, is found in patients with Waldenstörm's macroglobulinemia and lymphoma. Direct sequencing, allele-specific PCR (AS-PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and high-resolution melting analysis (HRM) are currently used to detect the mutation; however, they are either time-consuming or have low detection sensitivity. Here, we developed a novel highly sensitive and rapid detection method based on the quenching probe (QP) technique and AS-PCR. A lymphoma cell line heterozygous for the MYD88 mutation, two wild-type cell lines, and two samples from Waldenstörm's macroglobulinemia patients were analyzed by AS-PCR, PCR-RFLP, HRM, and QP, and their detection sensitivity was examined using the mixtures of the mutant and wild-type DNA. For mutation-carrying heterozygous samples, the QP method produced W-shaped melting profiles presenting curves derived from the wild-type and mutant alleles. The QP analysis was performed in 2 h and demonstrated the detection limit of 5%, which was similar to that of the other methods. However, the combination of AS-PCR and QP (AS-QP) improved the sensitivity to 0.62% of the mutant allele. The AS-QP analysis is rapid and minimally improves detection sensitivity compared to the AS-PCR. © 2016 John Wiley & Sons Ltd.

  8. Allele-specific DNA methylation: beyond imprinting.

    PubMed

    Tycko, Benjamin

    2010-10-15

    Allele-specific DNA methylation (ASM) and allele-specific gene expression (ASE) have long been studied in genomic imprinting and X chromosome inactivation. But these types of allelic asymmetries, along with allele-specific transcription factor binding (ASTF), have turned out to be far more pervasive-affecting many non-imprinted autosomal genes in normal human tissues. ASM, ASE and ASTF have now been mapped genome-wide by microarray-based methods and NextGen sequencing. Multiple studies agree that all three types of allelic asymmetries, as well as the related phenomena of expression and methylation quantitative trait loci, are mostly accounted for by cis-acting regulatory polymorphisms. The precise mechanisms by which this occurs are not yet understood, but there are some testable hypotheses and already a few direct clues. Future challenges include achieving higher resolution maps to locate the epicenters of cis-regulated ASM, using this information to test mechanistic models, and applying genome-wide maps of ASE/ASM/ASTF to pinpoint functional regulatory polymorphisms influencing disease susceptibility.

  9. Genetic and structure-function studies of missense mutations in human endothelial lipase.

    PubMed

    Razzaghi, Hamid; Tempczyk-Russell, Anna; Haubold, Kurt; Santorico, Stephanie A; Shokati, Touraj; Christians, Uwe; Churchill, Mair E A

    2013-01-01

    Endothelial lipase (EL) plays a pivotal role in HDL metabolism. We sought to characterize EL and its interaction with HDL as well as its natural variants genetically, functionally and structurally. We screened our biethnic population sample (n = 802) for selected missense mutations (n = 5) and identified T111I as the only common variant. Multiple linear regression analyses in Hispanic subjects revealed an unexpected association between T111I and elevated LDL-C (p-value = 0.012) and total cholesterol (p-value = 0.004). We examined lipase activity of selected missense mutants (n = 10) and found different impacts on EL function, ranging from normal to complete loss of activity. EL-HDL lipidomic analyses indicated that EL has a defined remodeling of HDL without exhaustion of the substrate and a distinct and preference for several fatty acids that are lipid mediators and known for their potent pro- and anti-inflammatory properties. Structural studies using homology modeling revealed a novel α/β motif in the C-domain, unique to EL. The EL dimer was found to have the flexibility to expand and to bind various sizes of HDL particles. The likely impact of the all known missense mutations (n = 18) on the structure of EL was examined using molecular modeling and the impact they may have on EL lipase activity using a novel structure-function slope based on their structural free energy differences. The results of this multidisciplinary approach delineated the impact of EL and its variants on HDL. Moreover, the results suggested EL to have the capacity to modulate vascular health through its role in fatty acid-based signaling pathways.

  10. Missense Mutations in Exons 18–24 of EGFR in Hepatocellular Carcinoma Tissues

    PubMed Central

    Sornmayura, Pattana; Leelaudomlipi, Surasak

    2015-01-01

    Epidermal growth factor receptor (EGFR), a transmembrane tyrosine kinase receptor, plays important roles in various cancers. In nonsmall cell lung cancer (NSCLC), EGFR mutations cluster around the ATP-binding pocket (exons 18–21) and some of these mutations activate the kinase and induce an increased sensitivity to EGFR-tyrosine kinase inhibitors. Nevertheless, data of EGFR mutations in HCC are limited. In this study, we investigated EGFR expression by immunohistochemistry and EGFR mutations (exons 18–24) by PCR cloning and sequencing. EGFR overexpression in HCC and matched nontumor tissues were detected in 13/40 (32.5%) and 10/35 (28.6%), respectively. Moreover, missense and silent mutations were detected in 13/33 (39.4%) and 11/33 (33.3%) of HCC tissues, respectively. The thirteen different missense mutations were p.L730P, p.V742I, p.K757E, p.I780T, p.N808S, p.R831C, p.V851A, p.V897A, p.S912P, p.P937L, p.T940A, p.M947V, and p.M947T. We also found already known SNP, p.Q787Q (CAG>CAA), in 13/33 (39.4%) of HCC tissues. However, no significant association was detected between EGFR mutations and EGFR overexpression, tissue, age, sex, tumor size, AFP, HBsAg, TP53, and Ki-67. Further investigation is warranted to validate the frequency and activity of these missense mutations, as well as their roles in HCC tumorigenesis and in EGFR-targeted therapy. PMID:26436086

  11. BRCA2 hypomorphic missense variants confer moderate risks of breast cancer.

    PubMed

    Shimelis, Hermela; Mesman, Romy L S; Von Nicolai, Catharina; Ehlen, Asa; Guidugli, Lucia; Martin, Charlotte; Calleja, Fabienne Mgr; Meeks, Huong; Hallberg, Emily; Hinton, Jamie; Lilyquist, Jenna; Hu, Chunling; Aalfs, Cora M; Aittomaki, Kristiina; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W; Benitez, Javier J; Bogdanova, Natalia; Bojesen, Stig E; Bolla, Manjeet K; Borresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Broeks, Annegien; Brouwers, Barbara; Bruning, Thomas; Burwinkel, Barbara; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Cheng, Ching-Yu; Choi, Ji-Yeob; Collée, J Margriet; Cox, Angela; Cross, Simon S; Czene, Kamila; Darabi, Hatef; Dennis, Joe; Dork, Thilo; Dos Santos Silva, Isabel; Dunning, Alison M; Fasching, Peter A; Figueroa, Jonine D; Flyger, Henrik; Garcia-Closas, Montserrat; Giles, Graham G; Glendon, Gord; Guenel, Pascal; Haiman, Christopher A; Hall, Per; Hamann, Ute; Hartman, Mikael; Hogervorst, Frans B L; Hollestelle, Antoinette; Hopper, John L; Ito, Hidemi; Jakubowska, Anna; Kang, Daehee; Kosma, Veli-Matti; Kristensen, Vessela; Lai, Kah-Nyin; Lambrechts, Diether; Le Marchand, Loic; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Machackova, Eva; Mannermaa, Arto; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; Miao, Hui; Michailidou, Kyriaki; Milne, Roger L; Muir, Kenneth; Neuhausen, Susan L; Nevanlinna, Heli; Olson, Janet E; Olswold, Curtis; Oosterwijk, Jan C; Osorio, Ana; Peterlongo, Paolo; Peto, Julian; Pharoah, Paul D P; Pylkäs, Katri; Radice, Paolo; Rashid, Muhammad U; Rhenius, Valerie; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Marjanka K; Schoemaker, Minouk J; Seynaeve, Caroline M; Shah, Mitul; Shen, Chen-Yang; Shrubsole, Martha J; Shu, Xiao-Ou; Slager, Susan L; Southey, Melissa C; Stram, Daniel O; Swerdlow, Anthony J; Teo, Soo Hwang; Tomlinson, Ian; Torres, Diana; Truong, Therese; van Asperen, Christi J; van der Kolk, Lizet E; Wang, Qin; Winqvist, Robert; Wu, Anna H; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Leary, Jennifer; Walker, Logan C; Foretova, Lenka; Fostira, Florentia; Claes, Kathleen; Varesco, Liliana; Moghadasi, Setareh; Easton, Douglas F; Spurdle, Amanda B; Devilee, Peter; Vrieling, Harry; Monteiro, Alvaro N; Goldgar, David E; Carreira, Aura; Vreeswijk, Maaike P G; Couch, Fergus J

    2017-03-10

    Breast cancer risks conferred by many germline missense variants in the BRCA1 and BRCA2 genes, often referred to as variants of uncertain significance (VUS), have not been established. In this study, associations between 19 BRCA1 and 33 BRCA2 missense substitution variants and breast cancer risk were investigated through a breast cancer case control study using genotyping data from 38 studies of predominantly European ancestry (41,890 cases and 41,607 controls) and nine studies of Asian ancestry (6,269 cases and 6,624 controls). The BRCA2 c.9104A>C, p.Tyr3035Ser (OR=2.52, p=0.04) and BRCA1 c.5096G>A, p.Arg1699Gln (OR=4.29, p=0.009) variant were associated with moderately increased risks of breast cancer among Europeans, whereas BRCA2 c.7522G>A, p.Gly2508Ser (OR=2.68, p=0.004) and c.8187G>T, p.Lys2729Asn (OR=1.4, p=0.004) were associated with moderate and low risks of breast cancer among Asians. Functional characterization of the BRCA2 variants using four quantitative assays showed reduced BRCA2 activity for p.Tyr3035Ser compared to wildtype. Overall, our results show how BRCA2 missense variants that influence protein function can confer clinically relevant, moderately increased risks of breast cancer, with potential implications for risk management guidelines in women with these specific variants.

  12. E-Cadherin Destabilization Accounts for the Pathogenicity of Missense Mutations in Hereditary Diffuse Gastric Cancer

    PubMed Central

    Simões-Correia, Joana; Figueiredo, Joana; Lopes, Rui; Stricher, François; Oliveira, Carla; Serrano, Luis; Seruca, Raquel

    2012-01-01

    E-cadherin is critical for the maintenance of tissue architecture due to its role in cell-cell adhesion. E-cadherin mutations are the genetic cause of Hereditary Diffuse Gastric Cancer (HDGC) and missense mutations represent a clinical burden, due to the uncertainty of their pathogenic role. In vitro and in vivo, most mutations lead to loss-of-function, although the causal factor is unknown for the majority. We hypothesized that destabilization could account for the pathogenicity of E-cadherin missense mutations in HDGC, and tested our hypothesis using in silico and in vitro tools. FoldX algorithm was used to calculate the impact of each mutation in E-cadherin native-state stability, and the analysis was complemented with evolutionary conservation, by SIFT. Interestingly, HDGC patients harbouring germline E-cadherin destabilizing mutants present a younger age at diagnosis or death, suggesting that the loss of native-state stability of E-cadherin accounts for the disease phenotype. To elucidate the biological relevance of E-cadherin destabilization in HDGC, we investigated a group of newly identified HDGC-associated mutations (E185V, S232C and L583R), of which L583R is predicted to be destabilizing. We show that this mutation is not functional in vitro, exhibits shorter half-life and is unable to mature, due to premature proteasome-dependent degradation, a phenotype reverted by stabilization with the artificial mutation L583I (structurally tolerated). Herein we report E-cadherin structural models suitable to predict the impact of the majority of cancer-associated missense mutations and we show that E-cadherin destabilization leads to loss-of-function in vitro and increased pathogenicity in vivo. PMID:22470475

  13. Missense mutations in the WD40 domain of AHI1 cause non-syndromic retinitis pigmentosa.

    PubMed

    Nguyen, Thanh-Minh T; Hull, Sarah; Roepman, Ronald; van den Born, L Ingeborgh; Oud, Machteld M; de Vrieze, Erik; Hetterschijt, Lisette; Letteboer, Stef J F; van Beersum, Sylvia E C; Blokland, Ellen A; Yntema, Helger G; Cremers, Frans P M; van der Zwaag, Paul A; Arno, Gavin; van Wijk, Erwin; Webster, Andrew R; Haer-Wigman, Lonneke

    2017-09-01

    Recent findings suggesting that Abelson helper integration site 1 (AHI1) is involved in non-syndromic retinal disease have been debated, as the functional significance of identified missense variants was uncertain. We assessed whether AHI1 variants cause non-syndromic retinitis pigmentosa (RP). Exome sequencing was performed in three probands with RP. The effects of the identified missense variants in AHI1 were predicted by three-dimensional structure homology modelling. Ciliary parameters were evaluated in patient's fibroblasts, and recombinant mutant proteins were expressed in ciliated retinal pigmented epithelium cells. In the three patients with RP, three sets of compound heterozygous variants were detected in AHI1 (c.2174G>A; p.Trp725* and c.2258A>T; p.Asp753Val, c.660delC; p.Ser221Glnfs*10 and c.2090C>T; p.Pro697Leu, c.2087A>G; p.His696Arg and c.2429C>T; p.Pro810Leu). All four missense variants were present in the conserved WD40 domain of Jouberin, the ciliary protein encoded by AHI1, with variable predicted implications for the domain structure. No significant changes in the percentage of ciliated cells, nor in cilium length or intraflagellar transport were detected. However, expression of mutant recombinant Jouberin in ciliated cells showed a significantly decreased enrichment at the ciliary base. This report confirms that mutations in AHI1 can underlie autosomal recessive RP. Moreover, it structurally and functionally validates the effect of the RP-associated AHI1 variants on protein function, thus proposing a new genotype-phenotype correlation for AHI1 mutation associated retinal ciliopathies. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. A missense mutation in PMEL17 is associated with the Silver coat color in the horse

    PubMed Central

    Brunberg, Emma; Andersson, Leif; Cothran, Gus; Sandberg, Kaj; Mikko, Sofia; Lindgren, Gabriella

    2006-01-01

    Background The Silver coat color, also called Silver dapple, in the horse is characterized by dilution of the black pigment in the hair. This phenotype shows an autosomal dominant inheritance. The effect of the mutation is most visible in the long hairs of the mane and tail, which are diluted to a mixture of white and gray hairs. Herein we describe the identification of the responsible gene and a missense mutation associated with the Silver phenotype. Results Segregation data on the Silver locus (Z) were obtained within one half-sib family that consisted of a heterozygous Silver colored stallion with 34 offspring and their 29 non-Silver dams. We typed 41 genetic markers well spread over the horse genome, including one single microsatellite marker (TKY284) close to the candidate gene PMEL17 on horse chromosome 6 (ECA6q23). Significant linkage was found between the Silver phenotype and TKY284 (θ = 0, z = 9.0). DNA sequencing of PMEL17 in Silver and non-Silver horses revealed a missense mutation in exon 11 changing the second amino acid in the cytoplasmic region from arginine to cysteine (Arg618Cys). This mutation showed complete association with the Silver phenotype across multiple horse breeds, and was not found among non-Silver horses with one clear exception; a chestnut colored individual that had several Silver offspring when mated to different non-Silver stallions also carried the exon 11 mutation. In total, 64 Silver horses from six breeds and 85 non-Silver horses from 14 breeds were tested for the exon 11 mutation. One additional mutation located in intron 9, only 759 bases from the missense mutation, also showed complete association with the Silver phenotype. However, as one could expect to find several non-causative mutations completely associated with the Silver mutation, we argue that the missense mutation is more likely to be causative. Conclusion The present study shows that PMEL17 causes the Silver coat color in the horse and enable genetic testing for

  15. Making Sense of Missense in the Lynch Syndrome: The Clinical Perspective

    PubMed Central

    Lynch, Henry T.; Jascur, Thomas; Lanspa, Stephen; Boland, C. Richard

    2010-01-01

    The DNA mismatch repair system provides critical genetic housekeeping, and its failure is associated with tumorigenesis. Through distinct domains on the DNA mismatch repair proteins, the system recognizes and repairs errors occurring during DNA synthesis, but signals apoptosis when the DNA damage cannot be repaired. Certain missense mutations in the mismatch repair genes can selectively alter just one of these functions. This impacts the clinical features of tumors associated with defective DNA mismatch repair activity. New work reported by Xie et al. in this issue of the journal (beginning on page XXX) adds to the understanding of DNA mismatch repair. PMID:20978117

  16. Genomic analysis of hybrid rice varieties reveals numerous superior alleles that contribute to heterosis.

    PubMed

    Huang, Xuehui; Yang, Shihua; Gong, Junyi; Zhao, Yan; Feng, Qi; Gong, Hao; Li, Wenjun; Zhan, Qilin; Cheng, Benyi; Xia, Junhui; Chen, Neng; Hao, Zhongna; Liu, Kunyan; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Zhang, Lei; Fan, Danlin; Zhou, Congcong; Lu, Yiqi; Weng, Qijun; Wang, Zi-Xuan; Li, Jiayang; Han, Bin

    2015-02-05

    Exploitation of heterosis is one of the most important applications of genetics in agriculture. However, the genetic mechanisms of heterosis are only partly understood, and a global view of heterosis from a representative number of hybrid combinations is lacking. Here we develop an integrated genomic approach to construct a genome map for 1,495 elite hybrid rice varieties and their inbred parental lines. We investigate 38 agronomic traits and identify 130 associated loci. In-depth analyses of the effects of heterozygous genotypes reveal that there are only a few loci with strong overdominance effects in hybrids, but a strong correlation is observed between the yield and the number of superior alleles. While most parental inbred lines have only a small number of superior alleles, high-yielding hybrid varieties have several. We conclude that the accumulation of numerous rare superior alleles with positive dominance is an important contributor to the heterotic phenomena.

  17. How allele frequency and study design affect association test statistics with misrepresentation errors.

    PubMed

    Escott-Price, Valentina; Ghodsi, Mansoureh; Schmidt, Karl Michael

    2014-04-01

    We evaluate the effect of genotyping errors on the type-I error of a general association test based on genotypes, showing that, in the presence of errors in the case and control samples, the test statistic asymptotically follows a scaled non-central $\\chi ^2$ distribution. We give explicit formulae for the scaling factor and non-centrality parameter for the symmetric allele-based genotyping error model and for additive and recessive disease models. They show how genotyping errors can lead to a significantly higher false-positive rate, growing with sample size, compared with the nominal significance levels. The strength of this effect depends very strongly on the population distribution of the genotype, with a pronounced effect in the case of rare alleles, and a great robustness against error in the case of large minor allele frequency. We also show how these results can be used to correct $p$-values.

  18. Do Structural Missense Variants in the ATM Gene Found in Women With Breast Cancer Cause Breast Cancer in "Knock-in" Mouse Strains?

    DTIC Science & Technology

    2006-04-01

    W81XWH-05-1-0282 TITLE: Do Structural Missense Variants in the ATM Gene Found in Women with Breast Cancer Cause Breast Cancer in "Knock-in...5a. CONTRACT NUMBER Do Structural Missense Variants in the ATM Gene Found in Women with Breast Cancer Cause Breast Cancer in "Knock-in" Mouse...human cohort-specific missense mutations will develop breast cancer with dominant inheritance in a subset of animals. It also is hypothesized that

  19. AlleleSeq: analysis of allele-specific expression and binding in a network framework.

    PubMed

    Rozowsky, Joel; Abyzov, Alexej; Wang, Jing; Alves, Pedro; Raha, Debasish; Harmanci, Arif; Leng, Jing; Bjornson, Robert; Kong, Yong; Kitabayashi, Naoki; Bhardwaj, Nitin; Rubin, Mark; Snyder, Michael; Gerstein, Mark

    2011-08-02

    To study allele-specific expression (ASE) and binding (ASB), that is, differences between the maternally and paternally derived alleles, we have developed a computational pipeline (AlleleSeq). Our pipeline initially constructs a diploid personal genome sequence (and corresponding personalized gene annotation) using genomic sequence variants (SNPs, indels, and structural variants), and then identifies allele-specific events with significant differences in the number of mapped reads between maternal and paternal alleles. There are many technical challenges in the construction and alignment of reads to a personal diploid genome sequence that we address, for example, bias of reads mapping to the reference allele. We have applied AlleleSeq to variation data for NA12878 from the 1000 Genomes Project as well as matched, deeply sequenced RNA-Seq and ChIP-Seq data sets generated for this purpose. In addition to observing fairly widespread allele-specific behavior within individual functional genomic data sets (including results consistent with X-chromosome inactivation), we can study the interaction between ASE and ASB. Furthermore, we investigate the coordination between ASE and ASB from multiple transcription factors events using a regulatory network framework. Correlation analyses and network motifs show mostly coordinated ASB and ASE.

  20. Forensic Loci Allele Database (FLAD): Automatically generated, permanent identifiers for sequenced forensic alleles.

    PubMed

    Van Neste, Christophe; Van Criekinge, Wim; Deforce, Dieter; Van Nieuwerburgh, Filip

    2016-01-01

    It is difficult to predict if and when massively parallel sequencing of forensic STR loci will replace capillary electrophoresis as the new standard technology in forensic genetics. The main benefits of sequencing are increased multiplexing scales and SNP detection. There is not yet a consensus on how sequenced profiles should be reported. We present the Forensic Loci Allele Database (FLAD) service, made freely available on http://forensic.ugent.be/FLAD/. It offers permanent identifiers for sequenced forensic alleles (STR or SNP) and their microvariants for use in forensic allele nomenclature. Analogous to Genbank, its aim is to provide permanent identifiers for forensically relevant allele sequences. Researchers that are developing forensic sequencing kits or are performing population studies, can register on http://forensic.ugent.be/FLAD/ and add loci and allele sequences with a short and simple application interface (API). Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. An integrated computational approach can classify VHL missense mutations according to risk of clear cell renal carcinoma

    PubMed Central

    Gossage, Lucy; Pires, Douglas E. V.; Olivera-Nappa, Álvaro; Asenjo, Juan; Bycroft, Mark; Blundell, Tom L.; Eisen, Tim

    2014-01-01

    Mutations in the von Hippel–Lindau (VHL) gene are pathogenic in VHL disease, congenital polycythaemia and clear cell renal carcinoma (ccRCC). pVHL forms a ternary complex with elongin C and elongin B, critical for pVHL stability and function, which interacts with Cullin-2 and RING-box protein 1 to target hypoxia-inducible factor for polyubiquitination and proteasomal degradation. We describe a comprehensive database of missense VHL mutations linked to experimental and clinical data. We use predictions from in silico tools to link the functional effects of missense VHL mutations to phenotype. The risk of ccRCC in VHL disease is linked to the degree of destabilization resulting from missense mutations. An optimized binary classification system (symphony), which integrates predictions from five in silico methods, can predict the risk of ccRCC associated with VHL missense mutations with high sensitivity and specificity. We use symphony to generate predictions for risk of ccRCC for all possible VHL missense mutations and present these predictions, in association with clinical and experimental data, in a publically available, searchable web server. PMID:24969085

  2. An integrated computational approach can classify VHL missense mutations according to risk of clear cell renal carcinoma.

    PubMed

    Gossage, Lucy; Pires, Douglas E V; Olivera-Nappa, Álvaro; Asenjo, Juan; Bycroft, Mark; Blundell, Tom L; Eisen, Tim

    2014-11-15

    Mutations in the von Hippel-Lindau (VHL) gene are pathogenic in VHL disease, congenital polycythaemia and clear cell renal carcinoma (ccRCC). pVHL forms a ternary complex with elongin C and elongin B, critical for pVHL stability and function, which interacts with Cullin-2 and RING-box protein 1 to target hypoxia-inducible factor for polyubiquitination and proteasomal degradation. We describe a comprehensive database of missense VHL mutations linked to experimental and clinical data. We use predictions from in silico tools to link the functional effects of missense VHL mutations to phenotype. The risk of ccRCC in VHL disease is linked to the degree of destabilization resulting from missense mutations. An optimized binary classification system (symphony), which integrates predictions from five in silico methods, can predict the risk of ccRCC associated with VHL missense mutations with high sensitivity and specificity. We use symphony to generate predictions for risk of ccRCC for all possible VHL missense mutations and present these predictions, in association with clinical and experimental data, in a publically available, searchable web server.

  3. Molecular analysis of Sanfilippo syndrome type C in Spain: seven novel HGSNAT mutations and characterization of the mutant alleles.

    PubMed

    Canals, I; Elalaoui, S C; Pineda, M; Delgadillo, V; Szlago, M; Jaouad, I C; Sefiani, A; Chabás, A; Coll, M J; Grinberg, D; Vilageliu, L

    2011-10-01

    The Sanfilippo syndrome type C [mucopolysaccharidosis IIIC (MPS IIIC)] is caused by mutations in the HGSNAT gene, encoding an enzyme involved in heparan sulphate degradation. We report the first molecular study on several Spanish Sanfilippo syndrome type C patients. Seven Spanish patients, one Argentinean and three Moroccan patients were analysed. All mutant alleles were identified and comprised nine distinct mutant alleles, seven of which were novel, including four missense mutations (p.A54V, p.L113P, p.G424V and p.L445P) and three splicing mutations due to two point mutations (c.633+1G>A and c.1378-1G>A) and an intronic deletion (c.821-31_821-13del). Furthermore, we found a new single nucleotide polymorphism (SNP) (c.564-98T>C). The two most frequent changes were the previously described c.372-2A>G and c.234+1G>A mutations. All five splicing mutations were experimentally confirmed by studies at the RNA level, and a minigene experiment was carried out in one case for which no fibroblasts were available. Expression assays allowed us to show the pathogenic effect of the four novel missense mutations and to confirm that the already known c.710C>A (p.P237Q) is a non-pathogenic SNP. Haplotype analyses suggested that the two mutations (c.234+1G>A and c.372-2A>G) that were present in more than one patient have a common origin, including one (c.234+1G>A) that was found in Spanish and Moroccan patients.

  4. Transformation of QTL genotypic effects to allelic effects

    PubMed Central

    Nagamine, Yoshitaka

    2005-01-01

    The genotypic and allelic effect models are equivalent in terms of QTL detection in a simple additive model, but the QTL allelic model has the advantage of providing direct information for marker-assisted selection. However, the allelic matrix is four times as large as the genotypic IBD matrix, causing computational problems, especially in genome scans examining multiple positions. Transformation from genotypic to allelic effects, after estimating the genotypic effects with a smaller IBD matrix, can solve this problem. Although the validity of transformation from genotypic to allelic effects has been disputed, this work proves that transformation can successfully yield unique allelic effects when genotypic and allelic IBD matrixes exist. PMID:16093016

  5. HLA class I-mediated control of HIV-1 in the Japanese population, in which the protective HLA-B*57 and HLA-B*27 alleles are absent.

    PubMed

    Naruto, Takuya; Gatanaga, Hiroyuki; Nelson, George; Sakai, Keiko; Carrington, Mary; Oka, Shinichi; Takiguchi, Masafumi

    2012-10-01

    We investigated the effect of HLA class I alleles on clinical parameters for HIV-1 disease progression in the Japanese population, where two strongly protective alleles, HLA-B*57 and HLA-B*27, are virtually nonexistent. HLA-B alleles showed a dominant role, primarily through HLA-B*67:01 and the HLA-B*52:01-C*12:02 haplotype. Neither a rare-allele nor a heterozygote advantage was found, suggesting that the effect of HLA alleles in the Japanese population is either different from those observed in Africans and Caucasians or undetectable due to limited power.

  6. Nonketotic hyperglycinemia: Functional assessment of missense variants in GLDC to understand phenotypes of the disease.

    PubMed

    Bravo-Alonso, Irene; Navarrete, Rosa; Arribas-Carreira, Laura; Perona, Almudena; Abia, David; Couce, María Luz; García-Cazorla, Angels; Morais, Ana; Domingo, Rosario; Ramos, María Antonia; Swanson, Michael A; Van Hove, Johan L K; Ugarte, Magdalena; Pérez, Belén; Pérez-Cerdá, Celia; Rodríguez-Pombo, Pilar

    2017-02-28

    The rapid analysis of genomic data is providing effective mutational confirmation in patients with clinical and biochemical hallmarks of a specific disease. This is the case for nonketotic hyperglycinemia (NKH), a Mendelian disorder causing seizures in neonates and early-infants, primarily due to mutations in the GLDC gene. However, understanding the impact of missense variants identified in this gene is a major challenge for the application of genomics into clinical practice. Herein, a comprehensive functional and structural analysis of 19 GLDC missense variants identified in a cohort of 26 NKH patients was performed. Mutant cDNA constructs were expressed in COS7 cells followed by enzymatic assays and Western blot analysis of the GCS P-protein to assess the residual activity and mutant protein stability. Structural analysis, based on molecular modeling of the 3D structure of GCS P-protein, was also performed. We identify hypomorphic variants that produce attenuated phenotypes with improved prognosis of the disease. Structural analysis allows us to interpret the effects of mutations on protein stability and catalytic activity, providing molecular evidence for clinical outcome and disease severity. Moreover, we identify an important number of mutants whose loss-of-functionality is associated with instability and, thus, are potential targets for rescue using folding therapeutic approaches.

  7. Molecular investigation of the functional relevance of missense variants of ICAM-1.

    PubMed

    Vischer, Peter; Telgmann, Ralph; Schmitz, Boris; Hasenkamp, Sandra; Schmidt-Petersen, Klaus; Beining, Katrin; Huge, Andreas; Paul, Martin; Amarenco, Pierre; Cambien, François; Brand, Eva; Brand-Herrmann, Stefan-Martin

    2008-11-01

    In genome-wide studies, the intercellular adhesion molecule-1 (ICAM-1) locus has been associated with cardiovascular and inflammatory bowel diseases. To determine the functional relevance of five missense ICAM-1 variants (G241R; I316V; P352L; K469E; R478W), we generated wild-type and variant proteins [M2(241R); M3(469E); M4(352L); M5(478W); M6(316V); M7(352L/469E)] and transiently transfected CV1 cells. Reverse transcription PCR, western blot, and ELISA did not reveal any differences in mRNA and protein expression levels for any construct. Conversely, in pulse-chase experiments, compared with wild-type (90-120 min), M3 and M5 possessed a prolonged half-life of approximately 150 min, whereas M2, M4, and M7 displayed a decreased half-life of approximately 60-75 min, implying differences in protein degradation. Our results do not indicate a major impact of missense variants on ICAM-1 biological function, even if G241R and K469E were functional in pulse-chase experiments. Whether these differences in protein stability exert measurable functional consequences needs to be elucidated further.

  8. Missense mutation in mouse GALC mimics human gene defect and offers new insights into Krabbe disease

    PubMed Central

    Potter, Gregory B.; Santos, Marta; Davisson, Muriel T.; Rowitch, David H.; Marks, Dan L.; Bongarzone, Ernesto R.; Petryniak, Magdalena A.

    2013-01-01

    Krabbe disease is a devastating pediatric leukodystrophy caused by mutations in the galactocerebrosidase (GALC) gene. A significant subset of the infantile form of the disease is due to missense mutations that result in aberrant protein production. The currently used mouse model, twitcher, has a nonsense mutation not found in Krabbe patients, although it is similar to the human 30 kb deletion in abrogating GALC expression. Here, we identify a spontaneous mutation in GALC, GALCtwi-5J, that precisely matches the E130K missense mutation in patients with infantile Krabbe disease. GALCtwi-5J homozygotes show loss of enzymatic activity despite normal levels of precursor protein, and manifest a more severe phenotype than twitcher, with half the life span. Although neuropathological hallmarks such as gliosis, globoid cells and psychosine accumulation are present throughout the nervous system, the CNS does not manifest significant demyelination. In contrast, the PNS is severely hypomyelinated and lacks large diameter axons, suggesting primary dysmyelination, rather than a demyelinating process. Our data indicate that early demise is due to mechanisms other than myelin loss and support an important role for neuroinflammation in Krabbe disease progression. Furthermore, our results argue against a causative relationship between psychosine accumulation, white matter loss and gliosis. PMID:23620143

  9. Novel LINS1 missense mutation in a family with non-syndromic intellectual disability.

    PubMed

    Sheth, Jayesh; Ranjan, Gyan; Shah, Krati; Bhavsar, Riddhi; Sheth, Frenny

    2017-04-01

    Newer sequencing technologies decipher molecular variations and increase the knowledge of pathogenesis of complex diseases like intellectual disability (ID), affecting 2-3% of the population. We report a novel family with a missense mutation in LINS1 as a cause for non-syndromic ID. Clinical exome sequencing for ID related genes carried out for a male with dysmorphism, mutism, and cognitive delay was uninformative. Subsequently, "pathogenic" and "likely pathogenic" variants associated with other inherited disorders were searched for as secondary findings. Further, PCR-RFLP carried out in other family members confirmed the result. A novel missense variant (c.937G>A) in exon 5 of LINS1 was detected in the proband. His affected elder brother was homozygous and the parents were heterozygous respectively, for the mutation. No mutation was observed in his unaffected sister. Mutations in LINS1 were suspected in this non-syndromic ID case with mutism. LINS1 alterations affect ELAV1 expression and result in reduction in the commissural axonal growth, thus affecting peripheral and central neuronal function. LINS1 acts in association with β-catenin to influence WNT1 signaling. It is hypothesized that mutations in LINS1 may alter HuR expression during neural differentiation, leading to ID in humans. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. Novel missense mutation in the EDA1 gene identified in a family with hypohidrotic ectodermal dysplasia.

    PubMed

    Pozo-Molina, Glustein; Reyes-Reali, Julia; Mendoza-Ramos, María Isabel; Villalobos-Molina, Rafael; Garrido-Guerrero, Efraín; Méndez-Cruz, Adolfo René

    2015-07-01

    Hypohidrotic ectodermal dysplasia (HED) is a human genetic disorder that affects structures of ectodermal origin such as hair, teeth, and sweat glands. Although there are autosomal recessive and dominant forms, X-linked (XL) is the most frequent form of the disease. This XL-HED phenotype is associated with mutations in the gene encoding the transmembrane protein ectodysplasin-1 (EDA1). We report the clinical and molecular analysis of a novel mutation in exon 1 affecting the transmembrane domain of the protein. We have screened 20 members of a family from Yucatán, México, nine men and 11 women, searching clinical and histopathological signs of HED. We searched mutations in EDA1 gene from patients with XL-HED, carriers, and controls. We identified seven men with clinical characteristics of HED showing short toes and plantar hyperkeratosis not reported previously in patients with HED. A mutational study of the EDA1 gene showed that all seven patients with HED carry a novel missense mutation of the nucleotide 409 (c.409T>C) in exon 1, which changes p.Leu56-Pro in the protein amino acid sequence; five women are heterozygous compatible with carrier status. We found a novel missense mutation in exon 1 of the EDA1 gene in a putative Mayan family from México with XL-HED. We identified in this population some novel clinical signs of HED. © 2015 The International Society of Dermatology.

  11. Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene.

    PubMed Central

    Romeo, G; Hassan, H J; Staempfli, S; Roncuzzi, L; Cianetti, L; Leonardi, A; Vicente, V; Mannucci, P M; Bertina, R; Peschle, C

    1987-01-01

    The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHI digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with approximately 50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed us to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC----GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees. Images PMID:2437584

  12. The ZZ Domain of Dystrophin in DMD: Making Sense of Missense Mutations

    PubMed Central

    Vulin, Adeline; Wein, Nicolas; Strandjord, Dana M.; Johnson, Eric K.; Findlay, Andrew R.; Maiti, Baijayanta; Howard, Michael T.; Kaminoh, Yuuki J.; Taylor, Laura E.; Simmons, Tabatha R.; Ray, Will C.; Montanaro, Federica; Ervasti, Jim M.; Flanigan, Kevin M.

    2014-01-01

    Duchenne muscular dystrophy (DMD) is associated with the loss of dystrophin, which plays an important role in myofiber integrity via interactions with β-dystroglycan and other members of the transmembrane dystrophin-associated protein complex. The ZZ domain, a cysteine-rich zinc-finger domain near the dystrophin C-terminus, is implicated in forming a stable interaction between dystrophin and β-dystroglycan, but the mechanism of pathogenesis of ZZ missense mutations has remained unclear because not all such mutations have been shown to alter β-dystroglycan binding in previous experimental systems. We engineered three ZZ mutations (p.Cys3313Phe, p.Asp3335His, and p.Cys3340Tyr) into a short construct similar to the Dp71 dystrophin isoform for in vitro and in vivo studies and delineated their effect on protein expression, folding properties, and binding partners. Our results demonstrate two distinct pathogenic mechanisms for ZZ missense mutations. The cysteine mutations result in diminished or absent subsarcolemmal expression because of protein instability, likely due to misfolding. In contrast, the aspartic acid mutation disrupts binding with β-dystroglycan despite an almost normal expression at the membrane, confirming a role for the ZZ domain in β-dystroglycan binding but surprisingly demonstrating that such binding is not required for subsarcolemmal localization of dystrophin, even in the absence of actin binding domains. PMID:24302611

  13. Uncoupling the Pleiotropic Phenotypes of clk-1 with tRNA Missense Suppressors in Caenorhabditis elegans

    PubMed Central

    Branicky, Robyn; Nguyen, Phuong Anh Thi; Hekimi, Siegfried

    2006-01-01

    clk-1 encodes a demethoxyubiquinone (DMQ) hydroxylase that is necessary for ubiquinone biosynthesis. When Caenorhabditis elegans clk-1 mutants are grown on bacteria that synthesize ubiquinone (UQ), they are viable but have a pleiotropic phenotype that includes slowed development, behaviors, and aging. However, when grown on UQ-deficient bacteria, the mutants arrest development transiently before growing up to become sterile adults. We identified nine suppressors of the missense mutation clk-1(e2519), which harbors a Glu-to-Lys substitution. All suppress the mutant phenotypes on both UQ-replete and UQ-deficient bacteria. However, each mutant suppresses a different subset of phenotypes, indicating that most phenotypes can be uncoupled from each other. In addition, all suppressors restore the ability to synthesize exceedingly small amounts of UQ, although they still accumulate the precursor DMQ, suggesting that the presence of DMQ is not responsible for the Clk-1 phenotypes. We cloned six of the suppressors, and all encode tRNAGlu genes whose anticodons are altered to read the substituted Lys codon of clk-1(e2519). To our knowledge, these suppressors represent the first missense suppressors identified in any metazoan. The pattern of suppression we observe suggests that the individual members of the tRNAGlu family are expressed in different tissues and at different levels. PMID:16648490

  14. Missense mutations in progranulin gene associated with frontotemporal lobar degeneration: study of pathogenetic features

    PubMed Central

    Karch, Celeste M; Ezerskiy, Lubov; Redaelli, Veronica; Giovagnoli, Annarita; Tiraboschi, Pietro; Pelliccioni, Giuseppe; Pelliccioni, Paolo; Kapetis, Dimos; Ilaria, D'Amato; Piccoli, Elena; Ferretti, Maria Giulia; Fabrizio, Tagliavini; Rossi, Giacomina

    2015-01-01

    GRN, the gene coding for the progranulin (PGRN), was recognized as a gene linked to frontotemporal lobar degeneration (FTLD). The first mutations identified were null mutations giving rise to haploinsufficiency. Missense mutations were subsequently detected but only a small subset has been functionally investigated. We identified missense mutations (C105Y, A199V and R298H) in FTLD cases with family history and/or with low plasma PGRN levels. The aim of this study was to determine their pathogenicity. We performed functional studies, analyzing PGRN expression, secretion and cleavage by elastase. GRN C105Y affected both secretion and elastase cleavage, likely representing a pathogenic mutation. GRN A199V did not alter the physiological properties of PGRN and GRN R298H produced only moderate effects on PGRN secretion, indicating that their pathogenicity is uncertain. In the absence of strong segregation data and neuropathological examinations, genetic, biomarker, and functional studies can be applied to an algorithm to assess the likelihood of pathogenicity for a mutation. This information can improve our understanding of the complex mechanisms by which GRN mutations lead to FTLD. PMID:26652843

  15. MSV3d: database of human MisSense Variants mapped to 3D protein structure.

    PubMed

    Luu, Tien-Dao; Rusu, Alin-Mihai; Walter, Vincent; Ripp, Raymond; Moulinier, Luc; Muller, Jean; Toursel, Thierry; Thompson, Julie D; Poch, Olivier; Nguyen, Hoan

    2012-01-01

    The elucidation of the complex relationships linking genotypic and phenotypic variations to protein structure is a major challenge in the post-genomic era. We present MSV3d (Database of human MisSense Variants mapped to 3D protein structure), a new database that contains detailed annotation of missense variants of all human proteins (20 199 proteins). The multi-level characterization includes details of the physico-chemical changes induced by amino acid modification, as well as information related to the conservation of the mutated residue and its position relative to functional features in the available or predicted 3D model. Major releases of the database are automatically generated and updated regularly in line with the dbSNP (database of Single Nucleotide Polymorphism) and SwissVar releases, by exploiting the extensive Décrypthon computational grid resources. The database (http://decrypthon.igbmc.fr/msv3d) is easily accessible through a simple web interface coupled to a powerful query engine and a standard web service. The content is completely or partially downloadable in XML or flat file formats. Database URL: http://decrypthon.igbmc.fr/msv3d.

  16. The impact of low-frequency and rare variants on lipid levels

    PubMed Central

    Surakka, Ida; Horikoshi, Momoko; Mägi, Reedik; Sarin, Antti-Pekka; Mahajan, Anubha; Lagou, Vasiliki; Marullo, Letizia; Ferreira, Teresa; Miraglio, Benjamin; Timonen, Sanna; Kettunen, Johannes; Pirinen, Matti; Karjalainen, Juha; Thorleifsson, Gudmar; Hägg, Sara; Hottenga, Jouke-Jan; Isaacs, Aaron; Ladenvall, Claes; Beekman, Marian; Esko, Tõnu; Ried, Janina S; Nelson, Christopher P; Willenborg, Christina; Gustafsson, Stefan; Westra, Harm-Jan; Blades, Matthew; de Craen, Anton JM; de Geus, Eco J; Deelen, Joris; Grallert, Harald; Hamsten, Anders; Havulinna, Aki S.; Hengstenberg, Christian; Houwing-Duistermaat, Jeanine J; Hyppönen, Elina; Karssen, Lennart C; Lehtimäki, Terho; Lyssenko, Valeriya; Magnusson, Patrik KE; Mihailov, Evelin; Müller-Nurasyid, Martina; Mpindi, John-Patrick; Pedersen, Nancy L; Penninx, Brenda WJH; Perola, Markus; Pers, Tune H; Peters, Annette; Rung, Johan; Smit, Johannes H; Steinthorsdottir, Valgerdur; Tobin, Martin D; Tsernikova, Natalia; van Leeuwen, Elisabeth M; Viikari, Jorma S; Willems, Sara M; Willemsen, Gonneke; Schunkert, Heribert; Erdmann, Jeanette; Samani, Nilesh J; Kaprio, Jaakko; Lind, Lars; Gieger, Christian; Metspalu, Andres; Slagboom, P Eline; Groop, Leif; van Duijn, Cornelia M; Eriksson, Johan G; Jula, Antti; Salomaa, Veikko; Boomsma, Dorret I; Power, Christine; Raitakari, Olli T; Ingelsson, Erik; Järvelin, Marjo-Riitta; Stefansson, Kari; Franke, Lude; Ikonen, Elina; Kallioniemi, Olli; Pietiäinen, Vilja; Lindgren, Cecilia M; Thorsteinsdottir, Unnur; Palotie, Aarno; McCarthy, Mark I; Morris, Andrew P; Prokopenko, Inga; Ripatti, Samuli

    2016-01-01

    Using a genome-wide screen of 9.6 million genetic variants achieved through 1000 Genomes imputation in 62,166 samples, we identify association to lipids in 93 loci including 79 previously identified loci with new lead-SNPs, 10 new loci, 15 loci with a low-frequency and 10 loci with missense lead-SNPs, and, 2 loci with an accumulation of rare variants. In six loci, SNPs with established function in lipid genetics (CELSR2, GCKR, LIPC, and APOE), or candidate missense mutations with predicted damaging function (CD300LG and TM6SF2), explained the locus associations. The low-frequency variants increased the proportion of variance explained, particularly for LDL-C and TC. Altogether, our results highlight the impact of low-frequency variants in complex traits and show that imputation offers a cost-effective alternative to re-sequencing. PMID:25961943

  17. The impact of low-frequency and rare variants on lipid levels.

    PubMed

    Surakka, Ida; Horikoshi, Momoko; Mägi, Reedik; Sarin, Antti-Pekka; Mahajan, Anubha; Lagou, Vasiliki; Marullo, Letizia; Ferreira, Teresa; Miraglio, Benjamin; Timonen, Sanna; Kettunen, Johannes; Pirinen, Matti; Karjalainen, Juha; Thorleifsson, Gudmar; Hägg, Sara; Hottenga, Jouke-Jan; Isaacs, Aaron; Ladenvall, Claes; Beekman, Marian; Esko, Tõnu; Ried, Janina S; Nelson, Christopher P; Willenborg, Christina; Gustafsson, Stefan; Westra, Harm-Jan; Blades, Matthew; de Craen, Anton J M; de Geus, Eco J; Deelen, Joris; Grallert, Harald; Hamsten, Anders; Havulinna, Aki S; Hengstenberg, Christian; Houwing-Duistermaat, Jeanine J; Hyppönen, Elina; Karssen, Lennart C; Lehtimäki, Terho; Lyssenko, Valeriya; Magnusson, Patrik K E; Mihailov, Evelin; Müller-Nurasyid, Martina; Mpindi, John-Patrick; Pedersen, Nancy L; Penninx, Brenda W J H; Perola, Markus; Pers, Tune H; Peters, Annette; Rung, Johan; Smit, Johannes H; Steinthorsdottir, Valgerdur; Tobin, Martin D; Tsernikova, Natalia; van Leeuwen, Elisabeth M; Viikari, Jorma S; Willems, Sara M; Willemsen, Gonneke; Schunkert, Heribert; Erdmann, Jeanette; Samani, Nilesh J; Kaprio, Jaakko; Lind, Lars; Gieger, Christian; Metspalu, Andres; Slagboom, P Eline; Groop, Leif; van Duijn, Cornelia M; Eriksson, Johan G; Jula, Antti; Salomaa, Veikko; Boomsma, Dorret I; Power, Christine; Raitakari, Olli T; Ingelsson, Erik; Järvelin, Marjo-Riitta; Thorsteinsdottir, Unnur; Franke, Lude; Ikonen, Elina; Kallioniemi, Olli; Pietiäinen, Vilja; Lindgren, Cecilia M; Stefansson, Kari; Palotie, Aarno; McCarthy, Mark I; Morris, Andrew P; Prokopenko, Inga; Ripatti, Samuli

    2015-06-01

    Using a genome-wide screen of 9.6 million genetic variants achieved through 1000 Genomes Project imputation in 62,166 samples, we identify association to lipid traits in 93 loci, including 79 previously identified loci with new lead SNPs and 10 new loci, 15 loci with a low-frequency lead SNP and 10 loci with a missense lead SNP, and 2 loci with an accumulation of rare variants. In six loci, SNPs with established function in lipid genetics (CELSR2, GCKR, LIPC and APOE) or candidate missense mutations with predicted damaging function (CD300LG and TM6SF2) explained the locus associations. The low-frequency variants increased the proportion of variance explained, particularly for low-density lipoprotein cholesterol and total cholesterol. Altogether, our results highlight the impact of low-frequency variants in complex traits and show that imputation offers a cost-effective alternative to resequencing.

  18. Allelic Dropout Can Cause False-Positive Results for Prader-Willi and Angelman Syndrome Testing

    PubMed Central

    Hussain Askree, Syed; Hjelm, Lawrence N.; Ali Pervaiz, Muhammad; Adam, Margaret; Bean, Lora J.H.; Hedge, Madhuri; Coffee, Bradford

    2011-01-01

    The diagnosis of many genetic disorders relies on a combination of clinical suspicion and confirmatory genetic testing. Our laboratory uses a standard methylation-sensitive PCR (MSP) to target the differentially methylated SNRPN gene to test for Prader-Willi syndrome (PWS) and Angelman syndrome. One patient, a 27-month-old female, who lacked the classical clinical features of PWS, but had a molecular diagnosis of PWS by MSP by another laboratory, had repeat testing in our laboratory. Testing by MSP in our laboratory also identified an apparent loss of the unmethylated paternal allele, consistent with a diagnosis of PWS. Confirmatory testing using Southern blot analysis with a methylation-sensitive restriction enzyme showed a normal pattern of methylation, detecting both the methylated maternal and unmethylated paternal alleles. To investigate these discrepant results, we amplified and sequenced the SNRPN locus in this patient and identified a single nucleotide change within the binding site for the unmethylated DNA-specific primer. These results indicate this nucleotide change led to allelic dropout in the MSP analysis, yielding the false-positive result. Subsequently, MSP analysis using an alternate primer set that was developed by our laboratory detected both methylated and unmethylated alleles. These findings illustrate that allelic dropout due to the presence of rare polymorphisms can cause false-positive results in commonly used MSP assays and lead to molecular misdiagnosis. PMID:21227401

  19. Differential alleleic expression of the type II collagen gene (COL2A2) in osteoarthritic cartilage

    SciTech Connect

    Loughlin, J.; Irven, C.; Sykes, B.; Athanasou, N.; Carr, A.

    1995-05-01

    Osteoarthritis (OA) is a common debilitating disease resulting from the degeneration of articular cartilage. The major protein of cartilage is type II collagen, which is encoded by the COL2A1 gene. Mutations at this locus have been discovered in several individuals with inherited disorders of cartilage. We have identified 27 primary OA patients who are heterozygous for sequence dimorphisms located in the coding region of COL2A1. These dimorphisms were used to distinguish the mRNA output from each of the two COL2A1 alleles in articular cartilage obtained from each patient. Three patients demonstrated differential allelic expression and produced <12% of the normal level of mRNA from one of their COL2A1 alleles. The same allele shows reduced expression in a well-defined OA population than in a control group, suggesting the possible existence of a rare COL2A1 allele that predisposes to OA. 31 refs., 4 figs., 3 tabs.

  20. Tetrasomic Segregation for Multiple Alleles in Alfalfa

    PubMed Central

    Quiros, Carlos F.

    1982-01-01

    Evidence of tetrasomic inheritance in alfalfa, Medicago sativa L. and M. falcata L., for multiple codominant alleles at three isozymic loci is reported in this study. The locus Prx-1 governing anodal peroxidase and the loci Lap-1 and Lap-2 governing anodal leucine-aminopeptidase were studied by starch gel electrophoresis in seedling root tissue or seeds. The progenies from several di-, tri- or tetra-allelic plants belong to the species M. sativa and M. falcata and their hybrids were studied for the segregation of the three genes. In all cases, tetrasomic inheritance of chromosomal-type segregation was observed. In another progeny resulting from the crossing of two plants involving four different alleles at locus Lap-2, tetrasomic segregation with the possible occurrence of double reduction was observed. This study presents direct evidence of autotetraploidy and the existence of tetra-allelic loci in alfalfa. It also supports the concept that the species M. sativa and M. falcata are genetically close enough to be considered biotypes of a common species. PMID:17246077

  1. Rational Manual and Automated Scoring Thresholds for the Immunohistochemical Detection of TP53 Missense Mutations in Human Breast Carcinomas.

    PubMed

    Taylor, Nicholas J; Nikolaishvili-Feinberg, Nana; Midkiff, Bentley R; Conway, Kathleen; Millikan, Robert C; Geradts, Joseph

    2016-07-01

    Missense mutations in TP53 are common in human breast cancer, have been associated with worse prognosis, and may predict therapy effect. TP53 missense mutations are associated with aberrant accumulation of p53 protein in tumor cell nuclei. Previous studies have used relatively arbitrary cutoffs to characterize breast tumors as positive for p53 staining by immunohistochemical assays. This study aimed to objectively determine optimal thresholds for p53 positivity by manual and automated scoring methods using whole tissue sections from the Carolina Breast Cancer Study. p53-immunostained slides were available for 564 breast tumors previously assayed for TP53 mutations. Average nuclear p53 staining intensity was manually scored as negative, borderline, weak, moderate, or strong and percentage of positive tumor cells was estimated. Automated p53 signal intensity was measured using the Aperio nuclear v9 algorithm combined with the Genie histology pattern recognition tool and tuned to achieve optimal nuclear segmentation. Receiver operating characteristic curve analysis was performed to determine optimal cutoffs for average staining intensity and percent cells positive to distinguish between tumors with and without a missense mutation. Receiver operating characteristic curve analysis demonstrated a threshold of moderate average nuclear staining intensity as a good surrogate for TP53 missense mutations in both manual (area under the curve=0.87) and automated (area under the curve=0.84) scoring systems. Both manual and automated immunohistochemical scoring methods predicted missense mutations in breast carcinomas with high accuracy. Validation of the automated intensity scoring threshold suggests a role for such algorithms in detecting TP53 missense mutations in high throughput studies.

  2. Intragenic allele pyramiding combines different specificities of wheat Pm3 resistance alleles.

    PubMed

    Brunner, Susanne; Hurni, Severine; Streckeisen, Philipp; Mayr, Gabriele; Albrecht, Mario; Yahiaoui, Nabila; Keller, Beat

    2010-11-01

    Some plant resistance genes occur as allelic series, with each member conferring specific resistance against a subset of pathogen races. In wheat, there are 17 alleles of the Pm3 gene. They encode nucleotide-binding (NB-ARC) and leucine-rich-repeat (LRR) domain proteins, which mediate resistance to distinct race spectra of powdery mildew. It is not known if specificities from different alleles can be combined to create resistance genes with broader specificity. Here, we used an approach based on avirulence analysis of pathogen populations to characterize the molecular basis of Pm3 recognition spectra. A large survey of mildew races for avirulence on the Pm3 alleles revealed that Pm3a has a resistance spectrum that completely contains that of Pm3f, but also extends towards additional races. The same is true for the Pm3b and Pm3c gene pair. The molecular analysis of these allelic pairs revealed a role of the NB-ARC protein domain in the efficiency of effector-dependent resistance. Analysis of the wild-type and chimeric Pm3 alleles identified single residues in the C-terminal LRR motifs as the main determinant of allele specificity. Variable residues of the N-terminal LRRs are necessary, but not sufficient, to confer resistance specificity. Based on these data, we constructed a chimeric Pm3 gene by intragenic allele pyramiding of Pm3d and Pm3e that showed the combined resistance specificity and, thus, a broader recognition spectrum compared with the parental alleles. Our findings support a model of stepwise evolution of Pm3 recognition specificities.

  3. Prevalence of URAT1 allelic variants in the Roma population.

    PubMed

    Stiburkova, Blanka; Gabrikova, Dana; Čepek, Pavel; Šimek, Pavel; Kristian, Pavol; Cordoba-Lanus, Elizabeth; Claverie-Martin, Felix

    2016-12-01

    The Roma represents a transnational ethnic group, with a current European population of 8-10 million. The evolutionary process that had the greatest impact on the gene pool of the Roma population is called the founder effect. Renal hypouricemia (RHUC) is a rare heterogenous inherited disorder characterized by impaired renal urate reabsorption. The affected individuals are predisposed to recurrent episodes of exercise-induced nonmyoglobinuric acute kidney injury and nephrolithiasis. To date, more than 150 patients with a loss-of-function mutation for the SLC22A12 (URAT1) gene have been found, most of whom are Asians. However, RHUC 1 patients have been described in a variety of ethnic groups (e.g., Arab Israelis, Iraqi Jews, Caucasians, and Roma) and in geographically noncontiguous countries. This study confirms our previous findings regarding the high frequency of SLC22A12 variants observed. Frequencies of the c.1245_1253del and c.1400C>T variants were found to be 1.92% and 5.56%, respectively, in a subgroup of the Roma population from five regions in three countries: Slovakia, Czech Republic, and Spain. Our findings suggested that the common dysfunction allelic variants of URAT1 exist in the general Roma population and thus renal hypouricemia should be kept in differential diagnostic algorithm on Roma patients with defect in renal tubular urate transport. This leads to confirm that the genetic drift in the Roma have increased the prevalence of hereditary disorders caused by very rare variants in major population.

  4. Estimating the probability of allelic drop-out of STR alleles in forensic genetics.

    PubMed

    Tvedebrink, Torben; Eriksen, Poul Svante; Mogensen, Helle Smidt; Morling, Niels

    2009-09-01

    In crime cases with available DNA evidence, the amount of DNA is often sparse due to the setting of the crime. In such cases, allelic drop-out of one or more true alleles in STR typing is possible. We present a statistical model for estimating the per locus and overall probability of allelic drop-out using the results of all STR loci in the case sample as reference. The methodology of logistic regression is appropriate for this analysis, and we demonstrate how to incorporate this in a forensic genetic framework.

  5. Two novel missense mutations in FGD4/FRABIN cause Charcot-Marie-Tooth type 4H (CMT4H).

    PubMed

    Baudot, Cécile; Esteve, Clothilde; Castro, Christel; Poitelon, Yannick; Mas, Camille; Hamadouche, Tarik; El-Rajab, Maryam; Lévy, Nicolas; Megarbané, André; Delague, Valérie

    2012-06-01

    By sequencing of the FGD4 coding sequence in a cohort of 101 patients affected by autosomal recessive demyelinating Charcot-Marie-Tooth disease (CMT), we have identified two novel missense mutations in FGD4 in two patients from consanguineous descent: p.Arg442His in an Algerian patient and p.Met566Ile in a Lebanese girl. The patients present early onset, slowly progressive CMT, with drastic reduction of nerve conduction velocities. These mutations are the second and third missense mutations characterized in FGD4. They are likely to lead to conformational changes in the PH1 and FYVE domains. © 2012 Peripheral Nerve Society.

  6. Association analysis of fiber quality traits and exploration of elite alleles in Upland cotton cultivars/accessions (Gossypium hirsutum L.).

    PubMed

    Cai, Caiping; Ye, Wenxue; Zhang, Tianzhen; Guo, Wangzhen

    2014-01-01

    Exploring the elite alleles and germplasm accessions related to fiber quality traits will accelerate the breeding of cotton for fiber quality improvement. In this study, 99 Gossypium hirsutum L. accessions with diverse origins were used to perform association analysis of fiber quality traits using 97 polymorphic microsatellite marker primer pairs. A total of 107 significant marker-trait associations were detected for three fiber quality traits under three different environments, with 70 detected in two or three environments and 37 detected in only one environment. Among the 70 significant marker-trait associations, 52.86% were reported previously, implying that these are stable loci for target traits. Furthermore, we detected a large number of elite alleles associated simultaneously with two or three traits. These elite alleles were mainly from accessions collected in China, introduced to China from the United States, or rare alleles with a frequency of less than 5%. No one cultivar contained more than half of the elite alleles, but 10 accessions were collected from China and the two introduced from the United States did contain more than half of these alleles. Therefore, there is great potential for mining elite alleles from germplasm accessions for use in fiber quality improvement in modern cotton breeding.

  7. An MDR1 promoter allele with higher promoter activity is common in clinically isolated strains of Candida albicans

    PubMed Central

    Bruzual, Igor

    2013-01-01

    In the opportunistic fungal pathogen Candida albicans, up-regulation of MDR1, encoding an efflux transporter, leads to increased resistance to the antifungal drug fluconazole. Antifungal resistance has been linked to several types of genetic change in C. albicans, including changes in genome structure, genetic alteration of the drug target, and overexpression of transporters. High-level over-expression of MDR1 is commonly mediated by mutation in a trans-acting factor, Mrr1p. This report describes a second mechanism that contributes to up-regulation of MDR1 expression. By analyzing the sequence of the MDR1 promoter region in fluconazole-resistant and fluconazole-susceptible strains, we identified sequence polymorphisms that defined two linkage groups, corresponding to the two alleles in the diploid genome. One of the alleles conferred higher MDR1 expression compared with the other allele. Strains in which both alleles were of the higher activity type were common in collections of clinically isolated strains while strains carrying only the less active allele were rare. As increased expression of MDR1 confers higher resistance to drugs, strains with the more active MDR1 promoter allele may grow or survive longer when exposed to drugs or other selective pressures, providing greater opportunity for mutations that confer high-level drug resistance to arise. Through this mechanism, higher activity alleles of the MDR1 promoter could promote the development of drug resistance. PMID:21972105

  8. Rare Disorders and Diseases

    ERIC Educational Resources Information Center

    Umlauf, Mary; Monaco, Jana; FitzZaland, Mary; FitzZaland, Richard; Novitsky, Scott

    2008-01-01

    According to the National Organization for Rare Disorders (NORD), a rare or "orphan" disease affects fewer than 200,000 people in the United States. There are more than 6,000 rare disorders that, taken together, affect approximately 25 million Americans. "Exceptional Parent" ("EP") recognizes that when a disorder affects a child or adult, it…

  9. Rare Disorders and Diseases

    ERIC Educational Resources Information Center

    Umlauf, Mary; Monaco, Jana; FitzZaland, Mary; FitzZaland, Richard; Novitsky, Scott

    2008-01-01

    According to the National Organization for Rare Disorders (NORD), a rare or "orphan" disease affects fewer than 200,000 people in the United States. There are more than 6,000 rare disorders that, taken together, affect approximately 25 million Americans. "Exceptional Parent" ("EP") recognizes that when a disorder affects a child or adult, it…

  10. FBXW7 mutations typically found in human cancers are distinct from null alleles and disrupt lung development

    PubMed Central

    Davis, Hayley; Lewis, Annabelle; Spencer-Dene, Bradley; Tateossian, Hilda; Stamp, Gordon; Behrens, Axel; Tomlinson, Ian

    2011-01-01

    FBXW7 is the substrate recognition component of a SCF-type E3 ubiquitin ligase. It has multiple targets such as Notch1, c-Jun, and cyclin E that function in critical developmental and signalling pathways. Mutations in FBXW7 are often found in many types of cancer. In most cases, these mutations do not inactivate the protein, but are mono-allelic missense changes at specific arginine resides involved in substrate binding. We have hypothesized that FBXW7 mutations are selected in cancers for reasons other than haploinsufficiency or full loss-of-function. Given that the existing mutant Fbxw7 mice carry null alleles, we created a mouse model carrying one of the commonly occurring point mutations (Fbxw7) in the WD40 substrate recognition domain of Fbxw7. Mice heterozygous for this mutation apparently developed normally in utero, died perinatally due to a defect in lung development, and in some cases showed cleft palate and eyelid fusion defects. By comparison, Fbxw7+/− mice were viable and developed normally. Fbxw7−/− animals died of vascular abnormalities at E10.5. We screened known FBXW7 targets for changes in the lungs of the Fbxw7R482Q/+ mice and found Tgif1 and Klf5 to be up-regulated. Fbxw7 alleles are not functionally equivalent to heterozygous or homozygous null alleles, and we propose that they are selected in tumourigenesis because they cause a selective or partial loss of FBXW7 function. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:21503901

  11. Allelic Variation of Gene Expression in Maize HybridsW⃞

    PubMed Central

    Guo, Mei; Rupe, Mary A.; Zinselmeier, Christopher; Habben, Jeffrey; Bowen, Benjamin A.; Smith, Oscar S.

    2004-01-01

    Allelic expression variation of nonimprinted autosomal genes has recently been uncovered in mouse hybrids and humans. The allelic expression variation is attributed to differences in noncoding DNA sequences and does not involve epigenetic regulation or gene imprinting. This expression variation is suggested to play important roles in determining phenotypic diversity. Virtually nothing is known about such allele-specific expression variation in a hybrid plant where two alleles are compared in the same genetic context. We examined parental transcript accumulation in maize (Zea mays) hybrids using allele-specific RT-PCR analysis. Among 15 genes analyzed, 11 showed differences at the RNA level, ranging from unequal expression of the two alleles (biallelic) to expression of a single allele (monoallelic). Maternal or paternal transmission had little effect on the allele-specific transcript ratio of nearly all genes analyzed, suggesting that parent-of-origin effect was minimal. We analyzed the allelic difference in genetically contrasting hybrids and hybrids under high planting density and drought stress. Whereas a genetically improved modern hybrid expressed both alleles, a less improved old hybrid frequently showed mono-allelic expression. Furthermore, the two alleles in the hybrid responded differentially to abiotic stresses. The results of allele-specific regulation in different tissues in responding to environment and stress suggest an unequivalent function of the parental alleles in the hybrid, which may have an impact on heterosis. PMID:15194819

  12. High-Throughput Genotyping with TaqMan Allelic Discrimination and Allele-Specific Genotyping Assays.

    PubMed

    Heissl, Angelika; Arbeithuber, Barbara; Tiemann-Boege, Irene

    2017-01-01

    Real-time PCR-based genotyping methods, such as TaqMan allelic discrimination assays and allele-specific genotyping, are particularly useful when screening a handful of single nucleotide polymorphisms in hundreds of samples; either derived from different individuals, tissues, or pre-amplified DNA. Although real-time PCR-based methods such as TaqMan are well-established, alternative methods, like allele-specific genotyping, are powerful alternatives, especially for genotyping short tandem repeat (STR) length polymorphisms. Here, we describe all relevant aspects when developing an assay for a new SNP or STR using either TaqMan or allele-specific genotyping, respectively, such as primer and probe design, optimization of reaction conditions, the experimental procedure for typing hundreds of samples, and finally the data evaluation. Our goal is to provide a guideline for developing genotyping assays using these two approaches that render reliable and reproducible genotype calls involving minimal optimization.

  13. Acute intermittent porphyria: identification and expression of exonic mutations in the hydroxymethylbilane synthase gene. An initiation codon missense mutation in the housekeeping transcript causes "variant acute intermittent porphyria" with normal expression of the erythroid-specific enzyme.

    PubMed Central

    Chen, C H; Astrin, K H; Lee, G; Anderson, K E; Desnick, R J

    1994-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error, results from the half-normal activity of the heme biosynthetic enzyme, hydroxymethylbilane synthase (EC 4.3.1.8). Diagnosis of AIP heterozygotes is essential to prevent acute, life-threatening neurologic attacks by avoiding various precipitating factors. Since biochemical diagnosis is problematic, the identification of hydroxymethylbilane synthase mutations has facilitated the detection of AIP heterozygotes. Molecular analyses of unrelated AIP patients revealed six exonic mutations: an initiating methionine to isoleucine substitution (M1I) in a patient with variant AIP, which precluded translation of the housekeeping, but not the erythroid-specific isozyme; four missense mutations in classical AIP patients, V93F, R116W, R201W, C247F; and a nonsense mutation W283X in a classical AIP patient, which truncated the housekeeping and erythroid-specific isozymes. Each mutation was confirmed in genomic DNA from family members. The W283X lesion was found in another unrelated AIP family. Expression of each mutation in Escherichia coli revealed that R201W, C247F, and W283X had residual activity. In vitro transcription/translation studies indicated that the M1I allele produced only the erythroid-specific enzyme, while the other mutant alleles encoded both isozymes. These mutations provide insight into the molecular pathology of classic and variant AIP and facilitate molecular diagnosis in AIP families. Images PMID:7962538

  14. A novel rho promoter::Tn10 mutation suppresses and ftsQ1(Ts) missense mutation in an essential Escherichia coli cell division gene by a mechanism not involving polarity suppression.

    PubMed Central

    Storts, D R; Markovitz, A

    1991-01-01

    An extragenic suppressor of the Escherichia coli cell division gene ftsQ1(Ts) was isolated. The suppressor is a Tn10 insertion into the -35 promoter consensus sequence of the rho gene, designated rho promoter::Tn10. The ftsQ1(Ts) mutation was also suppressed by the rho-4 mutant allele. The rho promoter::Tn10 strain does not exhibit rho mutant polarity suppressor phenotypes. In addition, overexpression of the ftsQ1(Ts) mutation does not reverse temperature sensitivity. Furthermore, DNA sequence analysis of the ftsQ1(Ts) allele revealed that the salt-remediable, temperature-sensitive phenotype arose from a single missense mutation. The most striking phenotype of the rho promoter::Tn10 mutant strain is an increase in the level of negative supercoiling. On the basis of these observations, we conclude that the ftsQ1(Ts) mutation may be suppressed by a change in supercoiling. Images PMID:1846147

  15. HLA-B alleles of the Cayapa of Ecuador: new B39 and B15 alleles.

    PubMed

    Garber, T L; Butler, L M; Trachtenberg, E A; Erlich, H A; Rickards, O; De Stefano, G; Watkins, D I

    1995-01-01

    Recent data suggest that HLA-B locus alleles can evolve quickly in native South American populations. To investigate further this phenomenon of new HLA-B variants among Amerindians, we studied samples from another South American tribe, the Cayapa from Ecuador. We selected individuals for HLA-B molecular typing based upon their HLA class II typing results. Three new variants of HLA-B39 and one new variant of HLA-B15 were found in the Cayapa: HLA-B*3905, HLA-B*3906, HLA-B*3907, and HLA-B*1522. A total of thirteen new HLA-B alleles have now been found in the four South American tribes studied. Each of these four tribes studied, including the Cayapa, had novel alleles that were not found in any of the other tribes, suggesting that many of these new HLA-B alleles may have evolved since the Paleo-Indians originally populated South America. Each of these 13 new alleles contained predicted amino acid replacements that were located in the peptide binding site. These amino acid replacements may affect the sequence motif of the bound peptides, suggesting that these new alleles have been maintained by selection. New allelic variants have been found for all common HLA-B locus antigenic groups present in South American tribes with the exception of B48. In spite of its high frequency in South American tribes, no evidence for variants of B48 has been found in all the Amerindians studied, suggesting that B48 may have unique characteristics among the B locus alleles.

  16. HLA-B alleles of the Cayapa of Ecuador: New B39 and B15 alleles

    SciTech Connect

    Garber, T.L.; Butler, L.M.; Watkins, D.I.

    1995-05-01

    Recent data suggest that HLA-B locus alleles can evolve quickly in native South American populations. To investigate further this phenomenon of new HLA-B variants among Amerindians, we studied samples from another South American tribe, the Cayapa from Ecuador. We selected individuals for HLA-B molecular typing based upon their HLA class II typing results. Three new variants of HLA-B39 and one new variant of HLA-B15 were found in the Cayapa: HLA-B*3905, HLA-B*3906, HLA-B*3907, and HLA-B*1522. A total of thirteen new HLA-B alleles have now been found in the four South American tribes studied. Each of these four tribes studied, including the Cayapa, had novel alleles that were not found in any of the other tribes, suggesting that many of these new HLA-B alleles may have evolved since the Paleo-Indians originally populated South America. Each of these 13 new alleles contained predicted amino acid replacements that were located in the peptide binding site. These amino acid replacements may affect the sequence motif of the bound peptides, suggesting that these new alleles have been maintained by selection. New allelic variants have been found for all common HLA-B locus antigenic groups present in South American tribes with the exception of B48. In spite of its high frequency in South American tribes, no evidence for variants of B48 has been found in all the Amerindians studied, suggesting that B48 may have unique characteristics among the B locus alleles. 70 refs., 2 figs., 2 tabs.

  17. Spatial proximity of homologous alleles and long noncoding RNAs regulate a switch in allelic gene expression

    PubMed Central

    Stratigi, Kalliopi; Kapsetaki, Manouela; Aivaliotis, Michalis; Town, Terrence; Flavell, Richard A.; Spilianakis, Charalampos G.

    2015-01-01

    Physiological processes rely on the regulation of total mRNA levels in a cell. In diploid organisms, the transcriptional activation of one or both alleles of a gene may involve trans-allelic interactions that provide a tight spatial and temporal level of gene expression regulation. The mechanisms underlying such interactions still remain poorly understood. Here, we demonstrate that lipopolysaccharide stimulation of murine macrophages rapidly resulted in the actin-mediated and transient homologous spatial proximity of Tnfα alleles, which was necessary for the mono- to biallelic switch in gene expression. We identified two new complementary long noncoding RNAs transcribed from the TNFα locus and showed that their knockdown had opposite effects in Tnfα spatial proximity and allelic expression. Moreover, the observed spatial proximity of Tnfα alleles depended on pyruvate kinase muscle isoform 2 (PKM2) and T-helper-inducing POZ-Krüppel-like factor (ThPOK). This study suggests a role for lncRNAs in the regulation of somatic homologous spatial proximity and allelic expression control necessary for fine-tuning mammalian immune responses. PMID:25770217

  18. Molecular characterization of an allelic series of mutations in the mouse Nox3 gene.

    PubMed

    Flaherty, John P; Fairfield, Heather E; Spruce, Catrina A; McCarty, Christopher M; Bergstrom, David E

    2011-04-01

    The inner ear consists of the cochlea (the organ of hearing) and the vestibular system (the organs of balance). Within the vestibular system, linear acceleration and gravity are detected by the saccule and utricle. Resting above the neurosensory epithelia of these organs are otoconia, minute proteinaceous and crystalline (calcite) inertial masses that shift under the physical forces imparted by linear movements and gravity. It is the transduction and sensation of these movements and their integration with vision and proprioceptive inputs that contribute to the sensation of balance. It has been proposed that a reactive oxygen species- (ROS-) generating NADPH oxidase comprising the gene products of the Nox3, Noxo1, and Cyba genes plays a critical and constructive role in the process of inner-ear development, specifically, the deposition of otoconia. Inactivation in mouse of any of the NADPH oxidase components encoded by the Nox3, Noxo1, or Cyba gene results in the complete congenital absence of otoconia and profound vestibular dysfunction. Here we describe our use of PCR, reverse transcription-PCR (RT-PCR), and rapid amplification of cDNA ends (RACE) with traditional and high-throughput (HTP) sequencing technologies to extend and complete the molecular characterization of an allelic series of seven mutations in the Nox3 gene. Collectively, the mutation spectrum includes an endogenous retrovirus insertion, two missense mutations, a splice donor mutation, a splice acceptor mutation, premature translational termination, and a small duplication. Together, these alleles provide tools to investigate the mechanisms of otoconial deposition over development, throughout aging, and in various disease states.

  19. Molecular characterization of an allelic series of mutations in the mouse Nox3 gene

    PubMed Central

    Flaherty, John P.; Fairfield, Heather E.; Spruce, Catrina A.; McCarty, Christopher M.; Bergstrom, David E.

    2011-01-01

    The inner ear consists of the cochlea (the organ of hearing) and the vestibular system (the organs of balance). Within the vestibular system, linear acceleration and gravity are detected by the saccule and utricle. Resting above the neurosensory epithelia of these organs are otoconia, minute proteinaceous and crystalline (calcite) inertial masses that shift under the physical forces imparted by linear movements and gravity. It is the transduction and sensation of these movements and their integration with vision and proprioceptive inputs that contribute to the sensation of balance. It has been proposed that a reactive oxygen species- (ROS-) generating NADPH oxidase comprising the gene products of the Nox3, Noxo1, and Cyba genes plays a critical and constructive role in the process of inner-ear development, specifically, the deposition of otoconia. Inactivation in mouse of any of the NADPH oxidase components encoded by the Nox3, Noxo1, or Cyba gene results in the complete congenital absence of otoconia and profound vestibular dysfunction. Here we describe our use of PCR, reverse transcription-PCR (RT-PCR), and rapid amplification of cDNA ends (RACE) with traditional and high-throughput (HTP) sequencing technologies to extend and complete the molecular characterization of an allelic series of seven mutations in the Nox3 gene. Collectively, the mutation spectrum includes an endogenous retrovirus insertion, two missense mutations, a splice donor mutation, a splice acceptor mutation, premature translational termination, and a small duplication. Together, these alleles provide tools to investigate the mechanisms of otoconial deposition over development, throughout aging, and in various disease states. PMID:21161235

  20. Do Heliconius butterfly species exchange mimicry alleles?

    PubMed Central

    Smith, Joel; Kronforst, Marcus R.

    2013-01-01

    Hybridization has the potential to transfer beneficial alleles across species boundaries, and there are a growing number of examples in which this has apparently occurred. Recent studies suggest that Heliconius butterflies have transferred wing pattern mimicry alleles between species via hybridization, but ancestral polymorphism could also produce a signature of shared ancestry around mimicry genes. To distinguish between these alternative hypotheses, we measured DNA sequence divergence around putatively introgressed mimicry loci and compared this with the rest of the genome. Our results reveal that putatively introgressed regions show strongly reduced sequence divergence between co-mimetic species, suggesting that their divergence times are younger than the rest of the genome. This is consistent with introgression and not ancestral variation. We further show that this signature of introgression occurs at sites throughout the genome, not just around mimicry genes. PMID:23864282