Sample records for rat gene encoding

  1. The complete inventory of receptors encoded by the rat natural killer cell gene complex

    PubMed Central

    Flornes, Line M.; Nylenna, Øyvind; Saether, Per C.; Daws, Michael R.; Dissen, Erik


    The natural killer cell gene complex (NKC) encodes receptors belonging to the C-type lectin superfamily expressed primarily by NK cells and other leukocytes. In the rat, the chromosomal region that starts with the Nkrp1a locus and ends with the Ly49i8 locus is predicted to contain 67 group V C-type lectin superfamily genes, making it one of the largest congregation of paralogous genes in vertebrates. Based on physical proximity and phylogenetic relationships between these genes, the rat NKC can be divided into four major parts. We have previously reported the cDNA cloning of the majority of the genes belonging to the centromeric Nkrp1/Clr cluster and the two telomeric groups, the Klre1–Klri2 and the Ly49 clusters. Here, we close the gap between the Nkrp1/Clr and the Klre1–Klri2 clusters by presenting the cDNA cloning and transcription patterns of eight genes spanning from Cd69 to Dectin1, including the novel Clec2m gene. The definition, organization, and evolution of the rat NKC are discussed. Electronic supplementary material The online version of this article (doi:10.1007/s00251-010-0455-y) contains supplementary material, which is available to authorized users. PMID:20544345

  2. Identification and Characterization of a Spliced C-Type Lectin-Like Gene Encoded by Rat Cytomegalovirus

    PubMed Central

    Voigt, Sebastian; Sandford, Gordon R.; Ding, Lijun; Burns, William H.


    The English isolate of rat cytomegalovirus (RCMV) encodes a 20-kDa protein with a C-type lectin-like domain that is expressed in the delayed-early and late phases of the viral replication cycle. Genomic sequence analysis of the restriction fragment KpnR of RCMV revealed significant homology to several C-type lectin-containing molecules implicated in natural killer (NK) and T-cell interactions, as well as genes from four poxviruses and African swine fever virus. The gene is spliced into five exons and shows a splicing pattern with exon boundaries similar to those observed in the human differentiation antigen CD69. The cap site of the gene was mapped by RNase protection, 5′ rapid amplification of cDNA ends, and primer extension experiments. This analysis demonstrated that the core promoter of the RCMV lectin-like gene contains a GATA rather than a TATA box. Splicing patterns were confirmed with isolates from an infected-cell cDNA library. A unique aspect of the protein is that its translation is not initiated by the canonical methionine but rather by alanine. To study its role in virus replication and pathogenesis, a recombinant virus was constructed in which the gene is interrupted. Replication in tissue culture was similar to that of wild-type virus. PMID:11134273

  3. The gene therapy of collagen-induced arthritis in rats by intramuscular administration of the plasmid encoding TNF-binding domain of variola virus CrmB protein.


    Shchelkunov, S N; Taranov, O S; Tregubchak, T V; Maksyutov, R A; Silkov, A N; Nesterov, A E; Sennikov, S V


    Wistar rats with collagen-induced arthritis were intramuscularly injected with the recombinant plasmid pcDNA/sTNF-BD encoding the sequence of the TNF-binding protein domain of variola virus CrmB protein (VARV sTNF-BD) or the pcDNA3.1 vector. Quantitative analysis showed that the histopathological changes in the hind-limb joints of rats were most severe in the animals injected with pcDNA3.1 and much less severe in the group of rats injected with pcDNA/sTNF-BD, which indicates that gene therapy of rheumatoid arthritis is promising in the case of local administration of plasmids governing the synthesis of VARV immunomodulatory proteins. PMID:27599513

  4. Isolation and characterization of a gene from Trypanosoma cruzi encoding a 46-kilodalton protein with homology to human and rat tyrosine aminotransferase.


    Bontempi, E J; Búa, J; Aslund, L; Porcel, B; Segura, E L; Henriksson, J; Orn, A; Pettersson, U; Ruiz, A M


    The complete sequence of a gene encoding a 46-kDa protein of Trypanosoma cruzi is presented. The first ATG complies with the consensus sequence for initiation of translation. A single band of 2 kb was highlighted by hybridizing a probe from the 46-kDa protein gene to a Northern filter containing total T. cruzi RNA. The gene is present in 50-80 copies per cell and most of them are contained in 2 tandem arrays on large T. cruzi chromosomes (> 2000 kb). A strong homology with rat and human tyrosine aminotransferase was detected. Homology with a Trypanosoma brucei retrotransposon was found in the nonsense strand of the intergenic region. PMID:8101971

  5. Shortening and intracellular Ca2+ in ventricular myocytes and expression of genes encoding cardiac muscle proteins in early onset type 2 diabetic Goto-Kakizaki rats.


    Salem, K A; Adrian, T E; Qureshi, M A; Parekh, K; Oz, M; Howarth, F C


    There has been a spectacular rise in the global prevalence of type 2 diabetes mellitus. Cardiovascular complications are the major cause of morbidity and mortality in diabetic patients. Contractile dysfunction, associated with disturbances in excitation-contraction coupling, has been widely demonstrated in the diabetic heart. The aim of this study was to investigate the pattern of cardiac muscle genes that are involved in the process of excitation-contraction coupling in the hearts of early onset (8-10 weeks of age) type 2 diabetic Goto-Kakizaki (GK) rats. Gene expression was assessed in ventricular muscle with real-time RT-PCR; shortening and intracellular Ca(2+) were measured in ventricular myocytes with video edge detection and fluorescence photometry, respectively. The general characteristics of the GK rats included elevated fasting and non-fasting blood glucose and blood glucose at 120 min following a glucose challenge. Expression of genes encoding cardiac muscle proteins (Myh6/7, Mybpc3, Myl1/3, Actc1, Tnni3, Tnn2, Tpm1/2/4 and Dbi) and intercellular proteins (Gja1/4/5/7, Dsp and Cav1/3) were unaltered in GK ventricle compared with control ventricle. The expression of genes encoding some membrane pumps and exchange proteins was unaltered (Atp1a1/2, Atp1b1 and Slc8a1), whilst others were either upregulated (Atp1a3, relative expression 2.61 ± 0.69 versus 0.84 ± 0.23) or downregulated (Slc9a1, 0.62 ± 0.07 versus 1.08 ± 0.08) in GK ventricle compared with control ventricle. The expression of genes encoding some calcium (Cacna1c/1g, Cacna2d1/2d2 and Cacnb1/b2), sodium (Scn5a) and potassium channels (Kcna3/5, Kcnj3/5/8/11/12, Kchip2, Kcnab1, Kcnb1, Kcnd1/2/3, Kcne1/4, Kcnq1, Kcng2, Kcnh2, Kcnk3 and Kcnn2) were unaltered, whilst others were either upregulated (Cacna1h, 0.95 ± 0.16 versus 0.47 ± 0.09; Scn1b, 1.84 ± 0.16 versus 1.11 ± 0.11; and Hcn2, 1.55 ± 0.15 versus 1.03 ± 0.08) or downregulated (Hcn4, 0.16 ± 0.03 versus 0.37 ± 0.08; Kcna2, 0.35 ± 0

  6. Conjugated linoleic acid-enriched butter improved memory and up-regulated phospholipase A2 encoding-genes in rat brain tissue.


    Gama, Marco A S; Raposo, Nádia R B; Mury, Fábio B; Lopes, Fernando C F; Dias-Neto, Emmanuel; Talib, Leda L; Gattaz, Wagner F


    Reduced phospholipase A2 (PLA2) activity has been reported in blood cells and in postmortem brains of patients with Alzheimer disease (AD), and there is evidence that conjugated linoleic acid (CLA) modulates the activity of PLA2 groups in non-brain tissues. As CLA isomers were shown to be actively incorporated and metabolized in the brains of rats, we hypothesized that feeding a diet naturally enriched in CLA would affect the activity and expression of Pla 2 -encoding genes in rat brain tissue, with possible implications for memory. To test this hypothesis, Wistar rats were trained for the inhibitory avoidance task and fed a commercial diet (control) or experimental diets containing either low CLA- or CLA-enriched butter for 4 weeks. After this period, the rats were tested for memory retrieval and killed for tissue collection. Hippocampal expression of 19 Pla 2 genes was evaluated by qPCR, and activities of PLA2 groups (cPLA2, iPLA2, and sPLA2) were determined by radioenzymatic assay. Rats fed the high CLA diet had increased hippocampal mRNA levels for specific PLA2 isoforms (iPla 2 g6γ; cPla 2 g4a, sPla 2 g3, sPla 2 g1b, and sPla 2 g12a) and higher enzymatic activity of all PLA2 groups as compared to those fed the control and the low CLA diet. The increment in PLA2 activities correlated significantly with memory enhancement, as assessed by increased latency in the step-down inhibitory avoidance task after 4 weeks of treatment (rs = 0.69 for iPLA2, P < 0.001; rs = 0.81 for cPLA2, P < 0.001; and rs = 0.69 for sPLA2, P < 0.001). In face of the previous reports showing reduced PLA2 activity in AD brains, the present findings suggest that dairy products enriched in cis-9, trans-11 CLA may be useful in the treatment of this disease. PMID:25913570

  7. [Development genes encoding transcription factors and dysmorphology].


    Lacombe, Didier


    Studies of children with developmental abnormalities of genetic origin are necessary for accurate diagnosis, prognostication, patient management, and genetic counseling. Such studies can also help to identify genes involved in normal and abnormal morphogenesis, which often act as patterning genes and are also potential oncogenes. Many encode transcription factors that regulate other genes during embryonic development. PMID:20120282

  8. Gene encoding plant asparagine synthetase


    Coruzzi, Gloria M.; Tsai, Fong-Ying


    The identification and cloning of the gene(s) for plant asparagine synthetase (AS), an important enzyme involved in the formation of asparagine, a major nitrogen transport compound of higher plants is described. Expression vectors constructed with the AS coding sequence may be utilized to produce plant AS; to engineer herbicide resistant plants, salt/drought tolerant plants or pathogen resistant plants; as a dominant selectable marker; or to select for novel herbicides or compounds useful as agents that synchronize plant cells in culture. The promoter for plant AS, which directs high levels of gene expression and is induced in an organ specific manner and by darkness, is also described. The AS promoter may be used to direct the expression of heterologous coding sequences in appropriate hosts.

  9. Sequence homology between RNAs encoding rat alpha-fetoprotein and rat serum albumin.

    PubMed Central

    Jagodzinski, L L; Sargent, T D; Yang, M; Glackin, C; Bonner, J


    We have determined the sequences of the recombinant DNA inserts of three bacterial plasmid cDNA clones containing most of the rat alpha a-fetoprotein mRNA. The resultant nucleotide sequence of alpha-fetoprotein was exhaustively compared to the nucleotide sequence of the mRNA encoding rat serum albumin. These two mRNAs have extensive homology (50%) throughout and the same intron locations. The amino acid sequence of rat alpha-fetoprotein has been deduced from the nucleotide sequence, and its comparison to rat serum albumin's amino acid sequence reveals a 34% homology. The regularly spaced positions of the cysteines found in serum albumin are conserved in rat alpha-fetoprotein, indicating that these two proteins may have a similar secondary folding structure. These homologies indicate that alpha-fetoprotein and serum albumin were derived by duplication of a common ancestral gene and constitute a gene family. PMID:6167988

  10. Chronic intermittent hypoxia increases encoding pigment epithelium-derived factor gene expression, although not that of the protein itself, in the temporal cortex of rats*,**

    PubMed Central

    Julian, Guilherme Silva; de Oliveira, Renato Watanabe; Favaro, Vanessa Manchim; de Oliveira, Maria Gabriela Menezes; Perry, Juliana Cini; Tufik, Sergio; Chagas, Jair Ribeiro


    Objective: Obstructive sleep apnea syndrome is mainly characterized by intermittent hypoxia (IH) during sleep, being associated with several complications. Exposure to IH is the most widely used animal model of sleep apnea, short-term IH exposure resulting in cognitive and neuronal impairment. Pigment epithelium-derived factor (PEDF) is a hypoxia-sensitive factor acting as a neurotrophic, neuroprotective, and antiangiogenic agent. Our study analyzed performance on learning and cognitive tasks, as well as PEDF gene expression and PEDF protein expression in specific brain structures, in rats exposed to long-term IH. Methods: Male Wistar rats were exposed to IH (oxygen concentrations of 21-5%) for 6 weeks-the chronic IH (CIH) group-or normoxia for 6 weeks-the control group. After CIH exposure, a group of rats were allowed to recover under normoxic conditions for 2 weeks (the CIH+N group). All rats underwent the Morris water maze test for learning and memory, PEDF gene expression and PEDF protein expression in the hippocampus, frontal cortex, and temporal cortex being subsequently assessed. Results: The CIH and CIH+N groups showed increased PEDF gene expression in the temporal cortex, PEDF protein expression remaining unaltered. PEDF gene expression and PEDF protein expression remained unaltered in the frontal cortex and hippocampus. Long-term exposure to IH did not affect cognitive function. Conclusions: Long-term exposure to IH selectively increases PEDF gene expression at the transcriptional level, although only in the temporal cortex. This increase is probably a protective mechanism against IH-induced injury. PMID:25750673

  11. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, P.G.; Ohlrogge, J.B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  12. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, Paul G.; Ohlrogge, John B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  13. Cloning, molecular characterization, and chromosomal assignment of a gene encoding a second D1 dopamine receptor subtype: differential expression pattern in rat brain compared with the D1A receptor.

    PubMed Central

    Tiberi, M; Jarvie, K R; Silvia, C; Falardeau, P; Gingrich, J A; Godinot, N; Bertrand, L; Yang-Feng, T L; Fremeau, R T; Caron, M G


    Multiple D1 dopaminergic receptor subtypes have been postulated on the basis of pharmacological, biochemical, and genetic studies. We describe the isolation and characterization of a rat gene encoding a dopamine receptor that is structurally and functionally similar to the D1 dopamine receptor. The coding region, which is intronless, encodes a protein of 475 amino acids (Mr 52,834) with structural features that are consistent with receptors coupled to guanine nucleotide-binding regulatory proteins. The expressed protein binds dopaminergic ligands and mediates stimulation of adenylyl cyclase with pharmacological properties similar to those of the D1 dopamine receptor. The gene encoding the human homologue of this receptor subtype is located to the short arm of chromosome 4 (4p16.3), the same region as the Huntington disease gene. In striking contrast to the previously cloned D1 receptor, little or no mRNA for the receptor described here was observed in striatum, nucleus accumbens, olfactory tubercle, and frontal cortex. High levels of mRNA for this receptor were found in distinct layers of the hippocampus, the mammillary nuclei, and the anterior pretectal nuclei, brain regions that have been shown to exhibit little or no D1 dopamine receptor binding. On the basis of its properties we propose that this dopamine receptor subtype be called D1B. Images PMID:1831904

  14. Cloning, molecular characterization, and chromosomal assignment of a gene encoding a second D sub 1 dopamine receptor subtype: Differential expression pattern in rat brain compared with the D sup 1A receptor

    SciTech Connect

    Tiberi, M.; Jarvie, K.R.; Silvia, C.; Falardeau, P.; Gingrich, J.A.; Godinot, N.; Bertrand, L.; Fremeau, R.T. Jr.; Caron, M.G. ); Yang-Feng, T.L. )


    Multiple D{sub 1} dopaminergic receptor subtypes have been postulated on the basis of pharmacological, biochemical, and genetic studies. The authors describe the isolation and characterization of a rat gene encoding a dopamine receptor that is structurally and functionally similar to the D{sub 1} dopamine receptor. The coding region, which is intronless, encodes a protein of 475 amino acids (M{sub r} 52,834) with structural features that are consistent with receptors coupled to guanine nucleotide-binding regulatory proteins. The expressed protein binds dopaminergic ligands and mediates stimulation of adenylyl cyclase with pharmacological properties similar to those of the D{sub 1} dopamine receptor. The gene encoding the human homologue of this receptor subtype is located to the short arm of chromosome 4 (4p16.3), the same region as the Huntington disease gene. In striking contrast to the previously cloned D{sub 1} receptor, little or no mRNA for the receptor described here was observed in striatum, nucleus accumbens, olfactory tubercle, and frontal cortex. High levels of mRNA for this receptor were found in distinct layers of the hippocampus, the mammillary nuclei, and the anterior pretectal nuclei, brain regions that have been shown to exhibit little or no D{sub 1} dopamine receptor binding. On the basis of its properties the authors propose that this dopamine receptor subtype be called D{sub 1B}.

  15. TGF-beta transcriptionally activates the gene encoding the high-affinity adenosine transporter CNT2 in rat liver parenchymal cells.


    Valdés, R; Fernández-Veledo, S; Aymerich, I; Casado, F J; Pastor-Anglada, M


    The nucleoside transporter CNT2 is the highest-affinity adenosine transporter identified so far. Recent evidence suggests that CNT2 has functions other than salvage (i.e. modulation of purinergic responses). Here we identified TGF-beta1 as a potent inducer of CNT2 protein expression in liver parenchymal cells. By contrast, CNT1, which is a target of multifunctional cytokines involved in liver cell proliferation, does not respond to TGF-beta1 treatment. Cloning of a murine CNT2 gene sequence with promoter-like activity enabled us to demonstrate that this cytokine exerts this effect by transcriptionally activating the CNT2-encoding gene in a JNK-dependent manner. The evidence that CNT2 is not a target of multifunctional cytokines involved in hepatocyte proliferation, but instead, of a cytokine that plays major roles in differentiation and apoptosis, further supports the view that the main physiological role of this transporter protein is not nucleoside salvage. PMID:17013559

  16. A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription.

    PubMed Central

    Grépin, C; Dagnino, L; Robitaille, L; Haberstroh, L; Antakly, T; Nemer, M


    In contrast to skeletal muscle, the mechanisms responsible for activation and maintenance of tissue-specific transcription in cardiac muscle remain poorly understood. A family of hormone-encoding genes is expressed in a highly specific manner in cardiac but not skeletal myocytes. This includes the A- and B-type natriuretic peptide (ANP and BNP) genes, which encode peptide hormones with crucial roles in the regulation of blood volume and pressure. Since these genes are markers of cardiac cells, we have used them to probe the mechanisms for cardiac muscle-specific transcription. Cloning and functional analysis of the rat BNP upstream sequences revealed unexpected structural resemblance to erythroid but not to muscle-specific promoters and enhancers, including a requirement for regulatory elements containing GATA motifs. A cDNA clone corresponding to a member of the GATA family of transcription factors was isolated from a cardiomyocyte cDNA library. Transcription of this GATA gene is restricted mostly to the heart and is undetectable in skeletal muscle. Within the heart, GATA transcripts are localized in ANP- and BNP-expressing myocytes, and forced expression of the GATA protein in heterologous cells markedly activates transcription from the natural cardiac muscle-specific ANP and BNP promoters. This GATA-dependent pathway defines the first mechanism for cardiac muscle-specific transcription. Moreover, the present findings reveal striking similarities between the mechanisms controlling gene expression in hematopoietic and cardiac cells and may have important implications for studies of cardiogenesis. Images PMID:8164667

  17. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  18. An essential yeast gene with homology to the exonuclease-encoding XRN1/KEM1 gene also encodes a protein with exoribonuclease activity

    SciTech Connect

    Kenna, M.; Douglas, M.G. ); Stevens, A. ); McCammon, M. )


    This is a study of a temperature-sensitive (ts) mutant from Saccharomyces cerevisiae which was obtained in a screen for mutants reduced in the synthesis of binding of a hybrid protein which competes for the transport of protein precursors into mitochondria. Examination of this mutant lead to the characterization of a gene with significant primary sequence homology to a previously identified gene, XRN1 or KEM1. Often called XRN1/KEM1, it encodes a protein of 175kDa which appears to have a multitude of properties, including involvement in recombination, RNA processing and turnover, involvement in recombination, RNA processing and turnover, microtubule function, karyogamy and DNA replication. The related gene describes further characterization of the HKE1/RAT1 gene and an hkal mutant and shows that p116 is a protein having 5[prime]-->3[prime] exoribonuclease activity, a major activity of the product of the related XRN1/KEM1 gene.

  19. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, Jonathan D.; Scott-Craig, John S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  20. Expression cloning of genes encoding human peroxisomal proteins

    SciTech Connect

    Spathaky, J.M.; Tate, A.W.; Cox, T.M.


    Numerous metabolic disorders associated with diverse peroxisomal defects have been identified but their molecular characterization has been hampered by difficulties associated with the purification of proteins from this fragile organelle. We have utilized antibodies directed against the C-terminal tripeptide peroxisomal targeting signal to detect hitherto unknown peroxisomal proteins in tissue fractions and to isolate genes encoding peroxisonal proteins from human expression libraries. We immunized rabbits with a peptide conjugate encompassing the C-terminal nine amino acids of rat peroxisomal acyl CoA oxidase. Immunoprecipitation assays using radio-labelled peptide showed that the antibody specifically recognizes the terminal SKL motif as well as C-terminal SHL and SRL but not SHL at an internal position. Affinity-purified antibody was used to probe Western blots of crude and peroxisome-enriched monkey liver preparations and detected 8-10 proteins specifically in the peroxisome fractions. 100 positive clones were identified on screening a human liver cDNA expression library in {lambda}-gt11. Sequence analysis has confirmed the identity of cDNA clones for human acyl CoA oxidase and epoxide hydrolase. Four clones show no sequence identity and their putative role in the human peroxisome is being explored.

  1. Mapping of a rat multidrug resistance gene by fluorescence in situ hybridization

    SciTech Connect

    Popescu, N.C.; Silverman, J.A.; Thorgeirsson, S.S. )


    A cDNA clone encoding the rat mdr1b (Pgy2) gene was recently isolated and characterized. This gene has a high degree of sequence identity with other Pgy genes, particularly the mouse Pgy2 gene. By means of in situ fluorescence hybridization, the rat Pgy gene was localized on chromosome 4 band q12. This regional mapping will facilitate the identification of synteny groups on rat, mouse, and human genomes and chromosomal rearrangements during mammalian evolution. 17 refs., 2 figs.

  2. Evolutionary relationship of nuclear genes encoding mitochondrial proteins across grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Comparative genome studies were done across taxa to provide a basic understanding of genome evolution regarding nuclear genes encoding for mitochondrial proteins and their conservation in grass species. Two different mitochondria-related gene sets, one from rice and another from Arabidopsis, were us...

  3. Organization and evolution of the rat tyrosine hydroxylase gene

    SciTech Connect

    Brown, E.R.; Coker, G.T. III; O'Malley, K.L.


    This report describes the organization of the rat tyrosine hydroxylase (TH) gene and compares its structure with the human phenylalanine hydroxylase gene. Both genes are single copy and contain 13 exons separated by 12 introns. Remarkably, the positions of 10 out 12 intron/exon boundaries are identical for the two genes. These results support the idea that these hydroxylases genes are members of a gene family which has a common evolutionary origin. The authors predict that this ancestral gene would have encoded exons similar to those of TH prior to evolutionary drift to other members of this gene family.

  4. Three rat preprotachykinin mRNAs encode the neuropeptides substance P and neurokinin A.

    PubMed Central

    Krause, J E; Chirgwin, J M; Carter, M S; Xu, Z S; Hershey, A D


    Synthetic oligonucleotides were used to screen a rat striatal cDNA library for sequences corresponding to the tachykinin peptides substance P and neurokinin A. The cDNA library was constructed from RNA isolated from the rostral portion of the rat corpus striatum, the site of striatonigral cell bodies. Two types of cDNAs were isolated and defined by restriction enzyme analysis and DNA sequencing to encode both substance P and neurokinin A. The two predicted preprotachykinin protein precursors (130 and 115 amino acids in length) differ from each other by a pentadecapeptide sequence between the two tachykinin sequences, and both precursors possess appropriate processing signals for substance P and neurokinin A production. The presence of a third preprotachykinin mRNA of minor abundance in rat striatum was established by S1 nuclease protection experiments. This mRNA encodes a preprotachykinin of 112 amino acids containing substance P but not neurokinin A. These three mRNAs are derived from one rat gene as a result of differential RNA processing; thus, this RNA processing pattern further increases the diversity of products that can be generated from the preprotachykinin gene. Images PMID:2433692

  5. Trichoderma asperellum Chi42 Genes Encode Chitinase

    PubMed Central

    Quang, Hoang Tan; Hung, Nguyen Bao; Huy, Nguyen Duc; Phuong, Truong Thi Bich; Ha, Tran Thi Thu


    Four Trichoderma strains (CH2, SH16, PQ34, and TN42) were isolated from soil samples collected from Quang Tri and Thua Thien Hue provinces in Vietnam. The strains exhibited high chitinolytic secretion. Strain PQ34 formed the largest zone of chitinase-mediated clearance (> 4 cm in diameter) in agar containing 1% (w/v) colloidal chitin. Analysis of the internal transcribed spacer regions of these strains indicated that they were Trichoderma asperellum. The molecular weights of the chitinases were approximately 42 kDa. Chitinase genes (chi42) of T. asperellum strains TN42, CH2, SH16, and PQ34 were 98~99% homologous to the ech42 gene of T. harzianum CB-Pin-01 (accession No. DQ166036). The deduced amino acid sequences of both T. asperellum strains SH16 and TN42 shared 100% similarity. PMID:22783101

  6. A reanalysis of mouse ENCODE comparative gene expression data

    PubMed Central

    Gilad, Yoav; Mizrahi-Man, Orna


    Recently, the Mouse ENCODE Consortium reported that comparative gene expression data from human and mouse tend to cluster more by species rather than by tissue. This observation was surprising, as it contradicted much of the comparative gene regulatory data collected previously, as well as the common notion that major developmental pathways are highly conserved across a wide range of species, in particular across mammals. Here we show that the Mouse ENCODE gene expression data were collected using a flawed study design, which confounded sequencing batch (namely, the assignment of samples to sequencing flowcells and lanes) with species. When we account for the batch effect, the corrected comparative gene expression data from human and mouse tend to cluster by tissue, not by species. PMID:26236466

  7. Selection for genes encoding secreted proteins and receptors.

    PubMed Central

    Klein, R D; Gu, Q; Goddard, A; Rosenthal, A


    Extracellular proteins play an essential role in the formation, differentiation, and maintenance of multicellular organisms. Despite that, the systematic identification of genes encoding these proteins has not been possible. We describe here a highly efficient method to isolate genes encoding secreted and membrane-bound proteins by using a single-step selection in yeast. Application of this method, termed signal peptide selection, to various tissues yielded 559 clones that appear to encode known or novel extracellular proteins. These include members of the transforming growth factor and epidermal growth factor protein families, endocrine hormones, tyrosine kinase receptors, serine/threonine kinase receptors, seven transmembrane receptors, cell adhesion molecules, extracellular matrix proteins, plasma proteins, and ion channels. The eventual identification of most, or all, extracellular signaling molecules will advance our understanding of fundamental biological processes and our ability to intervene in disease states. Images Fig. 1 PMID:8692953

  8. (Structure and expression of nuclear genes encoding rubisco activase)

    SciTech Connect

    Zielinski, R.E.


    Our activities during the past year have centered around two basic aspects of the project: describing more thoroughly the diurnal and light irradiance effects on activase gene expression in barley; and isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Three appendices are included that summarize these activities.

  9. Functions Encoded by Pyrrolnitrin Biosynthetic Genes from Pseudomonas fluorescens

    PubMed Central

    Kirner, Sabine; Hammer, Philip E.; Hill, D. Steven; Altmann, Annett; Fischer, Ilona; Weislo, Laura J.; Lanahan, Mike; van Pée, Karl-Heinz; Ligon, James M.


    Pyrrolnitrin is a secondary metabolite derived from tryptophan and has strong antifungal activity. Recently we described four genes, prnABCD, from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin. In the work presented here, we describe the function of each prn gene product. The four genes encode proteins identical in size and serology to proteins present in wild-type Pseudomonas fluorescens, but absent from a mutant from which the entire prn gene region had been deleted. The prnA gene product catalyzes the chlorination of l-tryptophan to form 7-chloro-l-tryptophan. The prnB gene product catalyzes a ring rearrangement and decarboxylation to convert 7-chloro-l-tryptophan to monodechloroaminopyrrolnitrin. The prnC gene product chlorinates monodechloroaminopyrrolnitrin at the 3 position to form aminopyrrolnitrin. The prnD gene product catalyzes the oxidation of the amino group of aminopyrrolnitrin to a nitro group to form pyrrolnitrin. The organization of the prn genes in the operon is identical to the order of the reactions in the biosynthetic pathway. PMID:9537395

  10. Cloning of human genes encoding novel G protein-coupled receptors

    SciTech Connect

    Marchese, A.; Docherty, J.M.; Heiber, M.


    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  11. (Genetic engineering with a gene encoding a soybean storage protein)

    SciTech Connect

    Beachy, R.N.


    We have isolated and characterized a gene which encodes the alpha prime subunit of beta conglycinin. This gene was fully sequenced by DNA sequence analysis and a report of that work was prepared and submitted for publication in early November 1985. This represented the culmination of several years of research effort by several scientists. A preprint of that work is attached to this report and has been offered by Dr. J.J. Doyle, Dr. Mary A. Schuler and Dr. Jerry Slighton, as well as myself. This paper is a comparison of the alpha prime subunit gene with a similar gene from phaseolus vulgaris, the common garden bean. In this paper we compare the sequences that are 5' of the gene, and which would represent the transcriptional promoter, as well as the sequences within the structural region of the gene. The sequence paper also compares the amino acid sequence of these two genes with that of other genes from Phaseolus, peas and from soybeans. On the basis of this comparison, we predict evolutionary trends within the multigene families which encode these proteins in the various plants, as well as to look at the protein itself to try to predict regions of the protein that might have functional significance. All of this work was done on a prior DOE-BER grant and has simply been reported here for the first time.

  12. Spatially Distributed Local Fields in the Hippocampus Encode Rat Position

    PubMed Central

    Agarwal, Gautam; Stevenson, Ian H.; Berényi, Antal; Mizuseki, Kenji; Buzsáki, György; Sommer, Friedrich T.


    Although neuronal spikes can be readily detected from extracellular recordings, synaptic and subthreshold activity remains undifferentiated within the local field potential (LFP). In the hippocampus, neurons discharge selectively when the rat is at certain locations, while LFPs at single anatomical sites exhibit no such place-tuning. Nonetheless, because the representation of position is sparse and distributed, we hypothesized that spatial information can be recovered from multiple-site LFP recordings. Using high-density sampling of LFP and computational methods, we show that the spatiotemporal structure of the theta rhythm can encode position as robustly as neuronal spiking populations. Because our approach exploits the rhythmicity and sparse structure of neural activity, features found in many brain regions, it is useful as a general tool for discovering distributed LFP codes. PMID:24812401

  13. A complex gene superfamily encodes actin in petunia.

    PubMed Central

    Baird, W V; Meagher, R B


    We have shown by several independent criteria that actin is encoded by a very large and complex superfamily of genes in Petunia. Several cDNA and genomic probes encoding actins from diverse organisms (Dictyostelium, Drosophila, chicken and soybean) hybridize to hundreds of restriction fragments in the petunia genome. Actin-hybridizing sequences were isolated from a petunia genomic library at a rate of at least 200 per genome equivalent. Twenty randomly selected actin-hybridizing clones were characterized in more detail. DNA sequence data from four representative and highly divergent clones, PAc2, PAc3, PAc4 and PAc7, demonstrate that these actin-like sequences are related to functional actin genes. Intron positions typical of other known plant actin genes are conserved in these clones. Four of six clones analyzed (PAc1, PAc2, PAc3, PAc4) hybridize to leaf mRNA of the same size (1.7 kb) as that reported for other plant actin mRNAs and to a slightly smaller mRNA species (1.5 kb). Five distinct subfamilies of actin-related genes were characterized which varied in size from a few members to several dozen members. It is clear from our data that other actin gene subfamilies must also exist within the genome. Possible mechanisms of actin gene amplification and genome turnover are discussed. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3428258

  14. Expression of genes encoding extracellular matrix proteins: A macroarray study

    PubMed Central



    Endometrial cancer (EC) is one of the most common gynecological malignancies in Poland, with well-established risk factors. Genetic instability and molecular alterations responsible for endometrial carcinogenesis have been systematically investigated. The aim of the present study was to investigate, by means of cDNA macroarrays, the expression profiles of genes encoding extracellular matrix (ECM) proteins in ECs. Tissue specimens were collected during surgical procedures from 40 patients with EC, and control tissue was collected from 9 patients with uterine leiomyomas. RNA was isolated and RT-PCR with radioisotope-labeled cDNA was performed. The levels of ECM protein gene expression in normal endometrial tissues were compared to the expression of these genes in EC specimens. Statistically significant differences in gene expression, stratified by clinical stage of the ECs, were detected for aggrecan, vitronectin, tenascin R, nidogen and two collagen proteins: type VIII chain α1 and type XI chain α2. All of these proteins were overexpressed in stage III endometrial carcinomas compared to levels in stage I and II uterine neoplasms. In conclusion, increased expression of genes encoding ECM proteins may play an important role in facilitating accelerated disease progression of human ECs. PMID:25231141

  15. Cloning and regulation of the rat mdr2 gene.

    PubMed Central

    Brown, P C; Thorgeirsson, S S; Silverman, J A


    We have cloned the complete cDNA encoding the rat mdr2 gene by a combination of library screening and the polymerase chain reaction. The sequence of rat mdr2 cDNA is highly similar to other members of the mdr gene family but the initiation of transcription, tissue distribution and regulation of expression of rat mdr2 diverge from the other isoforms. Primer extension analysis showed rat mdr2 mRNA to have a major transcription start point at -277 and a minor one at approximately -518. We constructed gene specific probes for rat mdr2 and mdr1b and compared the expression patterns of these two genes. The highest expression of mdr2 mRNA was in the muscle, heart, liver and spleen. Both mdr2 and 1b mRNA levels were elevated in the livers of rats treated with CCl4 or following partial hepatectomies although the time course of induction of each gene differed. Mdr1b increased by 12 to 24 hours while mdr2 did not increase until 48 hours. Treatment of isolated hepatocytes or RC3 cells with cycloheximide did not effect mdr2 mRNA. In contrast, mdr1b expression was increased. These data suggest that rat mdr2, unlike mdr1b, is not regulated by a negative trans-acting protein factor. Images PMID:8103593

  16. Identification of the gene encoding the mitochondrial elongation factor G in mammals.

    PubMed Central

    Barker, C; Makris, A; Patriotis, C; Bear, S E; Tsichlis, P N


    Protein synthesis in cytosolic and rough endoplasmic reticulum associated ribosomes is directed by factors, many of which have been well characterized. Although these factors have been the subject of intense study, most of the corresponding factors regulating protein synthesis in the mitochondrial ribosomes remain unknown. In this report we present the cloning and initial characterization of the gene encoding the rat mitochondrial elongation factor-G (rEF-Gmt). The rat gene encoding EF-Gmt (rMef-g) maps to rat chromosome 2 and it is expressed in all tissues with highest levels in liver, thymus and brain. Its DNA sequence predicts a 752 amino acid protein exhibiting 72% homology to the yeast Saccharomyces cerevisiae mitochondrial elongation factor-G (YMEF-G), 62% and 61% homology to the Thermus thermophilus and E. coli elongation factor-G (EF-G) respectively and 52% homology to the rat elongation factor-2 (EF-2). The deduced amino acid sequence of EF-G contains characteristic motifs shared by all GTP binding proteins. Therefore, similarly to other elongation factors, the enzymatic function of EF-Gmt is predicted to depend on GTP binding and hydrolysis. EF-Gmt differs from its cytoplasmic homolog, EF-2, in that it contains an aspartic acid residue at amino acid position 621 which corresponds to the EF-2 histidine residue at position 715. Since this histidine residue, following posttranslational modification into diphthamide, appears to be the sole cellular target of diphtheria toxin and Pseudomonas aeruginosa endotoxin A, we conclude that EF-Gmt will not be inactivated by these toxins. The severe effects of these toxins on protein elongation in tissues expressing EF-Gmt suggest that EF-Gmt and EF-2 exhibit nonoverlapping functions. The cloning and characterization of the mammalian mitochondrial elongation factor G will permit us to address its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction. Images

  17. Kluyveromyces lactis genome harbours a functional linker histone encoding gene.


    Staneva, Dessislava; Georgieva, Milena; Miloshev, George


    Linker histones are essential components of chromatin in eukaryotes. Through interactions with linker DNA and nucleosomes they facilitate folding and maintenance of higher-order chromatin structures and thus delicately modulate gene activity. The necessity of linker histones in lower eukaryotes appears controversial and dubious. Genomic data have shown that Schizosaccharomyces pombe does not possess genes encoding linker histones while Kluyveromyces lactis has been reported to have a pseudogene. Regarding this controversy, we have provided the first direct experimental evidence for the existence of a functional linker histone gene, KlLH1, in K. lactis genome. Sequencing of KlLH1 from both genomic DNA and copy DNA confirmed the presence of an intact open reading frame. Transcription and splicing of the KlLH1 sequence as well as translation of its mRNA have been studied. In silico analysis revealed homology of KlLH1p to the histone H1/H5 protein family with predicted three domain structure characteristic for the linker histones of higher eukaryotes. This strongly proves that the yeast K. lactis does indeed possess a functional linker histone gene thus entailing the evolutionary preservation and significance of linker histones. The nucleotide sequences of KlLH1 are deposited in the GenBank under accession numbers KT826576, KT826577 and KT826578. PMID:27189369

  18. Structure and chromosomal localization of the gene (BDKRB2) encoding human bradykinin B{sub 2} receptor

    SciTech Connect

    Jian-Xing Ma; Dan-Zhao Wang; Limei Chen


    The bradykinin B{sub 2} receptor (BDKRB2) has high affinity for the intact kinins, which mediate a wide spectrum of biological effects, including pain, inflammation, vasodilation, and smooth muscle contraction and relaxation. In the present study, the authors have cloned and sequenced the gene encoding human bradykinin B{sub 2} receptor from a human genomic library. The B{sub 2} receptor gene contains three exons separated by two introns. The first and second exons are noncoding, while the third exon contains the full-length coding region, which encodes a protein of 364 amino acids forming 7 transmembrane domains. The human B{sub 2} gene shares high sequence identity with rat and mouse B{sub 2} receptor genes and significant similarity with the gene encoding the angiotensin II type I receptor in the nucleotide sequence and exon-intron arrangement. In the 5` flanking region, a consensus TATA box and several putative transcription factor-binding sites have been identified. Genomic Southern blot analysis showed that the B{sub 2} receptor is encoded by a single-copy gene that was localized to chromosome 14q32 by in situ hybridization. In a Southern blot analysis following reverse transcription and polymerase chain reaction, the human B{sub 2} receptor was found to be expressed in most human tissues. 30 refs., 7 figs.

  19. Alteration of gene expression in rat colon mucosa after exercise.


    Buehlmeyer, K; Doering, F; Daniel, H; Kindermann, B; Schulz, T; Michna, H


    The development of colon cancer is highly influenced by lifestyle factors such as nutrition and physical inactivity. Detailed biological mechanisms are thus far unclear. The purpose of this study was to investigate the effects of regular treadmill exercise on gene expression in rat colon mucosa. For this purpose, 6-week-old male Wistar rats completed a stress-free voluntary treadmill exercise period of 12 weeks. Sedentary rats served as a control group. In the colon mucosa, steady-state mRNA expression levels of approximately 10,000 genes were compared between both groups by micro-array analysis (MWG rat 10K array). A total of 8846 mRNAs were detected above background level. Regular exercise led to a decreased expression of 47 genes at a threshold-factor of 2.0. Three genes were found to be up-regulated in the exercise group. The identified genes encode proteins involved in signal transduction (n=11), transport (n=8), immune system (n=7), cytoskeleton (n=6), protein targeting (n=6), metabolism (n=5), transcription (n=3) and vascularization (n=2). Among the genes regulated by regular exercise, the betaine-homocysteine methyltransferase 2 (BHMT2) seems to be of particular interest. Physical activity may protect against aberrant methylation by repressing the BHMT2 gene and thus contribute to a decreased risk of developing colon cancer. We have also identified vascular endothelial growth factor (VEGF), angiopoietin-2 (ANG-2) and calcium-independent phospholipase a2 (iPL-A2), all of them with markedly reduced transcript levels in the mucosa of active rats. In summary, our experiment presents the first gene expression pattern in rat colon mucosa following regular treadmill activity and represents an important step in understanding the molecular mechanisms responsible for the preventive effect of physical activity on the development of colon cancer. PMID:18342145

  20. Genome-wide analysis of NBS-encoding disease resistance genes in Cucumis sativus and phylogenetic study of NBS-encoding genes in Cucurbitaceae crops

    PubMed Central


    Background Plant nucleotide-binding site (NBS)-leucine-rich repeat (LRR) proteins encoded by resistance genes play an important role in the responses of plants to various pathogens, including viruses, bacteria, fungi, and nematodes. In this study, a comprehensive analysis of NBS-encoding genes within the whole cucumber genome was performed, and the phylogenetic relationships of NBS-encoding resistance gene homologues (RGHs) belonging to six species in five genera of Cucurbitaceae crops were compared. Results Cucumber has relatively few NBS-encoding genes. Nevertheless, cucumber maintains genes belonging to both Toll/interleukine-1 receptor (TIR) and CC (coiled-coil) families. Eight commonly conserved motifs have been established in these two families which support the grouping into TIR and CC families. Moreover, three additional conserved motifs, namely, CNBS-1, CNBS-2 and TNBS-1, have been identified in sequences from CC and TIR families. Analyses of exon/intron configurations revealed that some intron loss or gain events occurred during the structural evolution between the two families. Phylogenetic analyses revealed that gene duplication, sequence divergence, and gene loss were proposed as the major modes of evolution of NBS-encoding genes in Cucurbitaceae species. Compared with NBS-encoding sequences from the Arabidopsis thaliana genome, the remaining seven TIR familes of NBS proteins and RGHs from Cucurbitaceae species have been shown to be phylogenetically distinct from the TIR family of NBS-encoding genes in Arabidopsis, except for two subfamilies (TIR4 and TIR9). On the other hand, in the CC-NBS family, they grouped closely with the CC family of NBS-encoding genes in Arabidopsis. Thus, the NBS-encoding genes in Cucurbitaceae crops are shown to be ancient, and NBS-encoding gene expansions (especially the TIR family) may have occurred before the divergence of Cucurbitaceae and Arabidopsis. Conclusion The results of this paper will provide a genomic framework

  1. Human xeroderma pigmentosum group G gene encodes a DNA endonuclease.

    PubMed Central

    Habraken, Y; Sung, P; Prakash, L; Prakash, S


    Because of defective nucleotide excision repair of ultraviolet damaged DNA, xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers. Cell fusion studies have identified seven XP complementation groups, A to G. Previous studies have implicated the products of these seven XP genes in the recognition of ultraviolet-induced DNA damage and in incision of the damage-containing DNA strand. Here, we express the XPG-encoded protein in Sf9 insect cells and purify it to homogeneity. We demonstrate that XPG is a single-strand specific DNA endonuclease, thus identifying the catalytic role of the protein in nucleotide excision repair. We suggest that XPG nuclease acts on the single-stranded region created as a result of the combined action of the XPB helicase and XPD helicase at the DNA damage site. Images PMID:8078765

  2. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica


    Jarvis, Eric E.; Roessler, Paul G.


    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  3. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica


    Jarvis, E.E.; Roessler, P.G.


    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

  4. Characterization of a plasmid-encoded urease gene cluster found in members of the family Enterobacteriaceae.


    D'Orazio, S E; Collins, C M


    Plasmid-encoded urease gene clusters found in uropathogenic isolates of Escherichia coli, Providencia stuartii, and Salmonella cubana demonstrated DNA homology, similar positions of restriction endonuclease cleavage sites, and manners of urease expression and therefore represent the same locus. DNA sequence analysis indicated that the plasmid-encoded urease genes are closely related to the Proteus mirabilis urease genes. PMID:8449894

  5. Zebrafish tyrosine hydroxylase 2 gene encodes tryptophan hydroxylase.


    Ren, Guiqi; Li, Song; Zhong, Hanbing; Lin, Shuo


    The primary pathological hallmark of Parkinson disease (PD) is the profound loss of dopaminergic neurons in the substantia nigra pars compacta. To facilitate the understanding of the underling mechanism of PD, several zebrafish PD models have been generated to recapitulate the characteristics of dopaminergic (DA) neuron loss. In zebrafish studies, tyrosine hydroxylase 1 (th1) has been frequently used as a molecular marker of DA neurons. However, th1 also labels norepinephrine and epinephrine neurons. Recently, a homologue of th1, named tyrosine hydroxylase 2 (th2), was identified based on the sequence homology and subsequently used as a novel marker of DA neurons. In this study, we present evidence that th2 co-localizes with serotonin in the ventral diencephalon and caudal hypothalamus in zebrafish embryos. In addition, knockdown of th2 reduces the level of serotonin in the corresponding th2-positive neurons. This phenotype can be rescued by both zebrafish th2 and mouse tryptophan hydroxylase 1 (Tph1) mRNA as well as by 5-hydroxytryptophan, the product of tryptophan hydroxylase. Moreover, the purified Th2 protein has tryptophan hydroxylase activity comparable with that of the mouse TPH1 protein in vitro. Based on these in vivo and in vitro results, we conclude that th2 is a gene encoding for tryptophan hydroxylase and should be used as a marker gene of serotonergic neurons. PMID:23754283

  6. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.


    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  7. Genomic organization of the human NSP gene, prototype of a novel gene family encoding reticulons

    SciTech Connect

    Roebroek, A.J.M.; Ayoubi, T.A.Y.; Velde, H.J.K. van de; Schoenmakers, E.F.P.M.; Pauli, I.G.L.; Van De Ven, W.J.M.


    Recently, cDNA cloning and expression of three mRNA variants of the human NSP gene were described. This neuroendocrine-specific gene encodes three NSP protein isoforms with unique amino-terminal parts, but common carboxy-terminal parts. The proteins, with yet unknown function, are associated with the endoplasmic reticulum and therefore are named NSP reticulons. Potentially, these proteins are neuroendocrine markers of a novel category in human lung cancer diagnosis. Here, the genomic organization of this gene was studied by analysis of genomic clones isolated from lambda phage and YAC libraries. The NSP exons were found to be dispersed over a genomic region of about 275 kb. The present elucidation of the genomic organization of the NSP gene explains the generation of NSP mRNA variants encoding NSP protein isoforms. Multiple promoters rather than alternative splicing of internal exons seem to be involved in this diversity. Furthermore, comparison of NSP genomic and cDNA sequences with databank nucleotide sequences resulted in the discovery of other human members of this novel family of reticulons encoding genes. 25 refs., 4 figs.

  8. Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Pseudomonas putida.

    PubMed Central

    Allison, S L; Phillips, A T


    The hutC gene of Pseudomonas putida encodes a repressor which, in combination with the inducer urocanate, regulates expression of the five structural genes necessary for conversion of histidine to glutamate, ammonia, and formate. The nucleotide sequence of the hutC region was determined and found to contain two open reading frames which overlapped by one nucleotide. The first open reading frame (ORF1) appeared to encode a 27,648-dalton protein of 248 amino acids whose sequence strongly resembled that of the hut repressor of Klebsiella aerogenes (A. Schwacha and R. A. Bender, J. Bacteriol. 172:5477-5481, 1990) and contained a helix-turn-helix motif that could be involved in operator binding. The gene was preceded by a sequence which was nearly identical to that of the operator site located upstream of hutU which controls transcription of the hutUHIG genes. The operator near hutC would presumably allow the hut repressor to regulate its own synthesis as well as the expression of the divergent hutF gene. A second open reading frame (ORF2) would encode a 21,155-dalton protein, but because this region could be deleted with only a slight effect on repressor activity, it is not likely to be involved in repressor function or structure. PMID:2203753

  9. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.


    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  10. A transforming function of the BARF1 gene encoded by Epstein-Barr virus.

    PubMed Central

    Wei, M X; Ooka, T


    We report a new rodent cell-transforming gene, presumably involved in viral replication, encoded by Epstein-Barr virus. We previously showed that the corresponding open reading frame BARF1 is transcribed before the onset of viral DNA synthesis, and translated into a 33 kd early polypeptide (p33). Here we show that recombinant plasmids containing the BARF1 induce morphological change, anchorage-independent growth and tumorigenic transformation of established mouse fibroblast lines. The BARF1-transformed cells and the tumour tissues isolated from new-born rats after injection of such transformed cell both express p33. Transforming activity was obtained from either the genomic fragment or the cDNA sequence. Images PMID:2555151

  11. (Genetic engineering with a gene encoding a soybean storage protein). Progress report

    SciTech Connect

    Beachy, R.N.


    Progress is reported on research directed toward introducing a gene (Gmg 17.1) encoding the ..cap alpha..'-subunit of ..beta..-conglycinin, a soybean seed protein, into petunia plants using gene transfer mechanisms. (ACR)

  12. The maize brittle 1 gene encodes amyloplast membrane polypeptides.


    Sullivan, T D; Kaneko, Y


    A chimeric protein, formed of 56 amino acids from the carboxy terminus of the maize (Zea mays L.) wild-type Brittle1 (Bt1) protein fused to the glutathione-S-transferase gene, was synthesized in Escherichia coli, and used to raise antibodies. Following affinity purification, the antibodies recognized a set of 38- to 42-kDa proteins in endosperm from wild-type Bt1 plants, as well as from brittle2, shrunken2 and sugary1 plants, but not in mutant bt1 endosperm. Bt1 proteins were not detected with the preimmune antibodies. A low level of Bt1-specific proteins was detected at 10 d after pollination (DAP) and increased to a plateau at 16 DAP. At the same time, the ratio of slow- to fast-migrating forms of the protein decreased. During endosperm fractionation by differential centrifugation and membrane sedimentation in sucrose gradients, the Bt1 proteins co-purified with the carotenoid-containing plastid membranes. They were localized to amyloplasts by electron-microscopic immunocytochemistry; most of the signal was detected at the plastid periphery. These results are consistent with predictions made from the deduced amino-acid sequence and previous in-vitro experiments that the bt1 locus encodes amyloplast membrane proteins. PMID:7647682

  13. Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

    SciTech Connect

    Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J.


    Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryotic expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.

  14. Praja1, a novel gene encoding a RING-H2 motif in mouse development.


    Mishra, L; Tully, R E; Monga, S P; Yu, P; Cai, T; Makalowski, W; Mezey, E; Pavan, W J; Mishra, B


    As part of a cloning strategy to identify genes involved in early mouse liver development we have isolated Praja1, a gene with similar sequences to the Drosophila melanogaster gene goliath (gl) which is involved in the fate of mesodermal cells ultimately forming gut musculatures, fat body, and the heart. Praja1 is a 2.1 kb gene encoding a putative 396 amino acid ORF and includes a COOH-terminal RING-H2 domain. Using the Jackson Laboratory BSS panel, we have localized Praja1 on chromosome X at 36 cM, which may be a candidate gene for mouse sla (sex linked sideroblastic anemia), near the X inactivation center gene, Xist. Northern blot analysis demonstrated three transcripts (3.1, 2.6 and 2.1 kb) in mRNA from adult mouse tissues brain, liver, and kidney as well as in mRNA from developing mouse embryos (days 7, 11, 15 and 17 post coitus, p.c.). In vitro transcription/translation yielded a product with an Mr of 59 kD. Immunohistochemical staining of in vitro liver explant cultures using a heterologous antibody against praja1 demonstrated cytoplasmic staining of cuboidal cells that have hepatocyte morphology and organization. The presence of the RING-H2 domain, a proline-rich region at the COOH-end, and regions rich in acidic amino acids, leads to the hypothesis that the Praja1 product is possibly involved in mediating protein-protein interactions, possibly as part of a protein sorting or transport pathway. This is strengthened by the similarity of Praja1 to rat Neurodap1, whose product has been shown to localize to the endoplasmic reticulum and golgi in brain. PMID:9393880

  15. The rolB gene activates the expression of genes encoding microRNA processing machinery.


    Bulgakov, Victor P; Veremeichik, Galina N; Shkryl, Yuri N


    The rolB gene of Agrobacterium rhizogenes renders cells more tolerant of environmental stresses and increases their defense potential. However, these effects, coupled with the developmental abnormalities caused by rolB, have not yet been explained. In rolB-transformed Arabidopsis thaliana cells, we detected a 2.2 to 7-fold increase in the expression of genes encoding core and accessory proteins (DCL1, SE, HYL1, AGO1, TGH, DDL, HEN1, AGO4 and RDR2) of the microRNA processing machinery. However, the rolB gene did not affect the expression of DCL2, DCL3 and HST. The diverse and complex effects of rolB on transformed plant cells may be attributable to changes caused by this gene in particular RNA silencing pathways. PMID:25491479

  16. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima)

    PubMed Central

    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming


    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4–0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  17. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima).


    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming


    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4-0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  18. DNA sequence of a gene encoding a BALB/c mouse Ld transplantation antigen.


    Moore, K W; Sher, B T; Sun, Y H; Eakle, K A; Hood, L


    The sequence of a gene, denoted 27.5, encoding a transplantation antigen for the BALB/c mouse has been determined. Gene transfer studies and comparison of the translated sequence with the partial amino acid sequence of the Ld transplantation antigen establish that gene 27.5 encodes an Ld polypeptide. A comparison of the gene 27.5 sequence with several complementary DNA sequences suggests that the BALB/c mouse may contain a number of closely related L-like genes. Gene 27.5 has eight exons that correlate with the structural domains of the transplantation antigen. PMID:7058332

  19. A rat brain mRNA encoding a transcriptional activator homologous to the DNA binding domain of retroviral integrases.

    PubMed Central

    Duilio, A; Zambrano, N; Mogavero, A R; Ammendola, R; Cimino, F; Russo, T


    We have isolated a rat cDNA, named FE65, hybridizing to an mRNA of about 2,300 nucleotides present in rat brain, undetectable in rat liver and very poorly represented in other tissues. An mRNA of the same size is present in human neuroblastoma cells and is absent from other human cell lines. The FE65 cDNA contains an open reading frame (ORF) coding for a polypeptide of 499 amino acids in which 143 residues can be aligned with the DNA binding domain of the integrases encoded by mammalian immunodeficiency viruses. The remaining part of the FE65 ORF is not homologous with the correspondent regions of the integrases; the first 206 residues of the FE65 ORF show numerous negative charges and a short sequence not dispensable for the function of the transactivating acidic domain of the jun family transcriptional factors. A plasmid which expresses FE65 amino acids 1-232 fused to the yeast GAL4 DNA binding domain was co-transfected with a plasmid containing five GAL4 binding sites upstream of a minimal Adenovirus promoter controlling the expression of the CAT gene. This experiment showed that the fused protein GAL4-FE65 is able to obtain a 30-40 fold increase of the CAT gene expression compared to the expression observed in the presence of the GAL4 DNA binding domain alone. Two types of FE65 mRNA are present in rat brain, differing only for six nucleotides. We demonstrate that this is the consequence of a neuron-specific alternative splicing of a six-nucleotide miniexon, which is also present in the human genome, in an intron/exon context very similar to that of the rat FE65 gene. Images PMID:1923810

  20. Phylogeny and molecular dating of the cerato-platanin-encoding genes

    PubMed Central

    Yu, Hanying; Li, Lin


    The cerato-platanin family consists of proteins that can induce immune responses, cause necrosis, change chemotaxis and locomotion and may be related to the growth and development of various fungi. In this work, we analyzed the phylogenetic relationships among genes encoding members of the cerato-platanin family and computed the divergence times of the genes and corresponding fungi. The results showed that cerato-platanin-encoding genes could be classified into 10 groups but did not cluster according to fungal classes or their functions. The genes transferred horizontally and showed duplication. Molecular dating and adaptive evolution analyses indicated that the cerato-platanin gene originated with the appearance of saprophytes and that the gene was under positive selection. This finding suggests that cerato-platanin-encoding genes evolved with the development of fungal parasitic characteristics. PMID:25071408

  1. SurfaceomeDB: a cancer-orientated database for genes encoding cell surface proteins.


    de Souza, Jorge Estefano Santana; Galante, Pedro Alexandre Favoretto; de Almeida, Renan Valieris Bueno; da Cunha, Julia Pinheiro Chagas; Ohara, Daniel Takatori; Ohno-Machado, Lucila; Old, Lloyd J; de Souza, Sandro José


    Cell surface proteins (CSPs) are excellent targets for the development of diagnostic and therapeutic reagents, and it is estimated that 10-20% of all genes in the human genome encode CSPs. In an effort to integrate all data publicly available for genes encoding cell surface proteins, a database (SurfaceomeDB) was developed. SurfaceomeDB is a gene-centered portal containing different types of information, including annotation for gene expression, protein domains, somatic mutations in cancer, and protein-protein interactions for all human genes encoding CSPs. SurfaceomeDB was implemented as an integrative and relational database in a user-friendly web interface, where users can search for gene name, gene annotation, or keywords. There is also a streamlined graphical representation of all data provided and links to the most important data repositories and databases, such as NCBI, UCSC Genome Browser, and EBI. PMID:23390370

  2. The fatty acid desaturase 3 gene encodes for different FADS3 protein isoforms in mammalian tissues

    PubMed Central

    Pédrono, Frédérique; Blanchard, Hélène; Kloareg, Maela; D'andréa, Sabine; Daval, Stéphanie; Rioux, Vincent; Legrand, Philippe


    In 2000, Marquardt et al. (A. Marquardt, H. Stöhr, K. White, and B. H. F. Weber. 2000. cDNA cloning, genomic structure, and chromosomal localization of three members of the human fatty acid desaturase family. Genomics. 66: 176–183.) described the genomic structure of the fatty acid desaturase (FADS) cluster in humans. This cluster includes the FADS1 and FADS2 genes encoding, respectively, for the Δ5- and Δ6-desaturases involved in polyunsaturated fatty acid biosynthesis. A third gene, named FADS3, has recently been identified but no functional role has yet been attributed to the putative FADS3 protein. In this study, we investigated the FADS3 occurrence in rat tissues by using two specific polyclonal antibodies directed against the N-terminal and C-terminal ends of rat FADS3. Our results showed three potential protein isoforms of FADS3 (75 kDa, 51 kDa, and 37 kDa) present in a tissue-dependent manner. The occurrence of these FADS3 isoforms did not depend on the mRNA level determined by real-time PCR. In parallel, mouse tissues were also tested and showed the same three FADS3 isoforms but with a different tissue distribution. Finally, we reported the existence of FADS3 in human cells and tissues but different new isoforms were identified. To conclude, we showed in this study that FADS3 does exist under multiple protein isoforms depending on the mammalian tissues. These results will help further investigations to determine the physiological function of FADS3. PMID:19752397

  3. The Drosophila gene escargot encodes a zinc finger motif found in snail-related genes.


    Whiteley, M; Noguchi, P D; Sensabaugh, S M; Odenwald, W F; Kassis, J A


    Two independent P-element enhancer detection lines were obtained that express lacZ in a pattern of longitudinal stripes early in germband elongation. In this paper, molecular and genetic characterization of a gene located near these transposons is presented. Sequence analysis of a cDNA clone from the region reveals that this gene has a high degree of similarity with the Drosophila snail gene (Boulay et al., 1987). The sequence similarity extends over 400 nucleotides, and includes a region encoding five tandem zinc finger motifs (72% nucleotide identity; 76% amino acid identity). This region is also conserved in the snail homologue from Xenopus laevis (76% nucleotide identity; 83% amino acid identity) (Sargent and Bennett, 1990). We have named the Drosophila snail-related gene escargot (esg), and the region of sequence conservation common to all three genes the 'snailbox'. A number of Drosophila genomic DNA fragments cross-hybridize to a probe from the snailbox region suggesting that snail and escargot are members of a multigene family. The expression pattern of escargot is dynamic and complex. Early in germband elongation, escargot RNA is expressed in a pattern of longitudinal stripes identical to the one observed in the two enhancer detection lines. Later in development, escargot is expressed in cells that will form the larval imaginal tissues, escargot is allelic with l(2)35Ce, an essential gene located near snail in the genome. PMID:1571289

  4. Molecular cloning and transcriptional analysis of the Aspergillus terreus gla1 gene encoding a glucoamylase.

    PubMed Central

    Ventura, L; González-Candelas, L; Pérez-González, J A; Ramón, D


    The Aspergillus terreus gla1 gene, coding for a glucoamylase, has been cloned by heterologous hybridization. The gene is interrupted by four introns and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The expression of the gene is induced by starch and maltose and repressed by glucose. PMID:7534054

  5. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.


    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B


    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates. PMID:23441914

  6. Cloning, sequencing, and expression of bacteriophage BF23 late genes 24 and 25 encoding tail proteins.

    PubMed Central

    Nakayama, S; Kaneko, T; Ishimaru, H; Moriwaki, H; Mizobuchi, K


    Two bacteriophage BF23 late genes, genes 24 and 25, were isolated on a 7.4-kb PstI fragment from the phage DNA, and their nucleotide sequences were determined. Gene 24 encodes a minor tail protein with the expected M(r) of 34,309, and gene 25 located 4 bp upstream of gene 24 encodes a major tail protein with the expected M(r) of 50,329. When total cellular RNA isolated from either phage-infected cells or cells bearing the cloned genes was analyzed by the primer extension method using the primers specific to either gene 25 or gene 24, we identified a possible late gene promoter, designated P25, in the 5'-flanking region of gene 25. This promoter was similar in structure to Escherichia coli promoters for sigma 70. Studies of the translational gene 25- and gene 24-lacZ fusions in the cloned gene system revealed that the promoter P25 was responsible for the expression of both genes 25 and 24 even in the absence of the regulatory genes which were absolutely required for late gene expression in the normal phage-infected cells. These results indicate that the two genes constitute an operon under the control of P25 and that the regulatory gene products of BF23 do not participate directly in specifying the late gene promoter. Images PMID:7961500

  7. A single gene encodes a selective toxin causal to the development of tan spot of wheat.

    PubMed Central

    Ciuffetti, L M; Tuori, R P; Gaventa, J M


    The identification and characterization of pathogenicity factors are essential to an understanding of the molecular events that regulate the interaction of plant-pathogenic microbes with their hosts. We have isolated the gene that encodes a host-selective toxic protein produced by the fungus Pyrenophora tritici-repentis and confirmed that this gene functions in the plant as the primary determinant of pathogenicity in the Pyrenophora-wheat interaction. These results demonstrate that a single gene encodes the production of a host-selective toxin and that transformation of this gene into a non-toxin-producing isolate of P. tritici-repentis leads to both toxin production and pathogenicity. PMID:9061946

  8. RAmy2A; a novel alpha-amylase-encoding gene in rice.


    Huang, N; Reinl, S J; Rodriguez, R L


    The structure and expression of the alpha-amylase-encoding gene, RAmy2A, are described. This only representative of the Amy2 subfamily in rice differs from other cereal alpha-amylase-encoding genes in several respects. It contains the largest introns of all the cereal alpha-amylase-encoding genes examined to date. Moreover, the second of three introns in this gene contains a long inverted repeat sequence that can potentially form a large and stable stem-loop structure in the unspliced RNA transcript. Finally, RAmy2A is constitutively expressed at very low levels in germinated seeds, root, etiolated leaves, immature seeds and callus. This is in marked contrast to the Amy2 genes of wheat and barley which are highly expressed in the aleurone layer of the germinated seeds. PMID:1541400

  9. Divergence of genes encoding non-specific lipid transfer proteins in the poaceae family.


    Jang, Cheol Seong; Jung, Jae Hyeong; Yim, Won Cheol; Lee, Byung-Moo; Seo, Yong Weon; Kim, Wook


    The genes encoding non-specific lipid transfer proteins (nsLTPs), members of a small multigene family, show a complex pattern of expressional regulation, suggesting that some diversification may have resulted from changes in their expression after duplication. In this study, the evolution of nsLTP genes within the Poaceae family was characterized via a survey of the pseudogenes and unigenes encoding the nsLTP in rice pseudomolecules and the NCBI unigene database. nsLTP-rich regions were detected in the distal portions of rice chromosomes 11 and 12; these may have resulted from the most recent large segmental duplication in the rice genome. Two independent tandem duplications were shown to occur within the nsLTP-rich regions of rice. The genomic distribution of the nsLTP genes in the rice genome differs from that in wheat. This may be attributed to gene migration, chromosomal rearrangement, and/or differential gene loss. The genomic distribution pattern of nsLTP genes in the Poaceae family points to the existence of some differences among cereal nsLTP genes, all of which diverged from an ancient gene. The unigenes encoding nsLTPs in each cereal species are clustered into five groups. The somewhat different distribution of nsLTP-encoding EST clones between the groups across cereal species imply that independent duplication(s) followed by subfunctionalization (and/or neofunctionalization) of the nsLTP gene family in each species occurred during speciation. PMID:17978574

  10. A highly divergent gene cluster in honey bees encodes a novel silk family

    PubMed Central

    Sutherland, Tara D.; Campbell, Peter M.; Weisman, Sarah; Trueman, Holly E.; Sriskantha, Alagacone; Wanjura, Wolfgang J.; Haritos, Victoria S.


    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1–4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins. PMID:17065612

  11. The effects of clobazam treatment in rats on the expression of genes and proteins encoding glucronosyltransferase 1A/2B (UGT1A/2B) and multidrug resistance‐associated protein-2 (MRP2), and development of thyroid follicular cell hypertrophy

    SciTech Connect

    Miyawaki, Izuru Tamura, Akitoshi; Matsumoto, Izumi; Inada, Hiroshi; Kunimatsu, Takeshi; Kimura, Juki; Funabashi, Hitoshi


    Clobazam (CLB) is known to increase hepatobiliary thyroxine (T4) clearance in Sprague–Dawley (SD) rats, which results in hypothyroidism followed by thyroid follicular cell hypertrophy. However, the mechanism of the acceleration of T4-clearance has not been fully investigated. In the present study, we tried to clarify the roles of hepatic UDP-glucronosyltransferase (UGT) isoenzymes (UGT1A and UGT2B) and efflux transporter (multidrug resistance–associated protein-2; MRP2) in the CLB-induced acceleration of T4-clearance using two mutant rat strains, UGT1A-deficient mutant (Gunn) and MRP2-deficient mutant (EHBR) rats, especially focusing on thyroid morphology, levels of circulating hormones (T4 and triiodothyronine (T3)) and thyroid-stimulating hormone (TSH), and mRNA or protein expressions of UGTs (Ugt1a1, Ugt1a6, and Ugt2b1/2) and MRP2 (Mrp). CLB induced thyroid morphological changes with increases in TSH in SD and Gunn rats, but not in EHBR rats. T4 was slightly decreased in SD and Gunn rats, and T3 was decreased in Gunn rats, whereas these hormones were maintained in EHBR rats. Hepatic Ugt1a1, Ugt1a6, Ugt2b1/2, and Mrp2 mRNAs were upregulated in SD rats. In Gunn rats, UGT1A mRNAs (Ugt1a1/6) and protein levels were quite low, but UGT2B mRNAs (Ugt2b1/2) and protein were prominently upregulated. In SD and Gunn rats, MRP2 mRNA and protein were upregulated to the same degree. These results suggest that MRP2 is an important contributor in development of the thyroid cellular hypertrophy in CLB-treated rats, and that UGT1A and UGT2B work in concert with MRP2 in the presence of MRP2 function to enable the effective elimination of thyroid hormones. -- Highlights: ► Role of UGT and MRP2 in thyroid pathology was investigated in clobazam-treated rats. ► Clobazam induced thyroid cellular hypertrophy in SD and Gunn rats, but not EHBR rats. ► Hepatic Mrp2 gene and protein were upregulated in SD and Gunn rats, but not EHBR rats. ► Neither serum thyroid hormones (T3/T4

  12. Gene expression in rat brain.


    Milner, R J; Sutcliffe, J G


    191 randomly selected cDNA clones prepared from rat brain cytoplasmic poly (A)+ RNA were screened by Northern blot hybridization to rat brain, liver and kidney RNA to determine the tissue distribution, abundance and size of the corresponding brain mRNA. 18% hybridized to mRNAs each present equally in the three tissues, 26% to mRNAs differentially expressed in the tissues, and 30% to mRNAs present only in the brain. An additional 26% of the clones failed to detect mRNA in the three tissues at an abundance level of about 0.01%, but did contain rat cDNA as demonstrated by Southern blotting; this class probably represents rare mRNAs expressed in only some brain cells. Therefore, most mRNA expressed in brain is either specific to brain or otherwise displays regulation. Rarer mRNA species tend to be larger than the more abundant species, and tend to be brain specific; the rarest, specific mRNAs average 5000 nucleotides in length. Ten percent of the clones hybridize to multiple mRNAs, some of which are expressed from small multigenic families. From these data we estimate that there are probably at most 30,000 distinct mRNA species expressed in the rat brain, the majority of which are uniquely expressed in the brain. PMID:6193485

  13. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    SciTech Connect

    Parke, D.; Ornston, L.N.


    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  14. Identification and characterization of rat Bcl9l gene in silico.


    Katoh, Yuriko; Katoh, Masaru


    Drosophila wingless (wg), shaggy (sgg), armadillo (arm), legless (lgs), pygopus (pygo), pangolin (pan), and engrailed (en) are segment polarity genes implicated in Wg-Arm (WNT-beta-catenin) pathway. Drosophila lgs encodes nuclear scaffold protein functioning as positive regulator for Wg-Arm pathway. Cancer-associated genes BCL9 and BCL9L are human homologs for Drosophila lgs. Here, we identified and characterized rat Bcl9l gene by using bioinformatics. Rat Bcl9l gene, consisting of eight exons, was located within AC124034.4 and AC105645.5 genome sequences. Bcl9l gene was linked to Blr1 gene at rat chromosome 8q22 in the tail-to-tail manner with an interval less than 2 kb. Rat Bcl9l gene was found to encode a 1494-aa Bcl9l protein, which showed 97.7% and 94.2% total-amino-acid identity with mouse Bcl9l and human BCL9L, respectively. B9H1-B9H6 domains, originally identified as conserved regions among mammalian BCL9 and BCL9L homologs, were also identified within rat Bcl9l. B9H1 and B9H2 domains corresponded to HD1 and HD2 domains of Drosophila lgs, functioning as binding regions for Pygo and Arm, respectively. B9H4 domain was characterized by multiple Ser-Pro repeats. Thr 954 within B9H4 domain of rat Bcl9l was conserved in mammalian BCL9 and BCL9L homologs. Phylogenetic analysis revealed that mammalian Bcl9l homologs were more related to human BCL9 than to Drosophila lgs. This is the first report on rat Bcl9l gene. PMID:15703843

  15. Expression of liver carnitine palmitoyltransferase I and II genes during development in the rat.

    PubMed Central

    Thumelin, S; Esser, V; Charvy, D; Kolodziej, M; Zammit, V A; McGarry, D; Girard, J; Pegorier, J P


    The enzyme activity and the expression (protein and mRNA concentrations) of genes encoding for hepatic carnitine palmitoyl-transferases (CPT) I and II were studied during neonatal development, in response to nutritional state at weaning and during the fed-starved transition in adult rats. The activity, the protein concentration and the level of mRNA encoding CPT I are low in foetal-rat liver and increase 5-fold during the first day of extra-uterine life. The activity and gene expression of CPT I are high during the entire suckling period, in the liver of 30-day-old rats weaned at 20 days on to a high-fat diet and in the liver of 48 h-starved adult rats. The activity and CPT I gene expression are markedly decreased in the liver of rats weaned on to a high-carbohydrate diet. By contrast, the activity, the protein concentration and the level of mRNA encoding CPT II are already high in the liver of term foetuses and remain at this level throughout the suckling period, irrespective of the nutritional state of the animals either at weaning or in the adult. Images Figure 1 Figure 2 PMID:8002965

  16. NBS-LRR-Encoding genes in sorghum and their role in plant defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nucleotide-binding site leucine-rich repeats (NBS-LRR) proteins are encoded by a large class of plant genes and many of them play an important role in plant defense against pest attack. Identification and characterization of the whole set of NBS-LRR genes in a plant genome will provide insights int...

  17. Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.


    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V


    The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. PMID:25816930

  18. Regulation of nuclear genes encoding mitochondrial proteins in Saccharomyces cerevisiae.

    PubMed Central

    Brown, T A; Evangelista, C; Trumpower, B L


    Selection for mutants which release glucose repression of the CYB2 gene was used to identify genes which regulate repression of mitochondrial biogenesis. We have identified two of these as the previously described GRR1/CAT80 and ROX3 genes. Mutations in these genes not only release glucose repression of CYB2 but also generally release respiration of the mutants from glucose repression. In addition, both mutants are partially defective in CYB2 expression when grown on nonfermentable carbon sources, indicating a positive regulatory role as well. ROX3 was cloned by complementation of a glucose-inducible flocculating phenotype of an amber mutant and has been mapped as a new leftmost marker on chromosome 2. The ROX3 mutant has only a modest defect in glucose repression of GAL1 but is substantially compromised in galactose induction of GAL1 expression. This mutant also has increased SUC2 expression on nonrepressing carbon sources. We have also characterized the regulation of CYB2 in strains carrying null mutation in two other glucose repression genes, HXK2 and SSN6, and show that HXK2 is a negative regulator of CYB2, whereas SSN6 appears to be a positive effector of CYB2 expression. PMID:7592476

  19. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.


    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman


    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes. PMID:22733202

  20. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.


    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629


    Technology Transfer Automated Retrieval System (TEKTRAN)

    The elongated internode (ein) mutation of Brassica rapa leads to a deficiency in immunochemically detectable phytochrome B. Molecular analysis of the PHYB gene from ein indicates a deletion in the flanking DNA 5' of the ATG start codon, which could interfere either with PHYB transcription or process...

  2. The Novelty of Human Cancer/Testis Antigen Encoding Genes in Evolution

    PubMed Central

    Dobrynin, Pavel; Matyunina, Ekaterina; Malov, S. V.; Kozlov, A. P.


    In order to be inherited in progeny generations, novel genes should originate in germ cells. Here, we suggest that the testes may play a special “catalyst” role in the birth and evolution of new genes. Cancer/testis antigen encoding genes (CT genes) are predominantly expressed both in testes and in a variety of tumors. By the criteria of evolutionary novelty, the CT genes are, indeed, novel genes. We performed homology searches for sequences similar to human CT in various animals and established that most of the CT genes are either found in humans only or are relatively recent in their origin. A majority of all human CT genes originated during or after the origin of Eutheria. These results suggest relatively recent origin of human CT genes and align with the hypothesis of the special role of the testes in the evolution of the gene families. PMID:23691492

  3. Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong


    The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

  4. The bat gene of Halobacterium halobium encodes a trans-acting oxygen inducibility factor.

    PubMed Central

    Gropp, F; Betlach, M C


    Oxygen and light affect the expression of the bacterioopsin gene (bop), which encodes a light-driven proton pump in the purple membrane of Halobacterium halobium. This response is thought to be mediated by a set of genes located adjacent to the bop gene. DNA fragments containing either the bop gene or the entire bop gene cluster reversed the phenotype of purple membrane-deficient strains with mutations in the bop gene. Purple membrane synthesis was constitutive in one of these strains transformed with the bop gene alone. The same strain transformed with the bop gene cluster was inducible by low oxygen tension. Moreover, another strain that constitutively expresses purple membrane remained constitutive when transformed with the bop gene alone but the phenotype of the strain changed to inducible when transformed with the bop gene cluster. Additional experiments have confirmed that one of the genes of the bop gene cluster, the bat gene, encodes a trans-acting factor that is necessary and sufficient to confer inducibility of purple membrane synthesis by low oxygen tension. Images PMID:8202511

  5. The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene.

    PubMed Central

    Purves, F C; Spector, D; Roizman, B


    Earlier studies have shown that a herpes simplex virus 1 (HSV-1) open reading frame, US3, encodes a novel protein kinase and have characterized the cognate amino acid sequence which is phosphorylated by this enzyme. This report identifies an apparently essential viral phosphoprotein whose posttranslational processing involves the viral protein kinase. Analyses of viral proteins phosphorylated in the course of productive infection revealed a phosphoprotein whose mobility was viral protein kinase and serotype dependent. Thus, the corresponding HSV-1 and HSV-2 phosphoproteins differ in their electrophoretic mobilities, and the phosphoprotein specified by the HSV-1 mutant deleted in US3 (R7041) differs from that of the corresponding HSV-1 and HSV-2 proteins. Analyses of HSV-1 x HSV-2 recombinants mapped the phosphoprotein between 0.42 and 0.47 map units on the prototype HSV-1 DNA map. Within this region, the UL34 open reading frame was predicted to encode a protein of appropriate molecular weight which would also contain the consensus target site for phosphorylation by the viral protein kinase as previously defined with synthetic peptides. Replacement of the native UL34 gene with a UL34 gene tagged with a 17-amino-acid epitope from the alpha 4 protein identified this gene as encoding the phosphoprotein. Finally, mutagenesis of the predicted phosphorylation site on UL34 in the viral genome, and specifically the substitution of threonine or serine with alanine in the product of the UL34 gene, yielded phosphoproteins whose electrophoretic mobilities could not be differentiated from that of the US3- mutant. We conclude that the posttranslational processing of the UL34 gene product to its wild-type phenotype requires the participation of the viral protein kinase. While the viral protein kinase is not essential for viral replication in cells in culture, the UL34 gene product itself may not be dispensable. Images PMID:1656069

  6. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd


    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  7. The gene encoding topoisomerase II from Plasmodium falciparum.

    PubMed Central

    Cheesman, S; McAleese, S; Goman, M; Johnson, D; Horrocks, P; Ridley, R G; Kilbey, B J


    The gene for topoisomerase II has been isolated from genomic libraries of strain K1 of the human malarial parasite, Plasmodium falciparum. The sequence reveals an open reading frame of 4194 nucleotides which predicts a polypeptide of 1398 amino acids. There are apparently no introns. The sequence is present as a single copy which has an identity of 47.4% and a similarity of 65.4% with its human homologue. Sequences conserved in topoisomerase II from other species are present in Pftopoisomerase II but in addition it has two adjacent asparagine-rich insertions which are unique to it. We have also detected asparagine-rich regions in the gene for PfDNA polymerase alpha. The gene for Pftopoisomerase II has been localised to chromosome 14 and northern analysis reveals a transcript of 5.8 kb. Two independent antisera raised in mice against glutathione-S-transferase fusion proteins containing the amino terminal portion of the malarial protein detect a weak band on western blots at about 160kDa, the expected size of the protein. Use of the same antisera for immunofluorescence analysis suggests that the protein is present at all stages of intraerythrocytic growth of the parasite. Images PMID:8041616

  8. Molecular Cloning of Spergen-4, Encoding a Spermatogenic Cell-Specific Protein Associated with Sperm Flagella and the Acrosome Region in Rat Spermatozoa.


    Howida, Ali; Salaheldeen, Elsaid; Iida, Hiroshi


    We used a differential display in combination with complementary DNA (cDNA) cloning approach to isolate a novel rat gene LOC690919 with an open reading frame of 1227-length nucleotides encoding a protein of 409 amino acids. This gene was designated as Spergen-4 (a spermatogenic cell-specific gene-4). Spergen-4 mRNA was highly expressed in testis, and its expression was detected in rat testis starting at three weeks of postnatal development and persisting up to adulthood. Mouse and human orthologs, which lack N-terminal 77 amino acid residues of rat Spegen-4, were found in the database. Immunofluorescence microscopy and immunoblot analysis demonstrated that Spergen-4 was not expressed in spermatogonia, spermatocytes, and round spermatids, but was restrictedly detected at sperm head, cytoplasm, and developing flagella of elongated spermatids in rat testis. In mature spermatozoa, Spergen-4 was detected at the acrosome region as well as the principal piece of flagella. Spergen-4 immunosignal disappeared from sperm heads on acrosome reaction induced by progesterone. These data suggest that Spergen-4 integrated into elongated spermatids during spermiogenesis serves as a constituent for acrosome region and flagella of rat spermatozoa. PMID:27032685

  9. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.


    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  10. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus).


    Yue, Jia-Xing; Holland, Nicholas D; Holland, Linda Z; Deheyn, Dimitri D


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  11. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    NASA Astrophysics Data System (ADS)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  12. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    PubMed Central

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  13. Human and rat mast cell high-affinity immunoglobulin E receptors: Characterization of putative. alpha. -chain gene products

    SciTech Connect

    Shimizu, Akira; Benfey, P.N.; Leder, P. ); Tepler, I. Brigham and Women's Hospital, Boston, MA ); Berenstein, E.H.; Siraganian, R.P. )


    The authors have cloned and determined the entire nucleotide sequence of cDNAs corresponding to the putative {alpha} subunits of the human and rat mast cell high-affinity IgE receptors. Both human and rat cDNAs encode an NH{sub 2}-terminal signal peptide, two immunoglobulin-like extracellular domains (encoded by discrete exons), a hydrophobic transmembrane region, and a positively charged cytoplasmic tail. The human and rat {alpha} subunits share an overall homology with one another and the immunoglobulin gene family, suggesting that they arose from a common ancestral gene and continue to share structural homology with their ligands. In addition, the rat gene is transcribed into at least three distinct forms, each of which yields a somewhat different coding sequence.

  14. Analysis of genes encoding an alternative nitrogenase in the archaeon Methanosarcina barkeri 227.


    Chien, Y T; Auerbuch, V; Brabban, A D; Zinder, S H


    Methanosarcina barkeri 227 possesses two clusters of genes potentially encoding nitrogenases. We have previously demonstrated that one cluster, called nif2, is expressed under molybdenum (Mo)-sufficient conditions, and the deduced amino acid sequences for nitrogenase structural genes in that cluster most closely resemble those for the Mo nitrogenase of the gram-positive eubacterium Clostridium pasteurianum. The previously cloned nifH1 from M. barkeri shows phylogenetic relationships with genes encoding components of eubacterial Mo-independent eubacterial alternative nitrogenases and other methanogen nitrogenases. In this study, we cloned and sequenced nifD1 and part of nifK1 from M. barkeri 227. The deduced amino acid sequence encoded by nifD1 from M. barkeri showed great similarity with vnfD gene products from vanadium (V) nitrogenases, with an 80% identity at the amino acid level with the vnfD gene product from Anabaena variabilis. Moreover, there was a small open reading frame located between nifD1 and nifK1 with clear homology to vnfG, a hallmark of eubacterial alternative nitrogenases. Stimulation of diazotrophic growth of M. barkeri 227 by V in the absence of Mo was demonstrated. The unusual complement of nif genes in M. barkeri 227, with one cluster resembling that from a gram-positive eubacterium and the other resembling a eubacterial V nitrogenase gene cluster, suggests horizontal genetic transfer of those genes. PMID:10809706

  15. Sexual Dimorphism in the Expression of Mitochondria-Related Genes in Rat Heart at Different Ages

    PubMed Central

    Vijay, Vikrant; Han, Tao; Moland, Carrie L.; Kwekel, Joshua C.; Fuscoe, James C.; Desai, Varsha G.


    Cardiovascular disease (CVD) is the leading cause of mortality worldwide. Moreover, sex and age are considered major risk factors in the development of CVDs. Mitochondria are vital for normal cardiac function, and regulation of mitochondrial structure and function may impact susceptibility to CVD. To identify potential role of mitochondria in sex-related differences in susceptibility to CVD, we analyzed the basal expression levels of mitochondria-related genes in the hearts of male and female rats. Whole genome expression profiling was performed in the hearts of young (8-week), adult (21-week), and old (78-week) male and female Fischer 344 rats and the expression of 670 unique genes related to various mitochondrial functions was analyzed. A significant (p<0.05) sexual dimorphism in expression levels of 46, 114, and 41 genes was observed in young, adult and old rats, respectively. Gene Ontology analysis revealed the influence of sex on various biological pathways related to cardiac energy metabolism at different ages. The expression of genes involved in fatty acid metabolism was significantly different between the sexes in young and adult rat hearts. Adult male rats also showed higher expression of genes associated with the pyruvate dehydrogenase complex compared to females. In young and adult hearts, sexual dimorphism was not noted in genes encoding oxidative phosphorylation. In old rats, however, a majority of genes involved in oxidative phosphorylation had higher expression in females compared to males. Such basal differences between the sexes in cardiac expression of genes associated with energy metabolism may indicate a likely involvement of mitochondria in susceptibility to CVDs. In addition, female rats showed lower expression levels of apoptotic genes in hearts compared to males at all ages, which may have implications for better preservation of cardiac mass in females than in males. PMID:25615628

  16. Experimental strategies for cloning or identifying genes encoding DNA-binding proteins.


    Carey, Michael F; Peterson, Craig L; Smale, Stephen T


    This article describes experimental strategies for cloning or identifying genes encoding DNA-binding proteins. DNA-binding proteins are most commonly identified by electrophoretic mobility-shift assay (EMSA) or DNase I footprinting. To identify the gene encoding a protein detected by EMSA or DNase footprinting, the protein often needs to be purified and its sequence analyzed, as described here. Other methods are also available which do not resort to protein purification, including the one-hybrid screen, in vitro expression library screen, and mammalian expression cloning. These methods are outlined, and their advantages and disadvantages are discussed. PMID:22301659

  17. Human Genetic Disorders Caused by Mutations in Genes Encoding Biosynthetic Enzymes for Sulfated Glycosaminoglycans*

    PubMed Central

    Mizumoto, Shuji; Ikegawa, Shiro; Sugahara, Kazuyuki


    A number of genetic disorders are caused by mutations in the genes encoding glycosyltransferases and sulfotransferases, enzymes responsible for the synthesis of sulfated glycosaminoglycan (GAG) side chains of proteoglycans, including chondroitin sulfate, dermatan sulfate, and heparan sulfate. The phenotypes of these genetic disorders reflect disturbances in crucial biological functions of GAGs in human. Recent studies have revealed that mutations in genes encoding chondroitin sulfate and dermatan sulfate biosynthetic enzymes cause various disorders of connective tissues. This minireview focuses on growing glycobiological studies of recently described genetic diseases caused by disturbances in biosynthetic enzymes for sulfated GAGs. PMID:23457301

  18. Dynamics of place, boundary and object encoding in rat anterior claustrum

    PubMed Central

    Jankowski, Maciej M.; O’Mara, Shane M.


    Discrete populations of brain cells signal differing types of spatial information. These “spatial cells” are largely confined to a closely-connected network of sites. We describe here, for the first time, cells in the anterior claustrum of the freely-moving rat encoding place, boundary and object information. This novel claustral spatial signal potentially directly modulates a wide variety of anterior cortical regions. We hypothesize that one of the functions of the claustrum is to provide information about body position, boundaries and landmark information, enabling dynamic control of behavior. PMID:26557060

  19. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    NASA Technical Reports Server (NTRS)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.


    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  20. Population-level expression variability of mitochondrial DNA-encoded genes in humans

    PubMed Central

    Wang, Gang; Yang, Ence; Mandhan, Ishita; Brinkmeyer-Langford, Candice L; Cai, James J


    Human mitochondria contain multiple copies of a circular genome made up of double-stranded DNA (mtDNA) that encodes proteins involved in cellular respiration. Transcript abundance of mtDNA-encoded genes varies between human individuals, yet the level of variation in the general population has not been systematically assessed. In the present study, we revisited large-scale RNA sequencing data generated from lymphoblastoid cell lines of HapMap samples of European and African ancestry to estimate transcript abundance and quantify expression variation for mtDNA-encoded genes. In both populations, we detected up to over 100-fold difference in mtDNA gene expression between individuals. The marked variation was not due to differences in mtDNA copy number between individuals, but was shaped by the transcription of hundreds of nuclear genes. Many of these nuclear genes were co-expressed with one another, resulting in a module-enriched co-expression network. Significant correlations in expression between genes of the mtDNA and nuclear genomes were used to identify factors involved with the regulation of mitochondrial functions. In conclusion, we determined the baseline amount of variability in mtDNA gene expression in general human populations and cataloged a complete set of nuclear genes whose expression levels are correlated with those of mtDNA-encoded genes. Our findings will enable the integration of information from both mtDNA and nuclear genetic systems, and facilitate the discovery of novel regulatory pathways involving mitochondrial functions. PMID:24398800

  1. Genetic Variants in Nuclear-Encoded Mitochondrial Genes Influence AIDS Progression

    PubMed Central

    Hendrickson, Sher L.; Lautenberger, James A.; Chinn, Leslie Wei; Malasky, Michael; Sezgin, Efe; Kingsley, Lawrence A.; Goedert, James J.; Kirk, Gregory D.; Gomperts, Edward D.; Buchbinder, Susan P.; Troyer, Jennifer L.; O'Brien, Stephen J.


    Background The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression. Methodology/Principal Findings Here we explore whether single nucleotide polymorphisms (SNPs) within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs) influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4) on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI) on chromosome 6. Conclusions Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis. PMID:20877624

  2. Cloning, nucleotide sequence, and expression of the Escherichia coli gene encoding carnitine dehydratase.

    PubMed Central

    Eichler, K; Schunck, W H; Kleber, H P; Mandrand-Berthelot, M A


    Carnitine dehydratase from Escherichia coli O44 K74 is an inducible enzyme detectable in cells grown anaerobically in the presence of L-(-)-carnitine or crotonobetaine. The purified enzyme catalyzes the dehydration of L-(-)-carnitine to crotonobetaine (H. Jung, K. Jung, and H.-P. Kleber, Biochim. Biophys. Acta 1003:270-276, 1989). The caiB gene, encoding carnitine dehydratase, was isolated by oligonucleotide screening from a genomic library of E. coli O44 K74. The caiB gene is 1,215 bp long, and it encodes a protein of 405 amino acids with a predicted M(r) of 45,074. The identity of the gene product was first assessed by its comigration in sodium dodecyl sulfate-polyacrylamide gels with the purified enzyme after overexpression in the pT7 system and by its enzymatic activity. Moreover, the N-terminal amino acid sequence of the purified protein was found to be identical to that predicted from the gene sequence. Northern (RNA) analysis showed that caiB is likely to be cotranscribed with at least one other gene. This other gene could be the gene encoding a 47-kDa protein, which was overexpressed upstream of caiB. Images PMID:8188598

  3. Genetic location of genes encoding enterobacterial common antigen.

    PubMed Central

    Meier, U; Mayer, H


    A new rff mutation (rff-726) of Escherichia coli is described which affects the biosynthesis of the enterobacterial common antigen. This mutation was detected in an rfe-defective strain. A Tn10 insertion near the rfe locus was isolated to facilitate further mapping. Both mutations rfe and rff were mapped by transduction with bacteriophage P1, giving the gene order ilv rfe rff uvrD metE. The F' factor F14 was able to complement both mutations rfe and rff, whereas the F' factor F16 could complement the rfe but not the rff mutation. The rff mutation did not affect the biosynthesis of N-acetyl-D-mannosaminuronic acid, as the previously described rff mutations in Salmonella typhimurium do (H. C. Lew, H. Nikaido, and P. H. Mäkelä, J. Bacteriol. 136:227-233, 1978), and also did not affect the biosynthesis of other enterobacterial common antigen components; however, the biosynthesis of the complete enterobacterial common antigen molecule was blocked. PMID:3894334

  4. The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family

    SciTech Connect

    Peelman, L.J.; Van Zeveren, A.; Coppeiters, W.


    The BAT1 gene has previously been identified about 30 kb upstream from the tumor necrosis factor (TNF) locus and close to a NF{sub kb}-related gene of the nuclear factor family in the major histocompatibility complex (MHC) of human, mouse, and pig. We now show that the BAT1 translation product is the homolog of the rat p47 nuclear protein, the WM6 Drosophila gene product, and probably also Ce08102 of Caenorhabditis elegans, all members of the DEAD protein family of ATP-dependent RNA helicases. This family has more than 40 members, including the eukaryotic translation initiation factor-4A (eIF-4A), the human nuclear protein p68, and the Drosophila oocyte polar granule component vasa. BAT1 spans about 10 kb, is split into 10 exons of varying length, and encodes a protein of 428 amino acids ({approximately}48 kDa). Human and pig BAT1 cDNAs display 95.6% identity in the coding region and 80% identity in the 5{prime} and 3{prime} noncoding regions. Several repeat sequences of different types were identified in introns of the porcine BAT1 gene. Three different mRNAs, 4.1,1.7, and 0.9 kb, respectively, were detected in all tissues analyzed upon hybridization with porcine BAT1 cDNA. Transfection and expression of human BAT1 cDNA after tagging with a heterologous antibody recognition epitope revealed a nuclear localization of the hybrid protein. An MspI RFLP was detected in an SLA class I typed family, confirming the localization of the BAT1 gene in the porcine MHC. BAT1 thus encodes a putative nuclear ATP-dependent RNA helicase and is likely to have an indispensable function. 35 refs., 6 figs., 1 tab.

  5. The Good and Bad Differentially Encoded within the Subthalamic Nucleus in Rats

    PubMed Central

    Breysse, Emmanuel; Pelloux, Yann


    Abstract The subthalamic nucleus (STN) has only recently been added into the reward circuit. It has been shown to encode information regarding rewards (4% sucrose, 32% cocaine). To investigate the encoding of negative value, STN neurons were recorded in rats performing a task using discriminative stimuli predicting various rewards and especially during the replacement of a positive reinforcer (4% sucrose) by an aversive reinforcer (quinine). The results show that STN neurons encode information relative to both positive and aversive reinforcers via specialized subpopulations. The specialization is reset when the context is modified (change from a favorable context (4% vs 32% sucrose) to an unfavorable context (quinine vs 32% sucrose). An excitatory response to the cue light predicting the reward seems to be associated with the preferred situation, suggesting that STN plays a role in encoding the relative value of rewards. STN also seems to play a critical role in the encoding of execution error. Indeed, various subpopulations of neurons responding exclusively at early (i.e., “oops neurons”) or at correct lever release were identified. The oops neurons respond mostly when the preferred reward (32% sucrose) is missed. Furthermore, STN neurons respond to reward omission, suggesting a role in reward prediction error. These properties of STN neurons strengthen its position in the reward circuit as a key cerebral structure through which reward-related processes are mediated. It is particularly important given the fact that STN is the target of surgical treatment for Parkinson’s disease and obsessive compulsive disorders, and has been suggested for the treatment of addiction as well. PMID:26478913

  6. Compensation for differences in gene copy number among yeast ribosomal proteins is encoded within their promoters

    PubMed Central

    Zeevi, Danny; Sharon, Eilon; Lotan-Pompan, Maya; Lubling, Yaniv; Shipony, Zohar; Raveh-Sadka, Tali; Keren, Leeat; Levo, Michal; Weinberger, Adina; Segal, Eran


    Coordinate regulation of ribosomal protein (RP) genes is key for controlling cell growth. In yeast, it is unclear how this regulation achieves the required equimolar amounts of the different RP components, given that some RP genes exist in duplicate copies, while others have only one copy. Here, we tested whether the solution to this challenge is partly encoded within the DNA sequence of the RP promoters, by fusing 110 different RP promoters to a fluorescent gene reporter, allowing us to robustly detect differences in their promoter activities that are as small as ∼10%. We found that single-copy RP promoters have significantly higher activities, suggesting that proper RP stoichiometry is indeed partly encoded within the RP promoters. Notably, we also partially uncovered how this regulation is encoded by finding that RP promoters with higher activity have more nucleosome-disfavoring sequences and characteristic spatial organizations of these sequences and of binding sites for key RP regulators. Mutations in these elements result in a significant decrease of RP promoter activity. Thus, our results suggest that intrinsic (DNA-dependent) nucleosome organization may be a key mechanism by which genomes encode biologically meaningful promoter activities. Our approach can readily be applied to uncover how transcriptional programs of other promoters are encoded. PMID:22009988

  7. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.


    Ruifu, Y; Minli, Z; Guo, Z; Wang, X


    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum. PMID:9310943

  8. Arabidopsis thaliana contains a single gene encoding squalene synthase.


    Busquets, Antoni; Keim, Verónica; Closa, Marta; del Arco, Ana; Boronat, Albert; Arró, Montserrat; Ferrer, Albert


    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate (FPP) to produce squalene (SQ), the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. Arabidopsis thaliana contains two SQS-annotated genomic sequences, At4g34640 (SQS1) and At4g34650 (SQS2), organized in a tandem array. Here we report that the SQS1 gene is widely expressed in all tissues throughout plant development, whereas SQS2 is primarily expressed in the vascular tissue of leaf and cotyledon petioles, and the hypocotyl of seedlings. Neither the complete A. thaliana SQS2 protein nor the chimeric SQS resulting from the replacement of the 69 C-terminal residues of SQS2 by the 111 C-terminal residues of the Schizosaccharomyces pombe SQS were able to confer ergosterol prototrophy to a Saccharomyces cerevisiae erg9 mutant strain lacking SQS activity. A soluble form of SQS2 expressed in Escherichia coli and purified was unable to synthesize SQ from FPP in the presence of NADPH and either Mg2+ or Mn2+. These results demonstrated that SQS2 has no SQS activity, so that SQS1 is the only functional SQS in A. thaliana. Mutational studies revealed that the lack of SQS activity of SQS2 cannot be exclusively attributed to the presence of an unusual Ser replacing the highly conserved Phe at position 287. Expression of green fluorescent protein (GFP)-tagged versions of SQS1 in onion epidermal cells demonstrated that SQS1 is targeted to the endoplasmic reticulum (ER) membrane and that this location is exclusively dependent on the presence of the SQS1 C-terminal hydrophobic trans-membrane domain. PMID:18236008

  9. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    PubMed Central

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W


    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  10. Characterization of the BMR1 gene encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae.


    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Tanaka, Chihiro; Ueno, Makoto; Arase, Sakae


    We isolated and characterized Bipolaris melanin regulation 1 gene (BMR1) encoding a transcription factor for melanin biosynthesis genes in the phytopathogenic fungus Bipolaris oryzae. Sequence analysis showed that the BMR1 gene encodes a putative protein of 1012 amino acids that has 99% sequence similarity to transcription factor Cmr1 of Cochliobolus heterostrophus. The predicted B. oryzae Bmr1 protein has two DNA-binding motifs, two Cys2His2 zinc finger domains, and a Zn(II)2Cys6 binuclear cluster domain at the N-terminal region of Bmr1. Targeted disruption of the BMR1 gene showed that BMR1 is essential for melanin biosynthesis in B. oryzae. The overexpression of the BMR1 gene led to more dark colonies than in the wild-type strain under dark conditions. Real-time PCR analysis showed that the BMR1 expression of the overexpression transformant was about 10-fold that of the wild type under dark conditions and of the expression of three melanin biosynthesis genes. These results indicated that BMR1 encodes the transcription factor of melanin biosynthesis genes in B. oryzae. PMID:18312572

  11. Borrelia burgdorferi supercoiled plasmids encode multicopy tandem open reading frames and a lipoprotein gene family.

    PubMed Central

    Porcella, S F; Popova, T G; Akins, D R; Li, M; Radolf, J D; Norgard, M V


    DNA sequencing and Southern blot analyses of a Borrelia burgdorferi DNA fragment encoding a signal sequence led to the discovery of a genetic locus, designated 2.9, which appears to be present in at least seven copies in virulent B. burgdorferi 297. DNA sequence analysis of these regions revealed that each 2.9 locus contained an operon of four genes (ABCD) and open reading frames designated rep+ (positive strand) and rep- (negative strand) which encoded multiple repeat motifs. Downstream of the rep+ gene(s) in six of the completely cloned and sequenced 2.9 loci also were lipoprotein (LP) genes possessing highly similar signal sequences but encoding variable mature polypeptides. The lipoproteins could he separated into two classes on the basis of hydrophilicity profiles, sequence similarities, and reactivity with specific antibodies. The 2.9 loci were localized to two (20- and 30-kb) supercoiled plasmids in B. burgdorferi 297. Northern (RNA) blot analysis established that the 2.9 ABCD operon was only minimally expressed, whereas the rep- gene(s) and at least three of the seven LP genes were expressed by B. burgdorferi in vitro. A single putative promoter element was identified by RNA primer extension analysis upstream of the ABCD operon, whereas a number of potential promoter regions existed upstream of the LP genes. The combined data indicate that the ABCD operon, rep+ and rep- genes, and LP genes are separately transcribed during in vitro growth. The 2.9 loci possess a repetitiveness, diversity, and complexity not previously described for B. burgdorferi; differential expression of these genes may facilitate the spirochete's ability to survive in diverse host environments. PMID:8655511

  12. Encoding and Tracking of Outcome-Specific Expectancy in the Gustatory Cortex of Alert Rats

    PubMed Central

    Fontanini, Alfredo


    In natural conditions, gustatory stimuli are typically expected. Anticipatory and contextual cues provide information that allows animals to predict the availability and the identity of the substance to be ingested. Recording in alert rats trained to self-administer tastants following a go signal revealed that neurons in the primary gustatory cortex (GC) can respond to anticipatory cues. These experiments were optimized to demonstrate that even the most general form of expectation can activate neurons in GC, and did not provide indications on whether cues predicting different tastants could be encoded selectively by GC neurons. Here we recorded single-neuron activity in GC of rats engaged in a task where one auditory cue predicted sucrose, while another predicted quinine. We found that GC neurons respond differentially to the two cues. Cue-selective responses develop in parallel with learning. Comparison between cue and sucrose responses revealed that cues could trigger the activation of anticipatory representations. Additional experiments showed that an expectation of sucrose leads a subset of neurons to produce sucrose-like responses even when the tastant was omitted. Altogether, the data show that primary sensory cortices can encode for cues predicting different outcomes, and that specific expectations result in the activation of anticipatory representations. PMID:25253848

  13. Molecular cloning and characterization of the pgm gene encoding phosphoglucomutase of Escherichia coli.

    PubMed Central

    Lu, M; Kleckner, N


    We report here the identification and characterization of pgm, a gene in Escherichia coli that encodes the enzyme phosphoglucomutase, specifically required for the catalysis of the interconversion of glucose 1-phosphate and glucose 6-phosphate. The predicted amino acid sequence of the pgm gene is highly conserved in E. coli, Acetobacter xylinum, Saccharomyces cerevisiae, rabbits, and humans. pgm deletion mutant strains are deficient in phosphoglucomutase activity. Images PMID:8083177

  14. Prolonged noxious mechanical stimulation of the rat's tail: responses and encoding properties of dorsal horn neurones.

    PubMed Central

    Cervero, F; Handwerker, H O; Laird, J M


    1. Single-unit electrical activity has been recorded from dorsal horn neurones in the sacral (S1-S2) segments of the spinal cord of barbiturate-anaesthetized rats. Fifty-two neurones responding to a manually applied pinch of their receptive fields in the tail were selected. They were subsequently tested for their responses to four successive 2 min pinches at noxious intensities delivered by a feed-back-controlled mechanical device. 2. Neurones were tested with both innocuous (i.e. brushing and stroking) and noxious (i.e. pinching, pin-prick, and in some cases heating about 45 degrees C) stimulation of their cutaneous receptive fields. Three of the tested cells were driven exclusively by innocuous skin stimulation (mechanoreceptive or class 1), thirty-six were driven by both innocuous and noxious skin stimulation (multireceptive or class 2) and thirteen were driven exclusively by noxious skin stimulation (nocireceptive or class 3). 3. All of the multireceptive and nocireceptive neurones responded to the 2 min noxious pinch with an initial phasic discharge followed by sustained firing that showed little evidence of adaptation throughout the stimulus period. The three mechanoreceptive neurones responded to the 2 min noxious pinch with a short discharge at the stimulus onset, but were silent for the remainder of the stimulus period. 4. Thirty-one cells were tested with successive 2 min pinches of 4, 6 and 8 N (and in some cases, a further 4 N pinch) applied at 10 min intervals. Different encoding properties were observed during the sustained part of the neuronal response according to: (i) the afferent fibre input characteristics of the cell; (ii) whether or not the tail had received a test series of pinches earlier in the same experiment. 5. None of the multireceptive cells with only an A-fibre afferent input encoded the stimulus strength. However, the multireceptive cells with both an A- and a C-fibre afferent input and all nocireceptive cells did encode the stimulus

  15. Haplotypes of the steroid 21-hydroxylase gene region encoding mild steroid 21-hydroxylase deficiency.

    PubMed Central

    Haglund-Stengler, B; Martin Ritzén, E; Gustafsson, J; Luthman, H


    Haplotypes of the complement 4 (C4) and steroid 21-hydroxylase [21-OHase; steroid hydrogen-donor: oxygen oxidoreductase (21-hydroxylating), EC] repeated gene complex were studied in nine families with at least one member affected with a mild form of 21-OHase deficiency. DNA probes from different parts of the repeated C4/21-OHase unit were used to follow the segregation of hybridization patterns in the families. Ten structurally distinct haplotypes of the C4/21-OHase gene region were identified, and the encoded phenotype was assigned to 34 of the 36 C4/21-OHase haplotypes. Four structurally different haplotypes with three C4/21-OHase repeat units were found. Eight of the nine haplotypes found with triplications of the C4/21-OHase repeat unit encoded the mild form of 21-OHase deficiency, whereas one particular triplicated haplotype encoded a severe form of the disease. In one case the mild form of 21-OHase deficiency was encoded by a haplotype with a single C4/21-OHase repeat unit. Mild 21-OHase deficiency was predicted in a patient by the presence of a triplicated haplotype. The finding of deranged 21-OHase genes on all triplicated C4/21-OHase haplotypes indicate that most of these common haplotypes carry mutated 21-OHase genes, and thus may cause functional polymorphism of general importance in the population. PMID:1924294

  16. Genes Encoding Phospholipases A2 Mediate Insect Nodulation Reactions to Bacterial Challenge

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We propose that expression of four genes encoding secretory phospholipases A2 (sPLA2) mediates insect nodulation responses to bacterial infection. Nodulation is the quantitatively predominant cellular defense reaction to bacterial infection. This reaction is mediated by eicosanoids, the biosynthesis...

  17. Multiple proteins encoded within the urease gene complex of Proteus mirabilis.


    Walz, S E; Wray, S K; Hull, S I; Hull, R A


    Chromosomal DNA fragments from a uropathogenic isolate of Proteus mirabilis were inserted into the cosmid vector pHC79 to construct a genomic library in Escherichia coli HB101. A urease-positive recombinant cosmid, designated pSKW1, was recovered. Sequential recombinant manipulation of pSKW1 yielded a 10.2-kilobase plasmid, designated pSKW4, which encoded three urease isozymes with electrophoretic mobilities identical to those of the donor P. mirabilis strain. Plasmid pSKW4 gene sequences encode seven proteins designated 68K (apparent molecular weight, of 68,000), 28K, 25K, 22.5K, 18.5K, 7.5K, and 5.2K within the limits of the urease gene complex. Insertion mutations in genes encoding the 68K, 28K, 25K, 22.5K, 7.5K, and 5.2K proteins resulted in complete or partial (22.5K) loss of urease activity. There was no reduction in urease activity when the gene encoding the 18.5K protein was inactivated. PMID:2830226

  18. The cloning and expression of a gene encoding haemolytic activity from the fish pathogen Renibacterium salmoninarum.


    Evenden, A J; Gilpin, M L; Munn, C B


    A gene encoding haemolytic activity from Renibacterium salmoninarum (strain PPD) was cloned into Escherichia coli using the cosmid vector pHC79, and subsequently subcloned on a 1.6 kbp SAlI fragment into pBR328. Southern blot hybridisation revealed that a homologous sequence is found in other strains of R. salmoninarum. PMID:2276613

  19. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.


    Conner, T W; Thompson, M D; Silflow, C D


    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  20. Nucleotide sequence and expression of alpha-glucosidase-encoding gene (agdA) from Aspergillus oryzae.


    Minetoki, T; Gomi, K; Kitamoto, K; Kumagai, C; Tamura, G


    We have isolated an alpha-glucosidase(AGL)-encoding gene (agdA) from Aspergillus oryzae by heterologous hybridization using the corresponding Aspergillus niger gene as a probe. Southern hybridization analysis showed that the agdA gene is on a 5.0-kb ScaI fragment and there is a single copy in the A. oryzae chromosome. Comparison with the A. niger agdA gene indicated that the agdA gene contains three putative introns from 52 to 59 nucleotides long, and that it encodes 985 amino acid residues. The deduced amino acid sequence of A. oryzae AGL is 78% homologous with the A. niger AGL. The high degree of homology with the amino acid sequence bordering the putative catalytic residue of a number of AGL enzymes, and this enzyme suggests that Asp492 is a catalytic residue of A. oryzae AGL. The cloned gene was functional. Transformants of A. oryzae containing multiple copies of the cloned agdA gene showed a 6-16 fold increase in AGL activity. Like the Taka-amylase A and glucoamylase genes of A. oryzae, expression of the agdA gene was induced when maltose was provided as a carbon source, but expression was not induced by glucose. This result suggested that cis-element(s) involved in maltose induction may be also present in the agdA promoter region. PMID:7549103

  1. Genes Encoding Cher-TPR Fusion Proteins Are Predominantly Found in Gene Clusters Encoding Chemosensory Pathways with Alternative Cellular Functions

    PubMed Central

    Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino


    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  2. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1990--June 30, 1992

    SciTech Connect

    Kuchka, M.R.


    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5` UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  3. Multiple conversion between the genes encoding bacterial class-I release factors

    PubMed Central

    Ishikawa, Sohta A.; Kamikawa, Ryoma; Inagaki, Yuji


    Bacteria require two class-I release factors, RF1 and RF2, that recognize stop codons and promote peptide release from the ribosome. RF1 and RF2 were most likely established through gene duplication followed by altering their stop codon specificities in the common ancestor of extant bacteria. This scenario expects that the two RF gene families have taken independent evolutionary trajectories after the ancestral gene duplication event. However, we here report two independent cases of conversion between RF1 and RF2 genes (RF1-RF2 gene conversion), which were severely examined by procedures incorporating the maximum-likelihood phylogenetic method. In both cases, RF1-RF2 gene conversion was predicted to occur in the region encoding nearly entire domain 3, of which functions are common between RF paralogues. Nevertheless, the ‘direction’ of gene conversion appeared to be opposite from one another—from RF2 gene to RF1 gene in one case, while from RF1 gene to RF2 gene in the other. The two cases of RF1-RF2 gene conversion prompt us to propose two novel aspects in the evolution of bacterial class-I release factors: (i) domain 3 is interchangeable between RF paralogues, and (ii) RF1-RF2 gene conversion have occurred frequently in bacterial genome evolution. PMID:26257102

  4. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    PubMed Central

    Hays, Shan M; Swanson, Johanna; Selker, Eric U


    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged H4 variant (hH4v) not described in other species. The hH4-1 and hH4-2 genes, which are 96% identical in their coding regions and encode identical proteins, were inactivated independently. Strains with inactivating mutations in either gene were phenotypically wild type, in terms of growth rates and fertility, but the double mutants were inviable. As expected, we were unable to isolate null alleles of hH2A, hH2B, or hH3. The genomic arrangement of the histone and histone variant genes was determined. hH2Az and the hH3-hH4-1 gene pair are on LG IIR, with hH2Az centromere-proximal to hH3-hH4-1 and hH3 centromere-proximal to hH4-1. hH3v and hH4-2 are on LG IIIR with hH3v centromere-proximal to hH4-2. hH4v is on LG IVR and the hH2A-hH2B pair is located immediately right of the LG VII centromere, with hH2A centromere-proximal to hH2B. Except for the centromere-distal gene in the pairs, all of the histone genes are transcribed toward the centromere. Phylogenetic analysis of the N. crassa histone genes places them in the Euascomycota lineage. In contrast to the general case in eukaryotes, histone genes in euascomycetes are few in number and contain introns. This may be a reflection of the evolution of the RIP (repeat-induced point mutation) and MIP (methylation induced premeiotically) processes that detect sizable duplications and silence associated genes. PMID:11901114

  5. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.


    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  6. Structural organization of the human gene (LMNB1) encoding nuclear lamin B1

    SciTech Connect

    Lin, F.; Worman, H.J.


    The authors have determined the structural organization of the human gene (LMNB1) that encodes nuclear lamin B1, an intermediate filament protein of the nuclear envelope. The transcription unit spans more than 45 kb and the transcription start site is 348 nucleotides upstream from the translation initiation codon. Lamin B1 is encoded by 11 exons. Exon 1 codes for the amino-terminal head domain and the first portion of the central rod domain, exons 2 through 6 the central rod domain, and exons 7 through 11 the carboxyl-terminal tail domain of this intermediate filament protein. Intron positions are conserved in other lamin genes from frogs, mice, and humans but different in lamin genes from Drosophila melanogaster and Caenorhabditis elegans. In the region encoding the central rod domain, intron positions are also similar to those in the gene for an invertebrate nonneuronal cytoplasmic intermediate filament protein and the genes for most vertebrate cytoplasmic intermediate filament proteins except neurofilaments and nestin. 51 refs., 3 figs.

  7. Structure and expression of nuclear genes encoding rubisco activase. Final technical report

    SciTech Connect

    Zielinski, R.E.


    Rubisco activase (Rca) is a soluble chloroplast protein that catalyzes the activation of rubisco, the enzyme that initiates the photosynthetic carbon reduction cycle, to catalytic competency. Rca in barley consists of three polypeptides, one of 46- and two of 42-kDa, but the quaternary structure of the protein is not known. The authors have isolated and completely sequenced 8.8 kb of barley genomic DNA containing two, tandemly oriented activase genes (RcaA and RcaB) and three different cDNAs encoding the 42- and 46-kDa Rca polypeptide isoforms. Genomic Southern blot assays indicate that these sequences represent the entire Rca gene family in barley. Pre-mRNAs transcribed from the RcaA gene are alternatively spliced to give mRNAs encoding both 46- (RcaA1) and 42-kDa (RcaA2) Rca isoforms. The RcaB gene encodes a single polypeptide of 42 kDa. Primer extension and northern blot assays indicate that RcaB mRNA is expressed at a level that is 10- to 100-fold lower than RcaA mRNA. Analyses at the mRNA and protein level showed that Rca gene expression is coordinated by that of the rubisco subunits during barley leaf development.

  8. Systematic Identification and Characterization of Novel Human Skin-Associated Genes Encoding Membrane and Secreted Proteins

    PubMed Central

    Buhren, Bettina Alexandra; Martinez, Cynthia; Schrumpf, Holger; Gasis, Marcia; Grether-Beck, Susanne; Krutmann, Jean


    Through bioinformatics analyses of a human gene expression database representing 105 different tissues and cell types, we identified 687 skin-associated genes that are selectively and highly expressed in human skin. Over 50 of these represent uncharacterized genes not previously associated with skin and include a subset that encode novel secreted and plasma membrane proteins. The high levels of skin-associated expression for eight of these novel therapeutic target genes were confirmed by semi-quantitative real time PCR, western blot and immunohistochemical analyses of normal skin and skin-derived cell lines. Four of these are expressed specifically by epidermal keratinocytes; two that encode G-protein-coupled receptors (GPR87 and GPR115), and two that encode secreted proteins (WFDC5 and SERPINB7). Further analyses using cytokine-activated and terminally differentiated human primary keratinocytes or a panel of common inflammatory, autoimmune or malignant skin diseases revealed distinct patterns of regulation as well as disease associations that point to important roles in cutaneous homeostasis and disease. Some of these novel uncharacterized skin genes may represent potential biomarkers or drug targets for the development of future diagnostics or therapeutics. PMID:23840300

  9. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.


    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G


    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  10. Cloning and expression analysis of a prion protein encoding gene in guppy ( Poecilia reticulata)

    NASA Astrophysics Data System (ADS)

    Wu, Suihan; Wei, Qiwei; Yang, Guanpin; Wang, Dengqiang; Zou, Guiwei; Chen, Daqing


    The full length cDNA of a prion protein (PrP) encoding gene of guppy ( Poecilia reticulata) and the corresponding genomic DNA were cloned. The cDNA was 2245 bp in length and contained an open reading frame (ORF) of 1545 bp encoding a protein of 515 amino acids, which held all typical structural characteristics of the functional PrP. The cloned genomic DNA fragment corresponding to the cDNA was 3720 bp in length, consisting of 2 introns and 2 exons. The 5' untranslated region of cDNA originated from the 2 exons, while the ORF originated from the second exon. Although the gene was transcribed in diverse tissues including brain, eye, liver, intestine, muscle and tail, its transcript was most abundant in the brain. In addition, the transcription of the gene was enhanced by 5 salinity, implying that it was associated with the response of guppy to saline stress.

  11. A novel gene encoding amidinotransferase in the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum.


    Shalev-Alon, Gali; Sukenik, Assaf; Livnah, Oded; Schwarz, Rakefet; Kaplan, Aaron


    The hepatotoxin cylindrospermopsin is produced by several cyanobacteria species, which may flourish in tropical and sub-tropical lakes. Biosynthesis of cylindrospermopsin is poorly understood but its chemical nature, and feeding experiments with stable isotopes, suggested that guanidinoacetic acid is the starter unit and indicated involvement of a polyketide synthase. We have identified a gene encoding an amidinotransferase from the cylindrospermopsin producing cyanobacterium Aphanizomenon ovalisporum. This is the first report on an amidinotransferase gene in cyanobacteria. It is likely to be involved in the formation of guanidinoacetic acid. The aoaA is located in a genomic region bearing genes encoding a polyketide synthase and a peptide synthetase, further supporting its putative role in cylindrospermopsin biosynthesis. PMID:12007659

  12. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase

    PubMed Central

    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E.; Segerson, Nicholas A.; Kannan, Latha


    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  13. Identification of the Gene Encoding the Enzyme Deficient in Mucopolysaccharidosis IIIC (Sanfilippo Disease Type C)

    PubMed Central

    Fan, Xiaolian; Zhang, Huiwen; Zhang, Sunqu; Bagshaw, Richard D.; Tropak, Michael B.; Callahan, John W.; Mahuran, Don J.


    Mucopolysaccharidosis IIIC (MPS IIIC), or Sanfilippo C, represents the only MPS disorder in which the responsible gene has not been identified; however, the gene has been localized to the pericentromeric region of chromosome 8. In an ongoing proteomics study of mouse lysosomal membrane proteins, we identified an unknown protein whose human homolog, TMEM76, was encoded by a gene that maps to 8p11.1. A full-length mouse expressed sequence tag was expressed in human MPS IIIC fibroblasts, and its protein product localized to the lysosome and corrected the enzymatic defect. The mouse sequence was used to identify the full-length human homolog (HGSNAT), which encodes a protein with no homology to other proteins of known function but is highly conserved among plants and bacteria. Mutational analyses of two MPS IIIC cell lines identified a splice-junction mutation that accounted for three mutant alleles, and a single base-pair insertion accounted for the fourth. PMID:16960811

  14. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase.


    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E; Segerson, Nicholas A; Kannan, Latha; Mor, Tsafrir S


    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  15. Expression patterns of genes encoding plasma membrane aquaporins during fruit development in cucumber (Cucumis sativus L.).


    Shi, Jin; Wang, Jinfang; Li, Ren; Li, Dianbo; Xu, Fengfeng; Sun, Qianqian; Zhao, Bin; Mao, Ai-Jun; Guo, Yang-Dong


    Aquaporins are membrane channels precisely regulating water movement through cell membranes in most living organisms. Despite the advances in the physiology of fruit development, their participation during fruit development in cucumber still barely understood. In this paper, the expressions of 12 genes encoding plasma membrane intrinsic proteins (PIPs) were analyzed during cucumber fruit development in our work. Based on the homology search with known PIPs from rice, Arabidopsis and strawberry, 12 cucumber PIP genes subfamily members were identified. Cellular localization assays indicated that CsPIPs were localized in the plasma membrane. The qRT-PCR analysis of CsPIPs showed that 12 CsPIPs were differentially expressed during fruit development. These results suggest that 12 genes encoding plasma membrane intrinsic proteins (CsPIPs) play very important roles in cucumber life cycle and the data generated will be helpful in understanding their precise roles during fruit development in cucumber. PMID:26351149

  16. Characterization of the gene encoding a fibrinogen-related protein expressed in Crassostrea gigas hemocytes.


    Skazina, M A; Gorbushin, A M


    Four exons of the CgFrep1 gene (3333 bp long) encode a putative fibrinogen-related protein (324 aa) bearing a single C-terminal FBG domain. Transcripts of the gene obtained from hemocytes of different Pacific oysters show prominent individual variation based on SNP and indels of tandem repeats resulted in polymorphism of N-terminus of the putative CgFrep1 polypeptide. The polypeptide chain bears N-terminal coiled-coil region potentially acting as inter-subunit interface in the protein oligomerization. It is suggested that CgFrep1 gene encodes the oligomeric lectin composed of at least two subunits. PMID:27189918

  17. Cytosolic phospholipase A{sub 2} gene in human and rat: Chromosomal localization and polymorphic markers

    SciTech Connect

    Tay, A.; Simon, J.S.; Jacob, H.J.


    The authors report the chromosomal localization and a simple sequence repeat (SSR) in the cytosolic phospholipase A{sub 2} (cPLA{sub 2}) gene in both human and rat. A (CA){sub 18} repeat in the promoter of the rat gene was determined to exhibit length polymorphism when analyzed using the polymerase chain reaction (PCR) in 19 different inbred rat strains. Genotyping for this marker in 234 F{sub 2} progeny of a SHRXBN intercross mapped the gene to rat chromosome 13. Using a PCR strategy, a fragment of the promoter for the human gene was isolated, and a (CA){sub 18} repeat was identified. Since this marker displayed a low heterozygosity index, they also identified a mononucleotide repeat in the promoter for cPLA{sub 2} that displayed a polymorphism information content value of 0.76. The human gene was mapped using fluorescence in situ hybridization (FISH) to chromosome 1q25. Of interest, the gene encoding the enzyme prostaglandin-endoperoxide synthase 2 (cyclooxygenase-2), which acts on the arachidonic acid product of cPLA{sub 2}, was previously localized to this same chromosomal region, raising the possibility of coordinate regulation. Identification of intragenic markers may facilitate studies of polymorphic variants of these genes as candidates for disorders in which perturbations of the eicosanoid cascade may play a role. 20 refs., 3 figs., 2 tabs.

  18. Cloning and expression of a gene segment encoding the enzymatic moiety of Pseudomonas aeruginosa exotoxin A.

    PubMed Central

    Mozola, M A; Wilson, R B; Jordan, E M; Draper, R K; Clowes, R C


    Using the broad-host-range plasmid vector pRO1614, we cloned a segment of the gene from Pseudomonas aeruginosa PA103 encoding the enzymatically active part of the exotoxin A protein. Expression of the cloned gene segment has been achieved both in Escherichia coli and in a nontoxigenic P. aeruginosa host, as assayed by the production of exotoxin A-related antigen and by the ability of the gene product to ADP-ribosylate elongation factor 2. Western blot hybridization analysis revealed a series of polypeptides antigenically related to exotoxin A, the largest of which had a molecular weight of ca. 50,000. Images PMID:6086583

  19. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    PubMed Central

    Karlyshev, A.V.; Thacker, G.; Jones, M.A.; Clements, M.O.; Wren, B.W.


    According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection. PMID:24918062

  20. Horse cDNA clones encoding two MHC class I genes

    SciTech Connect

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.


    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  1. Partial gene deletion in LEC rat: An animal model for Wilson disease

    SciTech Connect

    Wu, J.; Forbes, J.R.; Cox, D.W.


    Wilson disease is an inherited disorder of copper transport in which incorporation of copper into ceruloplasmin and excretion of copper into bile are greatly reduced. Copper accumulates to a toxic level in the liver and also in the brain and kidney, causing a spectrum of hepatic and neurological abnormalities. We have recently cloned the gene for Wilson disease (designated ATP7B), which encodes a putative copper-transporting P-type ATPase. The inbred mutant Long-Evans Cinnamon (LEC) rat strain shows similarity to Wilson disease in many clinical and biochemical features. We have cloned cDNAs for the rat homologue (Atp7b) of the human Wilson disease gene (ATP7B) and have shown that the two genes have {approximately}82% identity at the amino acid sequence level. Rat cDNA sequences were used to identify a partial deletion in the Atp7b gene in the LEC rat. The deletion removes at least 750 bp of the coding region at the 3{prime} end, which includes the crucial ATP binding domain and extends downstream of the gene. The proximal breakpoint has been precisely localized at the cDNA level. Our results provide convincing evidence that the LEC rat is an animal model for Wilson disease. This model will be important for studying liver pathophysiology, for developing therapy for Wilson disease, and for studying the pathway of copper transport and its possible interaction with other heavy metals.

  2. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1991--May 31, 1992

    SciTech Connect

    Kuchka, M.R.


    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  3. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T


    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  4. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.


    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K


    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  5. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity

    PubMed Central

    Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.


    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  6. A gene encoding a new cold-active lipase from an Antarctic isolate of Penicillium expansum.


    Mohammed, Suja; Te'o, Junior; Nevalainen, Helena


    Cold-active lipases are of significant interest as biocatalysts in industrial processes. We have identified a lipase that displayed activity towards long carbon-chain-p-nitrophenyl substrates (C12-C18) at 25 °C from the culture supernatant of an Antarctic Penicillium expansum strain assigned P. expansum SM3. Zymography revealed a protein band of around 30 kDa with activity towards olive oil. DNA fragments of a lipase gene designated as lipPE were isolated from the genomic DNA of P. expansum SM3 by genomic walking PCR. Subsequently, the complete genomic lipPE gene was amplified using gene-specific primers designed from the 5'- and 3'-regions. Reverse transcription PCR was used to amplify the lipPE cDNA. The deduced amino acid sequence consisted of 285 residues that included a predicted signal peptide. Three peptides identified by LC/MS/MS analysis of the proteins in the culture supernatant of P. expansum were also present in the deduced amino acid sequence of the lipPE gene suggesting that this gene encoded the lipase identified by initial zymogram activity analysis. Full analysis of the nucleotide and the deduced amino acid sequences indicated that the lipPE gene encodes a novel P. expansum lipase. The lipPE gene was expressed in E. coli for further characterization of the enzyme with a view of assessing its suitability for industrial applications. PMID:23779196

  7. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin


    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  8. Isolation and expression of two aquaporin-encoding genes from the marine phanerogam Posidonia oceanica.


    Maestrini, Pierluigi; Giordani, Tommaso; Lunardi, Andrea; Cavallini, Andrea; Natali, Lucia


    Seagrasses such as Posidonia oceanica (L.) Delile are marine phanerogams, widespread in various seas, where they form large prairies representing dynamic substrates exceeding the area of the sediment surface several times over and allowing settlement of epiphyte organisms. Studying mechanisms involved in water transport in marine plants, we isolated two aquaporin-encoding genes, PoPIP1;1 and PoTIP1;1, showing high similarity to plasma membrane- and tonoplast-intrinsic protein-encoding genes, respectively. PoPIP1;1 is unique in the genome of P. oceanica, while PoTIP1;1 belongs to an aquaporin subfamily of at least four members. PoPIP1;1 and PoTIP1;1 encode functional proteins, as indicated by expression experiments in Xenopus oocytes. Both genes are constitutively expressed in the leaves, with higher levels of transcripts in young than in differentiated leaf tissues. Variations of salt concentration in aquarium determined different PoPIP1;1 and PoTIP1;1 transcript accumulation, indicating the existence of adaptation mechanisms related to gene expression also in marine plants, i.e. adapted to very high salt concentrations. Hyposalinity induced lower levels of PIP1 transcripts, while hypersalinity determined more PIP1 transcripts than normal salinity. TIP1 transcripts increased in response to both hypo- and hypersalinity after 2 days of treatment and went back to control levels after 5 d. PMID:15653802

  9. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce.


    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka


    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. PMID:21616548

  10. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei


    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  11. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.


    Perumal, N; Murugesan, S; Krishnan, P


    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates. PMID:27514959

  12. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein

    SciTech Connect

    Hickey, E.; Brandon, S.E.; Weber, L.A.; Lloyd, D.


    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89/alpha/ and hspio/beta/) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89/alpha/, is induced by the adenovirus E1A gene product. The authors have isolated a human hsp89/alpha/ gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression n a /beta/-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89/alpha/ protein sequence differed from the human hsp89/beta/ sequence reported elsewhere in at least 99 out of the 732 amino acids. Transcription of the hsp89/alpha/ gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycles. hsp89/alpha/ mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells.

  13. The Coxiella burnetii Cryptic Plasmid Is Enriched in Genes Encoding Type IV Secretion System Substrates▿ †

    PubMed Central

    Voth, Daniel E.; Beare, Paul A.; Howe, Dale; Sharma, Uma M.; Samoilis, Georgios; Cockrell, Diane C.; Omsland, Anders; Heinzen, Robert A.


    The intracellular bacterial pathogen Coxiella burnetii directs biogenesis of a phagolysosome-like parasitophorous vacuole (PV), in which it replicates. The organism encodes a Dot/Icm type IV secretion system (T4SS) predicted to deliver to the host cytosol effector proteins that mediate PV formation and other cellular events. All C. burnetii isolates carry a large, autonomously replicating plasmid or have chromosomally integrated plasmid-like sequences (IPS), suggesting that plasmid and IPS genes are critical for infection. Bioinformatic analyses revealed two candidate Dot/Icm substrates with eukaryotic-like motifs uniquely encoded by the QpH1 plasmid from the Nine Mile reference isolate. CpeC, containing an F-box domain, and CpeD, possessing kinesin-related and coiled-coil regions, were secreted by the closely related Legionella pneumophila Dot/Icm T4SS. An additional QpH1-specific gene, cpeE, situated in a predicted operon with cpeD, also encoded a secreted effector. Further screening revealed that three hypothetical proteins (CpeA, CpeB, and CpeF) encoded by all C. burnetii plasmids and IPS are Dot/Icm substrates. By use of new genetic tools, secretion of plasmid effectors by C. burnetii during host cell infection was confirmed using β-lactamase and adenylate cyclase translocation assays, and a C-terminal secretion signal was identified. When ectopically expressed in HeLa cells, plasmid effectors trafficked to different subcellular sites, including autophagosomes (CpeB), ubiquitin-rich compartments (CpeC), and the endoplasmic reticulum (CpeD). Collectively, these results suggest that C. burnetii plasmid-encoded T4SS substrates play important roles in subversion of host cell functions, providing a plausible explanation for the absolute maintenance of plasmid genes by this pathogen. PMID:21216993

  14. Mammalian ets-1 and ets-2 genes encode highly conserved proteins

    SciTech Connect

    Watson, D.K.; McWilliams, M.J.; Lapis, P.; Lautenberger, J.A.; Schweinfest, C.W.; Papas, T.S. )


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, the authors have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is >95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published finding indicates that ets is a family of genes whose members share distinct domains.

  15. Mammalian ets-1 and ets-2 genes encode highly conserved proteins.

    PubMed Central

    Watson, D K; McWilliams, M J; Lapis, P; Lautenberger, J A; Schweinfest, C W; Papas, T S


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, we have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is greater than 95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published findings indicates that ets is a family of genes whose members share distinct domains. PMID:2847145

  16. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.


    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  17. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  18. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.


    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J


    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  19. Cloning and characterization of two Lactobacillus casei genes encoding a cystathionine lyase.


    Irmler, Stefan; Raboud, Sylvie; Beisert, Beata; Rauhut, Doris; Berthoud, Hélène


    Volatile sulfur compounds are key flavor compounds in several cheese types. To better understand the metabolism of sulfur-containing amino acids, which certainly plays a key role in the release of volatile sulfur compounds, we searched the genome database of Lactobacillus casei ATCC 334 for genes encoding putative homologs of enzymes known to degrade cysteine, cystathionine, and methionine. The search revealed that L. casei possesses two genes that putatively encode a cystathionine beta-lyase (CBL; EC The enzyme has been implicated in the degradation of not only cystathionine but also cysteine and methionine. Recombinant CBL proteins catalyzed the degradation of L-cystathionine, O-succinyl-L-homoserine, L-cysteine, L-serine, and L-methionine to form alpha-keto acid, hydrogen sulfide, or methanethiol. The two enzymes showed notable differences in substrate specificity and pH optimum. PMID:17993563

  20. Human TOP3: a single-copy gene encoding DNA topoisomerase III.

    PubMed Central

    Hanai, R; Caron, P R; Wang, J C


    A human cDNA encoding a protein homologous to the Escherichia coli DNA topoisomerase I subfamily of enzymes has been identified through cloning and sequencing. Expressing the cloned human cDNA in yeast (delta)top1 cells lacking endogenous DNA topoisomerase I yielded an activity in cell extracts that specifically reduces the number of supercoils in a highly negatively supercoiled DNA. On the basis of these results, the human gene containing the cDNA sequence has been denoted TOP3, and the protein it encodes has been denoted DNA topoisomerase III. Screening of a panel of human-rodent somatic hybrids and fluorescence in situ hybridization of cloned TOP3 genomic DNA to metaphase chromosomes indicate that human TOP3 is a single-copy gene located at chromosome 17p11.2-12. Images Fig. 2 PMID:8622991

  1. Immunoglobulin kappa light chain variable region gene complex organization and immunoglobulin genes encoding anti-DNA autoantibodies in lupus mice.

    PubMed Central

    Kofler, R; Strohal, R; Balderas, R S; Johnson, M E; Noonan, D J; Duchosal, M A; Dixon, F J; Theofilopoulos, A N


    We have investigated the genetic origin of autoantibody production in several strains of mice that spontaneously develop a systemic lupus erythematosus-like disease. Restriction fragment length polymorphism analyses of gene loci encoding kappa light chain variable regions (Igk-V) demonstrated, as shown previously for the Ig heavy chain locus, that autoantibody production and disease occur in different Igk-V haplotypes. Moreover, autoimmune mice with known genetic derivation inherited their Igk-V loci essentially unaltered from their nonautoimmune ancestors. New Zealand black lupus mice, with unknown genetic derivation, had a possibly recombinant Igk-V haplotype, composed of V kappa loci that were primarily indistinguishable from those of nonautoimmune strains from either of the two potential donor haplotypes. The heavy and light chain gene segments (variable, diversity, joining) encoding anti-DNA antibodies were diverse and often closely related, or even identical, to those found in antibodies to foreign antigens in normal mice. Only 1 of 11 sequenced variable region genes could not be assigned to existing variable region gene families; however, corresponding germline genes were present in the genome of normal mice as well. These data argue against abnormalities in the genes and mechanisms generating antibody diversity in lupus mice and suggest a remarkable genetic and structural diversity in the generation of anti-DNA binding sites. Images PMID:3138286

  2. Nucleotide sequence, transcription and phylogeny of the gene encoding the superoxide dismutase of Sulfolobus acidocaldarius.


    Klenk, H P; Schleper, C; Schwass, V; Brudler, R


    The gene encoding the superoxide dismutase (SOD) of the thermophilic archaeon Sulfolobus acidocaldarius has been isolated and sequenced. Both the start site and the termination sites of the corresponding transcript were mapped. The deduced amino acid sequence of the protein is very similar to the sequence of manganese- or iron-containing SODs. Phylogenetic sequence analysis corroborated the monophyletic nature of the archaeal domain. PMID:8334170

  3. Cloning and Expression of clt Genes Encoding Milk-Clotting Proteases from Myxococcus xanthus 422

    PubMed Central

    Poza, M.; Prieto-Alcedo, M.; Sieiro, C.; Villa, T. G.


    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems. PMID:15466588

  4. Identification of the Repressor-Encoding Gene of the Lactobacillus Bacteriophage A2

    PubMed Central

    Ladero, Victor; García, Pilar; Bascarán, Victoria; Herrero, Mónica; Alvarez, Miguel A.; Suárez, Juan E.


    The repressor gene of the Lactobacillus phage A2 has the following properties: it (i) encodes a 224-residue polypeptide with DNA binding and RecA cleavage motifs, (ii) is expressed in lysogenic cultures, and (iii) confers superinfection immunity on the host. Adjacent, but divergently transcribed, lies another open reading frame whose product resembles the λ Cro protein. In the 161-bp intergenic segment, putative promoters and operators have been detected. PMID:9642205

  5. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.


    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting


    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  6. Genes encoding farnesyl cysteine carboxyl methyltransferase in Schizosaccharomyces pombe and Xenopus laevis.

    PubMed Central

    Imai, Y; Davey, J; Kawagishi-Kobayashi, M; Yamamoto, M


    The mam4 mutation of Schizosaccharomyces pombe causes mating deficiency in h- cells but not in h+ cells. h- cells defective in mam4 do not secrete active mating pheromone M-factor. We cloned mam4 by complementation. The mam4 gene encodes a protein of 236 amino acids, with several potential membrane-spanning domains, which is 44% identical with farnesyl cysteine carboxyl methyltransferase encoded by STE14 and required for the modification of a-factor in Saccharomyces cerevisiae. Analysis of membrane fractions revealed that mam4 is responsible for the methyltransferase activity in S. pombe. Cells defective in mam4 produced farnesylated but unmethylated cysteine and small peptides but no intact M-factor. These observations strongly suggest that the mam4 gene product is farnesyl cysteine carboxyl methyltransferase that modifies M-factor. Furthermore, transcomplementation of S. pombe mam4 allowed us to isolate an apparent homolog of mam4 from Xenopus laevis (Xmam4). In addition to its sequence similarity to S. pombe mam4, the product of Xmam4 was shown to have a farnesyl cysteine carboxyl methyltransferase activity in S. pombe cells. The isolation of a vertebrate gene encoding farnesyl cysteine carboxyl methyltransferase opens the way to in-depth studies of the role of methylation in a large body of proteins, including Ras superfamily proteins. PMID:9032282

  7. Isolation and characterization of a novel gene sfig in rat skeletal muscle up-regulated by spaceflight (STS-90)

    NASA Technical Reports Server (NTRS)

    Kano, Mihoko; Kitano, Takako; Ikemoto, Madoka; Hirasaka, Katsuya; Asanoma, Yuki; Ogawa, Takayuki; Takeda, Shinichi; Nonaka, Ikuya; Adams, Gregory R.; Baldwin, Kenneth M.; Oarada, Motoko; Kishi, Kyoichi; Nikawa, Takeshi


    We obtained the skeletal muscle of rats exposed to weightless conditions during a 16-day-spaceflight (STS-90). By using a differential display technique, we identified 6 up-regulated and 3 down-regulated genes in the gastrocnemius muscle of the spaceflight rats, as compared to the ground control. The up-regulated genes included those coding Casitas B-lineage lymphoma-b, insulin growth factor binding protein-1, titin and mitochondrial gene 16 S rRNA and two novel genes (function unknown). The down-regulated genes included those encoding RNA polymerase II elongation factor-like protein, NADH dehydrogenase and one novel gene (function unknown). In the present study, we isolated and characterized one of two novel muscle genes that were remarkably up-regulated by spaceflight. The deduced amino acid sequence of the spaceflight-induced gene (sfig) comprises 86 amino acid residues and is well conserved from Drosophila to Homo sapiens. A putative leucine-zipper structure located at the N-terminal region of sfig suggests that this gene may encode a transcription factor. The up-regulated expression of this gene, confirmed by Northern blot analysis, was observed not only in the muscles of spaceflight rats but also in the muscles of tail-suspended rats, especially in the early stage of tail-suspension when gastrocnemius muscle atrophy initiated. The gene was predominantly expressed in the kidney, liver, small intestine and heart. When rat myoblastic L6 cells were grown to 100% confluence in the cell culture system, the expression of sfig was detected regardless of the cell differentiation state. These results suggest that spaceflight has many genetic effects on rat skeletal muscle.

  8. Isolation and characterization of a novel gene sfig in rat skeletal muscle up-regulated by spaceflight (STS-90).


    Kano, Mihoko; Kitano, Takako; Ikemoto, Madoka; Hirasaka, Katsuya; Asanoma, Yuki; Ogawa, Takayuki; Takeda, Shinichi; Nonaka, Ikuya; Adams, Gregory R; Baldwin, Kenneth M; Oarada, Motoko; Kishi, Kyoichi; Nikawa, Takeshi


    We obtained the skeletal muscle of rats exposed to weightless conditions during a 16-day-spaceflight (STS-90). By using a differential display technique, we identified 6 up-regulated and 3 down-regulated genes in the gastrocnemius muscle of the spaceflight rats, as compared to the ground control. The up-regulated genes included those coding Casitas B-lineage lymphoma-b, insulin growth factor binding protein-1, titin and mitochondrial gene 16 S rRNA and two novel genes (function unknown). The down-regulated genes included those encoding RNA polymerase II elongation factor-like protein, NADH dehydrogenase and one novel gene (function unknown). In the present study, we isolated and characterized one of two novel muscle genes that were remarkably up-regulated by spaceflight. The deduced amino acid sequence of the spaceflight-induced gene (sfig) comprises 86 amino acid residues and is well conserved from Drosophila to Homo sapiens. A putative leucine-zipper structure located at the N-terminal region of sfig suggests that this gene may encode a transcription factor. The up-regulated expression of this gene, confirmed by Northern blot analysis, was observed not only in the muscles of spaceflight rats but also in the muscles of tail-suspended rats, especially in the early stage of tail-suspension when gastrocnemius muscle atrophy initiated. The gene was predominantly expressed in the kidney, liver, small intestine and heart. When rat myoblastic L6 cells were grown to 100% confluence in the cell culture system, the expression of sfig was detected regardless of the cell differentiation state. These results suggest that spaceflight has many genetic effects on rat skeletal muscle. PMID:12630567

  9. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    PubMed Central

    Liao, Liao; Vimolmangkang, Sornkanok; Wei, Guochao; Zhou, Hui; Korban, Schuyler S.; Han, Yuepeng


    Proanthocyanidins (PAs) are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR) and anthocyanidin reductase (ANR) was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis. PMID:25914714

  10. Four genes from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin.

    PubMed Central

    Hammer, P E; Hill, D S; Lam, S T; Van Pée, K H; Ligon, J M


    Pyrrolnitrin is a secondary metabolite of Pseudomonas and Burkholderia sp. strains with strong antifungal activity. Production of pyrrolnitrin has been correlated with the ability of some bacteria to control plant diseases caused by fungal pathogens, including the damping-off pathogen Rhizoctonia solani. Pseudomonas fluorescens BL915 has been reported to produce pyrrolnitrin and to be an effective biocontrol agent for this pathogen. We have isolated a 32-kb genomic DNA fragment from this strain that contains genes involved in the biosynthesis of pyrrolnitrin. Marker-exchange mutagenesis of this DNA with Tn5 revealed the presence of a 6.2-kb region that contains genes required for the synthesis of pyrrolnitrin. The nucleotide sequence of the 6.2-kb region was determined and found to contain a cluster of four genes that are required for the production of pyrrolnitrin. Deletion mutations in any of the four genes resulted in a pyrrolnitrin-nonproducing phenotype. The putative coding sequences of the four individual genes were cloned by PCR and fused to the tac promoter from Escherichia coli. In each case, the appropriate tac promoter-pyrrolnitrin gene fusion was shown to complement the pyrrolnitrin-negative phenotype of the corresponding deletion mutant. Transfer of the four gene cluster to E. coli resulted in the production of pyrrolnitrin by this organism, thereby demonstrating that the four genes are sufficient for the production of this metabolite and represent all of the genes required to encode the pathway for pyrrolnitrin biosynthesis. PMID:9172332

  11. Encoding four gene expression programs in the activation dynamics of a single transcription factor.


    Hansen, Anders S; O'Shea, Erin K


    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  12. The yeast SNF3 gene encodes a glucose transporter homologous to the mammalian protein.

    PubMed Central

    Celenza, J L; Marshall-Carlson, L; Carlson, M


    The SNF3 gene is required for high-affinity glucose transport in the yeast Saccharomyces cerevisiae and has also been implicated in control of gene expression by glucose repression. We report here the nucleotide sequence of the cloned SNF3 gene. The predicted amino acid sequence shows that SNF3 encodes a 97-kilodalton protein that is homologous to mammalian glucose transporters and has 12 putative membrane-spanning regions. We also show that a functional SNF3-lacZ gene-fusion product cofractionates with membrane proteins and is localized to the cell surface, as judged by indirect immunofluorescence microscopy. Expression of the fusion protein is regulated by glucose repression. Images PMID:3281163

  13. A Putative Gene Cluster from a Lyngbya wollei Bloom that Encodes Paralytic Shellfish Toxin Biosynthesis

    PubMed Central

    Mihali, Troco K.; Carmichael, Wayne W.; Neilan, Brett A.


    Saxitoxin and its analogs cause the paralytic shellfish-poisoning syndrome, adversely affecting human health and coastal shellfish industries worldwide. Here we report the isolation, sequencing, annotation, and predicted pathway of the saxitoxin biosynthetic gene cluster in the cyanobacterium Lyngbya wollei. The gene cluster spans 36 kb and encodes enzymes for the biosynthesis and export of the toxins. The Lyngbya wollei saxitoxin gene cluster differs from previously identified saxitoxin clusters as it contains genes that are unique to this cluster, whereby the carbamoyltransferase is truncated and replaced by an acyltransferase, explaining the unique toxin profile presented by Lyngbya wollei. These findings will enable the creation of toxin probes, for water monitoring purposes, as well as proof-of-concept for the combinatorial biosynthesis of these natural occurring alkaloids for the production of novel, biologically active compounds. PMID:21347365

  14. Neurally expressed Drosophila genes encoding homologs of the NSF and SNAP secretory proteins.

    PubMed Central

    Ordway, R W; Pallanck, L; Ganetzky, B


    Several lines of investigation have now converged to indicate that the neurotransmitter release apparatus is formed by assembly of cytosolic proteins with proteins of the synaptic vesicle and presynaptic terminal membranes. We are undertaking a genetic approach in Drosophila melanogaster to investigate the functions of two types of cytosolic proteins thought to function in this complex: N-ethylmaleimide-sensitive fusion protein (NSF) and the soluble NSF attachment proteins (SNAPs). We have identified Drosophila homologs of the vertebrate and yeast NSF and SNAP genes. Both Drosophila genes encode polypeptides that closely resemble their vertebrate counterparts and are expressed in the nervous system; neither appears to be in a family of closely related Drosophila genes. These results indicate that the Drosophila NSF and SNAP genes are excellent candidates for mutational analysis of neurotransmitter release. Images PMID:8202553

  15. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    PubMed Central

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica


    Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of

  16. Conservation of structure in the human gene encoding argininosuccinate synthetase and the argG genes of the archaebacteria Methanosarcina barkeri MS and Methanococcus vannielii

    SciTech Connect

    Morris, C.J.; Reeve, J.N.


    The DNA sequences of the argG genes of Methanosarcina barkeri MS and Methanococcus vannielii were determined. The polypeptide products of these methanogen genes have amino acid sequences which are 50% identical to each other and 38% identical to the amino acid sequence encoded by the exons of the human argininosuccinate synthetase gene. Introns in the human chromosomal gene separate regions which encode amino acids conserved in both the archaebacterial and human gene products. An open reading frame immediately upstream of argG in Methanosarcina barkeri MS codes for an amino acid sequence which is 45 and 31% identical to the sequences of the large subunits of carbamyl phosphate synthetase in Escherichia coli and Saccharomyces cerevisiae, respectively. If this gene encodes carbamyl phosphate synthetase in Methanosarcina barkeri, this is the first example, in an archaebacterium, of physical linkage of genes that encode enzymes which catalyze reactions in the same amino acid biosynthetic pathway.

  17. Hairpin Ribozyme Genes Curtail Alcohol Drinking: from Rational Design to in vivo Effects in the Rat.


    Sapag, Amalia; Irrazábal, Thergiory; Lobos-González, Lorena; Muñoz-Brauning, Carlos R; Quintanilla, María Elena; Tampier, Lutske


    Ribozyme genes were designed to reduce voluntary alcohol drinking in a rat model of alcohol dependence. Acetaldehyde generated from alcohol in the liver is metabolized by the mitochondrial aldehyde dehydrogenase (ALDH2) such that diminishing ALDH2 activity leads to the aversive effects of blood acetaldehyde upon alcohol intake. A stepwise approach was followed to design genes encoding ribozymes targeted to the rat ALDH2 mRNA. In vitro studies of accessibility to oligonucleotides identified suitable target sites in the mRNA, one of which fulfilled hammerhead and hairpin ribozyme requirements (CGGUC). Ribozyme genes delivered in plasmid constructs were tested in rat cells in culture. While the hairpin ribozyme reduced ALDH2 activity 56% by cleavage and blockade (P < 0.0001), the hammerhead ribozyme elicited minor effects by blockade. The hairpin ribozyme was tested in vivo by adenoviral gene delivery to UChB alcohol drinker rats. Ethanol intake was curtailed 47% for 34 days (P < 0.0001), while blood acetaldehyde more than doubled upon ethanol administration and ALDH2 activity dropped 25% in liver homogenates, not affecting other ALDH isoforms. Thus, hairpin ribozymes targeted to 16 nt in the ALDH2 mRNA provide durable and specific effects in vivo, representing an improvement on previous work and encouraging development of gene therapy for alcoholism. PMID:27404720

  18. funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi

    PubMed Central


    Background RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. Description To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. Conclusions funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi. PMID:25522231

  19. Somatic diversity in CDR3 loops allows single V-genes to encode innate immunological memories for multiple pathogens.


    Thomson, Christy A; Little, Ken Q; Reason, Donald C; Schrader, John W


    The human Ab response to many common pathogens is oligoclonal, with restricted usage of Ig V-genes. Intriguingly, the IGVK3-11 and IGVH3-30 V-genes are repeatedly paired in protective Abs against the 23F polysaccharide of Streptococcus pneumoniae, as well as against the gB envelope protein of human CMV, where germline-encoded amino acids make key contacts with the gB protein. We constructed IgGs encoded by the germline IGVK3-11 and IGVH3-30 V-genes together with DNA encoding the respective CDR3 regions of the L chain and H chain found in a hypermutated anti-23F Ab. These IgGs encoded by germline V-genes bound specifically to 23F pneumococcal capsular polysaccharides with no reactivity to other serotypes of pneumococcal capsular polysaccharides or arrayed glycans and recognized L-rhamnose, a component of the 23F repeating subunit. IgGs encoded by this pair of germline V-genes mediated complement-dependent phagocytosis of encapsulated 23F S. pneumoniae by human neutrophils. Mutations in CDRL3 and CDRH3 had significant effects on binding. Thus, IGKV3-11 and IGHV3-30, depending on with which distinct DNA sequences encoding CDR3 they are recombined, can encode binding sites for protective Abs against chemically distinct Ags and thus, may encode innate immunological memory against human CMV and S. pneumoniae. PMID:21228346

  20. Identification of candidate genes encoding an LDL-C QTL in baboons[S

    PubMed Central

    Karere, Genesio M.; Glenn, Jeremy P.; Birnbaum, Shifra; Hafizi, Sussan; Rainwater, David L.; Mahaney, Michael C.; VandeBerg, John L.; Cox, Laura A.


    Cardiovascular disease (CVD) is the leading cause of death in developed countries, and dyslipidemia is a major risk factor for CVD. We previously identified a cluster of quantitative trait loci (QTL) on baboon chromosome 11 for multiple, related quantitative traits for serum LDL-cholesterol (LDL-C). Here we report differentially regulated hepatic genes encoding an LDL-C QTL that influences LDL-C levels in baboons. We performed hepatic whole-genome expression profiling for LDL-C-discordant baboons fed a high-cholesterol, high-fat (HCHF) diet for seven weeks. We detected expression of 117 genes within the QTL 2-LOD support interval. Three genes were differentially expressed in low LDL-C responders and 8 in high LDL-C responders in response to a HCHF diet. Seven genes (ACVR1B, CALCOCO1, DGKA, ERBB3, KRT73, MYL6B, TENC1) showed discordant expression between low and high LDL-C responders. To prioritize candidate genes, we integrated miRNA and mRNA expression profiles using network tools and found that four candidates (ACVR1B, DGKA, ERBB3, TENC1) were miRNA targets and that the miRNAs were inversely expressed to the target genes. Candidate gene expression was validated using QRT-PCR and Western blotting. This study reveals candidate genes that influence variation in LDL-C in baboons and potential genetic mechanisms for further investigation. PMID:23596326

  1. Clusters of genes encoding fructan biosynthesizing enzymes in wheat and barley.


    Huynh, Bao-Lam; Mather, Diane E; Schreiber, Andreas W; Toubia, John; Baumann, Ute; Shoaei, Zahra; Stein, Nils; Ariyadasa, Ruvini; Stangoulis, James C R; Edwards, James; Shirley, Neil; Langridge, Peter; Fleury, Delphine


    Fructans are soluble carbohydrates with health benefits and possible roles in plant adaptation. Fructan biosynthetic genes were isolated using comparative genomics and physical mapping followed by BAC sequencing in barley. Genes encoding sucrose:sucrose 1-fructosyltransferase (1-SST), fructan:fructan 1-fructosyltransferase (1-FFT) and sucrose:fructan 6-fructosyltransferase (6-SFT) were clustered together with multiple copies of vacuolar invertase genes and a transposable element on two barley BAC. Intron-exon structures of the genes were similar. Phylogenetic analysis of the fructosyltransferases and invertases in the Poaceae showed that the fructan biosynthetic genes may have evolved from vacuolar invertases. Quantitative real-time PCR was performed using leaf RNA extracted from three wheat cultivars grown under different conditions. The 1-SST, 1-FFT and 6-SFT genes had correlated expression patterns in our wheat experiment and in existing barley transcriptome database. Single nucleotide polymorphism (SNP) markers were developed and successfully mapped to a major QTL region affecting wheat grain fructan accumulation in two independent wheat populations. The alleles controlling high- and low- fructan in parental lines were also found to be associated in fructan production in a diverse set of 128 wheat lines. To the authors' knowledge, this is the first report on the mapping and sequencing of a fructan biosynthetic gene cluster and in particular, the isolation of a novel 1-FFT gene from barley. PMID:22864927

  2. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.


    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B


    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. PMID:20722697

  3. Entamoeba histolytica: a unicellular organism containing two active genes encoding for members of the TBP family.


    Castañon-Sanchez, Carlos Alberto; Luna-Arias, Juan Pedro; de Dios-Bravo, Ma Guadalupe; Herrera-Aguirre, Maria Esther; Olivares-Trejo, Jose J; Orozco, Esther; Hernandez, Jose Manuel


    Entamoeba histolytica is the protozoan parasite which causes human amoebiasis. In this parasite, few encoding genes for transcription factors have been cloned and characterized. The E. histolytica TATA-box binding protein (EhTBP) is the first basal transcription factor that has been studied. To continue with the identification of other members of the basal transcription machinery, we performed an in silico analysis of the E. histolytica genome and found three loci encoding for polypeptides with similarity to EhTBP. One locus has a 100% identity to the previously Ehtbp gene reported by our group. The second locus encodes for a 212 aa polypeptide that is 100% identical to residues 23-234 from EhTBP. The third one encodes for a 216 aa polypeptide of 24kDa that showed 42.6% identity and 73.7% similarity to EhTBP. This protein was named E. histolytica TBP-related factor 1 (EhTRF1). Ehtrf1 gene was expressed in bacteria and the purified 28kDa recombinant polypeptide showed the capacity to bind to TATTTAAA-box by electrophoretic mobility shift assays. K(D) values for rEhTBP and rEhTRF1 were (1.71+/-2.90)x10(-12)M and (1.12+/-0.160)x10(-11)M, respectively. Homology modeling of EhTRF1 and EhTBP revealed that, although they were very similar, they showed some differences on their surfaces. Thus, E. histolytica is a unicellular organism having two members of the TBP family. PMID:20026212

  4. Cloning and characterization of a Pseudomonas mendocina KR1 gene cluster encoding toluene-4-monooxygenase

    SciTech Connect

    Kwangmu Yen; Karl, M.R.; Blatt, L.M.; Simon, M.J.; Winter, R.B.; Fausset, P.R.; Lu, H.S.; Harcourt, A.A.; Chen, K.K. )


    Pseudomonas mendocina KR1 metabolizes toluene as a carbon source by a previously unknown pathway. The initial step of the pathway is hydroxylation of toluene to form p-cresol by a multicomponent toluene-4-monooxygenase (T4MO) system. The authors have cloned and characterized a gene cluster from KR 1 that determines the T4MO activity. To clone the T4MO genes, KR1 DNA libraries were constructed in Escherichia coli HB 101 by using a broad-host-range vector and transferred to a KR1 mutant able to grow on p-cresol but no on toluene. An insert consisting of two SacI fragments of identical size was shown to complement the mutant for growth on toluene. One of the SacI fragments, when cloned into the E. coli vector pUC19, was found to direct the synthesis of indigo dye. The indigo-forming property was correlated with the presence of T4MO activity. The T4MO genes were mapped to a 3.6-kb region, and the direction of transcription was determined. DNA sequencing and N-terminal amino acid determination identified a five-gene cluster, tmoABCDE, within this region. Expression of this cluster carrying a single mutation in each gene demonstrated that each of the five genes is essential for T4MO activity. Other evidence presented indicated that none of the tmo genes was involved in the regulation of the tmo gene cluster, in the control of substrate transport of the T4MO system, or in major processing of the products of the tmo genes. It was tentatively concluded that the tmoABCDE genes encode structural polypeptides of the T4MO enzyme system. One of the tmo genes was tentatively identified as a ferredoxin gene.

  5. Mammalian Glutaminase Gls2 Gene Encodes Two Functional Alternative Transcripts by a Surrogate Promoter Usage Mechanism

    PubMed Central

    Campos-Sandoval, José A.; Manzanares, Elisa; Lobo, Carolina; Segura, J. A.; Alonso, Francisco J.; Matés, José M.; Márquez, Javier


    Background Glutaminase is expressed in most mammalian tissues and cancer cells, but the regulation of its expression is poorly understood. An essential step to accomplish this goal is the characterization of its species- and cell-specific isoenzyme pattern of expression. Our aim was to identify and characterize transcript variants of the mammalian glutaminase Gls2 gene. Methodology/Principal Findings We demonstrate for the first time simultaneous expression of two transcript variants from the Gls2 gene in human, rat and mouse. A combination of RT-PCR, primer-extension analysis, bioinformatics, real-time PCR, in vitro transcription and translation and immunoblot analysis was applied to investigate GLS2 transcripts in mammalian tissues. Short (LGA) and long (GAB) transcript forms were isolated in brain and liver tissue of human, rat and mouse. The short LGA transcript arises by a combination of two mechanisms of transcriptional modulation: alternative transcription initiation and alternative promoter. The LGA variant contains both the transcription start site (TSS) and the alternative promoter in the first intron of the Gls2 gene. The full human LGA transcript has two in-frame ATGs in the first exon, which are missing in orthologous rat and mouse transcripts. In vitro transcription and translation of human LGA yielded two polypeptides of the predicted size, but only the canonical full-length protein displayed catalytic activity. Relative abundance of GAB and LGA transcripts showed marked variations depending on species and tissues analyzed. Conclusions/Significance This is the first report demonstrating expression of alternative transcripts of the mammalian Gls2 gene. Transcriptional mechanisms giving rise to GLS2 variants and isolation of novel GLS2 transcripts in human, rat and mouse are presented. Results were also confirmed at the protein level, where catalytic activity was demonstrated for the human LGA protein. Relative abundance of GAB and LGA transcripts was

  6. Response of NBS encoding resistance genes linked to both heat and fungal stress in Brassica oleracea.


    Kim, Young-Wook; Jung, Hee-Jeong; Park, Jong-In; Hur, Yoonkang; Nou, Ill-Sup


    Environmental stresses, including both abiotic and biotic stresses, cause considerable yield loss in crops and can significantly affect their development. Under field conditions, crops are exposed to a variety of concurrent stresses. Among abiotic and biotic stresses, heat and Fusarium oxysporum, are the most important factors affecting development and yield productivity of Brassica oleracea. Genes encoding the nucleotide-binding site (NBS) motif are known to be related to responses to abiotic and biotic stresses in many plants. Hence, this study was conducted to characterize the NBS encoding genes obtained from transcriptome profiles of two cabbage genotypes with contrasting responses to heat stress, and to test expression levels of selected NBS- leucine reich repeat (LRR) genes in F. oxysporum infected plants. We selected 80 up-regulated genes from a total of 264 loci, among which 17 were confirmed to be complete and incomplete members of the TIR-NBS-LRR (TNL) class families, and another identified as an NFYA-HAP2 family member. Expression analysis using qRT-PCR revealed that eight genes showed significant responses to heat shock treatment and F. oxysporum infection. Additionally, in the commercial B. oleracea cultivars with resistance to F. oxysporum, the Bol007132, Bol016084, and Bol030522 genes showed dramatically higher expression in the F. oxysporum resistant line than in the intermediate and susceptible lines. The results of this study will facilitate the identification and the development of molecular markers based on multiple stress resistance genes related to heat and fungal stress under field conditions in B. oleracea. PMID:25461701

  7. The Arabidopsis HUELLENLOS Gene, Which Is Essential for Normal Ovule Development, Encodes a Mitochondrial Ribosomal Protein

    PubMed Central

    Skinner, Debra J.; Baker, Shawn C.; Meister, Robert J.; Broadhvest, Jean; Schneitz, Kay; Gasser, Charles S.


    The HUELLENLOS (HLL) gene participates in patterning and growth of the Arabidopsis ovule. We have isolated the HLL gene and shown that it encodes a protein homologous to the L14 proteins of eubacterial ribosomes. The Arabidopsis genome also includes a highly similar gene, HUELLENLOS PARALOG (HLP), and genes for both cytosolic (L23) and chloroplast ribosome L14 proteins. Phylogenetic analysis shows that HLL and HLP differ significantly from these other two classes of such proteins. HLL and HLP fusions to green fluorescent protein were localized to mitochondria. Ectopic expression of HLP complemented the hll mutant, indicating that HLP and HLL share redundant functions. We conclude that HLL and HLP encode L14 subunits of mitochondrial ribosomes. HLL mRNA was at significantly higher levels than HLP mRNA in pistils, with the opposite pattern in leaves. This differential expression can explain the confinement of effects of hll mutations to gynoecia and ovules. Our elucidation of the nature of HLL shows that metabolic defects can have specific effects on developmental patterning. PMID:11752383

  8. Comparative sequence analysis of double stranded RNA binding protein encoding gene of parapoxviruses from Indian camels.


    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Sivakumar, G; Tuteja, F C; Narnaware, S D; Mehta, S C; Singh, Raghvendar; Patil, N V


    The dsRNA binding protein (RBP) encoding gene of parapoxviruses (PPVs) from the Dromedary camels, inhabitating different geographical region of Rajasthan, India were amplified by polymerase chain reaction using the primers of pseudocowpoxvirus (PCPV) from Finnish reindeer and cloned into pGEM-T for sequence analysis. Analysis of RBP encoding gene revealed that PPV DNA from Bikaner shared 98.3% and 76.6% sequence identity at the amino acid level, with Pali and Udaipur PPV DNA, respectively. Reference strains of Bovine papular stomatitis virus (BPSV) and PCPV (reindeer PCPV and human PCPV) shared 52.8% and 86.9% amino acid identity with RBP gene of camel PPVs from Bikaner, respectively. But different strains of orf virus (ORFV) from different geographical areas of the world shared 69.5-71.7% amino acid identity with RBP gene of camel PPVs from Bikaner. These findings indicate that the camel PPVs described are closely related to bovine PPV (PCPV) in comparison to caprine and ovine PPV (ORFV). PMID:25685494

  9. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae.


    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem


    Proteins containing nucleotide binding sites (NBS) encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL)-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution. PMID:25249784

  10. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    PubMed Central

    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem


    Proteins containing nucleotide binding sites (NBS) encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL)-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution. PMID:25249784

  11. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    PubMed Central

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou


    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens. PMID:25514417

  12. Identification and characterization of a Neisseria gonorrhoeae gene encoding a glycolipid-binding adhesin.

    PubMed Central

    Paruchuri, D K; Seifert, H S; Ajioka, R S; Karlsson, K A; So, M


    We recently identified a set of mammalian cell receptors for Neisseria gonorrhoeae that are glycolipids. These receptors, lactosylceramide [Gal(beta 1-4)Glc(beta 1-1)Cer], gangliotriosylceramide [GalNAc( beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], and gangliotetraosylceramide [Gal(beta 1-3)GalNAc(beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], were shown to be specifically bound by a gonococcal outer membrane protein distinct from pilin and protein II. Here we report the isolation of the gene encoding the gangliotetraosylceramide-binding adhesin from a N. gonorrhoeae MS11 gene bank in Escherichia coli. Transposon mutagenesis studies in E. coli indicate that the adhesion is a protein with a molecular mass of 36,000 Da. The gene encoding the 36-kDa protein is duplicated in MS11 since two transposon insertions were required to abolish expression of the gene in this bacterium. This protein is present on the surface of the gonococcus and is not associated with the pilus. Images PMID:2153292

  13. Identification and characterization of a Neisseria gonorrhoeae gene encoding a glycolipid-binding adhesin.


    Paruchuri, D K; Seifert, H S; Ajioka, R S; Karlsson, K A; So, M


    We recently identified a set of mammalian cell receptors for Neisseria gonorrhoeae that are glycolipids. These receptors, lactosylceramide [Gal(beta 1-4)Glc(beta 1-1)Cer], gangliotriosylceramide [GalNAc( beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], and gangliotetraosylceramide [Gal(beta 1-3)GalNAc(beta 1-4)Gal(beta 1-4)Glc(beta 1-1)Cer], were shown to be specifically bound by a gonococcal outer membrane protein distinct from pilin and protein II. Here we report the isolation of the gene encoding the gangliotetraosylceramide-binding adhesin from a N. gonorrhoeae MS11 gene bank in Escherichia coli. Transposon mutagenesis studies in E. coli indicate that the adhesion is a protein with a molecular mass of 36,000 Da. The gene encoding the 36-kDa protein is duplicated in MS11 since two transposon insertions were required to abolish expression of the gene in this bacterium. This protein is present on the surface of the gonococcus and is not associated with the pilus. PMID:2153292

  14. The immune gene repertoire encoded in the purple sea urchin genome.


    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P


    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology. PMID:17027739

  15. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed.


    Rocca, Jennifer D; Hall, Edward K; Lennon, Jay T; Evans, Sarah E; Waldrop, Mark P; Cotner, James B; Nemergut, Diana R; Graham, Emily B; Wallenstein, Matthew D


    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes. PMID:25535936

  16. Decay of Genes Encoding the Oomycete Flagellar Proteome in the Downy Mildew Hyaloperonospora arabidopsidis

    PubMed Central

    Judelson, Howard S.; Shrivastava, Jolly; Manson, Joseph


    Zoospores are central to the life cycles of most of the eukaryotic microbes known as oomycetes, but some genera have lost the ability to form these flagellated cells. In the plant pathogen Phytophthora infestans, genes encoding 257 proteins associated with flagella were identified by comparative genomics. These included the main structural components of the axoneme and basal body, proteins involved in intraflagellar transport, regulatory proteins, enzymes for maintaining ATP levels, and others. Transcripts for over three-quarters of the genes were up-regulated during sporulation, and persisted to varying degrees in the pre-zoospore stage (sporangia) and motile zoospores. Nearly all of these genes had orthologs in other eukaryotes that form flagella or cilia, but not species that lack the organelle. Orthologs of 211 of the genes were also absent from a sister taxon to P. infestans that lost the ability to form flagella, the downy mildew Hyaloperonospora arabidopsidis. Many of the genes retained in H. arabidopsidis were also present in other non-flagellates, suggesting that they play roles both in flagella and other cellular processes. Remnants of the missing genes were often detected in the H. arabidopsidis genome. Degradation of the genes was associated with local compaction of the chromosome and a heightened propensity towards genome rearrangements, as such regions were less likely to share synteny with P. infestans. PMID:23077652

  17. Developmental expression of tobacco pistil-specific genes encoding novel extensin-like proteins.

    PubMed Central

    Goldman, M H; Pezzotti, M; Seurinck, J; Mariani, C


    We have sought to identify pistil-specific genes that can be used as molecular markers to study pistil development. For this purpose, a cDNA library was constructed from poly(A)+ RNA extracted from tobacco stigmas and styles at different developmental stages. Differential screening of this library led to the isolation of cDNA clones that correspond to genes preferentially or specifically expressed in the pistil. Seven of these cDNA clones encode proteins containing repetitions of the pentapeptide Ser-Pro4, which is a typical motif found in extensins. Unlike extensin genes, the extensin-like genes described here are not induced under stress conditions. RNA gel blot hybridizations demonstrated the organ-specific expression of the extensin-like genes and their temporal regulation during pistil development. After pollination, the transcript levels of the pistil-specific extensin-like genes change relative to levels in unpollinated pistils. In situ hybridization experiments showed that at least one of these pistil-specific genes is specifically expressed in cells of the transmitting tissue. The possible roles of the extensin-like proteins in pistils are discussed. PMID:1392607

  18. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    PubMed Central

    Rocca, Jennifer D; Hall, Edward K; Lennon, Jay T; Evans, Sarah E; Waldrop, Mark P; Cotner, James B; Nemergut, Diana R; Graham, Emily B; Wallenstein, Matthew D


    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes. PMID:25535936

  19. A bacterial gene codA encoding cytosine deaminase is an effective conditional negative selectable marker in Glycine max

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Conditional negative selection is a powerful technique whereby the absence of a gene product allows survival in otherwise lethal conditions. In plants, the Escherichia coli gene codA has been employed as a negative selection marker. CodA is a conditionally lethal dominant gene encoding cy...

  20. A mutation in the pnp gene encoding polynucleotide phosphorylase attenuates virulence of Salmonella enterica serovar typhimurium in swine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: The pnp gene encodes polynucleotide phosphorylase, an exoribonuclease involved in RNA degradation. A mutation in the pnp gene was previously identified by our group in a signature-tagged mutagenesis screen designed to search for Salmonella enterica serovar Typhimurium genes required for ...

  1. Genes encoding FAD-binding proteins in Volvariella volvacea exhibit differential expression in homokaryons and heterokaryons.


    Meng, Li; Yan, Junjie; Xie, Baogui; Li, Yu; Chen, Bingzhi; Liu, Shuyan; Li, Dan; Yang, Zhiyun; Zeng, Xiancheng; Deng, Youjin; Jiang, Yuji


    Flavin adenine dinucleotide (FAD)-binding proteins play a vital role in energy transfer and utilization during fungal growth and mycelia aggregation. We sequenced the genome of Volvariella volvacea, an economically important edible fungus, and discovered 41 genes encoding FAD-binding proteins. Gene expression profiles revealed that the expression levels of four distinctly differentially expressed genes in heterokaryotic strain H1521 were higher than in homokaryotic strains PYd15 and PYd21 combined. These observations were validated by quantitative real-time PCR. The results suggest that the differential expression of FAD-binding proteins may be important in revealing the distinction between homokaryons and heterokaryons on the basis of FAD-binding protein functionality. PMID:23570970

  2. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.


    Weiss, N; Sztejnberg, A; Yarden, O


    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  3. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    SciTech Connect

    Kashtanov, S.N.; Kazakova, T.I.


    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  4. The Drosophila melanogaster developmental gene g1 encodes a variant zinc-finger-motif protein.


    Bouchard, M L; Côté, S


    In Drosophila melanogaster, the mechanisms involved in the pattern formation of complex internal organs are still largely unknown. However, the identity of the molecular determinants that control the development of these specific tissues is emerging from the combined use of genetic and molecular approaches. We have cloned a gene that is expressed in the mesoderm, one of the fundamental embryonic germ layers which gives rise to internal structures, such as the musculature. Here, we describe the molecular characterization of this gene, designated as g1. The nucleotide (nt) sequence of its cDNA shows an open reading frame of 852 nt, which encodes a 32-kDa protein with two putative zinc fingers, and a serine/glutamine/proline-rich region. These features indicate a functional role for g1, which remains to be elucidated, in regulating gene expression during mesoderm formation. PMID:8462875

  5. [Identification of the Gene Encoding Nucleostemin in the Eye Tissues of Pleurodeles waltl].


    Markitantova, Y V; Avdonin, P P; Grigoryan, E N


    Nucleotide sequences were identified in the eye tissues (lens, retina, and retinal pigment epithelium) of the adult newt Pleurodeles waltl by the polymerase chain reaction with primers for the Ns gene. Sequencing showed that these nucleotide sequences belong to the Ns gene of the newt P. walt, which encodes the nucleolar protein nucleostemin. Structural analysis revealed a high homology of Ns nucleotide sequences of P. walt! with those of newts. Cynops pyrrhogaster and Notophthalmus viridescens. The expression of the Ns gene of P. walt, identified in the specialized eye cells of adult newts of the studied species, indicates that these differentiated cells retain some of the molecular characteristics inherent to the undifferentiated cells. PMID:26638232

  6. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    NASA Astrophysics Data System (ADS)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin


    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  7. Functional investigation of a gene encoding pteridine glycosyltransferase for cyanopterin synthesis in Synechocystis sp. PCC 6803.


    Hwang, Yoon Kyung; Kang, Ji Youn; Woo, Hyun Joo; Choi, Yong Kee; Park, Young Shik


    A gene (slr1166) putatively encoding pteridine glycosyltransferase was disrupted with a kanamycin resistance cassette in Synechocystis sp. PCC 6803, which produces cyanopterin. The deduced polypeptide from slr1166 consisted of 354 amino acid residues sharing 45% sequence identity with UDP-glucose:tetrahydrobiopterin alpha-glucosyltransferase (BGluT) isolated previously from Synechococcus sp. PCC 7942. The knockout mutant was unable to produce cyanopterin but only 6-hydroxymethylpterin-beta-galactoside, verifying that slr1166 encodes a pteridine glycosyltransferase, which is responsible for transfer of the second sugar glucuronic acid in cyanopterin synthesis. The mutant was affected in its intracellular pteridine content and growth rate, which were 74% and 80%, respectively, of wild type, demonstrating that the second sugar residue is still required for quantitative maintenance of cyanopterin. This supports the previous suggestion that glycosylation may contribute to high cellular concentration of pteridine compounds. PMID:11985899

  8. Trypanosoma rangeli and Trypanosoma cruzi: molecular characterization of genes encoding putative calcium-binding proteins, highly conserved in trypanosomatids.


    Porcel, B M; Bontempi, E J; Henriksson, J; Rydåker, M; Aslund, L; Segura, E L; Pettersson, U; Ruiz, A M


    Genes encoding a 29-kDa flagellar calcium-binding protein (F29) in Trypanosoma cruzi, strongly homologous to EF-hand calcium-binding protein-encoding genes previously reported in this parasite, were isolated by immunoscreening. F29 is encoded by a number of very similar genes, highly conserved among different T. cruzi isolates. The genes are located on a pair of homologous chromosomes, arranged in one or two clusters of tandem repeats. PCR amplification of Trypanosoma rangeli genomic DNA, using primers derived from the T. cruzi F29 sequence made it possible to isolate the homologous gene in T. rangeli, encoding a 23-kDa protein called TrCaBP. Gene sequence comparisons showed homology to EF-hand calcium-binding proteins from T. cruzi (82.8%), Trypanosoma brucei brucei (60.2%), and Entamoeba histolytica (28.4%). Northern blot analysis revealed that the TrCaBP gene is expressed in T. rangeli as a polyadenylated transcript. The TrCaBP-encoding genes are present in at least 20 copies per cell, organized in tandem arrays, on large T. rangeli chromosomes in some isolates and on two smaller ones in others. This gene, however, seems to be absent from Leishmania. PMID:8948328

  9. Regulation of genes encoding cellulolytic enzymes by Pal-PacC signaling in Aspergillus nidulans.


    Kunitake, Emi; Hagiwara, Daisuke; Miyamoto, Kentaro; Kanamaru, Kyoko; Kimura, Makoto; Kobayashi, Tetsuo


    Cellulosic biomass represents a valuable potential substitute for fossil-based fuels. As such, there is a strong need to develop efficient biotechnological processes for the enzymatic hydrolysis of cellulosic biomass via the optimization of cellulase production by fungi. Ambient pH is an important factor affecting the industrial production of cellulase. In the present study, we demonstrate that several Aspergillus nidulans genes encoding cellulolytic enzymes are regulated by Pal-PacC-mediated pH signaling, as evidenced by the decreased cellulase productivity of the palC mutant and pacC deletants of A. nidulans. The deletion of pacC was observed to result in delayed induction and decreased expression of the cellulase genes based on time course expression analysis. The genome-wide identification of PacC-regulated genes under cellobiose-induced conditions demonstrated that genes expressed in a PacC-dependent manner included 82 % of ClrB (a transcriptional activator of the cellulase genes)-regulated genes, including orthologs of various transporter and β-glucosidase genes considered to be involved in cellobiose uptake or production of stronger inducer molecules. Together with the significant overlap between ClrB- and PacC-regulated genes, the results suggest that PacC-mediated regulation of the cellulase genes involves not only direct regulation by binding to their promoter regions but also indirect regulation via modulation of the expression of genes involved in ClrB-dependent transcriptional activation. Our findings are expected to contribute to the development of more efficient industrial cellulase production methods. PMID:26946171

  10. Cloning of the genes encoding two murine and human cochlear unconventional type I myosins

    SciTech Connect

    Crozet, F.; El Amraoui, Z.; Blanchard, S.


    Several lines of evidence indicate a crucial role for unconventional myosins in the function of the sensory hair cells of the inner ear. We report here the characterization of the cDNAs encoding two unconventional type I myosins from a mouse cochlear cDNA library. The first cDNA encodes a putative protein named Myo1c, which is likely to be the murine orthologue of the bullfrog myosin I{beta} and which may be involved in the gating of the mechanotransduction channel of the sensory hair cells. This myosin belongs to the group of short-tailed myosins I, with its tail ending shortly after a polybasic, TH-1-like domain. The second cDNA encodes a novel type I myosin Myo1f which displays three regions: a head domain with the conserved ATP- and actin-binding sites, a neck domain with a single IQ motif, and a tail domain with the tripartite structure initially described in protozoan myosins I. The tail of Myo1f includes (1) a TH-1 region rich in basic residues, which may interact with anionic membrane phospholipids; (2) a TH-2 proline-rich region, expected to contain an ATP-insensitive actin-binding site; and (3) an SH-3 domain found in a variety of cytoskeletal and signaling proteins. Northern blot analysis indicated that the genes encoding Myo1c and Myo1f display a widespread tissue expression in the adult mouse. Myo1c and Myo1f were mapped by in situ hybridization to the chromosomal regions 11D-11E and 17B-17C, respectively. The human orthologuous genes MYO1C and MYO1F were also characterized, and mapped to the human chromosomal regions 17p13 and 19p13.2- 19p1.3.3, respectively. 45 refs., 5 figs., 2 tabs.

  11. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.


    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans


    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea. PMID:23811228

  12. Full-genome identification and characterization of NBS-encoding disease resistance genes in wheat.


    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem


    Host resistance is the most economical, effective and ecologically sustainable method of controlling diseases in crop plants. In bread wheat, despite the high number of resistance loci that have been cataloged to date, only few have been cloned, underlying the need for genomics-guided investigations capable of providing a prompt and acute knowledge on the identity of effective resistance genes that can be used in breeding programs. Proteins with a nucleotide-binding site (NBS) encoded by the major plant disease resistance (R) genes play an important role in the responses of plants to various pathogens. In this study, a comprehensive analysis of NBS-encoding genes within the whole wheat genome was performed, and the genome scale characterization of this gene family was established. From the recently published wheat genome sequence, we used a data mining and automatic prediction pipeline to identify 580 complete ORF candidate NBS-encoding genes and 1,099 partial-ORF ones. Among complete gene models, 464 were longer than 200 aa, among them 436 had less than 70 % of sequence identity to each other. This gene models set was deeply characterized. (1) First, we have analyzed domain architecture and identified, in addition to typical domain combinations, the presence of particular domains like signal peptides, zinc fingers, kinases, heavy-metal-associated and WRKY DNA-binding domains. (2) Functional and expression annotation via homology searches in protein and transcript databases, based on sufficient criteria, enabled identifying similar proteins for 60 % of the studied gene models and expression evidence for 13 % of them. (3) Shared orthologous groups were defined using NBS-domain proteins of rice and Brachypodium distachyon. (4) Finally, alignment of the 436 NBS-containing gene models to the full set of scaffolds from the IWGSC's wheat chromosome survey sequence enabled high-stringence anchoring to chromosome arms. The distribution of the R genes was found balanced

  13. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.


    Jung, Yangjin; Matthews, Karl R


    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. PMID:27554144

  14. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )


    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  15. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    SciTech Connect

    Lindner, I.; Ehlers, B. . E-mail:; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.


    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1{sub h}, ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1{sub h} and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation.

  16. A pin gene families encoding components of auxin efflux carriers in Brassica juncea.


    Ni, Wei Min; Chen, Xiao Ya; Xu, Zhi Hong; Xue, Hong Wei


    Based on the sequence information of Arabidopsis PIN1, two cDNAs encoding PIN homologues from Brassica juncea, Bjpin2 and Bjpin3, were isolated through cDNA library screening. Bjpin2 and Bjpin3 encoded proteins containing 640 and 635 amino acid residues, respectively, which shared 97.5% identities with each other and were highly homologous to Arabidopsis PIN1, PIN2 and other putative PIN proteins. BjPIN2 and BjPIN3 had similar structures as AtPIN proteins. Northern blot analysis indicated that Bjpin2 was expressed in stem, leaf and floral tissues, while Bjpin3 was expressed predominantly in stem and hypocotyls. Two promoter fragments of pin genes, Bjpin-X and Bjpin-Z, were isolated by 'genome walking' technique using primers at 5'-end of pin cDNA. Promoter-gus fusion studies revealed the GUS activities driven by Bjpin-X were at internal side of xylem and petal; while those driven by Bjpin-Z were detected at leaf vein, epidermal cell and cortex of stem, vascular tissues and anther. Results of the pin genes with different expression patterns in B. juncea suggested the presence of a gene family. PMID:12296384

  17. Cloning and characterization of glyceraldehyde-3-phosphate dehydrogenase encoding gene in Gracilaria/Gracilariopsis lemaneiformis

    NASA Astrophysics Data System (ADS)

    Ren, Xueying; Sui, Zhenghong; Zhang, Xuecheng


    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays important roles in various cellular processes. A cytosolic GAPDH encoding gene ( gpd) of Gracilaria/Gracilariopsis lemaneiformis was cloned and characterized. Deduced amino acid sequence of the enzyme of G. lemaneiformis had high homology with those of seven red algae. The 5'-untranslated regions of the GAPDHs encoding genes of these red algae varied greatly. GAPDHs of these red algae shared the highly conserved glyceraldehyde 3-phosphate dehydrogenase active site ASCTTNCL. However, such active site of Cyanidium caldarium was different from those of the other six algae at the last two residues (CL to LF), thus the spatial structure of its GAPDH active center may be different from those of the other six. Phylogenetic analysis indicated that GAPDH of G. lemaneiformis might have undergone an evolution similar to those of Porphyra yezoensis, Chondrus crispus, and Gracilaria verrucosa. C. caldarium had a closer evolutionary relationship with Cyanidioschyzon merolae than with Cyanidium sp. Virtual Northern blot analysis revealed that gpd of G. lemaneiformis expressed constitutively, which suggested that it might be house-keeping and could be adapted as an inner control in gene expression analysis of G. lemaneiformis.

  18. Cloning and orientation of the gene encoding polynucleotide phosphorylase in Escherichia coli.

    PubMed Central

    Crofton, S; Dennis, P P


    Mutations which affect the activity of polynucleotide phosphorylase (PNPase) map near 69 min on the bacterial chromosome. This region of the chromosome has been cloned by inserting the kanamycin-resistant transposon Tn5 near the argG and mtr loci at 68.5 min. Large SalI fragments of chromosomal DNA containing the Tn5 element were inserted into pBR322, and selection was made for kanamycin-resistant recombinant plasmids. Two of these plasmids were found to produce high levels of PNPase activity in both wild-type and host strains lacking PNPase activity. The pnp gene was further localized and subcloned on a 4.8 kilobase HindIII-EcoRI fragment. This fragment was shown to encode an 84,000-molecular weight protein which comigrated with purified PNPase during sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The orientation of the pnp gene was determined by insertion of Tn5 into the 4.8 kilobase fragment cloned in pBR322. Some of the insertions had lost the ability to elevate the level of PNPase activity in the host bacterium. Restriction mapping of the positions of the Tn5 insertions and analysis of plasmid-encoded polypeptides in UV-irradiated maxi-cells indicated that the pnp gene is oriented in the counterclockwise direction on the bacterial chromosome. Images PMID:6300041

  19. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    SciTech Connect

    Reynolds, P.; Weber, S.; Prakash, L.


    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures.

  20. Genes encoding putative natural killer cell C-type lectin receptors in teleostean fishes

    PubMed Central

    Sato, Akie; Mayer, Werner E.; Overath, Peter; Klein, Jan


    Mammalian natural killer (NK) cells are cytotoxic lymphocytes that express receptors specific for MHC class I molecules. The NK cell receptors belong to two structurally unrelated families, the killer cell Ig-like receptors and the killer cell C-type lectin receptors. We describe a cDNA clone derived from the bony (cichlid) fish Paralabidochromis chilotes and show that it encodes a protein related to the CD94/NK cell group 2 (NKG2) subfamily of the killer cell C-type lectin receptors. The gene encoding this receptor in a related species, Oreochromis niloticus, has a similar structure to the human CD94/NKG2 genes and is a member of a multigene cluster that resembles the mammalian NK cell gene complex. Thus, the CD94/NKG2 subfamily of NK cell receptors must have arisen before the divergence of fish and tetrapods and may have retained its function (possibly monitoring the expression of MHC class I molecules) for >400 million years. PMID:12802013

  1. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene

    PubMed Central

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.


    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  2. Yeast RAD14 and human xeroderma pigmentosum group A DNA-repair genes encode homologous proteins.


    Bankmann, M; Prakash, L; Prakash, S


    Xeroderma pigmentosum (XP), a human autosomal recessive disorder, is characterized by extreme sensitivity to sunlight and high incidence of skin cancers. XP cells are defective in the incision step of excision repair of DNA damaged by ultraviolet light. Cell fusion studies have defined seven XP complementation groups, XP-A to XP-G. Similar genetic complexity of excision repair is observed in the yeast Saccharomyces cerevisiae. Mutations in any one of five yeast genes, RAD1, RAD2, RAD3, RAD4, and RAD10, cause a total defect in incision and an extreme sensitivity to ultraviolet light. Here we report the characterization of the yeast RAD14 gene. The available rad14 point mutant is only moderately ultraviolet-sensitive, and it performs a substantial amount of incision of damaged DNA. Our studies with the rad14 deletion (delta) mutation indicate an absolute requirement of RAD14 in incision. RAD14 encodes a highly hydrophilic protein of 247 amino acids containing zinc-finger motifs, and it is similar to the protein encoded by the human XPAC gene that complements XP group A cell lines. PMID:1741034

  3. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.


    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro


    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  4. Divergence among Genes Encoding the Elongation Factor Tu of Yersinia Species▿

    PubMed Central

    Isabel, Sandra; Leblanc, Éric; Boissinot, Maurice; Boudreau, Dominique K.; Grondin, Myrian; Picard, François J.; Martel, Eric A.; Parham, Nicholas J.; Chain, Patrick S. G.; Bader, Douglas E.; Mulvey, Michael R.; Bryden, Louis; Roy, Paul H.; Ouellette, Marc; Bergeron, Michel G.


    Elongation factor Tu (EF-Tu), encoded by tuf genes, carries aminoacyl-tRNA to the ribosome during protein synthesis. Duplicated tuf genes (tufA and tufB), which are commonly found in enterobacterial species, usually coevolve via gene conversion and are very similar to one another. However, sequence analysis of tuf genes in our laboratory has revealed highly divergent copies in 72 strains spanning the genus Yersinia (representing 12 Yersinia species). The levels of intragenomic divergence between tufA and tufB sequences ranged from 8.3 to 16.2% for the genus Yersinia, which is significantly greater than the 0.0 to 3.6% divergence observed for other enterobacterial genera. We further explored tuf gene evolution in Yersinia and other Enterobacteriaceae by performing directed sequencing and phylogenetic analyses. Phylogenetic trees constructed using concatenated tufA and tufB sequences revealed a monophyletic genus Yersinia in the family Enterobacteriaceae. Moreover, Yersinia strains form clades within the genus that mostly correlate with their phenotypic and genetic classifications. These genetic analyses revealed an unusual divergence between Yersinia tufA and tufB sequences, a feature unique among sequenced Enterobacteriaceae and indicative of a genus-wide loss of gene conversion. Furthermore, they provided valuable phylogenetic information for possible reclassification and identification of Yersinia species. PMID:18790860

  5. Stress-dependent regulation of the gene encoding thioredoxin reductase from the fission yeast.


    Hong, Sung-Min; Lim, Hye-Won; Kim, Il-Han; Kim, Kanghwa; Park, Eun-Hee; Lim, Chang-Jin


    The unique putative gene for thioredoxin reductase (TrxR) was isolated from the chromosomal DNA of the fission yeast Schizosaccharomyces pombe. The determined DNA sequence carries 3125 bp, and encodes the plausible 322 amino acid sequence of TrxR with a molecular mass of 34,618 Da. The S. pombe cells harboring the cloned TrxR gene contain increased TrxR activity, and shows higher survivals on solid media with mercuric chloride or aluminum chloride. The 1526 bp upstream region was fused into promoterless beta-galactosidase gene of the shuttle vector YEp367R to generate the fusion plasmid. The synthesis of beta-galactosidase from the fusion plasmid pYUTR10 was enhanced by menadione, mercuric chloride, hydrogen peroxide, aluminium chloride and sodium selenite. Menadione significantly enhanced the TrxR mRNA level in the S. pombe cells, which was detected by RT-PCR. Induction of the S. pombe TrxR gene by menadione and mercuric chloride occurs through the mediation of the transcription factor Pap1. These results suggest that the S. pombe TrxR gene is one of the stress response-related genes. PMID:15135546

  6. The fdx gene encoding the [2Fe--2S] ferredoxin of Halobacterium salinarium (H. halobium).


    Pfeifer, F; Griffig, J; Oesterhelt, D


    The gene encoding the [2Fe--2S] ferredoxin (fdx gene) was isolated from Halobacterium salinarium using two oligonucleotides deduced from the ferredoxin sequence as probes. Cosmid DNAs exhibiting hybridization were isolated, the fdx gene was localized to smaller subfragments and the nucleotide sequence determined. The 390 bp coding sequence is located in the halobacterial FI-DNA and transcribed as a 440 nucleotide mRNA. S1 mapping indicated that the 5' terminus of the mRNA maps immediately upstream of the ATG start codon. The promoter box A, centred around position -25 (5' AC-TATG 3'), and box B (TG) elements at the start of the transcript resemble the sequences of a typical archaeal promoter. The restriction pattern of an approximately 50 kb region surrounding the fdx gene is conserved in various Halobacterium species. The halobacterial ferredoxin and the major gas vesicle protein GvpA exhibit up to 70% similarity to their respective counterparts in cyanobacteria suggesting lateral gene transfer between the organisms. These similarities prompted a more detailed investigation of the relative positions of the genes in the halobacterial genome. PMID:8510664

  7. A human alcohol dehydrogenase gene (ADH6) encoding an additional class of isozyme.

    PubMed Central

    Yasunami, M; Chen, C S; Yoshida, A


    The human alcohol dehydrogenase (ADH; alcohol:NAD+ oxidoreductase, EC gene family consists of five known loci (ADH1-ADH5), which have been mapped close together on chromosome 4 (4q21-25). ADH isozymes encoded by these genes are grouped in three distinct classes in terms of their enzymological properties. A moderate structural similarity is observed between the members of different classes. We isolated an additional member of the ADH gene family by means of cross-hybridization with the ADH2 (class I) cDNA probe. cDNA clones corresponding to this gene were derived from PCR-amplified libraries as well. The coding sequence of a 368-amino-acid-long open reading frame was interrupted by introns into eight exons and spanned approximately 17 kilobases on the genome. The gene contains a glucocorticoid response element at the 5' region. The transcript was detected in the stomach and liver. The deduced amino acid sequence of the open reading frame showed about 60% positional identity with known human ADHs. This extent of homology is comparable to interclass similarity in the human ADH family. Thus, the newly identified gene, which is designated ADH6, governs the synthesis of an enzyme that belongs to another class of ADHs presumably with a distinct physiological role. Images PMID:1881901

  8. Plant eR Genes That Encode Photorespiratory Enzymes Confer Resistance against Disease

    PubMed Central

    Taler, Dvir; Galperin, Marjana; Benjamin, Ido; Cohen, Yigal; Kenigsbuch, David


    Downy mildew caused by the oomycete pathogen Pseudoperonospora cubensis is a devastating foliar disease of cucurbits worldwide. We previously demonstrated that the wild melon line PI 124111F (PI) is highly resistant to all pathotypes of P. cubensis. That resistance was controlled genetically by two partially dominant, complementary loci. Here, we show that unlike other plant disease resistance genes, which confer an ability to resist infection by pathogens expressing corresponding avirulence genes, the resistance of PI to P. cubensis is controlled by enhanced expression of the enzymatic resistance (eR) genes At1 and At2. These constitutively expressed genes encode the photorespiratory peroxisomal enzyme proteins glyoxylate aminotransferases. The low expression of At1 and At2 in susceptible melon lines is regulated mainly at the transcriptional level. This regulation is independent of infection with the pathogen. Transgenic melon plants overexpressing either of these eR genes displayed enhanced activity of glyoxylate aminotransferases and remarkable resistance against P. cubensis. The cloned eR genes provide a new resource for developing downy mildew–resistant melon varieties. PMID:14688292

  9. Two Origins for the Gene Encoding α-Isopropylmalate Synthase in Fungi

    PubMed Central

    Larson, Erica M.; Idnurm, Alexander


    Background The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings Here we identified the leuA gene encoding α-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3+ gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events. PMID:20657649

  10. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    SciTech Connect

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.


    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  11. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP) Which Is Overexpressed in Highly Proliferating Tissues

    PubMed Central

    Szafron, Lukasz Michal; Balcerak, Anna; Grzybowska, Ewa Anna; Pienkowska-Grela, Barbara; Felisiak-Golabek, Anna; Podgorska, Agnieszka; Kulesza, Magdalena; Nowak, Natalia; Pomorski, Pawel; Wysocki, Juliusz; Rubel, Tymon; Dansonka-Mieszkowska, Agnieszka; Konopka, Bozena; Lukasik, Martyna; Kupryjanczyk, Jolanta


    CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene. PMID:25978564

  12. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.


    Pauchet, Yannick; Wilkinson, Paul; Chauhan, Ritika; Ffrench-Constant, Richard H


    Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs) are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology. PMID:21179425

  13. Disruption of the plr1+ gene encoding pyridoxal reductase of Schizosaccharomyces pombe.


    Morita, Tomotake; Takegawa, Kaoru; Yagi, Toshiharu


    Pyridoxal (PL) reductase encoded by the plr1(+) gene practically catalyzes the irreversible reduction of PL by NADPH to form pyridoxine (PN). The enzyme has been suggested to be involved in the salvage synthesis of pyridoxal 5'-phosphate (PLP), a coenzyme form of vitamin B(6), or the excretion of PL as PN from yeast cells. In this study, a PL reductase-disrupted (plr1 Delta) strain was constructed and its phenotype was examined. The plr1 Delta cells showed almost the same growth curve as that of wild-type cells in YNB and EMM media. In EMM, the plr1 Delta strain became flocculent at the late stationary phase for an unknown reason. The plr1 Delta cells showed low but measurable PL reductase activity catalyzed by some other protein(s) than the enzyme encoded by the plr1(+) gene, which maintained the flow of "PL --> PN --> PNP --> PLP" in the salvage synthesis of PLP. The total vitamin B(6) and pyridoxamine 5'-phosphate contents in the plr1 Delta cells were significantly lower than those in the wild-type ones. The percentages of the PLP amount as to the other vitamin B(6) compounds were similar in the two cell types. The amount of PL in the culture medium of the disruptant was significantly higher than that in the wild-type. In contrast, PN was much higher in the latter than the former. The plr1 Delta cells accumulated a 6.1-fold higher amount of PL than the wild-type ones when they were incubated with PL. The results showed that PL reductase encoded by the plr1(+ )gene is involved in the excretion of PL after reducing it to PN, and may not participate in the salvage pathway for PLP synthesis. PMID:15047724

  14. Cloning DPB3, the gene encoding the third subunit of DNA polymerase II of Saccharomyces cerevisiae.

    PubMed Central

    Araki, H; Hamatake, R K; Morrison, A; Johnson, A L; Johnston, L H; Sugino, A


    DNA polymerase II purified from Saccharomyces cerevisiae contains polypeptides with apparent molecular masses of greater than 200, 80, 34, 30 and 29 kDa, the two largest of which (subunits A and B) are encoded by the essential genes POL2 and DPB2. By probing a lambda gt11 expression library of yeast DNA with antiserum against DNA polymerase II, we isolated a single gene, DPB3, that encodes both the 34- and 30-kDa polypeptides (subunit C and C'). The nucleotide sequence of DPB3 contained an open reading frame encoding a 23-kDa protein, significantly smaller than the observed molecular masses, 34- or 30-kDa, which might represent post-translationally modified forms of the DPB3 product. The predicted amino acid sequence contained a possible NTP-binding motif and a glutamate-rich region. NTP-binding motif and a glutamate-rich region. A dpb3 deletion mutant (dpb3 delta) was viable and yielded a DNA polymerase II lacking the 34- and 30-kDa polypeptides. dpb3 delta strains exhibited an increased spontaneous mutation rate, suggesting that the DPB3 product is required to maintain fidelity of chromosomal replication. Since a fifth, 29-kDa polypeptide was present in DNA polymerase II preparations from wild-type cell extracts throughout purification, the subunit composition appears to be A, B, C (or C and C') and D. The 5' nontranscribed region of DPB3 contained the MulI-related sequence ACGCGA, while the 0.9-kb DPB3 transcript accumulated periodically during the cell cycle and peaked at the G1/S boundary. The level of DPB3 transcript thus appears to be under the same cell cycle control as those of POL2, DPB2 and other DNA replication genes. DPB3 was mapped to chromosome II, 30 cM distal to his7. Images PMID:1923754

  15. Assessment of Expression of Genes Coding GABAA Receptors during Chronic and Acute Intoxication of Laboratory Rats with Ethanol.


    Osechkina, N S; Ivanov, M B; Nazarov, G V; Batotsyrenova, E G; Lapina, N V; Babkin, A V; Berdinskikh, I S; Melekhova, A S; Voitsekhovich, K O; Lisitskii, D S; Kashina, T V


    Expression of genes encoding the individual subunits of ionotropic GABAA receptor was assessed after acute and chronic intoxication of rats with ethanol. The chronic 1-month-long exposure to ethanol signifi cantly decreased (by 38%) expression of Gabrb1 gene in the hippocampus. Acute exposure to ethanol elevated expression of genes Gabrb1 (by 1.7 times), Gabra1 (by 3.8 times), and Gabra4 (by 6.5 times), although it diminished expression of Gabra2 gene by 1.4 times. In preliminarily alcoholized rats, acute intoxication with ethanol enhanced expression of genes Gabrb1 and Gabra5 by 1.7 and 8.7 times, respectively. There was neither acute nor chronic effect of ethanol on expression of gene Gabra3. PMID:26902358

  16. Promoter for the human ferritin heavy chain-encoding gene (FERH): structural and functional characterization.


    Bevilacqua, M A; Giordano, M; D'Agostino, P; Santoro, C; Cimino, F; Costanzo, F


    We conducted a functional analysis of the promoter for the human ferritin heavy chain-encoding gene (pFERH) in HepG2 and HeLa cells. The activity of pFERH is equivalent in both cell types, despite their different ferritin (Fer) isotypes. Transfections of a series of 5'-deletion mutants indicate that pFERH activity is essentially dependent on two motifs. One of them, accounting for about 50% of the total transcriptional activity, is recognized by the RNA polymerase II transcription factor, Sp1, and the other by a low-affinity factor present in both the cell types analyzed. PMID:1541403

  17. Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida

    SciTech Connect

    Irie, S.; Doi, S.; Yorifuji, T.; Takagi, M.; Yano, K.


    The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed.

  18. Transcription of genes encoding iron and heme acquisition proteins of Haemophilus influenzae during acute otitis media.

    PubMed Central

    Whitby, P W; Sim, K E; Morton, D J; Patel, J A; Stull, T L


    Unencapsulated Haemophilus influenzae is the second most common etiologic agent of otitis media in children. H. influenzae requires heme for aerobic growth in vitro and is able to utilize hemoglobin and complexes of heme-hemopexin, heme-albumin, and hemoglobin-haptoglobin and ferritransferrin as sources of iron and heme in vitro. Several of the acquisition mechanisms have been characterized and been shown to be heme repressible in vitro. However, little is known about the expression of heme and/or iron acquisition mechanisms during infections in the middle ear. This study was performed to determine if the genes encoding heme and iron acquisition proteins are transcribed during in vivo growth and to compare these findings with those for samples grown in vitro. Reverse transcriptase PCR (RT-PCR) was used to analyze total RNA fractions derived from in vitro- and in vivo-grown H. influenzae. Genes encoding the transferrin-binding proteins TbpA and TbpB, the 100-kDa hemopexin-binding protein HxuA, and the hemoglobin-binding protein HgpA were transcribed during otitis media. Twelve middle ear fluid samples were analyzed by blind RT-PCR to determine the transcriptional status of these genes in H. influenzae during otitis media. Five isolates had transcripts corresponding to tbpA, tbpB, and hxuA. The presence of hgpA transcripts was variable, depending on the presence of hgpA in the genome of the H. influenzae isolate. Samples without H. influenzae gene transcripts contained other etiologic agents commonly causing otitis media. These data demonstrate that H. influenzae iron and/or heme acquisition genes are transcribed during otitis media and suggest that the microenvironment during acute otitis media starves H. influenzae of heme. PMID:9353052

  19. Metabolic regulation of the gene encoding glutamine-dependent asparagine synthetase in Arabidopsis thaliana.

    PubMed Central

    Lam, H M; Peng, S S; Coruzzi, G M


    Here, we characterize a cDNA encoding a glutamine-dependent asparagine synthetase (ASN1) from Arabidopsis thaliana and assess the effects of metabolic regulation on ASN1 mRNA levels. Sequence analysis shows that the predicted ASN1 peptide contains a purF-type glutamine-binding domain. Southern blot experiments and cDNA clone analysis suggest that ASN1 is the only gene encoding glutamine-dependent asparagine synthetase in A. thaliana. The ASN1 gene is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. This negative effect of light on ASN1 mRNA levels was shown to be mediated, at least in part, via the photoreceptor phytochrome. We also investigated whether light-induced changes in nitrogen to carbon ratios might exert a metabolic regulation of the ASN1 mRNA accumulation. These experiments demonstrated that the accumulation of ASN1 mRNA in dark-grown plants is strongly repressed by the presence of exogenous sucrose. Moreover, this sucrose repression of ASN1 expression can be partially rescued by supplementation with exogenous amino acids such as asparagine, glutamine, and glutamate. These findings suggest that the expression of the ASN1 gene is under the metabolic control of the nitrogen to carbon ratio in cells. This is consistent with the fact that asparagine, synthesized by the ASN1 gene product, is a favored compound for nitrogen storage and nitrogen transport in dark-grown plants. We have put forth a working model suggesting that when nitrogen to carbon ratios are high, the gene product of ASN1 functions to re-direct the flow of nitrogen into asparagine, which acts as a shunt for storage and/or long-distance transport of nitrogen. PMID:7846154

  20. Effects of TCDD on the Expression of Nuclear Encoded Mitochondrial Genes

    PubMed Central

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy


    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 hrs) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change|>1.5 and P-value <0.1). Of these, 8 exhibited a dose response (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 hrs. Dose responsive genes encoded proteins associated with electron transport chain (ETC) complex I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of the 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity. PMID:20399798

  1. Isolation and functional characterisation of the genes encoding Δ(8)-sphingolipid desaturase from Brassica rapa.


    Li, Shu-Fen; Song, Li-Ying; Yin, Wei-Bo; Chen, Yu-Hong; Chen, Liang; Li, Ji-Lin; Wang, Richard R-C; Hu, Zan-Min


    Δ(8)-Sphingolipid desaturase is the key enzyme that catalyses desaturation at the C8 position of the long-chain base of sphingolipids in higher plants. There have been no previous studies on the genes encoding Δ(8)-sphingolipid desaturases in Brassica rapa. In this study, four genes encoding Δ(8)-sphingolipid desaturases from B. rapa were isolated and characterised. Phylogenetic analyses indicated that these genes could be divided into two groups: BrD8A, BrD8C and BrD8D in group I, and BrD8B in group II. The two groups of genes diverged before the separation of Arabidopsis and Brassica. Though the four genes shared a high sequence similarity, and their coding desaturases all located in endoplasmic reticulum, they exhibited distinct expression patterns. Heterologous expression in Saccharomyces cerevisiae revealed that BrD8A/B/C/D were functionally diverse Δ(8)-sphingolipid desaturases that catalyse different ratios of the two products 8(Z)- and 8(E)-C18-phytosphingenine. The aluminium tolerance of transgenic yeasts expressing BrD8A/B/C/D was enhanced compared with that of control cells. Expression of BrD8A in Arabidopsis changed the ratio of 8(Z):8(E)-C18-phytosphingenine in transgenic plants. The information reported here provides new insights into the biochemical functional diversity and evolutionary relationship of Δ(8)-sphingolipid desaturase in plants and lays a foundation for further investigation of the mechanism of 8(Z)- and 8(E)-C18-phytosphingenine biosynthesis. PMID:22293117

  2. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy


    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  3. Differential expression of genes encoding subthreshold-operating voltage-gated K+ channels in brain.


    Saganich, M J; Machado, E; Rudy, B


    The members of the three subfamilies (eag, erg, and elk) of the ether-a-go-go (EAG) family of potassium channel pore-forming subunits express currents that, like the M-current (I(M)), could have considerable influence on the subthreshold properties of neuronal membranes, and hence the control of excitability. A nonradioactive in situ hybridization (NR-ISH) study of the distribution of the transcripts encoding the eight known EAG family subunits in rat brain was performed to identify neuronal populations in which the physiological roles of EAG channels could be studied. These distributions were compared with those of the mRNAs encoding the components of the classical M-current (Kcnq2 and Kcnq3). NR-ISH was combined with immunohistochemistry to specific neuronal markers to help identify expressing neurons. The results show that each EAG subunit has a specific pattern of expression in rat brain. EAG and Kcnq transcripts are prominent in several types of excitatory neurons in the cortex and hippocampus; however, only one of these channel components (erg1) was consistently expressed in inhibitory interneurons in these areas. Some neuronal populations express more than one product of the same subfamily, suggesting that the subunits may form heteromeric channels in these neurons. Many neurons expressed multiple EAG family and Kcnq transcripts, such as CA1 pyramidal neurons, which contained Kcnq2, Kcnq3, eag1, erg1, erg3, elk2, and elk3. This indicates that the subthreshold current in many neurons may be complex, containing different components mediated by a number of channels with distinct properties and neuromodulatory responses. PMID:11425889

  4. Common nucleotide sequence of structural gene encoding fibroblast growth factor 4 in eight cattle derived from three breeds.


    Sato, Sho; Takahashi, Toshikiyo; Nishinomiya, Hiroshi; Katoh, Makiko; Itoh, Ryu; Yokoo, Masaki; Yokoo, Mari; Iha, Momoe; Mori, Yuki; Kasuga, Kano; Kojima, Ikuo; Kobayashi, Masayuki


    Fibroblast growth factor 4 (FGF4) is considered as a crucial gene for the proper development of bovine embryos. However, the complete nucleotide sequences of the structural genes encoding FGF4 in identified breeds are still unknown. In the present study, direct sequencing of PCR products derived from genomic DNA samples obtained from three Japanese Black, two Japanese Shorthorn and three Holstein cattle, revealed that the nucleotide sequences of the structural gene encoding FGF4 matched completely among these eight cattle. On the other hand, differences in the nucleotide sequences, leading to substitutions, insertions or deletions of amino acid residues were detected when compared with the already reported sequence from unidentified breeds. We cannot rule out a possibility that the structural gene elucidated in the present study is widely distributed in cattle. To the best of our knowledge, this is the first determination of the complete nucleotide sequence of the structural gene encoding bovine FGF4 in identified breeds. PMID:22435631

  5. Localization of genes encoding three distinct flavin-containing monooxygenases to human chromosome 1q

    SciTech Connect

    Shephard, E.A.; Fox, M.F.; Povey, S. ); Dolphin, C.T.; Phillips, I.R.; Smith, R. )


    The authors have used the polymerase chain reaction to map the gene encoding human flavin-containing monooxygenase (FMO) form II (N. Lomri, Q. Gu, and J. R. Cashman, 1992, Proc. Natl. Acad. Sci. USA 89: 1685--1689) to chromosome 1. They propose the designation FMO3 for this gene as it is the third FMO gene to be mapped. The two other human FMO genes identified to date, FMO1 and FMO2, are also located on chromosome 1 (C. Dolphin, E. A. Shephard, S. Povey, C. N. A. Palmer, D. M. Ziegler, R. Ayesh, R. L. Smith, and 1. R. Phillips, 1991, J. Biol. Chem. 266: 12379--12385; C. Dolphin, E. A. Shephard, S. F. Povey, R. L. Smith, and I. R. Phillips, 1992, Biochem. J. 286: 261--267). The localization of FMO1, FMO2, and FMO3 has been refined to the long arm of chromosome 1. Analysis of human metaphase chromosomes by in situ hybridization confirmed the mapping of FMO1 and localized this gene more precisely to 1 q23-q25. 28 refs., 3 figs., 2 tabs.

  6. Phylogenetic analysis of the genus Plasmodium based on the gene encoding adenylosuccinate lyase.


    Kedzierski, Lukasz; Escalante, Ananias A; Isea, Raul; Black, Casilda G; Barnwell, John W; Coppel, Ross L


    Phylogenetic studies of the genus Plasmodium have been performed using sequences of the nuclear, mitochondrial and plastid genes. Here we have analyzed the adenylosuccinate lyase (ASL) gene, which encodes an enzyme involved in the salvage of host purines needed by malaria parasites for DNA synthesis. The ASL gene is present in several eukaryotic as well as prokaryotic organisms and does not have repeat regions, which facilitates the accuracy of the alignment. Furthermore, it has been shown that ASL is not subject to positive natural selection. We have sequenced the ASL gene of several different Plasmodium species infecting humans, rodents, monkeys and birds and used the obtained sequences along with the previously known P. falciparum ASL sequence, for structural and phylogenetic analysis of the genus Plasmodium. The genetic divergence of ASL is comparable with that observed in other nuclear genes such as cysteine proteinase, although ASL cannot be considered conserved when compared to aldolase or superoxide dismutase, which exhibit a slower rate of evolution. Nevertheless, a protein like ASL has a rate of evolution that provides enough information for elucidating evolutionary relationships. We modeled 3D structures of the ASL protein based on sequences used in the phylogenetic analysis and obtained a consistent structure for four different species despite the divergence observed. Such models would facilitate alignment in further studies with a greater number of plasmodial species or other Apicomplexa. PMID:12798008

  7. Bacterial Biosynthetic Gene Clusters Encoding the Anti-cancer Haterumalide Class of Molecules

    PubMed Central

    Matilla, Miguel A.; Stöckmann, Henning; Leeper, Finian J.; Salmond, George P. C.


    Haterumalides are halogenated macrolides with strong antitumor properties, making them attractive targets for chemical synthesis. Unfortunately, current synthetic routes to these molecules are inefficient. The potent haterumalide, oocydin A, was previously identified from two plant-associated bacteria through its high bioactivity against plant pathogenic fungi and oomycetes. In this study, we describe oocydin A (ooc) biosynthetic gene clusters identified by genome sequencing, comparative genomics, and chemical analysis in four plant-associated enterobacteria of the Serratia and Dickeya genera. Disruption of the ooc gene cluster abolished oocydin A production and bioactivity against fungi and oomycetes. The ooc gene clusters span between 77 and 80 kb and encode five multimodular polyketide synthase (PKS) proteins, a hydroxymethylglutaryl-CoA synthase cassette and three flavin-dependent tailoring enzymes. The presence of two free-standing acyltransferase proteins classifies the oocydin A gene cluster within the growing family of trans-AT PKSs. The amino acid sequences and organization of the PKS domains are consistent with the chemical predictions and functional peculiarities associated with trans-acyltransferase PKS. Based on extensive in silico analysis of the gene cluster, we propose a biosynthetic model for the production of oocydin A and, by extension, for other members of the haterumalide family of halogenated macrolides exhibiting anti-cancer, anti-fungal, and other interesting biological properties. PMID:23012376

  8. The Maltase Involved in Starch Metabolism in Barley Endosperm Is Encoded by a Single Gene

    PubMed Central

    Andriotis, Vasilios M. E.; Saalbach, Gerhard; Waugh, Robbie; Field, Robert A.; Smith, Alison M.


    During germination and early seedling growth of barley (Hordeum vulgare), maltase is responsible for the conversion of maltose produced by starch degradation in the endosperm to glucose for seedling growth. Despite the potential relevance of this enzyme for malting and the production of alcoholic beverages, neither the nature nor the role of maltase is fully understood. Although only one gene encoding maltase has been identified with certainty, there is evidence for the existence of other genes and for multiple forms of the enzyme. It has been proposed that maltase may be involved directly in starch granule degradation as well as in maltose hydrolysis. The aim of our work was to discover the nature of maltase in barley endosperm. We used ion exchange chromatography to fractionate maltase activity from endosperm of young seedlings, and we partially purified activity for protein identification. We compared maltase activity in wild-type barley and transgenic lines with reduced expression of the previously-characterised maltase gene Agl97, and we used genomic and transcriptomic information to search for further maltase genes. We show that all of the maltase activity in the barley endosperm can be accounted for by a single gene, Agl97. Multiple forms of the enzyme most likely arise from proteolysis and other post-translational modifications. PMID:27011041

  9. The Maltase Involved in Starch Metabolism in Barley Endosperm Is Encoded by a Single Gene.


    Andriotis, Vasilios M E; Saalbach, Gerhard; Waugh, Robbie; Field, Robert A; Smith, Alison M


    During germination and early seedling growth of barley (Hordeum vulgare), maltase is responsible for the conversion of maltose produced by starch degradation in the endosperm to glucose for seedling growth. Despite the potential relevance of this enzyme for malting and the production of alcoholic beverages, neither the nature nor the role of maltase is fully understood. Although only one gene encoding maltase has been identified with certainty, there is evidence for the existence of other genes and for multiple forms of the enzyme. It has been proposed that maltase may be involved directly in starch granule degradation as well as in maltose hydrolysis. The aim of our work was to discover the nature of maltase in barley endosperm. We used ion exchange chromatography to fractionate maltase activity from endosperm of young seedlings, and we partially purified activity for protein identification. We compared maltase activity in wild-type barley and transgenic lines with reduced expression of the previously-characterised maltase gene Agl97, and we used genomic and transcriptomic information to search for further maltase genes. We show that all of the maltase activity in the barley endosperm can be accounted for by a single gene, Agl97. Multiple forms of the enzyme most likely arise from proteolysis and other post-translational modifications. PMID:27011041

  10. Molecular characterization of enterobacterial pldA genes encoding outer membrane phospholipase A.

    PubMed Central

    Brok, R G; Brinkman, E; van Boxtel, R; Bekkers, A C; Verheij, H M; Tommassen, J


    The pldA gene of Escherichia coli encodes an outer membrane phospholipase A. A strain carrying the most commonly used mutant pldA allele appeared to express a correctly assembled PldA protein in the outer membrane. Nucleotide sequence analysis revealed that the only difference between the wild type and the mutant is the replacement of the serine residue in position 152 by phenylalanine. Since mutants that lack the pldA gene were normally viable under laboratory conditions and had no apparent phenotype except for the lack of outer membrane phospholipase activity, the exact role of the enzyme remains unknown. Nevertheless, the enzyme seems to be important for the bacteria, since Western blotting (immunoblotting) and enzyme assays showed that it is widely spread among species of the family Enterobacteriaceae. To characterize the PldA protein further, the pldA genes of Salmonella typhimurium, Klebsiella pneumoniae, and Proteus vulgaris were cloned and sequenced. The cloned genes were expressed in E. coli, and their gene products were enzymatically active. Comparison of the predicted PldA primary structures with that of E. coli PldA revealed a high degree of homology, with 79% of the amino acid residues being identical in all four proteins. Implications of the sequence comparison for the structure and the structure-function relationship of PldA protein are discussed. Images PMID:8300539

  11. Spermiogenesis initiation in Caenorhabditis elegans involves a casein kinase 1 encoded by the spe-6 gene.

    PubMed Central

    Muhlrad, Paul J; Ward, Samuel


    Immature spermatids from Caenorhabditis elegans are stimulated by an external activation signal to reorganize their membranes and cytoskeleton to form crawling spermatozoa. This rapid maturation, termed spermiogenesis, occurs without any new gene expression. To better understand this signal transduction pathway, we isolated suppressors of a mutation in the spe-27 gene, which is part of the pathway. The suppressors bypass the requirement for spe-27, as well as three other genes that act in this pathway, spe-8, spe-12, and spe-29. Eighteen of the suppressor mutations are new alleles of spe-6, a previously identified gene required for an early stage of spermatogenesis. The original spe-6 mutations are loss-of-function alleles that prevent major sperm protein (MSP) assembly in the fibrous bodies of spermatocytes and arrest development in meiosis. We have isolated the spe-6 gene and find that it encodes a predicted protein-serine/threonine kinase in the casein kinase 1 family. The suppressor mutations appear to be reduction-of-function alleles. We propose a model whereby SPE-6, in addition to its early role in spermatocyte development, inhibits spermiogenesis until the activation signal is received. The activation signal is transduced through SPE-8, SPE-12, SPE-27, and SPE-29 to relieve SPE-6 repression, thus triggering the formation of crawling spermatozoa. PMID:12019230

  12. Kinetics of gene expression of alkaline phosphatase during healing of alveolar bone in rats.


    Rodrigues, Willian Caetano; Fabris, André Luís da Silva; Hassumi, Jaqueline Suemi; Gonçalves, Alaíde; Sonoda, Celso Koogi; Okamoto, Roberta


    Immunohistochemical studies and molecular biology have enabled us to identify numerous proteins that are involved in the metabolism of bone, and their encoding genes. Among these is alkaline phosphatase (ALP), an enzyme that is responsible for the initiation of mineralisation of the extracellular matrix during alveolar bone repair. To evaluate the gene expression of ALP during this process, we studied nine healthy adult male rats, which had their maxillary central incisors extracted from the right side and were randomly divided into three groups. During three experimental periods, 7 days, 14 days, and 28 days, the alveoli were curetted, the rats killed, and samples analysed by real-time reverse transcription polymerase chain reaction (qRT-PCR). The RNAm that encodes the gene for the synthesis of ALP was expressed during the three periods analysed, but its concentration was significantly increased at 14 and 28 days compared with at 7 days. There was no significant difference between 14 and 28 days (p=0.0005). We conclude that genes related to ALP are expressed throughout the healing process and more intensively during the later periods (14 and 28 days), which coincides with the increased formation of mineralised bone. PMID:26935214

  13. Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937.


    Lojkowska, E; Masclaux, C; Boccara, M; Robert-Baudouy, J; Hugouvieux-Cotte-Pattat, N


    Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino-terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo-pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo-cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft-rot disease. PMID:8577252

  14. The KUP gene, located on human chromosome 14, encodes a protein with two distant zinc fingers.

    PubMed Central

    Chardin, P; Courtois, G; Mattei, M G; Gisselbrecht, S


    We have isolated a human cDNA (kup), encoding a new protein with two distantly spaced zinc fingers of the C2H2 type. This gene is highly conserved in mammals and is expressed mainly in hematopoietic cells and testis. Its expression was not higher in the various transformed cells tested than in the normal corresponding tissues. The kup gene is located in region q23-q24 of the long arm of human chromosome 14. The kup protein is 433 a.a. long, has a M.W. close to 50 kD and binds to DNA. Although the structure of the kup protein is unusual, the isolated fingers resemble closely those of the Krüppel family, suggesting that this protein is also a transcription factor. The precise function and DNA motif recognized by the kup protein remain to be determined. Images PMID:2027750

  15. Cloning and characterization of the nucleoredoxin gene that encodes a novel nuclear protein related to thioredoxin

    SciTech Connect

    Kurooka, Hisanori; Kato, Keizo; Minoguchi, Shigeru


    In a yeast artificial chromosome contig close to the nude locus on mouse chromosome 11, we identified a novel gene, nucleoredoxin, that encodes a protein with similarity to the active site of thioredoxins. Nucleoredoxin is conserved between mammalian species, and two homologous genes were found in Caenorhabditis elegans. The nucleoredoxin transcripts are expressed in all adult tissues examined, but restricted to the nervous system and the limb buds in Day 10.5-11.5 embryos. The nucleoredoxin protein is predominantly localized in the nucleus of cells transfected with the nucleoredoxin expression construct. Since the bacterially expressed protein of nucleoredoxin showed oxidoreductase activity of the insulin disulfide bonds with kinetics similar to that of thioredoxin, it may be a redox regulator of the nuclear proteins, such as transcription factors. 40 refs., 6 figs.

  16. Expression of the gene encoding growth hormone in the human mammary gland

    SciTech Connect

    Mol, J.A.; Misdorp, W.; Rijnberk, A.


    Progestins cause a syndrome of growth hormone (GH) excess and enhanced mammary tumorigenesis in the dog. This has been regarded as being specific for the dog. Recently we reported that progestin-induced GH excess originates from foci of hyperplastic ductular epithelium of the mammary gland in the dog. In the present report we demonstrate by reverse-transcriptase PCR and immunohistochemistry that a main factor involved in tissue growth, i.e. GH, is also expressed in normal and neoplastic human mammary glands. The gene expressed in the human mammary gland proved to be identical to the gene encoding GH in the pituitary gland. The role of progesterone in the GH expression of the human mammary gland needs, however, to be proven. It is hypothesized that this locally produced hGH may play a pathogenetic role in breast cancer. 21 refs., 2 figs., 1 tab.

  17. GSH2, a gene encoding gamma-glutamylcysteine synthetase in the methylotrophic yeast Hansenula polymorpha.


    Ubiyvovk, Vira M; Nazarko, Taras Y; Stasyk, Olena G; Sohn, Min Jeong; Kang, Hyun Ah; Sibirny, Andrei A


    The GSH2 gene, encoding Hansenula polymorpha gamma-glutamylcysteine synthetase, was cloned by functional complementation of a glutathione (GSH)-deficient gsh2 mutant of H. polymorpha. The gene was isolated as a 4.3-kb XbaI fragment that was capable of restoring GSH synthesis, heavy-metal resistance and cell proliferation when introduced into gsh2 mutant cells. It possesses 53% identical and 69% similar amino acids compared with the Candida albicans homologue (Gcs1p). In comparison to the Saccharomyces cerevisiae homologue (Gsh1p), it possesses 47% identical and 61% similar amino acids. The GSH2 sequence appears in the GenBank database under accession No. AF435121. PMID:12702282

  18. Cytochrome P450-encoding genes from the Heliconius genome as candidates for cyanogenesis.


    Chauhan, R; Jones, R; Wilkinson, P; Pauchet, Y; Ffrench-Constant, R H


    Cytochrome P450s are important both in the metabolism of xenobiotics and the production of compounds such as cyanogenic glucosides, which insects use in their defence. In the present study, we use transcriptomic and genomic information to isolate and name P450-encoding genes from the butterfly Heliconius melpomene. We classify each of the putative genes into its appropriate superfamily and compare the distribution of P450s across sequenced insects. We also identify homologues of two P450s known to be involved in cyanogenesis in the six-spot Burnet moth, Zygaena filipendulae. Classification of Heliconius P450s should be an important step in the dissection of their role in the exploitation of their host plant, the passion vine Passiflora. PMID:23834845

  19. The role of polymorphisms of genes encoding collagen IX and XI in lumbar disc disease.


    Janeczko, Łukasz; Janeczko, Magdalena; Chrzanowski, Robert; Zieliński, Grzegorz


    The intervertebral disc disease (IDD) is one of the most common musculoskeletal disorders. A number of environment and anthropometric risk factors may contribute to it. The recent reports have suggested the importance of genetic factors, especially these which encode collagen types IX and XI. The allelic variants in the collagen IX genes - COL9A2 (Trp2) and COL9A3 (Trp3) have been identified as genetic risk factors for IDD, because they interfere the cross-linking between collagen types II, IX and XI and result in decreased stability of intervertebral discs. Type XI collagen is a minor component of cartilage collagen fibrils, but it is present in the annulus fibrosus and nucleus pulposus of intervertebral discs. Some studies have shown the association between gene COL11A1 polymorphism c.4603C>T and IDD. The frequency of 4603T allele was significantly higher in the patients with IDD than in the healthy controls. PMID:24636772

  20. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    NASA Astrophysics Data System (ADS)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin


    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  1. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F


    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  2. PiggyBac transposon vectors: the tools of the human gene encoding

    PubMed Central

    Zhao, Shuang; Jiang, Enze; Chen, Shuangshuang; Gu, Yuan; Shangguan, Anna Junjie; Lv, Tangfeng


    A transposon is a DNA segment, which is able to change its relative position within the entire genome of a cell. The piggyBac (PB) transposon is a movable genetic element that efficiently transposes between vectors and chromosomes through a “cut-and-paste” mechanism. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeats (ITRs) sequences located on both ends of the transposon vector and eight efficiently moves the contents from its original positions and efficiently integrates them into TTAA chromosomal sites. PB has drawn much attention because of its transposition efficiency, safety and stability. Due to its priorities, PB can be used as a new genetic vehicle, a new tool for oncogene screening and a new method for gene therapy. PB has created a new outlook for human gene encoding. PMID:26958506

  3. Nucleotide sequence of a gene encoding an organophosphorus nerve agent degrading enzyme from Alteromonas haloplanktis.


    Cheng, T; Liu, L; Wang, B; Wu, J; DeFrank, J J; Anderson, D M; Rastogi, V K; Hamilton, A B


    Organophosphorus acid anhydrolases (OPAA) catalyzing the hydrolysis of a variety of toxic organophosphorus cholinesterase inhibitors offer potential for decontamination of G-type nerve agents and pesticides. The gene (opa) encoding an OPAA was cloned from the chromosomal DNA of Alteromonas haloplanktis ATCC 23821. The nucleotide sequence of the 1.7 -kb DNA fragment contained the opa gene (1.3 kb) and its flanking region. We report structural and functional similarity of OPAAs from A. haloplanktis and Alteromonas sp JD6.5 with the enzyme prolidase that hydrolyzes dipeptides with a prolyl residue in the carboxyl-terminal position. These results corroborate the earlier conclusion that the OPAA is a type of X-Pro dipeptidase, and that X-Pro could be the native substrate for such an enzyme in Alteromonas cells. PMID:9079288

  4. Characterization and developmental expression of genes encoding the early carotenoid biosynthetic enzymes in Citrus paradisi Macf.


    Costa, Marcio G C; Moreira, Cristina D; Melton, John R; Otoni, Wagner C; Moore, Gloria A


    In the present study, the full-length cDNA sequences of PSY, PDS, and ZDS, encoding the early carotenoid biosynthetic enzymes in the carotenoid pathway of grapefruit (Citrus paradisi), were isolated and characterized for the first time. CpPSY contained a 1311-bp open reading frame (ORF) encoding a polypeptide of 436 amino acids, CpPDS contained a 1659-bp ORF encoding a polypeptide of 552 amino acids, and CpZDS contained a 1713-bp ORF encoding a polypeptide of 570 amino acids. Phylogenetic analysis indicated that CpPSY shares homology with PSYs from Citrus, tomato, pepper, Arabidopsis, and the monocot PSY1 group, while CpPDS and CpZDS are most closely related to orthologs from Citrus and tomato. Expression analysis revealed fluctuations in CpPSY, CpPDS, and CpZDS transcript abundance and a non-coordinated regulation between the former and the two latter genes during fruit development in albedo and juice vesicles of white ('Duncan') and red ('Flame') grapefruits. A 3× higher upregulation of CpPSY expression in juice vesicles of red-fleshed 'Flame' as compared to white-fruited 'Duncan' was observed in the middle stages of fruit development, which correlates with the well documented accumulation pattern of lycopene in red grapefruit. Together with previous data, our results suggest that the primary mechanism controlling lycopene accumulation in red grapefruit involves the transcriptional upregulation of CpPSY, which controls the flux into the carotenoid pathway, and the downregulated expression of CpLCYB2, which controls the step of cyclization of lycopene in chromoplasts during fruit ripening. A correlation between CpPSY expression and fruit color evolution in red grapefruit is demonstrated. PMID:21594623

  5. Transcriptional Regulation of the Gene Cluster Encoding Allantoinase and Guanine Deaminase in Klebsiella pneumoniae▿

    PubMed Central

    Guzmán, Karla; Badia, Josefa; Giménez, Rosa; Aguilar, Juan; Baldoma, Laura


    Purines can be used as the sole source of nitrogen by several strains of K. pneumoniae under aerobic conditions. The genes responsible for the assimilation of purine nitrogens are distributed in three separated clusters in the K. pneumoniae genome. Here, we characterize the cluster encompassing genes KPN_01787 to KPN_01791, which is involved in the conversion of allantoin into allantoate and in the deamination of guanine to xanthine. These genes are organized in three transcriptional units, hpxSAB, hpxC, and guaD. Gene hpxS encodes a regulatory protein of the GntR family that mediates regulation of this system by growth on allantoin. Proteins encoded by hpxB and guaD display allantoinase and guanine deaminase activity, respectively. In this cluster, hpxSAB is the most tightly regulated unit. This operon was activated by growth on allantoin as a nitrogen source; however, addition of allantoin to nitrogen excess cultures did not result in hpxSAB induction. Neither guaD nor hpxC was induced by allantoin. Expression of guaD is mainly regulated by nitrogen availability through the action of NtrC. Full induction of hpxSAB by allantoin requires both HpxS and NAC. HpxS may have a dual role, acting as a repressor in the absence of allantoin and as an activator in its presence. HpxS binds to tandem sites, S1 and S2, overlapping the −10 and −35 sequences of the hpxSAB promoter, respectively. The NAC binding site is located between S1 and S2 and partially overlaps S2. In the presence of allantoin, interplay between NAC and HpxS is proposed. PMID:21357483

  6. Identification and functional expression of genes encoding flavonoid O- and C-glycosidases in intestinal bacteria.


    Braune, Annett; Engst, Wolfram; Blaut, Michael


    Gut bacteria play a crucial role in the metabolism of dietary flavonoids and thereby influence the bioactivity of these compounds in the host. The intestinal Lachnospiraceae strain CG19-1 and Eubacterium cellulosolvens are able to deglycosylate C- and O-coupled flavonoid glucosides. Growth of strain CG19-1 in the presence of the isoflavone C-glucoside puerarin (daidzein 8-C-glucoside) led to the induction of two proteins (DfgC, DfgD). Heterologous expression of the encoding genes (dfgC, dfgD) in Escherichia coli revealed no C-deglycosylating activity in the resulting cell extracts but cleavage of flavonoid O-glucosides such as daidzin (daidzein 7-O-glucoside). The recombinant DfgC and DfgD proteins were purified and characterized with respect to their quaternary structure, substrate and cofactor specificity. The products of the corresponding genes (dfgC, dfgD) from E. cellulosolvens also catalysed the O-deglycosylation of daidzin following their expression in E. coli. In combination with three recombinant proteins encoded by adjacent genes in E. cellulosolvens (dfgA, dfgB, dfgE), DfgC and DfgD from E. cellulosolvens catalysed the deglycosylation of the flavone C-glucosides homoorientin (luteolin 6-C-glucoside) and isovitexin (apigenin 6-C-glucoside). Even intact cells of E. coli expressing the five E. cellulosolvens genes cleaved these flavone C-glucosides and, also, flavonoid O-glucosides to the corresponding aglycones. PMID:25845411

  7. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley.


    Kristensen, M; Lok, F; Planchot, V; Svendsen, I; Leah, R; Svensson, B


    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement with a value of 105 kDa estimated by SDS-PAGE. The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic fragments coupled with matrix assisted laser desorption mass spectrometry. The sequenced peptide fragments cover 70% of the entire protein sequence, which shows 62% and 77% identity to that of starch debranching enzymes from spinach and rice and 37% identity to Klebsiella pullulanase. Sequence alignment supports the multidomain architecture and identifies both secondary structure elements of the catalytic (beta/alpha)8-barrel substrate, catalytic residues, and specificity associated motifs characteristic of members of the glycoside hydrolase family 13 which cleave alpha-1,6-glucosidic bonds. A remarkable distribution of the secondary structure elements to individual exons is observed. PMID:10350630

  8. Demonstration by heterologous expression that the Leishmania SCA1 gene encodes an arabinopyranosyltransferase.


    Goswami, Mamta; Dobson, Deborah E; Beverley, Stephen M; Turco, Salvatore J


    In part of the life cycle within their sand fly vector, Leishmania major parasites first attach to the fly's midgut through their main surface adhesin lipophosphoglycan (LPG) and later resynthesize a structurally distinct LPG that results in detachment and eventual transmission. One of these structural modifications requires the addition of alpha1,2-D-arabinopyranose caps to beta1,3-galactose side chains in the phosphoglycan repeat unit domain of LPG. We had previously identified two side chain arabinose genes (SCA1/2) that were involved in the alpha1,2-D-Arap capping. SCA1/2 exhibit canonical glycosyltransferase motifs, and overexpression of either gene leads to elevated microsomal alpha1,2-D-ArapT activity, resulting in arabinopyranosylation of beta1,3-Gal side chains in LPG (hereafter called side chain D-arabinopyranosyltransferase [sc-D-ArapT]). Heterologous expression in a null arabinose background was used to determine whether the SCA1 gene encodes the actual sc-D-ArapT. SCA1 expression constructs introduced into both mammalian COS-7 cells and the baculovirus-sf9 cell system exhibited considerable expression of the protein. However, functional sc-D-ArapT activity was observed only in the latter. In in vitro assays incubated with guanidine 59-diphosphate (GDP)-D-[3H]Arap as the sugar donor and utilizing exogenous LPG as an acceptor, significant sc-D-ArapT activity was observed when microsomes from the baculovirus-sf9 cells were incubated in presence of the LPG acceptor. No activity was observed in the absence of LPG. These results demonstrate that SCA1 encodes a sc-D-ArapT and provide the first example of heterologous expression of a D-ArapT gene. PMID:16272216

  9. Chlamydial gene encoding a 70-kilodalton antigen in Escherichia coli: analysis of expression signals and identification of the gene product.

    PubMed Central

    Sardinia, L M; Engel, J N; Ganem, D


    In an attempt to identify chlamydial genes whose native promoters allow them to be expressed in Escherichia coli, we isolated and characterized a chlamydial gene identified by screening a library of chlamydial DNA with antichlamydial antibodies. This gene encodes a 70-kilodalton immunoreactive polypeptide in E. coli hosts. Sequence analysis of the 5' portion of the gene identified its product as the chlamydial homolog of the E. coli ribosomal protein S1. The site of transcription initiation of the mRNA in chlamydiae was determined, and its putative promoter regions were identified. These regions apparently do not function efficiently in E. coli; in vitro transcripts generated by using E. coli RNA polymerase did not start at the authentic chlamydial initiation site. Several in vitro transcripts both larger and smaller than the authentic transcript were seen; presumably, these transcripts result from adventitious promoterlike elements in adjacent chlamydial DNA and may be responsible for the expression of the gene in E. coli. Images PMID:2644193

  10. Disruption of genes encoding subunits of yeast vacuolar H(+)-ATPase causes conditional lethality.

    PubMed Central

    Nelson, H; Nelson, N


    The main function of vacuolar H(+)-ATPases in eukaryotic cells is to generate proton and electrochemical gradients across the membranes of the vacuolar system. The enzyme is composed of a catalytic sector with five subunits (A-E) and a membrane sector containing at least two subunits (a and c). We disrupted two genes of this enzyme, in yeast cells, one encoding a subunit of the membrane sector (subunit c) and another encoding a subunit of the catalytic sector (subunit B). The resulting mutants did not grow in medium with a pH value higher than 6.5 and grew well only within a narrow pH range around 5.5. Transformation of the mutants with plasmids containing the corresponding genes repaired the mutations. Thus failure to lower the pH in the vacuolar system of yeast, and probably other eukaryotic cells, is lethal and the mutants may survive only if a low external pH allows for this acidification by fluid-phase endocytosis. Images PMID:2139726

  11. Clarin-1, Encoded by the Usher Syndrome III Causative Gene, Forms a Membranous Microdomain

    PubMed Central

    Tian, Guilian; Zhou, Yun; Hajkova, Dagmar; Miyagi, Masaru; Dinculescu, Astra; Hauswirth, William W.; Palczewski, Krzysztof; Geng, Ruishuang; Alagramam, Kumar N.; Isosomppi, Juha; Sankila, Eeva-Marja; Flannery, John G.; Imanishi, Yoshikazu


    Clarin-1 is the protein product encoded by the gene mutated in Usher syndrome III. Although the molecular function of clarin-1 is unknown, its primary structure predicts four transmembrane domains similar to a large family of membrane proteins that include tetraspanins. Here we investigated the role of clarin-1 by using heterologous expression and in vivo model systems. When expressed in HEK293 cells, clarin-1 localized to the plasma membrane and concentrated in low density compartments distinct from lipid rafts. Clarin-1 reorganized actin filament structures and induced lamellipodia. This actin-reorganizing function was absent in the modified protein encoded by the most prevalent North American Usher syndrome III mutation, the N48K form of clarin-1 deficient in N-linked glycosylation. Proteomics analyses revealed a number of clarin-1-interacting proteins involved in cell-cell adhesion, focal adhesions, cell migration, tight junctions, and regulation of the actin cytoskeleton. Consistent with the hypothesized role of clarin-1 in actin organization, F-actin-enriched stereocilia of auditory hair cells evidenced structural disorganization in Clrn1−/− mice. These observations suggest a possible role for clarin-1 in the regulation and homeostasis of actin filaments, and link clarin-1 to the interactive network of Usher syndrome gene products. PMID:19423712

  12. Plasmid-encoded genes influence exosporium assembly and morphology in Bacillus megaterium QM B1551 spores

    PubMed Central

    Manetsberger, Julia; Hall, Elizabeth A. H.; Christie, Graham


    Spores of Bacillus megaterium QM B1551 are encased in a morphologically distinctive exosporium. We demonstrate here that genes encoded on the indigenous pBM500 and pBM600 plasmids are required for exosporium assembly and or stability in spores of this strain. Bioinformatic analyses identified genes encoding orthologues of the B. cereus-family exosporium nap and basal layer proteins within the B. megaterium genome. Transcriptional analyses, supported by electron and fluorescent microscopy, indicate that the pole-localized nap, identified here for the first time in B. megaterium QM B1551 spores, is comprised of the BclA1 protein. The role of the BxpB protein, which forms the basal layer of the exosporium in B. cereus spores, is less clear since spores of a null mutant strain display an apparently normal morphology. Retention of the localized nap in bxpB null spores suggests that B. megaterium employs an alternative mechanism to that used by B. cereus spores in anchoring the nap to the spore surface. PMID:26316548

  13. Cell type-specific transcriptional regulation of the gene encoding importin-{alpha}1

    SciTech Connect

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro; Department of Biochemistry, Graduate School of Medicine, Osaka University; JST, CREST, Graduate School of Frontier Biosciences, Osaka University, Yamada-oka, Suita, Osaka 565-0871


    Importin-{alpha}1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: {yields} We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. {yields} NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. {yields} Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  14. Phylogenetic analysis to uncover organellar origins of nuclear-encoded genes.


    Foth, Bernardo J


    Most proteins that are located in mitochondria or plastids are encoded by the nuclear genome, because the organellar genomes have undergone severe reduction during evolution. In many cases, although not all, the nuclear genes encoding organelle-targeted proteins actually originated from the respective organellar genome and thus carry the phylogenetic fingerprint that still bespeaks their evolutionary origin. Phylogenetic analysis is a powerful in silico method that can yield important insights into the evolutionary history or molecular kinship of any gene or protein and that can thus also be used more specifically in the context of organellar targeting as one means to recognize protein candidates (e.g., from genome data) that may be targeted to mitochondria or plastids. This chapter provides protocols for creating multiple sequence alignments and carrying out phylogenetic analysis with the robust and comprehensive software packages Clustal and PHYLIP, which are both available free of charge for multiple computer platforms. Besides presenting step-by-step instructions on how to run these computer programs, this chapter also covers topics such as data collection and presentation of phylogenetic trees. PMID:17951706

  15. Nucleotide sequence of the gene encoding the two-subunit pilin of Bacteroides nodosus 265.

    PubMed Central

    Elleman, T C; Hoyne, P A; McKern, N M; Stewart, D J


    The nucleotide sequence of the gene encoding pilin from Bacteroides nodosus 265 has been determined. The pilin is encoded by a single-copy gene, from which can be predicted a prepilin comprising a single protein chain of Mr 16,637. The prepilin sequence differs in several respects from the mature protein sequence. Seven additional N-terminal amino acid residues are present in prepilin, whereas residue 8, phenylalanine, undergoes posttranslational modification to become the N-methylated amino-terminal residue of mature pilin. In addition, further processing occurs through internal cleavage to produce two noncovalently linked subunits characteristic of pilins from serogroup H of B. nodosus, of which strain 265 is a member. The position of cleavage has been identified between alanine residues at positions 72 and 73 of the mature 149-residue pilin protein. The predicted pilin sequence of B. nodosus 265 shows extensive N-terminal amino acid sequence homology with other pilins of the N-methylphenylalanine type. In addition this sequence also shows homology with these N-methylphenylalanine-type pilins in the C-terminal region of the molecule, especially with pilin from Pseudomonas aeruginosa PAK. Images PMID:2873127

  16. Molecular cloning and sequence analysis of the cDNA encoding rat liver cysteine sulfinate decarboxylase (CSD).


    Reymond, I; Sergeant, A; Tappaz, M


    The taurine biosynthesis enzyme, cysteine sulfinate decarboxylase (CSD), was purified to homogeneity from rat liver. Three CSD peptides generated by tryptic cleavage were isolated and partially sequenced. Two of them showed a marked homology with glutamate decarboxylase and their respective position on the CSD amino acid sequence was postulated accordingly. Using appropriate degenerated primers derived from these two peptides, a PCR amplified DNA fragment was generated from liver poly(A)+ mRNA, cloned and used as a probe to screen a rat liver cDNA library. Three cDNAs, length around 1800 bp, were isolated which all contained an open reading frame (ORF) encoding a 493 amino acid protein with a calculated molecular mass of 55.2 kDa close to the experimental values for CSD. The encoded protein contained the sequence of the three peptides isolated from homogenous liver CSD. Our data confirm and significantly extend those recently published (Kaisaki et al. (1995) Biochim. Biophys. Acta 1262, 79-82). Indeed, an additional base pair found 1371 bp downstream from the initiation codon led to a shift in the open reading frame which extended the carboxy-terminal end by 15 amino acid residues and altogether modified 36 amino acids. The validity of this correction is supported by the finding that the corrected reading frame encoded a peptide issued from CSD tryptic cleavage that was not encoded anywhere in the CSD sequence previously reported. PMID:8679699

  17. Gene structure and chromosomal localization of the mouse homologue of rat OX40 protein.


    Birkeland, M L; Copeland, N G; Gilbert, D J; Jenkins, N A; Barclay, A N


    The OX40 protein is expressed only on activated rat CD4+ T blasts and is a member of a superfamily of cell surface molecules which includes CD40, CD30, CD95 (Fas), CD27, 4-1BB antigens and the receptors for tumor necrosis factor (TNF) and nerve growth factor (NGF). The proteins of this group are related to each other by having three to six repeats of a cysteine-rich sequence in their extracellular domains. Members of this family of receptors have also been shown to bind to ligands which are structurally related to TNF. The mouse homologue of the rat OX40 protein was cloned at the cDNA and genomic levels. The gene structure shows that there are several intron/exon borders shared between OX40 and CD27, CD40, TNF receptor type I, CD95 and 4-1BB genes. This group of genes is less closely related structurally to the gene structure of the NGF receptor. The gene encoding murine OX40 has been placed on mouse chromosome 4, in an area which contains the genes for TNF receptor type II and 4-1BB, and is syntenic with a region of human chromosome 1 which contains human TNF receptor type II, OX40, and CD30 genes. PMID:7737295

  18. Central myelin gene expression during postnatal development in rats exposed to nicotine gestationally.


    Cao, Junran; Dwyer, Jennifer B; Gautier, Nicole M; Leslie, Frances M; Li, Ming D


    Abnormal myelin gene expression in the central nervous system (CNS) is associated with many mental illnesses, including psychiatric disorders and drug addiction. We have previously shown that prenatal exposure to nicotine, the major psychoactive component in cigarette smoke, alters myelin gene expression in the CNS of adolescent rats. To examine whether this effect is specific for adolescents, we examined myelin gene expression in the CNS of juveniles and adults. Pregnant Sprague-Dawley rats were treated with nicotine (3 mg/kg/day; GN) or saline (GS) via osmotic mini pumps from gestational days 4-18. Both male and female offspring were sacrificed at postnatal day P20-21 (juveniles), P35-36 (adolescents), or P59-60 (adults). Three limbic brain regions, the prefrontal cortex (PFC), caudate putamen (CPu), and nucleus accumbens (NAc), were dissected. The expression of genes encoding major myelin components was evaluated using quantitative RT-PCR. We found that GN altered myelin gene expression in juveniles with brain region and sex differences. The pattern of alteration was different from that observed in adolescents. Although these genes were expressed normally in male adults, we observed decreased expression in GN-treated female adults, especially in the CPu. Thus, GN altered myelin gene expression throughout postnatal development and adulthood. The effect on adolescents was quite different from that at other ages, which correlated with the unique symptoms of many psychiatric disorders during adolescence. PMID:23962570

  19. Characterization of the gene encoding pisatin demethylase (FoPDA1) in Fusarium oxysporum.


    Coleman, Jeffrey J; Wasmann, Catherine C; Usami, Toshiyuki; White, Gerard J; Temporini, Esteban D; McCluskey, Kevin; VanEtten, Hans D


    The pea pathogen Fusarium oxysporum f. sp. pisi is able to detoxify pisatin produced as a defense response by pea, and the gene encoding this detoxification mechanism, FoPDA1, was 82% identical to the cytochrome P450 pisatin demethylase PDA1 gene in Nectria haematococca. A survey of F. oxysporum f. sp. pisi isolates demonstrated that, as in N. haematococca, the PDA gene of F. oxysporum f. sp. pisi is generally located on a small chromosome. In N. haematococca, PDA1 is in a cluster of pea pathogenicity (PEP) genes. Homologs of these PEP genes also were found in the F. oxysporum f. sp. pisi isolates, and PEP1 and PEP5 were sometimes located on the same small chromosomes as the FoPDA1 homologs. Transforming FoPDA1 into a pda(?) F. oxysporum f. sp. lini isolate conferred pda activity and promoted pathogenicity on pea to some transformants. Different hybridization patterns of FoPDA1 were found in F. oxysporum f. sp. pisi but these did not correlate with the races of the fungus, suggesting that races within this forma specialis arose independently of FoPDA1. FoPDA1 also was present in the formae speciales lini, glycines, and dianthi of F. oxysporum but they had mutations resulting in nonfunctional proteins. However, an active FoPDA1 was present in F. oxysporum f. sp. phaseoli and it was virulent on pea. Despite their evolutionary distance, the amino acid sequences of FoPDA1 of F. oxysporum f. sp. pisi and F. oxysporum f. sp. phaseoli revealed only six amino acid differences, consistent with a horizontal gene transfer event accounting for the origin of these genes. PMID:22066900

  20. On the role of PDZ domain-encoding genes in Drosophila border cell migration.


    Aranjuez, George; Kudlaty, Elizabeth; Longworth, Michelle S; McDonald, Jocelyn A


    Cells often move as collective groups during normal embryonic development and wound healing, although the mechanisms governing this type of migration are poorly understood. The Drosophila melanogaster border cells migrate as a cluster during late oogenesis and serve as a powerful in vivo genetic model for collective cell migration. To discover new genes that participate in border cell migration, 64 out of 66 genes that encode PDZ domain-containing proteins were systematically targeted by in vivo RNAi knockdown. The PDZ domain is one of the largest families of protein-protein interaction domains found in eukaryotes. Proteins that contain PDZ domains participate in a variety of biological processes, including signal transduction and establishment of epithelial apical-basal polarity. Targeting PDZ proteins effectively assesses a larger number of genes via the protein complexes and pathways through which these proteins function. par-6, a known regulator of border cell migration, was a positive hit and thus validated the approach. Knockdown of 14 PDZ domain genes disrupted migration with multiple RNAi lines. The candidate genes have diverse predicted cellular functions and are anticipated to provide new insights into the mechanisms that control border cell movement. As a test of this concept, two genes that disrupted migration were characterized in more detail: big bang and the Dlg5 homolog CG6509. We present evidence that Big bang regulates JAK/STAT signaling, whereas Dlg5/CG6509 maintains cluster cohesion. Moreover, these results demonstrate that targeting a selected class of genes by RNAi can uncover novel regulators of collective cell migration. PMID:23173089

  1. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    SciTech Connect

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.


    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

  2. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  3. The relationship between transcript expression levels of nuclear encoded (TFAM, NRF1) and mitochondrial encoded (MT-CO1) genes in single human oocytes during oocyte maturation

    PubMed Central

    Novin, M Ghaffari; Allahveisi, A; Noruzinia, M; Farhadifar, F; Yousefian, E; Fard, A Dehghani; Salimi, M


    In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII) stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA), copied in oocytes, is essential for providing adenosine triphosphate (ATP) during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1) and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (TFAM) in various stages of human oocyte maturation. Nine consenting patients, age 21–35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI) procedures. mRNA levels of mitochondrial-related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR). There was no significant relationship between the relative expression levels in germinal vesicle (GV) stage oocytes (p = 0.62). On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI) and MII (p = 0.03 and p = 0.002). A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation. PMID:26929904

  4. Gene cloning and characterization of the protein encoded by the Neospora caninum bradyzoite-specific antigen gene BAG1.


    Kobayashi, T; Narabu, S; Yanai, Y; Hatano, Y; Ito, A; Imai, S; Ike, K


    Neospora caninum is an Apicomplexan parasite that causes repeated abortion and stillbirth in cattle. The aim of this study was to clone the gene encoding the N. caninum orthologue (NcBAG1) of the Toxoplasma gondii bradyzoite-specific protein TgBAG1 and characterize its expression pattern in the parasite. Isolation of the full-length 684-bp gene revealed that it shared 78.3% sequence similarity with TgBAG1. NcBAG1 encodes a predicted protein of 227 amino acids with 80.3% similarity to TgBAG1. A putative signal peptide sequence and an invariant GVL motif characteristic of small heat-shock proteins were identified in the predicted N. caninum amino acid sequence. We expressed the NcBAG1 gene as a recombinant glutathione S-transferase fusion protein (rNcBAG1) in Escherichia coli and used the purified 60 kDa protein to obtain a monoclonal antibody (Mab). rNcBAG1 reacted to Mabs specific for NcBAG1 and TgBAG1. No reaction between the NcBAG1 Mab and N. caninum tachyzoites was observed. Although the predicted molecular mass of NcBAG1 is 25 kDa, Western blot analysis of parasite lysates using the NcBAG1 Mab revealed a cross-reactive protein of approximately 30 kDa. Additionally, immunofluorescence assays using the tachyzoite-specific Mab for NcSAG1 and the bradyzoite-specific Mab for TgBAG1 or NcSAG4 revealed NcBAG1-specific expression in bradyzoites in cultures exposed to sodium nitroprusside, a reagent that increases the frequency of bradyzoites. Interestingly, the NcBAG1 protein was identified in the cytoplasm of the bradyzoite-stage parasites. This preliminary analysis of the NcBAG1 gene will assist investigations into the role of this protein in N. caninum . PMID:23245337

  5. Direct Introduction of Genes into Rats and Expression of the Genes

    NASA Astrophysics Data System (ADS)

    Benvenisty, Nissim; Reshef, Lea


    A method of introducing actively expressed genes into intact mammals is described. DNA precipitated with calcium phosphate has been injected intraperitoneally into newborn rats. The injected genes have been taken up and expressed by the animal tissues. To examine the generality of the method we have injected newborn rats with the chloramphenicol acetyltransferase prokaryotic gene fused with various viral and cellular gene promoters and the gene for hepatitis B surface antigen, and we observed appearance of chloramphenicol acetyltransferase activity and hepatitis B surface antigen in liver and spleen. In addition, administration of genes coding for hormones (insulin or growth hormone) resulted in their expression.

  6. Hyphal tip extension in Aspergillus nidulans requires the manA gene, which encodes phosphomannose isomerase.

    PubMed Central

    Smith, D J; Payton, M A


    A strain of Aspergillus nidulans carrying a temperature-sensitive mutation in the manA gene produces cell walls depleted of D-mannose and forms hyphal tip balloons at the restrictive temperature (B.P. Valentine and B.W. Bainbridge, J. Gen. Microbiol. 109:155-168, 1978). We have isolated and characterized the manA gene and physically located it between 3.5 and 5.5 kb centromere distal of the riboB locus on chromosome VIII. The manA gene contains four introns and encodes a 50.6-kDa protein which has significant sequence identity to type I phosphomannose isomerase proteins from other eukaryotes. We have constructed by integrative transformation a null mutation in the manA gene which can only be maintained in a heterokaryotic strain with wild-type manA+ nuclei. Thus, a manA null mutation is lethal in A. nidulans. The phenotype of the mutation was analyzed in germinating conidia. Such conidia are able to commence germination but swell abnormally, sometimes producing a misshapen germ tube, before growth ceases. The reason for the lethality is probably the lack of synthesis of mannose-containing cell wall polymers that must be required for normal cell wall development in growing hyphae. Images PMID:8065336

  7. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.


    Otsuka, Chie; Minami, Ikuko; Oda, Kenji


    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia. PMID:21150100

  8. BAGEL3: automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides

    PubMed Central

    van Heel, Auke J.; de Jong, Anne; Montalbán-López, Manuel; Kok, Jan; Kuipers, Oscar P.


    Identifying genes encoding bacteriocins and ribosomally synthesized and posttranslationally modified peptides (RiPPs) can be a challenging task. Especially those peptides that do not have strong homology to previously identified peptides can easily be overlooked. Extensive use of BAGEL2 and user feedback has led us to develop BAGEL3. BAGEL3 features genome mining of prokaryotes, which is largely independent of open reading frame (ORF) predictions and has been extended to cover more (novel) classes of posttranslationally modified peptides. BAGEL3 uses an identification approach that combines direct mining for the gene and indirect mining via context genes. Especially for heavily modified peptides like lanthipeptides, sactipeptides, glycocins and others, this genetic context harbors valuable information that is used for mining purposes. The bacteriocin and context protein databases have been updated and it is now easy for users to submit novel bacteriocins or RiPPs. The output has been simplified to allow user-friendly analysis of the results, in particular for large (meta-genomic) datasets. The genetic context of identified candidate genes is fully annotated. As input, BAGEL3 uses FASTA DNA sequences or folders containing multiple FASTA formatted files. BAGEL3 is freely accessible at PMID:23677608

  9. The sorghum photoperiod sensitivity gene, Ma3, encodes a phytochrome B.

    PubMed Central

    Childs, K L; Miller, F R; Cordonnier-Pratt, M M; Pratt, L H; Morgan, P W; Mullet, J E


    The Ma3 gene is one of six genes that regulate the photoperiodic sensitivity of flowering in sorghum (Sorghum bicolor [L.] Moench). The ma3R mutation of this gene causes a phenotype that is similar to plants that are known to lack phytochrome B, and ma3 sorghum lacks a 123-KD phytochrome that predominates in light-grown plants and that is present in non-ma3 plants. A population segregating for Ma3 and ma3 was created and used to identify two randomly amplified polymorphic DNA markers linked to Ma3. These two markers were cloned and mapped in a recombinant inbred population as restriction fragment length polymorphisms. cDNA clones of PHYA and PHYC were cloned and sequenced from a cDNA library prepared from green sorghum leaves. Using a genome-walking technique, a 7941-bp partial sequence of PHYB, was determined from genomic DNA from ma3 sorghum. PHYA, PHYB, and PHYC all mapped to the same linkage group. The Ma3-linked markers mapped with PHYB more than 121 centimorgans from PHYA and PHYC. A frameshift mutation resulting in a premature stop codon was found in the PHYB sequence from ma3 sorghum. Therefore, we conclude that the Ma3 locus in sorghum is a PHYB gene that encodes a 123-kD phytochrome. PMID:9046599

  10. A Gene Mutated in Nephronophthisis and Retinitis Pigmentosa Encodes a Novel Protein, Nephroretinin, Conserved in Evolution

    PubMed Central

    Otto, Edgar; Hoefele, Julia; Ruf, Rainer; Mueller, Adelheid M.; Hiller, Karl S.; Wolf, Matthias T. F.; Schuermann, Maria J.; Becker, Achim; Birkenhäger, Ralf; Sudbrak, Ralf; Hennies, Hans C.; Nürnberg, Peter; Hildebrandt, Friedhelm


    Nephronophthisis (NPHP) comprises a group of autosomal recessive cystic kidney diseases, which constitute the most frequent genetic cause for end-stage renal failure in children and young adults. The most prominent histologic feature of NPHP consists of development of renal fibrosis, which, in chronic renal failure of any origin, represents the pathogenic event correlated most strongly to loss of renal function. Four gene loci for NPHP have been mapped to chromosomes 2q13 (NPHP1), 9q22 (NPHP2), 3q22 (NPHP3), and 1p36 (NPHP4). At all four loci, linkage has also been demonstrated in families with the association of NPHP and retinitis pigmentosa, known as “Senior-Løken syndrome” (SLS). Identification of the gene for NPHP type 1 had revealed nephrocystin as a novel docking protein, providing new insights into mechanisms of cell-cell and cell-matrix signaling. We here report identification of the gene (NPHP4) causing NPHP type 4, by use of high-resolution haplotype analysis and by demonstration of nine likely loss-of-function mutations in six affected families. NPHP4 encodes a novel protein, nephroretinin, that is conserved in evolution—for example, in the nematode Caenorhabditis elegans. In addition, we demonstrate two loss-of-function mutations of NPHP4 in patients from two families with SLS. Thus, we have identified a novel gene with critical roles in renal tissue architecture and ophthalmic function. PMID:12205563

  11. The gusBC Genes of Escherichia coli Encode a Glucuronide Transport System

    PubMed Central

    Liang, Wei-Jun; Wilson, Kate J.; Xie, Hao; Knol, Jan; Suzuki, Shun'ichi; Rutherford, Nicholas G.; Henderson, Peter J. F.; Jefferson, Richard A.


    Two genes, gusB and gusC, from a natural fecal isolate of Escherichia coli are shown to encode proteins responsible for transport of β-glucuronides with synthetic [14C]phenyl-1-thio-β-d-glucuronide as the substrate. These genes are located in the gus operon downstream of the gusA gene on the E. coli genome, and their expression is induced by a variety of β-d-glucuronides. Measurements of transport in right-side-out subcellular vesicles show the system has the characteristics of secondary active transport energized by the respiration-generated proton motive force. When the genes were cloned together downstream of the tac operator-promoter in the plasmid pTTQ18 expression vector, transport activity was increased considerably with isopropylthiogalactopyranoside as the inducer. Amplified expression of the GusB and GusC proteins enabled visualization and identification by N-terminal sequencing of both proteins, which migrated at ca. 32 kDa and 44 kDa, respectively. Separate expression of the GusB protein showed that it is essential for glucuronide transport and is located in the inner membrane, while the GusC protein does not catalyze transport but assists in an as yet unknown manner and is located in the outer membrane. The output of glucuronides as waste by mammals and uptake for nutrition by gut bacteria or reabsorption by the mammalian host is discussed. PMID:15774881

  12. The pep4 gene encoding proteinase A is involved in dimorphism and pathogenesis of Ustilago maydis.


    Soberanes-Gutiérrez, Cinthia V; Juárez-Montiel, Margarita; Olguín-Rodríguez, Omar; Hernández-Rodríguez, César; Ruiz-Herrera, José; Villa-Tanaca, Lourdes


    Vacuole proteases have important functions in different physiological processes in fungi. Taking this aspect into consideration, and as a continuation of our studies on the analysis of the proteolytic system of Ustilago maydis, a phytopathogenic member of the Basidiomycota, we have analysed the role of the pep4 gene encoding the vacuolar acid proteinase PrA in the pathogenesis and morphogenesis of the fungus. After confirmation of the location of the protease in the vacuole using fluorescent probes, we obtained deletion mutants of the gene in sexually compatible strains of U. maydis (FB1 and FB2), and analysed their phenotypes. It was observed that the yeast to mycelium dimorphic transition induced by a pH change in the medium, or the use of a fatty acid as sole carbon source, was severely reduced in Δpep4 mutants. In addition, the virulence of the mutants in maize seedlings was reduced, as revealed by the lower proportion of plants infected and the reduction in size of the tumours induced by the pathogen, when compared with wild-type strains. All of these phenotypic alterations were reversed by complementation of the mutant strains with the wild-type gene. These results provide evidence of the importance of the pep4 gene for the morphogenesis and virulence of U. maydis. PMID:25597948

  13. Unexpected Diversity of pepA Genes Encoding Leucine Aminopeptidases in Sediments from a Freshwater Lake

    PubMed Central

    Tsuboi, Shun; Yamamura, Shigeki; Imai, Akio; Iwasaki, Kazuhiro


    We herein designed novel PCR primers for universal detection of the pepA gene, which encodes the representative leucine aminopeptidase gene, and investigated the genetic characteristics and diversity of pepA genes in sediments of hypereutrophic Lake Kasumigaura, Japan. Most of the amino acid sequences deduced from the obtained clones (369 out of 370) were related to PepA-like protein sequences in the M17 family of proteins. The developed primers broadly detected pepA-like clones associated with diverse bacterial phyla—Alpha-, Beta-, Gamma-, and Deltaproteobacteria, Acidobacteria, Actinobacteria, Aquificae, Chlamydiae, Chloroflexi, Cyanobacteria, Firmicutes, Nitrospirae, Planctomycetes, and Spirochetes as well as the archaeal phylum Thaumarchaeota, indicating that prokaryotes in aquatic environments possessing leucine aminopeptidase are more diverse than previously reported. Moreover, prokaryotes related to the obtained pepA-like clones appeared to be r- and K-strategists, which was in contrast to our previous findings showing that the neutral metalloprotease gene clones obtained were related to the r-strategist genus Bacillus. Our results suggest that an unprecedented diversity of prokaryotes with a combination of different proteases participate in sedimentary proteolysis. PMID:26936797

  14. Mutations in the Drosophila Melanogaster Gene Encoding S-Adenosylmethionine Suppress Position-Effect Variegation

    PubMed Central

    Larsson, J.; Zhang, J.; Rasmuson-Lestander, A.


    In Drosophila melanogaster, the study of trans-acting modifier mutations of position-effect variegation and Polycomb group (Pc-G) genes have been useful tools to investigate genes involved in chromatin structure. We have cloned a modifier gene, Suppressor of zeste 5 (Su(z)5), which encodes S-adenosylmethionine synthetase, and we present here molecular results and data concerning its expression in mutants and genetic interactions. The mutant alleles Su(z)5, l(2)R23 and l(2)M6 show suppression of w(m4) and also of two white mutants induced by roo element insertions in the regulatory region i.e., w(is) (in combination with z(1)) and w(sp1). Two of the Su(z)5 alleles, as well as a deletion of the gene, also act as enhancers of Polycomb by increasing the size of sex combs on midleg. The results suggest that Su(z)5 is connected with regulation of chromatin structure. The enzyme S-adenosylmethionine synthetase is involved in the synthesis of S-adenosylmethionine, a methyl group donor and also, after decarboxylation, a propylamino group donor in the bio-synthesis of polyamines. Our results from HPLC analysis show that in ovaries from heterozygous Su(z)5 mutants the content of spermine is significantly reduced. Results presented here suggest that polyamines are an important molecule class in the regulation of chromatin structure. PMID:8725236

  15. Mutations in the Drosophila melanogaster gene encoding S-adenosylmethionine suppress position-effect variegation

    SciTech Connect

    Larsson, J.; Rasmuson-Lestander, A.; Zhang, Jingpu


    In Drosophila melanogaster, the study of trans-acting modifier mutations of position-effect variegation and Polycomb group (Pc-G) genes have been useful tools to investigate genes involved in chromatin structure. We have cloned a modifier gene, Suppressor of zeste 5 (Su(z)5), which encodes S-adenosylmethionine synthetase, and we present here molecular results and data concerning its expression in mutants and genetic interactions. The mutant alleles Su(z)5, l(2)R23 and l(2)M6 show suppression of w{sup m4} and also of two white mutants induced by roo element insertions in the regulatory region i.e., w{sup is} (in combination with z{sup 1}) and w{sup sp1}. Two of the Su(z)5 alleles, as well as a deletion of the gene, also act as enhancers of Polycomb by increasing the size of sex combes on midleg. The results suggest that Su(z)5 is connected with regulation of chromatin structure. The enzyme S-adenosylmethionine synthetase is involved in the synthesis of S-adenosylmethionine, a methyl group donor and also, after decarboxylation, a propylamino group donor in the biosynthesis of polyamines. Our results from HPLC analysis show that in ovaries from heterozygous Su(z)5 mutants the content of spermine is significantly reduced. Results presented here suggest that polyamines are an important molecule class in the regulation of chromatin structure. 50 refs., 5 figs., 3 tabs.

  16. Detection of genes encoding antimicrobial peptides in Mexican strains of Trichoplusia ni (Hubner) exposed to Bacillus thuringiensis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The systemic immune response of Trichoplusia ni after Bacillus thuringiensis (Bt) exposure was evaluated by comparing the expression of genes encoding antimicrobial peptides (AMP) in Bt-susceptible and -resistant T. ni strains that were either exposed or not to XenTari® (Bt-XT). AMP genes were dete...

  17. Evidence of Localized Prophage-Host Recombination in the lytA Gene, Encoding the Major Pneumococcal Autolysin ▿

    PubMed Central

    Morales, María; García, Pedro; de la Campa, Adela G.; Liñares, Josefina; Ardanuy, Carmen; García, Ernesto


    According to a highly polymorphic region in the lytA gene, encoding the major autolysin of Streptococcus pneumoniae, two different families of alleles can be differentiated by PCR and restriction digestion. Here, we provide evidence that this polymorphic region arose from recombination events with homologous genes of pneumococcal temperate phages. PMID:20304992

  18. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.


    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H


    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. PMID:26475106

  19. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters

    PubMed Central

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L.; Jáuregui, Ruy; Vilchez-Vargas, Ramiro


    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. PMID:26475106

  20. Effects of increased hypothalamic leptin gene expression on ovariectomy-induced bone loss in rats

    PubMed Central

    Jackson, M.A.; Iwaniec, U.T.; Turner, R.T.; Wronski, T.J.; Kalra, S.P.


    Estrogen deficiency results in accelerated bone turnover with a net increase in bone resorption. Subcutaneous administration of leptin attenuates bone loss in ovariectomized (ovx) rats by reducing bone resorption. However, in addition to its direct beneficial effects, leptin has been reported to have indirect (central nervous system-mediated) antiosteogenic effects on bone, which may limit the efficacy of elevated serum leptin to prevent estrogen deficiency-associated bone loss. The present study evaluated the long-term effects of increased hypothalamic leptin transgene expression, using recombinant adeno-associated virus-leptin (rAAV-Lep) gene therapy, on bone mass, architecture, and cellular endpoints in sexually mature ovx Sprague-Dawley rats. Ovx rats were implanted with cannulae in the 3rd ventricle of the hypothalamus and injected with either rAAV-Lep or rAAV-GFP (control vector encoding green fluorescent protein) and maintained for 10 weeks. Additional controls consisted of ovary-intact rats and ovx rats pair-fed to rAAV-Lep rats. Lumbar vertebrae were analyzed by micro-computed tomography and tibiae by histomorphometry. Cancellous bone volume was lower and osteoclast perimeter, osteoblast perimeter, and bone marrow adipocyte density were greater in ovx rats compared to ovary-intact controls. In contrast, differences among ovx groups were not detected for any endpoint evaluated. In conclusion, whereas estrogen deficiency resulted in marked cancellous osteopenia, increased bone turnover and marrow adiposity, increasing hypothalamic leptin transgene expression in ovx rats had neither detrimental nor beneficial effects on bone mass, architecture, or cellular endpoints. These findings demonstrate that the antiresorptive effects of subcutaneous leptin administration in ovx rats are mediated through leptin targets in the periphery. PMID:21640774

  1. A gene from Renibacterium salmoninarum encoding a product which shows homology to bacterial zinc-metalloproteases.


    Grayson, T H; Evenden, A J; Gilpin, M L; Martin, K L; Munn, C B


    A genomic library constructed from Renibacterium salmoninarum isolate MT444 DNA in the plasmid vector pBR328 was screened using Escherichia coli host strain DH1 for the expression of genes encoding putative virulence factors. A single haemolytic clone was isolated at 22 degrees C and found to contain a 3.1 kb HindIII fragment of inserted DNA. This fragment was present in seven isolates of R. salmoninarum which were examined. Western blots of extracts from clones exhibiting haemolytic activity were performed with antisera raised against either cellular or extracellular components of R. salmoninarum and failed to identify any additional proteins compared to control E. coli containing pBR328. However, minicell analysis revealed that a polypeptide with an apparent molecular mass of 65 kDa was associated with a haemolytic activity distinct from that previously described for R. salmoninarum. The nucleotide sequence of the gene encoding this product was determined and the amino acid sequence deduced. The product was 548 amino acids with a predicted molecular mass of 66757 Da and a pl of 5.57. The deduced amino acid sequence of the gene possessed strong similarities to those of a range of secreted bacterial zinc-metalloproteases and was tentatively designed hly. Neither protease nor lecithinase activities were detectable in E. coli recombinants expressing gene hly. Haemolytic activity was observed from 6 degrees C to 37 degrees C for erythrocytes from a number of mammalian species and also from fish. Gene hly was expressed in E. coli as a fusion protein consisting of maltose-binding protein at the N-terminus linked to all but the first 24 amino acids, largely constituting the putative signal peptide, of the N-terminus of Hly. The soluble fusion protein was produced and purified by affinity chromatography. Antiserum raised against the purified fusion protein was used to probe Western blots of cell lysates and extracellular products from seven isolates of R. salmoninarum

  2. Virulence Plasmid of Rhodococcus equi Contains Inducible Gene Family Encoding Secreted Proteins

    PubMed Central

    Byrne, Barbara A.; Prescott, John F.; Palmer, Guy H.; Takai, Shinji; Nicholson, Vivian M.; Alperin, Debra C.; Hines, Stephen A.


    Rhodococcus equi causes severe pyogranulomatous pneumonia in foals. This facultative intracellular pathogen produces similar lesions in immunocompromised humans, particularly in AIDS patients. Virulent strains of R. equi bear a large plasmid that is required for intracellular survival within macrophages and for virulence in foals and mice. Only two plasmid-encoded proteins have been described previously; a 15- to 17-kDa surface protein designated virulence-associated protein A (VapA) and an antigenically related 20-kDa protein (herein designated VapB). These two proteins are not expressed by the same R. equi isolate. We describe here the substantial similarity between VapA and VapB. Moreover, we identify three additional genes carried on the virulence plasmid, vapC, -D, and -E, that are tandemly arranged downstream of vapA. These new genes are members of a gene family and encode proteins that are approximately 50% homologous to VapA, VapB, and each other. vapC, -D, and -E are found only in R. equi strains that express VapA and are highly conserved in VapA-positive isolates from both horses and humans. VapC, -D, and -E are secreted proteins coordinately regulated by temperature with VapA; the proteins are expressed when R. equi is cultured at 37°C but not at 30°C, a finding that is compatible with a role in virulence. As secreted proteins, VapC, -D, and -E may represent targets for the prevention of rhodococcal pneumonia. An immunologic study using VapA-specific antibodies and recombinant Vap proteins revealed no evidence of cross-reactivity despite extensive sequence similarity over the carboxy terminus of all four proteins. PMID:11159951

  3. Two murine natural polyreactive autoantibodies are encoded by nonmutated germ-line genes.

    PubMed Central

    Baccala, R; Quang, T V; Gilbert, M; Ternynck, T; Avrameas, S


    Two monoclonal IgM natural autoantibodies (E7 and D23) obtained from the fusion of normal, nonimmunized, BALB/c mouse spleen cells and nonsecreting myeloma cells were selected on the basis of their polyreactivity with auto- and xenoantigens and chemical haptens. Nucleotide sequence analysis of the variable and constant regions of the heavy and light chains showed the following. (i) The antibodies arise from different genetic elements with very low or no homology--E7 from a heavy-chain variable region (VH) of family 36-60 and kappa light-chain variable region (V kappa) from a group 19--whereas D23 derives from a VH of family Q52 and V kappa derives from group 8. (ii) E7 and D23 are probably of germ-line origin, as suggested by high homology with VH genes from the unrearranged genome. Compared with the germ-line VH 1210.7 gene, E7 has a single nucleotide difference leading to a silent mutation at position 15, whereas D23 seems to be encoded by germ-line VH 101 with one nucleotide difference causing replacement of Ser-84 by Ala. (iii) The genetic V kappa and VH elements for E7 and D23 also give rise to different responses to phenyloxazolone, dinitrophenyl, 5-(dimethylamino)naphthalene-1-sulfonyl, arsonate, phosphocholine, and influenza virus hemagglutinin. Antibodies from normal and autoimmune mice with rheumatoid factor-like activity are also homologous to E7 and D23. These results indicate that polyreactive autoantibodies are encoded by germ-line genes and that, starting with the preimmune poly- and autoreactive repertoire, mutated forms of antibodies recognizing exogenous antigens can be obtained and selected. PMID:2499887

  4. Constraints on intron evolution in the gene encoding the myosin alkali light chain in Drosophila

    SciTech Connect

    Leicht, B.G.; Muse, S.V.; Hanczyc, M.


    Interspecific comparisons of intron sequences reveal conserved blocks of invariant nucleotides and several other departures from the strictly neutral model of molecular evolution. To distinguish the past action of evolutionary forces in introns known to have regulatory information, we examined nucleotide sequence variation at 991 sites in a random sample of 16 Drosophila melanogaster alleles of the gene encoding the myosin alkali light chain (Mlc1). The Mlc1 gene of D. melanogaster encodes two Mlc1 isoforms via developmentally regulated alternative pre-mRNA splicing. Analyses of these data reveal that introns 4 and 5, which flank the alternatively spliced exon 5, have reduced levels of both intraspecific polymorphism and interspecific divergence relative to intron 3. No polymorphism was observed in any of the exons examined in D. melanogaster. A genealogical analysis clearly demonstrates the occurrence of intragenic recombination in the ancestral history of Mlc1. Recombination events are estimated to be 13 times more likely than mutation events over the span of the sequenced region. Although there is little evidence for pairwise linkage disequilibrium in the Mlc1 region, higher order disequilibrium. does seem to be present in the 5{prime} half of the portion of the gene that was examined. Predictions of the folding free energy of the pre-mRNA reveal that sampled alleles have a significantly higher (less stable) free energy than do randomly permuted sequences. These results are consistent with the hypothesis that introns surrounding an alternatively spliced exon are subjected to additional constraints, perhaps due to specific aspects of secondary structure required for appropriate splicing of the pre-mRNA molecule. 48 refs., 5 figs., 3 tabs.

  5. Cloning and characterization of the genes encoding nitrilotriacetate monooxygenase of Chelatobacter heintzii ATCC 29600.

    PubMed Central

    Knobel, H R; Egli, T; van der Meer, J R


    A 6.2-kb DNA fragment containing the genes for the nitrilotriacetate (NTA) monooxygenase of Chelatobacter heintzii ATCC 29600 was cloned and characterized by DNA sequencing and expression studies. The nucleotide sequence contained three major open reading frames (ORFs). Two of the ORFs, which were oriented divergently with an intergenic region of 307 bp, could be assigned to the NTA monooxygenase components A and B. The predicted N-terminal amino acid sequences of these ORFs were identical with those determined for the purified components. We therefore named these genes ntaA (for component A of NTA monooxygenase) and ntaB (for component B). The ntaA and ntaB genes could be expressed in Escherichia coli DH5alpha, and the gene products were visualized after Western blotting (immunoblotting) and incubation with polyclonal antibodies against component A or B. By mixing overproduced NtaB from E. coli and purified component A from C. heintzii ATCC 29600, reconstitution of a functional NTA monooxygenase complex was possible. The deduced gene product of ntaA showed only significant homology to SoxA (involved in dibenzothiophene degradation) and to SnaA (involved in pristamycin synthesis); that of ntaB shared weak homologies in one domain with other NADH:flavine mononucleotide oxidoreductases. These homologies provide no conclusive answer as to the possible evolutionary origin of the NTA monooxygenase. The deduced gene product of the third ORF (ORF1) had homology in the N-terminal region with the GntR class of bacterial regulator proteins and therefore may encode a regulator protein, possibly involved in regulation of ntaA and ntaB expression. PMID:8892809

  6. Evolution and Horizontal Transfer of dUTPase-Encoding Genes in Viruses and Their Hosts

    PubMed Central

    Baldo, Angela M.; McClure, Marcella A.


    dUTPase is a ubiquitous and essential enzyme responsible for regulating cellular levels of dUTP. The dut gene exists as single, tandemly duplicated, and tandemly triplicated copies. Crystallized single-copy dUTPases have been shown to assemble as homotrimers. dUTPase is encoded as an auxiliary gene in a number of virus genomes. The origin of viral dut genes has remained unresolved since their initial discovery. A comprehensive analysis of dUTPase amino acid sequence relationships was performed to explore the evolutionary dynamics of dut in viruses and their hosts. Our data set, comprised of 24 host and 51 viral sequences, includes representative sequences from available eukaryotes, archaea, eubacteria cells, and viruses, including herpesviruses. These amino acid sequences were aligned by using a hidden Markov model approach developed to align divergent data. Known secondary structures from single-copy crystals were mapped onto the aligned duplicate and triplicate sequences. We show how duplicated dUTPases might fold into a monomer, and we hypothesize that triplicated dUTPases also assemble as monomers. Phylogenetic analysis revealed at least five viral dUTPase sequence lineages in well-supported monophyletic clusters with eukaryotic, eubacterial, and archaeal hosts. We have identified all five as strong examples of horizontal transfer as well as additional potential transfer of dut genes among eubacteria, between eubacteria and viruses, and between retroviruses. The evidence for horizontal transfers is particularly interesting since eukaryotic dut genes have introns, while DNA virus dut genes do not. This implies that an intermediary retroid agent facilitated the horizontal transfer process between host mRNA and DNA viruses. PMID:10438861

  7. A lectin gene encodes the alpha-amylase inhibitor of the common bean.

    PubMed Central

    Moreno, J; Chrispeels, M J


    An alpha-amylase inhibitor that inhibits insect and mammalian alpha-amylases but not plant alpha-amylases, is present in seeds of the common bean (Phaseolus vulgaris). We have purified the alpha-amylase inhibitor by using a selective heat treatment in acidic medium and affinity chromatography with porcine pancreas alpha-amylase coupled to agarose. Under sodium dodecyl sulfate gel electrophoresis, the purified inhibitor gave rise to five bands with mobilities corresponding to molecular masses ranging from 14 to 19 kDa. N-terminal sequencing (up to 15 amino acids) of the polypeptides obtained from these bands resulted in only two different sequences matching two stretches of the amino acid sequence deduced from an already described lectin gene [Hoffman, L. M. (1984) J. Mol. Appl. Gen. 2,447-453]. This gene is different from but closely related to the genes that code for phytohemagglutinin, the major lectin of bean. Further evidence based on amino acid composition, identification of a precursor, and recognition of the product of the gene (expressed in Escherichia coli) by an anti-alpha-amylase inhibitor serum confirms that the inhibitor is encoded by this or a closely related lectin gene. This finding assigns a biological function, which has been described at the molecular level, to a plant lectin gene product and supports the defense role postulated for seed lectins. The lack of homology with other families of enzyme inhibitors suggests that this may be the first member of a new family of plant enzyme inhibitors. Images PMID:2682631

  8. Local and systemic responses following intravitreous injection of AAV2-encoded modified Volvox channelrhodopsin-1 in a genetically blind rat model.


    Sugano, E; Tabata, K; Takahashi, M; Nishiyama, F; Shimizu, H; Sato, M; Tamai, M; Tomita, H


    We previously designed a modified channelrhodopsin-1 (mVChR1) protein chimera with a broader action than that of Chlamydomonas channelrhodopsin-2 and reported that its transduction into retinal ganglion cells can restore visual function in genetically blind, dystrophic Royal College of Surgeons (RCS) rats, with photostimuli ranging from 486 to 640 nm. In the current study, we sought to investigate the safety and influence of mVChR1 transgene expression. Adeno-associated virus type 2 encoding mVChR1 was administered by intravitreous injection into dystrophic RCS rats. Reverse-transcription PCR was used to monitor virus and transgene dissemination and the results demonstrated that their expression was restricted specifically within the eye tissues, and not in non-target organs. Moreover, examination of the blood, plasma and serum revealed that no excess immunoreactivity was present, as determined using standard clinical hematological parameters. Serum antibodies targeting the recombinant adeno-associated virus (rAAV) capsid increased after the injection; however, no increase in mVChR1 antibody was detected during the observation period. In addition, retinal histological examination showed no signs of inflammation in rAAV-injected rats. In conclusion, our results demonstrate that mVChR1 can be exogenously expressed without harmful immunological reactions in vivo. These findings will aid in studies of AAV gene transfer to restore vision in late-stage retinitis pigmentosa. PMID:26440056

  9. Cloning of cDNAs that encode human mast cell carboxypeptidase A, and comparison of the protein with mouse mast cell carboxypeptidase A and rat pancreatic carboxypeptidases

    SciTech Connect

    Reynolds, D.S.; Gurley, D.S.; Stevens, R.L.; Austen, K.F.; Serafin, W.E. Brigham and Women's Hospital, Boston, MA ); Sugarbaker, D.J. )


    Human skin and lung mast cells and rodent peritoneal cells contain a carboxypeptidase in their secretory granules. The authors have screened human lung cDNA libraries with a mouse mast cell carboxypeptidase A (MC-CPA) cDNA probe to isolate a near-full-length cDNA that encodes human MC-CPA. The 5{prime} end of the human MC-CPA transcript was defined by direct mRNA sequencing and by isolation and partial sequencing of the human MC-CPA gene. Human MC-CPA is predicted to be translated as a 417 amino acid preproenzyme which includes a 15 amino acid signal peptide and a 94-amino acid activation peptide. The mature human MC-CPA enzyme has a predicted size of 36.1 kDa, a net positive charge of 16 at neutral pH, and 86% amino acid sequence identity with mouse MC-CPA. DNA blot analyses showed that human MC-CPA mRNA is transcribed from a single locus in the human genome. Comparison of the human MC-CPA with mouse MC-CPA and with three rat pancreatic carboxypeptidases shows that these enzymes are encoded by distinct but homologous genes.

  10. Multiple horizontally acquired genes from fungal and prokaryotic donors encode cellulolytic enzymes in the bdelloid rotifer Adineta ricciae.


    Szydlowski, L; Boschetti, C; Crisp, A; Barbosa, E G G; Tunnacliffe, A


    The bdelloid rotifer, Adineta ricciae, an anhydrobiotic microinvertebrate, exhibits a high rate of horizontal gene transfer (HGT), with as much as 10% of its transcriptome being of foreign origin. Approximately 80% of these foreign transcripts are involved in metabolic processes, and therefore bdelloids represent a useful model for assessing the contribution of HGT to biochemical diversity. To validate this concept, we focused on cellulose digestion, an unusual activity in animals, which is represented by at least 16 genes encoding cellulolytic enzymes in A. ricciae. These genes have been acquired from a variety of different donor organisms among the bacteria and fungi, demonstrating that bdelloids use diverse genetic resources to construct a novel biochemical pathway. A variable complement of the cellulolytic gene set was found in five other bdelloid species, indicating a dynamic process of gene acquisition, duplication and loss during bdelloid evolution. For example, in A. ricciae, gene duplications have led to the formation of three copies of a gene encoding a GH45 family glycoside hydrolase, at least one of which encodes a functional enzyme; all three of these gene copies are present in a close relative, Adineta vaga, but only one copy was found in each of four Rotaria species. Furthermore, analysis of expression levels of the cellulolytic genes suggests that a bacterial-origin cellobiase is upregulated upon desiccation. In summary, bdelloid rotifers have apparently developed cellulolytic functions by the acquisition and domestication of multiple foreign genes. PMID:25863176

  11. Design and evaluation of novel primers for the detection of genes encoding diverse enzymes of methylotrophy and autotrophy.


    Hung, Wei-Lian; Wade, William G; Chen, Yin; Kelly, Donovan P; Wood, Ann P


    The phylogenetic significance of the diversity of key enzymes of methylotrophic and autotrophic metabolism is discussed. Primers for these key enzymes were designed using gene sequences encoding methanol dehydrogenase (mxaF; using subsets from database sequences for 22 Bacteria), hydroxypyruvate reductase (hpr; 36 sequences), methylamine dehydrogenase (mauA; 12 sequences), methanesulfonate monooxygenase (msmA; four sequences), and the ccbL and cbbM genes of ribulose bisphosphate carboxylase (26 and 23 sequences). These were effective in amplifying the correct gene products for the target genes in reference organisms and in test organisms not previously shown to contain the genes, as well as in some methylotrophic Proteobacteria isolated from the human mouth. The availability of the new primers increases the probability of detecting diverse examples of the genes encoding these key enzymes both in natural populations and in isolated bacterial strains. PMID:22708342

  12. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s)

    PubMed Central

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V. Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. PMID:27060167

  13. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).


    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. PMID:27060167

  14. Correlation of gene and protein structure of rat and human lipocortin 1

    SciTech Connect

    Kovacic, R.T.; Tizard, R.; Cate, R.L.; Frey, A.Z.; Wallner, B.P. )


    Lipocortins (annexins) are a family of calcium-dependent phospholipid-binding proteins with phospholipase A{sub 2} inhibitory activity. The characteristic primary structure of members of this family consists of a core structure of four or eight repeated domains, which have been implicated in calcium-dependent phospholipid binding. In two lipocortins (1 and 2) a short amino-terminal sequence distinct from the core structure has potential regulatory functions which are dependent on its phosphorylation state. The authors isolated the rat and human lipocortin 1 genes and found that they both consist of 13 exons with a striking conservation of their exon-intron structure and their promoter and amino acid sequences. Both lipocortin I genes are at least 19 kbp in length with exons ranging from 57 to 123 bp interrupted by introns as large as 5 kbp. Each of the four repeat units of lipocortin 1 are encoded by two consecutive exons while individual exons code for the highly conserved putative calcium-binding domains. The promoter sequences in the rat and in human genes are highly conserved and contain nucleotide sequences characterized as enhancer sequences in other genes. The structure of the lipocortin 1 gene lends support to the hypothesis that the lipocortin genes arose by a duplication of a single domain.

  15. Plasmid content and localization of the genes encoding the denitrification enzymes in two strains of Rhodobacter sphaeroides.


    Schwintner, C; Sabaty, M; Berna, B; Cahors, S; Richaud, P


    Plasmid content and localization of the genes encoding the reductases of the denitrification pathway were determined in the photosynthetic bacterium Rhodobacter sphaeroides forma sp. denitrificans by transverse alternating-field electrophoresis (TAFE) and hybridization with digoxigenin-labeled homologous probes. Two large plasmids of 102 and 115 kb were found. The genes encoding the various reductases are not clustered on a single genetic unit. The nap locus (localized with a napA probe), the nirK gene and the norCB genes encoding the nitrate, nitrite and nitric oxide reductases, respectively, were found on different AseI and SnaBI digested chromosomal DNA fragments, whereas the nos locus (localized with a nosZ probe), encoding the nitrous oxide reductase, was identified on the 115-kb plasmid. Furthermore, the genes encoding two proteins of unknown function, one periplasmic and the other cytoplasmic, but whose synthesis is highly induced by nitrate, were found on a different chromosomal fragment. For comparison, the same experiments were carried out on the well-characterized strain Rhodobacter sphaeroides 2.4.1. PMID:9742704

  16. Nucleotide sequence of the cDNA encoding the precursor of the beta subunit of rat lutropin.

    PubMed Central

    Chin, W W; Godine, J E; Klein, D R; Chang, A S; Tan, L K; Habener, J F


    We have determined the nucleotide sequences of cDNAs encoding the precursor of the beta subunit of rat lutropin, a polypeptide hormone that regulates gonadal function, including the development of gametes and the production of steroid sex hormones. The cDNAs were prepared from poly(A)+ RNA derived from the pituitary glands of rats 4 weeks after ovariectomy and were cloned in bacterial plasmids. Bacterial colonies containing transfected plasmids were screened by hybridization with a 32P-labeled cDNA encoding the beta subunit of human chorionic gonadotropin, a protein that is related in structure to lutropin. Several recombinant plasmids were detected that by nucleotide sequence analyses contained coding sequences for the precursor of the beta subunit of lutropin. Complete determination of the nucleotide sequences of these cDNAs, as well as of cDNA reverse-transcribed from pituitary poly(A)+ RNA by using a synthetic pentadecanucleotide as a primer of RNA, provided the entire 141-codon sequence of the precursor of the beta subunit of rat lutropin. The precursor consists of a 20 amino acid leader (signal) peptide and an apoprotein of 121 amino acids. The amino acid sequence of the rat lutropin beta subunit shows similarity to the beta subunits of the ovine/bovine, porcine, and human lutropins (81, 86, and 74% of amino acids identical, respectively). Blot hybridization of pituitary RNAs separated by electrophoresis on agarose gels showed that the mRNA encoding the lutropin beta subunit consists of approximately 700 bases. The availability of cDNAs for both the alpha and beta subunits of lutropin will facilitate studies of the regulation of lutropin expression. Images PMID:6192440

  17. The SdiA-regulated gene srgE encodes a type III secreted effector.


    Habyarimana, Fabien; Sabag-Daigle, Anice; Ahmer, Brian M M


    Salmonella enterica serovar Typhimurium is a food-borne pathogen that causes severe gastroenteritis. The ability of Salmonella to cause disease depends on two type III secretion systems (T3SSs) encoded in two distinct Salmonella pathogenicity islands, 1 and 2 (SPI1 and SPI2, respectively). S. Typhimurium encodes a solo LuxR homolog, SdiA, which can detect the acyl-homoserine lactones (AHLs) produced by other bacteria and upregulate the rck operon and the srgE gene. SrgE is predicted to encode a protein of 488 residues with a coiled-coil domain between residues 345 and 382. In silico studies have provided conflicting predictions as to whether SrgE is a T3SS substrate. Therefore, in this work, we tested the hypothesis that SrgE is a T3SS effector by two methods, a β-lactamase activity assay and a split green fluorescent protein (GFP) complementation assay. SrgE with β-lactamase fused to residue 40, 100, 150, or 300 was indeed expressed and translocated into host cells, but SrgE with β-lactamase fused to residue 400 or 488 was not expressed, suggesting interference by the coiled-coil domain. Similarly, SrgE with GFP S11 fused to residue 300, but not to residue 488, was expressed and translocated into host cells. With both systems, translocation into host cells was dependent upon SPI2. A phylogenetic analysis indicated that srgE is found only within Salmonella enterica subspecies. It is found sporadically within both typhoidal and nontyphoidal serovars, although the SrgE protein sequences found within typhoidal serovars tend to cluster separately from those found in nontyphoidal serovars, suggesting functional diversification. PMID:24727228

  18. The SdiA-Regulated Gene srgE Encodes a Type III Secreted Effector

    PubMed Central

    Habyarimana, Fabien; Sabag-Daigle, Anice


    Salmonella enterica serovar Typhimurium is a food-borne pathogen that causes severe gastroenteritis. The ability of Salmonella to cause disease depends on two type III secretion systems (T3SSs) encoded in two distinct Salmonella pathogenicity islands, 1 and 2 (SPI1 and SPI2, respectively). S. Typhimurium encodes a solo LuxR homolog, SdiA, which can detect the acyl-homoserine lactones (AHLs) produced by other bacteria and upregulate the rck operon and the srgE gene. SrgE is predicted to encode a protein of 488 residues with a coiled-coil domain between residues 345 and 382. In silico studies have provided conflicting predictions as to whether SrgE is a T3SS substrate. Therefore, in this work, we tested the hypothesis that SrgE is a T3SS effector by two methods, a β-lactamase activity assay and a split green fluorescent protein (GFP) complementation assay. SrgE with β-lactamase fused to residue 40, 100, 150, or 300 was indeed expressed and translocated into host cells, but SrgE with β-lactamase fused to residue 400 or 488 was not expressed, suggesting interference by the coiled-coil domain. Similarly, SrgE with GFP S11 fused to residue 300, but not to residue 488, was expressed and translocated into host cells. With both systems, translocation into host cells was dependent upon SPI2. A phylogenetic analysis indicated that srgE is found only within Salmonella enterica subspecies. It is found sporadically within both typhoidal and nontyphoidal serovars, although the SrgE protein sequences found within typhoidal serovars tend to cluster separately from those found in nontyphoidal serovars, suggesting functional diversification. PMID:24727228

  19. Candidate genes for hypertension: insights from the Dahl S rat.


    Rudemiller, Nathan P; Mattson, David L


    Human genetic linkage and association studies have nominated many genes as possible contributors to disease. Mutating or deleting these genes in a relevant disease model can validate their association with disease and potentially uncover novel mechanisms of pathogenesis. Targeted genetic mutagenesis has only recently been developed in the rat, and this technique has been applied in the Dahl salt-sensitive (S) rat to investigate human candidate genes associated with hypertension. This mini-review communicates the findings of these studies and displays how targeted genetic mutagenesis may contribute to the discovery of novel therapies for patients. PMID:25877508

  20. Cacna1f gene decreased contractility of skeletal muscle in rat model with congenital stationary night blindness.


    An, Jing; Zhang, Lei; Jiao, Bo; Lu, Fan; Xia, Feng; Yu, Zhibin; Zhang, Zuoming


    The CACNA1F gene encodes a member of the alpha-1F subunit family in the voltage-dependent calcium channel (Cav1.4) complex. Mutations in this gene result in incomplete congenital stationary night blindness (iCSNB2) in humans. And Cav1.4 mutation could affect the functions of the skeletal muscle. This study investigated the role of Cacna1f mutations in alteration of the skeletal muscle functions in a Cacna1f mutation rat model (Cacna1f(CSNB2) rat). We found that the muscle endurance behaviors of Cacna1f(CSNB2) rats were significantly lower than those of the wild-type rats. The high-frequency fatigue resistance of the soleus muscle was decreased in Cacna1f(CSNB2) rats under continuous tetanic stimulation. The expression levels of the syntaxin (SYN) proteins in the soleus of the Cacna1f(CSNB2) rats were lower than those of wild-type rats. SYN was expressed in the soleus muscle, but not in the extensor digitorum longus. The Cav1.4 protein was not detected in the skeletal muscle of Cacna1f(CSNB2) rats. The Cacna1f mRNA level in the soleus of Cacna1f(CSNB2) rats was decreased compared with that in wild-type rats. This study demonstrated for the first time that the Cacna1f mutation reduces the function of slow-twitch skeletal muscle. And it also demonstrated that the Cacna1f gene affects synapse-associated protein expression, which may block the signal transmission in synaptic connectivity of the retina and skeletal muscle in Cacna1f-mutant rats. PMID:25748727

  1. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHC-restricted killing mediated by activated natural killer cells and T cells

    SciTech Connect

    Mathew, P.A.; Garni-Wagner, B.A.; Land, K.; Takashima, A.; Stoneman, E.; Bennett, M.; Kumar, V. )


    The authors have recently described a signal transducing molecule, 2B4, expressed on all NK and T cells that mediate non-MHC-restricted killing. The gene encoding this molecule was cloned and its nucleotide sequence determined. The encoded protein of 398 amino acids has a leader peptide of 18 amino acids and a transmembrane region of 24 amino acids. The predicted protein has eight N-linked glycosylation sites, suggesting that it is highly glycosylated. Comparison of 2B4 with sequences in the databanks indicates that 2B4 is a member of the Ig supergene family, and it shows homology to murine and rat CD48 and human LFA-3. Northern blot analysis has shown at least three transcripts for 2B4 in adherent lymphokine-activated killer cells of several mouse strains and TCR-[gamma]/[delta] dendritic epidermal T cell lines but not in allospecific T cell clones. These three mRNA are the products of differential splicing of heterogeneous nuclear RNA. Southern blot analysis of genomic DNA from several mouse strains revealed that 2B4 belongs to a family of closely related genes. The 2B4 gene has been mapped to mouse chromosome 1 by analysis of 2B4 expression in recombinant inbred mouse strains. 48 refs., 6 figs., 2 tabs.

  2. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.


    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben


    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators. PMID:26552797

  3. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells.


    Sateriale, Adam; Miller, Peter; Huston, Christopher D


    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment. PMID:26810036

  4. Identification of a Gene in Staphylococcus xylosus Encoding a Novel Glucose Uptake Protein

    PubMed Central

    Fiegler, Heike; Bassias, Joannis; Jankovic, Ivana; Brückner, Reinhold


    By transposon Tn917 mutagenesis, two mutants of Staphylococcus xylosus were isolated that showed higher levels of β-galactosidase activity in the presence of glucose than the wild type. Both transposons integrated in a gene, designated glcU, encoding a protein involved in glucose uptake in S. xylosus, which is followed by a glucose dehydrogenase gene (gdh). Glucose-mediated repression of β-galactosidase, α-glucosidase, and β-glucuronidase activities was partially relieved in the mutant strains, while repression by sucrose or fructose remained as strong as in the wild type. In addition to the pleiotropic regulatory effect, integration of the transposons into glcU reduced glucose dehydrogenase activity, suggesting cotranscription of glcU and gdh. Insertional inactivation of the gdh gene and deletion of the glcU gene without affecting gdh expression showed that loss of GlcU function is exclusively responsible for the regulatory defect. Reduced glucose repression is most likely the consequence of impaired glucose uptake in the glcU mutant strains. With cloned glcU, an Escherichia coli mutant deficient in glucose transport could grow with glucose as sole carbon source, provided a functional glucose kinase was present. Therefore, glucose is internalized by glcU in nonphosphorylated form. A gene from Bacillus subtilis, ycxE, that is homologous to glcU, could substitute for glcU in the E. coli glucose growth experiments and restored glucose repression in the S. xylosus glcU mutants. Three more proteins with high levels of similarity to GlcU and YcxE are currently in the databases. It appears that these proteins constitute a novel family whose members are involved in bacterial transport processes. GlcU and YcxE are the first examples whose specificity, glucose, has been determined. PMID:10438764

  5. Mutations in α- and β-tubulin encoding genes: implications in brain malformations.


    Romaniello, Romina; Arrigoni, Filippo; Bassi, Maria Teresa; Borgatti, Renato


    The tubulin gene family is mainly expressed in post-mitotic neurons during cortical development with a specific spatial and temporal expression pattern. Members of this family encode dimeric proteins consisting of two closely related subunits (α and β), representing the major constituents of microtubules. Tubulin genes play a crucial role in the mechanisms of the Central Nervous System development such as neuronal migration and axonal guidance (axon outgrowth and maintenance). Different mutations in α/β-tubulin genes (TUBA1A, TUBA8, TUBB2A, TUBB4A, TUBB2B, TUBB3, and TUBB) might alter the dynamic properties and functions of microtubules in several ways, effecting a reduction in the number of functional tubulin heterodimers and causing alterations in GTP binding and disruptions of the binding of other proteins to microtubules (motor proteins and other microtubule interacting proteins). In recent years an increasing number of brain malformations has been associated with mutations in tubulin genes: malformations of cortical development such as lissencephaly and various grades of gyral disorganization, focal or diffuse polymicrogyria and open or closed-lips schizencephaly as likely consequences of an altered neuronal migration process; abnormalities or agenesis of the midline commissural structures (anterior commissure, corpus callosum and fornix), hypoplasia of the oculomotor and optic nerves, dysmorphisms of the hind-brain as expression of axon guidance disorders. Dysmorphisms of the basal ganglia (fusion between the caudate nucleus and putamen with absence of the anterior limb of the internal capsule) and hippocampi were also observed. A rare form of leukoencephalopathy characterized by hypomyelination with atrophy of the basal ganglia an cerebellum (H-ABC) was also recently described. The present review, describing the structural and functional features of tubulin genes, aims to revise the main cerebral associated malformations and related clinical aspects

  6. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.


    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D


    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes. PMID:25567036

  7. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors

    PubMed Central

    Jones, Matthew L.; Norman, Jane E.; Morgan, Neil V.; Mundell, Stuart J.; Lordkipanidzé, Marie; Lowe, Gillian C.; Daly, Martina E.; Simpson, Michael A.; Drake, Sian; Watson, Steve P.; Mumford, Andrew D.


    Summary Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70% had global minor allele frequency (MAF) < 0.05%. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21%) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF<1% and 22 with MAF≥1%). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes. PMID:25567036

  8. The human TAX1 gene encoding the axon-associated cell adhesion molecule TAG-1/axonin-1: Genomic structure and basic promoter

    SciTech Connect

    Kozlov, S.V.; Giger, R.J.; Hasler, T.; Sonderegger, P.; Korvatska, E.; Schorderet, D.F.


    The human TAX-1 gene (HGMW-approved symbol TAX1) is located on chromosome 1 (1q32.1) and encodes the neuronal cell adhesion molecule TAG-1/axonin-1. The gene product, termed TAG-1 in the rat and axonin-1 in the chicken, is composed of six immunoglobulin (Ig)-like and four fibronectin type III (FNIII)-like domains. It is found predominantly on the axons of particular nerve fiber tracts during neural development, and it has been demonstrated to function as a potent substratum for neurite outgrowth in vitro. Here we report the cloning and structural characterization of the TAX-1 gene. The transcribed region of the TAX-1 gene extends over about 40 kb. Like its chicken homologue, the human TAX-1 gene consists of 23 exons. Two GT/CA microsatellites were localized in the first intron; a polymorphism was found for one of them. Reporter gene analysis with serially truncated fragments of the 5{prime}-flanking region indicated that a 164-bp fragment located immediately upstream of the putative transcription initiation site was sufficient to function as a basal promoter. 45 refs., 3 figs., 2 tabs.

  9. Cloning, expression, and characterization of the Lactococcus lactis pfl gene, encoding pyruvate formate-lyase.

    PubMed Central

    Arnau, J; Jørgensen, F; Madsen, S M; Vrang, A; Israelsen, H


    The Lactococcus lactis pfl gene, encoding pyruvate formate-lyase (PFL), has been cloned and characterized. The deduced amino acid sequence of the L. lactis PFL. protein showed high similarity to those of other bacterial PFL proteins and included the conserved glycine residue involved in posttranslational activation of PFL. The genetic organization of the chromosomal pfl region in L. lactis showed differences from other characterized pfl loci, with an upstream open reading frame independently transcribed in the same orientation as the pfl gene. The gene coding for PFL-activase (act), normally found downstream of pfl, was not identified in L. lactis. Analysis of pfl expression showed a strong induction under anaerobiosis at the transcriptional level independent of the growth medium used. During growth with galactose, pfl showed the highest levels of expression. Constructed L. lactis pfl strains were unable to produce formate under anaerobic growth. Higher levels of diacetyl and acetoin were produced anaerobically in the constructed Lactococcus lactis subsp. lactis biovar diacetylactis pfl strain. PMID:9294449

  10. Kallmann Syndrome: Mutations in the Genes Encoding Prokineticin-2 and Prokineticin Receptor-2

    PubMed Central

    Dodé, Catherine; Teixeira, Luis; Levilliers, Jacqueline; Fouveaut, Corinne; Bouchard, Philippe; Kottler, Marie-Laure; Lespinasse, James; Lienhardt-Roussie, Anne; Mathieu, Michèle; Moerman, Alexandre; Morgan, Graeme; Murat, Arnaud; Toublanc, Jean-Edmont; Wolczynski, Slawomir; Delpech, Marc; Petit, Christine; Young, Jacques; Hardelin, Jean-Pierre


    Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2) and one of its ligands, prokineticin-2 (PROK2), respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome. PMID:17054399

  11. The Drosophila prage Gene, Required for Maternal Transcript Destabilization in Embryos, Encodes a Predicted RNA Exonuclease.


    Cui, Jun; Lai, Yun Wei; Sartain, Caroline V; Zuckerman, Rebecca M; Wolfner, Mariana F


    Egg activation, the transition of mature oocytes into developing embryos, is critical for the initiation of embryogenesis. This process is characterized by resumption of meiosis, changes in the egg's coverings and by alterations in the transcriptome and proteome of the egg; all of these occur in the absence of new transcription. Activation of the egg is prompted by ionic changes in the cytoplasm (usually a rise in cytosolic calcium levels) that are triggered by fertilization in some animals and by mechanosensitive cues in others. The egg's transcriptome is dramatically altered during the process, including by the removal of many maternal mRNAs that are not needed for embryogenesis. However, the mechanisms and regulators of this selective RNA degradation are not yet fully known. Forward genetic approaches in Drosophila have identified maternal-effect genes whose mutations prevent the transcriptome changes. One of these genes, prage (prg), was identified by Tadros et al. in a screen for mutants that fail to destabilize maternal transcripts. We identified the molecular nature of the prg gene through a combination of deficiency mapping, complementation analysis, and DNA sequencing of both extant prg mutant alleles. We find that prg encodes a ubiquitously expressed predicted exonuclease, consistent with its role in maternal mRNA destabilization during egg activation. PMID:27172196

  12. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.


    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W


    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  13. The Drosophila prage Gene, Required for Maternal Transcript Destabilization in Embryos, Encodes a Predicted RNA Exonuclease

    PubMed Central

    Cui, Jun; Lai, Yun Wei; Sartain, Caroline V.; Zuckerman, Rebecca M.; Wolfner, Mariana F.


    Egg activation, the transition of mature oocytes into developing embryos, is critical for the initiation of embryogenesis. This process is characterized by resumption of meiosis, changes in the egg’s coverings and by alterations in the transcriptome and proteome of the egg; all of these occur in the absence of new transcription. Activation of the egg is prompted by ionic changes in the cytoplasm (usually a rise in cytosolic calcium levels) that are triggered by fertilization in some animals and by mechanosensitive cues in others. The egg’s transcriptome is dramatically altered during the process, including by the removal of many maternal mRNAs that are not needed for embryogenesis. However, the mechanisms and regulators of this selective RNA degradation are not yet fully known. Forward genetic approaches in Drosophila have identified maternal-effect genes whose mutations prevent the transcriptome changes. One of these genes, prage (prg), was identified by Tadros et al. in a screen for mutants that fail to destabilize maternal transcripts. We identified the molecular nature of the prg gene through a combination of deficiency mapping, complementation analysis, and DNA sequencing of both extant prg mutant alleles. We find that prg encodes a ubiquitously expressed predicted exonuclease, consistent with its role in maternal mRNA destabilization during egg activation. PMID:27172196

  14. Impacts of enterotoxin gene cluster-encoded superantigens on local and systemic experimental Staphylococcus aureus infections.


    Nowrouzian, F L; Ali, A; Badiou, C; Dauwalder, O; Lina, G; Josefsson, E


    Staphylococcus aureus is both a component of the normal skin flora and an important pathogen. It expresses a range of recognized and putative virulence factors, such as enterotoxins with superantigenic properties. Several superantigen genes, i.e., seg, sei, selm, seln, and selo, are encoded by the enterotoxin gene cluster (egc), which is found in the majority of S. aureus isolates. Carriage of egc is associated with fitness of S. aureus in the gut microbiota, but it is not known if it contributes to pathogenicity. We constructed egc+ (functional for the seg, selm, and selo genes) and isogenic egc- S. aureus mutants, and investigated their virulence profiles in murine infection models. No effect of egc was seen in a local skin and soft tissue infection model, but in an invasive infection model, increased weight loss was observed after infection with the egc+ as compared to the egc- mutant. Mortality and arthritis were not affected by egc status. Our data suggest that egc has limited effects on the virulence of S. aureus. It may primarily function as a colonization factor increasing commensal fitness, although it might have some aggravating effects on the infection when the bacteria reach the blood. PMID:25864191

  15. Early auxin-induced genes encode short-lived nuclear proteins.

    PubMed Central

    Abel, S; Oeller, P W; Theologis, A


    The plant growth hormone indoleacetic acid (IAA) transcriptionally activates gene expression in plants. Some of the genes whose expression is induced by IAA encode a family of proteins in pea (PS-IAA4 and PS-IAA6) and Arabidopsis (IAA1 and IAA2) that contain putative nuclear localization signals that direct a beta-glucuronidase reporter protein into the nucleus. Pulse-chase and immunoprecipitation experiments have defined the t1/2 of the PS-IAA4 and PS-IAA6 proteins to be 8 and 6 min, respectively. Their most prominent feature is the presence of a beta alpha alpha motif similar to the beta-sheet DNA-binding domain found in prokaryotic repressors of the Arc family. Based on these data, we suggest that plant tissues express short-lived nuclear proteins as a primary response to IAA. We propose that these proteins act as activators or repressors of genes responsible for mediating the various auxin responses. Images Fig. 2 Fig. 3 Fig. 4 PMID:8278386

  16. Tomato Ve disease resistance genes encode cell surface-like receptors

    PubMed Central

    Kawchuk, Lawrence M.; Hachey, John; Lynch, Dermot R.; Kulcsar, Frank; van Rooijen, Gijs; Waterer, Doug R.; Robertson, Albert; Kokko, Eric; Byers, Robert; Howard, Ronald J.; Fischer, Rainer; Prüfer, Dirk


    In tomato, Ve is implicated in race-specific resistance to infection by Verticillium species causing crop disease. Characterization of the Ve locus involved positional cloning and isolation of two closely linked inverted genes. Expression of individual Ve genes in susceptible potato plants conferred resistance to an aggressive race 1 isolate of Verticillium albo-atrum. The deduced primary structure of Ve1 and Ve2 included a hydrophobic N-terminal signal peptide, leucine-rich repeats containing 28 or 35 potential glycosylation sites, a hydrophobic membrane-spanning domain, and a C-terminal domain with the mammalian E/DXXXLφ or YXXφ endocytosis signals (φ is an amino acid with a hydrophobic side chain). A leucine zipper-like sequence occurs in the hydrophobic N-terminal signal peptide of Ve1 and a Pro-Glu-Ser-Thr (PEST)-like sequence resides in the C-terminal domain of Ve2. These structures suggest that the Ve genes encode a class of cell-surface glycoproteins with receptor-mediated endocytosis-like signals and leucine zipper or PEST sequences. PMID:11331751

  17. Cloning and nucleotide sequence of the Salmonella typhimurium dcp gene encoding dipeptidyl carboxypeptidase.

    PubMed Central

    Hamilton, S; Miller, C G


    Plasmids carrying the Salmonella typhimurium dcp gene were isolated from a pBR328 library of Salmonella chromosomal DNA by screening for complementation of a peptide utilization defect conferred by a dcp mutation. Strains carrying these plasmids overproduced dipeptidyl carboxypeptidase approximately 50-fold. The nucleotide sequence of a 2.8-kb region of one of these plasmids contained an open reading frame coding for a protein of 77,269 Da, in agreement with the 80-kDa size for dipeptidyl carboxypeptidase (determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration). The N-terminal amino acid sequence of dipeptidyl carboxypeptidase purified from an overproducer strain agreed with that predicted by the nucleotide sequence. Northern (RNA) blot data indicated that dcp is not cotranscribed with other genes, and primer extension analysis showed the start of transcription to be 22 bases upstream of the translational start. The amino acid sequence of dcp was not similar to that of a mammalian dipeptidyl carboxypeptidase, angiotensin I-converting enzyme, but showed striking similarities to the amino acid sequence of another S. typhimurium peptidase encoded by the opdA (formerly optA) gene. Images PMID:1537804

  18. Molecular cloning and characterization of a Bombyx mori gene encoding the transcription factor Atonal.


    Hu, Ping; Feng, Fan; Xia, Hengchuan; Chen, Liang; Yao, Qin; Chen, Keping


    The atonal genes are an evolutionarily conserved group of genes encoding regulatory basic helix-loop-helix (bHLH) transcription factors. These transcription factors have a critical antioncogenic function in the retina, and are necessary for cell fate determination through the regulation of the cell signal pathway. In this study, the atonal gene was cloned from Bombyx mori, and the transcription factor was named BmAtonal. Sequence analysis showed that the BmAtonal protein shares extensive homology with other invertebrate Atonal proteins with the bHLH motif. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analyses revealed that BmAtonal was expressed in all developmental stages of B. mori and various larval tissues. The BmAtonal protein was expressed in Escherichia coli, and polyclonal antibodies were raised against the purified protein. By immunofluorescence, the BmAtonal protein was localized to both the nucleus and cytoplasm of BmN cells. After knocking out nuclear localization signals (NLS), the BmAtonal protein was only detected in the cytoplasm. In addition, using the B. mori nuclear polyhedrosis virus (BmNPV) baculovirus expression system, the recombinant BmAtonal protein was successfully expressed in the B. mori cell line BmN. This work lays the foundation for exploring the biological functions of the BmAtonal protein, such as identifying its potential binding partners and understanding the molecular control of the formation of sensory organs. PMID:24873037

  19. (Structure and expression of nuclear genes encoding rubisco activase): Progress report

    SciTech Connect

    Not Available


    Our first year's activities include: (1) completing a survey of the basic characteristics of activase gene expression in barley; and (2) isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Our goal was to determine whether activase mRNA and protein accumulation are coordinated with those of the rubisco subunits. We utilized the first leaves of barley as an experimental system for these studies because they can be used in two ways to study the expression of leaf genes: by following the naturally occurring differentiation of leaf cells, which occurs acropetally along the barley leaf; and by following the photomorphogenesis of etiolated barley seedlings. In the acropetal gradient of leaf cell differentiation, activase mRNA and mRNA and polypeptide expression is tightly coordinated with rubisco subunit mRNA and polypeptide expression. Although we have not measured their precise stoichiometry at each stage of leaf differentiation, activase protein is expressed at the level of about one polypeptide per rubisco holoenzyme in mature regions of the leaf. Coordination of the expression of activase mRNAs and polypeptides indicates that in the barley leaf gradient, activase gene expression is largely controlled at the level of transcription. However, translational controls may play a role in regulating activase expression on a short term basis.

  20. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    PubMed Central

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  1. Arabidopsis thaliana and Saccharomyces cerevisiae NHX1 genes encode amiloride sensitive electroneutral Na+/H+ exchangers.

    PubMed Central

    Darley, C P; van Wuytswinkel , O C; van der Woude , K; Mager, W H; de Boer , A H


    Sodium at high millimolar levels in the cytoplasm is toxic to plant and yeast cells. Sequestration of Na(+) ions into the vacuole is one mechanism to confer Na(+)-tolerance on these organisms. In the present study we provide direct evidence that the Arabidopsis thaliana At-NHX1 gene and the yeast NHX1 gene encode low-affinity electroneutral Na(+)/H(+) exchangers. We took advantage of the ability of heterologously expressed At-NHX1 to functionally complement the yeast nhx1-null mutant. Experiments on vacuolar vesicles isolated from yeast expressing At-NHX1 or NHX1 provided direct evidence for pH-gradient-energized Na(+) accumulation into the vacuole. A major difference between NHX1 and At-NHX1 is the presence of a cleavable N-terminal signal peptide (SP) in the former gene. Fusion of the SP to At-NHX1 resulted in an increase in the magnitude of Na(+)/H(+) exchange, indicating a role for the SP in protein targeting or regulation. Another distinguishing feature between the plant and yeast antiporters is their sensitivity to the diuretic compound amiloride. Whereas At-NHX1 was completely inhibited by amiloride, NHX1 activity was reduced by only 20-40%. These results show that yeast as a heterologous expression system provides a convenient model to analyse structural and regulatory features of plant Na(+)/H(+) antiporters. PMID:10998367

  2. Monoclonal antibody against a putative myristoylated membrane protein encoded by grouper iridovirus 59L gene.


    Chen, Zhi-Yu; Chiou, Pinwen Peter; Liou, Chian-Jiun; Lai, Yu-Shen


    Groupers (Epinephelus spp.) are economically important fish species worldwide, and ranaviruses are major viral pathogens causing heavy economic losses in grouper aquaculture. In this study, the 59L gene of grouper iridovirus (GIV-59L) was cloned and characterized. This gene is 1521 bp and encodes a protein of 506 amino acids with a predicted molecular mass of 53.9 kDa. Interestingly, GIV-59L and its homologs are found in all genera of the family Iridoviridae. A mouse monoclonal antibody specific for the C-terminal domain (amino acid positions 254-506) of the GIV-59L protein, GIV-59L(760-1518)-MAb-21, was produced and proved to be well suited for use in a number of GIV immunoassays. RT-PCR, Western blotting, and cycloheximide and cytosine arabinoside drug inhibition analyses indicated that GIV-59L is a viral late gene in GIV-infected grouper kidney cells. Immunofluorescence analysis revealed that GIV-59L protein mainly accumulates in the cytoplasm of infected cells and is finally packed into a whole virus particle. The GIV-59L(760-1518)-MAb-21 characterized in this study could have widespread application in GIV immunodiagnostics and other research on GIV. In addition, the results presented here offer important insights into the pathogenesis of GIV. PMID:25850399

  3. Identification and analysis of a Saccharomyces cerevisiae copper homeostasis gene encoding a homeodomain protein.

    PubMed Central

    Knight, S A; Tamai, K T; Kosman, D J; Thiele, D J


    Yeast metallothionein, encoded by the CUP1 gene, and its copper-dependent transcriptional activator ACE1 play a key role in mediating copper resistance in Saccharomyces cerevisiae. Using an ethyl methanesulfonate mutant of a yeast strain in which CUP1 and ACE1 were deleted, we isolated a gene, designated CUP9, which permits yeast cells to grow at high concentrations of environmental copper, most notably when lactate is the sole carbon source. Disruption of CUP9, which is located on chromosome XVI, caused a loss of copper resistance in strains which possessed CUP1 and ACE1, as well as in the cup1 ace1 deletion strain. Measurement of intracellular copper levels of the wild-type and cup9-1 mutant demonstrated that total intracellular copper concentrations were unaffected by CUP9. CUP9 mRNA levels were, however, down regulated by copper when yeast cells were grown with glucose but not with lactate or glycerol-ethanol as the sole carbon source. This down regulation was independent of the copper metalloregulatory transcription factor ACE1. The DNA sequence of CUP9 predicts an open reading frame of 306 amino acids in which a 55-amino-acid sequence showed 47% identity with the homeobox domain of the human proto-oncogene PBX1, suggesting that CUP9 is a DNA-binding protein which regulates the expression of important copper homeostatic genes. Images PMID:7969120

  4. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    PubMed Central

    Mousa, Walaa K.; Raizada, Manish N.


    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  5. Generation of MANAbodies specific to HLA-restricted epitopes encoded by somatically mutated genes

    PubMed Central

    Skora, Andrew D.; Douglass, Jacqueline; Hwang, Michael S.; Tam, Ada J.; Blosser, Richard L.; Gabelli, Sandra B.; Cao, Jianhong; Diaz, Luis A.; Papadopoulos, Nickolas; Kinzler, Kenneth W.; Vogelstein, Bert; Zhou, Shibin


    Mutant epitopes encoded by cancer genes are virtually always located in the interior of cells, making them invisible to conventional antibodies. We here describe an approach to identify single-chain variable fragments (scFvs) specific for mutant peptides presented on the cell surface by HLA molecules. We demonstrate that these scFvs can be successfully converted to full-length antibodies, termed MANAbodies, targeting “Mutation-Associated Neo-Antigens” bound to HLA. A phage display library representing a highly diverse array of single-chain variable fragment sequences was first designed and constructed. A competitive selection protocol was then used to identify clones specific for mutant peptides bound to predefined HLA types. In this way, we obtained two scFvs, one specific for a peptide encoded by a common KRAS mutant and the other by a common epidermal growth factor receptor (EGFR) mutant. The scFvs bound to these peptides only when the peptides were complexed with HLA-A2 (KRAS peptide) or HLA-A3 (EGFR peptide). We converted one scFv to a full-length antibody (MANAbody) and demonstrate that the MANAbody specifically reacts with mutant peptide–HLA complex even when the peptide differs by only one amino acid from the normal, WT form. PMID:26216968

  6. Cloning and sequence analysis of complete gene encoding an alkaline lipase from Penicillium cyclopium.


    Zhang, H M; Wu, M C; Guo, J; Li, J F


    The complete gene (PG37 lipI) encoding an alkaline lipase (PG37 LipI) was cloned from the genomic DNA of Penicillium cyclopium PG37. The cloned PG37 lipI is 2020 bp in length, consisting of 632 bp of the 5' flanking promoter region and 1388 bp of the downstream fragment that contains 6 exons and 5 short introns. The promoter region harbors putative TATA box, CAAT box and several transcription factor binding sites. The open reading frame (ORF) encodes a PG37 LipI of 285 amino acid residues, which was predicted to contain a 20-aa signal peptide, a 7-aa propeptide and a 258-aa mature peptide with a conserved motif Gly-X-Ser-X-Gly. However, PG37 LipI shows only 32%, 30%, 28% and 26% identity with lipases of Aspergillus parasiticus, Penicillium camembertii, Thermomyces lanuginosus and Rhizomucor miehei, respectively. It was predicted that the main secondary structures of PG37 LipI are alpha-helix and random coil. Three amino acid residues, Ser132-Asp188-His241, compose the enzymatic active center in the tertiary structure. PMID:22288192

  7. Modulation of Gene Expression by Polymer Nanocapsule Delivery of DNA Cassettes Encoding Small RNAs.


    Yan, Ming; Wen, Jing; Liang, Min; Lu, Yunfeng; Kamata, Masakazu; Chen, Irvin S Y


    Small RNAs, including siRNAs, gRNAs and miRNAs, modulate gene expression and serve as potential therapies for human diseases. Delivery to target cells remains the fundamental limitation for use of these RNAs in humans. To address this challenge, we have developed a nanocapsule delivery technology that encapsulates small DNA molecules encoding RNAs into a small (30 nm) polymer nanocapsule. For proof of concept, we transduced DNA expression cassettes for three small RNAs. In one application, the DNA cassette encodes an shRNA transcriptional unit that downregulates CCR5 and protects from HIV-1 infection. The DNA cassette nanocapsules were further engineered for timed release of the DNA cargo for prolonged knockdown of CCR5. Secondly, the nanocapsules provide an efficient means for delivery of gRNAs in the CRISPR/Cas9 system to mutate integrated HIV-1. Finally, delivery of microRNA-125b to mobilized human CD34+ cells enhances survival and expansion of the CD34+ cells in culture. PMID:26035832

  8. Administration of DNA Encoding the Interleukin-27 Gene Augments Antitumour Responses through Non-adaptive Immunity.


    Li, Q; Sato, A; Shimozato, O; Shingyoji, M; Tada, Y; Tatsumi, K; Shimada, H; Hiroshima, K; Tagawa, M


    DNA-mediated immunization of a tumour antigen is a possible immunotherapy for cancer, and interleukin (IL)-27 has diverse functions in adaptive immunity. In this study, we examined whether IL-27 DNA administration enhanced antitumour effects in mice vaccinated with DNA encoding a putative tumour antigen, β-galactosidase (β-gal). An intramuscular injection of cardiotoxin before DNA administration facilitated the exogenous gene expression. In mice received β-gal and IL-27 DNA, growth of β-gal-positive P815 tumours was retarded and survival of the mice was prolonged. Development of β-gal-positive Colon 26 tumours was suppressed by vaccination of β-gal DNA and further inhibited by additional IL-27 DNA administration or IL-12 family cytokines. Nevertheless, a population of β-gal-specific CD8(+) T cells did not increase, and production of anti-β-gal antibody was not enhanced by IL-27 DNA administration. Spleen cells from mice bearing IL-27-expressing Colon 26 tumours showed greater YAC-1-targeted cytotoxicity although CD3(-)/DX5(+) natural killer (NK) cell numbers remained unchanged. Recombinant IL-27 enhanced YAC-1-targeted cytotoxicity of IL-2-primed splenic NK cells and augmented a phosphorylation of signal transducer and activator of transcription 3 and an expression of perforin. These data collectively indicate that IL-27 DNA administration activates NK cells and augments vaccination effects of DNA encoding a tumour antigen through non-adaptive immune responses. PMID:26095954

  9. Inducible Gene Manipulations in Brain Serotonergic Neurons of Transgenic Rats

    PubMed Central

    Tews, Björn; Bartsch, Dusan


    The serotonergic (5-HT) system has been implicated in various physiological processes and neuropsychiatric disorders, but in many aspects its role in normal and pathologic brain function is still unclear. One reason for this might be the lack of appropriate animal models which can address the complexity of physiological and pathophysiological 5-HT functioning. In this respect, rats offer many advantages over mice as they have been the animal of choice for sophisticated neurophysiological and behavioral studies. However, only recently technologies for the targeted and tissue specific modification of rat genes - a prerequisite for a detailed study of the 5-HT system - have been successfully developed. Here, we describe a rat transgenic system for inducible gene manipulations in 5-HT neurons. We generated a Cre driver line consisting of a tamoxifen-inducible CreERT2 recombinase under the control of mouse Tph2 regulatory sequences. Tissue-specific serotonergic Cre recombinase expression was detected in four transgenic TPH2-CreERT2 rat founder lines. For functional analysis of Cre-mediated recombination, we used a rat Cre reporter line (CAG-loxP.EGFP), in which EGFP is expressed after Cre-mediated removal of a loxP-flanked lacZ STOP cassette. We show an in-depth characterisation of this rat Cre reporter line and demonstrate its applicability for monitoring Cre-mediated recombination in all major neuronal subpopulations of the rat brain. Upon tamoxifen induction, double transgenic TPH2-CreERT2/CAG-loxP.EGFP rats show selective and efficient EGFP expression in 5-HT neurons. Without tamoxifen administration, EGFP is only expressed in few 5-HT neurons which confirms minimal background recombination. This 5-HT neuron specific CreERT2 line allows Cre-mediated, inducible gene deletion or gene overexpression in transgenic rats which provides new opportunities to decipher the complex functions of the mammalian serotonergic system. PMID:22140568

  10. Genome-wide identification and evolutionary analysis of nucleotide-binding site-encoding resistance genes in Lotus japonicus (Fabaceae).


    Song, H; Wang, P F; Li, T T; Xia, H; Zhao, S Z; Hou, L; Zhao, C Z


    Nucleotide-binding site (NBS) disease resistance genes play a crucial role in plant defense responses against pathogens and insect pests. Many NBS-encoding genes have been detected in Lotus japonicus, an important forage crop in many parts of the world. However, most NBS genes identified so far in L. japonicus were only partial sequences. We identified 45 full-length NBS-encoding genes in the L. japonicus genome, and analyzed gene duplications, motifs, and the molecular phylogeny to further understand the NBS gene family. We found that gene duplication events rarely occur in L. japonicus NBS-encoding (LjNBS) genes. In addition, LjNBS genes were subjected to selection pressure, and codon usage bias was evident. We tested for purifying selection (specifically in the CC-NBS-LRR and TIR-NBS-LRR groups), and found strong purifying selection in the TIR-domain-containing sequences, indicating that the CC-NBS-LRR group is more likely to undergo expansion than the TIR-NBS-LRR group. Moreover, our results showed that both selection and mutation contributed to LjNBS codon usage bias, but mutational bias was the major influence on codon usage. PMID:26662396

  11. Cloning, expression and characterization of a new agarase-encoding gene from marine Pseudoalteromonas sp.


    Lu, Xinzhi; Chu, Yan; Wu, Qianqian; Gu, Yuchao; Han, Feng; Yu, Wengong


    The beta-agarase gene agaA, cloned from a marine bacterium, Pseudoalteromonas sp. CY24, consists of 1,359 nucleotides encoding 453 amino acids in a sequence corresponding to a catalytic domain of glycosyl hydrolase family 16 (GH16) and a carbohydrate-binding module type 13 (CBM13). The recombinant enzyme is an endo-type agarase that hydrolyzes beta-1,4-linkages of agarose, yielding neoagarotetraose and neoagarohexaose as the predominant products. In two cleavage patterns, AgaA digested the smallest substrate, neoagarooctaose, into neoagarobiose, neoagarotetraose and neoagarohexaose. Site directed mutation was performed to investigate the differences between AgaA and AgaD of Vibrio sp. PO-303, identifying residues V(109)VTS(112) as playing a key role in the enzyme reaction. PMID:19504047

  12. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.


    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D


    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  13. Neuronostatin Encoded by the Somatostatin Gene Regulates Neuronal, Cardiovascular, and Metabolic Functions*S⃞

    PubMed Central

    Samson, Willis K.; Zhang, Jian V.; Avsian-Kretchmer, Orna; Cui, Kai; Yosten, Gina L. C.; Klein, Cindy; Lyu, Rong-Ming; Wang, Yong Xiong; Chen, Xiang Qun; Yang, Jun; Price, Christopher J.; Hoyda, Ted D.; Ferguson, Alastair V.; Yuan, Xiao-bin; Chang, Jaw Kang; Hsueh, Aaron J. W.


    Somatostatin is important in the regulation of diverse neuroendocrine functions. Based on bioinformatic analyses of evolutionarily conserved sequences, we predicted another peptide hormone in pro-somatostatin and named it neuronostatin. Immuno-affinity purification allowed the sequencing of an amidated neuronostatin peptide of 13 residues from porcine tissues. In vivo treatment with neuronostatin induced c-Fos expression in gastrointestinal tissues, anterior pituitary, cerebellum, and hippocampus. In vitro treatment with neuronostatin promoted the migration of cerebellar granule cells and elicited direct depolarizing actions on paraventricular neurons in hypothalamic slices. In a gastric tumor cell line, neuronostatin induced c-Fos expression, stimulated SRE reporter activity, and promoted cell proliferation. Furthermore, intracerebroventricular treatment with neuronostatin increased blood pressure but suppressed food intake and water drinking. Our findings demonstrate diverse neuronal, neuroendocrine, and cardiovascular actions of a somatostatin gene-encoded hormone and provide the basis to investigate the physiological roles of this endogenously produced brain/gut peptide. PMID:18753129

  14. Phenotypes associated with inherited and developmental somatic mutations in genes encoding mTOR pathway components.


    Saxena, Anurag; Sampson, Julian R


    Mutations affecting the genes that encode upstream components in the mammalian (or mechanistic) target of rapamycin signalling pathway are associated with a group of rare inherited and developmental disorders that show overlapping clinical features. These include predisposition to a variety of benign or malignant tumours, localized overgrowth, developmental abnormalities of the brain, neurodevelopmental disorders and epilepsy. Many of these features have been linked to hyperactivation of signalling via mammalian target of rapamycin complex 1, suggesting that inhibitors of this complex such as rapamycin and its derivatives may offer new opportunities for therapy. In this review we describe this group of inherited and developmental disorders and discuss recent progress in their treatment via mTORC1 inhibition. PMID:25263008

  15. sar1, a gene from Schizosaccharomyces pombe encoding a protein that regulates ras1.

    PubMed Central

    Wang, Y; Boguski, M; Riggs, M; Rodgers, L; Wigler, M


    Proper ras1 function is required for normal sexual function in the yeast Schizosaccharomyces pombe. We have found a gene in S. pombe, sar1, that encodes a product capable of regulating ras1 function. sar1 is a member of an expanding family of RAS GTPase-activating proteins (GAPs) that includes mammalian GAP, the yeast Saccharomyces cerevisiae IRA proteins, and the product of the human neurofibromatosis locus, NF1 sar1, like these other proteins, can complement the loss of IRA function in S. cerevisiae. Computer analysis shows that the highest degree of sequence conservation is restricted to a very small number of diagnostic residues represented by the motif Phe-Leu-Arg-X-X-X-Pro-Ala-X-X-X-Pro. We find no evidence that sar1 is required for the effector function of ras1. Images PMID:1883874

  16. Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit

    NASA Astrophysics Data System (ADS)

    Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.


    The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.

  17. Molecular characterization of a gene encoding a photolyase from Streptomyces griseus.

    PubMed Central

    Kobayashi, T; Takao, M; Oikawa, A; Yasui, A


    By using a synthetic DNA probe derived from an amino acid sequence in the most conserved region of three known photolyases (Escherichia coli, Anacystis nidulans and Saccharomyces cerevisiae), we isolated a DNA fragment containing two long open reading frames (ORFs) from a genomic DNA library of Streptomyces griseus. One ORF encodes a polypeptide of 455 amino acids (Mr 50594), which exhibits substantial similarities with the other three photolyases. Photoreactivation-repair deficient E. coli cells could be converted into photoreactivatable ones by introduction of plasmids harboring this ORF, indicating that this is the photolyase gene of S. griseus. The deduced aa sequence of Streptomyces photolyase was most similar to that of E. coli. The putative DNA binding site as well as cofactor binding regions were proposed. Images PMID:2501760

  18. A FUSCA gene of Arabidopsis encodes a novel protein essential for plant development.

    PubMed Central

    Castle, L A; Meinke, D W


    Arabidopsis fusca mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons. We describe six recessive fusca mutants isolated from Agrobacterium-transformed Arabidopsis families. These mutants first become defective during embryogenesis and exhibit limited seedling development. Double mutant constructs revealed that developmental defects were not simply a consequence of anthocyanin accumulation. fusca seedlings showed altered responses to several environmental and endogenous factors. Allelism tests established that three fusca loci are represented by mutants previously described as defective in light-regulated responses. To study the molecular basis of the fusca phenotype, we cloned the FUS6 gene. FUS6 encodes a novel protein that is hydrophilic, alpha-helical, and contains potential protein kinase C phosphorylation sites. The FUSCA proteins appear to act in a network of signal transduction pathways critical for plant development. PMID:8130643

  19. Isolation and characterization of all-trans-retinoic acid-responsive genes in the rat testis.


    Gaemers, I C; Van Pelt, A M; Themmen, A P; De Rooij, D G


    By way of differential screening of testis cDNA libraries from vitamin A-deficient (VAD) rats before and after administration of all-trans retinoic acid (ATRA), genes, the transcription of which was influenced by ATRA, were isolated. Most clones with an increased transcription encoded different subunits of the same mitochondrial protein complex, cytochrome c oxidase (COX). The mRNA expression of COX increased by a factor 3.9 +/- 1.5 (mean +/- SD, n = 4). This increased expression seems to reflect an increased energy demand in the ATRA-supplemented VAD testis. Also, one gene was isolated, the transcription of which was reduced to about 70% by ATRA. This gene, sulfated glycoprotein 2 (Sgp-2), is a major secretion product of Sertoli cells, the function of which is still unknown. The effect of ATRA on Sgp-2 expression may be direct, since the promoter of Sgp-2 contains a putative ATRA-responsive element (RARE). PMID:9547504

  20. Structure and expression of a pea nuclear gene encoding a chlorophyll a/b-binding polypeptide

    SciTech Connect

    Cashmore, A.R.


    A nuclear gene AB80 has been isolated from a phage lambda Charon 4 library of pea DNA. The sequence of the gene has been determined and it has been shown to contain an interrupted reading frame of 269 amino acids, corresponding to a precursor to a constituent polypeptide of the light-harvesting chlorophyll a/b-protein complex. Primer extension and S1 nuclease studies defined a cap site for AB80. The first methionine codon 3' from this site is 69 nucleotides away and is the initiating codon of the open reading frame. A TATA sequence occurs 31 nucleotides 5' from the cap site. A second TATA sequence is found 7 nucleotides on the 5' side of the initiating methionine codon and the sequences surrounding this TATA sequence are strikingly similar to those surrounding the first TATA sequence. The mature polypeptide encoded by AB80 differs by 5 amino acids from the polypeptide corresponding to a previously characterized cDNA sequence pAB96. This result is indicative of heterogeneity within the constituent polypeptides of the light-harvesting chlorophyll a/b-protein complex. The sequence Arg-Lys-Ser-Ala-Thr-Thr-Lys-Lys occurs at, or near, the NH/sub 2/-terminus of the mature polypeptide encoded by AB80. This basic peptide is of interest because of its apparent involvement in changes in excitation-energy distribution in chloroplast membranes. Some general similarities, but no extensive sequence homology, is found on comparing the transit sequence for the precursor to the chlorophyll a/b-binding polypeptide with the transit sequences previously determined for the precursors to the small subunit of ribulose-1,5-bisphosphate carboxylase. 40 references, 3 figures.

  1. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.


    Rady, Hamada F; Dai, Guixiang; Huang, Weitao; Shellito, Judd E; Ramsay, Alistair J


    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route. PMID:26844553

  2. Gene encoding prolactin in cinnamon clownfish Amphiprion melanopus and its expression upon acclimation to low salinities

    PubMed Central


    Background Prolactin (PRL) is a key hormone for osmoregulation in fish. Levels of PRL in the pituitary gland and plasma ion composition of clownfish seem to change to regulate their hydromineral balance during adaptation to waters of different salinities. In order to understand osmoregulatory mechanism and its association with growth performance and PRL in fish, the gene encoding PRL and its expression level in cinnamon clownfish Amphiprion melanopus upon acclimation to low salinity was analyzed. Results The PRL gene of A. melanopus encoded a protein of 212 amino acid residues comprised of a putative signal peptide of 24 amino acids and a mature protein of 188 amino acids. Analysis of growth performance under different salinities of 34, 25, 15, and 10 ppt indicated that cinnamon clownfish could survive under salinities as low as 10 ppt. A higher rate of growth was observed at the lower salinities as compared to that of 34 ppt. Upon shifting the salinity of the surrounding water from 34 ppt to 15 ppt, the level of the PRL transcripts gradually increased to reach the peak level until 24 h of acclimation at 15 ppt, but decreased back as adaptation continued to 144 h. In contrast, levels of plasma Na+, Cl-, and osmolality decreased at the initial stage (4–8 h) of acclimation at 15 pt but increased back as adaptation continued till 144 h. Conclusion Cinnamon clownfish could survive under salinities as low as 10 ppt. Upon shifting the salinity of the surrounding water from 34 ppt to 15 ppt, the level of the PRL transcripts gradually increased during the initial stage of acclimation but decreased back to the normal level as adaptation continued. An opposite pattern of changes - decrease at the beginning followed by an increase - in the levels of plasma Na+, Cl-, and osmolality was found upon acclimation to low salinity. The results suggest an involvement of PRL in the processes of osmoregulation and homeostasis in A. melanopus. PMID:23276106

  3. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant

    PubMed Central

    Rady, Hamada F.; Dai, Guixiang; Huang, Weitao; Shellito, Judd E.; Ramsay, Alistair J.


    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route. PMID:26844553

  4. Preclinical safety evaluation of recombinant adeno-associated virus 2 vector encoding human tumor necrosis factor receptor-immunoglobulin Fc fusion gene.


    Zhou, Xiaobing; Shen, Lianzhong; Liu, Li; Wang, Chao; Qi, Weihong; Zhao, Aizhi; Wu, Xiaobing; Li, Bo


    Recombinant adeno-associated virus (rAAV) 2 vector gene therapy offers promise for the healing of Rheumatoid arthritis. To support the clinical development of the candidate gene therapeutic product in China, a comprehensive preclinical safety assessment of rAAV2 encoding human TNF receptor-immunoglobulin Fc fusion gene (rAAV2/human TNFR:Fc), were conducted in 3 species of experimental animals. No abnormal findings were observed in mice following single intravenous administration with test article. Compared with the control group, no differences in mean body weight, food consumption in rats and monkeys following the repeated intraarticular administration with rAAV2/human TNFR:Fc. There were also no significant adverse effects due to treatment noted by clinical chemistry, hematology and pathology assessments. After intraarticular administration with rAAV2/human TNFR:Fc, the vector DNA initially distributed to spleen, lymph nodes, and joint synovium. The vector DNA cleared rapidly as it could be detected mainly at the site of injection by 91 d post-administration (182 d for monkey). Taken together, localized delivery of rAAV2/human TNFR:Fc showed no significant toxicity in mice, rats, and monkeys, which support the planned clinical evaluation of this product. PMID:26837862

  5. Structure of the gene encoding the 14.5 kDa subunit of human RNA polymerase II.

    PubMed Central

    Acker, J; Wintzerith, M; Vigneron, M; Kedinger, C


    The structure of the gene encoding the 14.5 kDa subunit of the human RNA polymerase II (or B) has been elucidated. The gene consists of six exons, ranging from 52 to over 101 bp, interspaced with five introns ranging from 84 to 246 bp. It is transcribed into three major RNA species, present at low abundance in exponentially growing HeLa cells. The corresponding messenger RNAs contain the same open reading frame encoding a 125 amino acid residue protein, with a calculated molecular weight of 14,523 Da. This protein (named hRPB14.5) shares strong homologies with the homologous polymerase subunits encoded by the Drosophila (RpII15) and yeast (RPB9) genes. Cysteines characteristic of two zinc fingers are conserved in all three corresponding sequences and, like the yeast protein, the hRPB14.5 subunit exhibits zinc-binding activity. Images PMID:8265347

  6. The omp2 gene locus of Brucella abortus encodes two homologous outer membrane proteins with properties characteristic of bacterial porins.

    PubMed Central

    Marquis, H; Ficht, T A


    In Brucella abortus, a gene encoding a major cell envelope protein, omp2, is duplicated within a short segment of the large chromosomal DNA. Although both genes contain open reading frames, encoding proteins of high identity, expression from only one, omp2b, has been detected in laboratory-grown B. abortus. In the present study, we wished to determine whether omp2b encodes the previously studied Brucella porin and to characterize the omp2a gene product. Experiments were performed with Escherichia coli transformants expressing either omp2a or omp2b. Our results indicated that both gene products localized to the outer membrane of E. coli. Initial rates of transport of [14C]maltose and growth rates in the presence of maltodextrins of defined size indicated an increased hydrophilic permeability of transformants expressing omp2a. These cells were also shown to grow on maltotetraose, a molecule with a molecular mass of 667 Da. Activity consistent with the formation of pores could not be demonstrated in transformants expressing omp2b. However, Omp2b formed oligomers resistant to heat denaturation up to 70 degrees C in sodium dodecyl sulfate buffer, a property characteristic of bacterial porins. Overall, these results suggest that the omp2a gene product has pore-forming activity and that the omp2b gene encodes the previously characterized Brucella porin. Images PMID:7689540

  7. Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.


    Adewoye, L O; Worobec, E A


    The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins. PMID:10940570

  8. Isolation of the cDNA and chromosomal localization of the gene (TAX1) encoding the human axonal glycoprotein TAG-1

    SciTech Connect

    Tsiotra, P.C.; Karagogeos, D.; Theodorakis, K.; Michaelidis, T.M.; Papamatheakis, J. ); Modi, W.S. ); Furley, A.J.; Jessell, T.M. )


    The transient axonal glycoprotein (TAG-1) is a cell adhesion molecule that promotes neurite outgrowth and belongs to the immunoglobulin superfamily. The authors have isolated cDNAs encoding TAX1, the human homologue of TAG-1. Human TAX1 shows a high degree of homology to rat TAX1 and less to its chick counterpart, axonin-1, with 91 and 75% identity at the amino acid level, respectively. The numbers of immunoglobulin (IgC2) domains and fibronectin repeats present in TAG-1 are conserved among the three species. The highest degree of conservation occurs in the second IgC2 domain (98% with the rat and 82% with the chick). The human homologue also contains a putative N-terminal signal sequence and a C-terminal hydrophobic sequence, suggestive of linkage to the cell membrane via phosphatidylinositol. In addition, the two mammalian TAG-1 proteins share the RDG tripeptide, a motif known to mediate recognition of fibronection by integrins. In situ hybridization to human metaphase chromosomes maps the TAX1 gene encoding human TAG-1 to a single location on chromosome 1q32. 35 refs., 3 figs.


    EPA Science Inventory

    Nucleic acids extracted from microbial biomass were hybridized with probes representing four mer operons, to detect genes encoding adaptation to Hg2+. An enrichment in sequences similar to the mer genes of transposon 501 occurred during adaptation in a freshwater community. In an...

  10. The motilin gene evolved a new function in kangaroo rats and kangaroo mice (Dipodomyinae).


    He, Jing; Zhou, Taicheng; Irwin, David M; Shen, Yongyi; Zhang, Yaping


    The motilin receptor gene was lost in the ancestral lineage of rodents. Subsequently, the gene encoding its ligand, motilin, has experienced different evolutionary fates. Previous genomic analyses had shown that the motilin gene (MLN) became a pseudogene independently in the lineages leading to the guinea pig and the common ancestor of the mouse and rat, yet an intact, and thus potentially functional, open reading frame for the MLN was preserved in the Dipodomys ordii genome. As only a single MLN haplotype from D. ordii was available, and this sequence is from a low coverage draft genome, it is possible that the intact MLN found in the draft kangaroo rat genome is an artifact, or represents an intermediate in the process of becoming a pseudogene. In order to establish whether an intact MLN is retained in kangaroo rats despite the loss of its specific receptor, and to investigate the evolutionary mechanisms underlying the retention of this gene sequence, we isolated MLN sequences from species that represent the diversity of the Dipodomyinae [the monophyletic Dipodomyinae subfamily consists of two genera: Dipodomys (kangaroo rats) and Microdipodops (kangaroo mice)]. The results demonstrate that the MLN sequence is well conserved in Dipodomyinae, and it codes for a predicted motilin peptide sequence possessing a conserved N-terminal pharmacophore and the potential to be processed and secreted as a hormone. The observations that the MLN evolved as a functional gene during the radiation of the Dipodomyinae, species that have lost their original motilin receptor, suggest that the MLN has undergone a lineage-specific physiological adaptation to a new function. PMID:23138633

  11. Salmonella induces prominent gene expression in the rat colon

    PubMed Central

    Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg MJ


    Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression

  12. Regulation of the acuF Gene, Encoding Phosphoenolpyruvate Carboxykinase in the Filamentous Fungus Aspergillus nidulans

    PubMed Central

    Hynes, Michael J.; Draht, Oliver W.; Davis, Meryl A.


    Phosphoenolpyruvate carboxykinase (PEPCK) is a key enzyme required for gluconeogenesis when microorganisms grow on carbon sources metabolized via the tricarboxylic acid (TCA) cycle. Aspergillus nidulans acuF mutants isolated by their inability to use acetate as a carbon source specifically lack PEPCK. The acuF gene has been cloned and shown to encode a protein with high similarity to PEPCK from bacteria, plants, and fungi. The regulation of acuF expression has been studied by Northern blotting and by the construction of lacZ fusion reporters. Induction by acetate is abolished in mutants unable to metabolize acetate via the TCA cycle, and induction by amino acids metabolized via 2-oxoglutarate is lost in mutants unable to form 2-oxoglutarate. Induction by acetate and proline is not additive, consistent with a single mechanism of induction. Malate and succinate result in induction, and it is proposed that PEPCK is controlled by a novel mechanism of induction by a TCA cycle intermediate or derivative, thereby allowing gluconeogenesis to occur during growth on any carbon source metabolized via the TCA cycle. It has been shown that the facB gene, which mediates acetate induction of enzymes specifically required for acetate utilization, is not directly involved in PEPCK induction. This is in contrast to Saccharomyces cerevisiae, where Cat8p and Sip4p, homologs of FacB, regulate PEPCK as well as the expression of other genes necessary for growth on nonfermentable carbon sources in response to the carbon source present. This difference in the control of gluconeogenesis reflects the ability of A. nidulans and other filamentous fungi to use a wide variety of carbon sources in comparison with S. cerevisiae. The acuF gene was also found to be subject to activation by the CCAAT binding protein AnCF, a protein homologous to the S. cerevisiae Hap complex and the mammalian NFY complex. PMID:11741859

  13. Inactivating mutations in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome

    PubMed Central

    Nichols, Kim E.; Harkin, D. Paul; Levitz, Seth; Krainer, Michael; Kolquist, Kathryn Ann; Genovese, Cameo; Bernard, Amy; Ferguson, Martin; Zuo, Lin; Snyder, Eric; Buckler, Alan J.; Wise, Carol; Ashley, Jennifer; Lovett, Michael; Valentine, Marcus B.; Look, A. Thomas; Gerald, William; Housman, David E.; Haber, Daniel A.


    X-linked lymphoproliferative syndrome (XLP) is an inherited immunodeficiency characterized by increased susceptibility to Epstein–Barr virus (EBV). In affected males, primary EBV infection leads to the uncontrolled proliferation of virus-containing B cells and reactive cytotoxic T cells, often culminating in the development of high-grade lymphoma. The XLP gene has been mapped to chromosome band Xq25 through linkage analysis and the discovery of patients harboring large constitutional genomic deletions. We describe here the presence of small deletions and intragenic mutations that specifically disrupt a gene named DSHP in 6 of 10 unrelated patients with XLP. This gene encodes a predicted protein of 128 amino acids composing a single SH2 domain with extensive homology to the SH2 domain of SHIP, an inositol polyphosphate 5-phosphatase that functions as a negative regulator of lymphocyte activation. DSHP is expressed in transformed T cell lines and is induced following in vitro activation of peripheral blood T lymphocytes. Expression of DSHP is restricted in vivo to lymphoid tissues, and RNA in situ hybridization demonstrates DSHP expression in activated T and B cell regions of reactive lymph nodes and in both T and B cell neoplasms. These observations confirm the identity of DSHP as the gene responsible for XLP, and suggest a role in the regulation of lymphocyte activation and proliferation. Induction of DSHP may sustain the immune response by interfering with SHIP-mediated inhibition of lymphocyte activation, while its inactivation in XLP patients results in a selective immunodeficiency to EBV. PMID:9811875

  14. The Agrobacterium rhizogenes GALLS Gene Encodes Two Secreted Proteins Required for Genetic Transformation of Plants▿

    PubMed Central

    Hodges, Larry D.; Lee, Lan-Ying; McNett, Henry; Gelvin, Stanton B.; Ream, Walt


    Agrobacterium tumefaciens and Agrobacterium rhizogenes are related pathogens that cause crown gall and hairy root diseases, which result from integration and expression of bacterial genes in the plant genome. Single-stranded DNA (T strands) and virulence proteins are translocated into plant cells by a type IV secretion system. VirD2 nicks a specific DNA sequence, attaches to the 5′ end, and pilots the DNA into plant cells. A. tumefaciens translocates single-stranded DNA-binding protein VirE2 into plant cells where it likely binds T strands and may aid in targeting them into the nucleus. Although some A. rhizogenes strains lack VirE2, they transfer T strands efficiently due to the GALLS gene, which complements an A. tumefaciens virE2 mutant for tumor formation. Unlike VirE2, full-length GALLS (GALLS-FL) contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. GALLS-FL and VirE2 contain nuclear localization signals (NLS) and secretion signals. Mutations in any of these domains abolish the ability of the GALLS gene to substitute for virE2. Here, we show that the GALLS gene encodes two proteins from one open reading frame: GALLS-FL and a protein comprised of the C-terminal domain, which initiates at an internal in-frame start codon. On some hosts, both GALLS proteins were required to substitute for VirE2. GALLS-FL tagged with yellow fluorescent protein localized to the nucleus of tobacco cells in an NLS-dependent manner. In plant cells, the GALLS proteins interacted with themselves, VirD2, and each other. VirD2 interacted with GALLS-FL and localized inside the nucleus, where its predicted helicase activity may pull T strands into the nucleus. PMID:18952790

  15. Diversification and Molecular Evolution of ATOH8, a Gene Encoding a bHLH Transcription Factor

    PubMed Central

    Balakrishnan-Renuka, Ajeesh; Leese, Florian; Schempp, Werner; Schaller, Felix; Hoffmann, Michael M.; Morosan-Puopolo, Gabriela; Yusuf, Faisal; Bisschoff, Izak Johannes; Chankiewitz, Verena; Xue, Jinglun; Chen, Jingzhong; Ying, Kang; Brand-Saberi, Beate


    ATOH8 is a bHLH domain transcription factor implicated in the development of the nervous system, kidney, pancreas, retina and muscle. In the present study, we collected sequence of ATOH8 orthologues from 18 vertebrate species and 24 invertebrate species. The reconstruction of ATOH8 phylogeny and sequence analysis showed that this gene underwent notable divergences during evolution. For those vertebrate species investigated, we analyzed the gene structure and regulatory elements of ATOH8. We found that the bHLH domain of vertebrate ATOH8 was highly conserved. Mammals retained some specific amino acids in contrast to the non-mammalian orthologues. Mammals also developed another potential isoform, verified by a human expressed sequence tag (EST). Comparative genomic analyses of the regulatory elements revealed a replacement of the ancestral TATA box by CpG-islands in the eutherian mammals and an evolutionary tendency for TATA box reduction in vertebrates in general. We furthermore identified the region of the effective promoter of human ATOH8 which could drive the expression of EGFP reporter in the chicken embryo. In the opossum, both the coding region and regulatory elements of ATOH8 have some special features, such as the unique extended C-terminus encoded by the third exon and absence of both CpG islands and TATA elements in the regulatory region. Our gene mapping data showed that in human, ATOH8 was hosted in one chromosome which is a fusion product of two orthologous chromosomes in non-human primates. This unique chromosomal environment of human ATOH8 probably subjects its expression to the regulation at chromosomal level. We deduce that the great interspecific differences found in both ATOH8 gene sequence and its regulatory elements might be significant for the fine regulation of its spatiotemporal expression and roles of ATOH8, thus orchestrating its function in different tissues and organisms. PMID:21857980

  16. A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.


    Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T


    The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. PMID:26297778

  17. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.


    Vanlerberghe, G. C.; McLntosh, L.


    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  18. Discovery of Nuclear-Encoded Genes for the Neurotoxin Saxitoxin in Dinoflagellates

    PubMed Central

    Stüken, Anke; Orr, Russell J. S.; Kellmann, Ralf; Murray, Shauna A.; Neilan, Brett A.; Jakobsen, Kjetill S.


    Saxitoxin is a potent neurotoxin that occurs in aquatic environments worldwide. Ingestion of vector species can lead to paralytic shellfish poisoning, a severe human illness that may lead to paralysis and death. In freshwaters, the toxin is produced by prokaryotic cyanobacteria; in marine waters, it is associated with eukaryotic dinoflagellates. However, several studies suggest that saxitoxin is not produced by dinoflagellates themselves, but by co-cultured bacteria. Here, we show that genes required for saxitoxin synthesis are encoded in the nuclear genomes of dinoflagellates. We sequenced >1.2×106 mRNA transcripts from the two saxitoxin-producing dinoflagellate strains Alexandrium fundyense CCMP1719 and A. minutum CCMP113 using high-throughput sequencing technology. In addition, we used in silico transcriptome analyses, RACE, qPCR and conventional PCR coupled with Sanger sequencing. These approaches successfully identified genes required for saxitoxin-synthesis in the two transcriptomes. We focused on sxtA, the unique starting gene of saxitoxin synthesis, and show that the dinoflagellate transcripts of sxtA have the same domain structure as the cyanobacterial sxtA genes. But, in contrast to the bacterial homologs, the dinoflagellate transcripts are monocistronic, have a higher GC content, occur in multiple copies, contain typical dinoflagellate spliced-leader sequences and eukaryotic polyA-tails. Further, we investigated 28 saxitoxin-producing and non-producing dinoflagellate strains from six different genera for the presence of genomic sxtA homologs. Our results show very good agreement between the presence of sxtA and saxitoxin-synthesis, except in three strains of A. tamarense, for which we amplified sxtA, but did not detect the toxin. Our work opens for possibilities to develop molecular tools to detect saxitoxin-producing dinoflagellates in the environment. PMID:21625593

  19. Expression of the Genes Encoding the Trk and Kdp Potassium Transport Systems of Mycobacterium tuberculosis during Growth In Vitro

    PubMed Central

    Cholo, Moloko C.; van Rensburg, Elizabeth J.; Osman, Ayman G.; Anderson, Ronald


    Two potassium (K+)-uptake systems, Trk and Kdp, are operative in Mycobacterium tuberculosis (Mtb), but the environmental factors triggering their expression have not been determined. The current study has evaluated the expression of these genes in the Mtb wild-type and a trk-gene knockout strain at various stages of logarithmic growth in relation to extracellular K+ concentrations and pH. In both strains, mRNA levels of the K+-uptake encoding genes were relatively low compared to those of the housekeeping gene, sigA, at the early- and mid-log phases, increasing during late-log. Increased gene expression coincided with decreased K+ uptake in the context of a drop in extracellular pH and sustained high extracellular K+ concentrations. In an additional series of experiments, the pH of the growth medium was manipulated by the addition of 1N HCl/NaOH. Decreasing the pH resulted in reductions in both membrane potential and K+ uptake in the setting of significant induction of genes encoding both K+ transporters. These observations are consistent with induction of the genes encoding the active K+ transporters of Mtb as a strategy to compensate for loss of membrane potential-driven uptake of K+ at low extracellular pH. Induction of these genes may promote survival in the acidic environments of the intracellular vacuole and granuloma. PMID:26351637

  20. PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases

    PubMed Central

    Shanmugam, Yuvaraj; Kurkure, Nitin Vasantrao; Chousalkar, Kapil Kamalakarrao; Barbuddhe, Sukhadeo Baliram


    The present study was carried out to genotypically characterize Staphylococcus aureus (S. aureus) isolated from bovine mastitis cases. A total of 37 strains of S. aureus were isolated during processing of 552 milk samples from 140 cows. The S. aureus strains were characterized phenotypically, and were further characterized genotypically by polymerase chain reaction using oligonucleotide primers that amplified genes encoding coagulase (coa), clumping factor (clfA), thermonuclease (nuc), enterotoxin A (entA), and the gene segments encoding the immunoglobulin G binding region and the X region of protein A gene spa. All of the isolates yielded an amplicon with a size of approximately 1,042 bp of the clfA gene. The amplification of the polymorphic spa gene segment encoding the immunoglobulin G binding region was observed in 34 isolates and X-region binding was detected in 26 isolates. Amplification of the coa gene yielded three different products in 20, 10, and 7 isolates. The amplification of the thermonuclease gene, nuc, was observed in 36 out of 37 isolates. All of the samples were negative for the entA gene. The phenotypic and genotypic findings of the present strategies might provide an understanding of the distribution of the prevalent S. aureus clones among bovine mastitis isolates, and might aid in the development of steps to control S. aureus infections in dairy herds. PMID:17519568

  1. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    PubMed Central

    Wong, Lee-Jun C; Dai, Pu; Lu, Jyh-Feng; Lou, Mary Ann; Clarke, Robert; Nazarov, Viktor


    Background The poly Q polymorphism in AIB1 (amplified in breast cancer) gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds) of AIB1 gene were found in 2 out of 9 (22%) ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330). The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1) and resistance to 4-hydroxy tamoxifen (4-OH TAM) (LCC2 and R27), ICI 182,780 (LCC9) or 4-OH TAM, KEO and LY 117018 (LY-2), AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (<20%) extra poly Q encoding sequence patterns that were derived from the original allele, presumably due to somatic instability. Although all MCF-7 cells and their variants had the same predominant poly Q encoding sequence pattern of (CAG)3CAA(CAG)9(CAACAG)3(CAACAGCAG)2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is

  2. Structure and nucleotide sequence of the rat intestinal vitamin D-dependent calcium binding protein gene.

    PubMed Central

    Krisinger, J; Darwish, H; Maeda, N; DeLuca, H F


    The vitamin D-dependent intestinal calcium binding protein (ICaBP, 9 kDa) is under transcriptional regulation by 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3], the hormonal active form of the vitamin. To study the mechanism of gene regulation by 1,25-(OH)2D3, we isolated the rat ICaBP gene by using a cDNA probe. Its nucleotide sequence revealed 3 exons separated by 2 introns within approximately 3 kilobases. The first exon represents only noncoding sequences, while the second and third encode the two calcium binding domains of the protein. The gene contains a 15-base-pair imperfect palindrome in the first intron that shows high homology to the estrogen-responsive element. This sequence may represent the vitamin D-responsive element involved in the regulation of the ICaBP gene. The second intron shows an 84-base-pair-long simple nucleotide repeat that implicates Z-DNA formation. Genomic Southern analysis shows that the rat gene is represented as a single copy. Images PMID:3194402

  3. deaD, a new Escherichia coli gene encoding a presumed ATP-dependent RNA helicase, can suppress a mutation in rpsB, the gene encoding ribosomal protein S2.

    PubMed Central

    Toone, W M; Rudd, K E; Friesen, J D


    We have cloned and sequenced a new gene from Escherichia coli which encodes a 64-kDa protein. The inferred amino acid sequence of the protein shows remarkable similarity to eIF4A, a murine translation initiation factor that has an ATP-dependent RNA helicase activity and is a founding member of the D-E-A-D family of proteins (characterized by a conserved Asp-Glu-Ala-Asp motif). Our new gene, called deaD, was cloned as a gene dosage-dependent suppressor of temperature-sensitive mutations in rpsB, the gene encoding ribosomal protein S2. We suggest that the DeaD protein plays a hitherto unknown role in translation in E. coli. Images PMID:2045359

  4. Selection of reference genes for expression analyses in liver of rats with impaired glucose metabolism

    PubMed Central

    Hernández, Alfonso H; Curi, Rui; Salazar, Luis A


    Hepatic gene expression studies are vital for identification of molecular factors involved in insulin resistance. However, the need of normalized gene expression data has led to the search of stable genes which are useful as a reference in specific experimental conditions. The aim of this study was to evaluate expression stability of potential reference genes for real-time PCR gene expression studies, in rats with insulin resistance, early programmed in intrauterine environment of maternal insulin resistance and triggered by exposure to a high sucrose and fat diet in adult life. Male rats coming from insulin resistant (F1IR) mothers or normal (F1N) mothers were fed a standard rodent diet from postnatal day 21 to day 56, and then divided in two groups each. One of each subgroups were fed a high sucrose and fat diet (groups F1IR + HSFD and F1N + HSFD respectively), the rest were fed a control diet (groups F1IR + CD and F1N + CD) for 14 days. Glucose metabolism related tests were later performed. After liver extraction, RNA was isolated and gene expression analyzes of seven potential reference genes (Actb, Gapdh, Gusb, Hprt1, Ldha, Rpl13a and Rplp1) were carried out. LinRegPCR software was used to analyze raw data and determinate baseline corrections, threshold lines, efficiency of PCR reactions and corrected Cq values. Evaluations of gene expression stabilities as well as the number of necessary genes for normalization were assessed with geNorm tool. All samples from all groups showed acceptable PCR amplification efficiencies. The most stable genes were Rplp1, Ldha, Hprt1 and Rpl13a and the less stable was Gapdh. For all groups, just 2 to 3 of the most stable genes were necessary for optimal gene expression data normalization in rat liver. Genes encoding ribosomal proteins are the most appropriated for normalization of expression data in the presented animal model. By contrast, Gapdh, one of the most used genes in normalization, is not recommendable due to its high

  5. Rosiglitazone and bezafibrate modulate gene expression in a rat model of non-alcoholic fatty liver disease - A historical prospective

    PubMed Central


    Background Genetic factors implicated in the pathogenesis of non-alcoholic fatty liver disease are poorly understood. Our aim was to characterize three genes involved in a rat model of non-alcoholic fatty liver disease and investigate the effect of rosiglitazone and bezafibrate. Method Five rats were fed a chow diet (controls) and 18 a fructose-enriched diet (FED) for 5 weeks: 6 were administered rosiglitazone and 6 bezafibrate during the last 2 weeks and 6 were not treated at all. Livers were examined by reverse transcription-PCR for the genes encoding peroxisome proliferator-activated receptors (PPAR), PPAR-α, PPAR-γ, and Mn superoxide dismutase2 (Mn SOD2). Western blot was used for proteins levels. Result The FED rats showed a decrease in mRNA of MnSOD2, PPAR-α, and PPAR-γ (3, 3.5 fold, and 27%, respectively) (p<0.05). The 3 genes normalized in response to rosiglitazone and bezafibrate. The proteins of MnSOD2, PPAR-α and PPAR-γ in the FED rats decreased (2.5, 2, and 2.2, respectively) (p<0.05). Following administration of rosiglitazone, proteins of MnSOD2, PPAR-α and PPAR-γ in the FED rats increased (reaching 1.5-fold, a 20% increase and normalization, respectively), (p<0.05). Administration of bezafibrate to the FED rats restored the proteins of 3 genes to baseline. Conclusion A consistent reduction in hepatic expression of MnSOD2, PPAR-α and PPAR-γ in the FED rats compared with controls was observed. Administration of either rosiglitazone or bezafibrate to the FED rats restored these genes to a pre-morbid state. PMID:23531105

  6. Systematic Global Analysis of Genes Encoding Protein Phosphatases in Aspergillus fumigatus

    PubMed Central

    Winkelströter, Lizziane K.; Dolan, Stephen K.; Fernanda dos Reis, Thaila; Bom, Vinícius Leite Pedro; Alves de Castro, Patrícia; Hagiwara, Daisuke; Alowni, Raneem; Jones, Gary W.; Doyle, Sean; Brown, Neil Andrew; Goldman, Gustavo H.


    Aspergillus fumigatus is a fungal pathogen that causes several invasive and noninvasive diseases named aspergillosis. This disease is generally regarded as multifactorial, considering that several pathogenicity determinants are present during the establishment of this illness. It is necessary to obtain an increased knowledge of how, and which, A. fumigatus signal transduction pathways are engaged in the regulation of these processes. Protein phosphatases are essential to several signal transduction pathways. We identified 32 phosphatase catalytic subunit-encoding genes in A. fumigatus, of which we were able to construct 24 viable deletion mutants. The role of nine phosphatase mutants in the HOG (high osmolarity glycerol response) pathway was evaluated by measuring phosphorylation of the p38 MAPK (SakA) and expression of osmo-dependent genes. We were also able to identify 11 phosphatases involved in iron assimilation, six that are related to gliotoxin resistance, and three implicated in gliotoxin production. These results present the creation of a fundamental resource for the study of signaling in A. fumigatus and its implications in the regulation of pathogenicity determinants and virulence in this important pathogen. PMID:25943523

  7. Toxic peptides and genes encoding toxin gamma of the Brazilian scorpions Tityus bahiensis and Tityus stigmurus.


    Becerril, B; Corona, M; Coronas, F I; Zamudio, F; Calderon-Aranda, E S; Fletcher, P L; Martin, B M; Possani, L D


    Seven toxic peptides from the venom of Tityus bahiensis and Tityus stigmurus was isolated and sequenced, five of them to completion. The most abundant peptide from each of these two species of scorpion was 95% identical with that of toxin gamma from the venom of Tityus serrulatus. They were consequently named gamma-b and gamma-st respectively. The genes encoding these new gamma-like peptides were cloned and sequenced by utilizing oligonucleotides synthesized according to known cDNA sequences of toxin gamma, and amplified by PCR on templates of DNA purified from both T. bahiensis and T. stigmurus. They contain an intron of approx. 470 bp. Possible mechanisms of processing and expressing these peptides are discussed, in view of the fact that glycine is the first residue of the N-terminal sequence of T. stigmurus, whereas lysine is the residue at position 1 of toxin gamma from T. serrulatus and T. bahiensis. In addition, chemical characterization of the less abundant toxic peptides showed the presence of at least four distinct families of peptides in all three species of the genus Tityus studied. There is a large degree of similarity among peptides from different venoms of the same family. By using specific horse and rabbit antisera, the venoms of T. bahiensis, T. serrulatus and T. stigmurus were compared. They showed an extended degree of cross-reactivity. Thus these three species of scorpion have similar toxic components, the genes of which are similarly organized, processed and expressed. PMID:8611151

  8. The dyf-3 gene encodes a novel protein required for sensory cilium formation in Caenorhabditis elegans.


    Murayama, Takashi; Toh, Yoshihiro; Ohshima, Yasumi; Koga, Makoto


    Ciliated neurons in animals are important for the reception of environmental stimuli. To understand the mechanism of cilium morphogenesis in Caenorhabditis elegans, we analyzed dyf-3 mutants that are defective in uptake of a fluorescent dye and abnormal in sensory cilium structure. Expression of green fluorescent protein in sensory neurons of a dyf-3 mutant revealed that the mutant has stunted cilia and abnormal posterior projections in some sensory neurons. The dyf-3 gene encodes three proteins with different N-terminals. The largest DYF-3 protein has 404 amino acid residues that are 38% identical with those of a predicted human protein of unknown function. Expression of a functional dyf-3Colon, two colonsgfp fusion gene is detected in 26 chemosensory neurons, including six IL2 neurons, eight pairs of amphid neurons (ASE, ADF, ASG, ASH, ASI, ASJ, ASK and ADL) and two pairs of phasmid neurons (PHA and PHB). Expression of a dyf-3 cDNA in specific neurons of dyf-3 animals indicated that dyf-3 acts cell-autonomously for fluorescent dye uptake. Reduction of dyf-3Colon, two colonsgfp expression in a daf-19 mutant suggests that dyf-3 expression is regulated by DAF-19 transcription factor, and DYF-3 may be involved in the intraflagellar transport system. PMID:15713455

  9. Systematic Global Analysis of Genes Encoding Protein Phosphatases in Aspergillus fumigatus.


    Winkelströter, Lizziane K; Dolan, Stephen K; Fernanda Dos Reis, Thaila; Bom, Vinícius Leite Pedro; Alves de Castro, Patrícia; Hagiwara, Daisuke; Alowni, Raneem; Jones, Gary W; Doyle, Sean; Brown, Neil Andrew; Goldman, Gustavo H


    Aspergillus fumigatus is a fungal pathogen that causes several invasive and noninvasive diseases named aspergillosis. This disease is generally regarded as multifactorial, considering that several pathogenicity determinants are present during the establishment of this illness. It is necessary to obtain an increased knowledge of how, and which, A. fumigatus signal transduction pathways are engaged in the regulation of these processes. Protein phosphatases are essential to several signal transduction pathways. We identified 32 phosphatase catalytic subunit-encoding genes in A. fumigatus, of which we were able to construct 24 viable deletion mutants. The role of nine phosphatase mutants in the HOG (high osmolarity glycerol response) pathway was evaluated by measuring phosphorylation of the p38 MAPK (SakA) and expression of osmo-dependent genes. We were also able to identify 11 phosphatases involved in iron assimilation, six that are related to gliotoxin resistance, and three implicated in gliotoxin production. These results present the creation of a fundamental resource for the study of signaling in A. fumigatus and its implications in the regulation of pathogenicity determinants and virulence in this important pathogen. PMID:25943523

  10. Cloning and characterization of the gene encoding Halobacterium halobium adenylate kinase.


    Song, S; Inouye, S; Kawai, M; Fukami-Kobayashi, K; Gõ, M; Nakazawa, A


    The gene (AK) encoding adenylate kinase (AK) of Halobacterium halobium was cloned. AK consisted of 648 bp and coded for 216 amino acids (aa). S1 mapping and primer extension experiments indicated that the transcription start point (tsp) was located immediately upstream from the start codon. The TAT-like promoter sequence was found at a position 20-24 bp upstream from tsp. The most striking property of the enzyme was a putative Zn finger-like structure with four cysteines. It might contribute to the structural stability of the molecule in high-salt conditions. Phylogenetic analysis indicated two lineages of the AK family, the short and long types which diverged a long time ago, possibly before the separation of prokaryotes and eukaryotes. Although the H. halobium AK belongs to the long-type AK lineage, it is located in an intermediary position between the two lineages of the phylogenetic tree, indicating early divergence of the gene along the long-type lineage. PMID:8917077

  11. Salmonella typhimurium proP gene encodes a transport system for the osmoprotectant betaine.


    Cairney, J; Booth, I R; Higgins, C F


    Betaine (N,N,N-trimethylglycine) can be accumulated to high intracellular concentrations and serves an important osmoprotective function in enteric bacteria. We found that the proP gene of Salmonella typhimurium, originally identified as encoding a minor transport system for proline (permease PP-II), plays an important role in betaine uptake. Mutations in proP reduced the ability of betaine to serve as an osmoprotectant. Transport of betaine into the cells was also severely impaired in these mutants. The kinetics of uptake via PP-II suggest that betaine, rather than proline, is the important physiological substrate for this transport system. Betaine uptake via PP-II was regulated by osmotic pressure at two different levels: transcription of the proP gene was increased by increasing osmolarity, and, in addition, activity of the transport system itself was dependent upon the osmotic pressure of the medium. The specificity of the transport system was also altered by increasing osmolarity which enhanced the affinity for betaine while reducing that for proline. PMID:3905767

  12. An inhibitor of viral RNA replication is encoded by a plant resistance gene.


    Ishibashi, Kazuhiro; Masuda, Kiyoshi; Naito, Satoshi; Meshi, Tetsuo; Ishikawa, Masayuki


    The tomato Tm-1 gene confers resistance to tomato mosaic virus (ToMV). Here, we report that the extracts of Tm-1 tomato cells (GCR237) have properties that inhibit the in vitro RNA replication of WT ToMV more strongly than that of the Tm-1-resistance-breaking mutant of ToMV, LT1. We purified this inhibitory activity and identified a polypeptide of approximately 80 kDa (p80(GCR237)) using LC-tandem MS. The amino acid sequence of p80(GCR237) had no similarity to any characterized proteins. The p80(GCR237) gene cosegregated with Tm-1; transgenic expression of p80(GCR237) conferred resistance to ToMV within tomato plants; and the knockdown of p80(GCR237) sensitized Tm-1 tomato plants to ToMV, indicating that Tm-1 encodes p80(GCR237) itself. We further show that in vitro-synthesized Tm-1 (p80(GCR237)) protein binds to the replication proteins of WT ToMV and inhibits their function at a step before, but not after, the viral replication complex is formed on the membrane surfaces. Such binding was not observed for the replication proteins of LT1. These results suggest that Tm-1 (p80(GCR237)) inhibits the replication of WT ToMV RNA through binding to the replication proteins. PMID:17699618

  13. An inhibitor of viral RNA replication is encoded by a plant resistance gene

    PubMed Central

    Ishibashi, Kazuhiro; Masuda, Kiyoshi; Naito, Satoshi; Meshi, Tetsuo; Ishikawa, Masayuki


    The tomato Tm-1 gene confers resistance to tomato mosaic virus (ToMV). Here, we report that the extracts of Tm-1 tomato cells (GCR237) have properties that inhibit the in vitro RNA replication of WT ToMV more strongly than that of the Tm-1-resistance-breaking mutant of ToMV, LT1. We purified this inhibitory activity and identified a polypeptide of ≈80 kDa (p80GCR237) using LC–tandem MS. The amino acid sequence of p80GCR237 had no similarity to any characterized proteins. The p80GCR237 gene cosegregated with Tm-1; transgenic expression of p80GCR237 conferred resistance to ToMV within tomato plants; and the knockdown of p80GCR237 sensitized Tm-1 tomato plants to ToMV, indicating that Tm-1 encodes p80GCR237 itself. We further show that in vitro-synthesized Tm-1 (p80GCR237) protein binds to the replication proteins of WT ToMV and inhibits their function at a step before, but not after, the viral replication complex is formed on the membrane surfaces. Such binding was not observed for the replication proteins of LT1. These results suggest that Tm-1 (p80GCR237) inhibits the replication of WT ToMV RNA through binding to the replication proteins. PMID:17699618

  14. Molecular cloning and expression of an Erwinia sp. gene encoding diphenyl ether cleavage in Escherichia coli.

    PubMed Central

    Liaw, H J; Srinivasan, V R


    A 2.1-kilobase fragment obtained by restriction enzyme HindIII digestion of Erwinia sp. genomic DNA was cloned into plasmid pUC19 and introduced into Escherichia coli by transformation. The transformants with diphenyl ether cleaving activity (Dpe+) were selected on agar plates with a specially designed medium (LTFN) containing 4-nitrodiphenyl ether. The positive clones showed a clear zone around the colonies. Analysis of mutants obtained by transposon mini-Mu dI(lacZ Kmr) mutagenesis indicated the coding region of the gene (dpe) and the utilization of a lacZ promoter of pUC19 for transcription of dpe. Clones with dpe in the opposite orientation in pUC19 were not expressed, confirming the need for a lacZ promoter. Utilization of a lacZ promoter in pUC19 was further confirmed by the observation that the degradation of 4-nitrodiphenyl ether was enhanced in the presence of isopropyl-beta-D-thiogalactoside. Expression of dpe was also found in pDPE7321, generated from cloning this gene into another plasmid, pSP73. Analysis of the plasmid-encoded proteins by the maxicell technique showed a polypeptide of 21,000 molecular weight as the product of dpe. Images PMID:2679381

  15. Characterization of the gene encoding the largest subunit of Plasmodium falciparum RNA polymerase III.


    Li, W B; Bzik, D J; Tanaka, M; Gu, H M; Fox, B A; Inselburg, J


    We report here the isolation, sequence analysis, structure, and expression of the gene encoding the largest subunit of RNA polymerase III (RPIII) from Plasmodium falciparum. The P. falciparum RPIII gene consists of 5 exons and 4 introns, is expressed in all of the asexual erythrocytic stages of the parasite as a 8.5-kb mRNA, and is present in a single copy on chromosome 13. The predicted 2339 amino acid residue RPIII subunit contained 5 regions that were conserved between different eukaryotic RPIII subunits, and 4 variable regions that separated the conserved regions. Three of the variable regions were greatly enlarged in comparison to the corresponding variable regions in other RPIII subunits. Variable region C' represented nearly one-third of the P. falciparum RPIII subunit (750 amino acid residues), included a unique repeated decapeptide sequence, and had some homology with yeast DNA topoisomerase II. Noteworthy amino acid sequences and structures were identified in both the conserved regions and in the enlarged variable regions, and their possible role(s) as domains that regulate RPIII enzyme activity is discussed. PMID:1656254

  16. A group III twintron encoding a maturase-like gene excises through lariat intermediates.

    PubMed Central

    Copertino, D W; Hall, E T; Van Hook, F W; Jenkins, K P; Hallick, R B


    The 1605 bp intron 4 of the Euglena gracilis chloroplast psbC gene was characterized as a group III twintron composed of an internal 1503 nt group III intron with an open reading frame of 1374 nt (ycf13, 458 amino acids), and an external group III intron of 102 nt. Twintron excision proceeds by a sequential splicing pathway. The splicing of the internal and external group III introns occurs via lariat intermediates. Branch sites were mapped by primer extension RNA sequencing. The unpaired adenosines in domains VI of the internal and external introns are covalently linked to the 5' nucleotide of the intron via 2'-5' phosphodiester bonds. This bond is susceptible to hydrolysis by the debranching activity of the HeLa nuclear S100 fraction. The internal intron and presumptive ycf13 mRNA accumulates primarily as a linear RNA, although a lariat precursor can also be detected. The ycf13 gene encodes a maturase-like protein that may be involved in group III intron metabolism. Images PMID:7512259

  17. Isolation of cDNA from Jacaratia mexicana encoding a mexicain-like cysteine protease gene.


    Ramos-Martínez, Erick M; Herrera-Ramírez, Alejandra C; Badillo-Corona, Jesús Agustín; Garibay-Orijel, Claudio; González-Rábade, Nuria; Oliver-Salvador, María Del Carmen


    Cysteine proteases (CPs) from the C1 family, which are similar to papain, can be found in animals and plants, as well as some viruses and prokaryotes. These enzymes have diverse physiological functions and are thus very attractive for science and industry. Jacaratia mexicana, a member of the Caricaceae plant family, contains several CPs, the principal being mexicain, found to favorably compete against papain for many industrial applications due to its high stability and specific activity. In this study, leaves of J. mexicana were used to isolate a CP-coding gene, similar to those that code for mexicain and chymomexicain. By using rapid amplification of cDNA ends (RACE) as well as oligonucleotide design from papain-like conserved amino acids (aa), a sequence of 1404 bp consisting of a 5' terminal untranslated region (UTR) of 153 bp, a 3' terminal UTR of 131 bp, with a polyadenylation (poly(A)) signal sequence and a poly(A) tail, and an open reading frame (ORF) of 1046 bp, was obtained by overlapping three partial sequences. Two full-length cDNA sequences that encode for mexicain-like proteases were cloned from mRNA (JmCP4 and JmCP5). JmCP4 is predicted to have an ORF of 1044 bp, which codifies for polypeptides that have a 26 aa signal peptide region, a 108 aa propeptide region and a mature enzyme of 214 aa. A 969 bp fragment (JmCP5) encodes for a partial sequence of a CP gene, without the signal peptide region but with a full-length propeptide region. The sequence analysis showed that this protease presented a high similarity to other plant CPs from J. mexicana, Vasconcellea cundinamarcensis, Vasconcellea stipulata, and Carica papaya, among others, mainly at the conserved catalytic site. Obtaining the sequence of this CP gene from J. mexicana provides an alternative for production in a standard system and could be an initial step towards the commercialization of this enzyme. PMID:22543019

  18. Macrolide Resistance Gene mreA of Streptococcus agalactiae Encodes a Flavokinase

    PubMed Central

    Clarebout, Gervais; Villers, Corinne; Leclercq, Roland


    The mreA gene from Streptococcus agalactiae COH31 γ/δ, resistant to macrolides and clindamycin by active efflux, has recently been cloned in Escherichia coli, where it was reported to confer macrolide resistance (J. Clancy, F. Dib-Hajj, J. W. Petitpas, and W. Yuan, Antimicrob. Agents Chemother. 41:2719–2723, 1997). Cumulative data suggested that the mreA gene was located on the chromosome of S. agalactiae COH31 γ/δ. Analysis of the deduced amino acid sequence of mreA revealed significant homology with several bifunctional flavokinases/(flavin adenine dinucleotide (FAD) synthetases, which convert riboflavin to flavin mononucleotide (FMN) and FMN to FAD, respectively. High-performance liquid chromatography experiments showed that the mreA gene product had a monofunctional flavokinase activity, similar to that of RibR from Bacillus subtilis. Sequences identical to those of the mreA gene and of a 121-bp upstream region containing a putative promoter were detected in strains of S. agalactiae UCN4, UCN5, and UCN6 susceptible to macrolides. mreA and its allele from S. agalactiae UCN4 were cloned on the shuttle vector pAT28. Both constructs were introduced into E. coli, where they conferred a similar two- to fourfold increase in the MICs of erythromycin, spiramycin, and clindamycin. The MICs of a variety of other molecules, including crystal violet, acriflavin, sodium dodecyl sulfate, and antibiotics, such as certain cephalosporins, chloramphenicol, doxycycline, nalidixic acid, novobiocin, and rifampin, were also increased. In contrast, resistance to these compounds was not detected when the constructs were introduced into E. faecalis JH2–2. In conclusion, the mreA gene was probably resident in S. agalactiae and may encode a metabolic function. We could not provide any evidence that it was responsible for macrolide resistance in S. agalactiae COH31 γ/δ; broad-spectrum resistance conferred by the gene in E. coli could involve multidrug efflux pumps by a mechanism

  19. Characterization of the BLR1 gene encoding a putative blue-light regulator in the phytopathogenic fungus Bipolaris oryzae.


    Kihara, Junichi; Moriwaki, Akihiro; Tanaka, Nozomi; Ueno, Makoto; Arase, Sakae


    Bipolaris oryzae is a filamentous ascomycetous fungus that causes brown leaf spot disease in rice. We isolated and characterized BLR1, a gene that encodes a putative blue-light regulator similar to Neurospora crassa white-collar 1 (WC-1). The deduced amino acid sequence of BLR1 showed high degrees of similarity to other fungal blue-light regulator protein. Disruption of the BLR1 gene demonstrated that this gene is essential for conidial development after conidiophore formation and for near-UV radiation-enhanced photolyase gene expression. PMID:17233721

  20. Regulation of Transcription of the Bacillus subtilis pyrG Gene, Encoding Cytidine Triphosphate Synthetase

    PubMed Central

    Meng, Qi; Switzer, Robert L.


    The B. subtilis pyrG gene, which encodes CTP synthetase, is located far from the pyrimidine biosynthetic operon on the chromosome and is independently regulated. The pyrG promoter and 5′ leader were fused to lacZ and integrated into the chromosomes of several B. subtilis strains having mutations in genes of pyrimidine biosynthesis and salvage. These mutations allowed the intracellular pools of cytidine and uridine nucleotides to be manipulated by the composition of the growth medium. These experiments indicated that pyrG expression is repressed by cytidine nucleotides but is largely independent of uridine nucleotides. The start of pyrG transcription was mapped by primer extension to a position 178 nucleotides upstream of the translation initiation codon. A factor-independent termination hairpin lying between the pyrG promoter and its coding region is essential for regulation of pyrG expression. Primer-extended transcripts were equally abundant in repressed and derepressed cells when the primer bound upstream of the terminator, but they were much less abundant in repressed cells when the primer bound downstream of the terminator. Furthermore, deletion of the terminator from pyrG-lacZ fusions integrated into the chromosome yielded elevated levels of expression that was not repressible by cytidine. We suggest that cytidine repression of pyrG expression is mediated by an antitermination mechanism in which antitermination by a putative trans-acting protein is reduced by elevated levels of cytidine nucleotides. Conservation of sequences and secondary structural elements in the pyrG 5′ leaders of several other gram-positive bacteria indicates that their pyrG genes are regulated by a similar mechanism. PMID:11544212

  1. Molecular cloning in Escherichia coli of Erwinia chrysanthemi genes encoding multiple forms of pectate lyase.

    PubMed Central

    Collmer, A; Schoedel, C; Roeder, D L; Ried, J L; Rissler, J F


    The phytopathogenic enterobacterium Erwinia chrysanthemi excretes multiple isozymes of the plant tissue-disintegrating enzyme, pectate lyase (PL). Genes encoding PL were cloned from E. chrysanthemi CUCPB 1237 into Escherichia coli HB101 by inserting Sau3A-generated DNA fragments into the BamHI site of pBR322 and then screening recombinant transformants for the ability to sink into pectate semisolid agar. Restriction mapping of the cloned DNA in eight pectolytic transformants revealed overlapping portions of a 9.8-kilobase region of the E. chrysanthemi genome. Deletion derivatives of these plasmids were used to localize the pectolytic genotype to a 2.5-kilobase region of the cloned DNA. PL gene expression in E. coli was independent of vector promoters, repressed by glucose, and not induced by galacturonan. PL accumulated largely in the periplasmic space of E. coli. An activity stain used in conjunction with ultrathin-layer isoelectric focusing resolved the PL in E. chrysanthemi culture supernatants and shock fluids of E. coli clones into multiple forms. One isozyme with an apparent pI of 7.8 was produced at a far higher level in E. coli and was common to all of the pectolytic clones. Activity staining of renatured PL in sodium dodecyl sulfate-polyacrylamide gels revealed that this isozyme comigrated with the corresponding isozyme produced by E. chrysanthemi. The PL isozyme profiles produced by different clones and deletion derivative subclones suggest that the cloned region contains at least two PL isozyme structural genes. Pectolytic E. coli clones possessed a limited ability to macerate potato tuber tissues. Images PMID:2982794

  2. Genes encoding Δ(8)-sphingolipid desaturase from various plants: identification, biochemical functions, and evolution.


    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Hu, Zan-Min; Gao, Wu-Jun


    ∆(8)-sphingolipid desaturase catalyzes the C8 desaturation of a long chain base, which is the characteristic structure of various complex sphingolipids. The genes of 20 ∆(8)-sphingolipid desaturases from 12 plants were identified and functionally detected by using Saccharomyces cerevisiae system to elucidate the relationship between the biochemical function and evolution of this enzyme. Results showed that the 20 genes all can encode a functional ∆(8)-sphingolipid desaturase, which catalyzes different ratios of two products, namely, 8(Z) and 8(E)-C18-phytosphingenine. The coded enzymes could be divided into two groups on the basis of biochemical functions: ∆(8)-sphingolipid desaturase with a preference for an E-isomer product and ∆(8)-sphingolipid desaturase with a preference for a Z-isomer product. The conversion rate of the latter was generally lower than that of the former. Phylogenetic analysis revealed that the 20 desaturases could also be clustered into two groups, and this grouping is consistent with that of the biochemical functions. Thus, the biochemical function of ∆(8)-sphingolipid desaturase is correlated with its evolution. The two groups of ∆(8)-sphingolipid desaturases could arise from distinct ancestors in higher plants. However, they might have initially evolved from ∆(8)-sphingolipid desaturases in lower organisms, such as yeasts, which can produce E-isomer products only. Furthermore, almost all of the transgenic yeasts harboring ∆(8)-sphingolipid desaturase genes exhibit an improvement in aluminum tolerance. Our study provided new insights into the biochemical function and evolution of ∆(8)-sphingolipid desaturases in plants. PMID:27294968

  3. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    SciTech Connect

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin


    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with I{kappa}B-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy.

  4. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    PubMed Central

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham


    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  5. Identification and functional characterization of K+ transporters encoded by Legionella pneumophila kup genes

    PubMed Central

    Hori, Juliana I.; Pereira, Marcelo S.F.; Roy, Craig R.; Nagai, Hiroki; Zamboni, Dario S.


    Summary Legionnaires’ disease is an emerging, severe, pneumonia-like illness caused by the Gram-negative intracellular bacteria Legionella pneumophila, which are able to infect and replicate intracellularly in macrophages. Little is known regarding the mechanisms used by intracellular L. pneumophila for the acquisition of specific nutrients that are essential for bacterial replication. Here, we investigate three L. pneumophila genes with high similarity to the E. coli K+ transporters. These three genes were expressed by L. pneumophila and have been designated kupA, kupB and kupC. Investigation using the L. pneumophila kup mutants revealed that kupA is involved in K+ acquisition during axenic growth. The kupA mutants replicated efficiently in rich axenic media, but poorly in a chemically defined medium. The kupA mutants were defective in the recruitment of polyubiquitinated proteins to the Legionella-containing vacuole that is formed in macrophages and displayed an intracellular multiplication defect during the replication in Acanthamoeba castellanii and in mouse macrophages. We found that bafilomycin treatment of macrophages was able to rescue the growth defects of kupA mutants, but it did not influence the replication of wild-type bacteria. The defects identified in kupA mutants of L. pneumophila were complemented by the expression E. coli trkD/Kup gene in trans, a bona fide K+ transporter encoded by E. coli. Collectively, our data indicate that KupA is a functional K+ transporter expressed by L. pneumophila that facilitates the bacterial replication intracellularly and in nutrient-limited conditions. PMID:23848378

  6. TOM1, an Arabidopsis gene required for efficient multiplication of a tobamovirus, encodes a putative transmembrane protein.


    Yamanaka, T; Ohta, T; Takahashi, M; Meshi, T; Schmidt, R; Dean, C; Naito, S; Ishikawa, M


    Host-encoded factors play an important role in virus multiplication, acting in concert with virus-encoded factors. However, information regarding the host factors involved in this process is limited. Here we report the map-based cloning of an Arabidopsis thaliana gene, TOM1, which is necessary for the efficient multiplication of tobamoviruses, positive-strand RNA viruses infecting a wide variety of plants. The TOM1 mRNA is suggested to encode a 291-aa polypeptide that is predicted to be a multipass transmembrane protein. The Sos recruitment assay supported the hypothesis that TOM1 is associated with membranes, and in addition, that TOM1 interacts with the helicase domain of tobamovirus-encoded replication proteins. Taken into account that the tobamovirus replication complex is associated with membranes, we propose that TOM1 participates in the in vivo formation of the replication complex by serving as a membrane anchor. PMID:10944200

  7. The androgen-binding protein gene is expressed in male and female rat brain.


    Wang, Y M; Bayliss, D A; Millhorn, D E; Petrusz, P; Joseph, D R


    Extracellular androgen-binding proteins (ABP) are thought to modulate the regulatory functions of androgens and the trans-acting nuclear androgen receptor. Testicular ABP and plasma sex hormone-binding globulin (SHBG), which is produced in liver, are encoded by the same gene. We have now found that the ABP-SHBG gene is also expressed in male and female rat brain. Immunoreactive ABP was found to be present in neuronal cell bodies throughout the brain as well as in fibers of the hypothalamic median eminence. The highest concentrations of immunoreactive cell bodies were located in the supraoptic and paraventricular nuclei. Likewise, ABP mRNA was present in all brain regions examined. Analysis of cDNA clones representing brain ABP mRNAs revealed amino acid sequence differences in brain and testicular ABPs. The protein encoded by an alternatively processed RNA has sequence characteristics suggesting that the protein could act as a competitior of ABP binding to cell surface receptors. These data and gene-sequencing experiments indicate that a specific ABP gene promoter is used for transcription initiation in brain. ABP may function in brain as an androgen carrier protein; however, in view of the widespread presence of ABP and ABP mRNA in brain, the protein may have a much broader, yet unknown, function. PMID:1701136

  8. Pseudomonas aeruginosa fur Overlaps with a Gene Encoding a Novel Outer Membrane Lipoprotein, OmlA

    PubMed Central

    Ochsner, Urs A.; Vasil, Adriana I.; Johnson, Zaiga; Vasil, Michael L.


    A novel outer membrane lipoprotein in Pseudomonas aeruginosa is encoded by the omlA gene, which was identified immediately upstream of the fur (ferric uptake regulator) gene. The omlA and fur genes were divergently transcribed and had overlapping promoter regions. The proximal fur P2 promoter and the omlA promoter shared a 5-bp DNA motif for their −10 promoter elements. The distal fur P1 promoter was located within the omlA coding sequence, and the omlA and fur T1 mRNAs overlapped by 154 nucleotides. Optimal expression of both fur and omlA required roughly 200 bp of DNA upstream of the promoter regions, suggesting the presence of cis-acting transcriptional activation elements located within the omlA and fur genes, respectively. The levels of Fur and OmlA proteins had no influence on omlA or fur expression, excluding any trans-acting cross-regulation between fur and omlA. Expression of omlA was constitutive regardless of growth phase, oxygen tension, iron concentration, pH, and temperature. OmlA contained a signal sequence typical of bacterial lipoproteins, with a cysteine as a putative cleavage and lipid attachment site. Inhibition of signal peptidase II by globomycin resulted in failure to process OmlA, thus giving strong evidence that OmlA is a lipoprotein. Cell fractionation followed by Western blot analysis indicated that all OmlA protein is localized in the outer membrane. Mature OmlA was an acidic (pI = 4.5) protein of 17.3 kDa and had close to 40% amino acid sequence identity to SmpA (small protein A) of Escherichia coli, Vibrio cholerae, and Haemophilus influenzae, a protein of unknown function. All P. aeruginosa strains tested as well as Pseudomonas fluorescens were found to produce OmlA. A mutant strain with impaired production of OmlA but no change in the expression of the overlapping fur gene was constructed. The omlA mutant was hypersusceptible to anionic detergents such as sodium dodecyl sulfate and deoxycholate, and it showed increased

  9. Nuclear factor-κB regulates the expression of multiple genes encoding liver transport proteins.


    Balasubramaniyan, Natarajan; Ananthanarayanan, Meenakshisundaram; Suchy, Frederick J


    In this study we identified the mechanisms underlying the inhibitory effects of NF-κB on the expression of genes encoding multiple liver transport proteins. Well-conserved NF-κB binding sites were found in the promoters of farnesoid X receptor (FXR)-target genes. An electromobility shift assay (EMSA) demonstrated the specific interaction between the NF-κB p65 protein and a (32)P-labeled BSEP NF-κB response element (NF-κBE). Chromatin immunoprecipitation (ChIP) analysis confirmed binding of NF-κB p65 to the BSEP locus but not the FXRE in vitro. NF-κB p65 overexpression in Huh-7 cells markedly repressed FXR/RXR transactivation of the BSEP, ABCG5/G8, MRP2, and FXR promoters, which was totally reversed by expression of the IκBα super-repressor. NF-κB interacted directly with FXR on coimmunoprecipitation, suggesting another level for the inhibitory effects of NF-κB on FXR-target genes. In vivo ChIP analysis with liver nuclei obtained from mice after 3 days of common bile duct ligation (BDL) or 6 h post-lipopolysaccharide (LPS) injection showed a markedly increased recruitment of NF-κB p65 to the Bsep promoter compared with controls. There was also increased recruitment of the corepressor silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) and histone deacetylase (HDAC)3 and HDAC2 to the NF-κB sites. We also found that NF-κB p65 was recruited to NF-κB binding sites in the promoters of organic solute transporter, OSTα and OSTβ, and unexpectedly activated rather than repressed gene expression. In mouse liver after BDL NF-κB recruitment to Ostα and Ostβ promoters was associated with increased binding of the potent coactivator cAMP response element binding protein (CREB)-binding protein (CBP)/p300 to the NF-κBE and depletion of CBP/p300 at the FXR element. Overall, these studies demonstrate a novel role for NF-κB in adaptation to obstructive and LPS-induced cholestasis acting through recruitment to specific NF-κB binding sites in

  10. Endurance training enhances LXRα gene expression in Wistar male rats.


    Kazeminasab, Fatemeh; Marandi, Mohammad; Ghaedi, Kamran; Esfarjani, Fahimeh; Moshtaghian, Jamal


    Liver X receptor α (LXRα) is a member of the ligand-activated transcription factor of nuclear hormonal receptor superfamily, whose activation leads to modulation in the expression of genes involved in cholesterol homeostasis including ATP-binding cassette transporter A1 (ABCA1), which plays a crucial role in plasma high-density lipoprotein cholesterol (HDL-C) remodeling. The purpose of this study was to investigate whether endurance training enhanced the expression level of liver LXRα gene. Twelve adult male Wistar rats (200-220 g) were divided into control and training groups. Training group received exercise on a motor-driven treadmill at 28 m/min (0 % grade) for 60 min/day, 5 days/week for 8 weeks. Twenty-four hours after the last exercise session, the rats were killed and blood was taken from the right ventricle of each rat. Plasma was collected for HDL-C, low-density lipoprotein cholesterol (LDL-C), TC and TG measurements. Furthermore, a portion of the liver of each rat was excised and washed in ice-cold saline and frozen in liquid nitrogen for assessment of LXRα and ABCA1 mRNA levels. Data indicated significant increase in both LXRα and ABCA1 mRNA levels in trained rats, compared to control rats. Plasma HDL-C concentration was significantly higher (P < 0.001) in trained rats at the end of treadmill exercise. However, there was a significant decrease in LDL-C (P < 0.003), TG, TC concentration, TC/HDL-C and LDL/HDL-C ratios in trained rats compared with those in the control group (P < 0.001). In conclusion, we found that endurance training induced significant elevation in LXRα gene expression, which correlated with enhanced levels of ABCA1 mRNA and plasma HDL-C concentration. PMID:23674092

  11. Six mouse alpha-tubulin mRNAs encode five distinct isotypes: testis-specific expression of two sister genes.

    PubMed Central

    Villasante, A; Wang, D; Dobner, P; Dolph, P; Lewis, S A; Cowan, N J


    Five mouse alpha-tubulin isotypes are described, each distinguished by the presence of unique amino acid substitutions within the coding region. Most, though not all of these isotype-specific amino acids, are clustered at the carboxy terminus. One of the alpha-tubulin isotypes described is expressed exclusively in testis and is encoded by two closely related genes (M alpha 3 and M alpha 7) which have homologous 3' untranslated regions but which differ at multiple third codon positions and in their 5' untranslated regions. We show that a subfamily of alpha-tubulin genes encoding the same testis-specific isotype also exists in humans. Thus, we conclude that the duplication event leading to a pair of genes encoding a testis-specific alpha-tubulin isotype predated the mammalian radiation, and both members of the duplicated sequence have been maintained since species divergence. A second alpha-tubulin gene, M alpha 6, is expressed ubiquitously at a low level, whereas a third gene, M alpha 4, is unique in that it does not encode a carboxy-terminal tyrosine residue. This gene yields two transcripts: a 1.8-kilobase (kb) mRNA that is abundant in muscle and a 2.4-kb mRNA that is abundant in testis. Whereas the 1.8-kb mRNA encodes a distinct alpha-tubulin isotype, the 2.4-kb mRNA is defective in that the methionine residue required for translational initiation is missing. Patterns of developmental expression of the various alpha-tubulin isotypes are presented. Our data support the view that individual tubulin isotypes are capable of conferring functional specificity on different kinds of microtubules. Images PMID:3785200

  12. Identification of Nuclear Genes Encoding Chloroplast-Localized Proteins Required for Embryo Development in Arabidopsis1[W][OA

    PubMed Central

    Bryant, Nicole; Lloyd, Johnny; Sweeney, Colleen; Myouga, Fumiyoshi; Meinke, David


    We describe here the diversity of chloroplast proteins required for embryo development in Arabidopsis (Arabidopsis thaliana). Interfering with certain chloroplast functions has long been known to result in embryo lethality. What has not been reported before is a comprehensive screen for embryo-defective (emb) mutants altered in chloroplast proteins. From a collection of transposon and T-DNA insertion lines at the RIKEN chloroplast function database ( that initially appeared to lack homozygotes and segregate for defective seeds, we identified 23 additional examples of EMB genes that likely encode chloroplast-localized proteins. Fourteen gene identities were confirmed with allelism tests involving duplicate mutant alleles. We then queried journal publications and the SeedGenes database ( to establish a comprehensive dataset of 381 nuclear genes encoding chloroplast proteins of Arabidopsis associated with embryo-defective (119 genes), plant pigment (121 genes), gametophyte (three genes), and alternate (138 genes) phenotypes. Loci were ranked based on the level of certainty that the gene responsible for the phenotype had been identified and the protein product localized to chloroplasts. Embryo development is frequently arrested when amino acid, vitamin, or nucleotide biosynthesis is disrupted but proceeds when photosynthesis is compromised and when levels of chlorophyll, carotenoids, or terpenoids are reduced. Chloroplast translation is also required for embryo development, with genes encoding chloroplast ribosomal and pentatricopeptide repeat proteins well represented among EMB datasets. The chloroplast accD locus, which is necessary for fatty acid biosynthesis, is essential in Arabidopsis but not in Brassica napus or maize (Zea mays), where duplicated nuclear genes compensate for its absence or loss of function. PMID:21139083

  13. Skeletal muscle gene expression in space-flown rats.


    Nikawa, Takeshi; Ishidoh, Kazumi; Hirasaka, Katsuya; Ishihara, Ibuki; Ikemoto, Madoka; Kano, Mihoko; Kominami, Eiki; Nonaka, Ikuya; Ogawa, Takayuki; Adams, Gregory R; Baldwin, Kenneth M; Yasui, Natsuo; Kishi, Kyoichi; Takeda, Shin'ichi


    Skeletal muscles are vulnerable to marked atrophy under microgravity. This phenomenon is due to the transcriptional alteration of skeletal muscle cells to weightlessness. To further investigate this issue at a subcellular level, we examined the expression of approximately 26,000 gastrocnemius muscle genes in space-flown rats by DNA microarray analysis. Comparison of the changes in gene expression among spaceflight, tail-suspended, and denervated rats revealed that such changes were unique after spaceflight and not just an extension of simulated weightlessness. The microarray data showed two spaceflight-specific gene expression patterns: 1) imbalanced expression of mitochondrial genes with disturbed expression of cytoskeletal molecules, including putative mitochondria-anchoring proteins, A-kinase anchoring protein, and cytoplasmic dynein, and 2) up-regulated expression of ubiquitin ligase genes, MuRF-1, Cbl-b, and Siah-1A, which are rate-limiting enzymes of muscle protein degradation. Distorted expression of cytoskeletal genes during spaceflight resulted in dislocation of the mitochondria in the cell. Several oxidative stress-inducible genes were highly expressed in the muscle of spaceflight rats. We postulate that mitochondrial dislocation during spaceflight has deleterious effects on muscle fibers, leading to atrophy in the form of insufficient energy provision for construction and leakage of reactive oxygen species from the mitochondria. PMID:14715702

  14. Aluminum-activated citrate and malate transporters encoded by distinct Al tolerance genes function independently in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aluminum (Al) -activated malate and citrate exudation from roots plays an important role in conferring Al tolerance to many plant species. Here, we report on the identification and characterization of AtMATE, the gene encoding an Al-activated root citrate efflux transporter that functions in Arabid...

  15. Influence of energy supply on expression of genes encoding for lipogenic enzymes and regulatory proteins in growing beef steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Forty crossbred beef steers were used to determine the effects metabolizable energy (ME) intake and of site and complexity of carbohydrate (CHO) infusion on expression of genes encoding lipogenic enzymes and regulatory proteins in subcutaneous (SC), mesenteric (MES) and omental (OM) adipose. Treatm...

  16. The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases

    PubMed Central

    Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi


    We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016

  17. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    SciTech Connect

    Parris, D.S. Institute of Virology, Glasgow ); Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S. ); Haarr, L. )


    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K{sub DBP}) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K{sub DBP}. Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K{sub DBP}, was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K{sub DBP}. The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K{sub DBP}, thus confirming the gene assignment.

  18. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce


    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  19. The rpoE gene of Escherichia coli, which encodes sigma E, is essential for bacterial growth at high temperature.

    PubMed Central

    Hiratsu, K; Amemura, M; Nashimoto, H; Shinagawa, H; Makino, K


    In vitro transcription analysis has shown that only RNA polymerase containing an alternative sigma subunit, sigma E, activates transcription from one of the rpoH promoters and the htrA promoter. The location of the rpoE gene encoding sigma E on the Escherichia coli chromosome has recently been established, but no rpoE mutant has yet become available for phenotypic testing. We cloned the rpoE gene from the lambda-ordered clones of the E. coli genome and confirmed that the reconstituted RNA polymerase containing the gene product (E sigma E) can transcribe htrA in vitro. We constructed an rpoE-defective strain by gene disruption using the cloned rpoE gene. We demonstrate that expression of htrA is completely dependent on the rpoE gene in vivo and that the rpoE gene is essential for bacterial growth at high temperature. PMID:7751307

  20. Identification of the Sensory Neuron Specific Regulatory Region for the Mouse Gene Encoding the Voltage Gated Sodium Channel Nav1.8

    PubMed Central

    Puhl, Henry L.; Ikeda, Stephen R.


    Voltage-gated sodium channels (VGSC) are critical membrane components that participate in the electrical activity of excitable cells. The type one VGSC family includes the tetrodotoxin insensitive sodium channel, Nav1.8, encoded by the Scn10a gene. Nav1.8 expression is restricted to small and medium diameter nociceptive sensory neurons of the dorsal root (DRG) and cranial sensory ganglia. In order to understand the stringent transcriptional regulation of the Scn10a gene, the sensory neuron specific promoter was functionally identified. While identifying the mRNA 5’ end, alternative splicing within the 5’ UTR was observed to create heterogeneity in the RNA transcript. Four kilobases of upstream genomic DNA was cloned and the presence of tissue specific promoter activity was tested by microinjection and adenoviral infection of fluorescent protein reporter constructs into primary mouse and rat neurons, and cell lines. The region contained many putative transcription factor binding sites and strong homology with the predicted rat ortholog. Homology to the predicted human ortholog was limited to the proximal end and several conserved cis elements were noted. Two regulatory modules were identified by microinjection of reporter constructs into DRG and superior cervical ganglia neurons: a neuron specific proximal promoter region between −1.6 and −0.2kb of the transcription start site cluster, and a distal sensory neuron switch region beyond −1.6kb that restricted fluorescent protein expression to a subset of primary sensory neurons. PMID:18466327

  1. The UmGcn5 gene encoding histone acetyltransferase from Ustilago maydis is involved in dimorphism and virulence.


    González-Prieto, Juan Manuel; Rosas-Quijano, Raymundo; Domínguez, Angel; Ruiz-Herrera, José


    We isolated a gene encoding a histone acetyltransferase from Ustilago maydis (DC.) Cda., which is orthologous to the Saccharomyces cerevisiae GCN5 gene. The gene was isolated from genomic clones identified by their specific hybridization to a gene fragment obtained by the polymerase chain reaction (PCR). This gene (Umgcn5; um05168) contains an open reading frame (ORF) of 1421bp that encodes a putative protein of 473 amino acids with a Mr. of 52.6kDa. The protein exhibits a high degree of homology with histone acetyltransferases from different organisms. Null a2b2 ΔUmgcn5 mutants were constructed by substitution of the region encoding the catalytic site with a hygromycin B resistance cassette. Null a1b1 ΔUmgcn5 mutants were isolated from genetic crosses of a2b2 ΔUmgcn5 and a1b1 wild-type strains in maize. Mutants displayed a slight reduction in growth rate under different conditions, and were more sensitive than the wild type to stress conditions, but more important, they grew as long mycelial cells, and formed fuzz-like colonies under all conditions where wild-type strains grew in the yeast-like morphology and formed smooth colonies. This phenotype was not reverted by cAMP addition. Mutants were not virulent to maize plants, and were unable to form teliospores. These phenotypic alterations of the mutants were reverted by their transformation with the wild-type gene. PMID:25242418

  2. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II {beta} subunit (CSNK2B)

    SciTech Connect

    Albertella, M.R.; Jones, H.; Thomson, W.


    A wide range of autoimmune and other diseases are known to be associated with the major histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility antigens in the class I and class II regions, but some appear to be more strongly associated with genes in the central 1100-kb class III region, making it important to characterize this region fully for the presence of novel genes. An {approximately}220-kb segment of DNA in the class III region separating the Hsp70 (HSPA1L) and BAT1 (D6S8IE) genes, which was previously known to contain 14 genes. Genomic DNA fragments spanning the gaps between the known genes were used as probes to isolate cDNAs corresponding to five new genes within this region. Evidence from Northern blot analysis and exon trapping experiments that suggested the presence of at least two more new genes was also obtained. Partial cDNA and complete exonic genomic sequencing of one of the new genes has identified it as the casein kinase II{beta} subunit (CSNK2B). Two of the other novel genes lie within a region syntenic to that implicated in susceptibility to experimental allergic orchitis in the mouse, an autoimmune disease of the testis, and represent additional candidates for the Orch-1 locus associated with this disease. In addition, characterization of the 13-kb intergenic gap separating the RD (D6545) and G11 (D6S60E) genes has revealed the presence of a gene encoding a 1246-amino-acid polypeptide that shows significant sequence similarity to the yeast anti-viral Ski2p gene product. 49 refs., 8 figs.

  3. Multigeneration reproductive and developmental toxicity study of bar gene inserted into genetically modified potato on rats.


    Rhee, Gyu Seek; Cho, Dae Hyun; Won, Yong Hyuck; Seok, Ji Hyun; Kim, Soon Sun; Kwack, Seung Jun; Lee, Rhee Da; Chae, Soo Yeong; Kim, Jae Woo; Lee, Byung Mu; Park, Kui Lea; Choi, Kwang Sik


    Each specific protein has an individual gene encoding it, and a foreign gene introduced to a plant can be used to synthesize a new protein. The identification of potential reproductive and developmental toxicity from novel proteins produced by genetically modified (GM) crops is a difficult task. A science-based risk assessment is needed in order to use GM crops as a conventional foodstuff. In this study, the specific characteristics of GM food and low-level chronic exposure were examined using a five-generation animal study. In each generation, rats were fed a solid pellet containing 5% GM potato and non-GM potato for 10 wk prior to mating in order to assess the potential reproductive and developmental toxic effects. In the multigeneration animal study, there were no GM potato-related changes in body weight, food consumption, reproductive performance, and organ weight. Polymerase chain reaction (PCR) was carried out using extracted genomic DNA to examine the possibility of gene persistence in the organ tissues after a long-term exposure to low levels of GM feed. In each generation, the gene responsible for bar was not found in any of the reproductive organs of the GM potato-treated male and female rats, and the litter-related indexes did not show any genetically modified organism (GMO)-related changes. The results suggest that genetically modified crops have no adverse effects on the multigeneration reproductive-developmental ability. PMID:16326439

  4. Transcriptome Analysis in Rat Kidneys: Importance of Genes Involved in Programmed Hypertension

    PubMed Central

    Tain, You-Lin; Huang, Li-Tung; Chan, Julie Y. H.; Lee, Chien-Te


    Suboptimal conditions in pregnancy can elicit long-term effects on the health of offspring. The most common outcome is programmed hypertension. We examined whether there are common genes and pathways in the kidney are responsible for generating programmed hypertension among three different models using next generation RNA sequencing (RNA-Seq) technology. Pregnant Sprague-Dawley rats received dexamethasone (DEX, 0.1 mg/kg) from gestational day 16 to 22, 60% high-fructose (HF) diet, or NG-nitro-l-arginine-methyester (l-NAME, 60 mg/kg/day) to conduct DEX, HF, or l-NAME model respectively. All three models elicited programmed hypertension in adult male offspring. We observed five shared genes (Bcl6, Dmrtc1c, Egr1, Inmt, and Olr1668) among three different models. The identified differential genes (DEGs) that are related to regulation of blood pressure included Aqp2, Ptgs1, Eph2x, Hba-a2, Apln, Guca2b, Hmox1, and Npy. RNA-Seq identified genes in arachidonic acid metabolism are potentially gatekeeper genes contributing to programmed hypertension. In addition, HF and DEX increased expression and activity of soluble epoxide hydrolase (Ephx2 gene encoding protein). Conclusively, the DEGs in arachidonic acid metabolism are potentially gatekeeper genes in programmed hypertension. The roles of DEGs identified by the RNA-Seq in this study deserve further clarification, to develop the potential interventions in the prevention of programmed hypertension. PMID:25739086

  5. Exon Skipping in the RET Gene Encodes Novel Isoforms That Differentially Regulate RET Protein Signal Transduction.


    Gabreski, Nicole A; Vaghasia, Janki K; Novakova, Silvia S; McDonald, Neil Q; Pierchala, Brian A


    Rearranged during transfection (RET), a receptor tyrosine kinase that is activated by the glial cell line-derived neurotrophic factor family ligands (GFLs), plays a crucial role in the development and function of the nervous system and additionally is required for kidney development and spermatogenesis. RET encodes a transmembrane receptor that is 20 exons long and produces two known protein isoforms differing in C-terminal amino acid composition, referred to as RET9 and RET51. Studies of human pheochromocytomas identified two additional novel transcripts involving the skipping of exon 3 or exons 3, 4, and 5 and are referred to as RET(Δ) (E3) and RET(Δ) (E345), respectively. Here we report the presence of Ret(Δ) (E3) and Ret(Δ) (E345) in zebrafish, mice, and rats and show that these transcripts are dynamically expressed throughout development of the CNS, peripheral nervous system, and kidneys. We further explore the biochemical properties of these isoforms, demonstrating that, like full-length RET, RET(ΔE3) and RET(ΔE345) are trafficked to the cell surface, interact with all four GFRα co-receptors, and have the ability to heterodimerize with full-length RET. Signaling experiments indicate that RET(ΔE3) is phosphorylated in a similar manner to full-length RET. RET(ΔE345), in contrast, displays higher baseline autophosphorylation, specifically on the catalytic tyrosine, Tyr(905), and also on one of the most important signaling residues, Tyr(1062) These data provide the first evidence for a physiologic role of these isoforms in RET pathway function. PMID:27226544

  6. Mammary gland morphology and gene expression signature of weanling male and female rats following exposure to exogenous estradiol.


    Miousse, Isabelle R; Gomez-Acevedo, Horacio; Sharma, Neha; Vantrease, Jamie; Hennings, Leah; Shankar, Kartik; Cleves, Mario A; Badger, Thomas M; Ronis, Martin Jj


    In order to characterize the actions of xenoestrogens, it is essential to possess a solid portrait of the physiological effects of exogenous estradiol. We assessed effects of three doses of exogenous estradiol (E2) (0.1, 1.0 and 10 µg/kg/day) given between postnatal days 21 and 33 on the mammary gland morphology and gene expression profiles of male and female rats compared to vehicle-treated controls. The male mammary gland was more responsive to E2 treatment than in females, with 509 genes regulated >2-fold in a dose-dependent manner in males and only 174 in females. In males, E2 treatment significantly (P < 0.01) increased the number of terminal end buds (TEBs) and the expression of proliferating cell nuclear antigen (PCNA) protein (P < 0.05), both of which are indicators of proliferation. This change was linked to a significant increase (P < 0.05) in the expression of the gene encoding amphiregulin, which is known to induce TEB formation. There was also a dose-dependent increase (P < 0.001) in the estrogen-regulated gene encoding the progesterone receptor. In intact females, despite lack of changes in mammary morphology, we observed a dose-dependent increase (P < 0.05) in the expression of genes encoding three milk proteins: whey acidic protein, casein beta and casein kappa. There was a significant (P < 0.05) downregulation of both estrogen receptors in response to E2 treatment. These results suggest that mammary glands of male rats are very sensitive to exogenous E2 during development post-weaning. The dose-dependent increase observed in amphiregulin and progesterone receptor gene expression was linked to morphological changes and represents a reliable and sensitive tool to evaluate estrogenicity. In contrast, intact weanling female rats were less responsive. PMID:23925648

  7. Technical development for production of gene-modified laboratory rats.


    Hirabayashi, Masumi


    Transgenic rats have been used as model animals for human diseases and organ transplantation and as animal bioreactors for protein production. In general, transgenic rats are produced by pronuclear microinjection of exogenous DNA. Improvement of post-injection survival has been achieved by micro-vibration of the injection pipette. The promoter region, structural gene, chain length and strand ends of the exogenous DNA are not involved in the production efficiency of transgenic rats. Exogenous DNA prepared at 5 microg/ml seemed to be better integrated than lower and higher concentrations. Intracytoplasmic sperm injection (ICSI) has been successfully achieved in rats using a piezo-driven injection pipette. The ICSI technique has not only been applied to rescue infertile male strains but also to produce transgenic rats. The optimal DNA concentration for the ICSI-tg method (0.1 to 0.5 microg/ml) is lower than that for the conventional pronuclear microinjection. Production efficiency was improved when the membrane structure of the sperm head was partially disrupted by detergent or ultrasonic treatment before exposure to the exogenous DNA solution. For successful production of transgenic rats with a modified endogenous gene, establishment of embryonic stem cell lines or alternatively male germline stem cell lines and technical development of somatic cell nuclear transfer are still necessary for this species. PMID:18446007

  8. Visinin-like peptide 1 in adrenal gland of the rat. Gene expression and its hormonal control.


    Trejter, Marcin; Hochol, Anna; Tyczewska, Marianna; Ziolkowska, Agnieszka; Jopek, Karol; Szyszka, Marta; Malendowicz, Ludwik K; Rucinski, Marcin


    VSNL1 encodes the calcium-sensor protein visinin-like 1 and was identified previously as an upregulated gene in a sample set of aldosterone-producing adenomas. Recently, by means of microarray studies we demonstrated high expression of Vsnl1 gene in rat adrenal zona glomerulosa (ZG). Only scanty data are available on the role of this gene in adrenal function as well as on regulation of its expression by factors affecting adrenal cortex structure and function. Therefore we performed relevant studies aimed at clarifying some of the above issues. By Affymetrix(®) Rat Gene 1.1 ST Array Strip, QPCR and immunohistochemistry we demonstrated that expression levels of Vsnl1 in the rat adrenal ZG are notably higher than in the fasciculata/reticularis zone. In QPCR assay this difference was approximately 10 times higher. Expression of this gene in the rat adrenal gland or adrenocortical cells was acutely down regulated by ACTH, while chronic administration of corticotrophin or dexamethasone did not change Vsnl1 mRNA levels. In enucleation-induced adrenocortical regeneration expression levels of both Vsnl1 and Cyp11b2 were notably lowered and positively correlated. Despite these findings, the physiological significance of adrenal Vsnl1 remains unclear, and requires further investigation. PMID:25451331

  9. The Drosophila melanogaster ade5 gene encodes a bifunctional enzyme for two steps in the de novo purine synthesis pathway.

    PubMed Central

    O'Donnell, A F; Tiong, S; Nash, D; Clark, D V


    Steps 6 and 7 of de novo purine synthesis are performed by 5-aminoimidazole ribonucleotide carboxylase (AIRc) and 4-[(N-succinylamino)carbonyl]-5-aminoimidazole ribonucleotide synthetase (SAICARs), respectively. In vertebrates, a single gene encodes AIRc-SAICARs with domains homologous to Escherichia coli PurE and PurC. We have isolated an AIRc-SAICARs cDNA from Drosophila melanogaster via functional complementation with an E. coli purC purine auxotroph. This cDNA encodes AIRc yet is unable to complement an E. coli purE mutant, suggesting functional differences between Drosophila and E. coli AIRc. In vertebrates, the AIRc-SAICARs gene shares a promoter region with the gene encoding phosphoribosylamidotransferase, which performs the first step in de novo purine synthesis. In Drosophila, the AIRc-SAICARs gene maps to section 11B4-14 of the X chromosome, while the phosphoribosylamidotransferase gene (Prat) maps to chromosome 3; thus, the close linkage of these two genes is not conserved in flies. Three EMS-induced X-linked adenine auxotrophic mutations, ade4(1), ade5(1), and ade5(2), were isolated. Two gamma-radiation-induced (ade5(3) and ade5(4)) and three hybrid dysgenesis-induced (ade5(5), ade5(6), and ade5(8)) alleles were also isolated. Characterization of the auxotrophy and the finding that the hybrid dysgenesis-induced mutations all harbor P transposon sequences within the AIRc-SAICARs gene show that ade5 encodes AIRc-SAICARs. PMID:10757766

  10. Transcriptome Sequencing of Gene Expression in the Brain of the HIV-1 Transgenic Rat

    PubMed Central

    Li, Ming D.; Cao, Junran; Wang, Shaolin; Wang, Ju; Sarkar, Sraboni; Vigorito, Michael; Ma, Jennie Z.; Chang, Sulie L.


    The noninfectious HIV-1 transgenic (HIV-1Tg) rat was developed as a model of AIDs-related pathology and immune dysfunction by manipulation of a noninfectious HIV-1gag-pol virus with a deleted 3-kb SphI-MscI fragment containing the 3′ -region of gag and the 5′ region of pol into F344 rats. Our previous studies revealed significant behavioral differences between HIV-1Tg and F344 control rats in their performance in the Morris water maze and responses to psychostimulants. However, the molecular mechanisms underlying these behavioral differences remain largely unknown. The primary goal of this study was to identify differentially expressed genes and enriched pathways affected by the gag-pol-deleted HIV-1 genome. Using RNA deep sequencing, we sequenced RNA transcripts in the prefrontal cortex, hippocampus, and striatum of HIV-1Tg and F344 rats. A total of 72 RNA samples were analyzed (i.e., 12 animals per group × 2 strains × 3 brain regions). Following deep-sequencing analysis of 50-bp paired-end reads of RNA-Seq, we used Bowtie/Tophat/Cufflinks suites to align these reads into transcripts based on the Rn4 rat reference genome and to measure the relative abundance of each transcript. Statistical analyses on each brain region in the two strains revealed that immune response- and neurotransmission-related pathways were altered in the HIV-1Tg rats, with brain region differences. Other neuronal survival-related pathways, including those encoding myelin proteins, growth factors, and translation regulators, were altered in the HIV-1Tg rats in a brain region-dependent manner. This study is the first deep-sequencing analysis of RNA transcripts associated the HIV-1Tg rat. Considering the functions of the pathways and brain regions examined in this study, our findings of abnormal gene expression patterns in HIV-1Tg rats suggest mechanisms underlying the deficits in learning and memory and vulnerability to drug addiction and other psychiatric disorders observed in HIV

  11. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    PubMed Central

    Jandova, Jana; Janda, Jaroslav; Sligh, James E


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-κB (NF-κB) is a key transcription factor for production of MMPs. An inhibitor of NF-κB activation, Bay11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-κB in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. PMID:22705584

  12. Temperature-sensitive albino gene TCD5, encoding a monooxygenase, affects chloroplast development at low temperatures.


    Wang, Yufeng; Zhang, Jianhui; Shi, Xiaoliang; Peng, Yu; Li, Ping; Lin, Dongzhi; Dong, Yanjun; Teng, Sheng


    Chloroplasts are essential for photosynthesis and play critical roles in plant development. In this study, we characterized the temperature-sensitive chlorophyll-deficient rice mutant tcd5, which develops albino leaves at low temperatures (20 °C) and normal green leaves at high temperatures (32 °C). The development of chloroplasts and etioplasts is impaired in tcd5 plants at 20 °C, and the temperature-sensitive period for the albino phenotype is the P4 stage of leaf development. The development of thylakoid membranes is arrested at the mid-P4 stage in tcd5 plants at 20 °C. We performed positional cloning of TCD5 and then complementation and knock-down experiments, and the results showed that the transcript LOC_Os05g34040.1 from the LOC_Os05g34040 gene corresponded to the tcd5 phenotype. TCD5 encodes a conserved plastid-targeted monooxygenase family protein which has not been previously reported associated with a temperature-sensitive albino phenotype in plants. TCD5 is abundantly expressed in young leaves and immature spikes, and low temperatures increased this expression. The transcription of some genes involved in plastid transcription/translation and photosynthesis varied in the tcd5 mutant. Although the phenotype and temperature dependence of the TCD5 orthologous mutant phenotype were different in rice and Arabidopsis, OsTCD5 could rescue the phenotype of the Arabidopsis mutant, suggesting that TCD5 function is conserved between monocots and dicots. PMID:27531886

  13. Temperature-sensitive albino gene TCD5, encoding a monooxygenase, affects chloroplast development at low temperatures

    PubMed Central

    Wang, Yufeng; Zhang, Jianhui; Shi, Xiaoliang; Peng, Yu; Li, Ping; Lin, Dongzhi; Dong, Yanjun; Teng, Sheng


    Chloroplasts are essential for photosynthesis and play critical roles in plant development. In this study, we characterized the temperature-sensitive chlorophyll-deficient rice mutant tcd5, which develops albino leaves at low temperatures (20 °C) and normal green leaves at high temperatures (32 °C). The development of chloroplasts and etioplasts is impaired in tcd5 plants at 20 °C, and the temperature-sensitive period for the albino phenotype is the P4 stage of leaf development. The development of thylakoid membranes is arrested at the mid-P4 stage in tcd5 plants at 20 °C. We performed positional cloning of TCD5 and then complementation and knock-down experiments, and the results showed that the transcript LOC_Os05g34040.1 from the LOC_Os05g34040 gene corresponded to the tcd5 phenotype. TCD5 encodes a conserved plastid-targeted monooxygenase family protein which has not been previously reported associated with a temperature-sensitive albino phenotype in plants. TCD5 is abundantly expressed in young leaves and immature spikes, and low temperatures increased this expression. The transcription of some genes involved in plastid transcription/translation and photosynthesis varied in the tcd5 mutant. Although the phenotype and temperature dependence of the TCD5 orthologous mutant phenotype were different in rice and Arabidopsis, OsTCD5 could rescue the phenotype of the Arabidopsis mutant, suggesting that TCD5 function is conserved between monocots and dicots. PMID:27531886

  14. Biochemical Characterization of Two Thermostable Xylanolytic Enzymes Encoded by a Gene Cluster of Caldicellulosiruptor owensensis

    PubMed Central

    Mi, Shuofu; Jia, Xiaojing; Wang, Jinzhi; Qiao, Weibo; Peng, Xiaowei; Han, Yejun


    The xylanolytic extremely thermophilic bacterium Caldicellulosiruptor owensensis provides a promising platform for xylan utilization. In the present study, two novel xylanolytic enzymes, GH10 endo-β-1,4-xylanase (Coxyn A) and GH39 β-1,4-xylosidase (Coxyl A) encoded in one gene cluster of C.owensensis were heterogeneously expressed and biochemically characterized. The optimum temperature of the two xylanlytic enzymes was 75°C, and the respective optimum pH for Coxyn A and Coxyl A was 7.0 and 5.0. The difference of Coxyn A and Coxyl A in solution was existing as monomer and homodimer respectively, it was also observed in predicted secondary structure. Under optimum condition, the catalytic efficiency (kcat/Km) of Coxyn A was 366 mg ml−1 s−1 on beechwood xylan, and the catalytic efficiency (kcat/Km) of Coxyl A was 2253 mM−1 s−1 on pNP-β-D-xylopyranoside. Coxyn A degraded xylan to oligosaccharides, which were converted to monomer by Coxyl A. The two intracellular enzymes might be responsible for xylooligosaccharides utilization in C.owensensis, also provide a potential way for xylan degradation in vitro. PMID:25127169

  15. Multiple pathways regulate the expression of genes encoding sodium channel subunits in developing neurons.


    Giraud, P; Alcaraz, G; Jullien, F; Sampo, B; Jover, E; Couraud, F; Dargent, B


    In primary cultures of fetal neurons, activation of sodium channels with either alpha-scorpion toxin or veratridine caused a rapid and persistent decrease of mRNAs encoding beta2 and different sodium channel alpha mRNAs. In contrast, beta1 subunit mRNA was up-regulated by sodium channel activation. This phenomenon was calcium-independent. The effects of activating toxins on mRNAs of different sodium channel subunits were mimicked by membrane depolarization. An important aspect of this study was the demonstration that cAMP also caused rapid reduction of alphaI, alphaII and alphaIII mRNA levels whereas beta1 subunit mRNA was up regulated and beta2 subunit mRNA was not affected. Sodium channel activation by veratridine was shown to increase cAMP immunoreactivity in cultured neurons, but alphaII mRNA down-regulation induced by activating toxins was not reversed by protein kinase A antagonists, indicating that this phenomenon is not protein kinase A dependent. The effects of cAMP and membrane depolarisation were antagonized by the PKA inhibitor H89. These results are indicative of the existence of multiple and independent regulatory pathways modulating the expression of sodium channel genes in the developing central nervous system. PMID:9602139

  16. Identification and characterization of a gene encoding a vertebrate-type carbonic anhydrase in cyanobacteria.

    PubMed Central

    Soltes-Rak, E; Mulligan, M E; Coleman, J R


    A gene (designated ecaA) encoding a vertebrate-like (alpha-type) carbonic anhydrase (CA) has been isolated from two disparate cyanobacteria, Anabaena sp. strain PCC 7120 and Synechococcus sp. strain PCC 7942. The deduced amino acid sequences correspond to proteins of 29 and 26 kDa, respectively, and revealed significant sequence similarity to human CAI and CAII, as well as Chlamydomonas CAHI, including conservation of most active-site residues identified in the animal enzymes. Structural similarities between the animal and cyanobacterial enzymes extend to the levels of antigenicity, as the Anabaena protein cross-reacts with antisera derived against chicken CAII. Expression of the cyanobacterial ecaA is regulated by CO2 concentration and is highest in cells grown at elevated levels of CO2. Immunogold localization using an antibody derived against the ecaA protein indicated an extracellular location. Preliminary analysis of Synechococcus mutants in which ecaA has been inactivated by insertion of a drug resistance cassette suggests that extracellular carbonic anhydrase plays a role in inorganic-carbon accumulation by maintaining equilibrium levels of CO2 and HCO3- in the periplasm. PMID:9006032

  17. Evolution-guided functional analyses reveal diverse antiviral specificities encoded by IFIT1 genes in mammals

    PubMed Central

    Daugherty, Matthew D; Schaller, Aaron M; Geballe, Adam P; Malik, Harmit S


    IFIT (interferon-induced with tetratricopeptide repeats) proteins are critical mediators of mammalian innate antiviral immunity. Mouse IFIT1 selectively inhibits viruses that lack 2'O-methylation of their mRNA 5' caps. Surprisingly, human IFIT1 does not share this antiviral specificity. Here, we resolve this discrepancy by demonstrating that human and mouse IFIT1 have evolved distinct functions using a combination of evolutionary, genetic and virological analyses. First, we show that human IFIT1 and mouse IFIT1 (renamed IFIT1B) are not orthologs, but are paralogs that diverged >100 mya. Second, using a yeast genetic assay, we show that IFIT1 and IFIT1B proteins differ in their ability to be suppressed by a cap 2'O-methyltransferase. Finally, we demonstrate that IFIT1 and IFIT1B have divergent antiviral specificities, including the discovery that only IFIT1 proteins inhibit a virus encoding a cap 2'O-methyltransferase. These functional data, combined with widespread turnover of mammalian IFIT genes, reveal dramatic species-specific differences in IFIT-mediated antiviral repertoires. DOI: PMID:27240734

  18. Regulation of the ahpC Gene Encoding Alkyl Hydroperoxide Reductase in Mycobacterium smegmatis

    PubMed Central

    Lee, Ha-Na; Lee, Na-On; Han, Seung J.; Ko, In-Jeong; Oh, Jeong-Il


    The ahpC (MSMEG_4891) gene encodes alkyl hydroperoxide reductase C in Mycobacterium smegmatis mc2155 and its expression is induced under oxidative stress conditions. Two well-defined inverted repeat sequences (IR1 and IR2) were identified in the upstream region of ahpC. Using a crp (cAMP receptor protein: MSMEG_6189) mutant and in vitro DNA-binding assay, it was demonstrated that the IR1 sequence serves as a Crp-binding site and that Crp functions as an activator in the regulation of ahpC expression. The expression level of ahpC was shown to be proportional to intracellular cAMP levels. Intracellular levels of cAMP were increased in M. smegmatis, when it was treated with oxidative stress inducers. The IR2 sequence is very similar to the known consensus sequence of FurA-binding sites and involved in the negative regulation of ahpC expression. Taken together, these results suggest that the induction of ahpC expression under oxidative stress conditions probably results from a combinatory effect of both inactivation of FurA by oxidative stress and activation of Crp in response to increased levels of cAMP. PMID:25365321

  19. Evolution-guided functional analyses reveal diverse antiviral specificities encoded by IFIT1 genes in mammals.


    Daugherty, Matthew D; Schaller, Aaron M; Geballe, Adam P; Malik, Harmit S


    IFIT (interferon-induced with tetratricopeptide repeats) proteins are critical mediators of mammalian innate antiviral immunity. Mouse IFIT1 selectively inhibits viruses that lack 2'O-methylation of their mRNA 5' caps. Surprisingly, human IFIT1 does not share this antiviral specificity. Here, we resolve this discrepancy by demonstrating that human and mouse IFIT1 have evolved distinct functions using a combination of evolutionary, genetic and virological analyses. First, we show that human IFIT1 and mouse IFIT1 (renamed IFIT1B) are not orthologs, but are paralogs that diverged >100 mya. Second, using a yeast genetic assay, we show that IFIT1 and IFIT1B proteins differ in their ability to be suppressed by a cap 2'O-methyltransferase. Finally, we demonstrate that IFIT1 and IFIT1B have divergent antiviral specificities, including the discovery that only IFIT1 proteins inhibit a virus encoding a cap 2'O-methyltransferase. These functional data, combined with widespread turnover of mammalian IFIT genes, reveal dramatic species-specific differences in IFIT-mediated antiviral repertoires. PMID:27240734

  20. Molecular Cloning and Characterization of Two Genes Encoding Dihydroflavonol-4-Reductase from Populus trichocarpa

    PubMed Central

    Jia, Zhichun; Yang, Li; Sun, Yimin; Xiao, Xunyan; Song, Feng; Luo, Keming


    Dihydroflavonol 4-reductase (DFR, EC is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins) that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum) via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr.) resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars. PMID:22363429

  1. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains.


    Jespersen, Jakob S; Wang, Christian W; Mkumbaye, Sixbert I; Minja, Daniel Tr; Petersen, Bent; Turner, Louise; Petersen, Jens Ev; Lusingu, John Pa; Theander, Thor G; Lavstsen, Thomas


    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding human endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction. PMID:27354391

  2. Expression and regulation of genes encoding lignocellulose-degrading activity in the genus Phanerochaete.


    MacDonald, Jacqueline; Suzuki, Hitoshi; Master, Emma R


    As white-rot basidiomycetes, Phanerochaete species are critical to the cycling of carbon sequestered as woody biomass, and are predicted to encode many enzymes that can be harnessed to promote the conversion of lignocellulose to sugars for fermentation to fuels and chemicals. Advances in genomic, transcriptomic, and proteomic technologies have enabled detailed analyses of different Phanerochaete species and have revealed numerous enzyme families required for lignocellulose utilization, as well as insight into the regulation of corresponding genes. Recent studies of Phanerochaete are also exemplified by molecular analyses following cultivation on different wood preparations, and show substrate-dependent responses that were difficult to predict using model compounds or isolated plant polysaccharides. The aim of this mini-review is to synthesize results from studies that have applied recent advances in molecular tools to evaluate the expression and regulation of proteins that contribute to lignocellulose conversion in Phanerochaete species. The identification of proteins with as yet unknown function are also highlighted and noted as important targets for future investigation of white-rot decay. PMID:22391967

  3. A novel GDNF-inducible gene, BMZF3, encodes a transcriptional repressor associated with KAP-1

    SciTech Connect

    Suzuki, Chikage; Murakumo, Yoshiki Kawase, Yukari; Sato, Tomoko; Morinaga, Takatoshi; Fukuda, Naoyuki; Enomoto, Atsushi; Ichihara, Masatoshi; Takahashi, Masahide


    The Krueppel-associated box (KRAB)-containing zinc finger proteins (ZFPs) comprise the largest family of zinc finger transcription factors that function as transcriptional repressors. In the study of glial cell line-derived neurotrophic factor (GDNF)-RET signaling, we have identified bone marrow zinc finger 3 (BMZF3), encoding a KRAB-ZFP, as a GDNF-inducible gene by differential display analysis. The expression of BMZF3 transcripts in the human neuroblastoma cell line TGW increased 1 h after GDNF stimulation, as determined by Northern blotting and quantitative reverse-transcriptase polymerase chain reaction. The BMZF3 possesses transcriptional repressor activity in the KRAB domain. BMZF3 interacts with a co-repressor protein, KRAB-associated protein 1 (KAP-1), through the KRAB domain and siRNA-mediated knockdown of KAP-1 abolished the transcriptional repressor activity of BMZF3, indicating that KAP-1 is necessary for BMZF3 function. Furthermore, siRNA-mediated silencing of BMZF3 inhibited cell proliferation. These findings suggest that BMZF3 is a transcriptional repressor induced by GDNF that plays a role in cell proliferation.

  4. The UVS9 gene of Chlamydomonas encodes an XPG homolog with a new conserved domain.


    Deitsch, Erin; Hibbard, Erin M; Petersen, Jason L


    Nucleotide excision repair (NER) is a key pathway for removing DNA damage that destabilizes the DNA double helix. During NER a protein complex coordinates to cleave the damaged DNA strand on both sides of the damage. The resulting lesion-containing oligonucleotide is displaced from the DNA and a replacement strand is synthesized using the undamaged strand as template. Ultraviolet (UV) light is known to induce two primary forms of DNA damage, the cyclobutane pyrimidine dimer and the 6-4 photoproduct, both of which destabilize the DNA double helix. The uvs9 strain of Chlamydomonas reinhardtii was isolated based on its sensitivity to UV light and was subsequently shown to have a defect in NER. In this work, the UVS9 gene was cloned through molecular mapping and shown to encode a homolog of XPG, the structure-specific nuclease responsible for cleaving damaged DNA strands 3' to sites of damage during NER. 3' RACE revealed that the UVS9 transcript is alternatively polyadenylated. The predicted UVS9 protein is nearly twice as long as other XPG homologs, primarily due to an unusually long spacer region. Despite this difference, amino acid sequence alignment of UVS9p with XPG homologs revealed a new conserved domain involved in TFIIH interaction. PMID:26658142

  5. The rice FISH BONE gene encodes a tryptophan aminotransferase, which affects pleiotropic auxin-related processes.


    Yoshikawa, Takanori; Ito, Momoyo; Sumikura, Tsuyoshi; Nakayama, Akira; Nishimura, Takeshi; Kitano, Hidemi; Yamaguchi, Isomaro; Koshiba, Tomokazu; Hibara, Ken-Ichiro; Nagato, Yasuo; Itoh, Jun-Ichi


    Auxin is a fundamental plant hormone and its localization within organs plays pivotal roles in plant growth and development. Analysis of many Arabidopsis mutants that were defective in auxin biosynthesis revealed that the indole-3-pyruvic acid (IPA) pathway, catalyzed by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) and YUCCA (YUC) families, is the major biosynthetic pathway of indole-3-acetic acid (IAA). In contrast, little information is known about the molecular mechanisms of auxin biosynthesis in rice. In this study, we identified a auxin-related rice mutant, fish bone (fib). FIB encodes an orthologue of TAA genes and loss of FIB function resulted in pleiotropic abnormal phenotypes, such as small leaves with large lamina joint angles, abnormal vascular development, small panicles, abnormal organ identity and defects in root development, together with a reduction in internal IAA levels. Moreover, we found that auxin sensitivity and polar transport activity were altered in the fib mutant. From these results, we suggest that FIB plays a pivotal role in IAA biosynthesis in rice and that auxin biosynthesis, transport and sensitivity are closely interrelated. PMID:24654985

  6. Identification and characterization of a cellulase-encoding gene from the buffalo rumen metagenomic library.


    Nguyen, Nhung Hong; Maruset, Lalita; Uengwetwanit, Tanaporn; Mhuantong, Wuttichai; Harnpicharnchai, Piyanun; Champreda, Verawat; Tanapongpipat, Sutipa; Jirajaroenrat, Kanya; Rakshit, Sudip K; Eurwilaichitr, Lily; Pongpattanakitshote, Somchai


    Microorganisms residing in the rumens of cattle represent a rich source of lignocellulose-degrading enzymes, since their diet consists of plant-based materials that are high in cellulose and hemicellulose. In this study, a metagenomic library was constructed from buffalo rumen contents using pCC1FOS fosmid vector. Ninety-three clones from the pooled library of approximately 10,000 clones showed degrading activity against AZCL-HE-Cellulose, whereas four other clones showed activity against AZCL-Xylan. Contig analysis of pyrosequencing data derived from the selected strongly positive clones revealed 15 ORFs that were closely related to lignocellulose-degrading enzymes belonging to several glycosyl hydrolase families. Glycosyl hydrolase family 5 (GHF5) was the most abundant glycosyl hydrolase found, and a majority of the GHF5s in our metagenomes were closely related to several ruminal bacteria, especially ones from other buffalo rumen metagenomes. Characterization of BT-01, a selected clone with highest cellulase activity from the primary plate screening assay, revealed a cellulase encoding gene with optimal working conditions at pH 5.5 at 50 °C. Along with its stability over acidic pH, the capability efficiently to hydrolyze cellulose in feed for broiler chickens, as exhibited in an in vitro digestibility test, suggests that BT-01 has potential application as a feed supplement. PMID:22790926

  7. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.


    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming


    Proline dehydrogenase (ProDH) (EC is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response. PMID:25502926

  8. Mechanism of expression of the rat HCNP precursor protein gene.


    Tohdoh, N; Tojo, S; Kimura, M; Ishii, T; Ojika, K


    The hippocampal cholinergic neurostimulating peptide (HCNP), isolated from hippocampal tissue of 10- to 12-day-old rats, enhances the in vitro synthesis of acetylcholine in medial septal tissue explants. The HCNP precursor is a 21 kDa protein that binds hydrophobic ligands and Mg-ATP, and is associated with the opioid-binding protein. We employed an HCNP-precursor cDNA as probe to clone the genomic DNA, used for mapping of the exon-intron structure of the gene. We also determined the nucleotide structure of the promoter region of the rat HCNP precursor protein gene. By using S1 mapping and CAT as a reporter, we found multiple promoters that were aligned in the 5' untranslated region. In addition, the presence of several putative enhancer binding sequences were tested by electrophoresis mobility shift assays. Northern blot analysis revealed that the gene is expressed in a variety of rat tissues and various subregions of the brain. These results suggest that HCNP-precursor gene expression is regulated by a general transactivation factor such as SP1, and that the specific presence of the bioactive HCNP in certain tissues results from post-translational events such as proteolytic processing of the precursor protein, which takes place predominantly in the hippocampus of young rats. PMID:9105667

  9. Predominance of a Versatile-Peroxidase-Encoding Gene, mnp4, as Demonstrated by Gene Replacement via a Gene Targeting System for Pleurotus ostreatus

    PubMed Central

    Salame, Tomer M.; Knop, Doriv; Tal, Dana; Levinson, Dana; Yarden, Oded


    Pleurotus ostreatus (the oyster mushroom) and other white rot filamentous basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a commercially important edible fungus with medicinal properties and is important for biotechnological and environmental applications. Efficient gene targeting via homologous recombination (HR) is a fundamental tool for facilitating comprehensive gene function studies. Since the natural HR frequency in Pleurotus transformations is low (2.3%), transformed DNA is predominantly integrated ectopically. To overcome this limitation, a general gene targeting system was developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using carboxin resistance complemented by the development of a protocol for hygromycin B resistance protoplast-based DNA transformation and homokaryon isolation. The Δku80 strain exhibited exclusive (100%) HR in the integration of transforming DNA, providing a high efficiency of gene targeting. Furthermore, the Δku80 strains produced showed a phenotype similar to that of the wild-type PC9 strain, with similar growth fitness, ligninolytic functionality, and capability of mating with the incompatible strain PC15 to produce a dikaryon which retained its resistance to the corresponding selection and was capable of producing typical fruiting bodies. The applicability of this system is demonstrated by inactivation of the versatile peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of P. ostreatus, being one of the nine members of the manganese-peroxidase (MnP) gene family, and is the predominantly expressed VP in Mn2+-deficient media. mnp4 inactivation provided a direct proof that mnp4 encodes a key VP responsible for the Mn2+-dependent and Mn2+-independent peroxidase activity under Mn2+-deficient culture conditions. PMID:22636004

  10. Inactivation of the Neurospora Crassa Gene Encoding the Mitochondrial Protein Import Receptor Mom19 by the Technique of ``sheltered Rip''

    PubMed Central

    Harkness, TAA.; Metzenberg, R. L.; Schneider, H.; Lill, R.; Neupert, W.; Nargang, F. E.


    We have used a technique referred to as ``sheltered RIP'' (repeat induced point mutation) to create mutants of the mom-19 gene of Neurospora crassa, which encodes an import receptor for nuclear encoded mitochondrial precursor proteins. Sheltered RIP permits the isolation of a mutant gene in one nucleus, even if that gene is essential for the survival of the organism, by sheltering the nucleus carrying the mutant gene in a heterokaryon with an unaffected nucleus. Furthermore, the nucleus harboring the RIPed gene contains a selectable marker so that it is possible to shift nuclear ratios in the heterokaryons to a state in which the nucleus containing the RIPed gene predominates in cultures grown under selective conditions. This results in a condition where the target gene product should be present at very suboptimal levels and allows the study of the mutant phenotype. One allele of mom-19 generated by this method contains 44 transitions resulting in 18 amino acid substitutions. When the heterokaryon containing this allele was grown under conditions favoring the RIPed nucleus, no MOM19 protein was detectable in the mitochondria of the strain. Homokaryotic strains containing the RIPed allele exhibit a complex and extremely slow growth phenotype suggesting that the product of the mom-19 gene is important in N. crassa. PMID:8138148

  11. Dietary sucrose enhances intestinal lactase gene expression in euthyroid rats.


    Kuranuki, Sachi; Mochizuki, Kazuki; Goda, Toshinao


    It is postulated that dietary carbohydrates and thyroid hormones are major regulators for expression of the lactase/phlorizin hydrolase (LPH) gene in rat jejunum. In this study, we investigated the effects of thyroid hormones and dietary sucrose on LPH gene expression and lactase activity in starved rats. Firstly, animals at 8 wk of age were fed a low-starch diet (5.5% energy as cornstarch) or high-starch diet (71% energy as cornstarch) for 7 d (experiment 1). The mRNA level of LPH as well as lactase activity significantly decreased in rats fed the low-starch diet as compared to those fed the high-starch diet. To investigate the effects of thyroid hormone status, the animals previously fed the low-starch diet were starved for 3 d, and half of the animals were given intraperitoneal (i.p.) injections of 20 microg/ 100 g body weight triiodothyronine (T3) twice daily (experiment 2). The LPH mRNA level and lactase activity were elevated by starvation for 3 d, but they were repressed by the injection of T3 during starvation. To investigate the effects of dietary sucrose in starved rats, they were force-fed a sucrose diet for 6 h (experiment 3). The LPH gene expression and lactase activity were up-regulated by force-feeding a sucrose diet, only when the animals were kept in euthyroid status by daily T3 administrations. In contrast, the sucrase-isomaltase mRNA levels and sucrase activity were unaffected by force-feeding the sucrose diet for both T3-treated and untreated starved rats. Our work suggests that dietary sucrose is capable of enhancing lactase gene expression in starved rats when they have a sustainable thyroid hormone level. PMID:17190105

  12. Biochemical and genetic characterization of the dominant positive element driving transcription ofthe yeast TBP-encoding gene, SPT15.


    Schroeder, S C; Weil, P A


    We previously demonstrated that a combination of both positive and negative cis -acting upstream elements control the transcription of the gene encoding TBP ( SPT15 ) in Saccharomyces cerevisiae . One of these elements found in that study, resident between 5' flanking sequences -147 and -128 , and termed PED (for positive element distal), was found to play an essential positive role in driving transcription of the gene encoding TBP. In this report, we map at nucleotide-level resolution, the critical residues which comprise PED, purify and sequence the protein that binds to it and determine that this PED binding factor is Abf1p, an abundant yeast protein previously broadly implicated in both gene regulation and DNA replication. In the case of the TBP-encoding gene, however, Abf1p works through the PED element which is a non-consensus binding site. Based upon the work of others, the PED-variant ABF1 site would be predicted to be a very poor binding site for this factor yet Abf1p binds PED and a consensus ABF1 site with comparable affinity. These results are discussed in light of the broader context of Abf1p-mediated gene regulation. PMID:9722639

  13. YY1 and Sp1 activate transcription of the human NDUFS8 gene encoding the mitochondrial complex I TYKY subunit.


    Lescuyer, Pierre; Martinez, Pascal; Lunardi, Joël


    Complex I is the most complicated of the multimeric enzymes that constitute the mitochondrial respiratory chain. It is encoded by both mitochondrial and nuclear genomes. We have previously characterized the human NDUFS8 gene that encodes the TYKY subunit. This essential subunit is thought to participate in the electron transfer and proton pumping activities of complex I. Here, we have analyzed the transcriptional regulation of the NDUFS8 gene. Using primer extension assays, we have identified two transcription start sites. The basal promoter was mapped to a 247 bp sequence upstream from the main transcription start site by reporter gene analysis in HeLa cells and in differentiated or non-differentiated C2C12 cells. Three Sp1 sites and one YY1 site were identified in this minimal promoter. Through gel shift analysis, all sites were shown to bind to their cognate transcription factors. Site-directed mutagenesis revealed that the YY1 site and two upstream adjacent Sp1 sites drive most of the promoter activity. This work represents the first promoter analysis for a complex I gene. Together with previous studies, our results indicate that YY1 and Sp1 control the expression of genes encoding proteins that are involved in almost all steps of the oxidative phosphorylation metabolism. PMID:11955626

  14. Environmental regulation of virulence in group A streptococci: transcription of the gene encoding M protein is stimulated by carbon dioxide.

    PubMed Central

    Caparon, M G; Geist, R T; Perez-Casal, J; Scott, J R


    We have found that different atmospheres can have significant effects on the transcription of emm, the gene that encodes M protein, the major virulence factor of the group A streptococcus (Streptococcus pyogenes). Expression of emm was monitored by constructing a transcriptional fusion of the promoter for emm6.1 from S. pyogenes JRS4 to a promoterless chloramphenicol acetyltransferase gene. Transcription, as measured by determining chloramphenicol acetyltransferase specific activity, was stimulated by as much as 25-fold by increased carbon dioxide tension. Expression was greater in the latter stages of growth and was not affected by growth at 30 instead of 37 degrees C. Insertional inactivation of mry, a gene encoding a positive regulator of emm6.1, reduced chloramphenicol acetyltransferase activity below the detectable level. We conclude that expression of emm is influenced by environmental factors and that the level of carbon dioxide is one signal that may influence expression of M protein during infection. Images PMID:1512202

  15. Determination of ligand-binding specificity by alternative splicing: Two distinct growth factor receptors encoded by a single gene

    SciTech Connect

    Miki, T.; Bottaro, D.P.; Fleming, T.P.; Smith, C.L.; Chan, A.M.L.; Aaronson, S.A. ); Burgess, W.H. )


    Expression cDNA cloning and structural analysis of the human keratinocyte growth factor receptor (KGFR) revealed identity with one of the fibroblast growth factor (FGF) receptors encoded by the bek gene (FGFR-2), except for a divergent stretch of 49 amino acids in their extracellular domains. Binding assays demonstrated that the KGFR was a high-affinity receptor for both KGF and acidic FGF, while FGFR-2 showed high affinity for basic and acidic FGF but no detectable binding by KGF. Genomic analysis of the bek gene revealed two alternative exons responsible for the region of divergence between the two receptors. The KGFR transcript was specific to epithelial cells, and it appeared to be differentially regulated with respect to the alternative FGFR-2 transcript. Thus, two growth factor receptors with different ligand-binding specificities and expression patterns are encoded by alternative transcripts of the same gene.

  16. Identification of the TRM2 gene encoding the tRNA(m5U54)methyltransferase of Saccharomyces cerevisiae.

    PubMed Central

    Nordlund, M E; Johansson, J O; von Pawel-Rammingen, U; Byström, A S


    The presence of 5-methyluridine (m5U) at position 54 is a ubiquitous feature of most bacterial and eukaryotic elongator tRNAs. In this study, we have identified and characterized the TRM2 gene that encodes the tRNA(m5U54)methyltransferase, responsible for the formation of this modified nucleoside in Saccharomyces cerevisiae. Transfer RNA isolated from TRM2-disrupted yeast strains does not contain the m5U54 nucleoside. Moreover, a glutathione S-transferase (GST) tagged recombinant, Trm2p, expressed in Escherichia coli displayed tRNA(m5U54)methyltransferase activity using as substrate tRNA isolated from a trm2 mutant strain, but not tRNA isolated from a TRM2 wild-type strain. In contrast to what is found for the tRNA(m5U54)methyltransferase encoding gene trmA+ in E. coli, the TRM2 gene is not essential for cell viability and a deletion strain shows no obvious phenotype. Surprisingly, we found that the TRM2 gene was previously identified as the RNC1/NUD1 gene, believed to encode the yNucR endo-exonuclease. The expression and activity of the yNucR endo-exonuclease is dependent on the RAD52 gene, and does not respond to increased gene dosage of the RNC1/NUD1 gene. In contrast, we find that the expression of a trm2-LacZ fusion and the activity of the tRNA(m5U54)methyltransferase is not regulated by the RAD52 gene and does respond on increased gene dosage of the TRM2 (RNC1/NUD1) gene. Furthermore, there was no nuclease activity associated with a GST-Trm2 recombinant protein. The purified yNucR endo-exonuclease has been reported to have an NH2-D-E-K-N-L motif, which is not found in the Trm2p. Therefore, we suggest that the yNucR endo-exonuclease is encoded by a gene other than TRM2. PMID:10864043

  17. Serial analysis of gene expression (SAGE) in rat liver regeneration

    SciTech Connect

    Cimica, Velasco . E-mail:; Batusic, Danko; Haralanova-Ilieva, Borislava; Chen, Yonglong; Hollemann, Thomas; Pieler, Tomas; Ramadori, Giuliano


    We have applied serial analysis of gene expression for studying the molecular mechanism of the rat liver regeneration in the model of 70% partial hepatectomy. We generated three SAGE libraries from a normal control liver (NL library: 52,343 tags), from a sham control operated liver (Sham library: 51,028 tags), and from a regenerating liver (PH library: 53,061 tags). By SAGE bioinformatics analysis we identified 40 induced genes and 20 repressed genes during the liver regeneration. We verified temporal expression of such genes by real time PCR during the regeneration process and we characterized 13 induced genes and 3 repressed genes. We found connective tissue growth factor transcript and protein induced very early at 4 h after PH operation before hepatocytes proliferation is triggered. Our study suggests CTGF as a growth factor signaling mediator that could be involved directly in the mechanism of liver regeneration induction.

  18. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins.


    Aminov, R I; Garrigues-Jeanjean, N; Mackie, R I


    Phylogenetic analysis of tetracycline resistance genes encoding the ribosomal protection proteins (RPPs) revealed the monophyletic origin of these genes. The most deeply branching class, exemplified by tet and otrA, consisted of genes from the antibiotic-producing organisms Streptomyces rimosus and Streptomyces lividans. With a high degree of confidence, the corresponding genes of the other seven classes (Tet M, Tet S, Tet O, Tet W, Tet Q, Tet T, and TetB P) formed phylogenetically distinct separate clusters. Based on this phylogenetic analysis, a set of PCR primers for detection, retrieval, and sequence analysis of the corresponding gene fragments from a variety of bacterial and environmental sources was developed and characterized. A pair of degenerate primers targeted all tetracycline resistance genes encoding RPPs except otrA and tet, and seven other primer pairs were designed to target the specific classes. The primers were used to detect the circulation of these genes in the rumina of cows, in swine feed and feces, and in swine fecal streptococci. Classes Tet O and Tet W were found in the intestinal contents of both animals, while Tet M was confined to pigs and Tet Q was confined to the rumen. The tet(O) and tet(W) genes circulating in the microbiota of the rumen and the gastrointestinal tract of pigs were identical despite the differences in animal hosts and antibiotic use regimens. Swine fecal streptococci uniformly possessed the tet(O) gene, and 22% of them also carried tet(M). This population could be considered one of the main reservoirs of these two resistance genes in the pig gastrointestinal tract. All classes of RPPs except Tet T and TetB P were found in the commercial components of swine feed. This is the first demonstration of the applicability of molecular ecology techniques to estimation of the gene pool and the flux of antibiotic resistance genes in production animals. PMID:11133424

  19. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  20. A testis-specific gene within a widely expressed gene: Contrasting evolutionary patterns of two differentially expressed mammalian proteins encoded by a single gene, CAMK4.


    Padhi, Abinash; Ma, Li


    Understanding the patterns of genetic variations within fertility-related genes and the evolutionary forces that shape such variations is crucial in predicting the fitness landscapes of subsequent generations. This study reports distinct evolutionary features of two differentially expressed mammalian proteins [CaMKIV (Ca(2+) /calmodulin-dependent protein kinase IV) and CaS (calspermin)] that are encoded by a single gene, CAMK4. The multifunctional CaMKIV, which is expressed in multiple tissues including testis and ovary, is evolving at a relatively low rate (0.46-0.64 × 10(-9) nucleotide substitutions/site/year), whereas the testis-specific CaS gene, which is predominantly expressed in post-meiotic cells, evolves at least three to four times faster (1.48-1.98 × 10(-9) substitutions/site/year). Concomitantly, maximum-likelihood-based selection analyses revealed that the ubiquitously expressed CaMKIV is constrained by intense purifying selection and, therefore, remained functionally highly conserved throughout the mammalian evolution, whereas the testis-specific CaS gene is under strong positive selection. The substitution rates of different mammalian lineages within both genes are positively correlated with GC content, indicating the possible influence of GC-biased gene conversion on the estimated substitution rates. The observation of such unusually high GC content of the CaS gene (≈74%), particularly in the lineage that comprises the bovine species, suggests the possible role of GC-biased gene conversion in the evolution of CaS that mimics positive selection. PMID:26388303

  1. Tyrosine triple mutated AAV2-BDNF gene therapy in a rat model of transient IOP elevation

    PubMed Central

    Igarashi, Tsutomu; Kobayashi, Maika; Kameya, Shuhei; Fujimoto, Chiaki; Nakamoto, Kenji; Takahashi, Hisatomo; Igarashi, Toru; Miyake, Noriko; Iijima, Osamu; Hirai, Yukihiko; Shimada, Takashi; Okada, Takashi; Takahashi, Hiroshi


    Purpose We examined the neuroprotective effects of exogenous brain-derived neurotrophic factor (BDNF), which provides protection to retinal ganglion cells (RGCs) in rodents, in a model of transient intraocular pressure (IOP) elevation using a mutant (triple Y-F) self-complementary adeno-associated virus type 2 vector encoding BDNF (tm-scAAV2-BDNF). Methods The tm-scAAV2-BDNF or control vector encoding green fluorescent protein (GFP; tm-scAAV2-GFP) was intravitreally administered to rats, which were then divided into four groups: control, ischemia/reperfusion (I/R) injury only, I/R injury with tm-scAAV2-GFP, and tm-scAAV2-BDNF. I/R injury was then induced by transiently increasing IOP, after which the rats were euthanized to measure the inner retinal thickness and cell counts in the RGC layer. Results Intravitreous injection of tm-scAAV2-BDNF resulted in high levels of BDNF expression in the neural retina. Histological analysis showed that the inner retinal thickness and cell numbers in the RGC layer were preserved after transient IOP elevation in eyes treated with tm-scAAV2-BDNF but not in the other I/R groups. Significantly reduced glial fibrillary acidic protein (GFAP) immunostaining after I/R injury in the rats that received tm-scAAV2-BDNF indicated reduced retinal stress, and electroretinogram (ERG) analysis confirmed preservation of retinal function in the tm-scAAV2-BDNF group. Conclusions These results demonstrate the feasibility and effectiveness of neuroprotective gene therapy using tm-scAAV2-BDNF to protect the inner retina from transiently high intraocular pressure. An in vivo gene therapeutic approach to the clinical management of retinal diseases in conditions such as glaucoma, retinal artery occlusion, hypertensive retinopathy, and diabetic retinopathy thus appears feasible. PMID:27440998

  2. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    SciTech Connect

    Jandova, Jana; Janda, Jaroslav; Sligh, James E


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  3. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.


    Kim, Eunseong; Kim, Yonggyun


    Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV) and bracovirus (BV). In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF). The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13) homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14) of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV) was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF. PMID:27598941

  4. Emergence of Staphylococcus aureus carrying multiple drug resistance genes on a plasmid encoding exfoliative toxin B.


    Hisatsune, Junzo; Hirakawa, Hideki; Yamaguchi, Takayuki; Fudaba, Yasuyuki; Oshima, Kenshiro; Hattori, Masahira; Kato, Fuminori; Kayama, Shizuo; Sugai, Motoyuki


    We report the complete nucleotide sequence and analysis of pETBTY825, a Staphylococcus aureus TY825 plasmid encoding exfoliative toxin B (ETB). S. aureus TY825 is a clinical isolate obtained from an impetigo patient in 2002. The size of pETBTY825, 60.6 kbp, was unexpectedly larger than that of the archetype pETBTY4 (∼30 kbp). Genomic comparison of the plasmids shows that pETBTY825 has the archetype pETBTY4 as the backbone and has a single large extra DNA region of 22.4 kbp. The extra DNA region contains genes for resistance to aminoglycoside [aac(6')/aph(2″)], macrolide (msrA), and penicillin (blaZ). A plasmid deletion experiment indicated that these three resistance elements were functionally active. We retrospectively examined the resistance profile of the clinical ETB-producing S. aureus strains isolated in 1977 to 2007 using a MIC determination with gentamicin (GM), arbekacin (ABK), and erythromycin (EM) and by PCR analyses for aac(6')/aph(2″) and msrA using purified plasmid preparations. The ETB-producing S. aureus strains began to display high resistance to GM, which was parallel with the detection of aac(6')/aph(2″) and mecA, after 1990. Conversely, there was no significant change in the ABK MIC during the testing period, although it had a tendency to slightly increase. After 2001, isolates resistant to EM significantly increased; however, msrA was hardly detected in ETB-producing S. aureus strains, and only five isolates were positive for both aac(6')/aph(2″) and msrA. In this study, we report the emergence of a fusion plasmid carrying the toxin gene etb and drug resistance genes. Prevalence of the pETBTY825 carrier may further increase the clinical threat, since ETB-producing S. aureus is closely related to more severe impetigo or staphylococcal scalded-skin syndrome (SSSS), which requires a general antimicrobial treatment. PMID:24080652

  5. Glomerulonephritis-induced changes in kidney gene expression in rats

    PubMed Central

    Pavkovic, Mira; Riefke, Björn; Frisk, Anna-Lena; Gröticke, Ina; Ellinger-Ziegelbauer, Heidrun


    We investigated a glomerulonephritis (GN) model in rats induced by nephrotoxic serum (NTS) which contains antibodies against the glomerular basement membrane (GBM). The anti-GBM GN model in rats is widely used since its biochemical and histopathological characteristics are similar to crescentic nephritis and Goodpasture's disease in humans (Pusey, 2003[2]). Male Wistar Kyoto (WKY) and Sprague–Dawley (SD) rats were dosed once with 1, 2.5 and 5 ml/kg nephrotoxic serum (NTS) or 1.5 and 5 ml/kg NTS, respectively. GN and tubular damage were observed histopathologically in all treated rats after 14 days. To obtain insight into molecular processes during GN pathogenesis, mRNA expression was investigated in WKY and SD kidneys using Affymetrix's GeneChip Rat genome 230_2.0 arrays (GSE64265). The immunopathological processes during GN are still not fully understood and likely involve both innate and adaptive immunity. In the present study, several hundred mRNAs were found deregulated, which functionally were mostly associated with inflammation and regeneration. The β-chain of the major histocompatibility complex class II RT1.B (Rt1-Bb) and complement component 6 (C6) were identified as two mRNAs differentially expressed between WKY and SD rat strains which could be related to known different susceptibilities to NTS of different rat strains; both were increased in WKY and decreased in SD rats (Pavkovic et al., 2015 [1]). Increased Rt1-Bb expression in WKY rats could indicate a stronger and more persistent cellular reaction of the adaptive immune system in this strain, in line with findings indicating adaptive immune reactions during GN. The complement cascade is also known to be essential for GN development, especially terminal cascade products like C6. PMID:26697341

  6. Bitumen fume-induced gene expression profile in rat lung

    SciTech Connect

    Gate, Laurent . E-mail:; Langlais, Cristina; Micillino, Jean-Claude; Nunge, Herve; Bottin, Marie-Claire; Wrobel, Richard; Binet, Stephane


    Exposure to bitumen fumes during paving and roofing activities may represent an occupational health risk. To date, most of the studies performed on the biological effect of asphalt fumes have been done with regard to their content in carcinogenic polycyclic aromatic hydrocarbons (PAH). In order to gain an additional insight into the mechanisms of action of bitumen fumes, we studied their pulmonary effects in rodents following inhalation using the microarray technology. Fisher 344 rats were exposed for 5 days, 6 h/day to bitumen fumes generated at road paving temperature (170 {sup o}C) using a nose-only exposition device. With the intention of studying the early transcriptional events induced by asphalt fumes, lung tissues were collected immediately following exposure and gene expression profiles in control and exposed rats were determined by using oligonucleotide microarrays. Data analysis revealed that genes involved in lung inflammatory response as well as genes associated with PAH metabolization and detoxification were highly expressed in bitumen-exposed animals. In addition, the expression of genes related to elastase activity and its inhibition which are associated with emphysema was also modulated. More interestingly genes coding for monoamine oxidases A and B involved in the metabolism of neurotransmitters and xenobiotics were downregulated in exposed rats. Altogether, these data give additional information concerning the bitumen fumes biological effects and would allow to better review the health effects of occupational asphalt fumes exposure.

  7. GSH1, which encodes gamma-glutamylcysteine synthetase, is a target gene for yAP-1 transcriptional regulation.

    PubMed Central

    Wu, A L; Moye-Rowley, W S


    Changes in gene dosage of the YAP1 gene, encoding the yAP-1 transcriptional regulatory protein, cause profound alterations in cellular drug and metal resistance. Previous studies on yAP-1 action in yeast cells have used the AP-1 response element (ARE) from simian virus 40 as an artificial site for yAP-1-mediated transcriptional activation. No authentic yeast target sites for control of gene expression by yAP-1 are known. Here we show that the GSH1 gene, encoding gamma-glutamylcysteine synthetase, is transcriptionally responsive to the yAP-1 protein. GSH1 encodes the rate-limiting step in yeast glutathione biosynthesis and contains within its promoter region a DNA element that matches the ARE in 11 of 12 positions. The GSH1 yAP-1 response element (YRE) was recognized by yAP-1 protein in vitro. Northern (RNA) blot analysis showed that GSH1 mRNA levels were responsive to YAP1 gene dosage. A site-directed mutation in the YRE that blocked yAP-1 binding in vitro prevented the mutant GSH1 promoter from responding to elevation in YAP1 gene dosage. A delta gsh1 mutant strain was constructed and unable to grow in the absence of exogenous glutathione. A mutant GSH1 gene lacking the YRE was unable to confer normal cadmium tolerance, although other yAP-1-mediated phenotypes remained normal. Thus, GSH1 is one of several genes that are transcriptionally controlled by yAP-1 and influence drug resistance. Images PMID:7915005

  8. Genuine genetic redundancy in maleylacetate-reductase-encoding genes involved in degradation of haloaromatic compounds by Cupriavidus necator JMP134.


    Pérez-Pantoja, Danilo; Donoso, Raúl A; Sánchez, Miguel A; González, Bernardo


    Maleylacetate reductases (MAR) are required for biodegradation of several substituted aromatic compounds. To date, the functionality of two MAR-encoding genes (tfdF(I) and tfdF(II)) has been reported in Cupriavidus necator JMP134(pJP4), a known degrader of aromatic compounds. These two genes are located in tfd gene clusters involved in the turnover of 2,4-dichlorophenoxyacetate (2,4-D) and 3-chlorobenzoate (3-CB). The C. necator JMP134 genome comprises at least three other genes that putatively encode MAR (tcpD, hqoD and hxqD), but confirmation of their functionality and their role in the catabolism of haloaromatic compounds has not been assessed. RT-PCR expression analyses of C. necator JMP134 cells exposed to 2,4-D, 3-CB, 2,4,6-trichlorophenol (2,4,6-TCP) or 4-fluorobenzoate (4-FB) showed that tfdF(I) and tfdF(II) are induced by haloaromatics channelled to halocatechols as intermediates. In contrast, 2,4,6-TCP only induces tcpD, and any haloaromatic compounds tested did not induce hxqD and hqoD. However, the tcpD, hxqD and hqoD gene products showed MAR activity in cell extracts and provided the MAR function for 2,4-D catabolism when heterologously expressed in MAR-lacking strains. Growth tests for mutants of the five MAR-encoding genes in strain JMP134 showed that none of these genes is essential for degradation of the tested compounds. However, the role of tfdF(I)/tfdF(II) and tcpD genes in the expression of MAR activity during catabolism of 2,4-D and 2,4,6-TCP, respectively, was confirmed by enzyme activity tests in mutants. These results reveal a striking example of genetic redundancy in the degradation of aromatic compounds. PMID:19684066

  9. The indigenous Pseudomonas plasmid pQBR103 encodes plant-inducible genes, including three putative helicases.


    Zhang, Xue-Xian; Lilley, Andrew K; Bailey, Mark J; Rainey, Paul B


    Plasmid pQBR103 ( approximately 400 kb) is representative of many self-transmissible, mercury resistant plasmids observed in the Pseudomonas community colonising the phytosphere of sugar beet. A promoter trapping strategy (IVET) was employed to identify pQBR103 genes showing elevated levels of expression on plant surfaces. Thirty-seven different plant-inducible gene fusions were isolated that were silent in laboratory media, but active in the plant environment. Three of the fusions were to DNA sequences whose protein products show significant homology to DNA-unwinding helicases. The three helicase-like genes, designated helA, helB and helC, are restricted to a defined group of related Pseudomonas plasmids. They are induced in both the root and shoot environments of sugar beet seedlings. Sequence analysis of the three plasmid-encoded helicase-like genes shows that they are phylogenetically distinct and likely to have independent evolutionary histories. The helA gene is predicted to encode a protein of 1121 amino acids, containing conserved domains found in the ultraviolet (UV) resistance helicase, UvrD. A helA knockout mutant was constructed and no phenotypic changes were found with plasmid-conferred UV resistance or plasmid conjugation. The other 34 fusions are unique with no homologues in the public gene databases, including the Pseudomonas genomes. These data demonstrate the presence of plant responsive genes in plasmid DNA comprising a component of the genomes of plant-associated bacteria. PMID:16329852

  10. In silico cloning of genes encoding neuropeptides, neurohormones and their putative G-protein coupled receptors in a spider mite.


    Veenstra, Jan A; Rombauts, Stephane; Grbić, Miodrag


    The genome of the spider mite was prospected for the presence of genes coding neuropeptides, neurohormones and their putative G-protein coupled receptors. Fifty one candidate genes were found to encode neuropeptides or neurohormones. These include all known insect neuropeptides and neurohormones, with the exception of sulfakinin, corazonin, neuroparsin and PTTH. True orthologs of adipokinetic hormone (AKH) were neither found, but there are three genes encoding peptides similar in structure to both AKH and the AKH-corazonin-related peptide. We were also unable to identify the precursors for pigment dispersing factor (PDF) or the recently discovered trissin. However, the spider mite probably does have such genes, as we found their putative receptors. A novel arthropod neuropeptide gene was identified that shows similarity to previously described molluscan neuropeptide genes and was called EFLamide. A total of 65 putative neuropeptide GPCR genes were also identified, of these 58 belong to the A-family and 7 to the B-family. Phylogenetic analysis showed that 50 of them are closely related to insect GPCRs, which allowed the identification of their putative ligand in 39 cases with varying degrees of certainty. Other spider mite GPCRs however have no identifiable orthologs in the genomes of the four holometabolous insect species best analyzed. Whereas some of the latter have orthologs in hemimetabolous insect species, crustaceans or ticks, for others such arthropod homologs are currently unknown. PMID:22214827

  11. scratch, a pan-neural gene encoding a zinc finger protein related to snail, promotes neuronal development.


    Roark, M; Sturtevant, M A; Emery, J; Vaessin, H; Grell, E; Bier, E


    The Drosophila scratch (scrt) gene is expressed in most or all neuronal precursor cells and encodes a predicted zinc finger transcription factor closely related to the product of the mesoderm determination gene snail (sna). Adult flies homozygous for scrt null alleles have a reduced number of photoreceptors in the eye, and embryos lacking the function of both scrt and the pan-neural gene deadpan (dpn), which encodes a basic helix-loop-helix (bHLH) protein, exhibit a significant loss of neurons. Conversely, ectopic expression of a scrt transgene during embryonic and adult development leads to the production of supernumerary neurons. Consistent with scrt functioning as a transcription factor, various genes are more broadly expressed than normal in scrt null mutants. Reciprocally, these same genes are expressed at reduced levels in response to ectopic scrt expression. We propose that scrt promotes neuronal cell fates by suppressing expression of genes promoting non-neuronal cell fates. We discuss the similarities between the roles of the ancestrally related scrt, sna, and escargot (esc) genes in regulating cell fate choices. PMID:7557390

  12. Naturally occurring anti-i/I cold agglutinins may be encoded by different VH3 genes as well as the VH4.21 gene segment.

    PubMed Central

    Jefferies, L C; Carchidi, C M; Silberstein, L E


    In the current study, we wished to determine if the V regions encoding the naturally occurring anti-i/I Cold Agglutinins (anti-i/I CA) differ from pathogenic anti-i/I CA that are exclusively encoded by the VH4.21 gene. After EBV transformation of B lymphocytes, we generated one anti-I secreting clone from each of two individuals; clone 4G (individual CM, PBL) and clone Sp1 (individual SC, spleen). Clone 4G expresses a VH3 gene sequence that is 92% homologous to the germline gene WHG26. Clone Sp1 also expresses a VH3 gene that is 98% homologous to the fetally rearranged M85/20P1 gene. Another clone, Sp2 (anti-i specificity), from individual SC is 98% homologous to the germline gene VH4.21. For correlation, we studied anti-i/I CA fractions purified from 15 normal sera and found no or relatively small amounts of 9G4 (VH4.21 related idiotype) reactive IgM. Five cold agglutinin fractions contained large amounts of VH3-encoded IgM (compared to pooled normal IgM) by virtue of their binding to modified protein Staph A (SPA), and absorption of three CA fractions with modified SPA specifically removed anti-i/I binding specificity entirely. Collectively, the data indicate that naturally occurring anti-i/I CA may be encoded to a large extent by non-VH4.21-related genes, and that the VH4.21 gene is not uniquely required for anti-i/I specificity. Images PMID:8254037

  13. Radiation induction of the receptor tyrosine kinase gene Ptk-3 in normal rat astrocytes

    SciTech Connect

    Sakuma, S.; Hideyuki, S.; Akihiro, I.


    Radiation-induced gene expression was examined in rat astrocyte cultures using differential display of mRNA via reverse transcriptase-polymerase chain reaction. A 0.3-kb cDNA that was consistently observed in irradiated cultures but not in unirradiated cultures was cloned and sequenced. It was found to be identical to Ptk-3, a receptor tyrosine kinase gene identified recently. The protein encoded by Ptk-3 is a member of a novel class of receptor tyrosine kinases whose extracellular domain contains regions of homology with coagulation factors V and VIII and complement component C1. Northern blot analysis revealed that the expression of Ptk-3 was increased in rat astrocytes by 0.5 h after exposure to 10 Gy and remained at the same elevated level for at least 24 h. The maximum increase occurred after 5 Gy cloning studies indicated the presence of at least two Ptk-3 mRNA transcripts, which are probable the result of an alternative splicing mechanism. The short isoform lacks a 37 amino acid sequence in the glycine/proline-rich juxtamembrane region. The splicing pattern of the Ptk-3 gene was not altered by radiation. However, the ratios of the longer to the shorter mRNA transcripts differed between adult cortex, neonatal cortex and in vitro astrocyte cultures. 36 refs., 5 figs.

  14. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    PubMed Central

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J


    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  15. Thermal and acid tolerant beta xylosidases, arabinofuranosidases, genes encoding, related organisms, and methods


    Thompson, David N; Thompson, Vicki S; Schaller, Kastli D; Apel, William A; Reed, David W; Lacey, Jeffrey A


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose, xylobiose, and/or arabinofuranose-substituted xylan using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  16. Thermal and acid tolerant beta-xylosidases, genes encoding, related organisms, and methods


    Thompson, David N.; Thompson, Vicki S.; Schaller, Kastli D.; Apel, William A.; Lacey, Jeffrey A.; Reed, David W.


    Isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof are provided. Further provided are methods of at least partially degrading xylotriose and/or xylobiose using isolated and/or purified polypeptides and nucleic acid sequences encoding polypeptides from Alicyclobacillus acidocaldarius and variations thereof.

  17. Rat Gene Mapping Using Pcr-Analyzed Microsatellites

    PubMed Central

    Serikawa, T.; Kuramoto, T.; Hilbert, P.; Mori, M.; Yamada, J.; Dubay, C. J.; Lindpainter, K.; Ganten, D.; Guenet, J. L.; Lathrop, G. M.; Beckmann, J. S.


    One hundred and seventy-four rat loci which contain short tandem repeat sequences were extracted from the GenBank or EMBL data bases and used to define primers for amplification by the polymerase chain reaction (PCR) of the microsatellite regions, creating PCR-formatted sequence-tagged microsatellite sites (STMSs). One hundred and thirty-four STMSs for 118 loci, including 6 randomly cloned STMSs, were characterized: (i) PCR-analyzed loci were assigned to specific chromosomes using a panel of rat X mouse somatic cell hybrid clones. (ii) Length variation of the STMSs among 8 inbred rat strains could be visualized at 85 of 107 loci examined (79.4%). (iii) A genetic map, integrating biochemical, coat color, mutant and restriction fragment length polymorphism loci, was constructed based on the segregation of 125 polymorphic markers in seven rat backcrosses and in two F(2) crosses. Twenty four linkage groups were identified, all of which were assigned to a defined chromosome. As a reflection of the bias for coding sequences in the public data bases, the STMSs described herein are often associated with genes. Hence, the genetic map we report coincides with a gene map. The corresponding map locations of the homologous mouse and human genes are also listed for comparative mapping purposes. PMID:1628813

  18. Moderate malnutrition in rats induces somatic gene mutations.


    Pacheco-Martínez, M Monserrat; Cortés-Barberena, Edith; Cervantes-Ríos, Elsa; Del Carmen García-Rodríguez, María; Rodríguez-Cruz, Leonor; Ortiz-Muñiz, Rocío


    The relationship between malnutrition and genetic damage has been widely studied in human and animal models, leading to the observation that interactions between genotoxic exposure and micronutrient status appear to affect genomic stability. A new assay has been developed that uses the phosphatidylinositol glycan class A gene (Pig-a) as a reporter for measuring in vivo gene mutation. The Pig-a assay can be employed to evaluate mutant frequencies (MFs) in peripheral blood reticulocytes (RETs) and erythrocytes (RBCs) using flow cytometry. In the present study, we assessed the effects of malnutrition on mutagenic susceptibility by exposing undernourished (UN) and well-nourished (WN) rats to N-ethyl-N-nitrosourea (ENU) and measuring Pig-a MFs. Two week-old UN and WN male Han-Wistar rats were treated daily with 0, 20, or 40mg/kg ENU for 3 consecutive days. Blood was collected from the tail vein one day before ENU treatment (Day-1) and after ENU administration on Days 7, 14, 21, 28, 35, 42, 49, 56 and 63. Pig-a MFs were measured in RETs and RBCs as the RET(CD59-) and RBC(CD59-) frequencies. In the vehicle control groups, the frequencies of mutant RETs and RBCs were significantly higher in UN rats compared with WN rats at all sampling times. The ENU treatments increased RET and RBC MFs starting at Day 7. Although ENU-induced Pig-a MFs were consistently lower in UN rats than in WN rats, these differences were not significant. To understand these responses, further studies should use other mutagens and nucleated surrogate cells and examine the types of mutations induced in UN and WN rats. PMID:26994962

  19. Prevalence of ESBL and MBL encoding genes in Acinetobacter baumannii strains isolated from patients of intensive care units (ICU).


    Safari, Marzieh; Mozaffari Nejad, Amir Sasan; Bahador, Abas; Jafari, Rasool; Alikhani, Mohammad Yousef


    The aim of this study was to investigate the prevalence of ESBL and MBL encoding genes among A. baumannii isolates. In this cross sectional study, 100 A. baumannii strains were isolated from ICU wards of 3 educational hospitals of Hamadan City, Iran in 2011. Phenotypic identification of the production of ESBLs and MBLs has been carried out by using E-test and DDST methods, respectively. PCR technique was used for amplification of the ESBL and MBL encoding genes, namely: CTX-M, SHV, TEM, OXA-51, VIM-Family, IMP-Family, SPM-1, SIM-1, and GIM-1. Eighty seven (87%), 95 (95%), 98 (98%) and 95 (95%) out of 100 A. baumannii isolates were resistant to imipenem, meropenem, ceftazidime and cefotaxime, respectively. Also, 99% and 7% of the isolates were MBLs and ESBLs produced phenotypically. Thirty (30%), 20 (20%) and 58 (58%) out of 100 A. baumannii isolates have been confirmed to harbor the bla VIM-family, TEM and SHV genes, respectively. Our results show no significant relationship between the detected gens with production of MBLs and ESBLs in spite of high prevalence of MBL encoding and drug resistant A. baumannii. Probably some other genes rather than what we studied are involved in phenotypic production of MBLs and ESBLs and subsequent drug resistance in Hamadan area, Iran. PMID:26150748