Cloning of the cocaine-sensitive bovine dopamine transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usdin, T.B.; Chen, C.; Brownstein, M.J.

1991-12-15

A cDNA encoding the dopamine transporter from bovine brain substantia nigra was identified on the basis of its structural homology to other, recently cloned, neurotransmitter transporters. The sequence of the 693-amino acid protein is quite similar to those of the rat {gamma}-aminobutyric acid, human norepinephrine, and rat serotonin transporters. Dopamine transporter mRNA was detected by in situ hybridization in the substantia nigra but not in the locus coeruleus, raphe, caudate, or other brain areas. ({sup 3}H)Dopamine accumulation in tissue culture cells transfected with the cDNA was inhibited by amphetamine, cocaine, and specific inhibitors of dopamine transports, including GBR12909.

Joint capsule treatment with enkephalin-encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFA monoarthritis.

PubMed

Lu, Ying; McNearney, Terry A; Wilson, Steven P; Yeomans, David C; Westlund, Karin N

2008-03-01

This study assessed enkephalin expression induced by intra-articular application of recombinant, enkephalin-encoding herpes virus (HSV-1) and the impact of expression on nociceptive behaviours and synovial lining inflammation in arthritic rats. Replication-conditional HSV-1 recombinant vectors with cDNA encoding preproenkephalin (HSV-ENK), or control transgene beta-galactosidase cDNA (HSV-beta-gal; control) were injected into knee joints with complete Freund's adjuvant (CFA). Joint temperatures, circumferences and nociceptive behaviours were monitored on days 0, 7, 14 and 21 post CFA and vector treatments. Lumbar (L4-6) dorsal root ganglia (DRG) and spinal cords were immunostained for met-enkephalin (met-ENK), beta-gal, HSV-1 proteins and Fos. Joint tissues were immunostained for met-ENK, HSV-1 proteins, and inflammatory mediators Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and cyclo-oxygenase-2, or stained with haematoxylin and eosin for histopathology. Compared to exuberant synovial hypertrophy and inflammatory cell infiltration seen in arthritic rats treated with CFA only or CFA and HSV-beta-gal, the CFA- and HSV-ENK-treated arthritic rats had: (i) striking preservation of synovial membrane cytoarchitecture with minimal inflammatory cell infiltrates; (ii) significantly improved nociceptive behavioural responses to mechanical and thermal stimuli; (iii) normalized Fos staining in lumbar dorsal horn; and (iv) significantly increased met-ENK staining in ipsilateral synovial tissue, lumbar DRG and spinal cord. The HSV-1 and transgene product expression were confined to ipsilateral lumbar DRG (HSV-1, met-ENK, beta-gal). Only transgene product (met-ENK and beta-gal) was seen in lumbar spinal cord sections. Targeted delivery of enkephalin-encoding HSV-1 vector generated safe, sustained opioid-induced analgesia with protective anti-inflammatory blunting in rat inflammatory arthritis.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

PubMed

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

Structural organization of the genes for rat von Ebner's gland proteins 1 and 2 reveals their close relationship to lipocalins.

PubMed

Kock, K; Ahlers, C; Schmale, H

1994-05-01

The rat von Ebner's gland protein 1 (VEGP 1) is a secretory protein, which is abundantly expressed in the small acinar von Ebner's salivary glands of the tongue. Based on the primary structure of this protein we have previously suggested that it is a member of the lipocalin superfamily of lipophilic-ligand carrier proteins. Although the physiological role of VEGP 1 is not clear, it might be involved in sensory or protective functions in the taste epithelium. Here, we report the purification of VEGP 1 and of a closely related secretory polypeptide, VEGP 2, the isolation of a cDNA clone encoding VEGP 2, and the isolation and structural characterization of the genes for both proteins. Protein purification by gel-filtration and anion-exchange chromatography using Mono Q revealed the presence of two different immunoreactive VEGP species. N-terminal sequence determination of peptide fragments isolated after protease Asp-N digestion allowed the identification of a new VEGP, named VEGP 2, in addition to the previously characterized VEGP 1. The complete VEGP 2 sequence was deduced from a cDNA clone isolated from a von Ebner's gland cDNA library. The VEGP 2 cDNA encodes a protein of 177 amino acids and is 94% identical to VEGP 1. DNA sequence analysis of the rat VEGP 1 and 2 genes isolated from rat genomic libraries revealed that both span about 4.5 kb and contain seven exons. The VEGP 1 and 2 genes are non-allelic distinct genes in the rat genome and probably arose by gene duplication. The high degree of nucleotide sequence identity in introns A-C (94-100%) points to a recent gene conversion event that included the 5' part of the genes. The genomic organization of the rat VEGP genes closely resembles that found in other lipocalins such as beta-lactoglobulin, mouse urinary proteins (MUPs) and prostaglandin D synthase, and therefore provides clear evidence that VEGPs belong to this superfamily of proteins.

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-12-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

Characterization of rtSH3p13 gene encoding a development protein involved in vesicular traffic in spermiogenesis.

PubMed

Qiao, Yuan; Yang, Ju Xiang; Zhang, Xiao Dong L; Liu, Yu; Zhang, Jian Chao; Zong, Shu Dong; Miao, Shi Ying; Wang, Lin Fang; Koide, Samuel S

2004-06-01

A cDNA, designated as rtSH3p13, was isolated from a rat testis cDNA library. It consists of 1463 bp nuclear acids, which encodes a protein of 312 amino acids and was assigned the GenBank accession number AF227439. The deduced rtSH3p13 protein is a truncated isoform of SH3p13 as a result of mRNA alternative splicing. It is mainly expressed in the rat testis, detected in spermatids at the steps 8-19 of spermiogenesis, and found around the acrosome. During postnatal development, rtSH3p13 appears on day 18 and reaches maximum on day 60. Further experimental results suggested that rtSH3p13 forms a complex with activated epidermal growth factor receptor (EGFR) and interacts with synaptojanin I. Surprisingly, similar to SH3 domain, the V region of rtSH3p13 also inhibits endocytosis in CHO cells. Our results reveal a link between an rtSH3p13-synaptojanin-clathrin complex-mediated formation of pits and the process of spermiogenesis.

Characterization of rat calcitonin mRNA.

PubMed Central

Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

1980-01-01

A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

PubMed Central

Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

1998-01-01

We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed Central

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-01-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

PubMed

Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

2005-08-01

Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

Structure and expression of the rat CYP3A1 gene: isolation of the gene (P450/6betaB) and characterization of the recombinant protein.

PubMed

Nagata, K; Ogino, M; Shimada, M; Miyata, M; Gonzalez, F J; Yamazoe, Y

1999-02-15

A P450 gene (P450/6betaB) of the CYP3A subfamily was isolated from a rat genomic library. Nucleotide sequencing of the exons revealed a high similarity with P450PCN1 cDNA (Gonzalez et al. (1985), J. Biol. Chem. 260, 7345-7441), but differed in 41 nucleotides, resulting in 11 changes and 2 deletions of amino acid residues. The P450/6betaB spanned about 30 kbp and consisted of 13 exons, and was in exon number and size identical with CYP3A2 gene except in the 6th exon, which was shorter than that of CYP3A2. 6beta-B mRNA, which may be transcribed from P450/6betaB, was detected on Northern blotting and by reverse transcription-polymerase chain reaction (RT-PCR). Profiles of the developmental change and induction by a treatment with several chemicals were very similar to those of P450PCN1 mRNA reported previously. P450PCN1 mRNA and gene, however, were not detected by PCR in rats. To determine whether P450/6betaB encodes an active protein, a cDNA was isolated and expressed. Expression of 6beta-B cDNA in COS-1 cells was carried out and revealed that the recombinant protein comigrated with purified P4506beta-4 previously identified as CYP3A1. The recombinant 6beta-B protein showed similar turnover rate and regioselectivity for testosterone with purified P4506beta-4 by the simultaneous addition of NADPH-cytochrome P450 reductase and cytochrome b5. These data suggest that P450/6betaB encodes an active P450 form corresponding to CYP3A1 and P450PCN1 reported previously does not exist in rats. Copyright 1999 Academic Press.

Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

PubMed

Sugimoto, H; Hayashi, H; Yamashita, S

1996-03-29

A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

Cloning of Human Tumor Necrosis Factor (TNF) Receptor cDNA and Expression of Recombinant Soluble TNF-Binding Protein

NASA Astrophysics Data System (ADS)

Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc

1990-10-01

The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).

Rat PPAR delta contains a CGG triplet repeat and is prominently expressed in the thalamic nuclei.

PubMed

Xing, G; Zhang, L; Zhang, L; Heynen, T; Yoshikawa, T; Smith, M; Weiss, S; Detera-Wadleigh, S

1995-12-26

We have isolated a new rat sequence containing motifs of a nuclear hormone receptor from a brain cDNA library. The deduced amino acid sequence encoded by the cDNA clone showed a strong homology to the human NUCI and the mouse peroxisome proliferator activated receptor delta (PPAR delta). We therefore refer to this new clone as rat PPAR delta (rPPAR delta). The new feature of rPPAR delta is a 14 CGG triplet repeat on the 5' untranslated region, not previously reported in either NUCI or mPPAR delta. We found that rPPAR delta was expressed as a 3.5-kb transcript which showed a wide distribution in adult rat tissues. Abundant expression was detected in brain, heart, skeletal muscle, kidney and lung. Weaker expression was noted in the liver, spleen and testis. To determine the specific brain localization of rPPAR delta we performed in situ hybridization analysis. Prominent expression was observed in the thalamus, particularly in the posterior part of the ventral medial nucleus, a site responsive to pain and cold stress. These results raise the possibility that PPAR delta might play a role in modulating response to thermal and pain sensations.

Organization of the murine Cd22 locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Law, Che-Leung; Torres, R.M.; Sundeberg, H.A.

1993-07-01

Murine CD22 (mCD22) is a B cell-associated adhesion protein with seven extracellular Ig-like domains that has 62% amino acid identify to its human homologue. Southern analysis on genomic DNA isolated from tissues and cell lines from several mouse strains using mCD22 cDNA demonstrated that the Cd22 locus encoding mCD22 is a single copy gene of [le]30 kb. Digestion of genomic DNA preparations with four restriction endonucleases revealed the presence of restriction fragment length polymorphisms (RFLP) in BALB/c, C57BL/6, and C3H strains vs DBA/2j, NZB, and NZC strains, suggesting the presence of two or more Cd22 alleles. Using a mCD22 cDNAmore » clone derived from the BALB/c strain, the authors isolated genomic clones from a DBA/2 genomic library that contained all the exons necessary to encode the full length mCD22 cDNA. Fifteen exons, including exon 3 that encodes the translation start codon, were identified. Each extracellular Ig-like domain of mCD22 is encoded by a single exon. A comparison between the nucleotide sequences of the BALB/c CD22 cDNA and the exons of the DBA/2j CD22 genomic clones revealed an 18-nucleotide deletion in exon 4 (encoding the most distal Ig-like domain 1 of mCD22) of the DBA/2j genomic sequence in addition to a number of substitutions, insertions, and deletions in other exons. These nucleotide differences were also present in a cDNA clone isolated from total RNA of LPS-activated DBA/2j splenocytes mosome 7, a region sytenic to human chromosome 19q, close to the previously reported loci, Lyb-8 and Mag (a homologue of Cd22). An antibody (CY34) against the Lyb-8.2 B cell marker reacted with a BHK transfectant expressing the full length mCd22 cDNA, thus demonstrating that Lyb-8 and Cd22 loci are identical. Furthermore, a rat anti-mCD22 mAb, NIM-R6, bound to slgM[sup +] DBA/2j B cells, confirming the expression of a CD22 protein by the Cd22[sup a]/lyb-8[sup a] allele. 63 refs., 7 figs., 1 tab.« less

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Genomic structure of rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD, AKR1C9).

PubMed

Lin, H K; Hung, C F; Moore, M; Penning, T M

1999-11-01

Rat liver 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD) is a member of the aldo-keto reductase (AKR) superfamily. It is involved in the inactivation of steroid hormones and the metabolic activation of polycyclic aromatic hydrocarbons (PAH) by converting trans-dihydrodiols into reactive and redox-active o-quinones. The structure of the 5'-flanking region of the gene and factors involved in the constitutive and regulated expression of this gene have been reported [H.-K. Lin, T.M. Penning, Cloning, sequencing, and functional analysis of the 5'-flanking region of the rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase gene, Cancer Res. 55 (1995) 4105-4113]. We now describe the complete genomic structure of the rat type 1 3alpha-HSD/DD gene. Charon 4A and P1 genomic clones contained at least three rat genes (type 1, type 2 and type 3 3alpha-HSD/DD) each of which encoded for the same open reading frame (ORF) but differed in their exon-intron organization. 5'-RACE confirmed that the type 1 3alpha-HSD/DD gene encodes for the dominant transcript in rat liver and it was the regulation of this gene that was previously studied. The rat type 1 3alpha-HSD/DD gene is 30 kb in length and consists of nine exons and eight introns. Exon 9 encodes +931 to 966 bp of the ORF and the 1292 bp 3'-UTR implicated in mRNA stability. This genomic structure is nearly identical to the homologous human genes, type 1 3alpha-HSD (chlordecone reductase/DD4, AKR1C4), type 2 3alpha-HSD (AKR1C3) and type 3 3alpha-HSD (bile-acid binding protein, AKR1C2) genes. Three different cDNA's containing identical ORFs for 3alpha-HSD have been reported suggesting that all three genes may be expressed in rat liver. Using 5' primers corresponding to the 5'-UTR's of the three different cDNA's only one PCR fragment was obtained and corresponded to the type 1 3alpha-HSD/DD gene. These data suggested that the type 2 and type 3 3alpha-HSD/DD genes are not abundantly expressed in rat liver. It is unknown whether the type 2 and type 3 3alpha-HSD/DD genes represent pseudo-genes or whether they represent genes that are differentially expressed in other rat tissues.

Rat organic solute carrier protein 1 (rOscp1) mediated the transport of organic solutes in Xenopus laevis oocytes: isolation and pharmacological characterization of rOscp1.

PubMed

Izuno, Hisanori; Kobayashi, Yasuna; Sanada, Yutaka; Nihei, Daisuke; Suzuki, Masako; Kohyama, Noriko; Ohbayashi, Masayuki; Yamamoto, Toshinori

2007-09-22

Rat organic solute carrier protein 1 (rOscp1) was isolated from a rat testis cDNA library. Isolated rOscp1 cDNA consisted of 1089 base pairs that encoded a 363-amino acid protein, and the amino acid sequence was 88% and 93% identical to that of human OSCP1 (hOSCP1) and mouse Oscp1 (mOscp1), respectively. The message for rOscp1 is highly detected in rat testis. When expressed in X. oocytes, rOscp1 mediated the high affinity transport of p-aminohippurate (PAH) with a Km value of 15.7+/-1.9 microM, and rOscp1-mediated organic solutes were exhibited in time- and Na+-independent manners. rOscp1 also transported various structurally heterogenous compounds such as testosterone, dehydroepiandrosterone sulfate (DHEA-S), and taurocholate with some differences in substrate specificity compared with hOSCP1. Immunohistochemical analysis revealed that the rOscp1 protein is localized in the basal membrane side of Sertoli cells as observed in mouse testis [Kobayashi et al., 2007; Kobayashi, Y., Tsuchiya, A., Hayashi, T., Kohyama, N., Ohbayashi, M., Yamamoto, T., 2007. Isolation and characterization of polyspecific mouse organic solute carrier protein 1 (mOscp1). Drug Metabolism and Disposition 35 (7), 1239-1245]. Thus, the present results indicate that a newly isolated cDNA clone, rOscp1, is a polyspecific organic solute carrier protein with some differences in substrate specificity compared with human and mouse OSCP1.

Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

1996-01-15

The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, L.; Desbarats, M.; Viel, J.

1996-08-15

The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

NASA Astrophysics Data System (ADS)

Zhao, Chunling; Ju, Jiyu

2015-06-01

The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Two rat brain staufen isoforms differentially bind RNA.

PubMed

Monshausen, M; Putz, U; Rehbein, M; Schweizer, M; DesGroseillers, L; Kuhl, D; Richter, D; Kindler, S

2001-01-01

In neurones, a limited number of mRNAs is found in dendrites, including transcripts encoding the microtubule-associated protein 2 (MAP2). Recently, we identified a cis-acting dendritic targeting element (DTE) in MAP2 mRNAs. Here we used the yeast tri-hybrid system to identify potential trans-acting RNA-binding factors of the DTE. A cDNA clone was isolated that encodes a member of a mammalian protein family that is highly homologous to the Drosophila RNA-binding protein Staufen. Mammalian Staufen appears to be expressed in most tissues and brain areas. Two distinct rat brain Staufen isoforms, rStau+I6 and rStau-I6, are encoded by alternatively spliced mRNAs. Both isoforms contain four double-stranded RNA-binding domains (dsRBD). In the larger rStau+I6 isoform, six additional amino acids are inserted in the second dsRBD. Although both isoforms interacted with the MAP2-DTE and various additional RNA fragments in an in vitro north-western assay, rStau-I6 exhibited a stronger signal of bound radioactively labelled RNAs as compared with rStau+I6. Using an antibody directed against mammalian Staufen, the protein was detected in somata and dendrites of neurones of the adult rat hippocampus and cerebral cortex. Ultrastructural studies revealed that in dendrites, rat Staufen accumulates along microtubules. Thus in neurones, rat Staufen may serve to link RNAs to the dendritic microtubular cytoskeleton and may thereby regulate their subcellular localization.

Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J.

1995-08-01

Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryoticmore » expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.« less

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin

PubMed Central

Loit, Evelin; Melnyk, Charles W; MacFarlane, Amanda J; Scott, Fraser W; Altosaar, Illimar

2009-01-01

Background Exposure to dietary wheat proteins in genetically susceptible individuals has been associated with increased risk for the development of Type 1 diabetes (T1D). Recently, a wheat protein encoded by cDNA WP5212 has been shown to be antigenic in mice, rats and humans with autoimmune T1D. To investigate the genomic origin of the identified wheat protein cDNA, a hexaploid wheat genomic library from Glenlea cultivar was screened. Results Three unique wheat globulin genes, Glo-3A, Glo3-B and Glo-3C, were identified. We describe the genomic structure of these genes and their expression pattern in wheat seeds. The Glo-3A gene shared 99% identity with the cDNA of WP5212 at the nucleotide and deduced amino acid level, indicating that we have identified the gene(s) encoding wheat protein WP5212. Southern analysis revealed the presence of multiple copies of Glo-3-like sequences in all wheat samples, including hexaploid, tetraploid and diploid species wheat seed. Aleurone and embryo tissue specificity of WP5212 gene expression, suggested by promoter region analysis, which demonstrated an absence of endosperm specific cis elements, was confirmed by immunofluorescence microscopy using anti-WP5212 antibodies. Conclusion Taken together, the results indicate that a diverse group of globulins exists in wheat, some of which could be associated with the pathogenesis of T1D in some susceptible individuals. These data expand our knowledge of specific wheat globulins and will enable further elucidation of their role in wheat biology and human health. PMID:19615078

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Acetylcholinesterase of the Sand Fly, Phlebotomus papatasi (Scopoli): cDNA Sequence, Baculovirus Expression, and Biochemical Properties

DTIC Science & Technology

2013-01-01

identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control

Molecular identification, immunolocalization, and characterization of Clonorchis sinensis triosephosphate isomerase.

PubMed

Zhou, Juanjuan; Liao, Hua; Li, Shan; Zhou, Chenhui; Huang, Yan; Li, Xuerong; Liang, Chi; Yu, Xinbing

2015-08-01

Clonorchis sinensis triosephosphate isomerase (CsTIM) is a key regulatory enzyme of glycolysis and gluconeogenesis, which catalyzes the interconversion of glyceraldehyde 3-phosphate to dihydroxyacetone phosphate. In this study, the biochemical characterizations of CsTIM have been examined. A full-length complementary DNA (cDNA; Cs105350) sequence encoding CsTIM was obtained from our C. sinensis cDNA library. The open reading frame of CsTIM contains 759 bp which encodes 252 amino acids. The amino acid sequence of CsTIM shares 60-65% identity with other species. Western blot analysis displayed that recombinant CsTIM (rCsTIM) can be probed by anti-rCsTIM rat serum and anti-C. sinensis excretory/secretory products (anti-CsESPs) rat serum. Quantitative reverse transcription (RT)-PCR and western blotting analysis revealed that CsTIM messenger RNA (mRNA) and protein were differentially expressed in development cycle stages of the parasite, including adult worm, metacercaria, excysted metacercaria, and egg. In addition, immunolocalization assay showed that CsTIM was located in the seminal vesicle, eggs, and testicle. Moreover, rCsTIM exhibited active enzyme activity in catalytic reactions. The Michaelis constant (K m) of rCsTIM was 0.33 mM, when using glyceraldehyde 3-phosphate as the substrate. The optimal temperature and pH of CsTIM were 37 °C and 7.5-9.5, respectively. Collectively, these results suggest that CsTIM is an important protein involved in glycometabolism, and CsTIM possibly take part in many biological functions in the growth and development of C. sinensis.

Mechanism of protection against alcoholism by an alcohol dehydrogenase polymorphism: development of an animal model.

PubMed

Rivera-Meza, Mario; Quintanilla, María Elena; Tampier, Lutske; Mura, Casilda V; Sapag, Amalia; Israel, Yedy

2010-01-01

Humans who carry a point mutation in the gene coding for alcohol dehydrogenase-1B (ADH1B*2; Arg47His) are markedly protected against alcoholism. Although this mutation results in a 100-fold increase in enzyme activity, it has not been reported to cause higher levels of acetaldehyde, a metabolite of ethanol known to deter alcohol intake. Hence, the mechanism by which this mutation confers protection against alcoholism is unknown. To study this protective effect, the wild-type rat cDNA encoding rADH-47Arg was mutated to encode rADH-47His, mimicking the human mutation. The mutated cDNA was incorporated into an adenoviral vector and administered to genetically selected alcohol-preferring rats. The V(max) of rADH-47His was 6-fold higher (P<0.001) than that of the wild-type rADH-47Arg. Animals transduced with rAdh-47His showed a 90% (P<0.01) increase in liver ADH activity and a 50% reduction (P<0.001) in voluntary ethanol intake. In animals transduced with rAdh-47His, administration of ethanol (1g/kg) produced a short-lived increase of arterial blood acetaldehyde concentration to levels that were 3.5- to 5-fold greater than those in animals transduced with the wild-type rAdh-47Arg vector or with a noncoding vector. This brief increase (burst) in arterial acetaldehyde concentration after ethanol ingestion may constitute the mechanism by which humans carrying the ADH1B*2 allele are protected against alcoholism.

Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

PubMed

Livingston, B T; Shaw, R; Bailey, A; Wilt, F

1991-12-01

In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

PubMed

Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

2011-12-10

Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Engineering brown fat into skeletal muscle using ultrasound-targeted microbubble destruction gene delivery in obese Zucker rats: Proof of concept design.

PubMed

Bastarrachea, Raul A; Chen, Jiaxi; Kent, Jack W; Nava-Gonzalez, Edna J; Rodriguez-Ayala, Ernesto; Daadi, Marcel M; Jorge, Barbara; Laviada-Molina, Hugo; Comuzzie, Anthony G; Chen, Shuyuan; Grayburn, Paul A

2017-09-01

Ultrasound-targeted microbubble destruction (UTMD) is a novel means of tissue-specific gene delivery. This approach systemically infuses transgenes precoupled to gas-filled lipid microbubbles that are burst within the microvasculature of target tissues via an ultrasound signal resulting in release of DNA and transfection of neighboring cells within the tissue. Previous work has shown that adenovirus containing cDNA of UCP-1, injected into the epididymal fat pads in mice, induced localized fat depletion, improving glucose tolerance, and decreasing food intake in obese diabetic mice. Our group recently demonstrated that gene therapy by UTMD achieved beta cell regeneration in streptozotocin (STZ)-treated mice and baboons. We hypothesized that gene therapy with BMP7/PRDM16/PPARGC1A in skeletal muscle (SKM) of obese Zucker diabetic fatty (fa/fa) rats using UTMD technology would produce a brown adipose tissue (BAT) phenotype with UCP-1 overexpression. This study was designed as a proof of concept (POC) project. Obese Zucker rats were administered plasmid cDNA contructs encoding a gene cocktail with BMP7/PRDM16/PPARGC1A incorporated within microbubbles and intravenously delivered into their left thigh. Controls received UTMD with plasmids driving a DsRed reporter gene. An ultrasound transducer was directed to the thigh to disrupt the microbubbles within the microcirculation. Blood samples were drawn at baseline, and after treatment to measure glucose, insulin, and free fatty acids levels. SKM was harvested for immunohistochemistry (IHC). Our IHC results showed a reliable pattern of effective UTMD-based gene delivery in enhancing SKM overexpression of the UCP-1 gene. This clearly indicates that our plasmid DNA construct encoding the gene combination of PRDM16, PPARGC1A, and BMP7 reprogrammed adult SKM tissue into brown adipose cells in vivo. Our pilot established POC showing that the administration of the gene cocktail to SKM in this rat model of genetic obesity using UTMD gene therapy, engineered a BAT phenotype with UCP-1 over-expression. © 2017 IUBMB Life, 69(9):745-755, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

Chromosomal localization and cDNA cloning of the human DBP and TEF genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khatib, Z.A.; Inaba, T.; Valentine, M.

1994-09-15

The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

Cholesterol biosynthesis from lanosterol: molecular cloning, chromosomal localization, functional expression and liver-specific gene regulation of rat sterol delta8-isomerase, a cholesterogenic enzyme with multiple functions.

PubMed Central

Bae, S; Seong, J; Paik, Y

2001-01-01

Sterol Delta(8)-isomerase (SI) (EC 5.3.3.5), also known as emopamil binding protein or sigma receptor, catalyses the conversion of the 8-ene isomer into the 7-ene isomer in the cholesterol biosynthetic pathway in mammals. Recently, mutations of SI have been found to be associated with Conradi-Hünermann syndrome in humans. To investigate the in vitro and in vivo modes of molecular regulation of SI and its role in cholesterol biosynthesis in mammals, we isolated a full-length cDNA encoding rat SI. The deduced amino-acid sequence of rat SI predicts a 230-residue protein (26737 Da) with 87% and 80% amino-acid identity to mouse and human counterparts. The rat SI gene was mapped to chromosome 12q1.2 using fluorescence in situ hybridization (FISH). The biological function of the cloned rat SI cDNA was verified by overexpressing recombinant Myc-SI in Saccharomyces cerevisiae. It showed a characteristic pattern of inhibition on exposure to trans-2-[4-(1,2-diphenylbuten-1-yl)phenoxy]-N,N-dimethylethylamine (tamoxifen; IC(50)=11.2 microM) and 3beta-[2-(diethylamino)ethoxy]androst-5-en-17-one (U18666A; IC(50)=4.2 microM), two well known potent inhibitors of SI. Northern-blot analysis of 3-week-old rats compared with 2-year-old rats showed that SI mRNA expression in both age groups was restricted to liver, where a 70% reduction in mRNA levels was observed in 2-year-old rats. The FISH studies revealed ubiquitous expression of SI mRNA in rat hepatocytes. The in vitro studies showed that the SI mRNA was highly suppressed by 25-hydroxycholesterol in H4IIE cells. Treatment of H4IIE cells grown in medium supplemented with fetal bovine serum with tamoxifen for 24 h resulted in a dose-dependent induction of SI mRNA, with a concomitant suppression of sterol regulatory element binding protein-1 mRNA. Interestingly, this effect was not seen in emopamil-treated cells. The in vivo experiments also indicate that both mRNA expression and enzymic activity of SI in liver were induced approx. 3-fold in rats fed 5% (w/w) cholestyramine plus 0.1% (w/w) lovastatin in normal chow for 2 weeks. With this newly cloned rat SI cDNA, it becomes possible to gain molecular understanding of previously unknown and tamoxifen-mediated gene regulation of SI that is involved in cholesterol metabolism, ischaemia and genetic diseases. PMID:11171067

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Zygote arrest 1 (Zar1) is an evolutionarily conserved gene expressed in vertebrate ovaries.

PubMed

Wu, Xuemei; Wang, Pei; Brown, Christopher A; Zilinski, Carolyn A; Matzuk, Martin M

2003-09-01

Zygote arrest 1 (ZAR1) is an ovary-specific maternal factor that plays essential roles during the oocyte-to-embryo transition. In mice, the Zar1 mRNA is detected as a 1.4-kilobase (kb) transcript that is synthesized exclusively in growing oocytes. To further understand the functions of ZAR1, we have cloned the orthologous Zar1 cDNA and/or genes for mouse, rat, human, frog, zebrafish, and pufferfish. The entire mouse Zar1 gene and a related pseudogene span approximately 4.0 kb, contain four exons, and map to adjacent loci on mouse chromosome 5. The human ZAR1 orthologous gene similarly consists of four exons and resides on human chromosome 4p12, which is syntenic with the mouse Zar1 chromosomal locus. Rat (Rattus norvegicus) and pufferfish (Fugu rubripes) Zar1 genes were recognized by database mining and deduced protein alignment analysis. The rat Zar1 gene also maps to a region that is syntenic with the mouse Zar1 gene locus on rat chromosome 14. Frog (Xenopus laevis) and zebrafish (Danio rerio) Zar1 orthologs were cloned by reverse transcription-polymerase chain reaction and rapid amplification of cDNA ends analysis of ovarian mRNA. Unlike mouse and human, the frog Zar1 is detected in multiple tissues, including lung, muscle, and ovary. The Zar1 mRNA appears in the cytoplasm of oocytes and persists until the tailbud stage during frog embryogenesis. Mouse, rat, human, frog, zebrafish, and pufferfish Zar1 genes encode proteins of 361, 361, 424, 295, 329, and 320 amino acids, respectively, and share 50.8%-88.1% amino acid identity. Regions of the N-termini of these ZAR1 orthologs show high sequence identity among these various proteins. However, the C-terminal 103 amino acids of these proteins, encoded by exons 2-4, contain an atypical eight-cysteine Plant Homeo Domain motif and are highly conserved, sharing 80.6%-98.1% identity among these species. These findings suggest that the carboxyl-termini of these ZAR1 proteins contain an important functional domain that is conserved through vertebrate evolution and that may be necessary for normal female reproduction in the transition from oocyte to embryonic life.

Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

PubMed

Su, S; Bird, R C

1995-09-15

A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed by a single amino acid from the sequence of hG1.16 and the published rat L37 sequence. Southern-blot analysis revealed that hG1.16 exists in multiple copies in human, rat and mouse genomes. These G1.16 clones encode unique human, rat and bovine members of the ribosomal protein L37 gene family, which are constitutively expressed even during transitions from quiescence to active cell proliferation or terminal differentiation, in all tissues and all vertebrates investigated.

Cloning and tissue distribution of rat hear fatty acid binding protein mRNA: identical forms in heart and skeletal muscle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Claffey, K.P.; Herrera, V.L.; Brecher, P.

1987-12-01

A fatty acid binding protein (FABP) as been identified and characterized in rat heart, but the function and regulation of this protein are unclear. In this study the cDNA for rat heart FABP was cloned from a lambda gt11 library. Sequencing of the cDNA showed an open reading frame coding for a protein with 133 amino acids and a calculated size of 14,776 daltons. Several differences were found between the sequence determined from the cDNA and that reported previously by protein sequencing techniques. Northern blot analysis using rat heart FABP cDNA as a probe established the presence of an abundantmore » mRNA in rat heart about 0.85 kilobases in length. This mRNA was detected, but was not abundant, in fetal heart tissue. Tissue distribution studies showed a similar mRNA species in red, but not white, skeletal muscle. In general, the mRNA tissue distribution was similar to that of the protein detected by Western immunoblot analysis, suggesting that heart FABP expression may be regulated at the transcriptional level. S1 nuclease mapping studies confirmed that the mRNA hybridized to rat heart FABP cDNA was identical in heart and red skeletal muscle throughout the entire open reading frame. The structural differences between heart FABP and other members of this multigene family may be related to the functional requirements of oxidative muscle for fatty acids as a fuel source.« less

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

PubMed

Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

2005-01-01

We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

HOXBES2: a novel epididymal HOXB2 homeoprotein and its domain-specific association with spermatozoa.

PubMed

Prabagaran, E; Bandivdekar, A H; Dighe, V; Raghavan, V P

2007-02-01

The sperm from the testis acquires complete fertilizing ability and forward progressive motility following its transit through the epididymis. Acquisition of these characteristics results from the modification of the sperm proteome following interactions with epididymal secretions. In our attempts to identify epididymis-specific sperm plasma membrane proteins, a partial 2.83-kb clone was identified by immunoscreening a monkey epididymal cDNA library with an agglutinating monoclonal antibody raised against washed human spermatozoa. The sequence of the 2.83-kb clone exhibited homology to the region between 1 and 1097 bp of the homeobox gene, Hoxb2. This sequence was found to be species conserved, as revealed by RT-PCR analysis. To obtain a full-length clone of the sequence, 5' RACE-PCR (rapid amplification of cDNA ends PCR) was carried out using rat epididymal RNA as the template. It resulted in a full-length 1.657-kb cDNA encoding a 32.9-kDa putative protein. The protein designated HOXBES2 exhibited homology to the conserved 61-amino acid homeodomain region of the HOXB2 homeoprotein. However, characteristic differences were noted in its amino and carboxyl termini compared with HOXB2. A putative 30-kDa protein was detected in the tissue extracts from adult rat epididymis and caudal spermatozoa, and a 37-kDa protein was detected in the rat embryo when probed with a polyclonal antibody against HOXB2 protein. Multiple tissue Western blot and immunohistochemical analysis further indicated its expression in the cytoplasm of the principal and basal epithelial cells, with maximal expression in the distal epididymal segments. Northern blot analysis detected a single approximately 2.5-kb transcript from the adult epididymis. Indirect immunofluorescence localized the protein to the acrosome, midpiece, and equatorial segments of rat caudal and ejaculated human and monkey spermatozoa, respectively. In conclusion, we have identified and characterized a novel epididymal homeoprotein different from HOXB2 protein and hereafter referred to as HOXBES2, (HOXB2 homeodomain containing epididymis-specific sperm protein) with a probable role in fertilization.

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.

PubMed

Geeta Vani, R; Varghese, C M; Rao, M R

1999-12-15

The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.

STUDIES OF NORMAL GENE EXPRESSION IN THE RAT NASAL EPITHELIUM USNG CDNA ARRAY TECHNOLOGY

EPA Science Inventory

Studies of Normal Gene Expression in the Rat Nasal Epithelium Using cDNA Array

The nasal epithelium is an important target site for chemically-induced toxicity and carcinogenicity .Gene expression data are being used increasingly for studies of such conditions. In or...

DIFFERENTIATING THE TOXICITY OF CARCINOGENIC ALDEHYDES FROM NONCARCINOGENIC ALDEHYDES IN THE RAT NOSE USING CDNA ARRAYS

EPA Science Inventory

Differentiating the Toxicity of Carcinogenic Aldehydes from Noncarcinogenic Aldehydes in the Rat Nose Using cDNA Arrays.

Formaldehyde is a widely used aldehyde in many industrial settings, the tanning process, household products, and is a contaminant in cigarette smoke. H...

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

The proteins interacting with C-terminal of μ receptor are identified by bacterial two-hybrid system from brain cDNA library in morphine-dependent rats.

PubMed

Zhou, Peilan; Jiang, Jiebing; Dong, Zhaoqi; Yan, Hui; You, Zhendong; Su, Ruibin; Gong, Zehui

2015-12-15

Opioid addiction is associated with long-term adaptive changes in the brain that involve protein expression. The carboxyl-terminal of the μ opioid receptor (MOR-C) is important for receptor signal transduction under opioid treatment. However, the proteins that interact with MOR-C after chronic morphine exposure remain unknown. The brain cDNA library of chronic morphine treatment rats was screened using rat MOR-C to investigate the regulator of opioids dependence in the present study. The brain cDNA library from chronic morphine-dependent rats was constructed using the SMART (Switching Mechanism At 5' end of RNA Transcript) technique. Bacterial two-hybrid system was used to screening the rat MOR-C interacting proteins from the cDNA library. RT-qPCR and immunoblotting were used to determine the variation of MOR-C interacting proteins in rat brain after chronic morphine treatment. Column overlay assays, immunocytochemistry and coimmunoprecipitation were used to demonstrate the interaction of MOR-C and p75NTR-associated cell death executor (NADE). 21 positive proteins, including 19 known proteins were screened to interact with rat MOR-C. Expression of several of these proteins was altered in specific rat brain regions after chronic morphine treatment. Among these proteins, NADE was confirmed to interact with rat MOR-C by in vitro protein-protein binding and coimmunoprecipitation in Chinese hamster ovary (CHO) cells and rat brain with or without chronic morphine treatment. Understanding the rat MOR-C interacting proteins and the proteins variation under chronic morphine treatment may be critical for determining the pathophysiological basis of opioid tolerance and addiction. Copyright © 2015. Published by Elsevier Inc.

Alternative polyadenylation of the gene transcripts encoding a rat DNA polymerase beta.

PubMed

Konopiński, R; Nowak, R; Siedlecki, J A

1996-10-17

Rat cells produce two different transcripts of DNA polymerase beta (beta-Pol). The low-molecular-weight transcript (1.4 kb) was already sequenced. We report here the cloning and sequencing of the full-length cDNA, corresponding to the high-molecular-weight (HMW) transcript (4.0 kb) of beta-Pol. Sequence data strongly suggest that both transcripts are produced from a single gene by alternative polyadenylation. The HMW transcript contains the entire 1.4 kb transcript sequence and additional 2.2 kb on the 3' end. The 3' UTR of the HMW transcript contains some regulatory sequences which are not present in the 1.4-kb transcript. The A + U-rich fragment and (GU)21 sequence are believed to influence the stability of the mRNA. The functional significance of the A-rich region locally destabilizing double-stranded secondary structure remains unknown.

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Identification and Cloning of Centaurin-α

PubMed Central

Hammonds-Odie, Latanya P.; Jackson, Trevor R.; Profit, Adam A.; Blader, Ira J.; Turck, Christoph W.; Prestwich, Glenn D.; Theibert, Anne B.

2015-01-01

Using an affinity resin and photoaffinity label based on phospholipid analogs of inositol 1,3,4,5-tetrakisphosphate (InsP4), we have isolated, characterized, and cloned a 46-kDa protein from rat brain, which we have named centaurin-α. Binding specificity was determined using displacement of 1-O-[3H](3-[4-benzoyldihydrocinnamidyl]propyl)-InsP4 photoaffinity labeling. Centaurin-α displayed highest affinity for phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) (IC50 = 120 nm), whereas InsP4, PtdInsP2, and InsP3 bound with 5-, 12-, and >50-fold lower affinity, respectively. Screening a rat brain cDNA library with a polymerase chain reaction product, generated using partial amino acid sequence from tryptic peptides, yielded a full-length clone. The 2,450-base pair cDNA contained an open reading frame (ORF) encoding a novel protein of 419 amino acids. Northern analysis revealed a 2.5-kilobase transcript that is highly expressed in brain. The deduced sequence contains a novel putative zinc finger motif, 10 ankyrin-like repeats, and shows homology to recently identified yeast and mammalian Arf GTPase-activating proteins. Given the specificity of binding and enrichment in brain, centaurin-α is a candidate PtdInsP3 receptor that may link the activation of phosphoinositide 3-kinase to downstream responses in the brain. PMID:8702546

A tolerance gene for prenylated flavonoid encodes a 26S proteasome regulatory subunit in Sophora flavescens.

PubMed

Shitan, Nobukazu; Kamimoto, Yoshihisa; Minami, Shota; Kubo, Mizuki; Ito, Kozue; Moriyasu, Masataka; Yazaki, Kazufumi

2011-01-01

Yeast functional screening with a Sophora flavescens cDNA library was performed to identify the genes involved in the tolerant mechanism to the self-producing prenylated flavonoid sophoraflavanone G (SFG). One cDNA, which conferred SFG tolerance, encoded a regulatory particle triple-A ATPase 2 (SfRPT2), a member of the 26S proteasome subunit. The yeast transformant of SfRPT2 showed reduced SFG accumulation in the cells.

Cloning and expression of cDNA coding for bouganin.

PubMed

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

PubMed

Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

1987-11-01

We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

PubMed

Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

1992-12-01

Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cool, D.E.; Tonks, N.K.; Charbonneau, H.

1989-07-01

A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

PubMed Central

Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

1998-01-01

Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

[Cloning and expressing of cyclophilin B gene from Schistosoma japonnicum and the analysis of immunoprotective effect].

PubMed

Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao

2010-03-01

The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Identification of an NADH-Cytochrome b5 Reductase Gene from an Arachidonic Acid-Producing Fungus, Mortierella alpina 1S-4, by Sequencing of the Encoding cDNA and Heterologous Expression in a Fungus, Aspergillus oryzae

PubMed Central

Sakuradani, Eiji; Kobayashi, Michihiko; Shimizu, Sakayu

1999-01-01

Based on the sequence information for bovine and yeast NADH-cytochrome b5 reductases (CbRs), a DNA fragment was cloned from Mortierella alpina 1S-4 after PCR amplification. This fragment was used as a probe to isolate a cDNA clone with an open reading frame encoding 298 amino acid residues which show marked sequence similarity to CbRs from other sources, such as yeast (Saccharomyces cerevisiae), bovine, human, and rat CbRs. These results suggested that this cDNA is a CbR gene. The results of a structural comparison of the flavin-binding β-barrel domains of CbRs from various species and that of the M. alpina enzyme suggested that the overall barrel-folding patterns are similar to each other and that a specific arrangement of three highly conserved amino acid residues (i.e., arginine, tyrosine, and serine) plays a role in binding with the flavin (another prosthetic group) through hydrogen bonds. The corresponding genomic gene, which was also cloned from M. alpina 1S-4 by means of a hybridization method with the above probe, had four introns of different sizes. These introns had GT at the 5′ end and AG at the 3′ end, according to a general GT-AG rule. The expression of the full-length cDNA in a filamentous fungus, Aspergillus oryzae, resulted in an increase (4.7 times) in ferricyanide reduction activity involving the use of NADH as an electron donor in the microsomes. The M. alpina CbR was purified by solubilization of microsomes with cholic acid sodium salt, followed by DEAE-Sephacel, Mono-Q HR 5/5, and AMP-Sepharose 4B affinity column chromatographies; there was a 645-fold increase in the NADH-ferricyanide reductase specific activity. The purified CbR preferred NADH over NADPH as an electron donor. This is the first report of an analysis of this enzyme in filamentous fungi. PMID:10473389

Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

NASA Technical Reports Server (NTRS)

Biermann, B.; Johnson, E. M.; Feldman, L. J.

1990-01-01

Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

PubMed Central

Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

1991-01-01

The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

Molecular cloning and expression of the CRISP family of proteins in the boar.

PubMed

Vadnais, Melissa L; Foster, Douglas N; Roberts, Kenneth P

2008-12-01

The family of mammalian cysteine-rich secretory proteins (CRISP) have been well characterized in the rat, mouse, and human. Here we report the molecular cloning and expression analysis of CRISP1, CRISP2, and CRISP3 in the boar. A partial sequence published in the National Center for Biotechnology Information (NCBI) database was used to derive the full-length sequences for CRISP1 and CRISP2 using rapid amplification of cDNA ends. RT-PCR confirmed the expression of these mRNAs in the boar reproductive tract, and real time RT-PCR showed CRISP1 to be highly expressed throughout the epididymis, with CRISP2 highly expressed in the testis. A search of the porcine genomic sequence in the NCBI database identified a BAC (CH242-199E6) encoding the CRISP1 gene. This BAC is derived from porcine Chromosome 7 and is syntenic with the regions of the mouse, rat, and human genomes encoding the CRISP gene family. This BAC was found to encode a third CRISP protein with a predicted amino acid sequence of high similarity to human CRISP3. Using RT-PCR we show that CRISP3 expression in the boar reproductive tract is confined to the prostate. Recombinant porcine (rp) CRISP2 protein was produced and purified. When incubated with capacitated boar sperm, rpCRISP2 induced an acrosome reaction, consistent with its demonstrated ability to alter the activity of calcium channels.

Isolation and characterization of a cDNA encoding a membrane bound acyl-CoA binding protein from Agave americana L. epidermis.

PubMed

Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio

2006-01-01

A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.

Characterization of tumor differentiation factor (TDF) and its receptor (TDF-R).

PubMed

Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

2013-08-01

Tumor differentiation factor (TDF) is an under-investigated protein produced by the pituitary with no definitive function. TDF is secreted into the bloodstream and targets the breast and prostate, suggesting that it has an endocrine function. Initially, TDF was indirectly discovered based on the differentiation effect of alkaline pituitary extracts of the mammosomatotropic tumor MtTWlO on MTW9/PI rat mammary tumor cells. Years later, the cDNA clone responsible for this differentiation activity was isolated from a human pituitary cDNA library using expression cloning. The cDNA encoded a 108-amino-acid polypeptide that had differentiation activity on MCF7 breast cancer cells and on DU145 prostate cancer cells in vitro and in vivo. Recently, our group focused on identification of the TDF receptor (TDF-R). As potential TDF-R candidates, we identified the members of the Heat Shock 70-kDa family of proteins (HSP70) in both MCF7 and BT-549 human breast cancer cells (HBCC) and PC3, DU145, and LNCaP human prostate cancer cells (HPCC), but not in HeLa cells, NG108 neuroblastoma, or HDF-a and BLK CL.4 cells fibroblasts or fibroblast-like cells. Here we review the current advances on TDF, with particular focus on the structural investigation of its receptor and on its functional effects on breast and prostate cells.

The human mu opioid receptor: modulation of functional desensitization by calcium/calmodulin-dependent protein kinase and protein kinase C.

PubMed

Mestek, A; Hurley, J H; Bye, L S; Campbell, A D; Chen, Y; Tian, M; Liu, J; Schulman, H; Yu, L

1995-03-01

Opioids are some of the most efficacious analgesics used in humans. Prolonged administration of opioids, however, often causes the development of drug tolerance, thus limiting their effectiveness. To explore the molecular basis of those mechanisms that may contribute to opioid tolerance, we have isolated a cDNA for the human mu opioid receptor, the target of such opioid narcotics as morphine, codeine, methadone, and fentanyl. The receptor encoded by this cDNA is 400 amino acids long with 94% sequence similarity to the rat mu opioid receptor. Transient expression of this cDNA in COS-7 cells produced high-affinity binding sites to mu-selective agonists and antagonists. This receptor displays functional coupling to a recently cloned G-protein-activated K+ channel. When both proteins were expressed in Xenopus oocytes, functional desensitization developed upon repeated stimulation of the mu opioid receptor, as observed by a reduction in K+ current induced by the second mu receptor activation relative to that induced by the first. The extent of desensitization was potentiated by both the multifunctional calcium/calmodulin-dependent protein kinase and protein kinase C. These results demonstrate that kinase modulation is a molecular mechanism by which the desensitization of mu receptor signaling may be regulated at the cellular level, suggesting that this cellular mechanism may contribute to opioid tolerance in humans.

AcT-2: a novel myotropic and antimicrobial type 2 tryptophyllin from the skin secretion of the Central American red-eyed leaf frog, Agalychnis callidryas.

PubMed

Ge, Lilin; Lyu, Peng; Zhou, Mei; Zhang, Huiling; Wan, Yuantai; Li, Bin; Li, Renjie; Wang, Lei; Chen, Tianbao; Shaw, Chris

2014-01-01

Tryptophyllins are a diverse family of amphibian peptides originally found in extracts of phyllomedusine frog skin by chemical means. Their biological activities remain obscure. Here we describe the isolation and preliminary pharmacological characterization of a novel type 2 tryptophyllin, named AcT-2, from the skin secretion of the red-eyed leaf frog, Agalychnis callidryas. The peptide was initially identified during smooth muscle pharmacological screening of skin secretion HPLC fractions and the unique primary structure--GMRPPWF-NH2--was established by both Edman degradation and electrospray MS/MS fragmentation sequencing. A. cDNA encoding the biosynthetic precursor of AcT-2 was successfully cloned from a skin secretion-derived cDNA library by means of RACE PCR and this contained an open-reading frame consisting of 62 amino acid residues with a single AcT-2 encoding sequence located towards the C-terminus. A synthetic replicate of AcT-2 was found to relax arterial smooth muscle (EC50 = 5.1 nM) and to contract rat urinary bladder smooth muscle (EC50 = 9.3 μ M). The peptide could also inhibit the growth of the microorganisms, Staphylococcus aureus, (MIC = 256 mg/L) Escherichia coli (MIC = 512 mg/L), and Candida albicans (128 mg/L). AcT-2 is thus the first amphibian skin tryptophyllin found to possess both myotropic and antimicrobial activities.

Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

PubMed

Wu, Zhencai; Burns, Jacqueline K

2003-04-01

The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

PubMed Central

Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

1997-01-01

A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

Isolation and characterization of a cDNA from Cuphea lanceolata encoding a beta-ketoacyl-ACP reductase.

PubMed

Klein, B; Pawlowski, K; Höricke-Grandpierre, C; Schell, J; Töpfer, R

1992-05-01

A cDNA encoding beta-ketoacyl-ACP reductase (EC 1.1.1.100), an integral part of the fatty acid synthase type II, was cloned from Cuphea lanceolata. This cDNA of 1276 bp codes for a polypeptide of 320 amino acids with 63 N-terminal residues presumably representing a transit peptide and 257 residues corresponding to the mature protein of 27 kDa. The encoded protein shows strong homology with the amino-terminal sequence and two tryptic peptides from avocado mesocarp beta-ketoacyl-ACP reductase, and its total amino acid composition is highly similar to those of the beta-ketoacyl-ACP reductases of avocado and spinach. Amino acid sequence homologies to polyketide synthase, beta-ketoreductases and short-chain alcohol dehydrogenases are discussed. An engineered fusion protein lacking most of the transit peptide, which was produced in Escherichia coli, was isolated and proved to possess beta-ketoacyl-ACP reductase activity. Hybridization studies revealed that in C. lanceolata beta-ketoacyl-ACP reductase is encoded by a small family of at least two genes and that members of this family are expressed in roots, leaves, flowers and seeds.

Molecular cloning and expression of a unique receptor-like protein-tyrosine-phosphatase in the leucocyte-common-antigen-related phosphate family.

PubMed Central

Zhang, W R; Hashimoto, N; Ahmad, F; Ding, W; Goldstein, B J

1994-01-01

Protein-tyrosine-phosphatases (PTPases) have been implicated in the regulation of certain tyrosine kinase growth factor receptors in that they dephosphorylate the activated (autophosphorylated) form of the receptors. In order to identify PTPases that potentially act on receptor targets in liver, we used the human leucocyte common antigen-related PTPase (LAR) cDNA [Streuli, Krueger, Hall, Schlossman and Saito (1988) J. Exp. Med. 168, 1523-1530] and isolated two closely related transmembrane PTPase homologues from a rat hepatic cDNA library. Both PTPases had large extracellular domains that contained three immunoglobulin-like repeats and eight type-III fibronectin repeats. Both enzymes had tandem homologous PTPase domains following a single hydrophobic transmembrane domain. One sequence encoded the rat homologue of LAR. The second PTPase, designated LAR-PTP2, had 79 and 90% identity with rat LAR in the respective cytoplasmic PTPase domains, with only 57% sequence similarity in the extracellular domain. The catalytic domains of LAR and LAR-PTP2 prepared by bacterial expression were active in dephosphorylating a variety of phosphotyrosyl substrates but did not hydrolyse phosphoserine or phosphothreonine residues of labelled casein. Both enzymes exhibited rapid turnover numbers of 4-7 s-1 for myelin basic protein and 78-150 s-1 for derivatized lysozyme. LAR and LAR-PTP2 displayed similar PTPase activity towards the simultaneous dephosphorylation of receptors of intact insulin and epidermal growth factor from liver membranes. These data indicate that there is a family of LAR-related PTPases that may regulate the phosphorylation state of receptor tyrosine kinases in liver and other tissues. Images Figure 1 Figure 4 Figure 5 Figure 6 PMID:8068021

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, N.V.

1994-01-04

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties. GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon. .

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

1994-01-04

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties. GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

PubMed Central

Newsome, A L; McLean, J W; Lively, M O

1992-01-01

Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

PubMed Central

Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

1995-01-01

We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

PubMed

Walker, J; Tait, A

1997-11-01

A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

[Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

1997-02-01

The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Novel transcripts of the estrogen receptor α gene in channel catfish

USGS Publications Warehouse

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may encode functional ERα or related proteins that modulate ERα or ERβ activity. The existence of ER antisense mRNA is reported in this study for the first time. Its role may be to participate in the regulation of ER gene expression.

CLONING AND CHARACTERIZATION OF CDNA ENCODING GIARDIA LAMBLIA d-GIARDIN

USDA-ARS?s Scientific Manuscript database

A cDNA coding for d-giardin was cloned from Giardia lamblia trophozoites in order to localize the protein and study its function in mediating surface attachment. Recombinant d-giardin antigen was produced in Escherichia coli as a poly-histidine fusion protein and was purified by affinity chromatogr...

Molecular cloning and characterization of a cDNA encoding a novel apoplastic protein preferentially expressed in a shikonin-producing callus strain of Lithospermum erythrorhizon.

PubMed

Yamamura, Yoshimi; Sahin, F Pinar; Nagatsu, Akito; Mizukami, Hajime

2003-04-01

A cDNA (LEPS-2) encoding a novel cell wall protein was cloned from shikonin-producing callus tissues of Lithospermum erythrorhizon by differential display between a shikonin-producing culture strain and a non-producing strain. The LEPS-2 cDNA encoded a polypeptide of 184 amino acids. The deduced amino acid sequence exhibited no significant homology with known proteins. Expression of LEPS-2 gene as well as accumulation of LEPS-2 protein was highly correlated with shikonin production in L. erythrorhizon cells in culture. In the intact plant, expression of LEPS-2 was detected only in the roots where shikonin pigments accumulated. Cell fractionation experiments and immunocytochemical analysis showed that the protein was localized in the apoplast fraction of the cell walls. The shikonin pigments were also stored on the cell walls as oil droplets. These results indicate that expression of the LEPS-2 is closely linked with shikonin biosynthesis and the LEPS-2 protein may be involved in the intra-cell wall trapping of shikonin pigments.

Sequence characterization of cDNA sequence of encoding of an antimicrobial Peptide with no disulfide bridge from the Iranian mesobuthus eupeus venomous glands.

PubMed

Farajzadeh-Sheikh, Ahmad; Jolodar, Abbas; Ghaemmaghami, Shamsedin

2013-01-01

Scorpion venom glands produce some antimicrobial peptides (AMP) that can rapidly kill a broad range of microbes and have additional activities that impact on the quality and effectiveness of innate responses and inflammation. In this study, we reported the identification of a cDNA sequence encoding cysteine-free antimicrobial peptides isolated from venomous glands of this species. Total RNA was extracted from the Iranian mesobuthus eupeus venom glands, and cDNA was synthesized by using the modified oligo (dT). The cDNA was used as the template for applying Semi-nested RT- PCR technique. PCR Products were used for direct nucleotide sequencing and the results were compared with Gen Bank database. A 213 BP cDNA fragment encoding the entire coding region of an antimicrobial toxin from the Iranian scorpion M. Eupeus venom glands were isolated. The full-length sequence of the coding region was 210 BP contained an open reading frame of 70 amino with a predicted molecular mass of 7970.48 Da and theoretical Pi of 9.10. The open reading frame consists of 210 BP encoding a precursor of 70 amino acid residues, including a signal peptide of 23 residues a propertied of 7 residues, and a mature peptide of 34 residues with no disulfide bridge. The peptide has detectable sequence identity to the Lesser Asian mesobuthus eupeus MeVAMP-2 (98%), MeVAMP-9 (60%) and several previously described AMPs from other scorpion venoms including mesobuthus martensii (94%) and buthus occitanus Israelis (82%). The secondary structure of the peptide mainly consisted of α-helical structure which was generally conserved by previously reported scorpion counterparts. The phylogenetic analysis showed that the Iranian MeAMP-like toxin was similar but not identical with that of venom antimicrobial peptides from lesser Asian scorpion mesobuthus eupeus.

Cloning and characterization of a cDNA encoding a novel extracellular peroxidase from Trametes versicolor.

PubMed

Collins, P J; O'Brien, M M; Dobson, A D

1999-03-01

The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression.

Cloning and Characterization of a cDNA Encoding a Novel Extracellular Peroxidase from Trametes versicolor

PubMed Central

Collins, Patrick J.; O’Brien, Margaret M.; Dobson, Alan D. W.

1999-01-01

The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression. PMID:10049906

Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

PubMed Central

Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

2011-01-01

To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli.

PubMed

Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N

1995-10-01

We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.

Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

NASA Astrophysics Data System (ADS)

Gao, Lan; Li, Hao-Ming

2017-08-01

Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

NASA Astrophysics Data System (ADS)

Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

1996-06-01

cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

PubMed

Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

2000-12-01

Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

A Plastidial Lysophosphatidic Acid Acyltransferase from Oilseed Rape1

PubMed Central

Bourgis, Fabienne; Kader, Jean-Claude; Barret, Pierre; Renard, Michel; Robinson, David; Robinson, Colin; Delseny, Michel; Roscoe, Thomas J.

1999-01-01

The biosynthesis of phosphatidic acid, a key intermediate in the biosynthesis of lipids, is controlled by lysophosphatidic acid (LPA, or 1-acyl-glycerol-3-P) acyltransferase (LPAAT, EC 2.3.1.51). We have isolated a cDNA encoding a novel LPAAT by functional complementation of the Escherichia coli mutant plsC with an immature embryo cDNA library of oilseed rape (Brassica napus). Transformation of the acyltransferase-deficient E. coli strain JC201 with the cDNA sequence BAT2 alleviated the temperature-sensitive phenotype of the plsC mutant and conferred a palmitoyl-coenzyme A-preferring acyltransferase activity to membrane fractions. The BAT2 cDNA encoded a protein of 351 amino acids with a predicted molecular mass of 38 kD and an isoelectric point of 9.7. Chloroplast-import experiments showed processing of a BAT2 precursor protein to a mature protein of approximately 32 kD, which was localized in the membrane fraction. BAT2 is encoded by a minimum of two genes that may be expressed ubiquitously. These data are consistent with the identity of BAT2 as the plastidial enzyme of the prokaryotic glycerol-3-P pathway that uses a palmitoyl-ACP to produce phosphatidic acid with a prokaryotic-type acyl composition. The homologies between the deduced protein sequence of BAT2 with prokaryotic and eukaryotic microsomal LAP acytransferases suggest that seed microsomal forms may have evolved from the plastidial enzyme. PMID:10398728

Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

PubMed

Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

2013-02-01

The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

Nectinepsin: a new extracellular matrix protein of the pexin family. Characterization of a novel cDNA encoding a protein with an RGD cell binding motif.

PubMed

Blancher, C; Omri, B; Bidou, L; Pessac, B; Crisanti, P

1996-10-18

We report the isolation and characterization of a novel cDNA from quail neuroretina encoding a putative protein named nectinepsin. The nectinepsin cDNA identifies a major 2.2-kilobase mRNA that is detected from ED 5 in neuroretina and is increasingly abundant during embryonic development. A nectinepsin mRNA is also found in quail liver, brain, and intestine and in mouse retina. The deduced nectinepsin amino acid sequence contains the RGD cell binding motif of integrin ligands. Furthermore, nectinepsin shares substantial homologies with vitronectin and structural protein similarities with most of the matricial metalloproteases. However, the presence of a specific sequence and the lack of heparin and collagen binding domains of the vitronectin indicate that nectinepsin is a new extracellular matrix protein. Furthermore, genomic Southern blot studies suggest that nectinepsin and vitronectin are encoded by different genes. Western blot analysis with an anti-human vitronectin antiserum revealed, in addition to the 65- and 70-kDa vitronectin bands, an immunoreactive protein of about 54 kDa in all tissues containing nectinepsin mRNA. It seems likely that the form of vitronectin found in chick egg yolk plasma by Nagano et al. ((1992) J. Biol. Chem. 267, 24863-24870) is the protein that corresponds to the nectinepsin cDNA. This new protein could be an important molecule involved in the early steps of the development.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression.

PubMed

Xu, Y L; Li, L; Wu, K; Peeters, A J; Gage, D A; Zeevaart, J A

1995-07-03

The biosynthesis of gibberellins (GAs) after GA12-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11.-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidase gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA53 to GA44 and GA19 to GA20. The Arabidopsis GA 20-oxidase shares 55% identity and > 80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA5 locus of Arabidopsis. The ga5 semidwarf mutant contains a G-->A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Ara-bidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA4 treatment, suggesting end-product repression in the GA biosynthetic pathway.

The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: Molecular cloning and functional expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Yun-Ling; Li, Li; Wu, Keqiang

1995-07-03

The biosynthesis of gibberellins (GAs) after GA{sub 12}-aldehyde involves a series of oxidative steps that lead to the formation of bioactive GAs. Previously, a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing), EC 1.14.11-] was isolated by immunoscreening a cDNA library from liquid endosperm of pumpkin (Cucurbita maxima L.) with antibodies against partially purified GA 20-oxidase. Here, we report isolation of a genomic clone for GA 20-oxidase from a genomic library of the long-day species Arabidopsis thaliana Heynh., strain Columbia, by using the pumpkin cDNA clone as a heterologous probe. This genomic clone contains a GA 20-oxidasemore » gene that consists of three exons and two introns. The three exons are 1131-bp long and encode 377 amino acid residues. A cDNA clone corresponding to the putative GA 20-oxidase genomic sequence was constructed with the reverse transcription-PCR method, and the identity of the cDNA clone was confirmed by analyzing the capability of the fusion protein expressed in Escherichia coli to convert GA{sub 53} to GA{sub 44} and GA{sub 19} to GA{sub 20}. The Arabidopsis GA 20-oxidase shares 55% identity and >80% similarity with the pumpkin GA 20-oxidase at the derived amino acid level. Both GA 20-oxidases share high homology with other 2-oxoglutarate-dependent dioxygenases (2-ODDs), but the highest homology was found between the two GA 20-oxidases. Mapping results indicated tight linkage between the cloned GA 20-oxidase and the GA locus of Arabidopsis. The ga5 semidwarf mutant contains a G {yields} A point mutation that inserts a translational stop codon in the protein-coding sequence, thus confirming that the GA5 locus encodes GA 20-oxidase. Expression of the GA5 gene in Arabidopsis leaves was enhanced after plants were transferred from short to long days; it was reduced by GA{sub 4} treatment, suggesting end-product repression in the GA biosynthetic pathway. 28 refs., 6 figs.« less

The Potential Role of As-sumo-1 in the Embryonic Diapause Process and Early Embryo Development of Artemia sinica

PubMed Central

Chu, Bing; Yao, Feng; Cheng, Cheng; Wu, Yang; Mei, Yanli; Li, Xuejie; Liu, Yan; Wang, Peisheng; Hou, Lin; Zou, Xiangyang

2014-01-01

During embryonic development of Artemia sinica, environmental stresses induce the embryo diapause phenomenon, required to resist apoptosis and regulate cell cycle activity. The small ubiquitin-related modifier-1 (SUMO), a reversible post-translational protein modifier, plays an important role in embryo development. SUMO regulates multiple cellular processes, including development and other biological processes. The molecular mechanism of diapause, diapause termination and the role of As-sumo-1 in this processes and in early embryo development of Artemia sinica still remains unknown. In this study, the complete cDNA sequences of the sumo-1 homolog, sumo ligase homolog, caspase-1 homolog and cyclin B homolog from Artemia sinica were cloned. The mRNA expression patterns of As-sumo-1, sumo ligase, caspase-1, cyclin B and the location of As-sumo-1 were investigated. SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E proteins were analyzed during different developmental stages of the embryo of A. sinica. Small interfering RNA (siRNA) was used to verify the function of sumo-1 in A. sinica. The full-length cDNA of As-sumo-1 was 476 bp, encoding a 92 amino acid protein. The As-caspases-1 cDNA was 966 bp, encoding a 245 amino-acid protein. The As-sumo ligase cDNA was 1556 bp encoding, a 343 amino acid protein, and the cyclin B cDNA was 739 bp, encoding a 133 amino acid protein. The expressions of As-sumo-1, As-caspase-1 and As-cyclin B were highest at the 10 h stage of embryonic development, and As-sumo ligase showed its highest expression at 0 h. The expression of As-SUMO-1 showed no tissue or organ specificity. Western blotting showed high expression of As-SUMO-1, p53, Mdm2, Caspase-1, Cyclin B and Cyclin E at the 10 h stage. The siRNA caused abnormal development of the embryo, with increased malformation and mortality. As-SUMO-1 is a crucial regulation and modification protein resumption of embryonic diapause and early embryo development of A. sinica. PMID:24404204

Biosynthesis and processing of the somatostatin family of peptide hormones.

PubMed

Andrews, P C; Dixon, J E

1986-01-01

Understanding of the biosynthesis of the somatostatin family of peptide hormones has greatly increased in recent years. Isolation and sequencing of the rat somatostatin gene indicates that it contains a single intron located between the codons for Gn(-57) and Glu(-56) of pre-prosomatostatin. The gene contains three repetitive sequences, one at the 5' end of the gene and two of them 3' to the coding portion. Two of the sequences consist of alternating purine-pyrimidine bases and have been shown to adopt Z-DNA structures in vitro. The cDNA for rat somatostatin codes for a 116-residue peptide structurally similar to the anglerfish and catfish precursors to the 14-residue somatostatin (SST-14). In addition to SST-14, the catfish and the anglerfish both contain an additional pancreatic somatostatin, each derived from a different gene. The catfish contains a 22-residue somatostatin, which is O-glycosylated at Thr-5. The second somatostatin gene from anglerfish encodes a prosomatostatin that is processed to a 28-residue peptide. The mature peptide contains a hydroxylated lysine at position 23.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

Sequence and pattern of expression of a bovine homologue of a human mitochondrial transport protein associated with Grave's disease.

PubMed

Fiermonte, G; Runswick, M J; Walker, J E; Palmieri, F

1992-01-01

A human cDNA has been isolated previously from a thyroid library with the aid of serum from a patient with Grave's disease. It encodes a protein belonging to the mitochondrial metabolite carrier family, referred to as the Grave's disease carrier protein (GDC). Using primers based on this sequence, overlapping cDNAs encoding the bovine homologue of the GDC have been isolated from total bovine heart poly(A)+ cDNA. The bovine protein is 18 amino acids shorter than the published human sequence, but if a frame shift requiring the removal of one nucleotide is introduced into the human cDNA sequence, the human and bovine proteins become identical in their C-terminal regions, and 308 out of 330 amino acids are conserved over their entire sequences. The bovine cDNA has been used to investigate the expression of the GDC in various bovine tissues. In the tissues that were examined, the GDC is most strongly expressed in the thyroid, but substantial amounts of its mRNA were also detected in liver, lung and kidney, and lesser amounts in heart and skeletal muscle.

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hev ein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

CDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

PubMed

Yi, S Y; Yu, S H; Choi, D

1999-06-30

Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

PubMed Central

Lassner, M W; Lardizabal, K; Metz, J G

1996-01-01

beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils. PMID:8742713

A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

PubMed

Lassner, M W; Lardizabal, K; Metz, J G

1996-02-01

beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

Phosducin-like protein: an ethanol-responsive potential modulator of guanine nucleotide-binding protein function.

PubMed

Miles, M F; Barhite, S; Sganga, M; Elliott, M

1993-11-15

Acute and chronic exposure to ethanol produces specific changes in several signal transduction cascades. Such alterations in signaling are thought to be a crucial aspect of the central nervous system's adaptive response, which occurs with chronic exposure to ethanol. We have recently identified and isolated several genes whose expression is specifically induced by ethanol in neural cell cultures. The product of one of these genes has extensive sequence homology to phosducin, a phosphoprotein expressed in retina and pineal gland that modulates trimeric guanine nucleotide-binding protein (G protein) function by binding to G-protein beta gamma subunits. We identified from a rat brain cDNA library an isolate encoding the phosducin-like protein (PhLP), which has 41% identity and 65% amino acid homology to phosducin. PhLP cDNA is expressed in all tissues screened by RNA blot-hybridization analysis and shows marked evolutionary conservation on Southern hybridization. We have identified four forms of PhLP cDNA varying only in their 5' ends, probably due to alternative splicing. This 5'-end variation generates two predicted forms of PhLP protein that differ by 79 aa at the NH2 terminus. Treatment of NG108-15 cells for 24 hr with concentrations of ethanol seen in actively drinking alcoholics (25-100 mM) causes up to a 3-fold increase in PhLP mRNA levels. Induction of PhLP by ethanol could account for at least some of the widespread alterations in signal transduction and G-protein function that are known to occur with chronic exposure to ethanol.

Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

PubMed

Yi, S Y; Hwang, B K

1998-10-31

Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

Molecular characterization of a KIF3B-like kinesin gene in the testis of Octopus tankahkeei (Cephalopoda, Octopus).

PubMed

Dang, Ran; Zhu, Jun-Quan; Tan, Fu-Qing; Wang, Wei; Zhou, Hong; Yang, Wan-Xi

2012-05-01

KIF3B is known for maintaining and assembling cilia and flagellum. To date, the function of KIF3B and its relationship with KIF3A during spermiogenesis in the cephalopod Octopus tankahkeei remains unknown. In the present study, we characterized a gene encoding a homologue of rat KIF3B in the O. tankahkeei testis and examined its temporal and spatial expression pattern during spermiogenesis. The cDNA of KIF3B was obtained with degenerate and RACE PCR and the distribution pattern of ot-kif3b were observed with RT-PCR. The morphological development during spermiogenesis was illustrated by histological and transmission electron microscopy and mRNA expression of ot-kif3b was observed by in situ hybridization. The 2,365 nucleotides cDNA consisted of a 102 bp 5' untranslated region (UTR), a 2,208 bp open reading frame (ORF) encoding a protein of 736 amino acids, and a 55 bp 3' UTR. Multiple alignments revealed that the putative Ot-KIF3B shared 68, 68, 69, 68, and 67% identity with that of Homo sapiens, Mus musculus, Gallus gallus, Danio rerio, and Xenopus laevis, respectively, along with high identities with Ot-KIF3A in fundamental structures. Ot-kif3b transcripts appeared gradually in early spermatids, increased in intermediate spermatids and maximized in drastically remodeled and final spermatids. The kif3b gene is identified and its expression pattern is demonstrated for the first time in O. tankahkeei. Compared to ot-kif3a reported by our laboratory before, our data suggested that the putative heterodimeric motor proteins Ot-KIF3A/B may be involved in intraspermatic transport and might contribute to structural changes during spermiogenesis.

Identification of interleukin-26 in the dromedary camel (Camelus dromedarius): Evidence of alternative splicing and isolation of novel splice variants.

PubMed

Premraj, Avinash; Nautiyal, Binita; Aleyas, Abi G; Rasool, Thaha Jamal

2015-10-01

Interleukin-26 (IL-26) is a member of the IL-10 family of cytokines. Though conserved across vertebrates, the IL-26 gene is functionally inactivated in a few mammals like rat, mouse and horse. We report here the identification, isolation and cloning of the cDNA of IL-26 from the dromedary camel. The camel cDNA contains a 516 bp open reading frame encoding a 171 amino acid precursor protein, including a 21 amino acid signal peptide. Sequence analysis revealed high similarity with other mammalian IL-26 homologs and the conservation of IL-10 cytokine family domain structure including key amino acid residues. We also report the identification and cloning of four novel transcript variants produced by alternative splicing at the Exon 3-Exon 4 regions of the gene. Three of the alternative splice variants had premature termination codons and are predicted to code for truncated proteins. The transcript variant 4 (Tv4) having an insertion of an extra 120 bp nucleotides in the ORF was predicted to encode a full length protein product with 40 extra amino acid residues. The mRNA transcripts of all the variants were identified in lymph node, where as fewer variants were observed in other tissues like blood, liver and kidney. The expression of Tv2 and Tv3 were found to be up regulated in mitogen induced camel peripheral blood mononuclear cells. IL-26-Tv2 expression was also induced in camel fibroblast cells infected with Camel pox virus in-vitro. The identification of the transcript variants of IL-26 from the dromedary camel is the first report of alternative splicing for IL-26 in a species in which the gene has not been inactivated. Copyright © 2015 Elsevier Ltd. All rights reserved.

Cloning, characterization and tissue specific expression of Amur tiger (Panthera tigris altaica) IGF-I.

PubMed

Hu, Xi-Lian; Zhu, Mu-Yuan; Zhang, Zhi-He; Hou, Rong; Shen, Fu-Jun; Li, Fu-Zhen; Zhang, An-Ju

2006-08-01

Insulin-like growth factor I (IGF-I) plays an important role in regulating gonad function, which is essential for normal reproduction in animals, especially in sexual receptivity and reproductive behavior. In this study, a cDNA encoding Amur tiger (Panthera tigris altaica) IGF-I was isolated from liver total RNA using RT-PCR. The IGF-I cDNA of Amur tiger (ATIGF-I) was highly homologous to that of other animals, 84.8% to rat, 93.7% to human and horse. Alignment analysis showed that the cysteine residues and many amino acid residues of putative mature ATIGF-I are highly conserved in mammalian species, confirming the high sequence homology observed in other species. DNA encoding the mature ATIGF-I peptide was ligated with pET-DsbA expression vector and highly expressed in Escherichia coli BL21 with IPTG induction. The recombinant proteins expressed existed mostly in the soluble protein fraction, and were purified with metal affinity resins. Western blotting confirmed that the recombinant proteins reacted with antibodies against IGF-I. The results obtained here should be useful for large-scale production of biological active ATIGF-I protein, as well as for further research on growth, development, and reproduction in the Amur tiger. Tissue specific expression of ATIGF-I mRNA in the Amur tiger was examined by reverse transcription-polymerase chain reaction (RT-PCR), The major ATIGF-I mRNA expression tissue was the liver, while medium signals were found in the uterus, ovary, and pituitary, and minor signals were detected in various tissues including the heart, spleen, pancreas, and kidney. The results indicate that IGF-I might play an important role in the reproductive system and in cub development in the Amur tiger.

Regulation and Functional Expression of Cinnamate 4-Hydroxylase from Parsley

PubMed Central

Koopmann, Edda; Logemann, Elke; Hahlbrock, Klaus

1999-01-01

A previously isolated parsley (Petroselinum crispum) cDNA with high sequence similarity to cinnamate 4-hydroxylase (C4H) cDNAs from several plant sources was expressed in yeast (Saccharomyces cerevisiae) containing a plant NADPH:cytochrome P450 oxidoreductase and verified as encoding a functional C4H (CYP73A10). Low genomic complexity and the occurrence of a single type of cDNA suggest the existence of only one C4H gene in parsley. The encoded mRNA and protein, in contrast to those of a functionally related NADPH:cytochrome P450 oxidoreductase, were strictly coregulated with phenylalanine ammonia-lyase mRNA and protein, respectively, as demonstrated by coinduction under various conditions and colocalization in situ in cross-sections from several different parsley tissues. These results support the hypothesis that the genes encoding the core reactions of phenylpropanoid metabolism form a tight regulatory unit. PMID:9880345

Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

PubMed

Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

2015-01-01

Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

NASA Technical Reports Server (NTRS)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Molecular analysis of ARF1 expression profiles during development of physic nut (Jatropha curcas L.).

PubMed

Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang

2011-03-01

A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.

Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finlay, C.A.; Hinds, P.W.; Tan, T.H.

1988-02-01

The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

Stable expression of rat cytochrome P-450IIB1 cDNA in Chinese hamster cells (V79) and metabolic activation of aflatoxin B1.

PubMed Central

Doehmer, J; Dogra, S; Friedberg, T; Monier, S; Adesnik, M; Glatt, H; Oesch, F

1988-01-01

V79 Chinese hamster fibroblasts are widely used for mutagenicity testing but have the serious limitation that they do not express cytochromes P-450, which are needed for the activation of many promutagens to mutagenic metabolites. A full-length cDNA clone encoding the monooxygenase cytochrome P-450IIB1 under control of the simian virus 40 early promoter was constructed and cointroduced with the selection marker neomycin phosphotransferase (conferring resistance to G418) into V79 Chinese hamster cells. G418-resistant cells were selected, established as cell lines, and tested for cytochrome P-450IIB1 expression and enzymatic activity. Two cell lines (SD1 and SD3) were found that stably produce cytochrome P-450IIB1. Although purified cytochromes P-450 possess monooxygenase activity only after reconstitution with cytochrome P-450 reductase and phospholipid, the gene product of the construct exhibited this activity. This implies that the gene product is intracellularly localized in a way that allows access to the required components. If compared with V79 cells, the mutation rate for the hypoxanthine phosphoribosyltransferase (HPRT) locus in SD1 cells is markedly increased when exposed to aflatoxin B1, which is activated by this enzyme. Images PMID:3137560

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

PubMed

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

Treesearch

Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

2003-01-01

Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...

Characterization of ROS1 cDNA from a human glioblastoma cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Birchmeier, C.; O'Neill, K.; Riggs, M.

1990-06-01

The authors have isolated and characterized a human ROS1 cDNA from the glioblastoma cell line SW-1088. The cDNA, 8.3 kilobases long, has the potential to encode a transmembrane tyrosine-specific protein kinase with a predicted molecular mass of 259 kDa. The putative extracellular domain of ROS1 is homologous to the extracellular domain of the sevenless gene product from Drosophila. No comparable similarities in the extracellular domains were found between ROS1 and other receptor-type tyrosine kinases. Together, ROS1 and sevenless gene products define a distinct subclass of transmember tyrosine kinases.

Analysis of the enzymatic formation of citral in the glands of sweet basil.

PubMed

Iijima, Yoko; Wang, Guodong; Fridman, Eyal; Pichersky, Eran

2006-04-15

Basil glands of the Sweet Dani cultivar contain high levels of citral, a mixture of geranial and its cis-isomer neral, as well as low levels of geraniol and nerol. We have previously reported the identification of a cDNA from Sweet Dani that encodes an enzyme responsible for the formation of geraniol from geranyl diphosphate in the glands, and that these glands cannot synthesize nerol directly from geranyl diphosphate. Here, we report the identification of two basil cDNAs encoding NADP+-dependent dehydrogenases that can use geraniol as the substrate. One cDNA, designated CAD1, represents a gene whose expression is highly specific to gland cells of all three basil cultivars examined, regardless of their citral content, and encodes an enzyme with high sequence similarity to known cinnamyl alcohol dehydrogenases (CADs). The enzyme encoded by CAD1 reversibly oxidizes geraniol to produce geranial (which reversibly isomerizes to neral via keto-enol tautomerization) at half the efficiency compared with its activity with cinnamyl alcohol. CAD1 does not use nerol and neral as substrates. A second cDNA, designated GEDH1, encodes an enzyme with sequence similarity to CAD1 that is capable of reversibly oxidizing geraniol and nerol in equal efficiency, and prolonged incubation of geraniol with GEDH1 in vitro produces not only geranial and neral, but also nerol. GEDH1 is also active, although at a lower efficiency, with cinnamyl alcohol. However, GEDH1 is expressed at low levels in glands of all cultivars compared with its expression in leaves. These and additional data presented indicate that basil glands may contain additional dehydrogenases capable of oxidizing geraniol.

Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

PubMed

Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

1997-11-01

Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Expression of Ornithine Decarboxylase Is Transiently Increased by Pollination, 2,4-Dichlorophenoxyacetic Acid, and Gibberellic Acid in Tomato Ovaries1

PubMed Central

Alabadí, David; Carbonell, Juan

1998-01-01

A cDNA encoding for a functional ornithine decarboxylase has been isolated from a cDNA library of carpels of tomato (Lycopersicon esculentum Mill.). Ornithine decarboxylase in tomato is represented by a single-copy gene that we show to be up-regulated during early fruit growth induced by 2,4-dichlorophenoxyacetic acid and gibberellic acid. PMID:9733552

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

NASA Astrophysics Data System (ADS)

Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

2015-09-01

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

PubMed Central

Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

1995-01-01

Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

Stachyose synthesis in seeds of adzuki bean (Vigna angularis): molecular cloning and functional expression of stachyose synthase.

PubMed

Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A

1999-12-01

Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.

1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

1999-02-01

A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

PubMed Central

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

Cloning and characterization of the human 5,10-methenyltetrahydrofolate synthetase-encoding cDNA.

PubMed

Dayan, A; Bertrand, R; Beauchemin, M; Chahla, D; Mamo, A; Filion, M; Skup, D; Massie, B; Jolivet, J

1995-11-20

Methenyltetrahydrofolate synthetase (MTHFS) catalyses the obligatory initial metabolic step in the intracellular conversion of 5-formyltetrahydrofolate to other reduced folates. We have isolated and sequenced a human MTHFS cDNA which is 872-bp long and codes for a 203-amino-acid protein of 23,229 Da. Escherichia coli BL21(DE3), transfected with pET11c plasmids containing an open reading frame encoding MTHFS, showed a 100-fold increase in MTHFS activity in bacterial extracts after IPTG induction. Northern blot studies of human tissues determined that the MTHFS mRNA was expressed preferentially in the liver and Southern blot analysis of human genomic DNA suggested the presence of a single-copy gene.

Functional Expression of Two Neuronal Nicotinic Acetylcholine Receptors from cDNA Clones Identifies a Gene Family

NASA Astrophysics Data System (ADS)

Boulter, Jim; Connolly, John; Deneris, Evan; Goldman, Dan; Heinemann, Steven; Patrick, Jim

1987-11-01

A family of genes coding for proteins homologous to the α subunit of the muscle nicotinic acetylcholine receptor has been identified in the rat genome. These genes are transcribed in the central and peripheral nervous systems in areas known to contain functional nicotinic receptors. In this paper, we demonstrate that three of these genes, which we call alpha3, alpha4, and beta2, encode proteins that form functional nicotinic acetylcholine receptors when expressed in Xenopus oocytes. Oocytes expressing either alpha3 or alpha4 protein in combination with the beta2 protein produced a strong response to acetylcholine. Oocytes expressing only the alpha4 protein gave a weak response to acetylcholine. These receptors are activated by acetylcholine and nicotine and are blocked by Bungarus toxin 3.1. They are not blocked by α -bungarotoxin, which blocks the muscle nicotinic acetylcholine receptor. Thus, the receptors formed by the alpha3, alpha4, and beta2 subunits are pharmacologically similar to the ganglionic-type neuronal nicotinic acetylcholine receptor. These results indicate that the alpha3, alpha4, and beta2 genes encode functional nicotinic acetylcholine receptor subunits that are expressed in the brain and peripheral nervous system.

A beta-galactosidase gene is expressed during mature fruit abscission of 'Valencia' orange (Citrus sinensis).

PubMed

Wu, Zhencai; Burns, Jacqueline K

2004-07-01

beta-galactosidases have been detected in a wide range of plants and are characterized by their ability to hydrolyse terminal non-reducing beta-D-galactosyl residues from beta-D-galactosides. These enzymes have been detected in a wide range of plant organs and tissues. In a search for differentially expressed genes during the abscission process in citrus, sequences encoding beta-galactosidase were identified. Three cDNA fragments of a beta-galactosidase gene were isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after the application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMN-pyrazole). Based on sequence information derived from these fragments, a full-length cDNA of 2847 nucleotides (GenBank accession number AY029198) encoding beta-galactosidase was isolated from mature fruit abscission zones by 5'- and 3'-RACE approaches. The beta-galactosidase cDNA encoded a protein of 737 amino acid residues with a calculated molecular weight of 82 kDa. The deduced protein was highly homologous to plant beta-galactosidases expressed in fruit ripening. Southern blot analysis demonstrated that at least two closely related beta-galactosidase genes were present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones indicated beta-galactosidase mRNA was detected 48 h after treatment of CMN-pyrazole and ethephon in mature fruit abscission zones. beta-galactosidase transcripts were detected in leaf abscission zones only after ethephon application. The citrus beta-galactosidase was expressed in stamens and petals of fully opened flowers and young fruitlets. The results suggest that this beta-galactosidase may play a role during abscission as well as early growth and development processes in flowers and fruitlets.

Massive Collection of Full-Length Complementary DNA Clones and Microarray Analyses:. Keys to Rice Transcriptome Analysis

NASA Astrophysics Data System (ADS)

Kikuchi, Shoshi

2009-02-01

Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.

Canine Lat1: molecular structure, distribution and its expression in cancer samples.

PubMed

Ochiai, Hideharu; Morishita, Taiki; Onda, Ken; Sugiyama, Hiroki; Maruo, Takuya

2012-07-01

A full-length cDNA sequence of canine L-type amino acid transporter 1 (Lat1) was determined from a canine brain. The sequence was 1828 bp long and was predicted to encode 485 amino acid polypeptides. The deduced amino acid sequence of canine Lat1 showed 93.2% and 91.1% similarities to those of humans and rats, respectively. Northern blot analysis detected Lat1 expression in the cerebellum at 4 kb, and Western blot analysis showed a single band at 40 kDa. RT-PCR analysis revealed a distinct expression of Lat1 in the pancreas and testis in addition to the cerebrum and cerebellum. Notably, Lat1 expression was observed in the tissues of thyroid cancer, melanoma and hemangiopericytoma. Although the cancer samples examined were not enough, Lat1 may serve as a useful biomarker of cancer cells in veterinary clinic.

Characterization of the gene encoding component C3 of the complement system from the spider Loxosceles laeta venom glands: Phylogenetic implications.

PubMed

Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V

2016-09-01

A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.

Isolation and characterization of a cDNA encoding a heat shock protein 70 from a sterile mutant of Ulva pertusa (Ulvales, Chlorophyta).

PubMed

Tominaga, Hiroshi; Coury, Daniel Adam; Amano, Hideomi; Kakinuma, Makoto

2010-03-01

Synthesis and accumulation of molecular chaperones are universal responses found in all cellular organisms when exposed to a variety of unfavorable conditions. Heat shock protein 70 (Hsp70), which is one of the major classes of molecular chaperones, plays a particularly important role in cellular stress responses, and the Hsp70 system is the most intensely studied in higher plants and algae. Therefore, we isolated and characterized a cDNA clone encoding Hsp70 from a sterile strain of Ulva pertusa (Ulvales, Chlorophyta). The sterile U. pertusa Hsp70 (UpHsp70) cDNA consisted of 2,272 nucleotides and had an open reading frame encoding a polypeptide of 663 amino acid (AA) residues with a molecular mass of 71.7 kDa. Amino acid alignment and phylogenetic analysis of Hsp70s from other organisms showed that UpHsp70 was more similar to cytoplasmic Hsp70s from green algae and higher plants (> or =75%) than to those from other algae and microorganisms. Southern blot analysis indicated that the sterile U. pertusa genome had at least four cytoplasmic Hsp70-encoding genes. UpHsp70 mRNA levels were significantly affected by diurnal changes, rapidly increased by high-temperature stress, and gradually increased by exposure to copper, cadmium, and lead. These results suggest that UpHsp70 plays particularly important roles in adaptation to high-temperature conditions and diurnal changes, and is potentially involved in tolerance to heavy metal toxicity.

Long-term erythropoietin gene expression from transduced cells in bioisolator devices.

PubMed

Yanay, Ofer; Barry, Simon C; Flint, Lisa Y; Brzezinski, Margaret; Barton, Randall W; Osborne, William R A

2003-11-20

Recombinant erythropoietin (EPO) is widely administered for long-term treatment of anemia associated with renal failure and other chronic diseases. The ability to deliver EPO by gene therapy would have clinical and economic benefit. We compared autologous and allogeneic transduced primary vascular smooth muscle cells for their ability to provide sustained EPO gene expression when encapsulated in TheraCyte devices implanted subcutaneously (SQ) or intraperitoneally (IP) in rats. Cells were transduced with retrovirus vector LrEpSN encoding rat EPO cDNA. Rats that received either autologous or allogeneic transduced cells showed elevated hematocrits (HCTs) ranging from 50 to 79% that were sustained for more than 12 months. The HCT of control rats remained at baseline (45.8%). Rats that received second SQ implants of either autologous or allogeneic cells showed elevations in hematocrit that were sustained for up to 12 months, suggesting the absence of immunological responses to transduced cells or implant material. All experimental groups had statistically significant elevated HCT (p < 0.001) when compared with controls. Both SQ and IP implantation were equally effective in delivering EPO long term. There were no significant differences in white blood cell (WBC) or platelet (PLT) values between treated and control animals. Implantation of TheraCyte devices was well tolerated and histological evaluation of the devices up to 12 months after surgery revealed a high degree of vascularization and no evidence of host immune response. TheraCyte devices offer a simple and safe gene delivery system that provides sustained therapeutic gene expression, permit removal and implantation of new devices, and do not require immunosuppression of the host.

Anti-liver-kidney microsome antibody type 1 recognizes human cytochrome P450 db1.

PubMed

Gueguen, M; Yamamoto, A M; Bernard, O; Alvarez, F

1989-03-15

Anti-liver-kidney microsome antibody type 1 (LKM1), present in the sera of a group of children with autoimmune hepatitis, was recently shown to recognize a 50 kDa protein identified as rat liver cytochromes P450 db1 and db2. High homology between these two members of the rat P450 IID subfamily and human P450 db1 suggested that anti-LKM1 antibody is directed against this human protein. To test this hypothesis, a human liver cDNA expression library in phage lambda GT-11 was screened using rat P450 db1 cDNA as a probe. Two human cDNA clones were found to be identical to human P450 db1 by restriction mapping. Immunoblot analysis using as antigen, the purified fusion protein from one of the human cDNA clones showed that only anti-LKM1 with anti-50 kDa reactivity recognized the fusion protein. This fusion protein was further used to develop an ELISA test that was shown to be specific for sera of children with this disease. These results: 1) identify the human liver antigen recognized by anti-LKM1 auto-antibodies as cytochrome P450 db1, 2) allow to speculate that mutation on the human P450 db1 gene could alter its expression in the hepatocyte and make it auto-antigenic, 3) provide a simple and specific diagnostic test for this disease.

Molecular cloning and characterization of rat sperm surface antigen 2B1, a glycoprotein implicated in sperm-zona binding.

PubMed

Hou, S T; Ma, A; Jones, R; Hall, L

1996-10-01

The rat sperm surface antigen, 2B1, that has been proposed to play a key role in sperm adhesion to the zona pellucida, has been cloned and its entire cDNA sequenced. Northern blot analysis indicates that 2B1 is encoded by a 2.2-kb RNA transcript that is abundantly expressed in the testis. The deduced protein sequence contains 512 amino-acid residues with a strong candidate signal sequence and C-terminal transmembrane domain. Data base searches reveal a high degree of sequence similarity to guinea pig, rabbit, monkey, and human PH20 sperm surface antigens, and a lower degree of similarity to honey bee and whiteface hornet venom hyaluronidases. Rat 2B1 antigen also possesses hyaluronidase activity, suggesting that it is a bifunctional protein with putative roles in the dispersion of cumulus oophorus cells as well as zona adhesion. However, while it would appear that 2B1 is the rat homologue of the guinea pig PH20 antigen, they differ in a number of important biochemical respects (including their mode of attachment to the sperm membrane and distribution between soluble and membrane-bound fractions), as well as in their localization on the sperm membrane. Expression of regions of the 2B1 protein in recombinant bacterial cells has allowed a preliminary mapping of the 2B1 epitope, and has provided more definitive information on the endoproteolytic processing of 2B1 during epididymal transit.

Expression of the neurotransmitter-synthesizing enzyme glutamic acid decarboxylase in male germ cells.

PubMed

Persson, H; Pelto-Huikko, M; Metsis, M; Söder, O; Brene, S; Skog, S; Hökfelt, T; Ritzén, E M

1990-09-01

The gene encoding glutamic acid decarboxylase (GAD), the key enzyme in the synthesis of the inhibitory neurotransmitter gamma-aminobutyric acid, is shown to be expressed in the testis of several different species. Nucleotide sequence analysis of a cDNA clone isolated from the human testis confirmed the presence of GAD mRNA in the testis. The major GAD mRNA in the testis was 2.5 kilobases. Smaller amounts of a 3.7-kilobase mRNA with the same size as GAD mRNA in the brain was also detected in the testis. In situ hybridization using a GAD-specific probe revealed GAD mRNA expressing spermatocytes and spermatids located in the middle part of rat seminiferous tubules. Studies on the ontogeny of GAD mRNA expression showed low levels of GAD mRNA in testes of prepubertal rats, with increasing levels as sexual maturation is reached, compatible with GAD mRNA expression in germ cells. In agreement with this, fractionation of cells from the rat seminiferous epithelium followed by Northern (RNA) blot analysis showed the highest levels of GAD mRNA associated with spermatocytes and spermatids. Evidence for the presence of GAD protein in the rat testis was obtained from the demonstration of GAD-like immunoreactivity in seminiferous tubules, predominantly at a position where spermatids and spermatozoa are found. Furthermore, GAD-like immunoreactivity was seen in the midpiece of ejaculated human spermatozoa, the part that is responsible for generating energy for spermatozoan motility.

Expression of the neurotransmitter-synthesizing enzyme glutamic acid decarboxylase in male germ cells.

PubMed Central

Persson, H; Pelto-Huikko, M; Metsis, M; Söder, O; Brene, S; Skog, S; Hökfelt, T; Ritzén, E M

1990-01-01

The gene encoding glutamic acid decarboxylase (GAD), the key enzyme in the synthesis of the inhibitory neurotransmitter gamma-aminobutyric acid, is shown to be expressed in the testis of several different species. Nucleotide sequence analysis of a cDNA clone isolated from the human testis confirmed the presence of GAD mRNA in the testis. The major GAD mRNA in the testis was 2.5 kilobases. Smaller amounts of a 3.7-kilobase mRNA with the same size as GAD mRNA in the brain was also detected in the testis. In situ hybridization using a GAD-specific probe revealed GAD mRNA expressing spermatocytes and spermatids located in the middle part of rat seminiferous tubules. Studies on the ontogeny of GAD mRNA expression showed low levels of GAD mRNA in testes of prepubertal rats, with increasing levels as sexual maturation is reached, compatible with GAD mRNA expression in germ cells. In agreement with this, fractionation of cells from the rat seminiferous epithelium followed by Northern (RNA) blot analysis showed the highest levels of GAD mRNA associated with spermatocytes and spermatids. Evidence for the presence of GAD protein in the rat testis was obtained from the demonstration of GAD-like immunoreactivity in seminiferous tubules, predominantly at a position where spermatids and spermatozoa are found. Furthermore, GAD-like immunoreactivity was seen in the midpiece of ejaculated human spermatozoa, the part that is responsible for generating energy for spermatozoan motility. Images PMID:1697032

Long-term preservation of retinal function in the RCS rat model of retinitis pigmentosa following lentivirus-mediated gene therapy.

PubMed

Tschernutter, M; Schlichtenbrede, F C; Howe, S; Balaggan, K S; Munro, P M; Bainbridge, J W B; Thrasher, A J; Smith, A J; Ali, R R

2005-04-01

The Royal College of Surgeons (RCS) rat is a well-characterized model of autosomal recessive retinitis pigmentosa (RP) due to a defect in the retinal pigment epithelium (RPE). It is homozygous for a null mutation in the gene encoding , a receptor tyrosine kinase found in RPE cells, that is required for phagocytosis of shed photoreceptor outer segments. The absence of Mertk results in accumulation of outer segment debris. This subsequently leads to progressive loss of photoreceptor cells. In order to evaluate the efficacy of lentiviral-mediated gene replacement therapy in the RCS rat, we produced recombinant VSV-G pseudotyped HIV-1-based lentiviruses containing a murine Mertk cDNA driven by a spleen focus forming virus (SFFV) promoter. The vector was subretinally injected into the right eye of 10-day-old RCS rats; the left eye was left untreated as an internal control. Here, we present a detailed assessment of the duration and extent of the morphological rescue and the resulting functional benefits. We examined animals at various time points over a period of 7 months by light and electron microscopy, and electroretinography. We observed correction of the phagocytic defect, slowing of photoreceptor cell loss and preservation of retinal function for up to 7 months. This study demonstrates the potential of gene therapy approaches for the treatment of retinal degenerations caused by defects specific to the RPE and supports the use of lentiviral vectors for the treatment of such disorders.

cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

PubMed

Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

1999-02-01

A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

DNA encoding for plant digalactosyldiacylglycerol galactosyltransferase and methods of use

DOEpatents

Benning, Christoph; Doermann, Peter

2003-11-04

The cDNA encoding digalactosyldiacylglycerol galactosyltransferase (DGD1) is provided. The deduced amino acid sequence is also provided. Methods of making and using DGD1 to screen for new herbicides and alter a plant's leaf lipid composition are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors.

Regulation of 4CL, encoding 4-coumarate: coenzyme A ligase, expression in kenaf under diverse stress conditions

USDA-ARS?s Scientific Manuscript database

We cloned the full length 4CL ortholog encoding 4-coumarate: coenzymeA ligase from kenaf (Hibiscus cannabiuns) using degenerate primers and RACE (rapid amplification of cDNA ends) systems. The 4CL is a key regulatory enzyme of the phenylpropanoid pathway that regulates the activation of cinnamic ac...

Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

PubMed

Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

1993-03-31

Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Cloning of human cDNA encoding a novel heptahelix receptor expressed in Burkitt's lymphoma and widely distributed in brain and peripheral tissues.

PubMed

Owman, C; Blay, P; Nilsson, C; Lolait, S J

1996-11-12

Using PCR with degenerate primers and screening of a human B-cell lymphoblast cDNA library, a full-length cDNA encoding a 375-amino-acid protein was isolated. It contains seven regions of hydrophobic amino acids probably representing membrane-spanning domains of a novel heptahelix receptor, tentatively named CMKRL2. It shows nearly 30% overall identity with the high-affinity IL8 receptor and similar degree of homology with other chemoattractant receptors, including the "fusin" coreceptors for HIV1. Measurements of various transduction pathways following application of a panel of chemokines to transfected cells failed to evoke any reproducible response. Although the natural ligand for CMKRL2 could, thus, not be identified, receptor expression in spleen and lymph nodes as well as in Burkitt's lymphoma (irrespective of EBV status) supports a functional role in activated B-cells. Receptor message was ubiquitously distributed in normal peripheral tissues and CNS, suggesting that CMKRL2 is expressed in widespread cell populations, such as macrophages and neuroglia.

Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

PubMed Central

Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

2007-01-01

Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

Primary structure of the Aequorea victoria green-fluorescent protein.

PubMed

Prasher, D C; Eckenrode, V K; Ward, W W; Prendergast, F G; Cormier, M J

1992-02-15

Many cnidarians utilize green-fluorescent proteins (GFPs) as energy-transfer acceptors in bioluminescence. GFPs fluoresce in vivo upon receiving energy from either a luciferase-oxyluciferin excited-state complex or a Ca(2+)-activated phosphoprotein. These highly fluorescent proteins are unique due to the chemical nature of their chromophore, which is comprised of modified amino acid (aa) residues within the polypeptide. This report describes the cloning and sequencing of both cDNA and genomic clones of GFP from the cnidarian, Aequorea victoria. The gfp10 cDNA encodes a 238-aa-residue polypeptide with a calculated Mr of 26,888. Comparison of A. victoria GFP genomic clones shows three different restriction enzyme patterns which suggests that at least three different genes are present in the A. victoria population at Friday Harbor, Washington. The gfp gene encoded by the lambda GFP2 genomic clone is comprised of at least three exons spread over 2.6 kb. The nucleotide sequences of the cDNA and the gene will aid in the elucidation of structure-function relationships in this unique class of proteins.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.

When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less

Characterization and expression of the calpastatin gene in Cyprinus carpio.

PubMed

Chen, W X; Ma, Y

2015-07-03

Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

Molecular cloning and functional identification of sterol C24-methyltransferase gene from Tripterygium wilfordii.

PubMed

Guan, Hongyu; Zhao, Yujun; Su, Ping; Tong, Yuru; Liu, Yujia; Hu, Tianyuan; Zhang, Yifeng; Zhang, Xianan; Li, Jia; Wu, Xiaoyi; Huang, Luqi; Gao, Wei

2017-09-01

Sterol C24-methyltransferase (SMT) plays multiple important roles in plant growth and development. SMT1, which belongs to the family of transferases and transforms cycloartenol into 24-methylene cycloartenol, is involved in the biosynthesis of 24-methyl sterols. Here, we report the cloning and characterization of a cDNA encoding a sterol C24-methyltransferase from Tripterygium wilfordii ( TwSMT1 ). TwSMT1 (GenBank access number KU885950) is a 1530 bp cDNA with a 1041 bp open reading frame predicted to encode a 346-amino acid, 38.62 kDa protein. The polypeptide encoded by the SMT1 cDNA was expressed and purified as a recombinant protein from Escherichia coli ( E. coli ) and showed SMT activity. The expression of TwSMT1 was highly up-regulated in T. wilfordii cell suspension cultures treated with methyl jasmonate (MeJA). Tissue expression pattern analysis showed higher expression in the phellem layer compared to the other four organs (leaf, stem, xylem and phloem), which is about ten times that of the lowest expression in leaf. The results are meaningful for the study of sterol biosynthesis of T. wilfordii and will further lay the foundations for the research in regulating both the content of other main compounds and growth and development of T. wilfordii.

Cloning and characterization of the nagA gene that encodes beta-n-acetylglucosaminidase from Aspergillus nidulans and its expression in Aspergillus oryzae.

PubMed

Kim, Sunhwa; Matsuo, Ichiro; Ajisaka, Katsumi; Nakajima, Harushi; Kitamoto, Katsuhiko

2002-10-01

We isolated a beta-N-acetylglucosaminidase encoding gene and its cDNA from the filamentous fungus Aspergillus nidulans, and designated it nagA. The nagA gene contained no intron and encoded a polypeptide of 603 amino acids with a putative 19-amino acid signal sequence. The deduced amino acid sequence was very similar to the sequence of Candida albicans Hex1 and Trichoderma harzianum Nag1. Yeast cells containing the nagA cDNA under the control of the GAL1 promoter expressed beta-N-acetylglucosaminidase activity. The chromosomal nagA gene of A. nidulans was disrupted by replacement with the argB marker gene. The disruptant strains expressed low levels of beta-N-acetylglucosaminidase activity and showed poor growth on a medium containing chitobiose as a carbon source. Aspergillus oryzae strain carrying the nagA gene under the control of the improved glaA promoter produced large amounts of beta-N-acetylglucosaminidase in a wheat bran solid culture.

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

PubMed

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases

PubMed Central

Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi

1999-01-01

We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016

Cloning and expression of trehalose-6-phosphate synthase 1 from Rhizopus oryzae.

PubMed

Ozer Uyar, Ebru; Yücel, Meral; Hamamcı, Haluk

2016-05-01

Trehalose is a reducing disaccharide acting as a protectant against environmental stresses in many organisms. In fungi, Trehalose-6-phosphate synthase 1 (TPS1) plays a key role in the biosynthesis of trehalose. In this study, a full-length cDNA from Rhizopus oryzae encoding TPS1 (designated as RoTPS1) was isolated. The RoTPS1 cDNA is composed of 2505 nucleotides and encodes a protein of 834 amino acids with a molecular mass of 97.8 kDa. The amino acid sequence of RoTPS1 has a relatively high homology with the TPS1s in several other filamentous fungi. RoTPS1 was cloned into Saccharomyces cerevisiae and secretively expressed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Isolation, expression, and chromosomal localization of the human mitochondrial capsule selenoprotein gene (MCSP)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aho, Hanne; Schwemmer, M.; Tessmann, D.

1996-03-01

The mitochondrial capsule selenoprotein (MCS) (HGMW-approved symbol MCSP) is one of three proteins that are important for the maintenance and stabilization of the crescent structure of the sperm mitochondria. We describe here the isolation of a cDNA, the exon-intron organization, the expression, and the chromosomal localization of the human MCS gene. Nucleotide sequence analysis of the human and mouse MCS cDNAs reveals that the 5{prime}- and 3{prime}-untranslated sequences are more conserved (71%) than the coding sequences (59%). The open reading frame encodes a 116-amino-acid protein and lacks the UGA codons, which have been reported to encode the selenocysteines in themore » N-terminal of the deduced mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein (39%). The most striking homology lies in the dicysteine motifs. Northern and Southern zooblot analyses reveal that the MCS gene in human, baboon, and bovine is more conserved than its counterparts in mouse and rat. The single intron in the human MCS gene is approximately 6 kb and interrupts the 5{prime}-untranslated region at a position equivalent to that in the mouse and rat genes. Northern blot and in situ hybridization experiments demonstrate that the expression of the human MCS gene is restricted to haploid spermatids. The human gene was assigned to q21 of chromosome 1. 30 refs., 9 figs.« less

Recombinant human antithrombin expressed in the milk of non-transgenic goats exhibits high efficiency on rat DIC model.

PubMed

Yang, Hai; Li, Qing-Wang; Han, Zeng-Sheng; Hu, Jian-Hong; Li, Wen-Ye; Liu, Zhi-Bin

2009-11-01

Plasma-derived antithrombin (pAT) is often used for the treatments of disseminated intravascular coagulation (DIC) patients. In this paper, the recombinant adenovirus vector encoding human antithrombin (AT) cDNA was constructed and directly infused into the mammary gland of two goats. The recombinant human antithrombin (rhAT) was purified by heparin affinity chromatography from the goat milk, and then used in the treatment of thirty lipopolysaccharide (LPS) induced DIC rats. A high expression level of rhAT up to 2.8 g/l was obtained in the milk of goats. After purification, the recovery rate and the purity of the rhAT were up to 54.7 +/- 3.2% and 96.2 +/- 2.7%, respectively. In blood of the DIC rat model treated with rhAT, the levels of antithrombin and thrombin-antithrombin (TAT) were augmented significantly; meanwhile the consumption of fibrinogen and platelet was reduced significantly, and the increase of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) concentration was restrained modest and non-significant. For the above DIC indexes, there were no differences between pAT and rhAT (P > 0.05). Our results demonstrated that the way we established is a pragmatic tool for large-scale production of rhAT, and the rhAT produced with this method has potential as a substitute for pAT in the therapy of DIC patients.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic arabidopsis.

PubMed

Lardizabal, K D; Metz, J G; Sakamoto, T; Hutton, W C; Pollard, M R; Lassner, M W

2000-03-01

Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a beta-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. (13)C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Isolation and functional expression of human COQ2, a gene encoding a polyprenyl transferase involved in the synthesis of CoQ.

PubMed

Forsgren, Margareta; Attersand, Anneli; Lake, Staffan; Grünler, Jacob; Swiezewska, Ewa; Dallner, Gustav; Climent, Isabel

2004-09-01

The COQ2 gene in Saccharomyces cerevisiae encodes a Coq2 (p-hydroxybenzoate:polyprenyl transferase), which is required in the biosynthetic pathway of CoQ (ubiquinone). This enzyme catalyses the prenylation of p-hydroxybenzoate with an all-trans polyprenyl group. We have isolated cDNA which we believe encodes the human homologue of COQ2 from a human muscle and liver cDNA library. The clone contained an open reading frame of length 1263 bp, which encodes a polypeptide that has sequence homology with the Coq2 homologues in yeast, bacteria and mammals. The human COQ2 gene, when expressed in yeast Coq2 null mutant cells, rescued the growth of this yeast strain in the absence of a non-fermentable carbon source and restored CoQ biosynthesis. However, the rate of CoQ biosynthesis in the rescued cells was lower when compared with that in cells rescued with the yeast COQ2 gene. CoQ formed when cells were incubated with labelled decaprenyl pyrophosphate and nonaprenyl pyrophosphate, showing that the human enzyme is active and that it participates in the biosynthesis of CoQ.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

PubMed

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Differential cDNA cloning by enzymatic degrading subtraction (EDS).

PubMed Central

Zeng, J; Gorski, R A; Hamer, D

1994-01-01

We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

Structure and chromosomal localization of the human PD-1 gene (PDCD1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shinohara, T.; Ishida, Y.; Kawaichi, M.

1994-10-01

A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that the different chitinase isoforms in maize might have different functions in the plant, since they show differential expression patterns under different conditions. PMID:7972490

[125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

PubMed Central

Dumont, Yvan; Quirion, Rémi

2000-01-01

GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

Interaction of Mimetic Analogs of Insect Kinin Neuropeptides with Arthropod Receptors

DTIC Science & Technology

2010-01-01

stagnalis.20 The amino acid sequence of the B. microplus receptor showed most similarity to the CG10626 Drosophila melanogaster gene product and to the...25 The A. aegypti cDNA encodes a 584 amino acid residue protein of predicted molecular mass of 65.2 kDa. The mosquito kinin receptor cDNA was...charged acid moiety.36,37 Within the core pentapeptide, the aromatic residues Phe1 and Trp4 are the most important for activity whereas a wide range

Human brain factor 1, a new member of the fork head gene family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, D.B.; Wiese, S.; Burfeind, P.

1994-06-01

Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. Themore » fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.« less

Gene-expression profiling using suppression-subtractive hybridization and cDNA microarray in rat mononuclear cells in response to welding-fume exposure.

PubMed

Rim, Kyung Taek; Park, Kun Koo; Sung, Jae Hyuck; Chung, Yong Hyun; Han, Jeong Hee; Cho, Key Seung; Kim, Kwang Jong; Yu, Il Je

2004-06-01

Welders with radiographic pneumoconiosis abnormalities have shown a gradual clearing of the X-ray identified effects following removal from exposure. In some cases, the pulmonary fibrosis associated with welding fumes appears in a more severe form in welders. Accordingly, for the early detection of welding-fume-exposure-induced pulmonary fibrosis, the gene expression profiles of peripheral mononuclear cells from rats exposed to welding fumes were studied using suppression-subtractive hybridization (SSH) and a cDNA microarray. As such, Sprague-Dawley rats were exposed to a stainless steel arc welding fume for 2 h/day in an inhalation chamber with a 1107.5 +/- 2.6 mg/m3 concentration of total suspended particulate (TSP) for 30 days. Thereafter, the total RNA was extracted from the peripheral blood mononuclear cells, the cDNA synthesized from the total RNA using the SMART PCR cDNA method, and SSH performed to select the welding-fume-exposure-regulated genes. The cDNAs identified by the SSH were then cloned into a plasmid miniprep, sequenced and the sequences analysed using the NCBI BLAST programme. In the SSH cloned cDNA microarray analysis, five genes were found to increase their expression by 1.9-fold or more, including Rgs 14, which plays an important function in cellular signal transduction pathways; meanwhile 36 genes remained the same and 30 genes decreased their expression by more than 59%, including genes associated with the immune response, transcription factors and tyrosine kinases. Among the 5200 genes analysed, 256 genes (5.1%) were found to increase their gene expression, while 742 genes (15%) decreased their gene expression in response to the welding-fume exposure when tested using a commercial 5.0k DNA microarray. Therefore, unlike exposure to other toxic substances, prolonged welding-fume exposure was found to substantially downregulate many genes.

Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

PubMed Central

Kurtz, David T.; Feigelson, Philip

1977-01-01

A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

Molecular cloning of Kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis.

PubMed

Kong, Hee Jeong; Cho, Hyun Kook; Park, Eun-Mi; Hong, Gyeong-Eun; Kim, Young-Ok; Nam, Bo-Hye; Kim, Woo-Jin; Lee, Sang-Jun; Han, Hyon Sob; Jang, In-Kwon; Lee, Chang Hoon; Cheong, Jaehun; Choi, Tae-Jin

2009-01-01

Proteinase inhibitors play important roles in host defence systems involving blood coagulation and pathogen digestion. We isolated and characterized a cDNA clone for a Kazal-type proteinase inhibitor (KPI) from a hemocyte cDNA library of the oriental white shrimp Fenneropenaeus chinensis. The KPI gene consists of three exons and two introns. KPI cDNA contains an open reading frame of 396 bp, a polyadenylation signal sequence AATAAA, and a poly (A) tail. KPI cDNA encodes a polypeptide of 131 amino acids with a putative signal peptide of 21 amino acids. The deduced amino acid sequence of KPI contains two homologous Kazal domains, each with six conserved cysteine residues. The mRNA of KPI is expressed in the hemocytes of healthy shrimp, and the higher expression of KPI transcript is observed in shrimp infected with the white spot syndrome virus (WSSV), suggesting a potential role for KPI in host defence mechanisms.

Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

PubMed

Saito, T; Ochiai, H

1999-10-01

cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

MORPHOLOGIC ANALYSIS CORRELATES WITH GENE EXPRESSION CHANGES IN CULTURED F344 RAT MESOTHELIAL CELLS

EPA Science Inventory

The gene expression pattern of mesothelial cells in vitro was determined after 4 or 12 h exposure to the rat mesothelial, kidney and thyroid carcinogen, and oxidative stressor potassium bromate (KBr03). Gene expression changes observed using cDNA arrays indicated oxidative stres...

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Kir2.1 encodes the inward rectifier potassium channel in rat arterial smooth muscle cells

PubMed Central

Bradley, Karri K; Jaggar, Jonathan H; Bonev, Adrian D; Heppner, Thomas J; Flynn, Elaine RM; Nelson, Mark T; Horowitz, Burton

1999-01-01

The molecular nature of the strong inward rectifier K+ channel in vascular smooth muscle was explored by using isolated cell RT-PCR, cDNA cloning and expression techniques.RT-PCR of RNA from single smooth muscle cells of rat cerebral (basilar), coronary and mesenteric arteries revealed transcripts for Kir2.1. Transcripts for Kir2.2 and Kir2.3 were not found.Quantitative PCR analysis revealed significant differences in transcript levels of Kir2.1 between the different vascular preparations (n = 3; P < 0.05). A two-fold difference was detected between Kir2.1 mRNA and β-actin mRNA in coronary arteries when compared with relative levels measured in mesenteric and basilar preparations.Kir2.1 was cloned from rat mesenteric vascular smooth muscle cells and expressed in Xenopus oocytes. Currents were strongly inwardly rectifying and selective for K+.The effect of extracellular Ba2+, Ca2+, Mg2+ and Cs2+ ions on cloned Kir2.1 channels expressed in Xenopus oocytes was examined. Ba2+ and Cs+ block were steeply voltage dependent, whereas block by external Ca2+ and Mg2+ exhibited little voltage dependence. The apparent half-block constants and voltage dependences for Ba2+, Cs+, Ca2+ and Mg2+ were very similar for inward rectifier K+ currents from native cells and cloned Kir2.1 channels expressed in oocytes.Molecular studies demonstrate that Kir2.1 is the only member of the Kir2 channel subfamily present in vascular arterial smooth muscle cells. Expression of cloned Kir2.1 in Xenopus oocytes resulted in inward rectifier K+ currents that strongly resemble those that are observed in native vascular arterial smooth muscle cells. We conclude that Kir2.1 encodes for inward rectifier K+ channels in arterial smooth muscle. PMID:10066894

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

[Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1997-05-01

The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

PubMed

Graham, L A; Bendena, W G; Walker, V K

1996-02-01

The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

Cloning of apg-2 encoding a novel member of heat shock protein 110 family.

PubMed

Kaneko, Y; Kimura, T; Kishishita, M; Noda, Y; Fujita, J

1997-04-11

Chinese hamster heat shock protein 110-encoding gene (hsp110), mouse apg-1 and human hsp70RY are structurally related genes, with the first two encoding about 110-kDa HSPs [Yoon et al. (1995) J. Biol. Chem. 270, 15725-15733; Kaneko et al. (1997) J. Biol. Chem., in press; Fathallah et al. (1993) J. Immunol. 151, 810-813]. Using apg-1 cDNA as a probe, we isolated a novel cDNA, apg-2 from a mouse testis cDNA library, which was highly homologous to human hsp70RY. However, the predicted amino acid (aa) sequence of APG-2 was longer (841 aa) than that of HSP70RY (701 aa) and comparable to those of HSP110 and APG-1. Northern blot analysis revealed that the expression of apg-2 transcripts was ubiquitous in various mouse tissues, and most abundant in the testis and ovary. While induction of hsp70 transcripts was observed in mouse TAMA26 Sertoli cells and NIH/3T3 fibroblasts on temperature shift from 37 degrees C to 42 degrees C (traditional heat shock) or from 32 degrees C to 39 degrees C, apg-2 transcripts were not induced under either condition. These results suggest that apg-2 is an isoform of mouse homolog of hsp70RY, but that it belongs to the hsp110 family instead of hsp70 family, and that it plays a role under non-stress conditions.

Molecular cloning and characterization of RGA1 encoding a G protein alpha subunit from rice (Oryza sativa L. IR-36).

PubMed

Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D

1995-03-01

A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.

Molecular cloning and characterization of a tomato cDNA encoding a systemically wound-inducible bZIP DNA-binding protein

NASA Technical Reports Server (NTRS)

Stankovic, B.; Vian, A.; Henry-Vian, C.; Davies, E.

2000-01-01

Localized wounding of one leaf in intact tomato (Lycopersicon esculentum Mill.) plants triggers rapid systemic transcriptional responses that might be involved in defense. To better understand the mechanism(s) of intercellular signal transmission in wounded tomatoes, and to identify the array of genes systemically up-regulated by wounding, a subtractive cDNA library for wounded tomato leaves was constructed. A novel cDNA clone (designated LebZIP1) encoding a DNA-binding protein was isolated and identified. This clone appears to be encoded by a single gene, and belongs to the family of basic leucine zipper domain (bZIP) transcription factors shown to be up-regulated by cold and dark treatments. Analysis of the mRNA levels suggests that the transcript for LebZIP1 is both organ-specific and up-regulated by wounding. In wounded wild-type tomatoes, the LebZIP1 mRNA levels in distant tissue were maximally up-regulated within only 5 min following localized wounding. Exogenous abscisic acid (ABA) prevented the rapid wound-induced increase in LebZIP1 mRNA levels, while the basal levels of LebZIP1 transcripts were higher in the ABA mutants notabilis (not), sitiens (sit), and flacca (flc), and wound-induced increases were greater in the ABA-deficient mutants. Together, these results suggest that ABA acts to curtail the wound-induced synthesis of LebZIP1 mRNA.

Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

PubMed Central

Kirkegaard, K; Nelsen, B

1990-01-01

Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Codina, J.; Olate, J.; Abramowitz, J.

1988-05-15

cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

PubMed

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

Wound induced Beta vulgaris polygalacturonase-inhibiting protein genes encode a longer leucine-rich repeat domain and inhibit fungal polygalacturonases

USDA-ARS?s Scientific Manuscript database

Polygalacturonase-inhibiting proteins (PGIPs) are leucine-rich repeat (LRR) proteins involved in plant defense. Sugar beet (Beta vulgaris L.) PGIP genes, BvPGIP1, BvPGIP2 and BvPGIP3, were isolated from two breeding lines, F1016 and F1010. Full-length cDNA sequences of the three BvPGIP genes encod...

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

Treesearch

Tomas Johansson; Per Olof Nyman; Daniel Cullen

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Cloning, expression and N-terminal myristoylation of CpCPK1, a calcium-dependent protein kinase from zucchini (Cucurbita pepo L.).

PubMed

Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L

1999-01-01

We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.

kappa-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system.

PubMed Central

Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B

1995-01-01

Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Two tropinone reductases with different stereospecificities are short-chain dehydrogenases evolved from a common ancestor.

PubMed Central

Nakajima, K; Hashimoto, T; Yamada, Y

1993-01-01

In the biosynthetic pathway of tropane alkaloids, tropinone reductase (EC 1.1.1.236) (TR)-I and TR-II, respectively, reduce a common substrate, tropinone, stereospecifically to the stereoisomeric alkamines tropine and pseudotropine (psi-tropine). cDNA clones coding for TR-I and TR-II, as well as a structurally related cDNA clone with an unknown function, were isolated from the solanaceous plant Datura stramonium. The cDNA clones for TR-I and TR-II encode polypeptides containing 273 and 260 amino acids, respectively, and when these clones were expressed in Escherichia coli, the recombinant TRs showed the same strict stereospecificity as that observed for the native TRs that had been isolated from plants. The deduced amino acid sequences of the two clones showed an overall identity of 64% in 260-amino acid residues and also shared significant similarities with enzymes in the short-chain, nonmetal dehydrogenase family. Genomic DNA-blot analysis detected the TR-encoding genes in three tropane alkaloid-producing solanaceous species but did not detect them in tobacco. We discuss how the two TRs may have evolved to catalyze the opposite stereospecific reductions. Images Fig. 4 Fig. 5 PMID:8415746

Comparative genomics on Norrie disease gene.

PubMed

Katoh, Masuko; Katoh, Masaru

2005-05-01

DAND1 (NBL1), DAND2 (CKTSF1B1 or GREM1 or GREMLIN), DAND3 (CKTSF1B2 or GREM2 or PRDC), DAND4 (CER1), DAND5 (CKTSF1B3 or GREM3 or DANTE), MUC2, MUC5AC, MUC5B, MUC6, MUC19, WISP1, WISP2, WISP3, VWF, NOV and Norrie disease (NDP or NORRIN) genes encode proteins with cysteine knot domain. Cysteine-knot superfamily proteins regulate ligand-receptor interactions for a variety of signaling pathways implicated in embryogenesis, homeostasis, and carcinogenesis. Although Ndp is unrelated to Wnt family members, Ndp is claimed to function as a ligand for Fzd4. Here, we identified and characterized rat Ndp, cow Ndp, chicken ndp and zebrafish ndp genes by using bioinformatics. Rat Ndp gene, consisting of three exons, was located within AC105563.4 genome sequence. Cow Ndp and chicken ndp complete CDS were derived from CB467544.1 EST and BX932859.2 cDNA, respectively. Zebrafish ndp gene was located within BX572627.5 genome sequence. Rat Ndp (131 aa) was a secreted protein with C-terminal cysteine knot-like (CTCK) domain. Rat Ndp showed 100, 96.9, 95.4, 87.8 and 66.4 total-amino-acid identity with mouse Ndp, cow Ndp, human NDP, chicken ndp and zebrafish ndp, respectively. Exon-intron structure of mammalian Ndp orthologs was well conserved. FOXA2, CUTL1 (CCAAT displacement protein), LMO2, CEBPA (C/EBPalpha)-binding sites and triple POU2F1 (OCT1)-binding sites were conserved among promoters of mammalian Ndp orthologs.

Cloning and expression profile of FLT3 gene during progenitor cell-dependent liver regeneration.

PubMed

Aydin, Iraz T; Tokcaer, Zeynep; Dalgic, Aydin; Konu, Ozlen; Akcali, Kamil C

2007-12-01

The liver has a unique capacity to regenerate upon exposure to viral infections, toxic reactions and cancer formation. Liver regeneration is a complex phenomenon in which several factors participate during its onset. Cellular proliferation is an important component of this process and the factors that regulate this proliferation have a vital role. FLT3, a well-known hematopoietic stem cell and hepatic lineage surface marker, is involved in proliferative events of hematopoietic stem cells. However, its contribution to liver regeneration is not known. Therefore, the aim of this study was to clone and examine the role of FLT3 during liver regeneration in rats. Partial cDNA of rat homolog of FLT3 gene was cloned from thymus and the tissue specific expression of this gene at mRNA and protein levels was examined by RT-PCR and Western blot. After treating with 2-AAF and performing hepatectomy in rats to induce progenitor-dependent liver regeneration, the mRNA and protein expression profile of FLT3 was investigated by real-time PCR and Western blot during liver regeneration. In addition, cellular localization of FLT3 protein was determined by immunohistochemistry. The results indicated that rat FLT3 cDNA has high homology with mouse and human FLT3 cDNA. It was also found that FLT3 is expressed in most of the rat tissues and during liver regeneration. In addition, its intracellular localization is altered during the late stages of liver regeneration. The FLT3 receptor is activated at the late stages of liver regeneration and participates in the proliferation response that is observed during progenitor-dependent liver regeneration.

Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

PubMed

Salton, S R; Fischberg, D J; Dong, K W

1991-05-01

Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

Isolation and characterization of the chicken trypsinogen gene family.

PubMed Central

Wang, K; Gan, L; Lee, I; Hood, L

1995-01-01

Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885

Isolation of stress responsive Psb A gene from rice (Oryza sativa l.) using differential display.

PubMed

Tyagi, Aruna; Chandra, Arti

2006-08-01

Differential display (DD) experiments were performed on drought-tolerant rice (Oryza sativa L.) genotype N22 to identify both upregulated and downregulated partial cDNAs with respect to moisture stress. DNA polymorphism was detected between drought-stressed and control leaf tissues on the DD gels. A partial cDNA showing differential expression, with respect to moisture stress was isolated from the gel. Northern blotting analysis was performed using this cDNA as a probe and it was observed that mRNA corresponding to this transcript was accumulated to high level in rice leaves under water deficit stress. At the DNA sequence level, the partial cDNA showed homology with psb A gene encoding for Dl protein.

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Purification of a Jojoba Embryo Wax Synthase, Cloning of its cDNA, and Production of High Levels of Wax in Seeds of Transgenic Arabidopsis

PubMed Central

Lardizabal, Kathryn D.; Metz, James G.; Sakamoto, Tetsuo; Hutton, William C.; Pollard, Michael R.; Lassner, Michael W.

2000-01-01

Wax synthase (WS, fatty acyl-coenzyme A [coA]: fatty alcohol acyltransferase) catalyzes the final step in the synthesis of linear esters (waxes) that accumulate in seeds of jojoba (Simmondsia chinensis). We have characterized and partially purified this enzyme from developing jojoba embryos. A protein whose presence correlated with WS activity during chromatographic fractionation was identified and a cDNA encoding that protein was cloned. Seed-specific expression of the cDNA in transgenic Arabidopsis conferred high levels of WS activity on developing embryos from those plants. The WS sequence has significant homology with several Arabidopsis open reading frames of unknown function. Wax production in jojoba requires, in addition to WS, a fatty acyl-CoA reductase (FAR) and an efficient fatty acid elongase system that forms the substrates preferred by the FAR. We have expressed the jojoba WS cDNA in Arabidopsis in combination with cDNAs encoding the jojoba FAR and a β-ketoacyl-CoA synthase (a component of fatty acid elongase) from Lunaria annua. 13C-Nuclear magnetic resonance analysis of pooled whole seeds from transgenic plants indicated that as many as 49% of the oil molecules in the seeds were waxes. Gas chromatography analysis of transmethylated oil from individual seeds suggested that wax levels may represent up to 70% (by weight) of the oil present in those seeds. PMID:10712527

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

[Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

PubMed

Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

2009-06-01

To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

Plant fatty acid hydroxylases

DOEpatents

Somerville, Chris; Broun, Pierre; van de Loo, Frank

2001-01-01

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

Molecular Cloning and Tissue-Specific Expression of an Anionic Peroxidase in Zucchini1

PubMed Central

Carpin, Sabine; Crèvecoeur, Michèle; Greppin, Hubert; Penel, Claude

1999-01-01

A calcium-pectate-binding anionic isoperoxidase (APRX) from zucchini (Cucurbita pepo) was purified and subjected to N-terminal amino acid microsequencing. The cDNA encoding this enzyme was obtained by reverse transcriptase polymerase chain reaction from a cDNA library. It encoded a mature protein of 309 amino acids exhibiting all of the sequence characteristics of a plant peroxidase. Despite the presence of a C-terminal propeptide, APRX was found in the apoplast. APRX protein and mRNA were found in the root, hypocotyls, and cotyledons. In situ hybridization showed that the APRX-encoding gene was expressed in many different tissues. The strongest expression was observed in root epidermis and in some cells of the stele, in differentiating tracheary elements of hypocotyl, in the lower and upper epidermis, in the palisade parenchyma of cotyledons, and in lateral and adventitious root primordia. In the hypocotyl hook there was an asymmetric expression, with the inner part containing more transcripts than the outer part. Treatment with 2,3,5-triiodobenzoic acid reduced the expression of the APRX-encoding gene in the lower part of the hypocotyl. Our observations suggest that APRX could be involved in lignin formation and that the transcription of its gene was related to auxin level. PMID:10398715

Purification, molecular cloning, and expression of 2-hydroxyphytanoyl-CoA lyase, a peroxisomal thiamine pyrophosphate-dependent enzyme that catalyzes the carbon–carbon bond cleavage during α-oxidation of 3-methyl-branched fatty acids

PubMed Central

Foulon, Veerle; Antonenkov, Vasily D.; Croes, Kathleen; Waelkens, Etienne; Mannaerts, Guy P.; Van Veldhoven, Paul P.; Casteels, Minne

1999-01-01

In the third step of the α-oxidation of 3-methyl-branched fatty acids such as phytanic acid, a 2-hydroxy-3-methylacyl-CoA is cleaved into formyl-CoA and a 2-methyl-branched fatty aldehyde. The cleavage enzyme was purified from the matrix protein fraction of rat liver peroxisomes and identified as a protein made up of four identical subunits of 63 kDa. Its activity proved to depend on Mg2+ and thiamine pyrophosphate, a hitherto unrecognized cofactor of α-oxidation. Formyl-CoA and 2-methylpentadecanal were identified as reaction products when the purified enzyme was incubated with 2-hydroxy-3-methylhexadecanoyl-CoA as the substrate. Hence the enzyme catalyzes a carbon–carbon cleavage, and we propose calling it 2-hydroxyphytanoyl-CoA lyase. Sequences derived from tryptic peptides of the purified rat protein were used as queries to recover human expressed sequence tags from the databases. The composite cDNA sequence of the human lyase contained an ORF of 1,734 bases that encodes a polypeptide with a calculated molecular mass of 63,732 Da. Recombinant human protein, expressed in mammalian cells, exhibited lyase activity. The lyase displayed homology to a putative Caenorhabditis elegans protein that resembles bacterial oxalyl-CoA decarboxylases. Similarly to the decarboxylases, a thiamine pyrophosphate-binding consensus domain was present in the C-terminal part of the lyase. Although no peroxisome targeting signal, neither 1 nor 2, was apparent, transfection experiments with constructs encoding green fluorescent protein fused to the full-length lyase or its C-terminal pentapeptide indicated that the C terminus of the lyase represents a peroxisome targeting signal 1 variant. PMID:10468558

Blocking of proteolytic processing and deletion of glycosaminoglycan side chain of mouse DMP1 by substituting critical amino acid residues.

PubMed

Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin

2009-01-01

Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

PubMed

Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

2002-11-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

Myelin-oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pham-Dinh, D.; Dautigny, A.; Mattei, M.G.

1993-09-01

Myelin/oligodendrocyte glycoprotein (MOG) is found on the surface of myelinating oligodendrocytes and external lamellae of myelin sheaths in the central nervous system, and it is target antigen in experimental autoimmune encephalomyelitis and multiple sclerosis. The authors have isolated bovine, mouse, and rat MOG cDNA clones and shown that the developmental pattern of MOG expression in the rat central nervous system coincides with the late stages of myelination. The amino-terminal, extracellular domain of MOG has characteristics of an immunoglobulin variable domain and is 46% and 41% identical with the amino terminus of bovine butyrophilin (expressed in the lactating mammary gland) andmore » B-G antigens of the chicken major histocompatibility complex (MHC), respectively; these proteins thus form a subset of the immunoglobulin superfamily. The homology between MOG and B-G extends beyond their structure and genetic mapping to their ability to induce strong antibody responses and has implications for the role of MOG in pathological, autoimmune conditions. The authors colocalized the MOG and BT genes to the human MHC on chromosome 6p21.3-p22. The mouse MOG gene was mapped to the homologous band C of chromosome 17, within the M region of the mouse MHC. 38 refs., 6 figs.« less

Evolutionary relationships of lactate dehydrogenases (LDHs) from mammals, birds, an amphibian, fish, barley, and bacteria: LDH cDNA sequences from Xenopus, pig, and rat.

PubMed Central

Tsuji, S; Qureshi, M A; Hou, E W; Fitch, W M; Li, S S

1994-01-01

The nucleotide sequences of the cDNAs encoding LDH (EC 1.1.1.27) subunits LDH-A (muscle), LDH-B (liver), and LDH-C (oocyte) from Xenopus laevis, LDH-A (muscle) and LDH-B (heart) from pig, and LDH-B (heart) and LDH-C (testis) from rat were determined. These seven newly deduced amino acid sequences and 22 other published LDH sequences, and three unpublished fish LDH-A sequences kindly provided by G. N. Somero and D. A. Powers, were used to construct the most parsimonious phylogenetic tree of these 32 LDH subunits from mammals, birds, an amphibian, fish, barley, and bacteria. There have been at least six LDH gene duplications among the vertebrates. The Xenopus LDH-A, LDH-B, and LDH-C subunits are most closely related to each other and then are more closely related to vertebrate LDH-B than LDH-A. Three fish LDH-As, as well as a single LDH of lamprey, also seem to be more related to vertebrate LDH-B than to land vertebrate LDH-A. The mammalian LDH-C (testis) subunit appears to have diverged very early, prior to the divergence of vertebrate LDH-A and LDH-B subunits, as reported previously. Images PMID:7937776

Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.

PubMed Central

Göttlicher, M; Widmark, E; Li, Q; Gustafsson, J A

1992-01-01

Peroxisome proliferators such as clofibric acid, nafenopin, and WY-14,643 have been shown to activate PPAR (peroxisome proliferator-activated receptor), a member of the steroid nuclear receptor superfamily. We have cloned the cDNA from the rat that is homologous to that from the mouse [Issemann, I. & Green, S. (1990) Nature (London) 347, 645-650], which encodes a 97% similar protein with a particularly well-conserved putative ligand-binding domain. To search for physiologically occurring activators, we established a transcriptional transactivation assay by stably expressing in CHO cells a chimera of rat PPAR and the human glucocorticoid receptor that activates expression of the placental alkaline phosphatase reporter gene under the control of the mouse mammary tumor virus promoter. Testing of compounds related to lipid metabolism or peroxisomal proliferation revealed that 150 microM concentrations of arachidonic or linoleic acid but not of dehydroepiandrosterone, cholesterol, or 25-hydroxy-cholesterol, activate the receptor chimera. In addition, saturated fatty acids induce the reporter gene. Shortening the chain length to n = 6 or introduction of an omega-terminal carboxylic group abolished the activation potential of the fatty acid. In conclusion, the present results indicate that fatty acids can regulate gene expression mediated by a member of the steroid nuclear receptor superfamily. Images PMID:1316614

Gene for ataxia-telangiectasia complementation group D (ATDC)

DOEpatents

Murnane, J.P.; Painter, R.B.; Kapp, L.N.; Yu, L.C.

1995-03-07

Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for the gene are provided as well as proteins encoded by the gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of the proteins. Further disclosed are methods to detect mutations in the gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups. 30 figs.

Molecular cloning and sequence analysis of stearoyl-CoA desaturase in milkfish, Chanos chanos.

PubMed

Hsieh, S L; Liao, W L; Kuo, C M

2001-12-01

Stearoyl-CoA desaturase (EC 1.14.99.5) is a key enzyme in the biosynthesis of polyunsaturated fatty acids and the maintenance of the homeoviscous fluidity of biological membranes. The stearoyl-CoA desaturase cDNA in milkfish (Chanos chanos) was cloned by RT-PCR and RACE, and it was compared with the stearoyl-CoA desaturase in cold-tolerant teleosts, common carp and grass carp. Nucleotide sequence analysis revealed that the cDNA clone has a 972-bp open reading frame encoding 323 amino acid residues. Alignments of the deduced amino acid sequence showed that the milkfish stearoyl-CoA desaturase shares 79% and 75% identity with common carp and grass carp, and 63%-64% with other vertebrates such as sheep, hamsters, rats, mice, and humans. Like common carp and grass carp, the deduced amino acid sequence in milkfish well conserves three histidine cluster motifs (one HXXXXH and two HXXHH) that are essential for catalysis of stearoyl-CoA desaturase activity. However, RT-PCR analysis showed that stearoyl-CoA desaturase expression in milkfish is detected in the tissues of liver, muscle, kidney, brain, and gill, and more expression sites were found in milkfish than in common carp and grass carp. Phylogenic relationships among the deduced stearoyl-CoA desaturase amino acid sequence in milkfish and those in other vertebrates showed that the milkfish stearoyl-CoA desaturase amino acid sequence is phylogenetically closer to those of common carp and grass carp than to other higher vertebrates.

The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

PubMed

Lerner, D R; Raikhel, N V

1992-06-05

Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tzeng, W.-P.; Frey, Teryl K.

Rubella virus (RUB) replicons are derivatives of the RUB infectious cDNA clone that retain the nonstructural open reading frame (NS-ORF) that encodes the replicase proteins but not the structural protein ORF (SP-ORF) that encodes the virion proteins. RUB defective interfering (DI) RNAs contain deletions within the SP-ORF and thus resemble replicons. DI RNAs often retain the 5' end of the capsid protein (C) gene that has been shown to modulate virus-specific RNA synthesis. However, when replicons either with or without the C gene were passaged serially in the presence of wt RUB as a source of the virion proteins, itmore » was found that neither replicon was maintained and DI RNAs were generated. The majority DI RNA species contained in-frame deletions in the SP-ORF leading to a fusion between the 5' end of the C gene and the 3' end of the E1 glycoprotein gene. DI infectious cDNA clones were constructed and transcripts from these DI infectious cDNA clones were maintained during serial passage with wt RUB. The C-E1 fusion protein encoded by the DI RNAs was synthesized and was required for maintenance of the DI RNA during serial passage. This is the first report of a functional novel gene product resulting from deletion during DI RNA generation. Thus far, the role of the C-E1 fusion protein in maintenance of DI RNAs during serial passage remained elusive as it was found that the fusion protein diminished rather than enhanced DI RNA synthesis and was not incorporated into virus particles.« less

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

A gene variation of 14-3-3 zeta isoform in rat hippocampus.

PubMed

Murakami, K; Situ, S Y; Eshete, F

1996-11-14

A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonacci, R.; Colombo, I.; Volta, M.

The electron-transfer flavoprotein (ETF), located in the mitochondrial matrix, is a nuclear-encoded enzyme delivering to the respiratory chain electrons by straight-chain acyl-CoA dehydrogenases and other dehydrogenases. ETF is composed of a 35-kDa [alpha]-subunit that is cleaved to a 32-kDa protein during mitochondrial import (ETFA) and a [beta]-subunit that reaches the mitochondrion unmodified (ETFB). The cDNA encoding both these subunits has been cloned and sequenced. 14 refs., 1 fig.

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

PubMed Central

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

PubMed Central

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Molecular cloning of rat sperm galactosyl receptor, a C-type lectin with in vitro egg binding activity.

PubMed

Rivkin, E; Tres, L L; Kaplan-Kraicer, R; Shalgi, R; Kierszenbaum, A L

2000-07-01

Rat sperm galactosyl receptor is a member of the C-type animal lectin family showing preferential binding to N-acetylgalactosamine compared to galactose. Binding is mediated by a Ca(2+)-dependent carbohydrate-recognition domain (CRD) identical to that of the minor variant of rat hepatic lectin receptor 2/3 (RHL-2/3). The molecular organization of the genomic DNA, cDNA, and derived amino acid sequence of rat testis galactosyl receptor have been determined and in vitro fertilization studies were conducted to ascertain its role. We have determined that the rat testis galactosyl receptor gene generates two mRNA species: one species, designated liver-type, is identical to RHL-2/3; the other, designated testis-type, contains one unspliced intron (86 nt) which alters the reading frame and changes the amino acid sequence of the carboxyl terminus. As a result, the CRD (glutamine-proline-aspartic acid/QPD) and flanked Ca(2+)-binding amino acid sequences were not present in the testis-type protein. Northern and Southern blots demonstrated presence of transcripts with unspliced intron in rat sperm but not liver. Similarly, antibody, raised against a synthetic 12-amino acid peptide (p12) encoded by the unspliced intron, recognized in immunoblots a 54 kDa receptor protein in protein extracts from testis but not from liver. Immunofluorescence and immunogold electron microscopy studies demonstrated that both protein species localized on the plasma membrane surface of the head and tail of rat sperm. Furthermore, capacitated rat sperm preincubated with polyclonal antisera to RHL-2/3 or to the CRD of the liver-type galactosyl receptor showed a statistically significant decrease in the in vitro fertilization rate. We conclude that rat sperm galactosyl receptor may play a role in egg binding and that an undetermined molecular mechanism operates to generate two proteins with identical intracellular amino terminal domain but only one of them displays a CRD and associated Ca(2+)-binding sites at the carboxyl terminal extracellular domain. Copyright 2000 Wiley-Liss, Inc.

Molecular Cloning and Functional Characterization of a Dihydroflavonol 4-Reductase from Vitis bellula.

PubMed

Zhu, Yue; Peng, Qingzhong; Li, Kegang; Xie, De-Yu

2018-04-10

Vitis bellula is a new grape crop in southern China. Berries of this species are rich in antioxidative anthocyanins and proanthocyanidins. This study reports cloning and functional characterization of a cDNA encoding a V. bellula dihydroflavonol reductase (VbDFR) involved in the biosynthesis of anthocyanins and proanthocyanidins. A cDNA including 1014 bp was cloned from young leaves and its open reading frame (ORF) was deduced encoding 337 amino acids, highly similar to V. vinifera DFR (VvDFR). Green florescence protein fusion and confocal microscopy analysis determined the cytosolic localization of VbDFR in plant cells. A soluble recombinant VbDFR was induced and purified from E. coli for enzyme assay. In the presence of NADPH, the recombinant enzyme catalyzed dihydrokaempferol (DHK) and dihydroquercetin (DHQ) to their corresponding leucoanthocyanidins. The VbDFR cDNA was introduced into tobacco plants via Agrobacterium -mediated transformation. The overexpression of VbDFR increased anthocyanin production in flowers. Anthocyanin hydrolysis and chromatographic analysis revealed that transgenic flowers produced pelargonidin and delphinidin, which were not detected in control flowers. These data demonstrated that the overexpression of VbDFR produced new tobacco anthocyanidins. In summary, all data demonstrate that VbDFR is a useful gene to provide three types of substrates for metabolic engineering of anthocyanins and proanthocyanidins in grape crops and other crops.

Purification and characterization of an antifungal protein, C-FKBP, from Chinese cabbage.

PubMed

Park, Seong-Cheol; Lee, Jung Ro; Shin, Sun-Oh; Jung, Ji Hyun; Lee, Young Mee; Son, Hyosuk; Park, Yoonkyung; Lee, Sang Yeol; Hahm, Kyung-Soo

2007-06-27

An antifungal protein was isolated from Chinese cabbage (Brassica campestris L. ssp. pekinensis) by buffer-soluble extraction and two chromatographic procedures. The results of matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry revealed that the isolated Chinese cabbage protein was identical to human FK506-binding protein (FKBP). A cDNA encoding FKBP was isolated from a Chinese cabbage leaf cDNA library and named C-FKBP. The open reading frame of the gene encoded a 154-amino acid polypeptide. The amino acid sequence of C-FKBP exhibits striking degrees of identity with the corresponding mouse (61%), human (60%), and yeast (56%) proteins. Genomic Southern blot analyses using the full-length C-FKBP cDNA probe revealed a multigene family in the Chinese cabbage genome. The C-FKBP mRNA was highly expressed in vegetative tissues. We also analyzed the antifungal and peptidyl-prolyl cis-trans isomerase activity of recombinant C-FKBP protein expressed in Escherichia coli. This protein inhibited pathogenic fungal strains, including Candida albicans, Botrytis cinerea, Rhizoctonia solani, and Trichoderma viride, whereas it exhibited no activity against E. coli and Staphylococcus aureus. These results suggest that recombinant C-FKBP is an excellent candidate as a lead compound for the development of antifungal agents.

Molecular cloning and characterization of novel phytocystatin gene from turmeric, Curcuma longa.

PubMed

Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling; Shaharuddin, Noor Azmi

2014-01-01

Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5'/3' rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis.

Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid.

PubMed

Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay

2011-09-01

Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.

Molecular Cloning and Characterization of Novel Phytocystatin Gene from Turmeric, Curcuma longa

PubMed Central

Chan, Seow-Neng; Abu Bakar, Norliza; Mahmood, Maziah; Ho, Chai-Ling

2014-01-01

Phytocystatin, a type of protease inhibitor (PI), plays major roles in plant defense mechanisms and has been reported to show antipathogenic properties and plant stress tolerance. Recombinant plant PIs are gaining popularity as potential candidates in engineering of crop protection and in synthesizing medicine. It is therefore crucial to identify PI from novel sources like Curcuma longa as it is more effective in combating against pathogens due to its novelty. In this study, a novel cDNA fragment encoding phytocystatin was isolated using degenerate PCR primers, designed from consensus regions of phytocystatin from other plant species. A full-length cDNA of the phytocystatin gene, designated CypCl, was acquired using 5′/3′ rapid amplification of cDNA ends method and it has been deposited in NCBI database (accession number KF545954.1). It has a 687 bp long open reading frame (ORF) which encodes 228 amino acids. BLAST result indicated that CypCl is similar to cystatin protease inhibitor from Cucumis sativus with 74% max identity. Sequence analysis showed that CypCl contains most of the motifs found in a cystatin, including a G residue, LARFAV-, QxVxG sequence, PW dipeptide, and SNSL sequence at C-terminal extension. Phylogenetic studies also showed that CypCl is related to phytocystatin from Elaeis guineensis. PMID:25853138

Cloning and expression of a Ca(2+)-inhibitable adenylyl cyclase from NCB-20 cells.

PubMed Central

Yoshimura, M; Cooper, D M

1992-01-01

A cDNA that encodes an adenylyl cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] has been cloned from NCB-20 cells, in which adenylyl cyclase activity is inhibited by Ca2+ at physiological concentrations. The cDNA clone (5.8 kilobases) was isolated by polymerase chain reaction (PCR) using degenerate primers designed by comparison of three adenylyl cyclase sequences (types I, II, and III) and subsequent library screening. Northern analysis revealed expression of mRNA (6.1 kilobases) corresponding to this cDNA in cardiac tissue, which is a prominent source of Ca(2+)-inhibitable adenylyl cyclase. The clone encodes a protein of 1165 amino acids, whose hydrophilicity profile was very similar to those of other mammalian adenylyl cyclases that have recently been cloned. A noticeable difference between this protein and other adenylyl cyclases was a lengthy aminoterminal region before the first transmembrane span. Transient expression of this cDNA in the human embryonic kidney cell line 293 revealed a 3-fold increase in cAMP production in response to forskolin compared with control transfected cells. In purified plasma membranes from transfected cells, increased adenylyl cyclase activity was also detected, which was susceptible to inhibition by submicromolar Ca2+. Thus, this adenylyl cyclase seems to represent the Ca(2+)-inhibitable form that is encountered in NCB-20 cells, cardiac tissue, and elsewhere. Its identification should permit a determination of the structural features that determine the mode of regulation of adenylyl cyclase by Ca2+. Images PMID:1379717

Molecular cloning, characterization and expression analysis of HSP60, HSP70 and HSP90 in the golden apple snail, Pomacea canaliculata.

PubMed

Xu, Yipeng; Zheng, Guowan; Dong, Shengzhang; Liu, Guangfu; Yu, Xiaoping

2014-12-01

The golden apple snail, Pomacea canaliculata, has strong tolerance to high temperature, facilitating its invasion in East and Southeast Asia. In the present study, three cDNAs encoding heat shock proteins (PocaHSP60, PocaHSP70, PocaHSP90) in P. canaliculata were cloned and characterized. The PocaHSP60 cDNA was 2447 bp, containing an ORF encoding a polypeptide of 574 amino acids. The PocaHSP70 cDNA was 2644 bp, containing an ORF encoding a polypeptide of 643 amino acids. The PocaHSP90 cDNA was 2546 bp, containing an ORF encoding a polypeptide of 726 amino acids. Genomic DNA analysis showed that PocaHSP60 had 11 introns in the coding region and PocaHSP90 had 7 introns but PocaHSP70 had no one. The expression changes of these three PocaHSPs in the gill, digestive gland, kidney and foot muscle of P. canaliculata exposed to high and low temperature were investigated. The results of quantitative PCR and western blotting showed that the expression level of PocaHSP90 was much higher than PocaHSP60 and PocaHSP70 at room temperature, and PocaHSP70 expression level was the lowest among them. Afterheat shock, PocaHSP70 expression increased rapidly, much more significantly than PocaHSP90 expression, and the effect of heat shock on the expression of PocaHSP70 and PocaHSP90 in the different tissues of P. canaliculata was not the same. Unlike PocaHSP70 and PocaHSP90, PocaHSP60 expression seemed not to be affected by heat shock, because its expression was moderately induced only in the foot muscle. However, cool shock had little effect on the expression change of above three PocaHSPs. These results indicated that HSPs might be related to the thermal resistance of P. canaliculata.

Molecular cloning and immunoglobulin E reactivity of a natural rubber latex lecithinase homologue, the major allergenic component of Hev b 4.

PubMed

Sunderasan, E; Bahari, A; Arif, S A M; Zainal, Z; Hamilton, R G; Yeang, H Y

2005-11-01

Hev b 4 is an allergenic natural rubber latex (NRL) protein complex that is reactive in skin prick tests and in vitro immunoassays. On SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Hev b 4 is discerned predominantly at 53-55 kDa together with a 57 kDa minor component previously identified as a cyanogenic glucosidase. Of the 13 NRL allergens recognized by the International Union of Immunological Societies, the 53-55 kDa Hev b 4 major protein is the only candidate that lacks complete cDNA and protein sequence information. We sought to clone the transcript encoding the Hev b 4 major protein, and characterize the native protein and its recombinant form in relation to IgE binding. The 5'/3' rapid amplification of cDNA ends method was employed to obtain the complete cDNA of the Hev b 4 major protein. A recombinant form of the protein was over-expressed in Escherichia coli. The native Hev b 4 major protein was deglycosylated by trifluoromethane sulphonic acid. Western immunoblots of the native, deglycosylated and recombinant proteins were performed using both polyclonal antibodies and sera from latex-allergic patients. The cDNA encoding the Hev b 4 major protein was cloned. Its open reading frame matched lecithinases in the conserved domain database and contained 10 predicted glycosylation sites. Detection of glycans on the Hev b 4 lecithinase homologue confirmed it to be a glycoprotein. The deglycosylated lecithinase homologue was discerned at 40 kDa on SDS-PAGE, this being comparable to the 38.53 kDa mass predicted by its cDNA. Deglycosylation of the lecithinase homologue resulted in the loss of IgE recognition, although reactivity to polyclonal rabbit anti-Hev b 4 was retained. IgE from latex-allergic patients also failed to recognize the non-glycosylated E. coli recombinant lecithinase homologue. The IgE epitopes of the Hev b 4 lecithinase homologue reside mainly in its carbohydrate moiety, which also account for the discrepancy between the observed molecular weight of the protein and the value calculated from its cDNA.

Molecular characterization of two serine proteases expressed in gut tissue of the African trypanosome vector, Glossina morsitans morsitans.

PubMed

Yan, J; Cheng, Q; Li, C B; Aksoy, S

2001-02-01

Serine proteases are major insect gut enzymes involved in digestion of dietary proteins, and in addition they have been implicated in the process of pathogen establishment in several vector insects. The medically important vector, tsetse fly (Diptera:Glossinidiae), is involved in the transmission of African trypanosomes, which cause devastating diseases in animals and humans. Both the male and female tsetse can transmit trypanosomes and both are strict bloodfeeders throughout all stages of their development. Here, we describe the characterization of two putative serine protease-encoding genes, Glossina serine protease-1 (Gsp1) and Glossina serine protease-2 (Gsp2) from gut tissue. Both putative cDNA products represent prepro peptides with hydrophobic signal peptide sequences associated with their 5'-end terminus. The Gsp1 cDNA encodes a putative mature protein of 245 amino acids with a molecular mass of 26 428 Da, while the predicted size of the 228 amino acid mature peptide encoded by Gsp2 cDNA is 24 573 Da. Both deduced peptides contain the Asp/His/Ser catalytic triad and the conserved residues surrounding it which are characteristic of serine proteases. In addition, both proteins have the six-conserved cysteine residues to form the three-cysteine bonds typically present in invertebrate serine proteases. Based on the presence of substrate specific residues, the Gsp1 gene encodes a chymotrypsin-like protease while Gsp2 gene encodes for a protein with trypsin-like activity. Both proteins are encoded by few loci in tsetse genome, being present in one or two copies only. The mRNA expression levels for the genes do not vary extensively throughout the digestive cycle, and high levels of mRNAs can be readily detected in the gut tissue of newly emerged flies. The levels of trypsin and chymotrypsin activities in the gut lumen increase following blood feeding and change significantly in the gut cells throughout the digestion cycle. Hence, the regulation of expression for trypsin and chymotrypsin occurs at the post-transcriptional level in tsetse. Both the coding sequences and patterns of expression of Gsp1 and Gsp2 genes are similar to the serine proteases that have been reported from the bloodfeeding insect Stomoxys calcitrans.

Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

PubMed Central

Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

1990-01-01

Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

The mapping of the human 52-kD Ro/SSA autoantigen gene to human chromosome II, and its polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank, M.B.; Itoh, Kazuko; Fujisaku, Atsushi

1993-01-01

Autoantibodies to the ribonucleoprotein Ro/SSA occur in nearly half of the patients with systemic lupus erythematosus and are associated with lymphopenia, photosensitive dermatitis, and pulmonary and renal disease, which suggests that they have an immunopathologic role. The majority of Ro/SSA precipitin-positive patients produce serum antibodies that bind to the 60-kD and 52-kD Ro/SSA proteins. The authors previously isolated and determined the nucleotide sequence of a cDNA clone that encodes the 52-kD form of the human Ro/SSA protein. In the present study, they have determined the chromosomal location of the gene by in situ hybridization to the end of the shortmore » arm of chromosome 11. Hybridization of portions of the cDNA probe to restriction enzyme-digested DNA indicated the gene is composed of at least three exons. The exon encoding the putative zinc fingers of this protein was found to be distinct from that which encodes the leucine zipper. An RFLP of this gene was identified and is associated with the presence of lupus, primarily in black Americans. 60 refs., 3 figs., 3 tabs.« less

Polygalacturonase from Sitophilus oryzae: Possible horizontal transfer of a pectinase gene from fungi to weevils

PubMed Central

Shen, Zhicheng; Denton, Michael; Mutti, Navdeep; Pappan, Kirk; Kanost, Michael R.; Reese, John C.; Reeck, Gerald R.

2003-01-01

Endo-polygalacturonase, one of the group of enzymes known collectively as pectinases, is widely distributed in bacteria, plants and fungi. The enzyme has also been found in several weevil species and a few other insects, such as aphids, but not in Drosophila melanogaster, Anopheles gambiae, or Caenorhabditis elegans or, as far as is known, in any more primitive animal species. What, then, is the genetic origin of the polygalacturonases in weevils? Since some weevil species harbor symbiotic microorganisms, it has been suggested, reasonably, that the symbionts' genomes of both aphids and weevils, rather than the insects' genomes, could encode polygalacturonase. We report here the cloning of a cDNA that encodes endo-polygalacturonase in the rice weevil, Sitophilus oryzae (L.), and investigations based on the cloned cDNA. Our results, which include analysis of genes in antibiotic-treated rice weevils, indicate that the enzyme is, in fact, encoded by the insect genome. Given the apparent absence of the gene in much of the rest of the animal kingdom, it is therefore likely that the rice weevil polygalacturonase gene was incorporated into the weevil's genome by horizontal transfer, possibly from a fungus. PMID:15841240

Polygalacturonase from Sitophilus oryzae: possible horizontal transfer of a pectinase gene from fungi to weevils.

PubMed

Shen, Zhicheng; Denton, Michael; Mutti, Navdeep; Pappan, Kirk; Kanost, Michael R; Reese, John C; Reeck, Gerald R

2003-01-01

Endo-polygalacturonase, one of the group of enzymes known collectively as pectinases, is widely distributed in bacteria, plants and fungi. The enzyme has also been found in several weevil species and a few other insects, such as aphids, but not in Drosophila melanogaster, Anopheles gambiae, or Caenorhabditis elegans or, as far as is known, in any more primitive animal species. What, then, is the genetic origin of the polygalacturonases in weevils? Since some weevil species harbor symbiotic microorganisms, it has been suggested, reasonably, that the symbionts' genomes of both aphids and weevils, rather than the insects' genomes, could encode polygalacturonase. We report here the cloning of a cDNA that encodes endo-polygalacturonase in the rice weevil, Sitophilus oryzae (L.), and investigations based on the cloned cDNA. Our results, which include analysis of genes in antibiotic-treated rice weevils, indicate that the enzyme is, in fact, encoded by the insect genome. Given the apparent absence of the gene in much of the rest of the animal kingdom, it is therefore likely that the rice weevil polygalacturonase gene was incorporated into the weevil's genome by horizontal transfer, possibly from a fungus.

Skeletal unloading inhibits the in vitro proliferation and differentiation of rat osteoprogenitor cells

NASA Technical Reports Server (NTRS)

Kostenuik, P. J.; Halloran, B. P.; Morey-Holton, E. R.; Bikle, D. D.

1997-01-01

Loss of weight bearing in the growing rat decreases bone formation, osteoblast numbers, and bone maturation in unloaded bones. These responses suggest an impairment of osteoblast proliferation and differentiation. To test this assumption, we assessed the effects of skeletal unloading using an in vitro model of osteoprogenitor cell differentiation. Rats were hindlimb elevated for 0 (control), 2, or 5 days, after which their tibial bone marrow stromal cells (BMSCs) were harvested and cultured. Five days of hindlimb elevation led to significant decreases in proliferation, alkaline phosphatase (AP) enzyme activity, and mineralization of BMSC cultures. Differentiation of BMSCs was analyzed by quantitative competitive polymerase chain reaction of cDNA after 10, 15, 20, and 28 days of culture. cDNA pools were analyzed for the expression of c-fos (an index of proliferation), AP (an index of early osteoblast differentiation), and osteocalcin (a marker of late differentiation). BMSCs from 5-day unloaded rats expressed 50% less c-fos, 61% more AP, and 35% less osteocalcin mRNA compared with controls. These data demonstrate that cultured osteoprogenitor cells retain a memory of their in vivo loading history and indicate that skeletal unloading inhibits proliferation and differentiation of osteoprogenitor cells in vitro.

Production of hydroxylated fatty acids in genetically modified plants

DOEpatents

Somerville, Chris [Portola Valley, CA; Broun, Pierre [Burlingame, CA; van de Loo, Frank [Weston, AU; Boddupalli, Sekhar S [Manchester, MI

2011-08-23

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

Production of hydroxylated fatty acids in genetically modified plants

DOEpatents

Somerville, Chris; Broun, Pierre; van de Loo, Frank; Boddupalli, Sekhar S.

2005-08-30

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

[Cloning and expression regulation of 1-deoxy-D-xylulose-5-phosphate reductoisomerase cDNA from Alpinia officinarum].

PubMed

Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min

2012-11-01

The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.

Molecular Cloning and Characterization of an Acetylcholinesterase cDNA in the Brown Planthopper, Nilaparvata lugens

PubMed Central

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1986-11-26

cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

PubMed Central

Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

1990-01-01

Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

Molecular Cloning of Secreted Luciferases from Marine Planktonic Copepods.

PubMed

Takenaka, Yasuhiro; Ikeo, Kazuho; Shigeri, Yasushi

2016-01-01

Secreted luciferases isolated from copepod crustaceans are frequently used for nondisruptive reporter-gene assays, such as the continuous, automated and/or high-throughput monitoring of gene expression in living cells. All known copepod luciferases share highly conserved amino acid residues in two similar, repeated domains in the sequence. The similarity in the domains are ideal nature for designing PCR primers to amplify cDNA fragments of unidentified copepod luciferases from bioluminescent copepod crustaceans. Here, we introduce how to establish a cDNA encoding novel copepod luciferases from a copepod specimen by PCR with degenerated primers.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Pyramiding expression of maize genes encoding phosphoenolpyruvate carboxylase (PEPC) and pyruvate orthophosphate dikinase (PPDK) synergistically improve the photosynthetic characteristics of transgenic wheat.

PubMed

Zhang, HuiFang; Xu, WeiGang; Wang, HuiWei; Hu, Lin; Li, Yan; Qi, XueLi; Zhang, Lei; Li, ChunXin; Hua, Xia

2014-09-01

Using particle bombardment transformation, we introduced maize pepc cDNA encoding phosphoenolpyruvate carboxylase (PEPC) and ppdk cDNA encoding pyruvate orthophosphate dikinase (PPDK) into the C3 crop wheat to generate transgenic wheat lines carrying cDNA of pepc (PC lines), ppdk (PK lines) or both (PKC lines). The integration, transcription, and expression of the foreign genes were confirmed by Southern blot, Real-time quantitative reverse transcription PCR (Q-RT-PCR), and Western blot analysis. Q-RT-PCR results indicated that the average relative expression levels of pepc and ppdk in the PKC lines reached 10 and 4.6, respectively, compared to their expressions in untransformed plants (set to 1). The enzyme activities of PEPC and PPDK in the PKC lines were 4.3- and 2.1-fold higher, respectively, than in the untransformed control. The maximum daily net photosynthetic rates of the PKC, PC, and PK lines were enhanced by 26.4, 13.3, and 4.5%, respectively, whereas the diurnal accumulations of photosynthesis were 21.3, 13.9, and 6.9%, respectively, higher than in the control. The Fv/Fm of the transgenic plants decreased less than in the control under high temperature and high light conditions (2 weeks after anthesis), suggesting that the transgenic wheat transports more absorbed light energy into a photochemical reaction. The exogenous maize C4-specific pepc gene was more effective than ppdk at improving the photosynthetic performance and yield characteristics of transgenic wheat, while the two genes showed a synergistic effect when they were transformed into the same genetic background, because the PKC lines exhibited improved photosynthetic and physiological traits.

Identification, localisation and functional implication of 26RFa orthologue peptide in the brain of zebra finch (Taeniopygia guttata).

PubMed

Tobari, Y; Iijima, N; Tsunekawa, K; Osugi, T; Haraguchi, S; Ubuka, T; Ukena, K; Okanoya, K; Tsutsui, K; Ozawa, H

2011-09-01

Several neuropeptides with the C-terminal Arg-Phe-NH(2) (RFa) sequence have been identified in the hypothalamus of a variety of vertebrates. The present study was conducted to isolate novel RFa peptides from the zebra finch brain. Peptides were isolated by immunoaffinity purification using an antibody that recognises avian RFa peptides. The isolated peptide consisted of 25 amino acids with RFa at its C-terminus. The sequence was SGTLGNLAEEINGYNRRKGGFTFRFa. Alignment of the peptide with vertebrate 26RFa has revealed that the identified peptide is the zebra finch 26RFa. We also cloned the precursor cDNA encoding this peptide. Synteny analysis of the gene showed a high conservation of this gene among vertebrates. In addition, we cloned the cDNA encoding a putative 26RFa receptor, G protein-coupled receptor 103 (GPR103) in the zebra finch brain. GPR103 cDNA encoded a 432 amino acid protein that has seven transmembrane domains. In situ hybridisation analysis in the brain showed that the expression of 26RFa mRNA is confined to the anterior-medial hypothalamic area, ventromedial nucleus of the hypothalamus and the lateral hypothalamic area, the brain regions that are involved in the regulation of feeding behaviour, whereas GPR103 mRNA is distributed throughout the brain in addition to the hypothalamic nuclei. When administered centrally in free-feeding male zebra finches, 26RFa increased food intake 24 h after injection without body mass change. Diencephalic GPR103 mRNA expression was up-regulated by fasting for 10 h. Our data suggest that the hypothalamic 26RFa-its receptor system plays an important role in the central control of food intake and energy homeostasis in the zebra finch. © 2011 The Authors. Journal of Neuroendocrinology © 2011 Blackwell Publishing Ltd.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Molecular Cloning of an Immunogenic Protein of Baylisascaris procyonis and Expression in Escherichia coli for Use in Developing Improved Serodiagnostic Assays▿

PubMed Central

Dangoudoubiyam, Sriveny; Vemulapalli, Ramesh; Hancock, Kathy; Kazacos, Kevin R.

2010-01-01

Larva migrans caused by Baylisascaris procyonis is an important zoonotic disease. Current serological diagnostic assays for this disease depend on the use of the parasite's larval excretory-secretory (ES) antigens. In order to identify genes encoding ES antigens and to generate recombinant antigens for use in diagnostic assays, construction and immunoscreening of a B. procyonis third-stage larva cDNA expression library was performed and resulted in identification of a partial-length cDNA clone encoding an ES antigen, designated repeat antigen 1 (RAG1). The full-length rag1 cDNA contained a 753-bp open reading frame that encoded a protein of 250 amino acids with 12 tandem repeats of a 12-amino-acid long sequence. The rag1 genomic DNA revealed a single intron of 837 bp that separated the 753-bp coding sequence into two exons delimited by canonical splice sites. No nucleotide or amino acid sequences present in the GenBank databases had significant similarity with those of RAG1. We have cloned, expressed, and purified the recombinant RAG1 (rRAG1) and analyzed its diagnostic potential by enzyme-linked immunosorbent assay. Anti-Baylisascaris species-specific rabbit serum showed strong reactivity to rRAG1, while only minimal to no reactivity was observed with sera against the related ascarids Toxocara canis and Ascaris suum, strongly suggesting the specificity of rRAG1. On the basis of these results, the identified RAG1 appears to be a promising diagnostic antigen for the development of serological assays for specific detection of B. procyonis larva migrans. PMID:20926699

Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues.

PubMed

Bown, David P; Gatehouse, John A

2004-05-01

Carboxypeptidases were purified from guts of larvae of corn earworm (Helicoverpa armigera), a lepidopteran crop pest, by affinity chromatography on immobilized potato carboxypeptidase inhibitor, and characterized by N-terminal sequencing. A larval gut cDNA library was screened using probes based on these protein sequences. cDNA HaCA42 encoded a carboxypeptidase with sequence similarity to enzymes of clan MC [Barrett, A. J., Rawlings, N. D. & Woessner, J. F. (1998) Handbook of Proteolytic Enzymes. Academic Press, London.], but with a novel predicted specificity towards C-terminal acidic residues. This carboxypeptidase was expressed as a recombinant proprotein in the yeast Pichia pastoris. The expressed protein could be activated by treatment with bovine trypsin; degradation of bound pro-region, rather than cleavage of pro-region from mature protein, was the rate-limiting step in activation. Activated HaCA42 carboxypeptidase hydrolysed a synthetic substrate for glutamate carboxypeptidases (FAEE, C-terminal Glu), but did not hydrolyse substrates for carboxypeptidase A or B (FAPP or FAAK, C-terminal Phe or Lys) or methotrexate, cleaved by clan MH glutamate carboxypeptidases. The enzyme was highly specific for C-terminal glutamate in peptide substrates, with slow hydrolysis of C-terminal aspartate also observed. Glutamate carboxypeptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate-specific metallocarboxypeptidase from clan MC to be identified and characterized. The genome of Drosophila melanogaster contains genes encoding enzymes with similar sequences and predicted specificity, and a cDNA encoding a similar enzyme has been isolated from gut tissue in tsetse fly. We suggest that digestive carboxypeptidases with sequence similarity to the classical mammalian enzymes, but with specificity towards C-terminal glutamate, are widely distributed in insects.

The VBP and a1/EBP leucine zipper factors bind overlapping subsets of avian retroviral long terminal repeat CCAAT/enhancer elements.

PubMed

Smith, C D; Baglia, L A; Curristin, S M; Ruddell, A

1994-10-01

Two long terminal repeat (LTR) enhancer-binding proteins which may regulate high rates of avian leukosis virus (ALV) LTR-enhanced c-myc transcription during bursal lymphomagenesis have been identified (A. Ruddell, M. Linial, and M. Groudine, Mol. Cell. Biol. 9:5660-5668, 1989). The genes encoding the a1/EBP and a3/EBP binding factors were cloned by expression screening of a lambda gt11 cDNA library from chicken bursal lymphoma cells. The a1/EBP cDNA encodes a novel leucine zipper transcription factor (W. Bowers and A. Ruddell, J. Virol. 66:6578-6586, 1992). The partial a3/EBP cDNA clone encodes amino acids 84 to 313 of vitellogenin gene-binding protein (VBP), a leucine zipper factor that binds the avian vitellogenin II gene promoter (S. Iyer, D. Davis, and J. Burch, Mol. Cell. Biol. 11:4863-4875, 1991). Multiple VBP mRNAs are expressed in B cells in a pattern identical to that previously observed for VBP in other cell types. The LTR-binding activities of VBP, a1/EBP, and B-cell nuclear extract protein were compared and mapped by gel shift, DNase I footprinting, and methylation interference assays. The purified VBP and a1/EBP bacterial fusion proteins bind overlapping but distinct subsets of CCAAT/enhancer elements in the closely related ALV and Rous sarcoma virus (RSV) LTR enhancers. Protein binding to these CCAAT/enhancer elements accounts for most of the labile LTR enhancer-binding activity observed in B-cell nuclear extracts. VBP and a1/EBP could mediate the high rates of ALV and RSV LTR-enhanced transcription in bursal lymphoma cells and many other cell types.

The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1

PubMed Central

Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.

1986-01-01

The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668

Assignment and expression patterns of porcine muscle-specific isoform of phosphoglycerate mutase gene.

PubMed

Qiu, Haifang; Zhao, Shuhong; Xu, Xuewen; Yerle, Martine; Liu, Bang

2008-05-01

It has been reported that the muscle-specific isoform (type M, PGAM2) of phosphoglycerate mutase (PGAM) is a housekeeping enzyme; it catalyzes the conversion of 3-phosphoglycerate into 2-phosphoglycerate in the glycolysis process to release energy. It is encoded by the Pgam2 gene. In this study, the cDNA of the porcine Pgam2 was cloned. This gene contains an open reading frame of 765 bp encoding a protein of 253 residues, and the predicted protein sequences share high similarity with other mammalians, 96% identity with humans, and 94% identity with mouse and rats. Pgam2 was mapped to SSC18q13-q21 by the RH panel. In this region, there are several QTLs, such as fat ratio, lean percentage, and diameter of muscle fiber, which affect meat production and quality. The reverse transcriptase-polymerase chain reaction revealed that the porcine Pgam2 gene was mainly expressed in the muscle tissue (skeletal muscle and cardiac muscle), and was expressed highly at skeletal muscle development stages (embryonic periods: 33, 65, and 90 days post-conception (dpc); postnatal pigs: 4 days and adult). This indicates that the Pgam2 gene plays an important role in muscle growth and development. In addition, it was demonstrated that PGAM2 locates both in cytoplasm and nuclei, and takes part in the glycometabolism process of cytoplasm and nuclei.

Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

PubMed Central

Eberwine, James; Bartfai, Tamas

2011-01-01

We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

Molecular characterization of genes encoding inward rectifier potassium (Kir) channels in the bed bug (Cimex lectularius).

PubMed

Mamidala, Praveen; Mittapelly, Priyanka; Jones, Susan C; Piermarini, Peter M; Mittapalli, Omprakash

2013-04-01

The molecular genetics of inward-rectifier potassium (Kir) channels in insects is poorly understood. To date, Kir channel genes have been characterized only from a few representative dipterans (i.e., fruit flies and mosquitoes). The goal of the present study was to characterize Kir channel cDNAs in a hemipteran, the bed bug (Cimex lectularius). Using our previously reported bed bug transcriptome (RNA-seq), we identified two cDNAs that encode putative Kir channels. One was a full-length cDNA that encodes a protein belonging to the insect 'Kir3' clade, which we designate as 'ClKir3'. The other was a partial cDNA that encodes a protein with similarity to both the insect 'Kir1' and 'Kir2' clades, which we designate as 'ClKir1/2'. Quantitative real-time PCR analysis revealed that ClKir1/2 and ClKir3 exhibited peak expression levels in late-instar nymphs and early-instar nymphs, respectively. Furthermore, ClKir3, but not ClKir1/2, showed tissue-specific expression in Malpighian tubules of adult bed bugs. Lastly, using an improved procedure for delivering double-stranded RNA (dsRNA) to male and female bed bugs (via the cervical membrane) we demonstrate rapid and systemic knockdown of ClKir3 transcripts. In conclusion, we demonstrate that the bed bug possesses at least two genes encoding Kir channels, and that RNAi is possible for at least Kir3, thereby offering a potential approach for elucidating the roles of Kir channel genes in bed bug physiology. Copyright © 2013 Elsevier Inc. All rights reserved.

Newly identified allatostatin Bs and their receptor in the two-spotted cricket, Gryllus bimaculatus.

PubMed

Tsukamoto, Yusuke; Nagata, Shinji

2016-06-01

A cDNA encoding allatostatin Bs (ASTBs) containing the W(X)6W motif was identified using a database generated by a next generation sequencer (NGS) in the two-spotted cricket, Gryllus bimaculatus. The contig sequence revealed the presence of five novel putative ASTBs (GbASTBs) in addition to GbASTBs previously identified in G. bimaculatus. MALDI-TOF MS analyses revealed the presence of these novel and previously identified GbASTBs with three missing GbASTBs. We also identified a cDNA encoding G. bimaculatus GbASTB receptor (GbASTBR) in the NGS data. Phylogenetic analysis demonstrated that this receptor was highly conserved with other insect ASTBRs, including the sex peptide receptor of Drosophila melanogaster. Calcium imaging analyses indicated that the GbASTBR heterologously expressed in HEK293 cells exhibited responses to all identified GbASTBs at a concentration range of 10(-10)-10(-5)M. Copyright © 2016 Elsevier Inc. All rights reserved.

Planarian myosin essential light chain is involved in the formation of brain lateral branches during regeneration.

PubMed

Yu, Shuying; Chen, Xuhui; Yuan, Zuoqing; Zhou, Luming; Pang, Qiuxiang; Mao, Bingyu; Zhao, Bosheng

2015-08-01

The myosin essential light chain (ELC) is a structure component of the actomyosin cross-bridge, however, the functions in the central nervous system (CNS) development and regeneration remain poorly understood. Planarian Dugesia japonica has revealed fundamental mechanisms and unique aspects of neuroscience and neuroregeneration. In this study, the cDNA DjElc, encoding a planarian essential light chain of myosin, was identified from the planarian Dugesia japonica cDNA library. It encodes a deduced protein with highly conserved functionally domains EF-Hand and Ca(2+) binding sites that shares significant similarity with other members of ELC. Whole mount in situ hybridization studies show that DjElc expressed in CNS during embryonic development and regeneration of adult planarians. Loss of function of DjElc by RNA interference during planarian regeneration inhibits brain lateral branches regeneration completely. In conclusion, these results demonstrated that DjElc is required for maintenance of neurons and neurite outgrowth, particularly for involving the brain later branch regeneration.

Sex- and tissue-specific expression of P450 aromatase (cyp19a1a) in the yellowtail clownfish, Amphiprion clarkii.

PubMed

Kobayashi, Yasuhisa; Horiguchi, Ryo; Miura, Saori; Nakamura, Masaru

2010-02-01

To investigate the role of estrogen in the gonad of yellowtail clownfish Amphiprion clarkii, we isolated cDNA encoding cytochrome P450 aromatase (Cyp19a1a) from the adult ovary. The full-length cDNA of clownfish cyp19a1a is 1928-bp long and encodes 520 amino acids. Real-time quantitative RT-PCR analysis showed that cyp19a1a was expressed mainly in the ovary of female-phase fish. In situ hybridization and immunohistochemical observations showed that positive signals were restricted to the ovarian follicle of the female-phase fish. In contrast, Cyp19a1a signal was not detected in the ambisexual gonad of the male-phase fish. These findings suggest that Cyp19a1a is involved in oogenesis in the female-phase fish, but not in the ambisexual gonad of male-phase fish. 2009 Elsevier Inc. All rights reserved.

Amino acid sequence of a trypsin inhibitor from a Spirometra (Spirometra erinaceieuropaei).

PubMed

Sanda, A; Uchida, A; Itagaki, T; Kobayashi, H; Inokuchi, N; Koyama, T; Iwama, M; Ohgi, K; Irie, M

2001-12-01

A trypsin inhibitor that is highly homologous with bovine pancreatic trypsin inhibitor (BPTI) was co-purified along with RNase from Spirometra (Spirometra erinaceieuropaei). The amino acid sequence of this inhibitor (SETI) and the nucleotide sequence of the cDNA encoding this protein were determined by protein chemistry and gene technology. SETI contains 68 amino acid residues and has a molecular mass of 7,798 Da. SETI has 31 amino acid residues that are identical with BPTI's sequence, including 6 half-cystine and 5 aromatic amino acid residues. The active site Lys residue in BPTI is replaced by an Arg residue in SETI. SETI is an effective inhibitor of trypsin and moderately inhibits a-chymotrypsin, but less inhibits elastase or subtilisin. SETI was expressed by E. coli containing a PelB vector carrying the SETI encoding cDNA; an expression yield of 0.68 mg/l was obtained. The phylogenetic relationship of SETI and the other BPTI-like trypsin inhibitors was analyzed using most likelihood inference methods.

Gene encoding herbicide safener binding protein

DOEpatents

Walton, Jonathan D.; Scott-Craig, John S.

1999-01-01

The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

Molecular Cloning and Analysis of the Tryptophan oxygenase Gene in the Silkworm, Bombyx mori

PubMed Central

Yan, Liu; Zhi-Qi, Meng; Bao-Long, Niu; Li-Hua, He; Hong-Biao, Weng; Wei-Feng, Shen

2008-01-01

A Bombyx mori L. (Lepidoptera: Bombycidae) gene encoding tryptophan oxygenase has been molecularly cloned and analyzed. The tryptophan oxygenase cDNA had 1374 nucleotides that encoded a 401 amino acid protein with an estimated molecular mass of 46.47 kDa and a PI of 5.88. RT-PCR analysis showed that the B. mori tryptophan oxygenase gene was transcribed in all examined stages. Tryptophan oxygenase proteins are relatively well conserved among different orders of arthropods. PMID:20331401

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Inhibin binding protein in rats: alternative transcripts and regulation in the pituitary across the estrous cycle.

PubMed

Bernard, D J; Woodruff, T K

2001-04-01

Inhibin binding protein (InhBP) and the transforming growth factor-beta (TGF beta) type III receptor, beta glycan, have been identified as putative inhibin coreceptors. Here we cloned the InhBP cDNA in rats and predict that it encodes a large membrane-spanning protein that is part of the Ig superfamily, as has been described for humans. Two abundant InhBP transcripts (4.4 and 1.8 kb) were detected in the adult rat pituitary. The larger transcript encodes the full-length protein while the 1.8-kb transcript (InhBP-short or InhBP-S) corresponds to a splice variant of the receptor. This truncated isoform contains only the N-terminal signal peptide and first two (of 12) Ig-like domains observed in the full-length InhBP (InhBP-long or InhBP-L). InhBP-S does not contain a transmembrane domain and is predicted to be a soluble protein. Beta glycan was also detected in the pituitary; however, it was most abundant within the intermediate lobe. Although we also observed beta glycan immunopositive cells in the anterior pituitary, they rarely colocalized with FSH beta-producing cells. We next examined physiological regulation of the coreceptors across the rat estrous cycle. Like circulating inhibin A and inhibin B levels, pituitary InhBP-L and InhBP-S mRNA levels were dynamically regulated across the cycle and were negatively correlated with serum FSH levels. Expression of both forms of InhBP was also positively correlated with serum inhibin B, but not inhibin A, levels. These data are particularly interesting in light of our in vitro observations that InhBP may function as an inhibin B-specific coreceptor. Pituitary beta glycan mRNA levels did not fluctuate across the cycle nor did they correlate with serum FSH. These observations, coupled with its pattern of expression within the pituitary, indicate that beta glycan likely functions as more than merely an inhibin coreceptor within the pituitary. A direct role for InhBP or beta glycan in regulation of pituitary FSH by inhibin in vivo has yet to be determined, but the demonstration of dynamic regulation of pituitary InhBP and its negative relation to serum FSH across the estrous cycle is an important step in this direction.

Expression of ayu (Plecoglossus altivelis) Pit-1 in Escherichia coli: its purification and immunohistochemical detection using monoclonal antibody.

PubMed

Chiu, Chi-Chien; John, Joseph Abraham Christopher; Hseu, Tzong-Hsiung; Chang, Chi-Yao

2002-03-01

The pituitary-specific transcription factor Pit-1 belongs to the family of POU-domain proteins and is known to play an important role in the differentiation of pituitary cells. Here we report the complete nucleotide sequence of cDNA encoding Pit-1 from the brackish water fish, ayu (Plecoglossus altivelis). Nucleotide sequence analysis of 1910 bp of ayu Pit-1 cDNA revealed an open reading frame of 1074 bp that encodes a protein of 358 amino acids containing a POU-specific domain, POU homeodomain, and an STA (Ser/Thr-rich activation) transactivation domain. We inserted the coding region of Pit-1 cDNA, obtained by PCR, into a pET-20b(+) plasmid to produce recombinant Pit-1 in Escherichia coli BL21 (DE3) pLysS cells. Upon induction with isopropyl beta-D-thiogalactopyranoside, Pit-1 was expressed and accumulated as inclusion bodies in E. coli. The protein was then purified in one step by affinity chromatography on a nickel-nitrilotriacetic acid agarose column under denaturing conditions. This method yielded 0.7 mg of highly pure and stable protein per 200 ml of bacterial culture. A band of 40 kDa, resolved as recombinant ayu Pit-1 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, agrees well with the molecular mass calculated from the translated cDNA sequence. The purified recombinant Pit-1 was confirmed in vitro through Western blot analysis, using its monoclonal antibody. This monoclonal antibody detected Pit-1 in the nuclei of ayu developing pituitary by immunohistochemical reaction. It serves as a good reagent for the detection of ayu Pit-1 in situ. Copyright 2002 Elsevier Science (USA).

Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reilly, D.S.; Nussbaum, R.L.

1994-09-01

The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

Molecular characterization of a cDNA encoding copper/zinc superoxide dismutase from cultured cells of Manihot esculenta.

PubMed

Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo

2005-01-01

Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.

Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

PubMed

Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

2014-10-01

Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of a maize nucleic acid-binding protein (NBP) belonging to a family of nuclear-encoded chloroplast proteins.

PubMed Central

Cook, W B; Walker, J C

1992-01-01

A cDNA encoding a nuclear-encoded chloroplast nucleic acid-binding protein (NBP) has been isolated from maize. Identified as an in vitro DNA-binding activity, NBP belongs to a family of nuclear-encoded chloroplast proteins which share a common domain structure and are thought to be involved in posttranscriptional regulation of chloroplast gene expression. NBP contains an N-terminal chloroplast transit peptide, a highly acidic domain and a pair of ribonucleoprotein consensus sequence domains. NBP is expressed in a light-dependent, organ-specific manner which is consistent with its involvement in chloroplast biogenesis. The relationship of NBP to the other members of this protein family and their possible regulatory functions are discussed. Images PMID:1346929

Molecular cloning and characterization of alpha - galactosidase gene from Glaciozyma antarctica

NASA Astrophysics Data System (ADS)

Moheer, Reyad Qaed Al; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul

2015-09-01

Psychrophilic enzymes are proteins produced by psychrophilic organisms which recently are the limelight for industrial applications. A gene encoding α-galactosidase from a psychrophilic yeast, Glaciozyma antarctica PI12 which belongs to glycoside hydrolase family 27, was isolated and analyzed using several bioinformatic tools. The cDNA of the gene with the size of 1,404-bp encodes a protein with 467 amino acid residues. Predicted molecular weight of protein was 48.59 kDa and hence we name the gene encoding α-galactosidase as GAL48. We found that the predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal α-galactosidase.

Creatine kinase and alpha-actin mRNA levels decrease in diabetic rat hearts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popovich, B.; Barrieux, A.; Dillmann, W.H.

1987-05-01

Diabetic cardiomyopathy is associated with cardiac atrophy and isoenzyme redistribution. To determine if tissue specific changes occur in mRNAs coding for ..cap alpha..-actin and creatine kinase (CK), they performed RNA blot analysis. Total ventricular RNA from control (C) and 4 wk old diabetic (D) rats were hybridized with /sup 32/P cDNA probes for ..cap alpha..-actin and CK. A tissue independent cDNA probe, CHOA was also used. Signal intensity was quantified by photodensitometry. D CK mRNA was 47 +/- 16% lower in D vs C. Insulin increases CK mRNA by 20% at 1.5 hs, and completely reverses the deficit after 4more » wks. D ..cap alpha..-actin mRNA is 66 +/- 18% lower in D vs C. Insulin normalized ..cap alpha..-actin mRNA by 5 hs. CHOA mRNA is unchanged in D vs C, but D + insulin CHOA mRNA is 30 +/- 2% lower than C. In rats with diabetic cardiomyopathy, muscle specific CK and ..cap alpha..-actin mRNAs are decreased. Insulin treatment reverses these changes.« less

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.

PubMed

Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S

1997-07-01

A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.

cDNA microarray analyses reveal candidate marker genes for the detection of ascidian disease in Korea.

PubMed

Azumi, Kaoru; Usami, Takeshi; Kamimura, Akiko; Sabau, Sorin V; Miki, Yasufumi; Fujie, Manabu; Jung, Sung-Ju; Kitamura, Shin-Ichi; Suzuki, Satoru; Yokosawa, Hideyoshi

2007-12-01

A serious disease of the ascidian Halocynthia roretzi has been spread extensively among Korean aquaculture sites. To reveal the cause of the disease and establish a monitoring system for it, we constructed a cDNA microarray spotted with 2,688 cDNAs derived from H. roretzi hemocyte cDNA libraries to detect genes differentially expressed in hemocytes between diseased and non-diseased ascidians. We detected 21 genes showing increased expression and 16 genes showing decreased expression in hemocytes from diseased ascidians compared with those from non-diseased ascidians. RT-PCR analyses confirmed that the expression levels of genes encoding astacin, lysozyme, ribosomal protein PO, and ubiquitin-ribosomal protein L40e fusion protein were increased in hemocytes from diseased ascidians, while those of genes encoding HSP40, HSP70, fibronectin, carboxypeptidase and lactate dehydrogenase were decreased. These genes were expressed not only in hemocytes but also in various other tissues in ascidians. Furthermore, the expression of glutathione-S transferase omega, which is known to be up-regulated in H. roretzi hemocytes during inflammatory responses, was strongly increased in hemocytes from diseased ascidians. These gene expression profiles suggest that immune and inflammatory reactions occur in the hemocytes of diseased ascidians. These genes will be good markers for detecting and monitoring this disease of ascidians in Korean aquaculture sites.

Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA; construction of cDNA clones and identification of a rabbit mu heavy chain clone.

PubMed

Bernstein, K E; Pavirani, A; Alexander, C; Jacobsen, F; Fitzmaurice, L; Mage, R

1983-01-01

Rabbits were infected by Trypanosoma equiperdum and the splenic mRNA was isolated. In vitro translation of this RNA and immunoprecipitation with anti-light chain, anti-heavy chain, anti-mu and anti-VH antibodies demonstrated that T. equiperdum infection elicits large quantities of splenic mRNA encoding mu and kappa chains. The mu and gamma heavy chains and the kappa light chains synthesized in the cell-free translation system were specifically immunoprecipitated by antisera to heavy chain VHa and light chain kappa b allotypes. In vitro labeling of spleen cells from trypanosome-infected animals demonstrated that the biosynthetically labeled IgM has a mu chain of higher molecular weight than the mu chain synthesized by in vitro translation, a difference that is largely abolished when cellular glycosylation is blocked with the antibiotic tunicamycin. Enrichment for heavy chain or light chain mRNA was achieved by fractionating mRNA from trypanosome-infected animals on a sucrose gradient. cDNA clones carrying mu heavy chain sequences were produced using a 'one tube' protocol and identified by cross species hybridization and hybridization selection. Infection of rabbits with T. equiperdum followed by sucrose gradient enrichment of splenic mRNA has provided sufficient quantities of mRNA encoding mu heavy chain suitable for cDNA cloning.

Molecular cloning and tissue expression of the fatty acid-binding protein (Es-FABP) gene in female Chinese mitten crab (Eriocheir sinensis).

PubMed

Gong, Ya-Nan; Li, Wei-Wei; Sun, Jiang-Ling; Ren, Fei; He, Lin; Jiang, Hui; Wang, Qun

2010-09-16

Fatty acid-binding proteins (FABPs), small cytosolic proteins that function in the uptake and utilization of fatty acids, have been extensively studied in higher vertebrates while invertebrates have received little attention despite similar nutritional requirements during periods of reproductive activity. Therefore, a cDNA encoding Eriocheir sinensis FABP (Es-FABP) was cloned based upon EST analysis of a hepatopancreas cDNA library. The full length cDNA was 750 bp and encoded a 131 aa polypeptide that was highly homologous to related genes reported in shrimp. The 9108 bp Es-FABP gene contained four exons that were interrupted by three introns, a genomic organization common among FABP multigene family members in vertebrates. Gene expression analysis, as determined by RT-PCR, revealed the presence of Es-FABP transcripts in hepatopancreas, hemocytes, ovary, gills, muscle, thoracic ganglia, heart, and intestine, but not stomach or eyestalk. Real-time quantitative RT-PCR analysis revealed that Es-FABP expression in ovary, hemocytes, and hepatopancreas was dependent on the status of ovarian development, with peak expression observed in January. Evidence provided in the present report supports a role of Es-FABP in lipid transport during the period of rapid ovarian growth in E. sinensis, and indirectly confirms the participation of the hepatopancreas, ovary, and hemocytes in lipid nutrient absorption and utilization processes.

Molecular cloning, cellular expression and characterization of Arabian camel (Camelus dromedarius) endoplasmin.

PubMed

Hoter, Abdullah; Amiri, Mahdi; Warda, Mohamad; Naim, Hassan Y

2018-05-27

Endoplasmin, or GRP94, is an ER-located stress inducible molecular chaperone implicated in the folding and assembly of many proteins. The Arabian one-humped camel lives in an environment of thermal stress, nevertheless is able to encounter the risk of misfolded proteins. Here, the cDNA encoding camel GRP94 was isolated by rapid amplification of cDNA ends. The isolated cDNA contained an open reading frame of 2412 bp encoding a protein of 803 amino acids with predicted molecular mass of 92.5 kDa. Nucleotide and protein BLAST analysis of cGRP94 revealed strong conservation between camel and other domestic mammals. Overexpression of cGRP94 in COS-1 cells revealed multiple isoforms including one N-glycosylated species. Immunofluorescence colocalized cGRP94 with the ER resident protein calnexin. Interestingly, none of the cGRP94 isoforms expressed in CHO cells was N-glycosylated, presumably due to folding determinants that mask the N-glycosylation sites as proposed by in silico modelling. Surprisingly, isoforms of cGRP94 were detected in the culture media of transfected cells indicating that the protein, although an ER resident, also is trafficked and secreted into the exterior milieu. The overall striking structural homologies of GRP94s among mammalian reflects their pivotal role in the ER quality control and protein homeostasis. Copyright © 2017. Published by Elsevier B.V.

Yeast two-hybrid cloning of a novel zinc finger protein that interacts with the multifunctional transcription factor YY1.

PubMed Central

Kalenik, J L; Chen, D; Bradley, M E; Chen, S J; Lee, T C

1997-01-01

Muscle-restricted transcription of sarcomeric actin genes is negatively controlled by the zinc finger protein YY1, which is down-regulated at the protein level during myogenic differentiation. To identify cellular proteins that might mediate the function/stability of YY1 in muscle cells, we screened an adult human muscle cDNA library using the yeast two-hybrid cloning system. We report the isolation and characterization of a novel protein termed YAF2 (YY1- associated factor 2) that interacts with YY1. The YAF2 cDNA encodes a 180 amino acid basic protein (pI 10.5) containing a single N-terminal C2-X10-C2 zinc finger. Lysine clusters are present that may function as a nuclear localization signal. Domain mapping analysis shows that the first and second zinc fingers of YY1 are targeted for YAF2 protein interaction. In contrast to the down-regulation of YY1, YAF2 message levels increase during in vitro differentiation of both rat skeletal and cardiac muscle cells. YAF2 appears to have a promyogenic regulatory role, since overexpression of YAF2 in C2 myoblasts stimulates myogenic promoter activity normally restricted by YY1. Co-transfection of YY1 reverses the stimulatory effect of YAF2. YAF2 also greatly potentiates proteolytic cleavage of YY1 by the calcium- activated protease m-calpain. The isolation of YAF2 may help in understanding the mechanisms through which inhibitors of myogenic transcription may be antagonized or eliminated by proteolysis during muscle development. PMID:9016636

Conservation of the sequence of the Alzheimer's disease amyloid peptide in dog, polar bear and five other mammals by cross-species polymerase chain reaction analysis.

PubMed

Johnstone, E M; Chaney, M O; Norris, F H; Pascual, R; Little, S P

1991-07-01

Neuritic plaque and cerebrovascular amyloid deposits have been detected in the aged monkey, dog, and polar bear and have rarely been found in aged rodents (Biochem. Biophy. Res. Commun., 12 (1984) 885-890; Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 4245-4249). To determine if the primary structure of the 42-43 residue amyloid peptide is conserved in species that accumulate plaques, the region of the amyloid precursor protein (APP) cDNA that encodes the peptide region was amplified by the polymerase chain reaction and sequenced. The deduced amino acid sequence was compared to those species where amyloid accumulation has not been detected. The DNA sequences of dog, polar bear, rabbit, cow, sheep, pig and guinea pig were compared and a phylogenetic tree was generated. We conclude that the amino acid sequence of dog and polar bear and other mammals which may form amyloid plaques is conserved and the species where amyloid has not been detected (mouse, rat) may be evolutionarily a distinct group. In addition, the predicted secondary structure of mouse and rat amyloid that differs from that of amyloid bearing species is its lack of propensity to form a beta sheeted structure. Thus, a cross-species examination of the amyloid peptide may suggest what is essential for amyloid deposition.

Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs

PubMed Central

Oduru, Sreedhar; Campbell, Janee L; Karri, SriTulasi; Hendry, William J; Khan, Shafiq A; Williams, Simon C

2003-01-01

Background Complete genome annotation will likely be achieved through a combination of computer-based analysis of available genome sequences combined with direct experimental characterization of expressed regions of individual genomes. We have utilized a comparative genomics approach involving the sequencing of randomly selected hamster testis cDNAs to begin to identify genes not previously annotated on the human, mouse, rat and Fugu (pufferfish) genomes. Results 735 distinct sequences were analyzed for their relatedness to known sequences in public databases. Eight of these sequences were derived from previously unidentified genes and expression of these genes in testis was confirmed by Northern blotting. The genomic locations of each sequence were mapped in human, mouse, rat and pufferfish, where applicable, and the structure of their cognate genes was derived using computer-based predictions, genomic comparisons and analysis of uncharacterized cDNA sequences from human and macaque. Conclusion The use of a comparative genomics approach resulted in the identification of eight cDNAs that correspond to previously uncharacterized genes in the human genome. The proteins encoded by these genes included a new member of the kinesin superfamily, a SET/MYND-domain protein, and six proteins for which no specific function could be predicted. Each gene was expressed primarily in testis, suggesting that they may play roles in the development and/or function of testicular cells. PMID:12783626

Characterization of a cis-Golgi matrix protein, GM130

PubMed Central

1995-01-01

Antisera raised to a detergent- and salt-resistant matrix fraction from rat liver Golgi stacks were used to screen an expression library from rat liver cDNA. A full-length clone was obtained encoding a protein of 130 kD (termed GM130), the COOH-terminal domain of which was highly homologous to a Golgi human auto-antigen, golgin-95 (Fritzler et al., 1993). Biochemical data showed that GM130 is a peripheral cytoplasmic protein that is tightly bound to Golgi membranes and part of a larger oligomeric complex. Predictions from the protein sequence suggest that GM130 is an extended rod-like protein with coiled-coil domains. Immunofluorescence microscopy showed partial overlap with medial- and trans-Golgi markers but almost complete overlap with the cis-Golgi network (CGN) marker, syntaxin5. Immunoelectron microscopy confirmed this location showing that most of the GM130 was located in the CGN and in one or two cisternae on the cis-side of the Golgi stack. GM130 was not re-distributed to the ER in the presence of brefeldin A but maintained its overlap with syntaxin5 and a partial overlap with the ER- Golgi intermediate compartment marker, p53. Together these results suggest that GM130 is part of a cis-Golgi matrix and has a role in maintaining cis-Golgi structure. PMID:8557739

cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

PubMed

Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

2005-01-01

SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

A tick B-cell inhibitory protein from salivary glands of the hard tick, Hyalomma asiaticum asiaticum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu Da; Department of Life Science and Technology, Changshu Institute of Technology, Changshu 215500; Liang Jiangguo

2006-05-05

Some studies done to date suggest that B-cell inhibitory factor occurred in tick saliva. In this study, a novel protein having B-cell inhibitory activity was purified and characterized from the salivary glands of the hard tick, Hyalomma asiaticum asiaticum. This protein was named B-cell inhibitory factor (BIF). The cDNA encoding BIF was cloned by cDNA library screening. The predicted protein from the cDNA sequence is composed of 138 amino acids including the mature BIF. No similarity was found by Blast search. The lipopolysaccharide-induced B-cell proliferation was inhibited by BIF. This is First report of the identification and characterization of B-cellmore » inhibitory protein from tick. The current study facilitates the study of identifying the interaction among tick, Borrelia burgdorferi, the causative agent of Lyme disease, and host.« less

Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

PubMed

Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

2006-10-01

Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

PubMed

Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

2004-03-01

The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses.

PubMed

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources.

Identification of Human N-Myristoylated Proteins from Human Complementary DNA Resources by Cell-Free and Cellular Metabolic Labeling Analyses

PubMed Central

Takamitsu, Emi; Otsuka, Motoaki; Haebara, Tatsuki; Yano, Manami; Matsuzaki, Kanako; Kobuchi, Hirotsugu; Moriya, Koko; Utsumi, Toshihiko

2015-01-01

To identify physiologically important human N-myristoylated proteins, 90 cDNA clones predicted to encode human N-myristoylated proteins were selected from a human cDNA resource (4,369 Kazusa ORFeome project human cDNA clones) by two bioinformatic N-myristoylation prediction systems, NMT-The MYR Predictor and Myristoylator. After database searches to exclude known human N-myristoylated proteins, 37 cDNA clones were selected as potential human N-myristoylated proteins. The susceptibility of these cDNA clones to protein N-myristoylation was first evaluated using fusion proteins in which the N-terminal ten amino acid residues were fused to an epitope-tagged model protein. Then, protein N-myristoylation of the gene products of full-length cDNAs was evaluated by metabolic labeling experiments both in an insect cell-free protein synthesis system and in transfected human cells. As a result, the products of 13 cDNA clones (FBXL7, PPM1B, SAMM50, PLEKHN, AIFM3, C22orf42, STK32A, FAM131C, DRICH1, MCC1, HID1, P2RX5, STK32B) were found to be human N-myristoylated proteins. Analysis of the role of protein N-myristoylation on the intracellular localization of SAMM50, a mitochondrial outer membrane protein, revealed that protein N-myristoylation was required for proper targeting of SAMM50 to mitochondria. Thus, the strategy used in this study is useful for the identification of physiologically important human N-myristoylated proteins from human cDNA resources. PMID:26308446

Purification of a Jojoba Embryo Fatty Acyl-Coenzyme A Reductase and Expression of Its cDNA in High Erucic Acid Rapeseed

PubMed Central

Metz, James G.; Pollard, Michael R.; Anderson, Lana; Hayes, Thomas R.; Lassner, Michael W.

2000-01-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes. PMID:10712526

Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed.

PubMed

Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W

2000-03-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.

Tagging potato leafroll virus with the jellyfish green fluorescent protein gene.

PubMed

Nurkiyanova, K M; Ryabov, E V; Commandeur, U; Duncan, G H; Canto, T; Gray, S M; Mayo, M A; Taliansky, M E

2000-03-01

A full-length cDNA corresponding to the RNA genome of Potato leafroll virus (PLRV) was modified by inserting cDNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene near its 3' end. Nicotiana benthamiana protoplasts electroporated with plasmid DNA containing this cDNA behind the 35S RNA promoter of Cauliflower mosaic virus became infected with the recombinant virus (PLRV-GFP). Up to 5% of transfected protoplasts showed GFP-specific fluorescence. Progeny virus particles were morphologically indistinguishable from those of wild-type PLRV but, unlike PLRV particles, they bound to grids coated with antibodies to GFP. Aphids fed on extracts of these protoplasts transmitted PLRV-GFP to test plants, as shown by specific fluorescence in some vascular tissue and epidermal cells and subsequent systemic infection. In plants agroinfected with PLRV-GFP cDNA in pBIN19, some cells became fluorescent and systemic infections developed. However, after either type of inoculation, fluorescence was mostly restricted to single cells and the only PLRV genome detected in systemically infected tissues lacked some or all of the inserted GFP cDNA, apparently because of naturally occurring deletions. Thus, intact PLRV-GFP was unable to move from cell to cell. Nevertheless, PLRV-GFP has novel potential for exploring the initial stages of PLRV infection.

Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

NASA Astrophysics Data System (ADS)

Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

2017-11-01

CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective animal model of human disease.

A pituitary gene encodes a protein that produces differentiation of breast and prostate cancer cells.

PubMed

Platica, Micsunica; Ivan, Elena; Holland, James F; Ionescu, Alin; Chen, Sheryl; Mandeli, John; Unger, Pamela D; Platica, Ovidiu

2004-02-10

A cDNA clone of 1.1 kb encoding a 108-aa polypeptide was isolated from a human pituitary cDNA library by expression cloning. This protein was named tumor differentiation factor (TDF). The recombinant TDF protein and a 20-aa peptide, P1, selected from the ORF of the gene, induced morphological and biochemical changes consistent with differentiation of human breast and prostate cancer cells. Fibroblast, kidney, hepatoma, and leukemic lymphocytic cell lines were unaffected. Breast and prostate cancer cells aggregated in spheroid-like structures within 24 h of exposure to TDF. This effect was abrogated by a specific affinity-purified rabbit polyclonal anti-P1 Ab. E-cadherin expression was increased in a dose-dependent manner by TDF. Treatment of MCF7 cells with TDF led to production of a lactalbumin-related protein. Peptide P1 significantly decreased the growth of androgen-independent DU145 prostate cancer in severe combined immunodeficient mice. The presence of TDF protein in human sera was detected by the anti-P1 Ab, suggesting a role of TDF in endocrine metabolism. The fact that all activities of TDF can be mimicked by a peptide derived from the encoding TDF sequence opens the possibility of therapeutic applications.

Subcellular distribution of serine acetyltransferase from Pisum sativum and characterization of an Arabidopsis thaliana putative cytosolic isoform.

PubMed

Ruffet, M L; Lebrun, M; Droux, M; Douce, R

1995-01-15

The intracellular compartmentation of serine acetyltransferase, a key enzyme in the L-cysteine biosynthesis pathway, has been investigated in pea (Pisum sativum) leaves, by isolation of organelles and fractionation of protoplasts. Enzyme activity was mainly located in mitochondria (approximately 76% of total cellular activity). Significant activity was also identified in both the cytosol (14% of total activity) and chloroplasts (10% of total activity). Three enzyme forms were separated by anion-exchange chromatography, and each form was found to be specific for a given intracellular compartment. To obtain cDNA encoding the isoforms, functional complementation experiments were performed using an Arabidopsis thaliana expression library and an Escherichia coli mutant devoid of serine acetyltransferase activity. This strategy allowed isolation of three distinct cDNAs encoding serine acetyltransferase isoforms, as confirmed by enzyme activity measurements, genomic hybridizations, and nucleotide sequencing. The cDNA and related gene for one of the three isoforms have been characterized. The predicted amino acid sequence shows that it encodes a polypeptide of M(r) 34,330 exhibiting 41% amino acid identity with the E. coli serine acetyltransferase. Since none of the general features of transit peptides could be observed in the N-terminal region of this isoform, we assume that it is a cytosolic form.

Continuous in vitro evolution of bacteriophage RNA polymerase promoters

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Banerji, A.; Joyce, G. F.

1994-01-01

Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

PubMed

Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

2005-01-01

We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

Production of hydroxylated fatty acids in genetically modified plants

DOEpatents

Somerville, Chris; Broun, Pierre; van de Loo, Frank

2001-01-01

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants.

The alpha1-fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family.

PubMed

Galarneau, L; Paré, J F; Allard, D; Hamel, D; Levesque, L; Tugwood, J D; Green, S; Bélanger, L

1996-07-01

The alpha1-fetoprotein (AFP) gene is located between the albumin and alpha-albumin genes and is activated by transcription factor FTF (fetoprotein transcription factor), presumed to transduce early developmental signals to the albumin gene cluster. We have identified FTF as an orphan nuclear receptor of the Drosophila FTZ-F1 family. FTF recognizes the DNA sequence 5'-TCAAGGTCA-3', the canonical recognition motif for FTZ-F1 receptors. cDNA sequence homologies indicate that rat FTF is the ortholog of mouse LRH-1 and Xenopus xFF1rA. Rodent FTF is encoded by a single-copy gene, related to the gene encoding steroidogenic factor 1 (SF-1). The 5.2-kb FTF transcript is translated from several in-frame initiator codons into FTF isoforms (54 to 64 kDa) which appear to bind DNA as monomers, with no need for a specific ligand, similar KdS (approximately equal 3 x 10(-10) M), and similar transcriptional effects. FTF activates the AFP promoter without the use of an amino-terminal activation domain; carboxy-terminus-truncated FTF exerts strong dominant negative effects. In the AFP promoter, FTF recruits an accessory trans-activator which imparts glucocorticoid reactivity upon the AFP gene. FTF binding sites are found in the promoters of other liver-expressed genes, some encoding liver transcription factors; FTF, liver alpha1-antitrypsin promoter factor LFB2, and HNF-3beta promoter factor UF2-H3beta are probably the same factor. FTF is also abundantly expressed in the pancreas and may exert differentiation functions in endodermal sublineages, similar to SF-1 in steroidogenic tissues. HepG2 hepatoma cells seem to express a mutated form of FTF.

Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

PubMed

Eberwine, James; Bartfai, Tamas

2011-03-01

We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Identification of a differentially-expressed gene in fatty liver of overfeeding geese.

PubMed

Zhao, Ayong; Tang, Huachun; Lu, Sufang; He, Ruiguo

2007-09-01

In response to overfeeding, geese develop fatty liver. To understand the fattening mechanism, mRNA differential display reverse transcription PCR was used to study the gene expression differences between French Landes grey geese and Xupu white geese in conditions of overfeeding and normal feeding. One gene was found to be up-regulated in the fatty liver in both breeds, and it has a 1797 bp cDNA with 83% identity to chicken SELENBP1. The sequence analysis revealed that its open reading frame of 1413 bp encodes a protein of 471 amino acids, which contains a putative conserved domain of 56 kDa selenium binding protein with high homology to its homologues of chicken (95%), rat (86%), mouse (84%), human (86%), monkey (86%), dog (86%), and cattle (86%). The function of this protein has been briefly reviewed based on published information. In tissue expression analysis, the expression of geese SELENBP1 mRNA was found to be higher in liver or kidney than in other tested tissues. The results showed that overfeeding could increase the mRNA expression level of geese SELENBP1.

Xuhuai goat H-FABP gene clone, subcellular localization of expression products and the preparation of transgenic mice.

PubMed

Yin, Yan-hui; Li, Bi-chun; Wei, Guang-hui; Zhu, Cai-ye; Li, Wei; Zhang, Ya-ni; Du, Li-xin; Cao, Wen-guang

2012-05-01

The aim of this study was to clone the heart-type fatty acid binding protein (H-FABP) gene of Xuhuai goat, to explore it bioinformatically, and analyze the subcellular localization using enhanced green fluorescent protein (EGFP). The results showed that the coding sequence (CDS) length of Xuhuai goat H-FABP gene was 402 bp, encoding 133 amino acids (GenBank accession number AY466498.1). The H-FABP cDNA coding sequence was compared with the corresponding region of human, chicken, brown rat, cow, wild boar, donkey, and zebrafish. The similarity were 89%, 76%, 85%, 84%, 93%, 91%, 70%, respectively. For the corresponding amino acid sequences, the similarity were 90%, 79%, 88%, 97%, 95%, 94%, 72%, respectively. This study did not find the signal peptide region in the H-FABP protein; it revealed that H-FABP protein might be a nonsecreted protein. H-FABP expression was detected in vitro by reverse transcription-polymerase chain reaction (RT-PCR), and the EGFP-H-FABP fusion protein was localized to the cytoplasm. The gene could also be transiently and permanently expressed in mice.

THE ROLE OF DELTA OPIOID RECEPTORS IN THE ANXIOLYTIC ACTIONS OF BENZODIAZEPINES

PubMed Central

Primeaux, Stefany D.; Wilson, Steven P.; McDonald, Alexander J.; Mascagni, Franco; Wilson, Marlene A.

2007-01-01

The anxiolytic effects of benzodiazepines appear to involve opioid processes in the amygdala. In previous experiments, overexpression of enkephalin in the amygdala enhanced the anxiolytic actions of the benzodiazepine agonist diazepam in the elevated plus maze. The effects of systemically administered diazepam are also blocked by injections of naltrexone into the central nucleus of the amygdala. The current studies investigated the role of delta opioid receptors in the anxiety-related effects of diazepam. Three days following bilateral stereotaxic injections of viral vectors containing cDNA encoding proenkephalin or β-galactosidase (control vector), the delta opioid receptor antagonist naltrindole (10 mg/kg, s.c.) attenuated the enhanced anxiolytic effects of 1–2 mg/kg diazepam in rats overexpressing preproenkephalin in the amygdala. Despite this effect, naltrindole failed to attenuate the anxiolytic action of higher diazepam doses (3 mg/kg) in animals with normal amygdalar enkephalin expression. Similarly, the mu opioid receptor antagonist, β-funaltrexamine (20mg/kg, sc), had no effect on the anxiolytic effect of diazepam alone. These data support a role for delta opioid receptors in the opioid-enhanced anxiolytic effects of diazepam. PMID:17109943

Cloning and characterisation of cDNA sequences encoding for anti-lipopolysaccharide factors (ALFs) in Brazilian palaemonid and penaeid shrimps.

PubMed

Rosa, Rafael Diego; Stoco, Patricia Hermes; Barracco, Margherita Anna

2008-11-01

Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides found in limulids and crustaceans that have a potent and broad range of antimicrobial activity. We report here the identification and molecular characterisation of new sequences encoding for ALFs in the haemocytes of the freshwater prawn Macrobrachium olfersi and also in two Brazilian penaeid species, Farfantepenaeus paulensis and Litopenaeus schmitti. All obtained sequences encoded for highly cationic peptides containing two conserved cysteine residues flanking a putative LPS-binding domain. They exhibited a significant amino acid similarity with crustacean and limulid ALF sequences, especially with those of penaeid shrimps. This is the first identification of ALF in a freshwater prawn.

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

Beta-ketoacyl-acyl carrier protein synthase III from pea (Pisum sativum L.): properties, inhibition by a novel thiolactomycin analogue and isolation of a cDNA clone encoding the enzyme.

PubMed

Jones, A Lesley; Gane, Andy M; Herbert, Derek; Willey, David L; Rutter, Andrew J; Kille, Peter; Dancer, Jane E; Harwood, John L

2003-03-01

A beta-ketoacyl-acyl carrier protein (ACP) synthase III (KAS III; short-chain condensing enzyme) has been partly purified from pea leaves. The enzyme, which had acetyl-CoA:ACP acyltransferase (ACAT) activity, was resolved from a second, specific, ACAT protein. The KAS III enzyme had a derived molecular mass of 42 kDa (from its cDNA sequence) and operated as a dimer. Its enzymological characteristics were similar to those of two other plant KAS III enzymes except for its inhibition by thiolactomycin. A derivative of thiolactomycin containing a longer (C8 saturated) hydrophobic side-chain (compound 332) was a more effective inhibitor of pea KAS III and showed competitive inhibition towards malonyl-ACP whereas thiolactomycin showed uncompetitive characteristics at high concentrations. This difference may be due to the better fit of compound 332 into a hydrophobic pocket at the active site. A full-length cDNA for the pea KAS III was isolated. This was expressed in Escherichia coli as a fusion protein with glutathione S-transferase in order to facilitate subsequent purification. Demonstrated activity in preparations from E. coli confirmed that the cDNA encoded a KAS III enzyme. Furthermore, the expressed KAS III had ACAT activity, showing that the latter was inherent. The derived amino acid sequence of the pea cDNA showed 81-87% similarity to that for other plant dicotyledon KAS IIIs, somewhat less for Allium porrum (leek, 71%) and for Porphyra spp. (62%), Synechocystis spp. (65%) and various bacteria (42-65%). The pea KAS III exhibited four areas of homology, three of which were around the active-site Cys(123), His(323) and Asn(353). In addition, a stretch of 23 amino acids (residues 207-229 in the pea KAS III) was almost completely conserved in the plant KAS IIIs. Modelling this stretch showed they belonged to a peptide fragment that fitted over the active site and contained segments suggested to be involved in substrate binding and in conformational changes during catalysis, as well as an arginine suggested to participate in the acid-base catalytic mechanism.

Chicken immunoglobulin gamma-heavy chains: limited VH gene repertoire, combinatorial diversification by D gene segments and evolution of the heavy chain locus.

PubMed

Parvari, R; Avivi, A; Lentner, F; Ziv, E; Tel-Or, S; Burstein, Y; Schechter, I

1988-03-01

cDNA clones encoding the variable and constant regions of chicken immunoglobulin (Ig) gamma-chains were obtained from spleen cDNA libraries. Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross-hybridizing VH genes of one subgroup. Since the VH clones were randomly selected, it is likely that the bulk of chicken H-chains are encoded by a single VH subgroup. Nucleotide sequence determinations of two cDNA clones reveal VH, D, JH and the constant region. The VH segments are closely related to each other (83% homology) as expected for VH or the same subgroup. The JHs are 15 residues long and differ by one amino acid. The Ds differ markedly in sequence (20% homology) and size (10 and 20 residues). These findings strongly indicate multiple (at least two) D genes which by a combinatorial joining mechanism diversify the H-chains, a mechanism which is not operative in the chicken L-chain locus. The most notable among the chicken Igs is the so-called 7S IgG because its H-chain differs in many important aspects from any mammalian IgG. The sequence of the C gamma cDNA reported here resolves this issue. The chicken C gamma is 426 residues long with four CH domains (unlike mammalian C gamma which has three CH domains) and it shows 25% homology to the chicken C mu. The chicken C gamma is most related to the mammalian C epsilon in length, the presence of four CH domains and the distribution of cysteines in the CH1 and CH2 domains. We propose that the unique chicken C gamma is the ancestor of the mammalian C epsilon and C gamma subclasses, and discuss the evolution of the H-chain locus from that of chicken with presumably three genes (mu, gamma, alpha) to the mammalian loci with 8-10 H-chain genes.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

Differential expression of copper-zinc superoxide dismutase gene of Polygonum sibiricum leaves, stems and underground stems, subjected to high-salt stress.

PubMed

Qu, Chun-Pu; Xu, Zhi-Ru; Liu, Guan-Jun; Liu, Chun; Li, Yang; Wei, Zhi-Gang; Liu, Gui-Feng

2010-01-01

In aerobic organisms, protection against oxidative damage involves the combined action of highly specialized antioxidant enzymes, such as copper-zinc superoxide dismutase. In this work, a cDNA clone which encodes a copper-zinc superoxide dismutase gene, named PS-CuZnSOD, has been identified from P. sibiricum Laxm. by the rapid amplification of cDNA ends method (RACE). Analysis of the nucleotide sequence reveals that the PS-CuZnSOD gene cDNA clone consists of 669 bp, containing 87 bp in the 5' untranslated region; 459 bp in the open reading frame (ORF) encoding 152 amino acids; and 123 bp in 3' untranslated region. The gene accession nucleotide sequence number in GenBank is GQ472846. Sequence analysis indicates that the protein, like most plant superoxide dismutases (SOD), includes two conserved ecCuZnSOD signatures that are from the amino acids 43 to 51, and from the amino acids 137 to 148, and it has a signal peptide extension in the front of the N-terminus (1-16 aa). Expression analysis by real-time quantitative PCR reveals that the PS-CuZnSOD gene is expressed in leaves, stems and underground stems. PS-CuZnSOD gene expression can be induced by 3% NaHCO(3). The different mRNA levels' expression of PS-CuZnSOD show the gene's different expression modes in leaves, stems and underground stems under the salinity-alkalinity stress.

Cloning of the cDNA encoding adenosine 5'-monophosphate deaminase 1 and its mRNA expression in Japanese flounder Paralichthys olivaceus

NASA Astrophysics Data System (ADS)

Jiang, Keyong; Sun, Shujuan; Liu, Mei; Wang, Baojie; Meng, Xiaolin; Wang, Lei

2013-01-01

AMP deaminase catalyzes the conversion of AMP into IMP and ammonia. In the present study, a full-length cDNA of AMPD1 from skeletal muscle of Japanese flounder Paralichthys olivaceus was cloned and characterized. The 2 526 bp cDNA contains a 5'-UTR of 78 bp, a 3'-UTR of 237 bp and an open reading frame (ORF) of 2 211 bp, which encodes a protein of 736 amino acids. The predicted protein contains a highly conserved AMP deaminase motif (SLSTDDP) and an ATP-binding site sequence (EPLMEEYAIAAQVFK). Phylogenetic analysis showed that the AMPD1 and AMPD3 genes originate from the same branch, but are evolutionarily distant from the AMPD2 gene. RT-PCR showed that the flounder AMPD1 gene was expressed only in skeletal muscle. QRT-PCR analysis revealed a statistically significant 2.54 fold higher level of AMPD1 mRNA in adult muscle (750±40 g) compared with juvenile muscle (7.5±2 g) ( P<0.05). HPLC analysis showed that the IMP content in adult muscle (3.35±0.21 mg/g) was also statistically significantly higher than in juvenile muscle (1.08±0.04 mg/g) ( P<0.05). There is a direct relationship between the AMPD1 gene expression level and IMP content in the skeletal muscle of juvenile and adult flounders. These results may provide useful information for quality improvement and molecular breeding of aquatic animals.

Molecular cloning and functional characterization of a glucose transporter (CsGLUT) in Clonorchis sinensis.

PubMed

Ahn, Seong Kyu; Cho, Pyo Yun; Na, Byoung-Kuk; Hong, Sung-Jong; Nam, Ho-Woo; Sohn, Woon-Mok; Ardelli, Bernadette F; Park, Yun-Kyu; Kim, Tong-Soo; Cha, Seok Ho

2016-01-01

A complementary DNA (cDNA) encoding a glucose transporter of Clonorchis sinensis (CsGLUT) was isolated from the adult C. sinensis cDNA library. The open reading frame of CsGLUT cDNA consists of 1653 base pairs that encode a 550-amino acid residue protein. Hydropathy analysis suggested that CsGLUT possess 12 putative membrane-spanning domains. The Northern blot analysis result using poly(A)(+)RNA showed a strong band at ~2.1 kb for CsGLUT. When expressed in Xenopus oocytes, CsGLUT mediated the transport of radiolabeled deoxy-D-glucose in a time-dependent but sodium-independent manner. Concentration-dependency results showed saturable kinetics and followed the Michaelis-Menten equation. Nonlinear regression analyses yielded a Km value of 588.5 ± 53.0 μM and a Vmax value of 1500.0 ± 67.5 pmol/oocyte/30 min for [1,2-(3)H]2-deoxy-D-glucose. No trans-uptakes of bile acid (taurocholic acid), amino acids (tryptophan and arginine), or p-aminohippuric acid were observed. CsGLUT-mediated transport of deoxyglucose was significantly and concentration-dependently inhibited by radio-unlabeled deoxyglucose and D-glucose. 3-O-Methylglucose at 10 and 100 μM inhibited deoxyglucose uptake by ~50 % without concentration dependence. No inhibitory effects by galactose, mannose, and fructose were observed. This work may contribute to the molecular biological study of carbohydrate metabolism and new drug development of C. sinensis.

Positive selection and propeptide repeats promote rapid interspecific divergence of a gastropod sperm protein.

PubMed

Hellberg, M E; Moy, G W; Vacquier, V D

2000-03-01

Male-specific proteins have increasingly been reported as targets of positive selection and are of special interest because of the role they may play in the evolution of reproductive isolation. We report the rapid interspecific divergence of cDNA encoding a major acrosomal protein of unknown function (TMAP) of sperm from five species of teguline gastropods. A mitochondrial DNA clock (calibrated by congeneric species divided by the Isthmus of Panama) estimates that these five species diverged 2-10 MYA. Inferred amino acid sequences reveal a propeptide that has diverged rapidly between species. The mature protein has diverged faster still due to high nonsynonymous substitution rates (> 25 nonsynonymous substitutions per site per 10(9) years). cDNA encoding the mature protein (89-100 residues) shows evidence of positive selection (Dn/Ds > 1) for 4 of 10 pairwise species comparisons. cDNA and predicted secondary-structure comparisons suggest that TMAP is neither orthologous nor paralogous to abalone lysin, and thus marks a second, phylogenetically independent, protein subject to strong positive selection in free-spawning marine gastropods. In addition, an internal repeat in one species (Tegula aureotincta) produces a duplicated cleavage site which results in two alternatively processed mature proteins differing by nine amino acid residues. Such alternative processing may provide a mechanism for introducing novel amino acid sequence variation at the amino-termini of proteins. Highly divergent TMAP N-termini from two other tegulines (Tegula regina and Norrisia norrisii) may have originated by such a mechanism.

IDENTIFICATION AND CHARACTERIZATION OF CDNA ENCODING CYTOCHROME P450 3A FROM THE FRESH WATER TELEOST MEDAKA (ORYZIAS LATIPES). (R825298)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Rhipicephalus (Boophilus) microplus aquaporin as an effective vaccine antigen to protect against cattle tick infestations

USDA-ARS?s Scientific Manuscript database

A cDNA encoding an aquaporin from the cattle tick, Rhipicephalus microplus, was isolated from transcriptomic studies. Bioinformatic analysis indicates this aquaporin, designated RmAQP1, shows greatest amino acid similarity to the human aquaporin 7 family. Members of this family of water-conducting c...

A NOVEL CADHERIN-LIKE GENE FROM WESTERN CORN ROOTWORM, DIABROTICA VIRGIFERA VIRGIFERA (COLEOPTERA: CHRYSOMELIDAE), LARVAL MIDGUT TISSUE

EPA Science Inventory

A cadherin-like gene and its mRNA were cloned from western corn rootworm (Diabrotica virgifera virgifera: Coleoptera), an economically important agricultural pest in North America and Europe. The full length cDNA (5371 bp in length) encodes an open reading frame for a 1688 amino ...

Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

USDA-ARS?s Scientific Manuscript database

We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

PubMed

Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

1996-08-01

The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

Cloning and characterization of two novel zebrafish P2X receptor subunits.

PubMed

Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M

2002-07-26

In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.

A novel extracellular matrix protein from tomato associated with lignified secondary cell walls.

PubMed Central

Domingo, C; Gómez, M D; Cañas, L; Hernández-Yago, J; Conejero, V; Vera, P

1994-01-01

A cDNA clone representing a novel cell wall protein was isolated from a tomato cDNA library. The deduced amino acid sequence shows that the encoded protein is very small (88 amino acids), contains an N-terminal hydrophobic signal peptide, and is enriched in lysine and tyrosine. We have designated this protein TLRP for tyrosine- and lysine-rich protein. RNA gel blot hybridization identified TLRP transcripts constitutively present in roots, stems, and leaves from tomato plants. The encoded protein seems to be highly insolubilized in the cell wall, and we present evidence that this protein is specifically localized in the modified secondary cell walls of the xylem and in cells of the sclerenchyma. In addition, the protein is localized in the protective periderm layer of the growing root. The highly localized deposition in cells destined to give support and protection to the plant indicates that this cell wall protein alone and/or in collaboration with other cell wall structural proteins may have a specialized structural function by mechanically strengthening the walls. PMID:7919979

Expression of mRNAs encoding ARPP-16/19, ARPP-21, and DARPP-32 in human brain tissue.

PubMed

Brené, S; Lindefors, N; Ehrlich, M; Taubes, T; Horiuchi, A; Kopp, J; Hall, H; Sedvall, G; Greengard, P; Persson, H

1994-03-01

In this study we have isolated and sequenced human cDNAs for the phosphoproteins DARPP-32, ARPP-21, and ARPP-16/19, and have compared these sequences to previously characterized bovine and rat cDNAs. In situ hybridization and Northern blot analysis with the human cDNA probes were used to study the expression of mRNAs encoding ARPP-16/19, ARPP-21, and DARPP-32 in human postmortem brain tissue. In situ hybridization was performed using horizontal whole hemisphere sections. Five representative levels of the brain ranging from 71 mm to 104 mm ventral to vertex were examined. All three probes showed distinct hybridization patterns in the caudate nucleus, putamen, nucleus accumbens, and the amygdaloid complex. For ARPP-16/19 mRNA, a hybridization signal comparable to the signal in caudate nucleus, putamen, and nucleus accumbens was also detected in the neocortex. ARPP-21 and DARPP-32 mRNA, on the other hand, were present in lower levels in neocortical regions. DARPP-32 mRNA was abundant in the cerebellar cortex at the level of the Purkinje cell layer. High levels of ARPP-16/19 and ARPP-21 mRNA were also found in the cerebellar cortex, where they were confined to deeper layers. The present result demonstrate that mRNAs for the three phosphoproteins are expressed in overlapping, but also distinct, areas of the human brain that in many cases coincide with previously described distribution of the dopamine D1 receptor.

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

LIFEdb: a database for functional genomics experiments integrating information from external sources, and serving as a sample tracking system

PubMed Central

Bannasch, Detlev; Mehrle, Alexander; Glatting, Karl-Heinz; Pepperkok, Rainer; Poustka, Annemarie; Wiemann, Stefan

2004-01-01

We have implemented LIFEdb (http://www.dkfz.de/LIFEdb) to link information regarding novel human full-length cDNAs generated and sequenced by the German cDNA Consortium with functional information on the encoded proteins produced in functional genomics and proteomics approaches. The database also serves as a sample-tracking system to manage the process from cDNA to experimental read-out and data interpretation. A web interface enables the scientific community to explore and visualize features of the annotated cDNAs and ORFs combined with experimental results, and thus helps to unravel new features of proteins with as yet unknown functions. PMID:14681468

Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

PubMed Central

Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

1992-01-01

cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

Glutamate-dependent ectodomain shedding of neuregulin-1 type II precursors in rat forebrain neurons.

PubMed

Iwakura, Yuriko; Wang, Ran; Inamura, Naoko; Araki, Kazuaki; Higashiyama, Shigeki; Takei, Nobuyuki; Nawa, Hiroyuki

2017-01-01

The neurotrophic factor neuregulin 1 (NRG1) regulates neuronal development, glial differentiation, and excitatory synapse maturation. NRG1 is synthesized as a membrane-anchored precursor and is then liberated by proteolytic processing or exocytosis. Mature NRG1 then binds to its receptors expressed by neighboring neurons or glial cells. However, the molecular mechanisms that govern this process in the nervous system are not defined in detail. Here we prepared neuron-enriched and glia-enriched cultures from embryonic rat neocortex to investigate the role of neurotransmitters that regulate the liberation/release of NRG1 from the membrane of neurons or glial cells. Using a two-site enzyme immunoassay to detect soluble NRG1, we show that, of various neurotransmitters, glutamate was the most potent inducer of NRG1 release in neuron-enriched cultures. NRG1 release in glia-enriched cultures was relatively limited. Furthermore, among glutamate receptor agonists, N-Methyl-D-Aspartate (NMDA) and kainate (KA), but not AMPA or tACPD, mimicked the effects of glutamate. Similar findings were acquired from analysis of the hippocampus of rats with KA-induced seizures. To evaluate the contribution of members of a disintegrin and metalloproteinase (ADAM) families to NRG1 release, we transfected primary cultures of neurons with cDNA vectors encoding NRG1 types I, II, or III precursors, each tagged with the alkaline phosphatase reporter. Analysis of alkaline phosphatase activity revealed that the NRG1 type II precursor was subjected to tumor necrosis factor-α-converting enzyme (TACE) / a Disintegrin And Metalloproteinase 17 (ADAM17) -dependent ectodomain shedding in a protein kinase C-dependent manner. These results suggest that glutamatergic neurotransmission positively regulates the ectodomain shedding of NRG1 type II precursors and liberates the active NRG1 domain in an activity-dependent manner.

An analysis of two open reading frames (ORF3 and ORF4) of rat hepatitis E virus genome using its infectious cDNA clones with mutations in ORF3 or ORF4.

PubMed

Tanggis; Kobayashi, Tominari; Takahashi, Masaharu; Jirintai, Suljid; Nishizawa, Tsutomu; Nagashima, Shigeo; Nishiyama, Takashi; Kunita, Satoshi; Hayama, Emiko; Tanaka, Takeshi; Mulyanto; Okamoto, Hiroaki

2018-04-02

Rat hepatitis E virus (ratHEV) genome has four open reading frames (ORFs: ORF1, ORF2, ORF3 and ORF4). The functions of ORF3 and ORF4 are unknown. An infectious cDNA clone (pUC-ratELOMB-131L_wt, wt) and its derivatives including ORF3-defective (ΔORF3) and ORF4-defective (ΔORF4) mutants, were constructed and their full-length RNA transcripts transfected into PLC/PRF/5 cells. ΔORF3 replicated as efficiently as wt in cells. However, ≤1/1000 of the number of progenies were detectable in the culture supernatant of ΔORF3-infected cells compared with wt-infected cells. ORF4 protein was not detectable in ratHEV-infected cells or in the liver tissues of ratHEV-infected rats. No marked differences were noted between wt and ΔORF4 regarding the viral replication and protein expression. ORF3 mutants with proline-to-leucine mutations at amino acids (aa) 93, 96 and/or 98 in ORF3 were constructed and transfected into PLC/PRF/5 cells. Wt and an ORF3 mutant with leucine at aa 98 (ORF3-L98) replicated efficiently (density 1.15-1.16 g/cm 3 ), while ORF3-L93 + L96 exhibited a decreased viral release and banded at 1.26-1.27 g/cm 3 , similar to ΔORF3. In conclusion, the ORF3 protein, especially its proline residues at aa 93 and 96, is essential for the release of membrane-associated ratHEV particles, and ORF4 is unnecessary for the replication of ratHEV. Copyright © 2018 Elsevier B.V. All rights reserved.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

PubMed

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Identification of a melanosomal membrane protein encoded by the pink-eyed dilution (type II oculocutaneous albinism) gene.

PubMed Central

Rosemblat, S; Durham-Pierre, D; Gardner, J M; Nakatsu, Y; Brilliant, M H; Orlow, S J

1994-01-01

The pink-eyed dilution (p) locus in the mouse is critical to melanogenesis; mutations in the homologous locus in humans, P, are a cause of type II oculocutaneous albinism. Although a cDNA encoded by the p gene has recently been identified, nothing is known about the protein product of this gene. To characterize the protein encoded by the p gene, we performed immunoblot analysis of extracts of melanocytes cultured from wild-type mice with an antiserum from rabbits immunized with a peptide corresponding to amino acids 285-298 of the predicted protein product of the murine p gene. This antiserum recognized a 110-kDa protein. The protein was absent from extracts of melanocytes cultured from mice with two mutations (pcp and p) in which transcripts of the p gene are absent or greatly reduced. Introduction of the cDNA for the p gene into pcp melanocytes by electroporation resulted in expression of the 3.3-kb mRNA and the 110-kDa protein. Upon subcellular fractionation of cultured melanocytes, the 110-kDa protein was found to be present in melanosomes but absent from the vesicular fraction; phase separation performed with the nonionic detergent Triton X-114 confirmed the predicted hydrophobic nature of the protein. These results demonstrate that the p gene encodes a 110-kDa integral melanosomal membrane protein and establish a framework by which mutations at this locus, which diminish pigmentation, can be analyzed at the cellular and biochemical levels. Images PMID:7991586

Analysis of expressed sequence tags from the four main developmental stages of Trypanosoma congolense

PubMed Central

Helm, Jared R.; Hertz-Fowler, Christiane; Aslett, Martin; Berriman, Matthew; Sanders, Mandy; Quail, Michael A.; Soares, Marcelo B.; Bonaldo, Maria F.; Sakurai, Tatsuya; Inoue, Noboru; Donelson, John E.

2009-01-01

Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and twenty-six VSG EST clusters were found in the bloodstream library, six of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the T. brucei and T. cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. PMID:19559733

Molecular characterization and phylogenetic analysis of a yak (Bos grunniens) κ-casein cDNA from lactating mammary gland.

PubMed

Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H

2011-04-01

κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.

Expression of calmodulin mRNA in rat olfactory neuroepithelium.

PubMed

Biffo, S; Goren, T; Khew-Goodall, Y S; Miara, J; Margolis, F L

1991-04-01

A calmodulin (CaM) cDNA was isolated by differential hybridization screening of a lambda gt10 library prepared from rat olfactory mucosa. This cDNA fragment, containing most of the open reading frame of the rat CaMI gene, was subcloned and used to characterize steady-state expression of CaM mRNA in rat olfactory neuroepithelium and bulb. Within the bulb mitral cells are the primary neuronal population expressing CaM mRNA. The major CaM mRNA expressed in the olfactory mucosa is 1.7 kb with smaller contributions from mRNAs of 4.0 and 1.4 kb. CaM mRNA was primarily associated with the olfactory neurons and, despite the cellular complexity of the tissue and the known involvement of CaM in diverse cellular processes, was only minimally evident in sustentacular cells, gland cells or respiratory epithelium. Following bulbectomy CaM mRNA declines in the olfactory neuroepithelium as does olfactory marker protein (OMP) mRNA. In contrast to the latter, CaM mRNA makes a partial recovery by one month after surgery. These results, coupled with those from in situ hybridization, indicate that CaM mRNA is expressed in both mature and immature olfactory neurons. The program regulating CaM gene expression in olfactory neurons is distinct from those controlling expression of B50/GAP43 in immature, or OMP in mature, neurons respectively.

Expression cloning and chromosomal mapping of the leukocyte activation antigen CD97, a new seven-span transmembrane molecule of the secretin receptor superfamily with an unusual extracellular domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamann, J.; Hamann, D.; Lier, R.A.W.

1995-08-15

CD97 is a monomeric glycoprotein of 75 to 85 kDa that is induced rapidly on the surface of most leukocytes upon activation. We herein report the isolation of a cDNA encoding human CD97 by expression cloning in COS cells. The 3-kb cDNA clone encodes a mature polypeptide chain of 722 amino acids with a predicted molecular mass of 79 kDa. Within the C-terminal part of the protein, a region with seven hydrophobic segments was identified, suggesting that CD97 is a seven-span transmembrane molecule. Sequence comparison indicates that CD97 is the first leukocyte Ag in a recently described superfamily that includesmore » the receptors for secretin, calcitonin, and other mammalian and insect peptide hormones. Different from these receptors, CD97 has an extended extracellular region of 433 amino acids that possesses three N-terminal epidermal growth factor-like domains, two of them with a calcium-binding site, and single Arg-Gly-Asp (RGD) motif. The existence of structural elements characteristic for extracellular matrix proteins in a seven-span transmembrane molecule makes CD97 a receptor potentially involved in both adhesion and signaling processes early after leukocyte activation. The gene encoding CD97 is localized on chromosome 19 (19p13.12-13.2).« less

Cloning, expression and functional role of a nociceptin/orphanin FQ receptor in the porcine gastrointestinal tract.

PubMed

Osinski, M A; Pampusch, M S; Murtaugh, M P; Brown, D R

1999-01-22

The heptadecapeptide nociceptin/orphanin FQ is the cognate ligand for the opioid receptor-like orphanin FQ (OFQ) receptor, a member of the G protein-coupled receptor superfamily. The gastrointestinal tract is a major site of opioid action, and preliminary evidence suggests that an OFQ receptor may be expressed in rat small intestine. We addressed the hypothesis that this receptor is expressed in the gastrointestinal tract of the pig, a model for the human digestive system. A 1205-bp cDNA was isolated from porcine forebrain which contained the 370 amino acid open reading frame encoding the OFQ receptor. The receptor mRNA is likely to arise from a single gene, as determined by Southern blotting of porcine genomic DNA restriction digests using a porcine OFQ receptor cDNA probe. A semi-nested reverse transcriptase-polymerase chain reaction survey of receptor mRNA indicates that it is expressed in the porcine cerebral cortex and kidney, and along the length of the gastrointestinal tract. OFQ decreased initial contractile responses of porcine ileal smooth muscle strips to trains of electrical field stimulation with an IC50 value of 1.3 nM; its effects were resistant to the opioid antagonist, naloxone. The peptide, at concentrations > or =3 nM, also attenuated Isc elevations evoked by electrical transmural stimulation of mucosa-submucosa sheets from porcine ileum. The actions of OFQ appeared to differ from those previously reported for opioid receptor agonists in these tissue preparations. These results indicate that an OFQ receptor is expressed in the porcine intestine which modulates the neural control of intestinal smooth muscle contractility and mucosal transport.

Establishment of an appropriate animal model for lacritin studies: cloning and characterization of lacritin in monkey eyes.

PubMed

Nakajima, T; Walkup, R D; Tochigi, A; Shearer, T R; Azuma, M

2007-11-01

Lacritin is a mitogen of human salivary gland cells as well as a stimulator of human corneal epithelial cells. It is expected to be an important factor in maintaining the surrounding ocular surface. The monkey would be a relevant animal model in which to study the role of lacritin in ophthalmic physiology and pathology. However, to our knowledge, no cDNA cloning or functional analysis of monkey lacritin has been performed. Thus, the purposes of this study were: (1) to clone the monkey ortholog of lacritin; (2) to characterize lacritin in tears from several species; and (3) to determine the tissues where lacritin is produced and secreted. cDNA for lacritin from rhesus macaque contained 547 bp, with 411 bp in an open reading frame (ORF) encoding a protein of 137 amino acids. Monkey lacritin showed 89% amino acid homology with human lacritin; one amino acid was deleted in all three monkey strains. The predicted MW of mature lacritin was 12.2 kDa, and the isoelectric point was 4.99. Lacritin showed anomalous migration at approximately 21.0 kDa on SDS-PAGE, as confirmed by immunoblotting and amino acid sequencing. Similar to native lacritin in monkey tears, a 21 kDa band was also detected in human tears. In contrast, no lacritin was observed at a similar position on SDS-PAGE in rat, rabbit and dog tears. In the monkey, lacritin mRNA was expressed highly in the lacrimal gland, moderately in the conjunctiva and the meibomian gland, and weakly in corneal epithelium. In primates, lacritin was produced in the lacrimal gland and secreted into tear fluid. These results suggest that lacritin might be important for the maintenance of the ocular surface in higher animals, such as monkeys and humans.

cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

PubMed

Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

2005-04-01

A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

PubMed

Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

2003-12-19

SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

Cloning and expression studies of the Dunaliella salina UDP-glucose dehydrogenase cDNA.

PubMed

Qinghua, He; Dairong, Qiao; Qinglian, Zhang; Shunji, He; Yin, Li; Linhan, Bai; Zhirong, Yang; Yi, Cao

2005-06-01

The enzyme UDP-glucose dehydrogenase (EC 1.1.1.22) converts UDP-glucose to UDP-glucuronate. Plant UDP-glucose dehydrogenase (UGDH) is an important enzyme in the formation of hemicellulose and pectin, the components of primary cell walls. A cDNA, named DsUGDH, (GeneBank accession number: AY795899) corresponding to UGDH was cloned by RT-PCR approach from Dunaliella salina. The cDNA is 1941-bp long and has an open reading frame encoded a protein of 483 amino acids with a calculated molecular weight of 53 kDa. The derived amino acids sequence shows high homology with reported plants UGDHs, and has highly conserved amino acids motifs believed to be NAD binding site and catalytic site. Although UDP-glucose dehydrogenase is a comparatively well characterized enzyme, the cloning and characterization of the green alga Dunaliella salina UDP-glucose dehydrogenase gene is very important to understand the salt tolerance mechanism of Dunaliella salina. Northern analyses indicate that NaCl can induce the expression the DsUGDH.

Purification and characterization of bovine cone arrestin (cArr).

PubMed

Maeda, T; Ohguro, H; Sohma, H; Kuroki, Y; Wada, H; Okisaka, S; Murakami, A

2000-03-31

To elucidate the quenching mechanism of phototransduction in vertebrate cone photoreceptors, a cDNA clone encoding cone specific arrestin (cArr) was isolated from a bovine retinal cDNA library using a human cArr cDNA probe. Affinity-purified anti-peptide antibody specific to cArr was prepared. Immunohistochemical staining displayed specific labeling of cArr in cone photoreceptors and immunoblotting identified a 46 kDa protein band. We purified cArr from bovine retinas by sequential column chromatography using DEAE-cellulose, gel filtration and mono Q columns. Binding studies revealed no binding of cArr to rhodopsin regardless of whether it was bleached and/or phosphorylated. cArr also failed to bind to heparin-Sepharose under conditions which rod arrestin (rArr) bound to the column. The present data suggest that cArr may play a role in the quenching of phototransduction in cone photoreceptors and that its activity therein is different to that of rArr.

ORF phage display to identify cellular proteins with different functions.

PubMed

Li, Wei

2012-09-01

Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification and heterologous expression of the cytochrome P450 oxidoreductase from the white-rot basidiomycete Coriolus versicolor.

PubMed

Ichinose, H; Wariishi, H; Tanaka, H

2002-09-01

A cDNA encoding cytochrome P450 oxidoreductase (CPR) from the lignin-degrading basidiomycete Coriolus versicolor was identified using RT-PCR. The full-length cDNA consisted of 2,484 nucleotides with a poly(A) tail, and contained an open reading frame. The G+C content of the cDNA isolated was 60%. A deduced protein contained 730 amino acid residues with a calculated molecular weight of 80.7 kDa. The conserved amino acid residues involved in functional domains such as FAD-, FMN-, and NADPH-binding domains, were all found in the deduced protein. A phylogenetic analysis demonstrated that C. versicolor CPR is significantly similar to CPR of the basidiomycete Phanerochaete chrysosporium and that they share the same major branch in the fungal cluster. A recombinant CPR protein was expressed using a pET/ Escherichia coli system. The recombinant CPR protein migrated at 81 kDa on SDS polyacrylamide gel electrophoresis. It exhibited an NADPH-dependent cytochrome c reducing activity.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

PubMed

Hargreaves, Adam D; Mulley, John F

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

PubMed Central

Hargreaves, Adam D.

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Casein expression in cytotoxic T lymphocytes.

PubMed Central

Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H

1990-01-01

A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885

A Novel Nonparametric Approach for Neural Encoding and Decoding Models of Multimodal Receptive Fields.

PubMed

Agarwal, Rahul; Chen, Zhe; Kloosterman, Fabian; Wilson, Matthew A; Sarma, Sridevi V

2016-07-01

Pyramidal neurons recorded from the rat hippocampus and entorhinal cortex, such as place and grid cells, have diverse receptive fields, which are either unimodal or multimodal. Spiking activity from these cells encodes information about the spatial position of a freely foraging rat. At fine timescales, a neuron's spike activity also depends significantly on its own spike history. However, due to limitations of current parametric modeling approaches, it remains a challenge to estimate complex, multimodal neuronal receptive fields while incorporating spike history dependence. Furthermore, efforts to decode the rat's trajectory in one- or two-dimensional space from hippocampal ensemble spiking activity have mainly focused on spike history-independent neuronal encoding models. In this letter, we address these two important issues by extending a recently introduced nonparametric neural encoding framework that allows modeling both complex spatial receptive fields and spike history dependencies. Using this extended nonparametric approach, we develop novel algorithms for decoding a rat's trajectory based on recordings of hippocampal place cells and entorhinal grid cells. Results show that both encoding and decoding models derived from our new method performed significantly better than state-of-the-art encoding and decoding models on 6 minutes of test data. In addition, our model's performance remains invariant to the apparent modality of the neuron's receptive field.

Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis.

PubMed Central

Lange, T; Hedden, P; Graebe, J E

1994-01-01

In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921

Sequence of a cDNA and expression of the gene encoding a putative epidermal chitin synthase of Manduca sexta.

PubMed

Zhu, Yu-Cheng; Specht, Charles A; Dittmer, Neal T; Muthukrishnan, Subbaratnam; Kanost, Michael R; Kramer, Karl J

2002-11-01

Glycosyltransferases are enzymes that synthesize oligosaccharides, polysaccharides and glycoconjugates. One type of glycosyltransferase is chitin synthase, a very important enzyme in biology, which is utilized by insects, fungi, and other invertebrates to produce chitin, a polysaccharide of beta-1,4-linked N-acetylglucosamine. Chitin is an important component of the insect's exoskeletal cuticle and gut lining. To identify and characterize a chitin synthase gene of the tobacco hornworm, Manduca sexta, degenerate primers were designed from two highly conserved regions in fungal and nematode chitin synthase protein sequences and then used to amplify a similar region from Manduca cDNA. A full-length cDNA of 5152 nucleotides was assembled for the putative Manduca chitin synthase gene, MsCHS1, and sequencing of genomic DNA verified the contiguity of the sequence. The MsCHS1 cDNA has an ORF of 4692 nucleotides that encodes a transmembrane protein of 1564 amino acid residues with a mass of approximately 179 kDa (GenBank no. AY062175). It is most similar, over its entire length of protein sequence, to putative chitin synthases from other insects and nematodes, with 68% identity to enzymes from both the blow fly, Lucilia cuprina, and the fruit fly, Drosophila melanogaster. The similarity with fungal chitin synthases is restricted to the putative catalytic domain, and the MsCHS1 protein has, at equivalent positions, several amino acids that are essential for activity as revealed by mutagenesis of the fungal enzymes. A 5.3-kb transcript of MsCHS1 was identified by northern blot hybridization of RNA from larval epidermis, suggesting that the enzyme functions to make chitin deposited in the cuticle. Further examination by RT-PCR showed that MsCHS1 expression is regulated in the epidermis, with the amount of transcript increasing during phases of cuticle deposition.

Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

PubMed

Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

1990-06-01

Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

delta 6 Hexadecenoic acid is synthesized by the activity of a soluble delta 6 palmitoyl-acyl carrier protein desaturase in Thunbergia alata endosperm.

PubMed

Cahoon, E B; Cranmer, A M; Shanklin, J; Ohlrogge, J B

1994-11-04

delta 6 Hexadecenoic acid (16:1 delta 6) composes more than 80% of the seed oil of Thunbergia alata. Studies were conducted to determine the biosynthetic origin of the double bond of this unusual fatty acid. Assays of fractions of developing T. alata seed endosperm with [1-14C]palmitoyl (16:0)-acyl carrier protein (ACP) revealed the presence of a soluble delta 6 desaturase activity. This activity was greatest when 16:0-ACP was provided as a substrate, whereas no desaturation of the coenzyme A ester of this fatty acid was detected. In addition, delta 6 16:0-ACP desaturase activity in T. alata endosperm extracts was dependent on the presence of ferredoxin and molecular oxygen and was stimulated by catalase. To further characterize this enzyme, a cDNA encoding a diverged acyl-ACP desaturase was isolated from a T. alata endosperm cDNA library using polymerase chain reaction with degenerate oligonucleotides corresponding to conserved amino acid sequences in delta 9 stearoyl (18:0)- and delta 4 16:0-ACP desaturases. The primary structure of the mature peptide encoded by this cDNA shares 66% identity with the mature castor delta 9 18:0-ACP desaturase and 57% identity with the mature coriander delta 4 16:0-ACP desaturase. Extracts of Escherichia coli that express the T. alata cDNA catalyzed the delta 6 desaturation of 16:0-ACP. These results demonstrate that 16:1 delta 6 in T. alata endosperm is formed by the activity of a soluble delta 6 16:0-ACP desaturase that is structurally related to the delta 9 18:0- and delta 4 16:0-ACP desaturases. Implications of this work to an understanding of active site structures of acyl-ACP desaturases are discussed.

Cloning and expression of sheep renal K-CI cotransporter-1.

PubMed

Zhang, Jin J; Misri, Sandeep; Adragna, Norma C; Gagnon, Kenneth B E; Fyffe, Robert E W; Lauf, Peter K

2005-01-01

Sheep K-Cl cotransporter-1(shKCC1) cDNA was cloned from kidney by RT-PCR with an open reading frame of 3258 base pairs exhibiting 92%, 90%, 88% and 87% identity with pig, rabbit and human, rat and mouse KCC1 cDNAs, respectively, encoding an approximately 122 kDa polypeptide of 1086-amino acids. Hydropathy analysis reveals the familiar KCC1 topology with 12 transmembrane domains (TMDs) and the hydrophilic NH2-terminal (NTD) and COOH-terminal (CTD) domains both at the cytoplasmic membrane face. However, shKCC1 has two rather than one large extracellular loops (ECL): ECL3 between TMDs 5 and 6, and ECL6, between TMDs 11 and 12. The translated shKCC1 protein differs in 12 amino acid residues from other KCC1s, mainly within the NTD, ECL3, ICL4, ECL6, and CTD. Notably, a tyrosine residue at position 996 replaces aspartic acid conserved in all other species. Human embryonic kidney (HEK293) cells and mouse NIH/3T3 fibroblasts, transiently transfected with shKCCI-cDNA, revealed the glycosylated approximately 150 kDa proteins by Western blots and positive immunofluorescence-staining with polyclonal rabbit anti-ratKCC1 antibodies. ShKCC1 was functionally expressed in NIH/3T3 cells by an elevated basal Cl-dependent K influx measured with Rb as K-congener that was stimulated three-fold by the KCC-activator N-ethylmaleimide. Copyright (c) 2005 S. Karger AG, Basel.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

Liposomal gene transfer of keratinocyte growth factor improves wound healing by altering growth factor and collagen expression.

PubMed

Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G

2007-05-15

Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.

T-cell receptor accessory and co-receptor molecules in channel catfish

USDA-ARS?s Scientific Manuscript database

T cell receptor (TCR) associated invariant chains CD3gamma/delta,epsilon, and zeta as well as TCR co-receptors CD8alpha and CD8beta were isolated from the channel catfish, Ictalurus punctatus, at both the gene and cDNA levels. All of catfish CD3 sequences encode for proteins that resemble their resp...

A Venom Gland Extracellular Chitin-Binding-Like Protein from Pupal Endoparasitoid Wasps, Pteromalus Puparum, Selectively Binds Chitin

USDA-ARS?s Scientific Manuscript database

Chitin-binding proteins (CBPs) existed in various species and involved in different biology processes. In the present study, we cloned a full length cDNA of chitin-binding protein-like (PpCBP-like) from Pteromalus puparum, a pupal endoparasitoid of Pieris rapae. PpCBP-like encoded a 96 putative amin...

Construction and analysis of cDNA libraries from the antennae of Batocera horsfieldi and expression pattern of putative odorant binding proteins

USDA-ARS?s Scientific Manuscript database

In the natural environment, the longhorned beetle, Batocera horsfieldi (Hope) (Coleoptera: Cerambycidae), finds it’s maturation-feeding and host plants by using chemical cues. In this study, we described the identification and characterization of four new cDNAs that encode Minus-C odorant binding pr...

The nop gene from Phanerochaete chrysosporium encodes a peroxidase with novel structural features

Treesearch

Luis F. Larrondo; Angel Gonzalez; Tomas Perez-Acle; Dan Cullen; Rafael Vicuna

2005-01-01

Inspection of the genome of the ligninolytic basidiomycete Phanerochaete chrysosporium revealed an unusual peroxidase-like sequence. The corresponding full length cDNA was sequenced and an archetypal secretion signal predicted. The deduced mature protein (NoP, novel peroxidase) contains 295 aa residues and is therefore considerably shorter than other Class II (fungal)...

Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

USDA-ARS?s Scientific Manuscript database

Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by multiple ESTs derived only from the oocyte c...

Cloning and characterization of a novel oocyte-specific gene encoding an F-Box protein in rainbow trout (Oncorhynchus mykiss)

USDA-ARS?s Scientific Manuscript database

Oocyte-specific genes play critical roles in oogenesis, folliculogenesis and early embryonic development. Through analysis of expressed sequence tags (ESTs) from a rainbow trout oocyte cDNA library, we identified a novel transcript which is represented by ESTs only from the oocyte library. The novel...

Design and construction of a first-generation high-throughput integrated robotic molecular biology platform for bioenergy applications

USDA-ARS?s Scientific Manuscript database

The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-based clones to expres...

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

Identification and expression analysis of a novel R-type lectin from the coleopteran beetle, Tenebrio molitor.

PubMed

Kim, Dong Hyun; Patnaik, Bharat Bhusan; Seo, Gi Won; Kang, Seong Min; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo

2013-11-01

We have identified novel ricin-type (R-type) lectin by sequencing of random clones from cDNA library of the coleopteran beetle, Tenebrio molitor. The cDNA sequence is comprised of 495 bp encoding a protein of 164 amino acid residues and shows 49% identity with galectin of Tribolium castaneum. Bioinformatics analysis shows that the amino acid residues from 35 to 162 belong to ricin-type beta-trefoil structure. The transcript was significantly upregulated after early hours of injection with peptidoglycans derived from Gram (+) and Gram (-) bacteria, beta-1, 3 glucan from fungi and an intracellular pathogen, Listeria monocytogenes suggesting putative function in innate immunity. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

NASA Astrophysics Data System (ADS)

Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

2017-12-01

As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

Tick vitellogenin receptor reveals critical role in oocyte development and transovarial transmission of Babesia parasite.

PubMed

Boldbaatar, Damdinsuren; Battsetseg, Badgar; Matsuo, Tomohide; Hatta, Takeshi; Umemiya-Shirafuji, Rika; Xuan, Xuenan; Fujisaki, Kozo

2008-08-01

A cDNA encoding the vitellogenin receptor of the ixodid tick, Haemaphysalis longicornis Neumann (HlVgR) was cloned and characterized. The full-length cDNA is 5631 bp, including an intact ORF encoding an expected protein with 1782 amino acids. The deduced amino acid sequence of the HlVgR cDNA revealed two ligand-binding domains with four class A cysteine-rich repeats in the first domain and eight in the second domain similar to those of insect VgRs. The immunoblot analysis detected approximately 197 kDa protein in both tick ovary and egg. The developmental expression profile demonstrated that HlVgR mRNA exists throughout the ovarian development, and the transcriptional level is especially high in the previtellogenic period. Immuno electron microscopy analysis demonstrated that the localization of HlVgR is detected on the external surface of oocyte plasma membrane. RNAi showed that eggs of HlVgR dsRNA-injected adult ticks had not developed into fully mature oocytes and laid abnormal eggs. The Babesia parasite DNA was not detected in the eggs of HlVgR dsRNA-injected tick that fed on Babesia gibsoni infected dog, whereas it was detected in the eggs of PBS-injected ticks and noninjected ticks. Expression of HlVgR was increased by the vitellogenic hormone 20-hydroxyecdysone. These results indicate that HlVgR, which is produced by the developing oocytes, is essential for Vg uptake, egg development in the H. longicornis tick, and transovarial transmission of Babesia parasites.

Cloning, functional characterization, and expression profiles of NADPH-cytochrome P450 reductase gene from the Asiatic rice striped stem borer, Chilo suppressalis (Lepidoptera: Pyralidae).

PubMed

Liu, Su; Liang, Qing-Mei; Huang, Yuan-Jie; Yuan, Xin; Zhou, Wen-Wu; Qiao, Fei; Cheng, Jiaan; Gurr, Geoff M; Zhu, Zeng-Rong

2013-01-01

NADPH-cytochrome P450 reductase (CPR) is one of the most important components of the cytochrome P450 enzyme system. It catalyzes electron transfer from NADPH to all known P450s, thus plays central roles not only in the metabolism of exogenous xenobiotics but also in the regulation of endogenous hormones in insects. In this study, a full-length cDNA encoding of a CPR (named CsCPR) was isolated from the Asiatic rice striped stem borer, Chilo suppressalis, by using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. The cDNA contains a 2061 bp open reading frame, which encodes an enzyme of 686 amino acid residues, with a calculated molecular mass of 77.6 kDa. The deduced peptide has hallmarks of typical CPR, including an N-terminal membrane anchor and the FMN, FAD and NADPH binding domains. The N-terminal-truncated protein fused with a 6 × His·tag was heterologously expressed in Escherichia coli Rosetta (DE3) cells and purified, specific activity and the Km values of the recombinant enzyme were determined. Tissue- and developmental stage-dependent expression of CsCPR mRNA was investigated by real-time quantitative PCR. The CsCPR mRNA was noticeably expressed in the digestive, metabolic, and olfactory organs of the larvae and adults of C. suppressalis. Our initial results would provide valuable information for further study on the interactions between CPR and cytochrome P450 enzyme systems. © 2013.

A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Reddy, V. S.; Golovkin, M.

2000-01-01

Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed Central

Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

1994-01-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

PubMed

Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

1994-05-01

The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

1992-01-01

We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

Grafting fibroblasts genetically modified to produce L-dopa in a rat model of Parkinson disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolff, J.A.; Fisher, L.J.; Xu, L.

1989-11-01

Rat fibroblasts were infected with a retroviral vector containing the cDNA for rat tyrosine hydroxylase. A TH-positive clone was identified by biochemical assay and immunohistochemical staining. When supplemented in vitro with pterin cofactors required for TH activity, these cells produced L-dopa and released it into the cell cultured medium. Uninfected control cells and fibroblasts infected with the TH vector were grafted separately to the caudate of rats with unilateral 6-hydroxydopamine lesions of the nigrostriatal pathway. Only grafts containing TH-expressing fibroblasts were found to reduce rotational asymmetry. These results have general implications for the application of gene therapy to human neurologicalmore » disease and specific implications for Parkinson disease.« less

Characterization of a sterol carrier protein 2/3-oxoacyl-CoA thiolase from the cotton leafworm (Spodoptera littoralis): a lepidopteran mechanism closer to that in mammals than that in dipterans

PubMed Central

2004-01-01

Numerous invertebrate species belonging to several phyla cannot synthesize sterols de novo and rely on a dietary source of the compound. SCPx (sterol carrier protein 2/3-oxoacyl-CoA thiolase) is a protein involved in the trafficking of sterols and oxidation of branched-chain fatty acids. We have isolated SCPx protein from Spodoptera littoralis (cotton leafworm) and have subjected it to limited amino acid sequencing. A reverse-transcriptase PCR-based approach has been used to clone the cDNA (1.9 kb), which encodes a 57 kDa protein. Northern blotting detected two mRNA transcripts, one of 1.9 kb, encoding SCPx, and one of 0.95 kb, presumably encoding SCP2 (sterol carrier protein 2). The former mRNA was highly expressed in midgut and Malpighian tubules during the last larval instar. Furthermore, constitutive expression of the gene was detected in the prothoracic glands, which are the main tissue producing the insect moulting hormone. There was no significant change in the 1.9 kb mRNA in midgut throughout development, but slightly higher expression in the early stages. Conceptual translation of the cDNA and a database search revealed that the gene includes the SCP2 sequence and a putative peroxisomal targeting signal in the C-terminal region. Also a cysteine residue at the putative active site for the 3-oxoacyl-CoA thiolase is conserved. Southern blotting showed that SCPx is likely to be encoded by a single-copy gene. The mRNA expression pattern and the gene structure suggest that SCPx from S. littoralis (a lepidopteran) is evolutionarily closer to that of mammals than to that of dipterans. PMID:15149283

CLOFIBRATE-INDUCED GENE EXPRESSION CHANGES IN RAT LIVER: A CROSS-LABORATORY ANALYSIS USING MEMBRANE CDNA ARRAYS

EPA Science Inventory

Microarrays have the potential to significantly impact our ability to identify toxic hazards by the identification of mechanistically-relevant markers of toxicity. To be useful for risk assessment however, microarray data must be challenged to determine its reliability and inter...

Characterization of rat serum amyloid A4 (SAA4): A novel member of the SAA superfamily

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rossmann, Christine; Windpassinger, Christian; Brunner, Daniela

2014-08-08

Highlights: • The full length rat SAA4 (rSAA4) mRNA was characterized by rapid amplification of cDNA ends. • rSAA4 mRNA has 1830 bases including a GA dinucleotide tandem repeat in the 5′UTR. • Three consecutive C/EBP promoter elements are crucial for transcription of rSAA4. • rSAA4 is abundantly expressed in the liver on mRNA and protein level. - Abstract: The serum amyloid A (SAA) family of proteins is encoded by multiple genes, which display allelic variation and a high degree of homology in mammals. The SAA1/2 genes code for non-glycosylated acute-phase SAA1/2 proteins, that may increase up to 1000-fold duringmore » inflammation. The SAA4 gene, well characterized in humans (hSAA4) and mice (mSaa4) codes for a SAA4 protein that is glycosylated only in humans. We here report on a previously uncharacterized SAA4 gene (rSAA4) and its product in Rattus norvegicus, the only mammalian species known not to express acute-phase SAA. The exon/intron organization of rSAA4 is similar to that reported for hSAA4 and mSaa4. By performing 5′- and 3′RACE, we identified a 1830-bases containing rSAA4 mRNA (including a GA-dinucleotide tandem repeat). Highest rSAA4 mRNA expression was detected in rat liver. In McA-RH7777 rat hepatoma cells, rSAA4 transcription was significantly upregulated in response to LPS and IL-6 while IL-1α/β and TNFα were without effect. Luciferase assays with promoter-truncation constructs identified three proximal C/EBP-elements that mediate expression of rSAA4 in McA-RH7777 cells. In line with sequence prediction a 14-kDa non-glycosylated SAA4 protein is abundantly expressed in rat liver. Fluorescence microscopy revealed predominant localization of rSAA4-GFP-tagged fusion protein in the ER.« less

Differential display cloning of a novel rat cDNA (RNB6) that shows high expression in the neonatal brain revealed a member of Ena/VASP family.

PubMed

Ohta, S; Mineta, T; Kimoto, M; Tabuchi, K

1997-08-18

We have used the differential display method to identify genes that control the neural cell development in CNS. Screening of the differential display bands that showed higher expression at neonate than at adult age enabled us to identify a novel rat cDNA (RNB6) coding for a protein of 393 amino acid residues. Database search revealed this gene as a rat homologue of the murine EVL, a member of Ena/VASP protein family that is implicated to be involved in the control of cell motility through actin filament assembly by their GP5 motifs. Although the precise characterization of EVL was not reported, our Northern blot and immunoblot analyses demonstrated that RNB6 expression in the brain gradually increases during embryonic development, reaches maximum at postnatal day 1 and decreases thereafter. Studies of tissue distribution revealed the expression of RNB6 not only in the brain but also in the spleen, thymus and testis. Histochemical analyses showed that RNB6 protein is mainly expressed in neurons and may be expressed in neural fibers. Our analyses suggest that RNB6 is critically involved in the development of CNS probably through the control of neural cell motility and/or including neuronal fiber extension.

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

PubMed

Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

2015-06-01

Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koener, J.F.; Leong, J.A.C.

A cDNA fragment containing the gene encoding the glycoprotein of infectious hematopoietic necrosis virus was inserted into Autographa californica baculovirus vectors under the control of the polyhedrin promoter. A 66-kilodalton protein, identical in size to the glycosylated glycoprotein of infectious hematopoietic necrosis virus, was expressed at high levels in Spodoptera frugiperda cells infected with the recombinant viruses. The expressed protein reacted with antiserum to the glycoprotein on Western blots.

Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

USDA-ARS?s Scientific Manuscript database

The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

Design and construction of a first-generation high-throughput integrated molecular biology platform for production of optimized synthetic genes and improved industrial strains

USDA-ARS?s Scientific Manuscript database

The molecular biological techniques for plasmid-based assembly and cloning of synthetic assembled gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-bas...

Characterization and Promoter Analysis of a Cotton Ring-Type Ubiquitin Ligase (E3) Gene

USDA-ARS?s Scientific Manuscript database

A cotton fiber cDNA, GhRING1, and its corresponding gene have been cloned and characterized. The GhRING1 gene encodes a RING-type ubiquitin ligase (E3) containing 337 amino acids (aa). The GhRING1 protein contains a RING finger motif with conserved cysteine and histine residues at the C-terminus a...

Expression analysis of kenaf cinnamate 4-hydroxylase (C4H) ortholog during developmental and stress responses

USDA-ARS?s Scientific Manuscript database

This study was conducted to clone and analyze the expression pattern of a C4H gene encoding cinnamate 4-hydroxylase from kenaf (Hibiscus cannabinus L.). A full-length C4H ortholog was cloned using degenerate primers and the RACE (rapid amplification of cDNA ends) method. The full-length C4H ortholog...

Mannan-binding lectin of the sea urchin Strongylocentrotus nudus.

PubMed

Bulgakov, Aleksandr A; Eliseikina, Marina G; Kovalchuk, Svetlana N; Petrova, Irina Yu; Likhatskaya, Galina N; Shamshurina, Ekaterina V; Rasskazov, Valery A

2013-02-01

A novel lectin specific to low-branched mannans (MBL-SN) was isolated from coelomic plasma of the sea urchin Strongylocentrotus nudus by combining anion-exchange liquid chromatography on DEAE Toyopearl 650 M, affinity chromatography on mannan-Sepharose and gel filtration on the Sephacryl S-200. The molecular mass of MBL-SN was estimated by sodium dodecyl sulphate polyacrylamide gel electrophoresis under non-reducing conditions to be about 34 kDa. MBL-SN was shown to be a dimer with two identical subunits of about 17 kDa. The native MBL-SN exists as a tetramer. The physico-chemical properties of MBL-SN indicate that it belongs to C-type mannan-binding lectins. The cDNA encoding MBL-SN was cloned from the total cDNA of S. nudus coelomocytes and encodes a 17-kDa protein of 144 amino acid residues that contains a single carbohydrate-recognition domain of C-type lectins. Prediction of the MBL-SN tertiary structure using comparative modelling revealed that MBL-SN is an α/β-protein with eight β-strands and two α-helices. Comparison of the MBL-SN model with available three-dimensional structures of C-type lectins revealed that they share a common fold pattern.

An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van De Loo, F.J.; Broun, P.; Turner, S.

1995-07-18

Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

In silico analysis of β-1,3-glucanase from a psychrophilic yeast, Glaciozyma antarctica PI12

NASA Astrophysics Data System (ADS)

Mohammadi, Salimeh; Bakar, Farah Diba Abu; Rabu, Amir; Murad, Abdul Munir Abdul

2014-09-01

1,3-beta-glucanase is an industrially important enzyme having wide range of applications especially in food industry. It is crucial to gain an understanding about the structure and functional aspects of various beta-1,3-glucanase produced from diverse sources. In this, study a cDNA encoding β-1,3-glucanase (GaExg55) was isolated from a psychrophilic yeast, Glaciozyma antarctica PI12. The cDNA sequence has been submitted to Genbank with an accession number (KJ436377). Subsequently, the perdition protein was analyzed using various bioinformatics tools to explore the properties of the protein. GaEXG55 is consisting of 1,440-bp nucleotides encoding 480 amino acid residues. Alignment of the deduced amino acid for GaExg55 with other exo-β-1,3-glucanase available at the NCBI database indicate that deduced amino acids shared a consensus motif NEP, which is signature pattern of GH5 hydrolases. Predicted molecular weight of GaExg55 is 53.66 kDa. GaExg55 sequences possesses signal peptide sequence and it is highly conserved with other fungal exo-beta-1,3 glucanase.

The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

PubMed Central

Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

1998-01-01

Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs. PMID:9707446

The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

PubMed

Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

1998-08-17

Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.

Molecular structure, chemical synthesis, and antibacterial activity of ABP-dHC-cecropin A from drury (Hyphantria cunea).

PubMed

Zhang, Jiaxin; Movahedi, Ali; Wang, Xiaoli; Wu, Xiaolong; Yin, Tongming; Zhuge, Qiang

2015-06-01

The increasing resistance of bacteria and fungi to currently available antibiotics is a major concern worldwide, leading to enormous efforts to develop new antibiotics with new modes of actions. In this paper, cDNA encoding cecropin A was amplified from drury (Hyphantria cunea) (dHC) pupa fatbody total RNA using RT-PCR. The full-length dHC-cecropin A cDNA encoded a protein of 63 amino acids with a predicted 26-amino acid signal peptide and a 37-amino acid functional domain. We synthesized the antibacterial peptide (ABP) from the 37-amino acid functional domain (ABP-dHC-cecropin A), and amidated it via the C-terminus. Time-of-flight mass spectrometry showed its molecular weight to be 4058.94. The ABP-dHC-cecropin A was assessed in terms of its protein structure using bioinformatics and CD spectroscopy. The protein's secondary structure was predicted to be α-helical. In an antibacterial activity analysis, the ABP-dHC-cecropin A exhibited strong antibacterial activity against E. coli K12D31 and Agrobacterium EHA105. Copyright © 2014 Elsevier Inc. All rights reserved.

Isolation and characterization of a novel acidic matrix protein hic22 from the nacreous layer of the freshwater mussel, Hyriopsis cumingii.

PubMed

Liu, X J; Jin, C; Wu, L M; Dong, S J; Zeng, S M; Li, J L

2016-07-29

Matrix proteins that either weakly acidic or unusually highly acidic have important roles in shell biomineralization. In this study, we have identified and characterized hic22, a weakly acidic matrix protein, from the nacreous layer of Hyriopsis cumingii. Total protein was extracted from the nacre using 5 M EDTA and hic22 was purified using a DEAE-sepharose column. The N-terminal amino acid sequence of hic22 was determined and the complete cDNA encoding hic22 was cloned and sequenced by rapid amplification of cDNA ends-polymerase chain reaction. Finally, the localization and distribution of hic22 was determined by in situ hybridization. Our results revealed that hic22 encodes a 22-kDa protein composed of 185 amino acids. Tissue expression analysis and in situ hybridization indicated that hic22 is expressed in the dorsal epithelial cells of the mantle pallial; moreover, significant expression levels of hic22 were observed after the early formation of the pearl sac (days 19-77), implying that hic22 may play an important role in biomineralization of the nacreous layer.

Molecular characterization of cDNAs encoding G protein alpha and beta subunits and study of their temporal and spatial expression patterns in Nicotiana plumbaginifolia Viv.

PubMed

Kaydamov, C; Tewes, A; Adler, K; Manteuffel, R

2000-04-25

We have isolated cDNA sequences encoding alpha and beta subunits of potential G proteins from a cDNA library prepared from somatic embryos of Nicotiana plumbaginifolia Viv. at early developmental stages. The predicted NPGPA1 and NPGPB1 gene products are 75-98% identical to the known respective plant alpha and beta subunits. Southern hybridizations indicate that NPGPA1 is probably a single-copy gene, whereas at least two copies of NPGPB1 exist in the N. plumbaginifolia genome. Northern analyses reveal that both NPGPA1 and NPGPB1 mRNA are expressed in all embryogenic stages and plant tissues examined and their expression is obviously regulated by the plant hormone auxin. Immunohistological localization of NPGPalpha1 and NPGPbeta1 preferentially on plasma and endoplasmic reticulum membranes and their immunochemical detection exclusively in microsomal cell fractions implicate membrane association of both proteins. The temporal and spatial expression patterns of NPGPA1 and NPGPB1 show conformity as well as differences. This could account for not only cooperative, but also individual activities of both subunits during embryogenesis and plant development.

Involvement of transcription factor encoded by the mouse mi locus (MITF) in apoptosis of cultured mast cells induced by removal of interleukin-3.

PubMed Central

Tsujimura, T.; Hashimoto, K.; Morii, E.; Tunio, G. M.; Tsujino, K.; Kondo, T.; Kanakura, Y.; Kitamura, Y.

1997-01-01

Mast cells develop when spleen cells of mice are cultured in the medium containing interleukin (IL)-3. Cultured mast cells (CMCs) show apoptosis when they are incubated in the medium without IL-3. We obtained CMCs from tg/tg mice that did not express the transcription factor encoded by the mi gene (MITF) due to the integration of a transgene at its 5' flanking region. MITF is a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors. We investigated the effect of MITF on the apoptosis of CMCs after removal of IL-3. When cDNA encoding normal MITF ((+)-MITF) was introduced into tg/tg CMCs with the retroviral vector, the apoptosis of tg/tg CMCs was significantly accelerated. The mutant mi allele represents a deletion of an arginine at the basic domain of MITF. The apoptosis of tg/tg CMCs was not accelerated by the introduction of cDNA encoding mi-MITF. The overexpression of (+)-MITF was not prerequisite to the acceleration of the apoptosis, as the apoptotic process proceeded faster in +/+ CMCs than in mi/mi CMCs. The Ba/F3 lymphoid cell line is also dependent on IL-3, and Ba/F3 cells show apoptosis after removal of IL-3. The c-myc gene encodes another transcription factor of the bHLH-Zip family, and the overexpression of the c-myc gene accelerated the apoptosis of Ba/F3 cells. However, the overexpression of (+)-MITF did not accelerate the apoptosis of Ba/F3 cells. The (+)-MITF appeared to play some roles for the acceleration of the apoptosis specifically in the mast cell lineage. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9327738

Transcriptional regulation of genes encoding ABA metabolism enzymes during the fruit development and dehydration stress of pear 'Gold Nijisseiki'.

PubMed

Dai, Shengjie; Li, Ping; Chen, Pei; Li, Qian; Pei, Yuelin; He, Suihuan; Sun, Yufei; Wang, Ya; Kai, Wenbin; Zhao, Bo; Liao, Yalan; Leng, Ping

2014-09-01

To investigate the contribution of abscisic acid (ABA) in pear 'Gold Nijisseiki' during fruit ripening and under dehydration stress, two cDNAs (PpNCED1 and PpNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) (a key enzyme in ABA biosynthesis), two cDNAs (PpCYP707A1 and PpCYP707A2) which encode 8'-hydroxylase (a key enzyme in the oxidative catabolism of ABA), one cDNA (PpACS3) which encodes 1-aminocyclopropane-1-carboxylic acid (ACC), and one cDNA (PpACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from 'Gold Nijisseiki' fruit. In the pulp, peel and seed, expressions of PpNCED1 and PpNCED2 rose in two stages which corresponded with the increase of ABA levels. The expression of PpCYP707A1 dramatically declined after 60-90 days after full bloom (DAFB) in contrast to the changes of ABA levels during this period, while PpCYP707A2 stayed low during the whole development of fruit. Application of exogenous ABA at 100 DAFB increased the soluble sugar content and the ethylene release but significantly decreased the titratable acid and chlorophyll contents in fruits. When fruits harvested at 100 DAFB were stored in the laboratory (25 °C, 50% relative humidity), the ABA content and the expressions of PpNCED1/2 and PpCYP707A1 in the pulp, peel and seed increased significantly, while ethylene reached its highest value after the maximum peak of ABA accompanied with the expressions of PpACS3 and PpACO1. In sum the endogenous ABA may play an important role in the fruit ripening and dehydration of pear 'Gold Nijisseiki' and the ABA level was regulated mainly by the dynamics of PpNCED1, PpNCED2 and PpCYP707A1 at the transcriptional level. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Identification of the neurofibromatosis type 1 gene product

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gutmann, D.H.; Wood, D.L.; Collins, F.S.

The gene for neurofibromatosis type 1 (NF1) was recently identified by positional cloning. The complete cDNA encodes a polypeptide of 2818 amino acids. To study the NF1 gene product, antibodies were raised against both fusion proteins and synthetic peptides. Initial characterization of two anti-peptide antibodies and one fusion-protein antibody demonstrated a specific protein of {approx}250 kDa by both immunoprecipitation and immunoblotting. This protein was found in all tissues and cell lines examined and is detected in human, rat, and mouse tissues. To demonstrate that these antibodies specifically recognize the NF1 protein, additional fusion proteins containing the sequence specific to themore » synthetic peptide were generated. Both peptide antisera recognize the proper specific fusion proteins so generated. Immunoprecipitates using the peptide antisera were shown to recognize the same protein detected by immunoblotting with either the other peptide antiserum or the fusion-protein antiserum. Immunoblotting using antiserum specific to spatially distinct epitopes conducted on tissue homogenates demonstrated the NF1 protein in all adult tissues. Based on the homology between the NF1 gene product and members of the GTPase-activating protein (GAP) superfamily, the name NF1-GAP-related protein (NF1GRP) is suggested.« less

Cloning, functional expression, and characterization of a PKA-activated gastric Cl- channel.

PubMed

Malinowska, D H; Kupert, E Y; Bahinski, A; Sherry, A M; Cuppoletti, J

1995-01-01

cDNA encoding a Cl- channel was isolated from a rabbit gastric library, sequenced, and expressed in Xenopus oocytes. The predicted protein (898 amino acids, relative molecular mass 98,433 Da) was overall 93% similar to the rat brain ClC-2 Cl- channel. However, a 151-amino acid stretch toward the COOH-terminus was 74% similar to ClC-2 with six amino acids deleted. Two new potential protein kinase A (PKA) phosphorylation sites (also protein kinase C phosphorylation sites) were introduced. cRNA-injected Xenopus oocytes expressed a Cl- channel that was active at pHtrans 3 and had a linear current-voltage (I-V) curve and a slope conductance of 29 +/- 1 pS at 800 mM CsCl. A fivefold Cl- gradient caused a rightward shift in the I-V curve with a reversal potential of +30 +/- 3 mV, indicating anion selectivity. The selectivity was I- > Cl- > NO3-. The native and recombinant Cl- channel were both activated in vitro by PKA catalytic subunit and ATP. The electrophysiological and regulatory properties of the cloned and the native channel were similar. The cloned protein may be the Cl- channel involved in gastric HCl secretion.

Transfer of a gene encoding the anticandidal protein histatin 3 to salivary glands.

PubMed

O'Connell, B C; Xu, T; Walsh, T J; Sein, T; Mastrangeli, A; Crystal, R G; Oppenheim, F G; Baum, B J

1996-12-01

Mucosal candidiasis, the most common opportunistic fungal infection in human immunodeficiency virus (HIV)-infected patients, is an early sign of clinically overt acquired immunodeficiency syndrome (AIDS) and an important cause of morbidity, particularly in HIV-infected children. The appearance of azole-resistant strains of Candida albicans had made clinical management of candidiasis increasingly difficult. We propose a novel approach to the management of candidal infections that involves the use of naturally occurring antifungal proteins, such as the histatins. Histatins are a family of small proteins that are secreted in human saliva. We have constructed recombinant adenovirus vectors that contain the histatin 3 cDNA. These vectors are capable of directing the expression of histatin 3 in the saliva of rats at up to 1,045 micrograms/ml, well above the levels found in normal human saliva. The adenovirus-directed histatin demonstrated a 90% candidacidal effect in the timed-kill assay against both fluconazole-susceptible and fluconazole-resistant strains of C. albicans and inhibited germination by 45% in the same strains. These studies suggest that a gene transfer approach to overexpress naturally occurring antifungal proteins may be useful in the management of mucosal candidiasis.

Identification of phosphomethylethanolamine N-methyltransferase from Arabidopsis and its role in choline and phospholipid metabolism.

PubMed

BeGora, Michael D; Macleod, Mitchell J R; McCarry, Brian E; Summers, Peter S; Weretilnyk, Elizabeth A

2010-09-17

Three sequential methylations of phosphoethanolamine (PEA) are required for the synthesis of phosphocholine (PCho) in plants. A cDNA encoding an N-methyltransferase that catalyzes the last two methylation steps was cloned from Arabidopsis by heterologous complementation of a Saccharomyces cerevisiae cho2, opi3 mutant. The cDNA encodes phosphomethylethanolamine N-methyltransferase (PMEAMT), a polypeptide of 475 amino acids that is organized as two tandem methyltransferase domains. PMEAMT shows 87% amino acid identity to a related enzyme, phosphoethanolamine N-methyltransferase, an enzyme in plants that catalyzes all three methylations of PEA to PCho. PMEAMT cannot use PEA as a substrate, but assays using phosphomethylethanolamine as a substrate result in both phosphodimethylethanolamine and PCho as products. PMEAMT is inhibited by the reaction products PCho and S-adenosyl-l-homocysteine, a property reported for phosphoethanolamine N-methyltransferase from various plants. An Arabidopsis mutant with a T-DNA insertion associated with locus At1g48600 showed no transcripts encoding PMEAMT. Shotgun lipidomic analyses of leaves of atpmeamt and wild-type plants generated phospholipid profiles showing the content of phosphatidylmethylethanolamine to be altered relative to wild type with the content of a 34:3 lipid molecular species 2-fold higher in mutant plants. In S. cerevisiae, an increase in PtdMEA in membranes is associated with reduced viability. This raises a question regarding the role of PMEAMT in plants and whether it serves to prevent the accumulation of PtdMEA to potentially deleterious levels.

Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

PubMed

Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2004-02-01

To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

Cloning and functional expression of the small subunit of acetolactate synthase from Nicotiana plumbaginifolia.

PubMed

Hershey, H P; Schwartz, L J; Gale, J P; Abell, L M

1999-07-01

Acetolactate synthase (ALS) is the first committed step of branched-chain amino acid biosynthesis in plants and bacteria. The bacterial holoenzyme has been well characterized and is a tetramer of two identical large subunits (LSUs) of 60 kDa and two identical small subunits (SSUs) ranging in molecular mass from 9 to 17 kDa depending on the isozyme. The enzyme from plants is much less well characterized. Attempts to purify the protein have yielded an enzyme which appears to be an oligomer of LSUs, with the potential existence of a SSU for the plant enzyme remaining a matter of considerable speculation. We report here the discovery of a cDNA clone that encodes a SSU of plant ALS based upon the homology of the encoded peptide with various bacterial ALS SSUs. The plant ALS SSU is more than twice as large as any of its prokaryotic homologues and contains two domains that each encode a full-length copy of the prokaryotic SSU polypeptide. The cDNA clone was used to express Nicotiana plumbaginifolia SSU in Escherichia coli. Mixing a partially purified preparation of this SSU with the LSU of ALS from either N. plumbaginifolia or Arabidopsis thaliana results in both increased specific activity and increased stability of the enzymic activity. These results are consistent with those observed for the bacterial enzyme in similar experiments and represent the first functional demonstration of the existence of a SSU for plant ALS.

Rat leucine-rich protein binds and activates the promoter of the beta isoform of Ca2+/calmodulin-dependent protein kinase II gene.

PubMed

Ochiai, Nagahiro; Masumoto, Shuji; Sakagami, Hiroyuki; Yoshimura, Yoshiyuki; Yamauchi, Takashi

2007-05-01

We previously found the neuronal cell-type specific promoter and binding partner of the beta isoform of Ca(2+)/calmodulin-dependent protein kinase II (beta CaM kinase II) in rat brain [Donai, H., Morinaga, H., Yamauchi, T., 2001. Genomic organization and neuronal cell type specific promoter activity of beta isoform of Ca(2+)/calmodulin-dependent protein kinase II of rat brain. Mol. Brain Res. 94, 35-47]. In the present study, we purified a protein that binds specifically a promoter region of beta CaM kinase II gene from a nuclear extract of the rat cerebellum using DEAE-cellulose column chromatography, ammonium sulfate fractionation, gel filtration and polyacrylamide gel electrophoresis. The purified protein was identified as rat leucine-rich protein 157 (rLRP157) using tandem mass spectrometry. Then, we prepared its cDNA by reverse transcriptase-polymerase chain reaction (RT-PCR) from poly(A)(+)RNA of rat cerebellum. The rLRP157 cDNA was introduced into mouse neuroblastomaxrat glioma hybrid NG108-15 cells, and cells stably expressing rLRP157 (NG/LRP cells) were isolated. Binding of rLRP157 with the promoter sequence was confirmed by electrophoretic mobility shift assay using nuclear extract of NG/LRP cells. A luciferase reporter gene containing a promoter of beta CaM kinase II was transiently expressed in NG/LRP cells. Under the conditions, the promoter activity was enhanced about 2.6-fold in NG/LRP cells as compared with wild-type cells. The expression of rLRP157 mRNA was paralleled with that of beta CaM kinase II in the adult and embryo rat brain detected by in situ hybridization. Nuclear localization of rLRP157 was confirmed using GFP-rLRP157 fusion protein investigated under a confocal microscope. These results indicate that rLRP157 is one of the proteins binding to, and regulating the activity of, the promoter of beta CaM kinase II.

Rat1p and Xrn1p are functionally interchangeable exoribonucleases that are restricted to and required in the nucleus and cytoplasm, respectively.

PubMed Central

Johnson, A W

1997-01-01

XRN1 encodes an abundant cytoplasmic exoribonuclease, Xrn1p, responsible for mRNA turnover in yeast. A screen for bypass suppressors of the inviability of xrn1 ski2 double mutants identified dominant alleles of RAT1, encoding an exoribonuclease homologous with Xrn1p. These RAT1 alleles restored XRN1-like functions, including cytoplasmic RNA turnover, wild-type sensitivity to the microtubule-destabilizing drug benomyl, and sporulation. The mutations were localized to a region of the RAT1 gene encoding a putative bipartite nuclear localization sequence (NLS). Fusions to green fluorescent protein were used to demonstrate that wild-type Rat1p is localized to the nucleus and that the mutant alleles result in mislocalization of Rat1p to the cytoplasm. Conversely, targeting Xrn1p to the nucleus by the addition of the simian virus 40 large-T-antigen NLS resulted in complementation of the temperature sensitivity of a rat1-1 strain. These results indicate that Xrn1p and Rat1p are functionally interchangeable exoribonucleases that function in and are restricted to the cytoplasm and nucleus, respectively. It is likely that the higher eukaryotic homologs of these proteins will function similarly in the cytoplasm and nucleus. PMID:9315672

Cloning, characterization, and chromosomal mapping of a human electroneutral Na(+)-driven Cl-HCO3 exchanger.

PubMed

Grichtchenko, I I; Choi, I; Zhong, X; Bray-Ward, P; Russell, J M; Boron, W F

2001-03-16

The electroneutral Na(+)-driven Cl-HCO3 exchanger is a key mechanism for regulating intracellular pH (pH(i)) in neurons, glia, and other cells. Here we report the cloning, tissue distribution, chromosomal location, and functional characterization of the cDNA of such a transporter (NDCBE1) from human brain (GenBank accession number AF069512). NDCBE1, which encodes 1044 amino acids, is 34% identical to the mammalian anion exchanger (AE2); approximately 50% to the electrogenic Na/HCO3 cotransporter (NBCe1) from salamander, rat, and humans; approximately 73% to mammalian electroneutral Na/HCO3 cotransporters (NBCn1); 71% to mouse NCBE; and 47% to a Na(+)-driven anion exchanger (NDAE1) from Drosophila. Northern blot analysis of NDCBE1 shows a robust approximately 12-kilobase signal in all major regions of human brain and in testis, and weaker signals in kidney and ovary. This human gene (SLC4A8) maps to chromosome 12q13. When expressed in Xenopus oocytes and running in the forward direction, NDCBE1 is electroneutral and mediates increases in both pH(i) and [Na(+)](i) (monitored with microelectrodes) that require HCO3(-) and are blocked by 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). The pH(i) increase also requires extracellular Na(+). The Na(+):HCO3(-) stoichiometry is 1:2. Forward-running NDCBE1 mediates a 36Cl efflux that requires extracellular Na(+) and HCO3(-) and is blocked by DIDS. Running in reverse, NDCBE1 requires extracellular Cl(-). Thus, NDCBE1 encodes a human, electroneutral Na(+)-driven Cl-HCO3 exchanger.

Differences in brain gene expression between sleep and waking as revealed by mRNA differential display and cDNA microarray technology.

PubMed

Cirelli, C; Tononi, G

1999-06-01

The consequences of sleep and sleep deprivation at the molecular level are largely unexplored. Knowledge of such molecular events is essential to understand the restorative processes occurring during sleep as well as the cellular mechanisms of sleep regulation. Here we review the available data about changes in neural gene expression across different behavioural states using candidate gene approaches such as in situ hybridization and immunocytochemistry. We then describe new techniques for systematic screening of gene expression in the brain, such as subtractive hybridization, mRNA differential display, and cDNA microarray technology, outlining advantages and disadvantages of these methods. Finally, we summarize our initial results of a systematic screening of gene expression in the rat brain across behavioural states using mRNA differential display and cDNA microarray technology. The expression pattern of approximately 7000 genes was analysed in the cerebral cortex of rats after 3 h of spontaneous sleep, 3 h of spontaneous waking, or 3 h of sleep deprivation. While the majority of transcripts were expressed at the same level among these three conditions, 14 mRNAs were modulated by sleep and waking. Six transcripts, four more expressed in waking and two more expressed in sleep, corresponded to novel genes. The eight known transcripts were all expressed at higher levels in waking than in sleep and included transcription factors and mitochondrial genes. A possible role for these known transcripts in mediating neural plasticity during waking is discussed.

Subtractive cloning of cDNA from Aspergillus oryzae differentially regulated between solid-state culture and liquid (submerged) culture.

PubMed

Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu

2002-07-01

In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.

cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with epithelium.

PubMed Central

Haskill, S; Martin, G; Van Le, L; Morris, J; Peace, A; Bigler, C F; Jaffe, G J; Hammerberg, C; Sporn, S A; Fong, S

1991-01-01

A cDNA encoding a receptor antagonist of interleukin 1 (IL-1ra), secreted from human monocytes, has recently been isolated and sequenced [Eisenberg, S. P., Evans, R. J., Arend, W. P., Verderber, E., Brewer, M. T., Hannum, C. H. & Thompson, R. C. (1990) Nature (London) 343, 341-346]. We have identified another version of this IL-1ra, which is predominantly expressed in epithelial cells. This IL-1ra lacks a leader sequence and, thus, is probably intracellular. Both proteins are derived from the same gene through use of an alternative transcriptional start site and internal splice-acceptor site. Expression of intracellular IL-1ra cDNA in COS cells demonstrated that the intracellular product specifically inhibited exogenous interleukin 1-dependent responses. Keratinocytes were shown to contain significant amounts of nonsecreted IL-1ra protein. Constitutive expression of the intracellular IL-1ra may be an intracellular defensive mechanism in exposed epithelial cells and/or may serve to regulate autocrine interleukin 1-mediated pathways of differentiation. Images PMID:1827201

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

Identification and characterization of a DnaJ gene from red alga Pyropia yezoensis (Bangiales, Rhodophyta)

NASA Astrophysics Data System (ADS)

Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin

2016-03-01

Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.

The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

PubMed Central

Allison, J; Hall, L; MacIntyre, I; Craig, R K

1981-01-01

(1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

Molecular cloning of a cysteine proteinase cDNA from the cotton boll weevil Anthonomus grandis (Coleoptera: Curculionidae).

PubMed

De Oliveira Neto, Osmundo Brilhante; Batista, João Aguiar Nogueira; Rigden, Daniel John; Franco, Octávio Luiz; Fragoso, Rodrigo Rocha; Monteiro, Ana Carolina Santos; Monnerat, Rose Gomes; Grossi-De-Sa, Maria Fátima

2004-06-01

The cotton boll weevil (Anthonomus grandis) causes severe cotton crop losses in North and South America. This report describes the presence of cysteine proteinase activity in the cotton boll weevil. Cysteine proteinase inhibitors from different sources were assayed against total A. grandis proteinases but, unexpectedly, no inhibitor tested was particularly effective. In order to screen for active inhibitors against the boll weevil, a cysteine proteinase cDNA (Agcys1) was isolated from A. grandis larvae using degenerate primers and rapid amplification of cDNA ends (RACE) techniques. Sequence analysis showed significant homologies with other insect cysteine proteinases. Northern blot analysis indicated that the mRNA encoding the proteinase was transcribed mainly in the gut of larvae. No mRNA was detected in neonatal larvae, pupae, or in the gut of the adult insect, suggesting that Agcys1 is an important cysteine proteinase for larvae digestion. The isolated gene will facilitate the search for highly active inhibitors towards boll weevil larvae that may provide a new opportunity to control this important insect pest.

Construction and characterization of a normalized cDNA library of Nannochloropsis oculata (Eustigmatophyceae)

NASA Astrophysics Data System (ADS)

Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong

2010-07-01

We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.

Nucleus Accumbens Core and Shell Differentially Encode Reward-Associated Cues after Reinforcer Devaluation

PubMed Central

West, Elizabeth A.

2016-01-01

Nucleus accumbens (NAc) neurons encode features of stimulus learning and action selection associated with rewards. The NAc is necessary for using information about expected outcome values to guide behavior after reinforcer devaluation. Evidence suggests that core and shell subregions may play dissociable roles in guiding motivated behavior. Here, we recorded neural activity in the NAc core and shell during training and performance of a reinforcer devaluation task. Long–Evans male rats were trained that presses on a lever under an illuminated cue light delivered a flavored sucrose reward. On subsequent test days, each rat was given free access to one of two distinctly flavored foods to consume to satiation and were then immediately tested on the lever pressing task under extinction conditions. Rats decreased pressing on the test day when the reinforcer earned during training was the sated flavor (devalued) compared with the test day when the reinforcer was not the sated flavor (nondevalued), demonstrating evidence of outcome-selective devaluation. Cue-selective encoding during training by NAc core (but not shell) neurons reliably predicted subsequent behavioral performance; that is, the greater the percentage of neurons that responded to the cue, the better the rats suppressed responding after devaluation. In contrast, NAc shell (but not core) neurons significantly decreased cue-selective encoding in the devalued condition compared with the nondevalued condition. These data reveal that NAc core and shell neurons encode information differentially about outcome-specific cues after reinforcer devaluation that are related to behavioral performance and outcome value, respectively. SIGNIFICANCE STATEMENT Many neuropsychiatric disorders are marked by impairments in behavioral flexibility. Although the nucleus accumbens (NAc) is required for behavioral flexibility, it is not known how NAc neurons encode this information. Here, we recorded NAc neurons during a training session in which rats learned that a cue predicted a specific reward and during a test session when that reward value was changed. Although encoding in the core during training predicted the ability of rats to change behavior after the reward value was altered, the NAc shell encoded information about the change in reward value during the test session. These findings suggest differential roles of the core and shell in behavioral flexibility. PMID:26818502

Betacellulin overexpression in mesenchymal stem cells induces insulin secretion in vitro and ameliorates streptozotocin-induced hyperglycemia in rats.

PubMed

Paz, Ana H; Salton, Gabrielle Dias; Ayala-Lugo, Ana; Gomes, Cristiano; Terraciano, Paula; Scalco, Rosana; Laurino, Claudia Cilene Fernandes Correia; Passos, Eduardo Pandolfi; Schneider, Marlon R; Meurer, Luise; Cirne-Lima, Elizabeth

2011-02-01

Betacellulin (BTC), a ligand of the epidermal growth factor receptor, has been shown to promote growth and differentiation of pancreatic β-cells and to improve glucose metabolism in experimental diabetic rodent models. Mesenchymal stem cells (MSCs) have been already proved to be multipotent. Recent work has attributed to rat and human MSCs the potential to differentiate into insulin-secreting cells. Our goal was to transfect rat MSCs with a plasmid containing BTC cDNA to guide MSC differentiation into insulin-producing cells. Prior to induction of cell MSC transfection, MSCs were characterized by flow cytometry and the ability to in vitro differentiate into mesoderm cell types was evaluated. After rat MSC characterization, these cells were electroporated with a plasmid containing BTC cDNA. Transfected cells were cultivated in Dulbecco's modified Eagle medium high glucose (H-DMEM) with 10 mM nicotinamide. Then, the capability of MSC-BTC to produce insulin in vitro and in vivo was evaluated. It was possible to demonstrate by radioimmunoassay analysis that 10(4) MSC-BTC cells produced up to 0.4 ng/mL of insulin, whereas MSCs transfected with the empty vector (negative control) produced no detectable insulin levels. Moreover, MSC-BTC were positive for insulin in immunohistochemistry assay. In parallel, the expression of pancreatic marker genes was demonstrated by molecular analysis of MSC-BTC. Further, when MSC-BTC were transplanted to streptozotocin diabetic rats, BTC-transfected cells ameliorated hyperglycemia from over 500 to about 200 mg/dL at 35 days post-cell transplantation. In this way, our results clearly demonstrate that BTC overabundance enhances glucose-induced insulin secretion in MSCs in vitro as well as in vivo.

SK3 is an important component of K(+) channels mediating the afterhyperpolarization in cultured rat SCG neurones.

PubMed

Hosseini, R; Benton, D C; Dunn, P M; Jenkinson, D H; Moss, G W

2001-09-01

1. Our aim was to identify the small-conductance Ca(2+)-activated K(+) channel(s) (SK) underlying the apamin-sensitive afterhyperpolarization (AHP) in rat superior cervical ganglion (SCG) neurones. 2. Degenerate oligonucleotide primers designed to the putative calmodulin-binding domain conserved in all mammalian SK channel sequences were employed to detect SK DNA in a cDNA library from rat SCG. Only a single band, corresponding to a fragment of the rSK3 gene, was amplified. 3. Northern blot analysis employing a PCR-generated rSK3 fragment showed the presence of mRNA coding for SK3 in SCG as well in other rat peripheral tissues including adrenal gland and liver. 4. The same rSK3 fragment enabled the isolation of a full-length rSK3 cDNA from the library. Its sequence was closely similar to, but not identical with, that of the previously reported rSK3 gene. 5. Expression of the rSK3 gene in mammalian cell lines (CHO, HEK cells) caused the appearance of a K(+) conductance with SK channel properties. 6. The application of selective SK blocking agents (including apamin, scyllatoxin and newer non-peptidic compounds) showed these homomeric SK3 channels to have essentially the same pharmacological characteristics as the SCG afterhyperpolarization, but to differ from those of homomeric SK1 and SK2 channels. 7. Immunohistochemistry using a rSK3 antipeptide antibody revealed the presence of SK3 protein in the cell bodies and processes of cultured SCG neurones. 8. Taken together, these results identify SK3 as a major component of the SK channels responsible for the afterhyperpolarization of cultured rat SCG neurones.

Molecular cloning of a small prostate protein, known as beta-microsemenoprotein, PSP94 or beta-inhibin, and demonstration of transcripts in non-genital tissues.

PubMed

Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A

1989-11-15

In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.

[Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1996-12-01

The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.

Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

PubMed

Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

2012-01-01

Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

In vitro reestablishment of cell-cell contacts in adult rat cardiomyocytes. Functional role of transmembrane components in the formation of new intercalated disk-like cell contacts.

PubMed

Eppenberger, H M; Zuppinger, C

1999-01-01

Primary adult rat cardiomyocytes (ARC)in culture are shown to be a model system for cardiac cell hypertrophy in vitro. ARC undergo a process of morphological transformation and grow only by increase in cell size, however, without loss of the cardiac phenotype. The isolated cells spread and establish new cell-cell contacts, eventually forming a two-dimensional heart tissue-like synchronously beating cell sheet. The reformation of specific cell contacts (intercalated disks) is shown also between ventricular and atrial cardiomyocytes by using antibodies against the gap junction protein connexin-43 and after microinjection into ARC of N-cadherin cDNA fused to reporter green fluorescent protein (GFP) cDNA. The expressed fusion protein allowed the study of live cell cultures and of the dynamics of the adherens junction protein N-cadherin during the formation of new cell-cell contacts. The possible use of the formed ARC cell-sheet cells under microgravity conditions as a test system for the reformation of the cytoskeleton of heart muscle cells is proposed.

Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

PubMed Central

Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

2010-01-01

It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

FragIdent--automatic identification and characterisation of cDNA-fragments.

PubMed

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

PubMed

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

An anti-tumor protein produced by Trichinella spiralis and identified by screening a T7 phage display library, induces apoptosis in human hepatoma H7402 cells

USDA-ARS?s Scientific Manuscript database

Trichinella spiralis infection confers effective resistance to tumor cell expansion. In this study, a T7 phage cDNA display library was constructed to express genes encoded by T. spiralis. Organic phase multi-cell screening was used to sort through candidate proteins in a transfected human chronic m...

Molecular cloning, characterization and mRNA expression of duck interleukin-17F

USDA-ARS?s Scientific Manuscript database

Interleukin-17F (IL-17F) is a proinflammatory cytokine that plays an important role in gut homeostasis. A full-length duck IL-17F (duIL-17F) cDNA with a 501-bp coding region was identified in ConA-activated splenic lymphocytes. duIL-17F is predicted to encode 166 amino acids, including a 26-amino ...

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Treesearch

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Molecular cloning and expression of a heat-shock cognate 70 (hsc70) gene from swordtail fish ( Xiphophorus helleri)

NASA Astrophysics Data System (ADS)

Li, Ningqiu; Fu, Xiaozhe; Han, Jingang; Shi, Cunbin; Huang, Zhibin; Wu, Shuqin

2013-07-01

Heat shock proteins are a family of molecular chaperones that are involved in many aspects of protein homeostasis. In the present study, a full-length cDNA, encoding the constitutively expressed 70-kDa heat shock cognate protein (Hsc70), was isolated from swordtail fish ( Xiphophorus helleri) and designated as XheHsc70. The Xhehsc70 cDNA was 2 104 bp long with an open reading frame of 1 941 bp, and it encoded a protein of 646 amino acids with a theoretical molecular weight of 70.77 kDa and an isoelectric point of 5.04. The deduced amino acid sequence shared 94.1%-98.6% identities with the Hsc70s from a number of other fish species. Tissue distribution results show that the Xhehsc70 mRNA was expressed in brain, heart, head kidney, kidney, spleen, liver, muscle, gill, and peripheral blood. After immunization with formalin-killed Vibrio alginolyticus cells there was a significant increase in the Xhehsc70 mRNA transcriptional level in the head kidney of the vaccinated fish compared with in the control at 6, 12, 24, and 48 h as shown by quantitative real time RT-PCR. Based on an analysis of the amino acid sequence of XheHsc70, its phylogeny, and Xhehsc70 mRNA expression, XheHsc70 was identified as a member of the cytoplasmic Hsc70 (constitutive) subfamily of the Hsp70 family of heat shock proteins, suggesting that it may play a role in the immune response. The Xhehsc70 cDNA sequence reported in this study was submitted to GenBank under the accession number JF739182.

Expression analysis of HSP70 in the testis of Octopus tankahkeei under thermal stress.

PubMed

Long, Ling-Li; Han, Ying-Li; Sheng, Zhang; Du, Chen; Wang, You-Fa; Zhu, Jun-Quan

2015-09-01

The gene encoding heat shock protein 70 (HSP70) was identified in Octopus tankahkeei by homologous cloning and rapid amplification of cDNA ends (RACE). The full-length cDNA (2471 bp) consists of a 5'-untranslated region (UTR) (89 bp), a 3'-UTR (426 bp), and an open reading frame (1956 bp) that encodes 651 amino acid residues with a predicted molecular mass of 71.8 kDa and an isoelectric point of 5.34. Based on the amino acid sequence analysis and multiple sequence alignment, this cDNA is a member of cytoplasmic hsp70 subfamily of the hsp70 family and was designated as ot-hsp70. Tissue expression analysis showed that HSP70 expression is highest in the testes when all examined organs were compared. Immunohistochemistry analysis, together with hematoxylin-eosin staining, revealed that the HSP70 protein was expressed in all spermatogenic cells, but not in fibroblasts. In addition, O. tankahkeei were heat challenged by exposure to 32 °C seawater for 2 h, then returned to 13 °C for various recovery time (0-24 h). Relative expression of ot-hsp70 mRNA in the testes was measured at different time points post-challenge by quantitative real-time PCR. A clear time-dependent mRNA expression of ot-hsp70 after thermal stress indicates that the HSP70 gene is inducible. Ultrastructural changes of the heat-stressed testis were observed by transmission electron microscopy. We suggest that HSP70 plays an important role in spermatogenesis and testis protection against thermal stress in O. tankahkeei. Copyright © 2015 Elsevier Inc. All rights reserved.

Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

PubMed Central

Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

1988-01-01

In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

PubMed

Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim

2002-04-01

Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.

PubMed

Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M

2013-07-01

Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.

Molecular cloning of hsf1 and hsbp1 cDNAs, and the expression of hsf1, hsbp1 and hsp70 under heat stress in the sea cucumber Apostichopus japonicus.

PubMed

Xu, Dongxue; Sun, Lina; Liu, Shilin; Zhang, Libin; Yang, Hongsheng

2016-08-01

The heat shock response (HSR) is known for the elevated synthesis of heat shock proteins (HSPs) under heat stress, which is mediated primarily by heat shock factor 1 (HSF1). Heat shock factor binding protein 1 (HSBP1) and feedback control of heat shock protein 70 (HSP70) are major regulators of the activity of HSF1. We obtained full-length cDNA of genes hsf1 and hsbp1 in the sea cucumber Apostichopus japonicus, which are the second available for echinoderm (after Strongylocentrotus purpuratus), and the first available for holothurian. The full-length cDNA of hsf1 was 2208bp, containing a 1326bp open reading frame encoding 441 amino acids. The full-length cDNA of hsbp1 was 2850bp, containing a 225bp open reading frame encoding 74 amino acids. The similarities of A. japonicus HSF1 with other species are low, and much higher similarity identities of A. japonicus HSBP1 were shared. Phylogenetic trees showed that A. japonicus HSF1 and HSBP1 were clustered with sequences from S. purpuratus, and fell into distinct clades with sequences from mollusca, arthropoda and vertebrata. Analysis by real-time PCR showed hsf1 and hsbp1 mRNA was expressed constitutively in all tissues examined. The expression of hsf1, hsbp1 and hsp70 in the intestine at 26°C was time-dependent. The results of this study might provide new insights into the regulation of heat shock response in this species. Copyright © 2016. Published by Elsevier Inc.

Characterization of a gene family abundantly expressed in Oenothera organensis pollen that shows sequence similarity to polygalacturonase.

PubMed Central

Brown, S M; Crouch, M L

1990-01-01

We have isolated and characterized cDNA clones of a gene family (P2) expressed in Oenothera organensis pollen. This family contains approximately six to eight family members and is expressed at high levels only in pollen. The predicted protein sequence from a near full-length cDNA clone shows that the protein products of these genes are at least 38,000 daltons. We identified the protein encoded by one of the cDNAs in this family by using antibodies to beta-galactosidase/pollen cDNA fusion proteins. Immunoblot analysis using these antibodies identifies a family of proteins of approximately 40 kilodaltons that is present in mature pollen, indicating that these mRNAs are not stored solely for translation after pollen germination. These proteins accumulate late in pollen development and are not detectable in other parts of the plant. Although not present in unpollinated or self-pollinated styles, the 40-kilodalton to 45-kilodalton antigens are detectable in extracts from cross-pollinated styles, suggesting that the proteins are present in pollen tubes growing through the style during pollination. The proteins are also present in pollen tubes growing in vitro. Both nucleotide and amino acid sequences are similar to the published sequences for cDNAs encoding the enzyme polygalacturonase, which suggests that the P2 gene family may function in depolymerizing pectin during pollen development, germination, and tube growth. Cross-hybridizing RNAs and immunoreactive proteins were detected in pollen from a wide variety of plant species, which indicates that the P2 family of polygalacturonase-like genes are conserved and may be expressed in the pollen from many angiosperms. PMID:2152116

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

Interactions between neutral endopeptidase (EC 3.4.24.11) and the substance P (NK1) receptor expressed in mammalian cells.

PubMed

Okamoto, A; Lovett, M; Payan, D G; Bunnett, N W

1994-05-01

Interactions between neutral endopeptidase-24.11 (NEP) and the substance P receptor (SPR; NK1) were investigated by examining substance P (SP) degradation, SP binding and SP-induced Ca2+ mobilization in epithelial cells transfected with cDNA encoding the rat SPR and rat NEP. Expression of NEP accelerated the degradation of SP by intact epithelial cells and by membrane preparations, and degradation was reduced by the NEP inhibitor thiorphan. In cells expressing SPR alone, specific 125I-SP binding after 20 min incubation at 37 degrees C was 92.2 +/- 3.1% of maximal binding and was unaffected by thiorphan. Coexpression of NEP in the same cells as the SPR markedly reduced SP binding to 13.9 +/- 0.5% of maximal, and binding was increased to 82.7 +/- 2.4% of maximal with thiorphan. Coexpression of NEP in the same cells as the SPR also reduced to undetectable the increase in intracellular Ca2+ in response to low concentrations of SP (0.3 and 0.5 nM), and significantly reduced the response to higher concentrations (1 and 3 nM). The Ca2+ response was restored to control values by inhibition of NEP with thiorphan. In contrast, SP binding and SP-induced Ca2+ mobilization were only slightly reduced when cells expressing SPR alone were mixed with a 3- to 24-fold excess of cells expressing NEP alone. Therefore, in this system, NEP markedly down-regulates SP binding and SP-induced Ca2+ mobilization only when coexpressed in the same cells as the SPR.

L-Arginine Modulates Intestinal Inflammation in Rats Submitted to Mesenteric Ischemia-Reperfusion Injury.

PubMed

Taha, M O; de Oliveira, J V; Dias Borges, M; de Lucca Melo, F; Gualtieri, F G; E Silva Aidar, A L; Pacheco, R L; de Melo Alexandre E Silva, T; Klajner, R K; Iuamoto, L R; Munhoz Torres, L; Morais Mendes de Paula, B J; de Campos, K; Oliveira-Junior, I S; Fagundes, D J

2016-03-01

The goal of this study was to investigate whether exogenous offer of L-arginine (LARG) modulates the gene expression of intestinal dysfunction caused by ischemia and reperfusion. Eighteen Wistar-EPM1 male rats (250-300 g) were anesthetized and subjected to laparotomy. The superior mesenteric vessels were exposed, and the rats were randomized into 3 groups (n = 6): the control group (CG), with no superior mesenteric artery interruption; the ischemia/reperfusion group (IRG), with 60 minutes of ischemia and 120 minutes of reperfusion and saline injections; and the L-arginine group (IRG + LARG), with L-arginine injected in the femoral vein 5 minutes before ischemia, 5 minutes after reperfusion, and after 55 minutes of reperfusion. The total RNA was extracted and purified from samples of the small intestine. The concentration of each total RNA sample was determined by using spectrophotometry. The first-strand complementary DNA (cDNA) was synthesized in equal amounts of cDNA and the Master Mix SYBR Green qPCR Mastermix (SABiosciences, a Qiagen Company, Frederick, Md). Amounts of cDNA and Master Mix SYBR Green qPCR Mastermix were distributed to each well of the polymerase chain reaction microarray plate containing the predispensed gene-specific primer sets for Bax and Bcl2. Each sample was evaluated in triplicate, and the Student t test was applied to validate the homogeneity of each gene expression reaction (P < .05). The gene expression of Bax in IRG (+1.48) was significantly higher than in IRG-LARG (+9.69); the expression of Bcl2L1 in IRG (+1.01) was significantly higher than IRG-LARG (+22.89). The apoptotic cell pathway of 2 protagonists showed that LARG improves the gene expression of anti-apoptotic Bcl2l1 (Bcl2-like 1) more than the pro-apoptotic Bax (Bcl2-associated X protein). Copyright © 2016. Published by Elsevier Inc.

Four rice seed cDNA clones belonging to the alpha-amylase/trypsin inhibitor gene family encode potential rice allergens.

PubMed

Alvarez, A M; Fukuhara, E; Nakase, M; Adachi, T; Aoki, N; Nakamura, R; Matsuda, T

1995-07-01

Four rice seed proteins encoded by cDNAs belonging to the alpha-amylase/trypsin inhibitor gene family were overexpressed as TrpE-fusion proteins in E. coli. The expressed rice proteins were detected by SDS-PAGE as major proteins in bacterial cell lysates. Western blot analyses showed that all the recombinant proteins were immunologically reactive to rabbit polyclonal antibodies and to a mouse monoclonal antibody (25B9) specific for a previously isolated rice allergen of 16 kDa. Some truncated proteins from deletion mutants of the cDNAs retained their reactivity to the specific antibodies. These results suggest that the cDNAs encode potential rice allergens and that some epitopes of the recombinant proteins are still immunoreactive when they are expressed as their fragments.

Localization and physical mapping of genes encoding the A+U-rich element RNA-binding protein AUF1 to human chromosomes 4 and X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagner, B.J.; Long, L.; Pettenati, M.J.

Messenger RNAs encoding many oncoproteins and cytokines are relatively unstable. Their instability, which ensures appropriate levels and timing of expression, is controlled in part by proteins that bind to A + U-rich instability elements (AREs) present in the 3{prime}-untranslated regions of the mRNAs. cDNAs encoding the AUF1 family of ARE-binding proteins were cloned from human and murine cDNA libraries. In the present study monochromosomal somatic cell hybrids were used to localize two AUF1 loci to human chromosomes 4 and X. In situ hybridization analyses using P1 clones as probes identified the 4q21.1-q21.2 and Xq12 regions as the locations of themore » AUF1 genes. 10 refs., 2 figs.« less

Role of pectolytic enzymes in the programmed separation of cells from the root cap of higher plants. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hawes, M.C.

1995-03-01

The objective of this research was to develop a model system to study border cell separation in transgenic pea roots. In addition, the hypothesis that genes encoding pectolytic enzymes in the root cap play a role in the programmed separation of root border cells from the root tip was tested. The following objectives have been accomplished: (1) the use of transgenic hairy roots to study border cell separation has been optimized for Pisum sativum; (2) a cDNA encoding a root cap pectinmethylesterase (PME) has been cloned; (3) PME and polygalacturonase activities in cell walls of the root cap have beenmore » characterized and shown to be correlated with border cell separation. A fusion gene encoding pectate lyase has also been transformed into pea hairy root cells.« less

Purification and cDNA cloning of a protein derived from Flammulina velutipes that increases the permeability of the intestinal Caco-2 cell monolayer.

PubMed

Watanabe, H; Narai, A; Shimizu, M

1999-06-01

A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.

Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

PubMed

Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

2013-11-01

Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

Primary structure of stanniocalcin in two basal Actinopterygii.

PubMed

Amemiya, Yutaka; Youson, John H

2004-01-15

The primary structure of stanniocalcin (STC), the principal product of the corpuscles of Stannius (CS) in ray-finned fishes, was deduced from STC cDNA clones for two species of holostean, the gar, Lepisosteus osseus and the bowfin, Amia calva. Overlapping partial cDNA clones were amplified by polymerase chain reaction (PCR) from single-strand cDNA of the CS. Excluding the poly(A) tail, the cDNAs of 1863 base pairs [bp] (gar) and 914 bp (bowfin) contained the 5' untranslated region followed by the coding region and the 3' untranslated region. Both the gar and bowfin STC cDNA encode a prehormone of 252 amino acids (aa) with a signal peptide of 32 aa and a mature protein of 220 aa. The deduced aa sequence of gar STC shows 87% identity with bowfin STC, 60-72% identity with most vertebrate STCs and 26% identity with mouse STC2. Phylogenetic analysis of the sequences support a view that the gar and bowfin form a monophyletic holostean clade. RT-PCR revealed in the gar and bowfin that, just as in mammals and rainbow trout, the expression of STC mRNA is widely spread in many tissues and organs. Since the gar and bowfin are representatives of the most ancient fishes known to possess CS, the corpuscular-derived STC molecule in fish has had a conserved evolution.

Construction of cDNA expression library of watermelon for isolation of ClWRKY1 transcription factors gene involved in resistance to Fusarium wilt.

PubMed

Yang, Bing-Yan; Huo, Xiu-Ai; Li, Peng-Fei; Wang, Cui-Xia; Duan, Hui-Jun

2014-08-01

Full-length cDNAs are very important for genome annotation and functional analysis of genes. The number of full-length cDNAs from watermelon remains limited. Here we report first the construction of a full-length enriched cDNA library from Fusarium wilt stressed watermelon (Citrullus lanatus Thunb.) cultivar PI296341 root tissues using the SMART method. The titer of primary cDNA library and amplified library was 2.21 x 10(6) and 2.0 x 10(10) pfu/ml, respectively and the rate of recombinant was above 85%. The size of insert fragment ranged from 0.3 to 2.0 kb. In this study, we first cloned a gene named ClWRKY1, which was 1981 bp long and encoded a protein consisting of 394 amino acids. It contained two characteristic WRKY domains and two zinc finger motifs. Quantitative real-time PCR showed that ClWRKY1 expression levels reached maximum level at 12 h after inoculation with Fusarium oxysporum f. sp. niveum. The full-length cDNA library of watermelon root tissues is not only essential for the cloning of genes which are known, but also an initial key for the screening and cloning of new genes that might be involved in resistance to Fusarium wilt.

The cloning and characterization of a localized maternal transcript in Xenopus laevis whose zygotic counterpart is detected in the CNS.

PubMed

Reddy, B A; Kloc, M; Etkin, L D

1992-12-01

We have cloned a cDNA (xlan4) from a Xenopus laevis oocyte cDNA library whose cognate mRNA is localized in the animal pole region of full grown oocytes. The cDNA can be translated in vitro to produce a predicted size protein of 35 kDa and, is also expressed in E. coli as a fusion protein. The conceptual protein encoded by the xlan4 cDNA is 17.5% proline rich and possesses several PEST sequences found in proteins with short half-lives. The xlan4 mRNA is 2.6 kb and during early development its titer decreases until the neurula stage after which it begins to reaccumulate. Northern blots on dissected embryos and in situ hybridization revealed that the zygotic expression is limited to the dorsal axial structures consisting primarily of the CNS. UV irradiation of the vegetal pole region immediately following fertilization that produces ventralized embryos results in a loss of zygotic xlan4 expression. In the adult, xlan4 mRNA is limited primarily to the brain. The presence of this mRNA in animal pole region which contributes to the future neural cell lineages suggests that this gene product may function either in the specification of neural cell types or in a neural specific function.

Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

PubMed

Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

2004-01-01

The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

A novel RET rearrangement (ACBD5/RET) by pericentric inversion, inv(10)(p12.1;q11.2), in papillary thyroid cancer from an atomic bomb survivor exposed to high-dose radiation.

PubMed

Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro

2014-11-01

During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.

Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

PubMed

Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

2016-10-01

A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

1991-05-01

The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

PubMed Central

Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

2012-01-01

Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit peptide sequence) of the full length cDNA from M. alba. PMID:23284650

A new 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene encoding the committed-step enzyme in the MEP pathway from Rauvolfia verticillata.

PubMed

Liao, Zhihua; Chen, Rong; Chen, Min; Yang, Chunxian; Wang, Qiang; Gong, Yifu

2007-01-01

1-Deoxy-D-xylulose 5-phosphate (DXP) reductoisomerase (DXR; EC 1.1.1.267) catalyzes a committed step of the methylerythritol phosphate (MEP) pathway for the biosynthesis of pharmaceutical terpenoid indole alkaloid (TIA) precursors. The full-length cDNA sequence was cloned and characterized from a TIA-producing species, Rauvolfia verticillata, using rapid amplification of cDNA ends (RACE) technique. The new cDNA was named as RvDXR and submitted to GenBank to be assigned with an accession number (DQ779286). The full-length cDNA of RvDXR was 1804 bp containing a 1425 bp open reading frame (ORF) encoding a polypeptide of 474 amino acids with a calculated molecular mass of 51.3 kDa and an isoelectric point of 5.88. Comparative and bioinformatic analyses revealed that RvDXR showed extensive homology with DXRs from other plant species and contained a conserved transit peptide for plastids, an extended Pro-rich region and a highly conserved NADPH-binding motif in its N-terminal region owned by all plant DXRs. The phylogenetic analysis revealed that DXRs had two groups including a plant and bacterial group; RvDXR belonged to angiosperm DXRs that were obtained from Synechocystis through gene transfer according to the phylogenetic analysis. The structural modeling of RvDXR showed that RvDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that RvDXR expressed in all tissues including roots, stems, leaves, fruits and followers but at different levels. The lowest transcription level was observed in followers and the highest transcription was found in fruits of R. verticillata; the transcription level of RvDXR was a little higher in roots and stems than in leaves. The cloning and characterization of RvDXR will be helpful to understand more about the role of DXR involved in R. verticillata TIA biosynthesis at the molecular level and provides a candidate gene for metabolic engineering of the TIAs pathway in R. verticillata.

Association of an SNP in a novel DREB2-like gene SiDREB2 with stress tolerance in foxtail millet [Setaria italica (L.)].

PubMed

Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj

2011-06-01

The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.

Encoding changes in orbitofrontal cortex in reversal-impaired aged rats.

PubMed

Schoenbaum, Geoffrey; Setlow, Barry; Saddoris, Michael P; Gallagher, Michela

2006-03-01

Previous work in rats and primates has shown that normal aging can be associated with a decline in cognitive flexibility mediated by prefrontal circuits. For example, aged rats are impaired in rapid reversal learning, which in young rats depends critically on the orbitofrontal cortex. To assess whether aging-related reversal impairments reflect orbitofrontal dysfunction, we identified aged rats with reversal learning deficits and then recorded single units as these rats, along with unimpaired aged cohorts and young control rats, learned and reversed a series of odor discrimination problems. We found that the flexibility of neural correlates in orbitofrontal cortex was markedly diminished in aged rats characterized as reversal-impaired in initial training. In particular, although many cue-selective neurons in young and aged-unimpaired rats reversed odor preference when the odor-outcome associations were reversed, cue-selective neurons in reversal-impaired aged rats did not. In addition, outcome-expectant neurons in aged-impaired rats failed to become active during cue sampling after learning. These altered features of neural encoding could provide a basis for cognitive inflexibility associated with normal aging.

Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

PubMed

Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

2000-12-01

Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.