Firefly Mating Algorithm for Continuous Optimization Problems.

PubMed

Ritthipakdee, Amarita; Thammano, Arit; Premasathian, Nol; Jitkongchuen, Duangjai

2017-01-01

This paper proposes a swarm intelligence algorithm, called firefly mating algorithm (FMA), for solving continuous optimization problems. FMA uses genetic algorithm as the core of the algorithm. The main feature of the algorithm is a novel mating pair selection method which is inspired by the following 2 mating behaviors of fireflies in nature: (i) the mutual attraction between males and females causes them to mate and (ii) fireflies of both sexes are of the multiple-mating type, mating with multiple opposite sex partners. A female continues mating until her spermatheca becomes full, and, in the same vein, a male can provide sperms for several females until his sperm reservoir is depleted. This new feature enhances the global convergence capability of the algorithm. The performance of FMA was tested with 20 benchmark functions (sixteen 30-dimensional functions and four 2-dimensional ones) against FA, ALC-PSO, COA, MCPSO, LWGSODE, MPSODDS, DFOA, SHPSOS, LSA, MPDPGA, DE, and GABC algorithms. The experimental results showed that the success rates of our proposed algorithm with these functions were higher than those of other algorithms and the proposed algorithm also required fewer numbers of iterations to reach the global optima.

Firefly algorithm versus genetic algorithm as powerful variable selection tools and their effect on different multivariate calibration models in spectroscopy: A comparative study

NASA Astrophysics Data System (ADS)

Attia, Khalid A. M.; Nassar, Mohammed W. I.; El-Zeiny, Mohamed B.; Serag, Ahmed

2017-01-01

For the first time, a new variable selection method based on swarm intelligence namely firefly algorithm is coupled with three different multivariate calibration models namely, concentration residual augmented classical least squares, artificial neural network and support vector regression in UV spectral data. A comparative study between the firefly algorithm and the well-known genetic algorithm was developed. The discussion revealed the superiority of using this new powerful algorithm over the well-known genetic algorithm. Moreover, different statistical tests were performed and no significant differences were found between all the models regarding their predictabilities. This ensures that simpler and faster models were obtained without any deterioration of the quality of the calibration.

Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

NASA Astrophysics Data System (ADS)

Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

2018-03-01

This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

Naturally Inspired Firefly Controller For Stabilization Of Double Inverted Pendulum

NASA Astrophysics Data System (ADS)

Srikanth, Kavirayani; Nagesh, Gundavarapu

2015-12-01

A double inverted pendulum plant as an established model that is analyzed as part of this work was tested under the influence of time delay, where the controller was fine tuned using a firefly algorithm taking into considering the fitness function of variation of the cart position and to minimize the cart position displacement and still stabilize it effectively. The naturally inspired algorithm which imitates the fireflies definitely is an energy efficient method owing to the inherent logic of the way the fireflies respond collectively and has shown that critical time delays makes the system healthy.

Firefly algorithm versus genetic algorithm as powerful variable selection tools and their effect on different multivariate calibration models in spectroscopy: A comparative study.

PubMed

Attia, Khalid A M; Nassar, Mohammed W I; El-Zeiny, Mohamed B; Serag, Ahmed

2017-01-05

For the first time, a new variable selection method based on swarm intelligence namely firefly algorithm is coupled with three different multivariate calibration models namely, concentration residual augmented classical least squares, artificial neural network and support vector regression in UV spectral data. A comparative study between the firefly algorithm and the well-known genetic algorithm was developed. The discussion revealed the superiority of using this new powerful algorithm over the well-known genetic algorithm. Moreover, different statistical tests were performed and no significant differences were found between all the models regarding their predictabilities. This ensures that simpler and faster models were obtained without any deterioration of the quality of the calibration. Copyright © 2016 Elsevier B.V. All rights reserved.

Bouc-Wen hysteresis model identification using Modified Firefly Algorithm

NASA Astrophysics Data System (ADS)

Zaman, Mohammad Asif; Sikder, Urmita

2015-12-01

The parameters of Bouc-Wen hysteresis model are identified using a Modified Firefly Algorithm. The proposed algorithm uses dynamic process control parameters to improve its performance. The algorithm is used to find the model parameter values that results in the least amount of error between a set of given data points and points obtained from the Bouc-Wen model. The performance of the algorithm is compared with the performance of conventional Firefly Algorithm, Genetic Algorithm and Differential Evolution algorithm in terms of convergence rate and accuracy. Compared to the other three optimization algorithms, the proposed algorithm is found to have good convergence rate with high degree of accuracy in identifying Bouc-Wen model parameters. Finally, the proposed method is used to find the Bouc-Wen model parameters from experimental data. The obtained model is found to be in good agreement with measured data.

A new approach to optic disc detection in human retinal images using the firefly algorithm.

PubMed

Rahebi, Javad; Hardalaç, Fırat

2016-03-01

There are various methods and algorithms to detect the optic discs in retinal images. In recent years, much attention has been given to the utilization of the intelligent algorithms. In this paper, we present a new automated method of optic disc detection in human retinal images using the firefly algorithm. The firefly intelligent algorithm is an emerging intelligent algorithm that was inspired by the social behavior of fireflies. The population in this algorithm includes the fireflies, each of which has a specific rate of lighting or fitness. In this method, the insects are compared two by two, and the less attractive insects can be observed to move toward the more attractive insects. Finally, one of the insects is selected as the most attractive, and this insect presents the optimum response to the problem in question. Here, we used the light intensity of the pixels of the retinal image pixels instead of firefly lightings. The movement of these insects due to local fluctuations produces different light intensity values in the images. Because the optic disc is the brightest area in the retinal images, all of the insects move toward brightest area and thus specify the location of the optic disc in the image. The results of implementation show that proposed algorithm could acquire an accuracy rate of 100 % in DRIVE dataset, 95 % in STARE dataset, and 94.38 % in DiaRetDB1 dataset. The results of implementation reveal high capability and accuracy of proposed algorithm in the detection of the optic disc from retinal images. Also, recorded required time for the detection of the optic disc in these images is 2.13 s for DRIVE dataset, 2.81 s for STARE dataset, and 3.52 s for DiaRetDB1 dataset accordingly. These time values are average value.

Thermal buckling optimisation of composite plates using firefly algorithm

NASA Astrophysics Data System (ADS)

Kamarian, S.; Shakeri, M.; Yas, M. H.

2017-07-01

Composite plates play a very important role in engineering applications, especially in aerospace industry. Thermal buckling of such components is of great importance and must be known to achieve an appropriate design. This paper deals with stacking sequence optimisation of laminated composite plates for maximising the critical buckling temperature using a powerful meta-heuristic algorithm called firefly algorithm (FA) which is based on the flashing behaviour of fireflies. The main objective of present work was to show the ability of FA in optimisation of composite structures. The performance of FA is compared with the results reported in the previous published works using other algorithms which shows the efficiency of FA in stacking sequence optimisation of laminated composite structures.

A clustering method of Chinese medicine prescriptions based on modified firefly algorithm.

PubMed

Yuan, Feng; Liu, Hong; Chen, Shou-Qiang; Xu, Liang

2016-12-01

This paper is aimed to study the clustering method for Chinese medicine (CM) medical cases. The traditional K-means clustering algorithm had shortcomings such as dependence of results on the selection of initial value, trapping in local optimum when processing prescriptions form CM medical cases. Therefore, a new clustering method based on the collaboration of firefly algorithm and simulated annealing algorithm was proposed. This algorithm dynamically determined the iteration of firefly algorithm and simulates sampling of annealing algorithm by fitness changes, and increased the diversity of swarm through expansion of the scope of the sudden jump, thereby effectively avoiding premature problem. The results from confirmatory experiments for CM medical cases suggested that, comparing with traditional K-means clustering algorithms, this method was greatly improved in the individual diversity and the obtained clustering results, the computing results from this method had a certain reference value for cluster analysis on CM prescriptions.

The construction of support vector machine classifier using the firefly algorithm.

PubMed

Chao, Chih-Feng; Horng, Ming-Huwi

2015-01-01

The setting of parameters in the support vector machines (SVMs) is very important with regard to its accuracy and efficiency. In this paper, we employ the firefly algorithm to train all parameters of the SVM simultaneously, including the penalty parameter, smoothness parameter, and Lagrangian multiplier. The proposed method is called the firefly-based SVM (firefly-SVM). This tool is not considered the feature selection, because the SVM, together with feature selection, is not suitable for the application in a multiclass classification, especially for the one-against-all multiclass SVM. In experiments, binary and multiclass classifications are explored. In the experiments on binary classification, ten of the benchmark data sets of the University of California, Irvine (UCI), machine learning repository are used; additionally the firefly-SVM is applied to the multiclass diagnosis of ultrasonic supraspinatus images. The classification performance of firefly-SVM is also compared to the original LIBSVM method associated with the grid search method and the particle swarm optimization based SVM (PSO-SVM). The experimental results advocate the use of firefly-SVM to classify pattern classifications for maximum accuracy.

The Construction of Support Vector Machine Classifier Using the Firefly Algorithm

PubMed Central

Chao, Chih-Feng; Horng, Ming-Huwi

2015-01-01

The setting of parameters in the support vector machines (SVMs) is very important with regard to its accuracy and efficiency. In this paper, we employ the firefly algorithm to train all parameters of the SVM simultaneously, including the penalty parameter, smoothness parameter, and Lagrangian multiplier. The proposed method is called the firefly-based SVM (firefly-SVM). This tool is not considered the feature selection, because the SVM, together with feature selection, is not suitable for the application in a multiclass classification, especially for the one-against-all multiclass SVM. In experiments, binary and multiclass classifications are explored. In the experiments on binary classification, ten of the benchmark data sets of the University of California, Irvine (UCI), machine learning repository are used; additionally the firefly-SVM is applied to the multiclass diagnosis of ultrasonic supraspinatus images. The classification performance of firefly-SVM is also compared to the original LIBSVM method associated with the grid search method and the particle swarm optimization based SVM (PSO-SVM). The experimental results advocate the use of firefly-SVM to classify pattern classifications for maximum accuracy. PMID:25802511

Wireless sensor placement for structural monitoring using information-fusing firefly algorithm

NASA Astrophysics Data System (ADS)

Zhou, Guang-Dong; Yi, Ting-Hua; Xie, Mei-Xi; Li, Hong-Nan

2017-10-01

Wireless sensor networks (WSNs) are promising technology in structural health monitoring (SHM) applications for their low cost and high efficiency. The limited wireless sensors and restricted power resources in WSNs highlight the significance of optimal wireless sensor placement (OWSP) during designing SHM systems to enable the most useful information to be captured and to achieve the longest network lifetime. This paper presents a holistic approach, including an optimization criterion and a solution algorithm, for optimally deploying self-organizing multi-hop WSNs on large-scale structures. The combination of information effectiveness represented by the modal independence and the network performance specified by the network connectivity and network lifetime is first formulated to evaluate the performance of wireless sensor configurations. Then, an information-fusing firefly algorithm (IFFA) is developed to solve the OWSP problem. The step sizes drawn from a Lévy distribution are adopted to drive fireflies toward brighter individuals. Following the movement with Lévy flights, information about the contributions of wireless sensors to the objective function as carried by the fireflies is fused and applied to move inferior wireless sensors to better locations. The reliability of the proposed approach is verified via a numerical example on a long-span suspension bridge. The results demonstrate that the evaluation criterion provides a good performance metric of wireless sensor configurations, and the IFFA outperforms the simple discrete firefly algorithm.

Application of firefly algorithm to the dynamic model updating problem

NASA Astrophysics Data System (ADS)

Shabbir, Faisal; Omenzetter, Piotr

2015-04-01

Model updating can be considered as a branch of optimization problems in which calibration of the finite element (FE) model is undertaken by comparing the modal properties of the actual structure with these of the FE predictions. The attainment of a global solution in a multi dimensional search space is a challenging problem. The nature-inspired algorithms have gained increasing attention in the previous decade for solving such complex optimization problems. This study applies the novel Firefly Algorithm (FA), a global optimization search technique, to a dynamic model updating problem. This is to the authors' best knowledge the first time FA is applied to model updating. The working of FA is inspired by the flashing characteristics of fireflies. Each firefly represents a randomly generated solution which is assigned brightness according to the value of the objective function. The physical structure under consideration is a full scale cable stayed pedestrian bridge with composite bridge deck. Data from dynamic testing of the bridge was used to correlate and update the initial model by using FA. The algorithm aimed at minimizing the difference between the natural frequencies and mode shapes of the structure. The performance of the algorithm is analyzed in finding the optimal solution in a multi dimensional search space. The paper concludes with an investigation of the efficacy of the algorithm in obtaining a reference finite element model which correctly represents the as-built original structure.

Experimental Investigation and Optimization of TIG Welding Parameters on Aluminum 6061 Alloy Using Firefly Algorithm

NASA Astrophysics Data System (ADS)

Kumar, Rishi; Mevada, N. Ramesh; Rathore, Santosh; Agarwal, Nitin; Rajput, Vinod; Sinh Barad, AjayPal

2017-08-01

To improve Welding quality of aluminum (Al) plate, the TIG Welding system has been prepared, by which Welding current, Shielding gas flow rate and Current polarity can be controlled during Welding process. In the present work, an attempt has been made to study the effect of Welding current, current polarity, and shielding gas flow rate on the tensile strength of the weld joint. Based on the number of parameters and their levels, the Response Surface Methodology technique has been selected as the Design of Experiment. For understanding the influence of input parameters on Ultimate tensile strength of weldment, ANOVA analysis has been carried out. Also to describe and optimize TIG Welding using a new metaheuristic Nature - inspired algorithm which is called as Firefly algorithm which was developed by Dr. Xin-She Yang at Cambridge University in 2007. A general formulation of firefly algorithm is presented together with an analytical, mathematical modeling to optimize the TIG Welding process by a single equivalent objective function.

Extension of the firefly algorithm and preference rules for solving MINLP problems

NASA Astrophysics Data System (ADS)

Costa, M. Fernanda P.; Francisco, Rogério B.; Rocha, Ana Maria A. C.; Fernandes, Edite M. G. P.

2017-07-01

An extension of the firefly algorithm (FA) for solving mixed-integer nonlinear programming (MINLP) problems is presented. Although penalty functions are nowadays frequently used to handle integrality conditions and inequality and equality constraints, this paper proposes the implementation within the FA of a simple rounded-based heuristic and four preference rules to find and converge to MINLP feasible solutions. Preliminary numerical experiments are carried out to validate the proposed methodology.

A firefly algorithm for solving competitive location-design problem: a case study

NASA Astrophysics Data System (ADS)

Sadjadi, Seyed Jafar; Ashtiani, Milad Gorji; Ramezanian, Reza; Makui, Ahmad

2016-12-01

This paper aims at determining the optimal number of new facilities besides specifying both the optimal location and design level of them under the budget constraint in a competitive environment by a novel hybrid continuous and discrete firefly algorithm. A real-world application of locating new chain stores in the city of Tehran, Iran, is used and the results are analyzed. In addition, several examples have been solved to evaluate the efficiency of the proposed model and algorithm. The results demonstrate that the performed method provides good-quality results for the test problems.

A hyperbolastic type-I diffusion process: Parameter estimation by means of the firefly algorithm.

PubMed

Barrera, Antonio; Román-Román, Patricia; Torres-Ruiz, Francisco

2018-01-01

A stochastic diffusion process, whose mean function is a hyperbolastic curve of type I, is presented. The main characteristics of the process are studied and the problem of maximum likelihood estimation for the parameters of the process is considered. To this end, the firefly metaheuristic optimization algorithm is applied after bounding the parametric space by a stagewise procedure. Some examples based on simulated sample paths and real data illustrate this development. Copyright © 2017 Elsevier B.V. All rights reserved.

Sensitive Dual Color in vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase

DTIC Science & Technology

2011-04-01

Sensitive Dual Color In Vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase Laura...20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that...spectral emissions using a suitable spectral unmixing algorithm . This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future

Endmember extraction from hyperspectral image based on discrete firefly algorithm (EE-DFA)

NASA Astrophysics Data System (ADS)

Zhang, Chengye; Qin, Qiming; Zhang, Tianyuan; Sun, Yuanheng; Chen, Chao

2017-04-01

This study proposed a novel method to extract endmembers from hyperspectral image based on discrete firefly algorithm (EE-DFA). Endmembers are the input of many spectral unmixing algorithms. Hence, in this paper, endmember extraction from hyperspectral image is regarded as a combinational optimization problem to get best spectral unmixing results, which can be solved by the discrete firefly algorithm. Two series of experiments were conducted on the synthetic hyperspectral datasets with different SNR and the AVIRIS Cuprite dataset, respectively. The experimental results were compared with the endmembers extracted by four popular methods: the sequential maximum angle convex cone (SMACC), N-FINDR, Vertex Component Analysis (VCA), and Minimum Volume Constrained Nonnegative Matrix Factorization (MVC-NMF). What's more, the effect of the parameters in the proposed method was tested on both synthetic hyperspectral datasets and AVIRIS Cuprite dataset, and the recommended parameters setting was proposed. The results in this study demonstrated that the proposed EE-DFA method showed better performance than the existing popular methods. Moreover, EE-DFA is robust under different SNR conditions.

Firefly Algorithm for Structural Search.

PubMed

Avendaño-Franco, Guillermo; Romero, Aldo H

2016-07-12

The problem of computational structure prediction of materials is approached using the firefly (FF) algorithm. Starting from the chemical composition and optionally using prior knowledge of similar structures, the FF method is able to predict not only known stable structures but also a variety of novel competitive metastable structures. This article focuses on the strengths and limitations of the algorithm as a multimodal global searcher. The algorithm has been implemented in software package PyChemia ( https://github.com/MaterialsDiscovery/PyChemia ), an open source python library for materials analysis. We present applications of the method to van der Waals clusters and crystal structures. The FF method is shown to be competitive when compared to other population-based global searchers.

A Firefly Algorithm-based Approach for Pseudo-Relevance Feedback: Application to Medical Database.

PubMed

Khennak, Ilyes; Drias, Habiba

2016-11-01

The difficulty of disambiguating the sense of the incomplete and imprecise keywords that are extensively used in the search queries has caused the failure of search systems to retrieve the desired information. One of the most powerful and promising method to overcome this shortcoming and improve the performance of search engines is Query Expansion, whereby the user's original query is augmented by new keywords that best characterize the user's information needs and produce more useful query. In this paper, a new Firefly Algorithm-based approach is proposed to enhance the retrieval effectiveness of query expansion while maintaining low computational complexity. In contrast to the existing literature, the proposed approach uses a Firefly Algorithm to find the best expanded query among a set of expanded query candidates. Moreover, this new approach allows the determination of the length of the expanded query empirically. Experimental results on MEDLINE, the on-line medical information database, show that our proposed approach is more effective and efficient compared to the state-of-the-art.

Analysis of United States Air Forces Central Government Purchase Card Reachback Viability

DTIC Science & Technology

2011-12-01

being a wealth of knowledge and answering every contingency and reachback question throughout our PMA trip • Ms. Karey Schaffer – for giving us a...11. Karey L. Shaffer Program Manager, Acquisition Research Program, GB

A GPU-Based Implementation of the Firefly Algorithm for Variable Selection in Multivariate Calibration Problems

PubMed Central

de Paula, Lauro C. M.; Soares, Anderson S.; de Lima, Telma W.; Delbem, Alexandre C. B.; Coelho, Clarimar J.; Filho, Arlindo R. G.

2014-01-01

Several variable selection algorithms in multivariate calibration can be accelerated using Graphics Processing Units (GPU). Among these algorithms, the Firefly Algorithm (FA) is a recent proposed metaheuristic that may be used for variable selection. This paper presents a GPU-based FA (FA-MLR) with multiobjective formulation for variable selection in multivariate calibration problems and compares it with some traditional sequential algorithms in the literature. The advantage of the proposed implementation is demonstrated in an example involving a relatively large number of variables. The results showed that the FA-MLR, in comparison with the traditional algorithms is a more suitable choice and a relevant contribution for the variable selection problem. Additionally, the results also demonstrated that the FA-MLR performed in a GPU can be five times faster than its sequential implementation. PMID:25493625

A GPU-Based Implementation of the Firefly Algorithm for Variable Selection in Multivariate Calibration Problems.

PubMed

de Paula, Lauro C M; Soares, Anderson S; de Lima, Telma W; Delbem, Alexandre C B; Coelho, Clarimar J; Filho, Arlindo R G

2014-01-01

Several variable selection algorithms in multivariate calibration can be accelerated using Graphics Processing Units (GPU). Among these algorithms, the Firefly Algorithm (FA) is a recent proposed metaheuristic that may be used for variable selection. This paper presents a GPU-based FA (FA-MLR) with multiobjective formulation for variable selection in multivariate calibration problems and compares it with some traditional sequential algorithms in the literature. The advantage of the proposed implementation is demonstrated in an example involving a relatively large number of variables. The results showed that the FA-MLR, in comparison with the traditional algorithms is a more suitable choice and a relevant contribution for the variable selection problem. Additionally, the results also demonstrated that the FA-MLR performed in a GPU can be five times faster than its sequential implementation.

Basic firefly algorithm for document clustering

NASA Astrophysics Data System (ADS)

Mohammed, Athraa Jasim; Yusof, Yuhanis; Husni, Husniza

2015-12-01

The Document clustering plays significant role in Information Retrieval (IR) where it organizes documents prior to the retrieval process. To date, various clustering algorithms have been proposed and this includes the K-means and Particle Swarm Optimization. Even though these algorithms have been widely applied in many disciplines due to its simplicity, such an approach tends to be trapped in a local minimum during its search for an optimal solution. To address the shortcoming, this paper proposes a Basic Firefly (Basic FA) algorithm to cluster text documents. The algorithm employs the Average Distance to Document Centroid (ADDC) as the objective function of the search. Experiments utilizing the proposed algorithm were conducted on the 20Newsgroups benchmark dataset. Results demonstrate that the Basic FA generates a more robust and compact clusters than the ones produced by K-means and Particle Swarm Optimization (PSO).

An evolutionary firefly algorithm for the estimation of nonlinear biological model parameters.

PubMed

Abdullah, Afnizanfaizal; Deris, Safaai; Anwar, Sohail; Arjunan, Satya N V

2013-01-01

The development of accurate computational models of biological processes is fundamental to computational systems biology. These models are usually represented by mathematical expressions that rely heavily on the system parameters. The measurement of these parameters is often difficult. Therefore, they are commonly estimated by fitting the predicted model to the experimental data using optimization methods. The complexity and nonlinearity of the biological processes pose a significant challenge, however, to the development of accurate and fast optimization methods. We introduce a new hybrid optimization method incorporating the Firefly Algorithm and the evolutionary operation of the Differential Evolution method. The proposed method improves solutions by neighbourhood search using evolutionary procedures. Testing our method on models for the arginine catabolism and the negative feedback loop of the p53 signalling pathway, we found that it estimated the parameters with high accuracy and within a reasonable computation time compared to well-known approaches, including Particle Swarm Optimization, Nelder-Mead, and Firefly Algorithm. We have also verified the reliability of the parameters estimated by the method using an a posteriori practical identifiability test.

An Evolutionary Firefly Algorithm for the Estimation of Nonlinear Biological Model Parameters

PubMed Central

Abdullah, Afnizanfaizal; Deris, Safaai; Anwar, Sohail; Arjunan, Satya N. V.

2013-01-01

The development of accurate computational models of biological processes is fundamental to computational systems biology. These models are usually represented by mathematical expressions that rely heavily on the system parameters. The measurement of these parameters is often difficult. Therefore, they are commonly estimated by fitting the predicted model to the experimental data using optimization methods. The complexity and nonlinearity of the biological processes pose a significant challenge, however, to the development of accurate and fast optimization methods. We introduce a new hybrid optimization method incorporating the Firefly Algorithm and the evolutionary operation of the Differential Evolution method. The proposed method improves solutions by neighbourhood search using evolutionary procedures. Testing our method on models for the arginine catabolism and the negative feedback loop of the p53 signalling pathway, we found that it estimated the parameters with high accuracy and within a reasonable computation time compared to well-known approaches, including Particle Swarm Optimization, Nelder-Mead, and Firefly Algorithm. We have also verified the reliability of the parameters estimated by the method using an a posteriori practical identifiability test. PMID:23469172

Clustering PPI data by combining FA and SHC method.

PubMed

Lei, Xiujuan; Ying, Chao; Wu, Fang-Xiang; Xu, Jin

2015-01-01

Clustering is one of main methods to identify functional modules from protein-protein interaction (PPI) data. Nevertheless traditional clustering methods may not be effective for clustering PPI data. In this paper, we proposed a novel method for clustering PPI data by combining firefly algorithm (FA) and synchronization-based hierarchical clustering (SHC) algorithm. Firstly, the PPI data are preprocessed via spectral clustering (SC) which transforms the high-dimensional similarity matrix into a low dimension matrix. Then the SHC algorithm is used to perform clustering. In SHC algorithm, hierarchical clustering is achieved by enlarging the neighborhood radius of synchronized objects continuously, while the hierarchical search is very difficult to find the optimal neighborhood radius of synchronization and the efficiency is not high. So we adopt the firefly algorithm to determine the optimal threshold of the neighborhood radius of synchronization automatically. The proposed algorithm is tested on the MIPS PPI dataset. The results show that our proposed algorithm is better than the traditional algorithms in precision, recall and f-measure value.

Clustering PPI data by combining FA and SHC method

PubMed Central

2015-01-01

Clustering is one of main methods to identify functional modules from protein-protein interaction (PPI) data. Nevertheless traditional clustering methods may not be effective for clustering PPI data. In this paper, we proposed a novel method for clustering PPI data by combining firefly algorithm (FA) and synchronization-based hierarchical clustering (SHC) algorithm. Firstly, the PPI data are preprocessed via spectral clustering (SC) which transforms the high-dimensional similarity matrix into a low dimension matrix. Then the SHC algorithm is used to perform clustering. In SHC algorithm, hierarchical clustering is achieved by enlarging the neighborhood radius of synchronized objects continuously, while the hierarchical search is very difficult to find the optimal neighborhood radius of synchronization and the efficiency is not high. So we adopt the firefly algorithm to determine the optimal threshold of the neighborhood radius of synchronization automatically. The proposed algorithm is tested on the MIPS PPI dataset. The results show that our proposed algorithm is better than the traditional algorithms in precision, recall and f-measure value. PMID:25707632

Motion Estimation Using the Firefly Algorithm in Ultrasonic Image Sequence of Soft Tissue

PubMed Central

Chao, Chih-Feng; Horng, Ming-Huwi; Chen, Yu-Chan

2015-01-01

Ultrasonic image sequence of the soft tissue is widely used in disease diagnosis; however, the speckle noises usually influenced the image quality. These images usually have a low signal-to-noise ratio presentation. The phenomenon gives rise to traditional motion estimation algorithms that are not suitable to measure the motion vectors. In this paper, a new motion estimation algorithm is developed for assessing the velocity field of soft tissue in a sequence of ultrasonic B-mode images. The proposed iterative firefly algorithm (IFA) searches for few candidate points to obtain the optimal motion vector, and then compares it to the traditional iterative full search algorithm (IFSA) via a series of experiments of in vivo ultrasonic image sequences. The experimental results show that the IFA can assess the vector with better efficiency and almost equal estimation quality compared to the traditional IFSA method. PMID:25873987

Motion estimation using the firefly algorithm in ultrasonic image sequence of soft tissue.

PubMed

Chao, Chih-Feng; Horng, Ming-Huwi; Chen, Yu-Chan

2015-01-01

Ultrasonic image sequence of the soft tissue is widely used in disease diagnosis; however, the speckle noises usually influenced the image quality. These images usually have a low signal-to-noise ratio presentation. The phenomenon gives rise to traditional motion estimation algorithms that are not suitable to measure the motion vectors. In this paper, a new motion estimation algorithm is developed for assessing the velocity field of soft tissue in a sequence of ultrasonic B-mode images. The proposed iterative firefly algorithm (IFA) searches for few candidate points to obtain the optimal motion vector, and then compares it to the traditional iterative full search algorithm (IFSA) via a series of experiments of in vivo ultrasonic image sequences. The experimental results show that the IFA can assess the vector with better efficiency and almost equal estimation quality compared to the traditional IFSA method.

Unequal-area, fixed-shape facility layout problems using the firefly algorithm

NASA Astrophysics Data System (ADS)

Ingole, Supriya; Singh, Dinesh

2017-07-01

In manufacturing industries, the facility layout design is a very important task, as it is concerned with the overall manufacturing cost and profit of the industry. The facility layout problem (FLP) is solved by arranging the departments or facilities of known dimensions on the available floor space. The objective of this article is to implement the firefly algorithm (FA) for solving unequal-area, fixed-shape FLPs and optimizing the costs of total material handling and transportation between the facilities. The FA is a nature-inspired algorithm and can be used for combinatorial optimization problems. Benchmark problems from the previous literature are solved using the FA. To check its effectiveness, it is implemented to solve large-sized FLPs. Computational results obtained using the FA show that the algorithm is less time consuming and the total layout costs for FLPs are better than the best results achieved so far.

Feature Selection for Motor Imagery EEG Classification Based on Firefly Algorithm and Learning Automata

PubMed Central

Liu, Aiming; Liu, Quan; Ai, Qingsong; Xie, Yi; Chen, Anqi

2017-01-01

Motor Imagery (MI) electroencephalography (EEG) is widely studied for its non-invasiveness, easy availability, portability, and high temporal resolution. As for MI EEG signal processing, the high dimensions of features represent a research challenge. It is necessary to eliminate redundant features, which not only create an additional overhead of managing the space complexity, but also might include outliers, thereby reducing classification accuracy. The firefly algorithm (FA) can adaptively select the best subset of features, and improve classification accuracy. However, the FA is easily entrapped in a local optimum. To solve this problem, this paper proposes a method of combining the firefly algorithm and learning automata (LA) to optimize feature selection for motor imagery EEG. We employed a method of combining common spatial pattern (CSP) and local characteristic-scale decomposition (LCD) algorithms to obtain a high dimensional feature set, and classified it by using the spectral regression discriminant analysis (SRDA) classifier. Both the fourth brain–computer interface competition data and real-time data acquired in our designed experiments were used to verify the validation of the proposed method. Compared with genetic and adaptive weight particle swarm optimization algorithms, the experimental results show that our proposed method effectively eliminates redundant features, and improves the classification accuracy of MI EEG signals. In addition, a real-time brain–computer interface system was implemented to verify the feasibility of our proposed methods being applied in practical brain–computer interface systems. PMID:29117100

Feature Selection for Motor Imagery EEG Classification Based on Firefly Algorithm and Learning Automata.

PubMed

Liu, Aiming; Chen, Kun; Liu, Quan; Ai, Qingsong; Xie, Yi; Chen, Anqi

2017-11-08

Motor Imagery (MI) electroencephalography (EEG) is widely studied for its non-invasiveness, easy availability, portability, and high temporal resolution. As for MI EEG signal processing, the high dimensions of features represent a research challenge. It is necessary to eliminate redundant features, which not only create an additional overhead of managing the space complexity, but also might include outliers, thereby reducing classification accuracy. The firefly algorithm (FA) can adaptively select the best subset of features, and improve classification accuracy. However, the FA is easily entrapped in a local optimum. To solve this problem, this paper proposes a method of combining the firefly algorithm and learning automata (LA) to optimize feature selection for motor imagery EEG. We employed a method of combining common spatial pattern (CSP) and local characteristic-scale decomposition (LCD) algorithms to obtain a high dimensional feature set, and classified it by using the spectral regression discriminant analysis (SRDA) classifier. Both the fourth brain-computer interface competition data and real-time data acquired in our designed experiments were used to verify the validation of the proposed method. Compared with genetic and adaptive weight particle swarm optimization algorithms, the experimental results show that our proposed method effectively eliminates redundant features, and improves the classification accuracy of MI EEG signals. In addition, a real-time brain-computer interface system was implemented to verify the feasibility of our proposed methods being applied in practical brain-computer interface systems.

Design optimization of steel frames using an enhanced firefly algorithm

NASA Astrophysics Data System (ADS)

Carbas, Serdar

2016-12-01

Mathematical modelling of real-world-sized steel frames under the Load and Resistance Factor Design-American Institute of Steel Construction (LRFD-AISC) steel design code provisions, where the steel profiles for the members are selected from a table of steel sections, turns out to be a discrete nonlinear programming problem. Finding the optimum design of such design optimization problems using classical optimization techniques is difficult. Metaheuristic algorithms provide an alternative way of solving such problems. The firefly algorithm (FFA) belongs to the swarm intelligence group of metaheuristics. The standard FFA has the drawback of being caught up in local optima in large-sized steel frame design problems. This study attempts to enhance the performance of the FFA by suggesting two new expressions for the attractiveness and randomness parameters of the algorithm. Two real-world-sized design examples are designed by the enhanced FFA and its performance is compared with standard FFA as well as with particle swarm and cuckoo search algorithms.

Performance Enhancement of Radial Distributed System with Distributed Generators by Reconfiguration Using Binary Firefly Algorithm

NASA Astrophysics Data System (ADS)

Rajalakshmi, N.; Padma Subramanian, D.; Thamizhavel, K.

2015-03-01

The extent of real power loss and voltage deviation associated with overloaded feeders in radial distribution system can be reduced by reconfiguration. Reconfiguration is normally achieved by changing the open/closed state of tie/sectionalizing switches. Finding optimal switch combination is a complicated problem as there are many switching combinations possible in a distribution system. Hence optimization techniques are finding greater importance in reducing the complexity of reconfiguration problem. This paper presents the application of firefly algorithm (FA) for optimal reconfiguration of radial distribution system with distributed generators (DG). The algorithm is tested on IEEE 33 bus system installed with DGs and the results are compared with binary genetic algorithm. It is found that binary FA is more effective than binary genetic algorithm in achieving real power loss reduction and improving voltage profile and hence enhancing the performance of radial distribution system. Results are found to be optimum when DGs are added to the test system, which proved the impact of DGs on distribution system.

Continuous Firefly Algorithm for Optimal Tuning of Pid Controller in Avr System

NASA Astrophysics Data System (ADS)

Bendjeghaba, Omar

2014-01-01

This paper presents a tuning approach based on Continuous firefly algorithm (CFA) to obtain the proportional-integral- derivative (PID) controller parameters in Automatic Voltage Regulator system (AVR). In the tuning processes the CFA is iterated to reach the optimal or the near optimal of PID controller parameters when the main goal is to improve the AVR step response characteristics. Conducted simulations show the effectiveness and the efficiency of the proposed approach. Furthermore the proposed approach can improve the dynamic of the AVR system. Compared with particle swarm optimization (PSO), the new CFA tuning method has better control system performance in terms of time domain specifications and set-point tracking.

Definition of energy-calibrated spectra for national reachback

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kunz, Christopher L.; Hertz, Kristin L.

2014-01-01

Accurate energy calibration is critical for the timeliness and accuracy of analysis results of spectra submitted to National Reachback, particularly for the detection of threat items. Many spectra submitted for analysis include either a calibration spectrum using 137Cs or no calibration spectrum at all. The single line provided by 137Cs is insufficient to adequately calibrate nonlinear spectra. A calibration source that provides several lines that are well-spaced, from the low energy cutoff to the full energy range of the detector, is needed for a satisfactory energy calibration. This paper defines the requirements of an energy calibration for the purposes ofmore » National Reachback, outlines a method to validate whether a given spectrum meets that definition, discusses general source considerations, and provides a specific operating procedure for calibrating the GR-135.« less

Firefly as a novel swarm intelligence variable selection method in spectroscopy.

PubMed

Goodarzi, Mohammad; dos Santos Coelho, Leandro

2014-12-10

A critical step in multivariate calibration is wavelength selection, which is used to build models with better prediction performance when applied to spectral data. Up to now, many feature selection techniques have been developed. Among all different types of feature selection techniques, those based on swarm intelligence optimization methodologies are more interesting since they are usually simulated based on animal and insect life behavior to, e.g., find the shortest path between a food source and their nests. This decision is made by a crowd, leading to a more robust model with less falling in local minima during the optimization cycle. This paper represents a novel feature selection approach to the selection of spectroscopic data, leading to more robust calibration models. The performance of the firefly algorithm, a swarm intelligence paradigm, was evaluated and compared with genetic algorithm and particle swarm optimization. All three techniques were coupled with partial least squares (PLS) and applied to three spectroscopic data sets. They demonstrate improved prediction results in comparison to when only a PLS model was built using all wavelengths. Results show that firefly algorithm as a novel swarm paradigm leads to a lower number of selected wavelengths while the prediction performance of built PLS stays the same. Copyright © 2014. Published by Elsevier B.V.

Synchronous Firefly Algorithm for Cluster Head Selection in WSN.

PubMed

Baskaran, Madhusudhanan; Sadagopan, Chitra

2015-01-01

Wireless Sensor Network (WSN) consists of small low-cost, low-power multifunctional nodes interconnected to efficiently aggregate and transmit data to sink. Cluster-based approaches use some nodes as Cluster Heads (CHs) and organize WSNs efficiently for aggregation of data and energy saving. A CH conveys information gathered by cluster nodes and aggregates/compresses data before transmitting it to a sink. However, this additional responsibility of the node results in a higher energy drain leading to uneven network degradation. Low Energy Adaptive Clustering Hierarchy (LEACH) offsets this by probabilistically rotating cluster heads role among nodes with energy above a set threshold. CH selection in WSN is NP-Hard as optimal data aggregation with efficient energy savings cannot be solved in polynomial time. In this work, a modified firefly heuristic, synchronous firefly algorithm, is proposed to improve the network performance. Extensive simulation shows the proposed technique to perform well compared to LEACH and energy-efficient hierarchical clustering. Simulations show the effectiveness of the proposed method in decreasing the packet loss ratio by an average of 9.63% and improving the energy efficiency of the network when compared to LEACH and EEHC.

Genome-Wide Analysis of Translational Control in Tuberous Sclerosis Complex

DTIC Science & Technology

2012-07-01

particular non-AUG codons in the 5’UTR. However, these data was “noisy” and required a machine-learning algorithm to identify TIS codons. We develop...To investigate how nutrient signaling affects the folding of nascent chains, we used firefly luciferase (Luc) as a reporter because of its high...folding as the structural basis for the rapid de novo folding of firefly luciferase. Nat Struct Biol 6(7):697-705. 12. Gupta R, Kasturi P, Bracher A

A firefly algorithm for optimum design of new-generation beams

NASA Astrophysics Data System (ADS)

Erdal, F.

2017-06-01

This research addresses the minimum weight design of new-generation steel beams with sinusoidal openings using a metaheuristic search technique, namely the firefly method. The proposed algorithm is also used to compare the optimum design results of sinusoidal web-expanded beams with steel castellated and cellular beams. Optimum design problems of all beams are formulated according to the design limitations stipulated by the Steel Construction Institute. The design methods adopted in these publications are consistent with BS 5950 specifications. The formulation of the design problem considering the above-mentioned limitations turns out to be a discrete programming problem. The design algorithms based on the technique select the optimum universal beam sections, dimensional properties of sinusoidal, hexagonal and circular holes, and the total number of openings along the beam as design variables. Furthermore, this selection is also carried out such that the behavioural limitations are satisfied. Numerical examples are presented, where the suggested algorithm is implemented to achieve the minimum weight design of these beams subjected to loading combinations.

Firefly Algorithm in detection of TEC seismo-ionospheric anomalies

NASA Astrophysics Data System (ADS)

Akhoondzadeh, Mehdi

2015-07-01

Anomaly detection in time series of different earthquake precursors is an essential introduction to create an early warning system with an allowable uncertainty. Since these time series are more often non linear, complex and massive, therefore the applied predictor method should be able to detect the discord patterns from a large data in a short time. This study acknowledges Firefly Algorithm (FA) as a simple and robust predictor to detect the TEC (Total Electron Content) seismo-ionospheric anomalies around the time of the some powerful earthquakes including Chile (27 February 2010), Varzeghan (11 August 2012) and Saravan (16 April 2013). Outstanding anomalies were observed 7 and 5 days before the Chile and Varzeghan earthquakes, respectively and also 3 and 8 days prior to the Saravan earthquake.

Optimal groundwater remediation design of pump and treat systems via a simulation-optimization approach and firefly algorithm

NASA Astrophysics Data System (ADS)

Javad Kazemzadeh-Parsi, Mohammad; Daneshmand, Farhang; Ahmadfard, Mohammad Amin; Adamowski, Jan; Martel, Richard

2015-01-01

In the present study, an optimization approach based on the firefly algorithm (FA) is combined with a finite element simulation method (FEM) to determine the optimum design of pump and treat remediation systems. Three multi-objective functions in which pumping rate and clean-up time are design variables are considered and the proposed FA-FEM model is used to minimize operating costs, total pumping volumes and total pumping rates in three scenarios while meeting water quality requirements. The groundwater lift and contaminant concentration are also minimized through the optimization process. The obtained results show the applicability of the FA in conjunction with the FEM for the optimal design of groundwater remediation systems. The performance of the FA is also compared with the genetic algorithm (GA) and the FA is found to have a better convergence rate than the GA.

Synchronous Firefly Algorithm for Cluster Head Selection in WSN

PubMed Central

Baskaran, Madhusudhanan; Sadagopan, Chitra

2015-01-01

Wireless Sensor Network (WSN) consists of small low-cost, low-power multifunctional nodes interconnected to efficiently aggregate and transmit data to sink. Cluster-based approaches use some nodes as Cluster Heads (CHs) and organize WSNs efficiently for aggregation of data and energy saving. A CH conveys information gathered by cluster nodes and aggregates/compresses data before transmitting it to a sink. However, this additional responsibility of the node results in a higher energy drain leading to uneven network degradation. Low Energy Adaptive Clustering Hierarchy (LEACH) offsets this by probabilistically rotating cluster heads role among nodes with energy above a set threshold. CH selection in WSN is NP-Hard as optimal data aggregation with efficient energy savings cannot be solved in polynomial time. In this work, a modified firefly heuristic, synchronous firefly algorithm, is proposed to improve the network performance. Extensive simulation shows the proposed technique to perform well compared to LEACH and energy-efficient hierarchical clustering. Simulations show the effectiveness of the proposed method in decreasing the packet loss ratio by an average of 9.63% and improving the energy efficiency of the network when compared to LEACH and EEHC. PMID:26495431

Computational Discovery of Materials Using the Firefly Algorithm

NASA Astrophysics Data System (ADS)

Avendaño-Franco, Guillermo; Romero, Aldo

Our current ability to model physical phenomena accurately, the increase computational power and better algorithms are the driving forces behind the computational discovery and design of novel materials, allowing for virtual characterization before their realization in the laboratory. We present the implementation of a novel firefly algorithm, a population-based algorithm for global optimization for searching the structure/composition space. This novel computation-intensive approach naturally take advantage of concurrency, targeted exploration and still keeping enough diversity. We apply the new method in both periodic and non-periodic structures and we present the implementation challenges and solutions to improve efficiency. The implementation makes use of computational materials databases and network analysis to optimize the search and get insights about the geometric structure of local minima on the energy landscape. The method has been implemented in our software PyChemia, an open-source package for materials discovery. We acknowledge the support of DMREF-NSF 1434897 and the Donors of the American Chemical Society Petroleum Research Fund for partial support of this research under Contract 54075-ND10.

Support vector machine firefly algorithm based optimization of lens system.

PubMed

Shamshirband, Shahaboddin; Petković, Dalibor; Pavlović, Nenad T; Ch, Sudheer; Altameem, Torki A; Gani, Abdullah

2015-01-01

Lens system design is an important factor in image quality. The main aspect of the lens system design methodology is the optimization procedure. Since optimization is a complex, nonlinear task, soft computing optimization algorithms can be used. There are many tools that can be employed to measure optical performance, but the spot diagram is the most useful. The spot diagram gives an indication of the image of a point object. In this paper, the spot size radius is considered an optimization criterion. Intelligent soft computing scheme support vector machines (SVMs) coupled with the firefly algorithm (FFA) are implemented. The performance of the proposed estimators is confirmed with the simulation results. The result of the proposed SVM-FFA model has been compared with support vector regression (SVR), artificial neural networks, and generic programming methods. The results show that the SVM-FFA model performs more accurately than the other methodologies. Therefore, SVM-FFA can be used as an efficient soft computing technique in the optimization of lens system designs.

Simulation of optical signaling among nano-bio-sensors: enhancing of bioimaging contrast.

PubMed

SalmanOgli, A; Behzadi, S; Rostami, A

2014-09-01

In this article, the nanoparticle-dye systems is designed and simulated to illustrate the possibility of enhancement in optical imaging contrast. For this, the firefly optimization technique is used as an optical signaling mechanism among agents (nanoparticle-dye) because fireflies attract together due to their flashing light and optical signaling that is produced by a process of bioluminescence (also it has been investigated that other parameters such as neural response and brain function have essential role in attracting fireflies to each other). The first parameter is coincided with our work, because the nanoparticle-dye systems have ability to augment of received light and its amplification cause that the designed complex system act as a brightness particle. This induced behavior of nanoparticles can be considered as an optical communication and signaling. Indeed by functionalization of nanoparticles and then due to higher brightness of the tumor site because of active targeting, the other particles can be guided to reach toward the target point and the signaling among agents is done by optical relation similar to firefly nature. Moreover, the fundamental of this work is the use of surface plasmon resonance and plasmons hybridization, in which photonic signals can be manipulated on the nanoscale and can be used in biomedical applications such as electromagnetic field enhancement. Finally, it can be mentioned that by simultaneously using plasmon hybridization, near-field augmentation, and firefly algorithm, the optical imaging contrast can be impressively improved.

A Novel RSSI Prediction Using Imperialist Competition Algorithm (ICA), Radial Basis Function (RBF) and Firefly Algorithm (FFA) in Wireless Networks

PubMed Central

Goudarzi, Shidrokh; Haslina Hassan, Wan; Abdalla Hashim, Aisha-Hassan; Soleymani, Seyed Ahmad; Anisi, Mohammad Hossein; Zakaria, Omar M.

2016-01-01

This study aims to design a vertical handover prediction method to minimize unnecessary handovers for a mobile node (MN) during the vertical handover process. This relies on a novel method for the prediction of a received signal strength indicator (RSSI) referred to as IRBF-FFA, which is designed by utilizing the imperialist competition algorithm (ICA) to train the radial basis function (RBF), and by hybridizing with the firefly algorithm (FFA) to predict the optimal solution. The prediction accuracy of the proposed IRBF–FFA model was validated by comparing it to support vector machines (SVMs) and multilayer perceptron (MLP) models. In order to assess the model’s performance, we measured the coefficient of determination (R2), correlation coefficient (r), root mean square error (RMSE) and mean absolute percentage error (MAPE). The achieved results indicate that the IRBF–FFA model provides more precise predictions compared to different ANNs, namely, support vector machines (SVMs) and multilayer perceptron (MLP). The performance of the proposed model is analyzed through simulated and real-time RSSI measurements. The results also suggest that the IRBF–FFA model can be applied as an efficient technique for the accurate prediction of vertical handover. PMID:27438600

A Novel RSSI Prediction Using Imperialist Competition Algorithm (ICA), Radial Basis Function (RBF) and Firefly Algorithm (FFA) in Wireless Networks.

PubMed

Goudarzi, Shidrokh; Haslina Hassan, Wan; Abdalla Hashim, Aisha-Hassan; Soleymani, Seyed Ahmad; Anisi, Mohammad Hossein; Zakaria, Omar M

2016-01-01

This study aims to design a vertical handover prediction method to minimize unnecessary handovers for a mobile node (MN) during the vertical handover process. This relies on a novel method for the prediction of a received signal strength indicator (RSSI) referred to as IRBF-FFA, which is designed by utilizing the imperialist competition algorithm (ICA) to train the radial basis function (RBF), and by hybridizing with the firefly algorithm (FFA) to predict the optimal solution. The prediction accuracy of the proposed IRBF-FFA model was validated by comparing it to support vector machines (SVMs) and multilayer perceptron (MLP) models. In order to assess the model's performance, we measured the coefficient of determination (R2), correlation coefficient (r), root mean square error (RMSE) and mean absolute percentage error (MAPE). The achieved results indicate that the IRBF-FFA model provides more precise predictions compared to different ANNs, namely, support vector machines (SVMs) and multilayer perceptron (MLP). The performance of the proposed model is analyzed through simulated and real-time RSSI measurements. The results also suggest that the IRBF-FFA model can be applied as an efficient technique for the accurate prediction of vertical handover.

Deciphering the Mechanism of Alternative Cleavage and Polyadenylation in Mantle Cell Lymphoma (MCL)

DTIC Science & Technology

2013-10-01

also has human firefly luciferase cloned within the same reporter system allowing for intra-plasmid normalization of transfection eliminating problems...collaboration with Dr. Wei Li, a Bioinformaticist from Baylor College of Medicine whose lab specializes in developing complex algorithms to analyze genome...wide sequencing data. Dr. Wei Li and his postdoctoral fellow, Dr. Zheng Xia developed a customized algorithm that is able to detect and quantify

The application of Firefly algorithm in an Adaptive Emergency Evacuation Centre Management (AEECM) for dynamic relocation of flood victims

NASA Astrophysics Data System (ADS)

ChePa, Noraziah; Hashim, Nor Laily; Yusof, Yuhanis; Hussain, Azham

2016-08-01

Flood evacuation centre is defined as a temporary location or area of people from disaster particularly flood as a rescue or precautionary measure. Gazetted evacuation centres are normally located at secure places which have small chances from being drowned by flood. However, due to extreme flood several evacuation centres in Kelantan were unexpectedly drowned. Currently, there is no study done on proposing a decision support aid to reallocate victims and resources of the evacuation centre when the situation getting worsens. Therefore, this study proposes a decision aid model to be utilized in realizing an adaptive emergency evacuation centre management system. This study undergoes two main phases; development of algorithm and models, and development of a web-based and mobile app. The proposed model operates using Firefly multi-objective optimization algorithm that creates an optimal schedule for the relocation of victims and resources for an evacuation centre. The proposed decision aid model and the adaptive system can be applied in supporting the National Security Council's respond mechanisms for handling disaster management level II (State level) especially in providing better management of the flood evacuating centres.

On Processing Hexagonally Sampled Images

DTIC Science & Technology

2011-07-01

Mersereau’s HDFT: Mersereau encountered an “insurmountable difficulty” when attempting to develop a fast algorithm to compute the hexagonal DFT...WNR GND 1-bit output CS1 . ------. (input for analog) j(-- -: I (analog out) ADC ,. __ I I I I l ______ l Power to Firefly C1 ~2 TT

C-5M Super Galaxy Utilization with Joint Precision Airdrop System

DTIC Science & Technology

2012-03-22

System Notes FireFly 900-2,200 Steerable Parafoil Screamer 500-2,200 Steerable Parafoil w/additional chutes to slow touchdown Dragonfly...setting . This initial feasible solution provides the Nonlinear Program algorithm a starting point to continue its calculations. The model continues...provides the NLP with a starting point of 1. This provides the NLP algorithm a point within the feasible region to begin its calculations in an attempt

Optimized extreme learning machine for urban land cover classification using hyperspectral imagery

NASA Astrophysics Data System (ADS)

Su, Hongjun; Tian, Shufang; Cai, Yue; Sheng, Yehua; Chen, Chen; Najafian, Maryam

2017-12-01

This work presents a new urban land cover classification framework using the firefly algorithm (FA) optimized extreme learning machine (ELM). FA is adopted to optimize the regularization coefficient C and Gaussian kernel σ for kernel ELM. Additionally, effectiveness of spectral features derived from an FA-based band selection algorithm is studied for the proposed classification task. Three sets of hyperspectral databases were recorded using different sensors, namely HYDICE, HyMap, and AVIRIS. Our study shows that the proposed method outperforms traditional classification algorithms such as SVM and reduces computational cost significantly.

Identifying People with Soft-Biometrics at Fleet Week

DTIC Science & Technology

2013-03-01

onboard sensors. This included:  Color Camera: Located in the right eye, Octavia stored 640x480 RGB images at ~4 Hz from a Point Grey Firefly camera. A...Face Detection The Fleet Week experiments demonstrated the potential of soft biometrics for recognition, but all of the existing algorithms currently

Testing New Drugs for Treatment of Melanoma Patients Applying Connectivity Map Database Analysis with Melanoma Gene Signatures

DTIC Science & Technology

2012-10-01

use of R packages implemented in Bioconductor. Each dataset was normalized from raw data using the Frozen RMA (fRMA) algorithm . We applied the same...because development of the specific algorithms and fine tuning of the analytic strategy to accomplish this task was not immediately straightforward. We...express firefly luciferase using a retrovirus that encodes a fusion of luciferase and neomycin phosphotransferase (LucNeo), will be implanted and followed

Special Nuclear Material Gamma-Ray Signatures for Reachback Analysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karpius, Peter Joseph; Myers, Steven Charles

2016-08-29

These are slides on special nuclear material gamma-ray signatures for reachback analysts for an LSS Spectroscopy course. The closing thoughts for this presentation are the following: SNM materials have definite spectral signatures that should be readily recognizable to analysts in both bare and shielded configurations. One can estimate burnup of plutonium using certain pairs of peaks that are a few keV apart. In most cases, one cannot reliably estimate uranium enrichment in an analogous way to the estimation of plutonium burnup. The origin of the most intense peaks from some SNM items may be indirect and from ‘associated nuclides.' Indirectmore » SNM signatures sometimes have commonalities with the natural gamma-ray background.« less

Light-extraction enhancement for light-emitting diodes: a firefly-inspired structure refined by the genetic algorithm

NASA Astrophysics Data System (ADS)

Bay, Annick; Mayer, Alexandre

2014-09-01

The efficiency of light-emitting diodes (LED) has increased significantly over the past few years, but the overall efficiency is still limited by total internal reflections due to the high dielectric-constant contrast between the incident and emergent media. The bioluminescent organ of fireflies gave incentive for light-extraction enhance-ment studies. A specific factory-roof shaped structure was shown, by means of light-propagation simulations and measurements, to enhance light extraction significantly. In order to achieve a similar effect for light-emitting diodes, the structure needs to be adapted to the specific set-up of LEDs. In this context simulations were carried out to determine the best geometrical parameters. In the present work, the search for a geometry that maximizes the extraction of light has been conducted by using a genetic algorithm. The idealized structure considered previously was generalized to a broader variety of shapes. The genetic algorithm makes it possible to search simultaneously over a wider range of parameters. It is also significantly less time-consuming than the previous approach that was based on a systematic scan on parameters. The results of the genetic algorithm show that (1) the calculations can be performed in a smaller amount of time and (2) the light extraction can be enhanced even more significantly by using optimal parameters determined by the genetic algorithm for the generalized structure. The combination of the genetic algorithm with the Rigorous Coupled Waves Analysis method constitutes a strong simulation tool, which provides us with adapted designs for enhancing light extraction from light-emitting diodes.

Biosynthesis of firefly luciferin in adult lantern: decarboxylation of L-cysteine is a key step for benzothiazole ring formation in firefly luciferin synthesis.

PubMed

Oba, Yuichi; Yoshida, Naoki; Kanie, Shusei; Ojika, Makoto; Inouye, Satoshi

2013-01-01

Bioluminescence in fireflies and click beetles is produced by a luciferase-luciferin reaction. The luminescence property and protein structure of firefly luciferase have been investigated, and its cDNA has been used for various assay systems. The chemical structure of firefly luciferin was identified as the D-form in 1963 and studies on the biosynthesis of firefly luciferin began early in the 1970's. Incorporation experiments using (14)C-labeled compounds were performed, and cysteine and benzoquinone/hydroquinone were proposed to be biosynthetic component for firefly luciferin. However, there have been no clear conclusions regarding the biosynthetic components of firefly luciferin over 30 years. Incorporation studies were performed by injecting stable isotope-labeled compounds, including L-[U-(13)C3]-cysteine, L-[1-(13)C]-cysteine, L-[3-(13)C]-cysteine, 1,4-[D6]-hydroquinone, and p-[2,3,5,6-D]-benzoquinone, into the adult lantern of the living Japanese firefly Luciola lateralis. After extracting firefly luciferin from the lantern, the incorporation of stable isotope-labeled compounds into firefly luciferin was identified by LC/ESI-TOF-MS. The positions of the stable isotope atoms in firefly luciferin were determined by the mass fragmentation of firefly luciferin. We demonstrated for the first time that D- and L-firefly luciferins are biosynthesized in the lantern of the adult firefly from two L-cysteine molecules with p-benzoquinone/1,4-hydroquinone, accompanied by the decarboxylation of L-cysteine.

Evolution of synchronization and desynchronization in digital organisms.

PubMed

Knoester, David B; McKinley, Philip K

2011-01-01

We present a study in the evolution of temporal behavior, specifically synchronization and desynchronization, through digital evolution and group selection. In digital evolution, a population of self-replicating computer programs exists in a user-defined computational environment and is subject to instruction-level mutations and natural selection. Group selection links the survival of the individual to the survival of its group, thus encouraging cooperation. Previous approaches to engineering synchronization and desynchronization algorithms have taken inspiration from nature: In the well-known firefly model, the only form of communication between agents is in the form of flash messages among neighbors. Here we demonstrate that populations of digital organisms, provided with a similar mechanism and minimal information about their environment, are capable of evolving algorithms for synchronization and desynchronization, and that the evolved behaviors are robust to message loss. We further describe how the evolved behavior for synchronization mimics that of the well-known Ermentrout model for firefly synchronization in biology. In addition to discovering self-organizing behaviors for distributed computing systems, this result indicates that digital evolution may be used to further our understanding of synchronization in biology.

Motion control of nonlinear gantry crane system via priority-based fitness scheme in firefly algorithm

NASA Astrophysics Data System (ADS)

Jaafar, Hazriq Izzuan; Latif, Norfaneysa Abd; Kassim, Anuar Mohamed; Abidin, Amar Faiz Zainal; Hussien, Sharifah Yuslinda Syed; Aras, Mohd Shahrieel Mohd

2015-05-01

Advanced manufacturing technology made Gantry Crane System (GCS) is one of the suitable heavy machinery transporters and frequently employed in handling with huge materials. The interconnection of trolley movement and payload oscillation has a technical impact which needs to be considered. Once the trolley moves to the desired position with high speed, this will induce undesirable's payload oscillation. This frequent unavoidable load swing causes an efficiency drop, load damages and even accidents. In this paper, a new control strategy of Firefly Algorithm (FA) will be developed to obtain five optimal controller parameters (PID and PD) via Priority-based Fitness Scheme (PFS). Combinations of these five parameters are utilized for controlling trolley movement and minimizing the angle of payload oscillation. This PFS is prioritized based on steady-state error (SSE), overshoot (OS) and settling time (Ts) according to the needs and circumstances. Lagrange equation will be chosen for modeling and simulation will be conducted by using related software. Simulation results show that the proposed control strategy is efficient to control the trolley movement to the desired position and minimize the angle of payload oscillation.

Faster experimental validation of microRNA targets using cold fusion cloning and a dual firefly-Renilla luciferase reporter assay.

PubMed

Alvarez, M Lucrecia

2014-01-01

Different target prediction algorithms have been developed to provide a list of candidate target genes for a given animal microRNAs (miRNAs). However, these computational approaches provide both false-positive and false-negative predictions. Therefore, the target genes of a specific miRNA identified in silico should be experimentally validated. In this chapter, we describe a step-by-step protocol for the experimental validation of a direct miRNA target using a faster Dual Firefly-Renilla Luciferase Reporter Assay. We describe how to construct reporter plasmids using the simple, fast, and highly efficient cold fusion cloning technology, which does not require ligase, phosphatase, or restriction enzymes. In addition, we provide a protocol for co-transfection of reporter plasmids with either miRNA mimics or miRNA inhibitors in human embryonic kidney 293 (HEK293) cells, as well as a description on how to measure Firefly and Renilla luciferase activity using the Dual-Glo Luciferase Assay kit. As an example of the use of this technology, we will validate glucose-6-phosphate dehydrogenase (G6PD) as a direct target of miR-1207-5p.

Advanced algorithms for the identification of mixtures using condensed-phase FT-IR spectroscopy

NASA Astrophysics Data System (ADS)

Arnó, Josep; Andersson, Greger; Levy, Dustin; Tomczyk, Carol; Zou, Peng; Zuidema, Eric

2011-06-01

FT-IR spectroscopy is the technology of choice to identify solid and liquid phase unknown samples. Advances in instrument portability have made possible the use of FT-IR spectroscopy in emergency response and military field applications. The samples collected in those harsh environments are rarely pure and typically contain multiple chemical species in water, sand, or inorganic matrices. In such critical applications, it is also desired that in addition to broad chemical identification, the user is warned immediately if the sample contains a threat or target class material (i.e. biological, narcotic, explosive). The next generation HazMatID 360 combines the ruggedized design and functionality of the current HazMatID with advanced mixture analysis algorithms. The advanced FT-IR instrument allows effective chemical assessment of samples that may contain one or more interfering materials like water or dirt. The algorithm was the result of years of cumulative experience based on thousands of real-life spectra sent to our ReachBack spectral analysis service by customers in the field. The HazMatID 360 combines mixture analysis with threat detection and chemical hazard classification capabilities to provide, in record time, crucial information to the user. This paper will provide an overview of the software and algorithm enhancements, in addition to examples of improved performance in mixture identification.

Advanced FIREFLY Assessment Generalized Mechanization Requirements Report

DTIC Science & Technology

1979-06-01

Systems; Fire Control Computers ; Weapon Control 20. ABSTRACT (Continue on reverse side If necessary end tdentify by blockc number) -The requirements for...airborne digital computer which can be specialized to per- form successfully in a variety of tactical aircraft with differing avionics sensors, fire...AGG ........................................... 27 13 Time of Flight Computation Using a Modified (China Lake) Numerical Integration Algorithm

ECG based Myocardial Infarction detection using Hybrid Firefly Algorithm.

PubMed

Kora, Padmavathi

2017-12-01

Myocardial Infarction (MI) is one of the most frequent diseases, and can also cause demise, disability and monetary loss in patients who suffer from cardiovascular disorder. Diagnostic methods of this ailment by physicians are typically invasive, even though they do not fulfill the required detection accuracy. Recent feature extraction methods, for example, Auto Regressive (AR) modelling; Magnitude Squared Coherence (MSC); Wavelet Coherence (WTC) using Physionet database, yielded a collection of huge feature set. A large number of these features may be inconsequential containing some excess and non-discriminative components that present excess burden in computation and loss of execution performance. So Hybrid Firefly and Particle Swarm Optimization (FFPSO) is directly used to optimise the raw ECG signal instead of extracting features using the above feature extraction techniques. Provided results in this paper show that, for the detection of MI class, the FFPSO algorithm with ANN gives 99.3% accuracy, sensitivity of 99.97%, and specificity of 98.7% on MIT-BIH database by including NSR database also. The proposed approach has shown that methods that are based on the feature optimization of the ECG signals are the perfect to diagnosis the condition of the heart patients. Copyright © 2017 Elsevier B.V. All rights reserved.

A support vector regression-firefly algorithm-based model for limiting velocity prediction in sewer pipes.

PubMed

Ebtehaj, Isa; Bonakdari, Hossein

2016-01-01

Sediment transport without deposition is an essential consideration in the optimum design of sewer pipes. In this study, a novel method based on a combination of support vector regression (SVR) and the firefly algorithm (FFA) is proposed to predict the minimum velocity required to avoid sediment settling in pipe channels, which is expressed as the densimetric Froude number (Fr). The efficiency of support vector machine (SVM) models depends on the suitable selection of SVM parameters. In this particular study, FFA is used by determining these SVM parameters. The actual effective parameters on Fr calculation are generally identified by employing dimensional analysis. The different dimensionless variables along with the models are introduced. The best performance is attributed to the model that employs the sediment volumetric concentration (C(V)), ratio of relative median diameter of particles to hydraulic radius (d/R), dimensionless particle number (D(gr)) and overall sediment friction factor (λ(s)) parameters to estimate Fr. The performance of the SVR-FFA model is compared with genetic programming, artificial neural network and existing regression-based equations. The results indicate the superior performance of SVR-FFA (mean absolute percentage error = 2.123%; root mean square error =0.116) compared with other methods.

Numerical model updating technique for structures using firefly algorithm

NASA Astrophysics Data System (ADS)

Sai Kubair, K.; Mohan, S. C.

2018-03-01

Numerical model updating is a technique used for updating the existing experimental models for any structures related to civil, mechanical, automobiles, marine, aerospace engineering, etc. The basic concept behind this technique is updating the numerical models to closely match with experimental data obtained from real or prototype test structures. The present work involves the development of numerical model using MATLAB as a computational tool and with mathematical equations that define the experimental model. Firefly algorithm is used as an optimization tool in this study. In this updating process a response parameter of the structure has to be chosen, which helps to correlate the numerical model developed with the experimental results obtained. The variables for the updating can be either material or geometrical properties of the model or both. In this study, to verify the proposed technique, a cantilever beam is analyzed for its tip deflection and a space frame has been analyzed for its natural frequencies. Both the models are updated with their respective response values obtained from experimental results. The numerical results after updating show that there is a close relationship that can be brought between the experimental and the numerical models.

Comparison of two optimization algorithms for fuzzy finite element model updating for damage detection in a wind turbine blade

NASA Astrophysics Data System (ADS)

Turnbull, Heather; Omenzetter, Piotr

2018-03-01

vDifficulties associated with current health monitoring and inspection practices combined with harsh, often remote, operational environments of wind turbines highlight the requirement for a non-destructive evaluation system capable of remotely monitoring the current structural state of turbine blades. This research adopted a physics based structural health monitoring methodology through calibration of a finite element model using inverse techniques. A 2.36m blade from a 5kW turbine was used as an experimental specimen, with operational modal analysis techniques utilised to realize the modal properties of the system. Modelling the experimental responses as fuzzy numbers using the sub-level technique, uncertainty in the response parameters was propagated back through the model and into the updating parameters. Initially, experimental responses of the blade were obtained, with a numerical model of the blade created and updated. Deterministic updating was carried out through formulation and minimisation of a deterministic objective function using both firefly algorithm and virus optimisation algorithm. Uncertainty in experimental responses were modelled using triangular membership functions, allowing membership functions of updating parameters (Young's modulus and shear modulus) to be obtained. Firefly algorithm and virus optimisation algorithm were again utilised, however, this time in the solution of fuzzy objective functions. This enabled uncertainty associated with updating parameters to be quantified. Varying damage location and severity was simulated experimentally through addition of small masses to the structure intended to cause a structural alteration. A damaged model was created, modelling four variable magnitude nonstructural masses at predefined points and updated to provide a deterministic damage prediction and information in relation to the parameters uncertainty via fuzzy updating.

Electricity Load Forecasting Using Support Vector Regression with Memetic Algorithms

PubMed Central

Hu, Zhongyi; Xiong, Tao

2013-01-01

Electricity load forecasting is an important issue that is widely explored and examined in power systems operation literature and commercial transactions in electricity markets literature as well. Among the existing forecasting models, support vector regression (SVR) has gained much attention. Considering the performance of SVR highly depends on its parameters; this study proposed a firefly algorithm (FA) based memetic algorithm (FA-MA) to appropriately determine the parameters of SVR forecasting model. In the proposed FA-MA algorithm, the FA algorithm is applied to explore the solution space, and the pattern search is used to conduct individual learning and thus enhance the exploitation of FA. Experimental results confirm that the proposed FA-MA based SVR model can not only yield more accurate forecasting results than the other four evolutionary algorithms based SVR models and three well-known forecasting models but also outperform the hybrid algorithms in the related existing literature. PMID:24459425

Electricity load forecasting using support vector regression with memetic algorithms.

PubMed

Hu, Zhongyi; Bao, Yukun; Xiong, Tao

2013-01-01

Electricity load forecasting is an important issue that is widely explored and examined in power systems operation literature and commercial transactions in electricity markets literature as well. Among the existing forecasting models, support vector regression (SVR) has gained much attention. Considering the performance of SVR highly depends on its parameters; this study proposed a firefly algorithm (FA) based memetic algorithm (FA-MA) to appropriately determine the parameters of SVR forecasting model. In the proposed FA-MA algorithm, the FA algorithm is applied to explore the solution space, and the pattern search is used to conduct individual learning and thus enhance the exploitation of FA. Experimental results confirm that the proposed FA-MA based SVR model can not only yield more accurate forecasting results than the other four evolutionary algorithms based SVR models and three well-known forecasting models but also outperform the hybrid algorithms in the related existing literature.

Pan evaporation prediction using a hybrid multilayer perceptron-firefly algorithm (MLP-FFA) model: case study in North Iran

NASA Astrophysics Data System (ADS)

Ghorbani, M. A.; Deo, Ravinesh C.; Yaseen, Zaher Mundher; H. Kashani, Mahsa; Mohammadi, Babak

2017-08-01

An accurate computational approach for the prediction of pan evaporation over daily time horizons is a useful decisive tool in sustainable agriculture and hydrological applications, particularly in designing the rural water resource systems, water use allocations, utilization and demand assessments, and the management of irrigation systems. In this study, a hybrid predictive model (Multilayer Perceptron-Firefly Algorithm (MLP-FFA)) based on the FFA optimizer that is embedded within the MLP technique is developed and evaluated for its suitability for the prediction of daily pan evaporation. To develop the hybrid MLP-FFA model, the pan evaporation data measured between 2012 and 2014 for two major meteorological stations (Talesh and Manjil) located at Northern Iran are employed to train and test the predictive model. The ability of the hybrid MLP-FFA model is compared with the traditional MLP and support vector machine (SVM) models. The results are evaluated using five performance criteria metrics: root mean square error (RMSE), mean absolute error (MAE), Nash-Sutcliffe efficiency (NS), and the Willmott's Index (WI). Taylor diagrams are also used to examine the similarity between the observed and predicted pan evaporation data in the test period. Results show that an optimal MLP-FFA model outperforms the MLP and SVM model for both tested stations. For Talesh, a value of WI = 0.926, NS = 0.791, and RMSE = 1.007 mm day-1 is obtained using MLP-FFA model, compared with 0.912, 0.713, and 1.181 mm day-1 (MLP) and 0.916, 0.726, and 1.153 mm day-1 (SVM), whereas for Manjil, a value of WI = 0.976, NS = 0.922, and 1.406 mm day-1 is attained that contrasts 0.972, 0.901, and 1.583 mm day-1 (MLP) and 0.971, 0.893, and 1.646 mm day-1 (SVM). The results demonstrate the importance of the Firefly Algorithm applied to improve the performance of the MLP-FFA model, as verified through its better predictive performance compared to the MLP and SVM model.

One-pot non-enzymatic formation of firefly luciferin in a neutral buffer from p-benzoquinone and cysteine

PubMed Central

Kanie, Shusei; Nishikawa, Toshio; Ojika, Makoto; Oba, Yuichi

2016-01-01

Firefly luciferin, the substrate for the bioluminescence reaction of luminous beetles, possesses a benzothiazole ring, which is rare in nature. Here, we demonstrate a novel one-pot reaction to give firefly luciferin in a neutral buffer from p-benzoquinone and cysteine without any synthetic reagents or enzymes. The formation of firefly luciferin was low in yield in various neutral buffers, whereas it was inhibited or completely prevented in acidic or basic buffers, in organic solvents, or under a nitrogen atmosphere. Labelling analysis of the firefly luciferin using stable isotopic cysteines showed that the benzothiazole ring was formed via the decarboxylation and carbon-sulfur bond rearrangement of cysteine. These findings imply that the biosynthesis of firefly luciferin can be developed/evolved from the non-enzymatic production of firefly luciferin using common primary biosynthetic units, p-benzoquinone and cysteine. PMID:27098929

One-pot non-enzymatic formation of firefly luciferin in a neutral buffer from p-benzoquinone and cysteine.

PubMed

Kanie, Shusei; Nishikawa, Toshio; Ojika, Makoto; Oba, Yuichi

2016-04-21

Firefly luciferin, the substrate for the bioluminescence reaction of luminous beetles, possesses a benzothiazole ring, which is rare in nature. Here, we demonstrate a novel one-pot reaction to give firefly luciferin in a neutral buffer from p-benzoquinone and cysteine without any synthetic reagents or enzymes. The formation of firefly luciferin was low in yield in various neutral buffers, whereas it was inhibited or completely prevented in acidic or basic buffers, in organic solvents, or under a nitrogen atmosphere. Labelling analysis of the firefly luciferin using stable isotopic cysteines showed that the benzothiazole ring was formed via the decarboxylation and carbon-sulfur bond rearrangement of cysteine. These findings imply that the biosynthesis of firefly luciferin can be developed/evolved from the non-enzymatic production of firefly luciferin using common primary biosynthetic units, p-benzoquinone and cysteine.

Assessment of environmental factors that affect the fireflies for ecotourism in Unesco Tasik Chini biosphere reserve

NASA Astrophysics Data System (ADS)

Roslan, Norzeana; Sulaiman, Norela

2015-09-01

This study was conducted to study the firefly species found in Tasik Chini, the soil factors that suitable for larval development fireflies flashes, and the sociological aspects of the community's availability to engage in firefly ecotourism. This was achieved through firefly sampling, soil analysis, abiotic data collection and by questionnaire surveys from local community perceptions and knowledge on fireflies and ecotourism. Fireflies sampling were conducted from December 2011 to January 2013 at Kampung Melai and Kampung Cenahan. Three non-synchronize fireflies genus were found, namely Colophotia sp., Pygoluciola sp., and Pyrocoelia sp. A total of 25 questionnaires were given to four groups of respondents consisting orang asli (5 respondents), boat operator (2 respondents), resort workers (5 respondents) and FELDA residents (13 respondents). The questionnaires were analysed using Rasch Winstep Software based on Rasch Measurement Model. Results of the survey indicated that the local community was not ready for ecotourism in their area. Meanwhile, the soil pH was very acidic and the heavy metals concentration was high, which is not good for the development of firefly larvae. In conclusion, Tasik Chini was not having the potential for ecotourism. Despite the fact, improvement of soils with soil remediation methods can be apply for enhancing larvae development and having more awareness campaign of ecotourism to local community.

Solution to automatic generation control problem using firefly algorithm optimized I(λ)D(µ) controller.

PubMed

Debbarma, Sanjoy; Saikia, Lalit Chandra; Sinha, Nidul

2014-03-01

Present work focused on automatic generation control (AGC) of a three unequal area thermal systems considering reheat turbines and appropriate generation rate constraints (GRC). A fractional order (FO) controller named as I(λ)D(µ) controller based on crone approximation is proposed for the first time as an appropriate technique to solve the multi-area AGC problem in power systems. A recently developed metaheuristic algorithm known as firefly algorithm (FA) is used for the simultaneous optimization of the gains and other parameters such as order of integrator (λ) and differentiator (μ) of I(λ)D(µ) controller and governor speed regulation parameters (R). The dynamic responses corresponding to optimized I(λ)D(µ) controller gains, λ, μ, and R are compared with that of classical integer order (IO) controllers such as I, PI and PID controllers. Simulation results show that the proposed I(λ)D(µ) controller provides more improved dynamic responses and outperforms the IO based classical controllers. Further, sensitivity analysis confirms the robustness of the so optimized I(λ)D(µ) controller to wide changes in system loading conditions and size and position of SLP. Proposed controller is also found to have performed well as compared to IO based controllers when SLP takes place simultaneously in any two areas or all the areas. Robustness of the proposed I(λ)D(µ) controller is also tested against system parameter variations. © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

Using the Firefly optimization method to weight an ensemble of rainfall forecasts from the Brazilian developments on the Regional Atmospheric Modeling System (BRAMS)

NASA Astrophysics Data System (ADS)

dos Santos, A. F.; Freitas, S. R.; de Mattos, J. G. Z.; de Campos Velho, H. F.; Gan, M. A.; da Luz, E. F. P.; Grell, G. A.

2013-09-01

In this paper we consider an optimization problem applying the metaheuristic Firefly algorithm (FY) to weight an ensemble of rainfall forecasts from daily precipitation simulations with the Brazilian developments on the Regional Atmospheric Modeling System (BRAMS) over South America during January 2006. The method is addressed as a parameter estimation problem to weight the ensemble of precipitation forecasts carried out using different options of the convective parameterization scheme. Ensemble simulations were performed using different choices of closures, representing different formulations of dynamic control (the modulation of convection by the environment) in a deep convection scheme. The optimization problem is solved as an inverse problem of parameter estimation. The application and validation of the methodology is carried out using daily precipitation fields, defined over South America and obtained by merging remote sensing estimations with rain gauge observations. The quadratic difference between the model and observed data was used as the objective function to determine the best combination of the ensemble members to reproduce the observations. To reduce the model rainfall biases, the set of weights determined by the algorithm is used to weight members of an ensemble of model simulations in order to compute a new precipitation field that represents the observed precipitation as closely as possible. The validation of the methodology is carried out using classical statistical scores. The algorithm has produced the best combination of the weights, resulting in a new precipitation field closest to the observations.

On the Effectiveness of Nature-Inspired Metaheuristic Algorithms for Performing Phase Equilibrium Thermodynamic Calculations

PubMed Central

Fateen, Seif-Eddeen K.; Bonilla-Petriciolet, Adrian

2014-01-01

The search for reliable and efficient global optimization algorithms for solving phase stability and phase equilibrium problems in applied thermodynamics is an ongoing area of research. In this study, we evaluated and compared the reliability and efficiency of eight selected nature-inspired metaheuristic algorithms for solving difficult phase stability and phase equilibrium problems. These algorithms are the cuckoo search (CS), intelligent firefly (IFA), bat (BA), artificial bee colony (ABC), MAKHA, a hybrid between monkey algorithm and krill herd algorithm, covariance matrix adaptation evolution strategy (CMAES), magnetic charged system search (MCSS), and bare bones particle swarm optimization (BBPSO). The results clearly showed that CS is the most reliable of all methods as it successfully solved all thermodynamic problems tested in this study. CS proved to be a promising nature-inspired optimization method to perform applied thermodynamic calculations for process design. PMID:24967430

On the effectiveness of nature-inspired metaheuristic algorithms for performing phase equilibrium thermodynamic calculations.

PubMed

Fateen, Seif-Eddeen K; Bonilla-Petriciolet, Adrian

2014-01-01

The search for reliable and efficient global optimization algorithms for solving phase stability and phase equilibrium problems in applied thermodynamics is an ongoing area of research. In this study, we evaluated and compared the reliability and efficiency of eight selected nature-inspired metaheuristic algorithms for solving difficult phase stability and phase equilibrium problems. These algorithms are the cuckoo search (CS), intelligent firefly (IFA), bat (BA), artificial bee colony (ABC), MAKHA, a hybrid between monkey algorithm and krill herd algorithm, covariance matrix adaptation evolution strategy (CMAES), magnetic charged system search (MCSS), and bare bones particle swarm optimization (BBPSO). The results clearly showed that CS is the most reliable of all methods as it successfully solved all thermodynamic problems tested in this study. CS proved to be a promising nature-inspired optimization method to perform applied thermodynamic calculations for process design.

From nonlinear optimization to convex optimization through firefly algorithm and indirect approach with applications to CAD/CAM.

PubMed

Gálvez, Akemi; Iglesias, Andrés

2013-01-01

Fitting spline curves to data points is a very important issue in many applied fields. It is also challenging, because these curves typically depend on many continuous variables in a highly interrelated nonlinear way. In general, it is not possible to compute these parameters analytically, so the problem is formulated as a continuous nonlinear optimization problem, for which traditional optimization techniques usually fail. This paper presents a new bioinspired method to tackle this issue. In this method, optimization is performed through a combination of two techniques. Firstly, we apply the indirect approach to the knots, in which they are not initially the subject of optimization but precomputed with a coarse approximation scheme. Secondly, a powerful bioinspired metaheuristic technique, the firefly algorithm, is applied to optimization of data parameterization; then, the knot vector is refined by using De Boor's method, thus yielding a better approximation to the optimal knot vector. This scheme converts the original nonlinear continuous optimization problem into a convex optimization problem, solved by singular value decomposition. Our method is applied to some illustrative real-world examples from the CAD/CAM field. Our experimental results show that the proposed scheme can solve the original continuous nonlinear optimization problem very efficiently.

From Nonlinear Optimization to Convex Optimization through Firefly Algorithm and Indirect Approach with Applications to CAD/CAM

PubMed Central

Gálvez, Akemi; Iglesias, Andrés

2013-01-01

Fitting spline curves to data points is a very important issue in many applied fields. It is also challenging, because these curves typically depend on many continuous variables in a highly interrelated nonlinear way. In general, it is not possible to compute these parameters analytically, so the problem is formulated as a continuous nonlinear optimization problem, for which traditional optimization techniques usually fail. This paper presents a new bioinspired method to tackle this issue. In this method, optimization is performed through a combination of two techniques. Firstly, we apply the indirect approach to the knots, in which they are not initially the subject of optimization but precomputed with a coarse approximation scheme. Secondly, a powerful bioinspired metaheuristic technique, the firefly algorithm, is applied to optimization of data parameterization; then, the knot vector is refined by using De Boor's method, thus yielding a better approximation to the optimal knot vector. This scheme converts the original nonlinear continuous optimization problem into a convex optimization problem, solved by singular value decomposition. Our method is applied to some illustrative real-world examples from the CAD/CAM field. Our experimental results show that the proposed scheme can solve the original continuous nonlinear optimization problem very efficiently. PMID:24376380

Identification of DNA-binding proteins using multi-features fusion and binary firefly optimization algorithm.

PubMed

Zhang, Jian; Gao, Bo; Chai, Haiting; Ma, Zhiqiang; Yang, Guifu

2016-08-26

DNA-binding proteins (DBPs) play fundamental roles in many biological processes. Therefore, the developing of effective computational tools for identifying DBPs is becoming highly desirable. In this study, we proposed an accurate method for the prediction of DBPs. Firstly, we focused on the challenge of improving DBP prediction accuracy with information solely from the sequence. Secondly, we used multiple informative features to encode the protein. These features included evolutionary conservation profile, secondary structure motifs, and physicochemical properties. Thirdly, we introduced a novel improved Binary Firefly Algorithm (BFA) to remove redundant or noisy features as well as select optimal parameters for the classifier. The experimental results of our predictor on two benchmark datasets outperformed many state-of-the-art predictors, which revealed the effectiveness of our method. The promising prediction performance on a new-compiled independent testing dataset from PDB and a large-scale dataset from UniProt proved the good generalization ability of our method. In addition, the BFA forged in this research would be of great potential in practical applications in optimization fields, especially in feature selection problems. A highly accurate method was proposed for the identification of DBPs. A user-friendly web-server named iDbP (identification of DNA-binding Proteins) was constructed and provided for academic use.

Lowering effect of firefly squid powder on triacylglycerol content and glucose-6-phosphate dehydrogenase activity in rat liver.

PubMed

Takeuchi, Hiroyuki; Morita, Ritsuko; Shirai, Yoko; Nakagawa, Yoshihisa; Terashima, Teruya; Ushikubo, Shun; Matsuo, Tatsuhiro

2014-01-01

Effects of dietary firefly squid on serum and liver lipid levels were investigated. Male Wistar rats were fed a diet containing 5% freeze-dried firefly squid or Japanese flying squid for 2 weeks. There was no significant difference in the liver triacylglycerol level between the control and Japanese flying squid groups, but the rats fed the firefly squid diet had a significantly lower liver triacylglycerol content than those fed the control diet. No significant difference was observed in serum triacylglycerol levels between the control and firefly squid groups. The rats fed the firefly squid had a significantly lower activity of liver glucose-6-phosphate dehydrogenase compared to the rats fed the control diet. There was no significant difference in liver fatty acid synthetase activity among the three groups. Hepatic gene expression and lipogenic enzyme activity were investigated; a DNA microarray showed that the significantly enriched gene ontology category of down-regulated genes in the firefly squid group was "lipid metabolic process". The firefly squid group had lower mRNA level of glucose-6-phosphate dehydrogenase compared to the controls. These results suggest that an intake of firefly squid decreases hepatic triacylglycerol in rats, and the reduction of mRNA level and enzyme activity of glucose-6-phosphate dehydrogenase might be related to the mechanisms.

Study of firefly luciferin oxidation and isomerism as possible inhibition pathways for firefly bioluminescence

NASA Astrophysics Data System (ADS)

Pinto da Silva, Luís; Esteves da Silva, Joaquim C. G.

2014-01-01

Firefly bioluminescence presents a light emitting profile with a form of a flash, due to the firefly luciferase-catalyzed formation of inhibitory products. These impair the binding of the substrate luciferin to the active site of the enzyme. However, this luciferase catalyzed pathways may not be the only ones responsible for the flash profile. The oxidation and isomerisation of the substrate luciferin lead to the formation of compounds that are also known inhibitors of firefly bioluminescence. So, the objective of this Letter was to analyze if these reactions could be capable of interfering with the bioluminescence reaction.

Solving Fractional Programming Problems based on Swarm Intelligence

NASA Astrophysics Data System (ADS)

Raouf, Osama Abdel; Hezam, Ibrahim M.

2014-04-01

This paper presents a new approach to solve Fractional Programming Problems (FPPs) based on two different Swarm Intelligence (SI) algorithms. The two algorithms are: Particle Swarm Optimization, and Firefly Algorithm. The two algorithms are tested using several FPP benchmark examples and two selected industrial applications. The test aims to prove the capability of the SI algorithms to solve any type of FPPs. The solution results employing the SI algorithms are compared with a number of exact and metaheuristic solution methods used for handling FPPs. Swarm Intelligence can be denoted as an effective technique for solving linear or nonlinear, non-differentiable fractional objective functions. Problems with an optimal solution at a finite point and an unbounded constraint set, can be solved using the proposed approach. Numerical examples are given to show the feasibility, effectiveness, and robustness of the proposed algorithm. The results obtained using the two SI algorithms revealed the superiority of the proposed technique among others in computational time. A better accuracy was remarkably observed in the solution results of the industrial application problems.

The NSF Firefly Cubesat: Progress and status

NASA Astrophysics Data System (ADS)

Rowland, D. E.; Weatherwax, A. T.; Klenzing, J. H.; Hill, J.

2009-12-01

Firefly is a science investigation into the linkage between lightning and Terrestrial Gamma ray Flashes (TGFs). Firefly combines a gamma ray / electron scintillation detector, VLF radio receiver, and optical photometers to perform the first simultaneous measurements of lightning and TGFs from a single platform. Firefly will push the boundaries of TGF detection and build on the successes of past missions such as RHESSI, CGRO, AGILE, and Fermi by pursuing focused TGF science. In particular, Firefly will address the following science questions: a) What types of lightning do and do not produce TGFs? b) What is the occurrence rate of weak TGFs? c) How strong are TGFs, and to what extent were previous measurements affected by pileup and detector limitations? d) What is the relative timing of gamma ray, optical, and VLF signatures of TGFs? e) What are the characteristics of energetic electrons associated with TGFs? Firefly is scheduled for launch in August 2010, and will be delivered to the launch vehicle in spring 2010. We will present an update on the Firefly status, student training activities, tools we have developed for the community, and lessons learned.

Characterization of CG6178 gene product with high sequence similarity to firefly luciferase in Drosophila melanogaster.

PubMed

Oba, Yuichi; Ojika, Makoto; Inouye, Satoshi

2004-03-31

This is the first identification of a long-chain fatty acyl-CoA synthetase in Drosophila by enzymatic characterization. The gene product of CG6178 (CG6178) in Drosophila melanogaster genome, which has a high sequence similarity to firefly luciferase, has been expressed and characterized. CG6178 showed long-chain fatty acyl-CoA synthetic activity in the presence of ATP, CoA and Mg(2+), suggesting a fatty acyl adenylate is an intermediate. Recently, it was revealed that firefly luciferase has two catalytic functions, monooxygenase (luciferase) and AMP-mediated CoA ligase (fatty acyl-CoA synthetase). However, unlike firefly luciferase, CG6178 did not show luminescence activity in the presence of firefly luciferin, ATP, CoA and Mg(2+). The enzymatic properties of CG6178 including substrate specificity, pH dependency and optimal temperature were close to those of firefly luciferase and rat fatty acyl-CoA synthetase. Further, phylogenic analyses strongly suggest that the firefly luciferase gene may have evolved from a fatty acyl-CoA synthetase gene as a common ancestral gene.

Investigation into the efficiency of different bionic algorithm combinations for a COBRA meta-heuristic

NASA Astrophysics Data System (ADS)

Akhmedova, Sh; Semenkin, E.

2017-02-01

Previously, a meta-heuristic approach, called Co-Operation of Biology-Related Algorithms or COBRA, for solving real-parameter optimization problems was introduced and described. COBRA’s basic idea consists of a cooperative work of five well-known bionic algorithms such as Particle Swarm Optimization, the Wolf Pack Search, the Firefly Algorithm, the Cuckoo Search Algorithm and the Bat Algorithm, which were chosen due to the similarity of their schemes. The performance of this meta-heuristic was evaluated on a set of test functions and its workability was demonstrated. Thus it was established that the idea of the algorithms’ cooperative work is useful. However, it is unclear which bionic algorithms should be included in this cooperation and how many of them. Therefore, the five above-listed algorithms and additionally the Fish School Search algorithm were used for the development of five different modifications of COBRA by varying the number of component-algorithms. These modifications were tested on the same set of functions and the best of them was found. Ways of further improving the COBRA algorithm are then discussed.

Metaheuristic Optimization and its Applications in Earth Sciences

NASA Astrophysics Data System (ADS)

Yang, Xin-She

2010-05-01

A common but challenging task in modelling geophysical and geological processes is to handle massive data and to minimize certain objectives. This can essentially be considered as an optimization problem, and thus many new efficient metaheuristic optimization algorithms can be used. In this paper, we will introduce some modern metaheuristic optimization algorithms such as genetic algorithms, harmony search, firefly algorithm, particle swarm optimization and simulated annealing. We will also discuss how these algorithms can be applied to various applications in earth sciences, including nonlinear least-squares, support vector machine, Kriging, inverse finite element analysis, and data-mining. We will present a few examples to show how different problems can be reformulated as optimization. Finally, we will make some recommendations for choosing various algorithms to suit various problems. References 1) D. H. Wolpert and W. G. Macready, No free lunch theorems for optimization, IEEE Trans. Evolutionary Computation, Vol. 1, 67-82 (1997). 2) X. S. Yang, Nature-Inspired Metaheuristic Algorithms, Luniver Press, (2008). 3) X. S. Yang, Mathematical Modelling for Earth Sciences, Dunedin Academic Press, (2008).

The Role of AhR in Breast Cancer Development

DTIC Science & Technology

2004-07-01

The renilla luciferase vectorphRL-TK (0.05 rtg) was co-transfected with firefly luciferase reporter constructs (0.1 ptg pGudLuc, 0.5-1.0 [tg wildtype...Glo Luciferase system (Promega, Madison, WI ) which allowed sequential reading of the firefly and renilla signals. Cells were lysed according to the...Madison, WI ). The renilla signal was read after quenching the firefly output, thus allowing normalization between sample wells. The normalized firefly

Segmentation and classification of brain images using firefly and hybrid kernel-based support vector machine

NASA Astrophysics Data System (ADS)

Selva Bhuvaneswari, K.; Geetha, P.

2017-05-01

Magnetic resonance imaging segmentation refers to a process of assigning labels to set of pixels or multiple regions. It plays a major role in the field of biomedical applications as it is widely used by the radiologists to segment the medical images input into meaningful regions. In recent years, various brain tumour detection techniques are presented in the literature. The entire segmentation process of our proposed work comprises three phases: threshold generation with dynamic modified region growing phase, texture feature generation phase and region merging phase. by dynamically changing two thresholds in the modified region growing approach, the first phase of the given input image can be performed as dynamic modified region growing process, in which the optimisation algorithm, firefly algorithm help to optimise the two thresholds in modified region growing. After obtaining the region growth segmented image using modified region growing, the edges can be detected with edge detection algorithm. In the second phase, the texture feature can be extracted using entropy-based operation from the input image. In region merging phase, the results obtained from the texture feature-generation phase are combined with the results of dynamic modified region growing phase and similar regions are merged using a distance comparison between regions. After identifying the abnormal tissues, the classification can be done by hybrid kernel-based SVM (Support Vector Machine). The performance analysis of the proposed method will be carried by K-cross fold validation method. The proposed method will be implemented in MATLAB with various images.

QSRR modeling for the chromatographic retention behavior of some β-lactam antibiotics using forward and firefly variable selection algorithms coupled with multiple linear regression.

PubMed

Fouad, Marwa A; Tolba, Enas H; El-Shal, Manal A; El Kerdawy, Ahmed M

2018-05-11

The justified continuous emerging of new β-lactam antibiotics provokes the need for developing suitable analytical methods that accelerate and facilitate their analysis. A face central composite experimental design was adopted using different levels of phosphate buffer pH, acetonitrile percentage at zero time and after 15 min in a gradient program to obtain the optimum chromatographic conditions for the elution of 31 β-lactam antibiotics. Retention factors were used as the target property to build two QSRR models utilizing the conventional forward selection and the advanced nature-inspired firefly algorithm for descriptor selection, coupled with multiple linear regression. The obtained models showed high performance in both internal and external validation indicating their robustness and predictive ability. Williams-Hotelling test and student's t-test showed that there is no statistical significant difference between the models' results. Y-randomization validation showed that the obtained models are due to significant correlation between the selected molecular descriptors and the analytes' chromatographic retention. These results indicate that the generated FS-MLR and FFA-MLR models are showing comparable quality on both the training and validation levels. They also gave comparable information about the molecular features that influence the retention behavior of β-lactams under the current chromatographic conditions. We can conclude that in some cases simple conventional feature selection algorithm can be used to generate robust and predictive models comparable to that are generated using advanced ones. Copyright © 2018 Elsevier B.V. All rights reserved.

Towards predictive data-driven simulations of wildfire spread - Part I: Reduced-cost Ensemble Kalman Filter based on a Polynomial Chaos surrogate model for parameter estimation

NASA Astrophysics Data System (ADS)

Rochoux, M. C.; Ricci, S.; Lucor, D.; Cuenot, B.; Trouvé, A.

2014-05-01

This paper is the first part in a series of two articles and presents a data-driven wildfire simulator for forecasting wildfire spread scenarios, at a reduced computational cost that is consistent with operational systems. The prototype simulator features the following components: a level-set-based fire propagation solver FIREFLY that adopts a regional-scale modeling viewpoint, treats wildfires as surface propagating fronts, and uses a description of the local rate of fire spread (ROS) as a function of environmental conditions based on Rothermel's model; a series of airborne-like observations of the fire front positions; and a data assimilation algorithm based on an ensemble Kalman filter (EnKF) for parameter estimation. This stochastic algorithm partly accounts for the non-linearities between the input parameters of the semi-empirical ROS model and the fire front position, and is sequentially applied to provide a spatially-uniform correction to wind and biomass fuel parameters as observations become available. A wildfire spread simulator combined with an ensemble-based data assimilation algorithm is therefore a promising approach to reduce uncertainties in the forecast position of the fire front and to introduce a paradigm-shift in the wildfire emergency response. In order to reduce the computational cost of the EnKF algorithm, a surrogate model based on a polynomial chaos (PC) expansion is used in place of the forward model FIREFLY in the resulting hybrid PC-EnKF algorithm. The performance of EnKF and PC-EnKF is assessed on synthetically-generated simple configurations of fire spread to provide valuable information and insight on the benefits of the PC-EnKF approach as well as on a controlled grassland fire experiment. The results indicate that the proposed PC-EnKF algorithm features similar performance to the standard EnKF algorithm, but at a much reduced computational cost. In particular, the re-analysis and forecast skills of data assimilation strongly relate to the spatial and temporal variability of the errors in the ROS model parameters.

Towards predictive data-driven simulations of wildfire spread - Part I: Reduced-cost Ensemble Kalman Filter based on a Polynomial Chaos surrogate model for parameter estimation

NASA Astrophysics Data System (ADS)

Rochoux, M. C.; Ricci, S.; Lucor, D.; Cuenot, B.; Trouvé, A.

2014-11-01

This paper is the first part in a series of two articles and presents a data-driven wildfire simulator for forecasting wildfire spread scenarios, at a reduced computational cost that is consistent with operational systems. The prototype simulator features the following components: an Eulerian front propagation solver FIREFLY that adopts a regional-scale modeling viewpoint, treats wildfires as surface propagating fronts, and uses a description of the local rate of fire spread (ROS) as a function of environmental conditions based on Rothermel's model; a series of airborne-like observations of the fire front positions; and a data assimilation (DA) algorithm based on an ensemble Kalman filter (EnKF) for parameter estimation. This stochastic algorithm partly accounts for the nonlinearities between the input parameters of the semi-empirical ROS model and the fire front position, and is sequentially applied to provide a spatially uniform correction to wind and biomass fuel parameters as observations become available. A wildfire spread simulator combined with an ensemble-based DA algorithm is therefore a promising approach to reduce uncertainties in the forecast position of the fire front and to introduce a paradigm-shift in the wildfire emergency response. In order to reduce the computational cost of the EnKF algorithm, a surrogate model based on a polynomial chaos (PC) expansion is used in place of the forward model FIREFLY in the resulting hybrid PC-EnKF algorithm. The performance of EnKF and PC-EnKF is assessed on synthetically generated simple configurations of fire spread to provide valuable information and insight on the benefits of the PC-EnKF approach, as well as on a controlled grassland fire experiment. The results indicate that the proposed PC-EnKF algorithm features similar performance to the standard EnKF algorithm, but at a much reduced computational cost. In particular, the re-analysis and forecast skills of DA strongly relate to the spatial and temporal variability of the errors in the ROS model parameters.

Firefly: embracing future web technologies

NASA Astrophysics Data System (ADS)

Roby, W.; Wu, X.; Goldina, T.; Joliet, E.; Ly, L.; Mi, W.; Wang, C.; Zhang, Lijun; Ciardi, D.; Dubois-Felsmann, G.

2016-07-01

At IPAC/Caltech, we have developed the Firefly web archive and visualization system. Used in production for the last eight years in many missions, Firefly gives the scientist significant capabilities to study data. Firefly provided the first completely web based FITS viewer as well as a growing set of tabular and plotting visualizers. Further, it will be used for the science user interface of the LSST telescope which goes online in 2021. Firefly must meet the needs of archive access and visualization for the 2021 LSST telescope and must serve astronomers beyond the year 2030. Recently, our team has faced the fact that the technology behind Firefly software was becoming obsolete. We were searching for ways to utilize the current breakthroughs in maintaining stability, testability, speed, and reliability of large web applications, which Firefly exemplifies. In the last year, we have ported the Firefly to cutting edge web technologies. Embarking on this massive overhaul is no small feat to say the least. Choosing the technologies that will maintain a forward trajectory in a future development project is always hard and often overwhelming. When a team must port 150,000 lines of code for a production-level product there is little room to make poor choices. This paper will give an overview of the most modern web technologies and lessons learned in our conversion from GWT based system to React/Redux based system.

A new firefly luciferase with bimodal spectrum: identification of structural determinants of spectral pH-sensitivity in firefly luciferases.

PubMed

Viviani, Vadim R; Oehlmeyer, T L; Arnoldi, F G C; Brochetto-Braga, M R

2005-01-01

Fireflies emit flashes in the green-yellow region of the spectrum for the purpose of sexual attraction. The bioluminescence color is determined by the luciferases. It is well known that the in vitro bioluminescence color of firefly luciferases can be shifted toward the red by lower pH and higher temperature; for this reason they are classified as pH-sensitive luciferases. However, the mechanism and structural origin of pH sensitivity in fireflies remains unknown. Here we report the cloning of a new luciferase from the Brazilian twilight active firefly Macrolampis sp2, which displays an unusual bimodal spectrum. The recombinant luciferase displays a sensitive spectrum with the peak at 569 nm and a shoulder in the red region. Comparison of the bioluminescence spectra of Macrolampis, Photinus and Cratomorphus firefly luciferases shows that the distinct colors are determined by the ratio between green and red emitters under luciferase influence. Comparison of Macrolampis luciferase with the highly similar North American Photinus pyralis luciferase (91%) showed few substitutions potentially involved with the higher spectral sensitivity in Macrolampis luciferase. Site-directed mutagenesis showed that the natural substitution E354N determines the appearance of the shoulder in the red region of Macrolampis luciferase bioluminescence spectrum, helping to identify important interactions and residues involved in the pH-sensing mechanism in firefly luciferases.

Application of the Firefly and Luus-Jaakola algorithms in the calculation of a double reactive azeotrope

NASA Astrophysics Data System (ADS)

Mendes Platt, Gustavo; Pinheiro Domingos, Roberto; Oliveira de Andrade, Matheus

2014-01-01

The calculation of reactive azeotropes is an important task in the preliminary design and simulation of reactive distillation columns. Classically, homogeneous nonreactive azeotropes are vapor-liquid coexistence conditions where phase compositions are equal. For homogeneous reactive azeotropes, simultaneous phase and chemical equilibria occur concomitantly with equality of compositions (in the Ung-Doherty transformed space). The modeling of reactive azeotrope calculation is represented by a nonlinear algebraic system with phase equilibrium, chemical equilibrium and azeotropy equations. This nonlinear system can exhibit more than one solution, corresponding to a double reactive azeotrope. In a previous paper (Platt et al 2013 J. Phys.: Conf. Ser. 410 012020), we investigated some numerical aspects of the calculation of reactive azeotropes in the isobutene + methanol + methyl-tert-butyl-ether (with two reactive azeotropes) system using two metaheuristics: the Luus-Jaakola adaptive random search and the Firefly algorithm. Here, we use a hybrid structure (stochastic + deterministic) in order to produce accurate results for both azeotropes. After identifying the neighborhood of the reactive azeotrope, the nonlinear algebraic system is solved using Newton's method. The results indicate that using metaheuristics and some techniques devoted to the calculation of multiple minima allows both azeotropic coordinates in this reactive system to be obtains. In this sense, we provide a comprehensive analysis of a useful framework devoted to solving nonlinear systems, particularly in phase equilibrium problems.

Japanese Interest in “Hotaru” (Fireflies) and “Kabuto-Mushi” (Japanese Rhinoceros Beetles) Corresponds with Seasonality in Visible Abundance

PubMed Central

Takada, Kenta

2012-01-01

Seasonal changes in the popularity of fireflies [usually Genji-fireflies (Luciola cruciata Motschulsky) in Japan] and Japanese rhinoceros beetles [Allomyrina dichotoma (Linne)] were investigated to examine whether contemporary Japanese are interested in visible emergence of these insects as seasonal events. The popularity of fireflies and Japanese rhinoceros beetles was assessed by the Google search volume of their Japanese names, “Hotaru” and “Kabuto-mushi” in Japanese Katakana script using Google Trends. The search volume index for fireflies and Japanese rhinoceros beetles was distributed across seasons with a clear peak in only particular times of each year from 2004 to 2011. In addition, the seasonal peak of popularity for fireflies occurred at the beginning of June, whereas that for Japanese rhinoceros beetles occurred from the middle of July to the beginning of August. Thus seasonal peak of each species coincided with the peak period of the emergence of each adult stage. These findings indicated that the Japanese are interested in these insects primarily during the time when the two species are most visibly abundant. Although untested, this could suggest that fireflies and Japanese rhinoceros beetles are perceived by the general public as indicators or symbols of summer in Japan. PMID:26466535

Long-read sequence assembly of the firefly Pyrocoelia pectoralis genome

PubMed Central

Fu, Xinhua; Li, Jingjing; Tian, Yu; Quan, Weipeng; Zhang, Shu; Liu, Qian; Liang, Fan; Zhu, Xinlei; Zhang, Liangsheng

2017-01-01

Abstract Background Fireflies are a family of insects within the beetle order Coleoptera, or winged beetles, and they are one of the most well-known and loved insect species because of their bioluminescence. However, the firefly is in danger of extinction because of the massive destruction of its living environment. In order to improve the understanding of fireflies and protect them effectively, we sequenced the whole genome of the terrestrial firefly Pyrocoelia pectoralis. Findings Here, we developed a highly reliable genome resource for the terrestrial firefly Pyrocoelia pectoralis (E. Oliv., 1883; Coleoptera: Lampyridae) using single molecule real time (SMRT) sequencing on the PacBio Sequel platform. In total, 57.8 Gb of long reads were generated and assembled into a 760.4-Mb genome, which is close to the estimated genome size and covered 98.7% complete and 0.7% partial insect Benchmarking Universal Single-Copy Orthologs. The k-mer analysis showed that this genome is highly heterozygous. However, our long-read assembly demonstrates continuousness with a contig N50 length of 3.04 Mb and the longest contig length of 13.69 Mb. Furthermore, 135 589 SSRs and 341 Mb of repeat sequences were detected. A total of 23 092 genes were predicted; 88.44% of genes were annotated with one or more related functions. Conclusions We assembled a high-quality firefly genome, which will not only provide insights into the conservation and biodiversity of fireflies, but also provide a wealth of information to study the mechanisms of their sexual communication, bio-luminescence, and evolution. PMID:29186486

Developing a Fly-Away-Kit (FLAK) to Support Hastily Formed Networks (HFN) for Humanitarian Assistance and Disaster Relief (HA/DR)

DTIC Science & Technology

2005-06-01

HFN Components: Reach-Back, Last-Mile, and FLAK .............19 Figure 5. Example of a VSAT solution (from Tachyon , 2004...and IDU (From Tachyon Networks, 2004) ............................................31 Figure 16. IDU...44 Figure 22. Tachyon Auto Deploy ODU and IDU .............................................................44 Figure

Automatic Identification System (AIS) Collection and Reach-back System: System Description

DTIC Science & Technology

2014-08-20

installation. 8.1.1 Power The HPS requires three NEMA 5 outlets, one each for the RPC, BPC, and KG-175D TACLANE-micro COMSEC device. The HPS draws less than...Military Sealift Command NEMA National Electrical Manufacturers Association NMEA National Marine Electronics Association NRL Naval Research Laboratory OTH-G

Structure and weights optimisation of a modified Elman network emotion classifier using hybrid computational intelligence algorithms: a comparative study

NASA Astrophysics Data System (ADS)

Sheikhan, Mansour; Abbasnezhad Arabi, Mahdi; Gharavian, Davood

2015-10-01

Artificial neural networks are efficient models in pattern recognition applications, but their performance is dependent on employing suitable structure and connection weights. This study used a hybrid method for obtaining the optimal weight set and architecture of a recurrent neural emotion classifier based on gravitational search algorithm (GSA) and its binary version (BGSA), respectively. By considering the features of speech signal that were related to prosody, voice quality, and spectrum, a rich feature set was constructed. To select more efficient features, a fast feature selection method was employed. The performance of the proposed hybrid GSA-BGSA method was compared with similar hybrid methods based on particle swarm optimisation (PSO) algorithm and its binary version, PSO and discrete firefly algorithm, and hybrid of error back-propagation and genetic algorithm that were used for optimisation. Experimental tests on Berlin emotional database demonstrated the superior performance of the proposed method using a lighter network structure.

Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

PubMed Central

2014-01-01

Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane. PMID:24708613

Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane.

PubMed

Chou, Ting-Chun; Moyle, Richard L

2014-04-08

Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene.Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences.Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures.Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes.In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane.

Escalated convergent artificial bee colony

NASA Astrophysics Data System (ADS)

Jadon, Shimpi Singh; Bansal, Jagdish Chand; Tiwari, Ritu

2016-03-01

Artificial bee colony (ABC) optimisation algorithm is a recent, fast and easy-to-implement population-based meta heuristic for optimisation. ABC has been proved a rival algorithm with some popular swarm intelligence-based algorithms such as particle swarm optimisation, firefly algorithm and ant colony optimisation. The solution search equation of ABC is influenced by a random quantity which helps its search process in exploration at the cost of exploitation. In order to find a fast convergent behaviour of ABC while exploitation capability is maintained, in this paper basic ABC is modified in two ways. First, to improve exploitation capability, two local search strategies, namely classical unidimensional local search and levy flight random walk-based local search are incorporated with ABC. Furthermore, a new solution search strategy, namely stochastic diffusion scout search is proposed and incorporated into the scout bee phase to provide more chance to abandon solution to improve itself. Efficiency of the proposed algorithm is tested on 20 benchmark test functions of different complexities and characteristics. Results are very promising and they prove it to be a competitive algorithm in the field of swarm intelligence-based algorithms.

Building Twilight "Light Sensors" to Study the Effects of Light Pollution on Fireflies

ERIC Educational Resources Information Center

Thancharoen, Anchana; Branham, Marc A.; Lloyd, James E.

2008-01-01

Light pollution negatively affects many nocturnal organisms. We outline two experiments that can be conducted by students to examine the effects of light pollution on firefly behavior. Inexpensive electronic light sensors, which are easy to construct and calibrate, are used to sample light levels along transects in spaces where fireflies are…

Bioinspired photonic structures by the reflector layer of firefly lantern for highly efficient chemiluminescence

PubMed Central

Chen, Linfeng; Shi, Xiaodi; Li, Mingzhu; Hu, Junping; Sun, Shufeng; Su, Bin; Wen, Yongqiang; Han, Dong; Jiang, Lei; Song, Yanlin

2015-01-01

Fireflies have drawn considerable attention for thousands of years due to their highly efficient bioluminescence, which is important for fundamental research and photonic applications. However, there are few reports on the reflector layer (RL) of firefly lantern, which contributes to the bright luminescence. Here we presented the detailed microstructure of the RL consisting of random hollow granules, which had high reflectance in the range from 450 nm to 800 nm. Inspired by the firefly lantern, artificial films with high reflectance in the visible region were fabricated using hollow silica microparticles mimicking the structure of the RL. Additionally, the bioinspired structures provided an efficient RL for the chemiluminescence system and could substantially enhance the initial chemiluminescence intensity. The work not only provides new insight into the bright bioluminescence of fireflies, but also is importance for the design of photonic materials for theranostics, detection, and imaging. PMID:26264643

Improvement of thermostability and activity of firefly luciferase through [TMG][Ac] ionic liquid mediator.

PubMed

Ebrahimi, Mehdi; Hosseinkhani, Saman; Heydari, Akbar; Khavari-Nejad, Ramazan Ali; Akbari, Jafar

2012-10-01

Firefly luciferase catalyzes production of light from luciferin in the presence of Mg(2+)-ATP and oxygen. This enzyme has wide range of applications in biotechnology and development of biosensors. The low thermal stability of wild-type firefly luciferase is a limiting factor in most applications. Improvements in activity and stability of few enzymes in the presence of ionic liquids were shown in many reports. In this study, kinetic and thermal stability of firefly luciferase from Photinus pyralis in the presence of three tetramethylguanidine-based ionic liquids was investigated. The enzyme has shown improved activity in the presence of [1, 1, 3, 3-tetramethylguanidine][acetate], but in the presence of [TMG][trichloroacetate] and [TMG][triflouroacetate] activity, it decreased or unchanged significantly. Among these ionic liquids, only [TMG][Ac] has increased the thermal stability of luciferase. Incubation of [TMG][Ac] with firefly luciferase brought about with decrease of K(m) for ATP.

Engineering the metal sensitive sites in Macrolampis sp2 firefly luciferase and use as a novel bioluminescent ratiometric biosensor for heavy metals.

PubMed

Gabriel, Gabriele V M; Viviani, Vadim R

2016-12-01

Most luminescent biosensors for heavy metals are fluorescent and rely on intensity measurements, whereas a few are ratiometric and rely on spectral changes. Bioluminescent biosensors for heavy metals are less common. Firefly luciferases have been coupled to responsive promoters for mercury and arsenium, and used as light on biosensors. Firefly luciferase bioluminescence spectrum is naturally sensitive to heavy metal cations such as zinc and mercury and to pH. Although pH sensitivity of firefly luciferases was shown to be useful for ratiometric estimation of intracellular pH, its potential use for ratiometric estimation of heavy metals was never considered. Using the yellow-emitting Macrolampis sp2 firefly luciferase and site-directed mutagenesis, we show that the residues H310 and E354 constitute two critical sites for metal sensitivity that can be engineered to increase sensitivity to zinc, nickel, and mercury. A linear relationship between cation concentration and the ratio of bioluminescence intensities at 550 and 610 nm allowed, for the first time, the ratiometric estimation of heavy metals concentrations down to 0.10 mM, demonstrating the potential applicability of firefly luciferases as enzymatic and intracellular ratiometric metal biosensors.

Air Force Contingency Contracting: Reachback and Other Opportunities for Improvement

DTIC Science & Technology

2011-01-01

electrical, mechanical, air conditioning, food service , lodging management, laundry plant operation, fire protection emergency management, professional...public service of the RAND Corporation. CHILDREN AND FAMILIES EDUCATION AND THE ARTS ENERGY AND ENVIRONMENT HEALTH AND HEALTH CARE INFRASTRUCTURE AND...information, including suggestions for reducing this burden, to Washington Headquarters Services , Directorate for Information Operations and Reports

Modeling and image reconstruction in spectrally resolved bioluminescence tomography

NASA Astrophysics Data System (ADS)

Dehghani, Hamid; Pogue, Brian W.; Davis, Scott C.; Patterson, Michael S.

2007-02-01

Recent interest in modeling and reconstruction algorithms for Bioluminescence Tomography (BLT) has increased and led to the general consensus that non-spectrally resolved intensity-based BLT results in a non-unique problem. However, the light emitted from, for example firefly Luciferase, is widely distributed over the band of wavelengths from 500 nm to 650 nm and above, with the dominant fraction emitted from tissue being above 550 nm. This paper demonstrates the development of an algorithm used for multi-wavelength 3D spectrally resolved BLT image reconstruction in a mouse model. It is shown that using a single view data, bioluminescence sources of up to 15 mm deep can be successfully recovered given correct information about the underlying tissue absorption and scatter.

Firefly, Firefly: First Grade Students Learn, Talk, and Write about Light

ERIC Educational Resources Information Center

Mesa, Jennifer; Sorensen, Kirsten

2016-01-01

Inspired by a song to be sung by her daughter's first-grade class in an upcoming musical, a parent volunteer teacher used fireflies as the focus of a science lesson to build on the children's interest and experiences. She developed a 5E lesson (Bybee et al. 2006) using the backwards-design approach (Wiggins and McTighe 2005) to ensure meaningful…

Translational Regulation of PTEN/MMAC1 Expression in Prostate Cancer

DTIC Science & Technology

2003-05-01

the transcription of dicistronic RNA encoding Renilla luciferase as the first cistron and firefly luciferase as the second cistron. Translation of the...first cistron ( Renilla luciferase) serves as an indicator of cap-dependent translation while translation of the second cistron (firefly luciferase...cellular IRES (Sachs, 2000). These dicistronic constructs were transfected into HeLa cells and both Renilla and firefly luciferase activities were measured

Theoretical tuning of the firefly bioluminescence spectra by the modification of oxyluciferin

NASA Astrophysics Data System (ADS)

Cheng, Yuan-Yuan; Zhu, Jia; Liu, Ya-Jun

2014-01-01

Extending the firefly bioluminescence is of practical significance for the improved visualization of living cells and the development of a multicolor reporter. Tuning the color of bioluminescence in fireflies mainly involves the modification of luciferase and luciferin. In this Letter, we theoretically studied the emission spectra of 9 firefly oxyluciferin analogs in the gas phase and in solutions. Three density functionals, including B3LYP, CAM-B3LYP and M06-2X, were employed to theoretically predict the efficiently luminescent analogs. The reliable functionals for calculating the targeted systems were suggested. The luminescence efficiency, solvent effects, and substituent effects are discussed based on the calculated results.

Molecular Targeting of Prostate Cancer During Androgen Ablation: Inhibition of CHES1/FOXN3

DTIC Science & Technology

2011-05-01

activity (Firefly luciferase) was normalized to Renilla luciferase activity. Results are presented as fold-change in PSA reporter activity...reporter (DLR) assays performed. In each sample, the CHES1-RR1/3.5 reporter activity (Firefly luciferase) was normalized to Renilla luciferase...4.0) reporter activity (Firefly luciferase) was normalized to Renilla luciferase activity. Results are presented as fold-change in BNIP3 reporter

Variation in opsin genes correlates with signaling ecology in North American fireflies

PubMed Central

Sander, Sarah E.; Hall, David W.

2015-01-01

Genes underlying signal reception should evolve to maximize signal detection in a particular environment. In animals, opsins, the protein component of visual pigments, are predicted to evolve according to this expectation. Fireflies are known for their bioluminescent mating signals. The eyes of nocturnal species are expected to maximize detection of conspecific signal colors emitted in the typical low-light environment. This is not expected for species that have transitioned to diurnal activity in bright daytime environments. Here we test the hypothesis that opsin gene sequence plays a role in modifying firefly eye spectral sensitivity. We use genome and transcriptome sequencing in four firefly species, transcriptome sequencing in six additional species, and targeted gene sequencing in 28 other species to identify all opsin genes present in North American fireflies and to elucidate amino acid sites under positive selection. We also determine whether amino acid substitutions in opsins are linked to evolutionary changes in signal mode, signal color, and light environment. We find only two opsins, one long wavelength and one ultraviolet, in all firefly species and identify 25 candidate sites that may be involved in determining spectral sensitivity. In addition, we find elevated rates of evolution at transitions to diurnal activity, and changes in selective constraint on LW opsin associated with changes in light environment. Our results suggest that changes in eye spectral sensitivity are at least partially due to opsin sequence. Fireflies continue to be a promising system in which to investigate the evolution of signals, receptors, and signaling environments. PMID:26289828

Towards enhancement of performance of K-means clustering using nature-inspired optimization algorithms.

PubMed

Fong, Simon; Deb, Suash; Yang, Xin-She; Zhuang, Yan

2014-01-01

Traditional K-means clustering algorithms have the drawback of getting stuck at local optima that depend on the random values of initial centroids. Optimization algorithms have their advantages in guiding iterative computation to search for global optima while avoiding local optima. The algorithms help speed up the clustering process by converging into a global optimum early with multiple search agents in action. Inspired by nature, some contemporary optimization algorithms which include Ant, Bat, Cuckoo, Firefly, and Wolf search algorithms mimic the swarming behavior allowing them to cooperatively steer towards an optimal objective within a reasonable time. It is known that these so-called nature-inspired optimization algorithms have their own characteristics as well as pros and cons in different applications. When these algorithms are combined with K-means clustering mechanism for the sake of enhancing its clustering quality by avoiding local optima and finding global optima, the new hybrids are anticipated to produce unprecedented performance. In this paper, we report the results of our evaluation experiments on the integration of nature-inspired optimization methods into K-means algorithms. In addition to the standard evaluation metrics in evaluating clustering quality, the extended K-means algorithms that are empowered by nature-inspired optimization methods are applied on image segmentation as a case study of application scenario.

Towards Enhancement of Performance of K-Means Clustering Using Nature-Inspired Optimization Algorithms

PubMed Central

Deb, Suash; Yang, Xin-She

2014-01-01

Traditional K-means clustering algorithms have the drawback of getting stuck at local optima that depend on the random values of initial centroids. Optimization algorithms have their advantages in guiding iterative computation to search for global optima while avoiding local optima. The algorithms help speed up the clustering process by converging into a global optimum early with multiple search agents in action. Inspired by nature, some contemporary optimization algorithms which include Ant, Bat, Cuckoo, Firefly, and Wolf search algorithms mimic the swarming behavior allowing them to cooperatively steer towards an optimal objective within a reasonable time. It is known that these so-called nature-inspired optimization algorithms have their own characteristics as well as pros and cons in different applications. When these algorithms are combined with K-means clustering mechanism for the sake of enhancing its clustering quality by avoiding local optima and finding global optima, the new hybrids are anticipated to produce unprecedented performance. In this paper, we report the results of our evaluation experiments on the integration of nature-inspired optimization methods into K-means algorithms. In addition to the standard evaluation metrics in evaluating clustering quality, the extended K-means algorithms that are empowered by nature-inspired optimization methods are applied on image segmentation as a case study of application scenario. PMID:25202730

Synthesis of concentric circular antenna arrays using dragonfly algorithm

NASA Astrophysics Data System (ADS)

Babayigit, B.

2018-05-01

Due to the strong non-linear relationship between the array factor and the array elements, concentric circular antenna array (CCAA) synthesis problem is challenging. Nature-inspired optimisation techniques have been playing an important role in solving array synthesis problems. Dragonfly algorithm (DA) is a novel nature-inspired optimisation technique which is based on the static and dynamic swarming behaviours of dragonflies in nature. This paper presents the design of CCAAs to get low sidelobes using DA. The effectiveness of the proposed DA is investigated in two different (with and without centre element) cases of two three-ring (having 4-, 6-, 8-element or 8-, 10-, 12-element) CCAA design. The radiation pattern of each design cases is obtained by finding optimal excitation weights of the array elements using DA. Simulation results show that the proposed algorithm outperforms the other state-of-the-art techniques (symbiotic organisms search, biogeography-based optimisation, sequential quadratic programming, opposition-based gravitational search algorithm, cat swarm optimisation, firefly algorithm, evolutionary programming) for all design cases. DA can be a promising technique for electromagnetic problems.

Prediction of protein-protein interaction network using a multi-objective optimization approach.

PubMed

Chowdhury, Archana; Rakshit, Pratyusha; Konar, Amit

2016-06-01

Protein-Protein Interactions (PPIs) are very important as they coordinate almost all cellular processes. This paper attempts to formulate PPI prediction problem in a multi-objective optimization framework. The scoring functions for the trial solution deal with simultaneous maximization of functional similarity, strength of the domain interaction profiles, and the number of common neighbors of the proteins predicted to be interacting. The above optimization problem is solved using the proposed Firefly Algorithm with Nondominated Sorting. Experiments undertaken reveal that the proposed PPI prediction technique outperforms existing methods, including gene ontology-based Relative Specific Similarity, multi-domain-based Domain Cohesion Coupling method, domain-based Random Decision Forest method, Bagging with REP Tree, and evolutionary/swarm algorithm-based approaches, with respect to sensitivity, specificity, and F1 score.

Flash Bulletin: Fireflies

ERIC Educational Resources Information Center

Brown, Debbie

1984-01-01

Explains the flashes of light emitted by fireflies as competition, species-specific code, species identification and mating behavior and ecology. Suggests activities to conduct to study the insects and their behavior. (ERB)

Genome size of 14 species of fireflies (Insecta, Coleoptera, Lampyridae)

PubMed Central

Liu, Gui-Chun; Dong, Zhi-Wei; He, Jin-Wu; Zhao, Ruo-Ping; Wang, Wen; Li, Xue-Yan

2017-01-01

Eukaryotic genome size data are important both as the basis for comparative research into genome evolution and as estimators of the cost and difficulty of genome sequencing programs for non-model organisms. In this study, the genome size of 14 species of fireflies (Lampyridae) (two genera in Lampyrinae, three genera in Luciolinae, and one genus in subfamily incertae sedis) were estimated by propidium iodide (PI)-based flow cytometry. The haploid genome sizes of Lampyridae ranged from 0. 42 to 1. 31 pg, a 3. 1-fold span. Genome sizes of the fireflies varied within the tested subfamilies and genera. Lamprigera and Pyrocoelia species had large and small genome sizes, respectively. No correlation was found between genome size and morphological traits such as body length, body width, eye width, and antennal length. Our data provide additional information on genome size estimation of the firefly family Lampyridae. Furthermore, this study will help clarify the cost and difficulty of genome sequencing programs for non-model organisms and will help promote studies on firefly genome evolution. PMID:29280364

Dragonflies and Fireflies

ERIC Educational Resources Information Center

Mannlein, Sally

2009-01-01

Most first-graders are interested in insects. In this article, the author describes a lesson, "Dragonflies and Fireflies," which is a first-grade lesson showing drawing, symmetry, neighboring colors (analogous) and watercolor techniques.

Bioluminescence.

ERIC Educational Resources Information Center

Jones, M. Gail

1993-01-01

Describes bioluminescence and the chemistry of how it occurs. Presents information for conducting the following classroom activities: (1) firefly mimic; (2) modeling deep-sea fish; (3) sea fireflies; and (4) the chemistry of light. (PR)

75 FR 39143 - Airworthiness Directives; Arrow Falcon Exporters, Inc. (previously Utah State University); AST...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-08

... Firefly Aviation Helicopter Services, and Erickson Air-Crane); Rotorcraft Development Corporation..., Inc. (Previously Firefly Aviation Helicopter Services, and Erickson Air-Crane); Rotorcraft Development...

Analysis of United States Air Forces Central Government Purchase Card Reachback Viability

DTIC Science & Technology

2011-12-01

Phase 1: Mobilization and Initial Deployment ................................38  2.  Phase 2: Joint Reception , Staging, Onward Movement, and...the theory into practice. By creating a test cell, efficiencies, best practices, proper funding, and appropriate manning can be analyzed. Second... Reception , Staging, Onward Movement, and Integration Phase 2 (better known as the buildup phase) is characterized by the reception and bed-down of the

Functional Geno,ic Analysis of Breast Cancer Cell Tumorigenicity Using a Noval Gene Silencing Resource

DTIC Science & Technology

2006-04-01

Fig. 2B). In addition, luciferase assay on cells co-transfected with constructs expressing firefly and renilla luciferase genes showed a significant...positive cells. (C) BT474 cells were co-transfected with pGL3 plasmid expressing firefly luciferase, pRL plasmid expressing renilla luciferase, and...genes Per1 (A) and Bmal1 (B). BT474 cells were transfected with Per1 (A) and Bmal1 (B) firefly luciferase reporters, pRL plasmid expressing renilla

Firefly courtship as the basis of the synchronization-response principle

NASA Astrophysics Data System (ADS)

Ramírez Ávila, G. M.; Deneubourg, J.-L.; Guisset, J.-L.; Wessel, N.; Kurths, J.

2011-06-01

Response to synchronization seems to be a widespread phenomenon specially in biological systems. We highlight this phenomenon studying the courtship of flashing fireflies in which a typical collective rhythm occurring only among the males arises and it is followed by a response of the females. Based on a model issued from electronic fireflies, we explain the synchronization of the males and the active responses of the females in the courtship of mingled (both sexes) populations of fireflies. The model also explains the courtship behavior of other species whose interactions follow the same logic even if their physical features are different. Moreover, the model can make predictions on the behavior of mingled and mixed (natural and artificial) groups of such animals. This finding could be considered as the basis of a new principle, namely the synchronization-response.

Comparison of the thermostability of recombinant luciferases from Brazilian bioluminescent beetles: Relationship with kinetics and bioluminescence colours.

PubMed

Oliveira, Gabriela; Viviani, Vadim R

2018-03-01

Firefly luciferases have been used extensively as bioanalytical reagents and their cDNAs as reporter genes for biosensors and bioimaging, but they are in general unstable at temperatures above 30°C. In the past few years, efforts have been made to stabilize some firefly luciferases for better application as analytical reagents. Novel luciferases from different beetle families, displaying distinct bioluminescence colours and kinetics, may offer desirable alternatives to extend the range of applications. In the past years, our group has cloned the largest variety of luciferases from the three main families of bioluminescent beetles (Elateridae: P. termitilluminans, F. bruchi, P. angustus; Phengodidae: P. hirtus, P. vivianii; and Lampyridae: A. vivianii, C. distinctus and Macrolampis sp2) occurring in Brazilian biomes. We compared the thermostability of these recombinant luciferases and investigated their relationships with bioluminescence spectra and kinetics. The most thermostable luciferases were those of Pyrearinus termitilluminans larval click beetle (534 nm), Amydetes vivianii firefly (539 nm) and Phrixotrix vivianii railroad worm (546 nm), which are the most blue-shifted examples in each family, confirming the trend that the most blue-shifted emitting luciferases are also the most thermostable. Comparatively, commercial P. pyralis firefly luciferase was less thermostable than P. termitilluminans click beetle and A. vivianii firefly luciferases. The higher thermostability in these luciferases could be related to higher degree of hydrophobic packing and disulfide bond content (for firefly luciferases). Copyright © 2017 John Wiley & Sons, Ltd.

Using Firefly Tools to Enhance Archive Web Pages

NASA Astrophysics Data System (ADS)

Roby, W.; Wu, X.; Ly, L.; Goldina, T.

2013-10-01

Astronomy web developers are looking for fast and powerful HTML 5/AJAX tools to enhance their web archives. We are exploring ways to make this easier for the developer. How could you have a full FITS visualizer or a Web 2.0 table that supports paging, sorting, and filtering in your web page in 10 minutes? Can it be done without even installing any software or maintaining a server? Firefly is a powerful, configurable system for building web-based user interfaces to access astronomy science archives. It has been in production for the past three years. Recently, we have made some of the advanced components available through very simple JavaScript calls. This allows a web developer, without any significant knowledge of Firefly, to have FITS visualizers, advanced table display, and spectrum plots on their web pages with minimal learning curve. Because we use cross-site JSONP, installing a server is not necessary. Web sites that use these tools can be created in minutes. Firefly was created in IRSA, the NASA/IPAC Infrared Science Archive (http://irsa.ipac.caltech.edu). We are using Firefly to serve many projects including Spitzer, Planck, WISE, PTF, LSST and others.

Experimental tests of light-pollution impacts on nocturnal insect courtship and dispersal.

PubMed

Firebaugh, Ariel; Haynes, Kyle J

2016-12-01

Though a number of effects of artificial light pollution on behavior and physiology have been described, there is little understanding of their consequences for the growth and distribution of populations. Here, we document impacts of light pollution on aspects of firefly population ecology and underlying mating behaviors. Many firefly species have a unique communication system whereby bioluminescent flashes are used in courtship displays to find and attract mates. We performed a series of manipulative field experiments in which we quantified the effects of adding artificial nighttime lighting on abundances and total flashing activity of fireflies, courtship behaviors and mating between tethered females and free-flying males, and dispersal distances of marked individuals. We show that light pollution reduces flashing activities in a dark-active firefly species (Photuris versicolor) by 69.69 % and courtship behavior and mating success in a twilight-active species (Photinus pyralis). Though courtship behavior and mating success of Photinus pyralis was reduced by light pollution, we found no effects of light pollution on male dispersal in this species. Our findings suggest that light pollution is likely to adversely impact firefly populations, and contribute to wider discussions about the ecological consequences of sensory pollution.

The nuclear factor κB inhibitor (E)-2-fluoro-4'-methoxystilbene inhibits firefly luciferase.

PubMed

Braeuning, Albert; Vetter, Silvia

2012-12-01

Photinus pyralis (firefly) luciferase is widely used as a reporter system to monitor alterations in gene promoter and/or signalling pathway activities in vitro. The enzyme catalyses the formation of oxyluciferin from D-luciferin in an ATP-consuming reaction involving photon emission. The purpose of the present study was to characterize the luciferase-inhibiting potential of (E)-2-fluoro-4'-methoxystilbene, which is known as a potent inhibitor of the NF-κB (nuclear factor κB) signalling pathway that is used to modulate the NF-κB signalling pathway in vitro. Results show that (E)-2-fluoro-4'-methoxystilbene effectively inhibits firefly luciferase activity in cell lysates and living cells in a non-competitive manner with respect to the luciferase substrates D-luciferin and ATP. By contrast, the compound has no effect on Renilla and Gaussia luciferases. The mechanism of firefly luciferase inhibition by (E)-2-fluoro-4'-methoxystilbene, as well as its potency is comparable to its structure analogue resveratrol. The in vitro use of trans-stilbenes such as (E)-2-fluoro-4'-methoxystilbene or resveratrol compromises firefly luciferase reporter assays as well as ATP/luciferase-based cell viability assays.

The nuclear factor κB inhibitor (E)-2-fluoro-4′-methoxystilbene inhibits firefly luciferase

PubMed Central

Braeuning, Albert; Vetter, Silvia

2012-01-01

Photinus pyralis (firefly) luciferase is widely used as a reporter system to monitor alterations in gene promoter and/or signalling pathway activities in vitro. The enzyme catalyses the formation of oxyluciferin from D-luciferin in an ATP-consuming reaction involving photon emission. The purpose of the present study was to characterize the luciferase-inhibiting potential of (E)-2-fluoro-4′-methoxystilbene, which is known as a potent inhibitor of the NF-κB (nuclear factor κB) signalling pathway that is used to modulate the NF-κB signalling pathway in vitro. Results show that (E)-2-fluoro-4′-methoxystilbene effectively inhibits firefly luciferase activity in cell lysates and living cells in a non-competitive manner with respect to the luciferase substrates D-luciferin and ATP. By contrast, the compound has no effect on Renilla and Gaussia luciferases. The mechanism of firefly luciferase inhibition by (E)-2-fluoro-4′-methoxystilbene, as well as its potency is comparable to its structure analogue resveratrol. The in vitro use of trans-stilbenes such as (E)-2-fluoro-4′-methoxystilbene or resveratrol compromises firefly luciferase reporter assays as well as ATP/luciferase-based cell viability assays. PMID:22789175

KITAE II: Knowledge Development in Battlespace Helmand

DTIC Science & Technology

2011-06-01

Sergeant Andrew James Jones 18-09-2010 Private Simon Mundt Jørgensen 22-09-2010 Corporal Matthew Thomas 25-09-2010 Rifleman Suraj Gurung 02-10-2010...targeting driven. See Mattis (2008); For philosophical foundation see Smith (2005, 2006); Nicholson (2006);Mitchell (2004); and a doctrinal...BATTLESPACE IS THE KNOWLEDGE BASE HUMINT 1 SIGINT1 OSINT BIO IMINT 1 SIGINT 2 PATROLS HUMINT 2 REACHBACK IMINT 2 Sources OTHER… Actionable Assets Organic

Environmental Engagement Success Utilizing Reachback Support

DTIC Science & Technology

2012-05-24

Georgia •Kosovo •Moldova • Montenegro •Norway •Romania •Russia •Sweden 24 May 2012 - 7 UNCLASSIFIED $0 $100,000 $200,000 $300,000 $400,000...Bulgaria $770K Serbia $500K Macedonia $1.3M Kosovo $950K Montenegro $2.4M Albania $900K Bosnia $500K Lithuania $815K Latvia...treatment plants Sustainable energy Sustainable design 24 May 2012 - 14 UNCLASSIFIED BPC DOD Strategy Project Development Country

Different types of maximum power point tracking techniques for renewable energy systems: A survey

NASA Astrophysics Data System (ADS)

Khan, Mohammad Junaid; Shukla, Praveen; Mustafa, Rashid; Chatterji, S.; Mathew, Lini

2016-03-01

Global demand for electricity is increasing while production of energy from fossil fuels is declining and therefore the obvious choice of the clean energy source that is abundant and could provide security for development future is energy from the sun. In this paper, the characteristic of the supply voltage of the photovoltaic generator is nonlinear and exhibits multiple peaks, including many local peaks and a global peak in non-uniform irradiance. To keep global peak, MPPT is the important component of photovoltaic systems. Although many review articles discussed conventional techniques such as P & O, incremental conductance, the correlation ripple control and very few attempts have been made with intelligent MPPT techniques. This document also discusses different algorithms based on fuzzy logic, Ant Colony Optimization, Genetic Algorithm, artificial neural networks, Particle Swarm Optimization Algorithm Firefly, Extremum seeking control method and hybrid methods applied to the monitoring of maximum value of power at point in systems of photovoltaic under changing conditions of irradiance.

Full color modulation of firefly luciferase through engineering with unified Stark effect.

PubMed

Cai, Duanjun; Marques, Miguel A L; Nogueira, Fernando

2013-11-07

The firefly luciferase has been a unique marking tool used in various bioimaging techniques. Extensive color modulation is strongly required to meet special marking demands; however, intentional and accurate wavelength tuning has yet to be achieved. Here, we demonstrate that the color shift of the firefly chromophore (OxyLH2-1) by internal and external fields can be described as a unified Stark shift. Electrostatic microenvironmental effects on fluorescent spectroscopy are modeled in vacuo through effective electric fields by using time-dependent density functional theory. A complete visible fluorescence spectrum of firefly chromophore is depicted, which enables one to control the emission in a specific color. As an application, the widely observed pH-correlated color shift is proved to be associated with the local Stark field generated by the trace water-ions (vicinal hydronium and hydroxide ions) at active sites close to the OxyLH2-1.

An improved swarm optimization for parameter estimation and biological model selection.

PubMed

Abdullah, Afnizanfaizal; Deris, Safaai; Mohamad, Mohd Saberi; Anwar, Sohail

2013-01-01

One of the key aspects of computational systems biology is the investigation on the dynamic biological processes within cells. Computational models are often required to elucidate the mechanisms and principles driving the processes because of the nonlinearity and complexity. The models usually incorporate a set of parameters that signify the physical properties of the actual biological systems. In most cases, these parameters are estimated by fitting the model outputs with the corresponding experimental data. However, this is a challenging task because the available experimental data are frequently noisy and incomplete. In this paper, a new hybrid optimization method is proposed to estimate these parameters from the noisy and incomplete experimental data. The proposed method, called Swarm-based Chemical Reaction Optimization, integrates the evolutionary searching strategy employed by the Chemical Reaction Optimization, into the neighbouring searching strategy of the Firefly Algorithm method. The effectiveness of the method was evaluated using a simulated nonlinear model and two biological models: synthetic transcriptional oscillators, and extracellular protease production models. The results showed that the accuracy and computational speed of the proposed method were better than the existing Differential Evolution, Firefly Algorithm and Chemical Reaction Optimization methods. The reliability of the estimated parameters was statistically validated, which suggests that the model outputs produced by these parameters were valid even when noisy and incomplete experimental data were used. Additionally, Akaike Information Criterion was employed to evaluate the model selection, which highlighted the capability of the proposed method in choosing a plausible model based on the experimental data. In conclusion, this paper presents the effectiveness of the proposed method for parameter estimation and model selection problems using noisy and incomplete experimental data. This study is hoped to provide a new insight in developing more accurate and reliable biological models based on limited and low quality experimental data.

FIREFLY: A cubesat mission to study terrestrial gamma-ray flashes

NASA Astrophysics Data System (ADS)

Klenzing, J. H.; Rowland, D. E.; Hill, J.; Weatherwax, A. T.

2009-12-01

FIREFLY is small satellite mission to investigate the link between atmospheric lightning and terrestrial gamma-ray flashes scheduled to launch in late 2010. The instrumentation includes a Gamma-Ray Detector (GRD), VLF receiver, and photometer. GRD will measure the energy and arrival time of x-ray and gamma-ray photons, as well as the energetic electron flux by using a phoswitch-style layered scintillator. The current status of the instrumentation will be discussed, including laboratory tests and simulations of the GRD. FIREFLY is the second in a series of NSF-funded cubesats designed to study the upper atmosphere.

Flash signal evolution in Photinus fireflies: character displacement and signal exploitation in a visual communication system.

PubMed

Stanger-Hall, Kathrin F; Lloyd, James E

2015-03-01

Animal communication is an intriguing topic in evolutionary biology. In this comprehensive study of visual signal evolution, we used a phylogenetic approach to study the evolution of the flash communication system of North American fireflies. The North American firefly genus Photinus contains 35 described species with simple ON-OFF visual signals, and information on habitat types, sympatric congeners, and predators. This makes them an ideal study system to test hypotheses on the evolution of male and female visual signal traits. Our analysis of 34 Photinus species suggests two temporal pattern generators: one for flash duration and one for flash intervals. Reproductive character displacement was a main factor for signal divergence in male flash duration among sympatric Photinus species. Male flash pattern intervals (i.e., the duration of the dark periods between signals) were positively correlated with the number of sympatric Photuris fireflies, which include predators of Photinus. Females of different Photinus species differ in their response preferences to male traits. As in other communication systems, firefly male sexual signals seem to be a compromise between optimizing mating success (sexual selection) and minimizing predation risk (natural selection). An integrative model for Photinus signal evolution is proposed. © 2015 The Author(s).

Molecular characterization of firefly nuptial gifts: a multi-omics approach sheds light on postcopulatory sexual selection.

PubMed

Al-Wathiqui, Nooria; Fallon, Timothy R; South, Adam; Weng, Jing-Ke; Lewis, Sara M

2016-12-22

Postcopulatory sexual selection is recognized as a key driver of reproductive trait evolution, including the machinery required to produce endogenous nuptial gifts. Despite the importance of such gifts, the molecular composition of the non-gametic components of male ejaculates and their interactions with female reproductive tracts remain poorly understood. During mating, male Photinus fireflies transfer to females a spermatophore gift manufactured by multiple reproductive glands. Here we combined transcriptomics of both male and female reproductive glands with proteomics and metabolomics to better understand the synthesis, composition and fate of the spermatophore in the common Eastern firefly, Photinus pyralis. Our transcriptome of male glands revealed up-regulation of proteases that may enhance male fertilization success and activate female immune response. Using bottom-up proteomics we identified 208 functionally annotated proteins that males transfer to the female in their spermatophore. Targeted metabolomic analysis also provided the first evidence that Photinus nuptial gifts contain lucibufagin, a firefly defensive toxin. The reproductive tracts of female fireflies showed increased gene expression for several proteases that may be involved in egg production. This study offers new insights into the molecular composition of male spermatophores, and extends our understanding of how nuptial gifts may mediate postcopulatory interactions between the sexes.

Identification and characterization of the Luc2-type luciferase in the Japanese firefly, Luciola parvula, involved in a dim luminescence in immobile stages.

PubMed

Bessho-Uehara, Manabu; Oba, Yuichi

2017-09-01

Nocturnal Japanese fireflies, Luciola parvula, emit from their lanterns a yellow light, one of the most red-shifted colors found among fireflies. Previously, we isolated and characterized two different types of luciferase gene, Luc1 and Luc2, from the fireflies Luciola cruciata and Luciola lateralis; Luc1 is responsible for the green-yellow luminescence of larval and adult lanterns, whereas Luc2 is responsible for the dim greenish glow of eggs and pupal bodies. The biological role of firefly lanterns in adults is related to sexual communication, but why the eggs and pupae glow remains uncertain. In this study, we isolated the gene Luc2 from L. parvula, and compared its expression profiles and enzymatic characteristics with those of Luc1. A semi-quantitative reverse transcription polymerase chain reaction showed that Luc1 was predominantly expressed in larvae, prepupae, pupae and adults, whereas Luc2 was expressed in eggs, prepupae, pupae and adult females. Enzymatic analyses showed that the luminescent color of Luc1 matches the visual sensitivity of L. parvula eyes, whereas that of Luc2 is very different from it. These results suggest that the biological role of Luc2 expressed in immobile stages is not intraspecific communication. Copyright © 2017 John Wiley & Sons, Ltd.

Biosynthesis-inspired deracemizative production of d-luciferin by combining luciferase and thioesterase.

PubMed

Maeda, Juri; Kato, Dai-Ichiro; Okuda, Masatoshi; Takeo, Masahiro; Negoro, Seiji; Arima, Kazunari; Ito, Yuji; Niwa, Kazuki

2017-08-01

Due to the strict enantioselectivity of firefly luciferase, only d-luciferin can be used as a substrate for bioluminescence reactions. Unfortunately, luciferin racemizes easily and accumulation of nonluminous l-luciferin has negative influences on the light emitting reaction. Thus, maintaining the enantiopurity of luciferin in the reaction mixture is one of the most important demands in bioluminescence applications using firefly luciferase. In fireflies, however, l-luciferin is the biosynthetic precursor of d-luciferin, which is produced from the L-form undergoing deracemization. This deracemization consists of three successive reactions: l-enantioselective thioesterification by luciferase, in situ epimerization, and hydrolysis by thioesterase. In this work, we introduce a deracemizative luminescence system inspired by the biosynthetic pathway of d-luciferin using a combination of firefly luciferase from Luciola cruciata (LUC-G) and fatty acyl-CoA thioesterase II from Escherichia coli (TESB). The enzymatic reaction property analysis indicated the importance of the concentration balance between LUC-G and TESB for efficient d-luciferin production and light emission. Using this deracemizative luminescence system, a highly sensitive quantitative analysis method for l-cysteine was constructed. This LUC-G-TESB combination system can improve bioanalysis applications using the firefly bioluminescence reaction by efficient deracemization of D-luciferin. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

On-Location Public Affairs Reach-Back System

DTIC Science & Technology

2017-03-01

benefit of this study was to provide a required capability to Commander Naval Air Forces Atlantic (CNAL) Public Affairs Office (PAO). The required...of research are possible, including, but not limited to • Feasibility studies and cost - benefit analyses of upgrading a given ship to MEO from GEO...identified by Stephens and Adams (2016). • A cost - benefit analysis of providing MEO SATCOM to a geographical area (e.g., CENTCOM area of responsibility

ASW Reach-Back Cell Oceanography Analysis System (ARCOAS) Version 3 User’s Guide

DTIC Science & Technology

2012-02-24

65 Table of Figures Figure 2.1: Warning dialog box indicating ActiveX ...Click OK in response to the message box indicating that ActiveX controls are being used by the application (Figure 2.1). Figure 2.1: Warning...dialog box indicating ActiveX controls could be unsafe. 3. Open an existing map or create a new empty map. 4. Start ARCOAS by clicking the ARCOAS

Hands-on Science. How Fireflies Communicate.

ERIC Educational Resources Information Center

Kepler, Lynne

1995-01-01

One creative way that elementary science educators can teach their students about animal communication is to give them glow sticks and a set of cards with descriptions of what different firefly flash signals mean. The paper describes such a project and presents related activities. (SM)

A new blue-shifted luciferase from the Brazilian Amydetes fanestratus (Coleoptera: Lampyridae) firefly: molecular evolution and structural/functional properties.

PubMed

Viviani, Vadim R; Amaral, Danilo; Prado, Rogilene; Arnoldi, Frederico G C

2011-12-01

Firefly luciferases usually produce bioluminescence in the yellow-green region, with colors in the green and yellow-orange extremes of the spectrum being less common. Several firefly luciferases have already been cloned and sequenced, and site-directed mutagenesis studies have already identified important regions and residues for bioluminescence colors. However the structural determinants and mechanisms of bioluminescence colors turned out to be elusive, mainly when comparing luciferases with a high degree of divergence. Thus comparison of more similar luciferases producing colors in the two extremes of the spectrum could be revealing. The South-American fauna of fireflies remains largely unstudied, with some unique taxa that are not found anywhere else in the world and that produce a wide range of bioluminescence colors. Among them, fireflies of the genus Amydetes are especially interesting because its taxonomical status as an independent subfamily or as a tribe is not yet solved, and because they usually produce a continuous bright blue-shifted bioluminescence. In this work we cloned the cDNA for the luciferase of the Atlantic rain forest Amydetes fanestratus firefly, which is found near Sorocaba municipality (São Paulo, Brazil). Despite showing a higher degree of identity with the South-American Cratomorphus, the European Lampyris and the Asiatic Pyrocoelia, phylogenetical analysis of the luciferase sequence support the inclusion of Amydetes as an independent subfamily. Amydetes luciferase displays one of the most blue-shifted emission spectra (λ(max) = 538 nm) among beetle luciferases, with lower pH-sensitivity and higher affinity for ATP when compared to other luciferases, making this luciferase attractive for sensitive ATP and reporter assays.

Comparison of penalty functions on a penalty approach to mixed-integer optimization

NASA Astrophysics Data System (ADS)

Francisco, Rogério B.; Costa, M. Fernanda P.; Rocha, Ana Maria A. C.; Fernandes, Edite M. G. P.

2016-06-01

In this paper, we present a comparative study involving several penalty functions that can be used in a penalty approach for globally solving bound mixed-integer nonlinear programming (bMIMLP) problems. The penalty approach relies on a continuous reformulation of the bMINLP problem by adding a particular penalty term to the objective function. A penalty function based on the `erf' function is proposed. The continuous nonlinear optimization problems are sequentially solved by the population-based firefly algorithm. Preliminary numerical experiments are carried out in order to analyze the quality of the produced solutions, when compared with other penalty functions available in the literature.

FIREFLY LUCIFERASE ATP ASSAY DEVELOPMENT FOR MONITORING BACTERIAL CONCENTRATIONS IN WATER SUPPLIES

EPA Science Inventory

This research program was initiated to develop a rapid, automatable system for measuring total viable microorganisms in potable drinking water supplies using the firefly luciferase ATP assay. The assay was adapted to an automatable flow system that provided comparable sensitivity...

Molecular Origin of Color Variation in Firefly (Beetle) Bioluminescence: A Chemical Basis for Biological Imaging.

PubMed

Hirano, Takashi

2016-01-01

Firefly shows bioluminescence by "luciferin-luciferase" (L-L) reaction using luciferin, luciferase, ATP and O2. The chemical photon generation by an enzymatic reaction is widely utilized for analytical methods including biological imaging in the life science fields. To expand photondetecting analyses with firefly bioluminescence, it is important for users to understand the chemical basis of the L-L reaction. In particular, the emission color variation of the L-L reaction is one of the distinguishing characteristics for multicolor luciferase assay and in vivo imaging. From the viewpoint of fundamental chemistry, this review explains the recent progress in the studies on the molecular mechanism of emission color variation after showing the outline of the reaction mechanism of the whole L-L reaction. On the basis of the mechanism, the progresses in organic synthesis of luciferin analogs modulating their emission colors are also presented to support further developments of red/near infrared in vivo biological imaging utility of firefly bioluminescence.

Impact of Site-Directed Mutant Luciferase on Quantitative Green and Orange/Red Emission Intensities in Firefly Bioluminescence

NASA Astrophysics Data System (ADS)

Wang, Yu; Akiyama, Hidefumi; Terakado, Kanako; Nakatsu, Toru

2013-08-01

Firefly bioluminescence has attracted great interest because of its high quantum yield and intriguing modifiable colours. Modifications to the structure of the enzyme luciferase can change the emission colour of firefly bioluminescence, and the mechanism of the colour change has been intensively studied by biochemists, structural biologists, optical physicists, and quantum-chemistry theorists. Here, we report on the quantitative spectra of firefly bioluminescence catalysed by wild-type and four site-directed mutant luciferases. While the mutation caused different emission spectra, the spectra differed only in the intensity of the green component (λmax ~ 560 nm). In contrast, the orange (λmax ~ 610 nm) and red (λmax ~ 650 nm) components present in all the spectra were almost unaffected by the modifications to the luciferases and changes in pH. Our results reveal that the intensity of the green component is the unique factor that is influenced by the luciferase structure and other reaction conditions.

Site-directed mutagenesis of firefly luciferase: implication of conserved residue(s) in bioluminescence emission spectra among firefly luciferases.

PubMed

Tafreshi, Narges Kh; Sadeghizadeh, Majid; Emamzadeh, Rahman; Ranjbar, Bijan; Naderi-Manesh, Hossein; Hosseinkhani, Saman

2008-05-15

The bioluminescence colours of firefly luciferases are determined by assay conditions and luciferase structure. Owing to red light having lower energy than green light and being less absorbed by biological tissues, red-emitting luciferases have been considered as useful reporters in imaging technology. A set of red-emitting mutants of Lampyris turkestanicus (Iranian firefly) luciferase has been made by site-directed mutagenesis. Among different beetle luciferases, those from Phrixothrix (railroad worm) emit either green or red bioluminescence colours naturally. By substitution of three specific amino acids using site-specific mutagenesis in a green-emitting luciferase (from L. turkestanicus), the colour of emitted light was changed to red concomitant with decreasing decay rate. Different specific mutations (H245N, S284T and H431Y) led to changes in the bioluminescence colour. Meanwhile, the luciferase reaction took place with relative retention of its basic kinetic properties such as K(m) and relative activity. Structural comparison of the native and mutant luciferases using intrinsic fluorescence, far-UV CD spectra and homology modelling revealed a significant conformational change in mutant forms. A change in the colour of emitted light indicates the critical role of these conserved residues in bioluminescence colour determination among firefly luciferases. Relatively high specific activity and emission of red light might make these mutants suitable as reporters for the study of gene expression and bioluminescence imaging.

Biochemical characteristics and gene expression profiles of two paralogous luciferases from the Japanese firefly Pyrocoelia atripennis (Coleoptera, Lampyridae, Lampyrinae): insight into the evolution of firefly luciferase genes.

PubMed

Bessho-Uehara, Manabu; Konishi, Kaori; Oba, Yuichi

2017-08-09

Two paralogous genes of firefly luciferase, Luc1 and Luc2, have been isolated from the species in two subfamilies, Luciolinae and Photurinae, of the family Lampyridae. The gene expression profiles have previously been examined only in the species of Luciolinae. Here we isolated Luc1 and Luc2 genes from the Japanese firefly Pyrocoelia atripennis. This is the first report of the presence of both Luc1 and Luc2 genes in the species of the subfamily Lampyrinae and of the exon-intron structure of Luc2 in the family Lampyridae. The luminescence of both gene products peaked at 547 nm under neutral buffer conditions, and the spectrum of Luc1, but not Luc2, was red-shifted under acidic conditions, as observed for Luc2 in the Luciolinae species. The semi-quantitative reverse transcription-polymerase chain reaction suggested that Luc1 was expressed in lanterns of all the stages except eggs, while Luc2 was expressed in the non-lantern bodies of eggs, prepupae, pupae, and female adults. These expression profiles are consistent with those in the Luciolinae species. Considering the distant phylogenetic relationship between Lampyrinae and Luciolinae in Lampyridae, we propose that fireflies generally possess two different luciferase genes and the biochemical properties and gene expression profiles for each paralog are conserved among lampyrid species.

R-EACTR: A Framework for Designing Realistic Cyber Warfare Exercises

DTIC Science & Technology

2017-09-11

2.1 Environment 3 2.2 Adversary 4 2.3 Communications 4 2.4 Tactics 5 2.5 Roles 5 3 Case Study – Cyber Forge 11 7 3.1 Environment 7 3.2...realism into each aspect of the exercise, and a case study of one exercise where the framework was successfully employed. CMU/SEI-2017-TR-005...network, emulation, logging, reporting Supporting: computer network defense service provider (CNDSP), intelligence, reach-back, higher

The medical decision model and decision maker tools for management of radiological and nuclear incidents.

PubMed

Koerner, John F; Coleman, C Norman; Murrain-Hill, Paula; FitzGerald, Denis J; Sullivan, Julie M

2014-06-01

Effective decision making during a rapidly evolving emergency such as a radiological or nuclear incident requires timely interim decisions and communications from onsite decision makers while further data processing, consultation, and review are ongoing by reachback experts. The authors have recently proposed a medical decision model for use during a radiological or nuclear disaster, which is similar in concept to that used in medical care, especially when delay in action can have disastrous effects. For decision makers to function most effectively during a complex response, they require access to onsite subject matter experts who can provide information, recommendations, and participate in public communication efforts. However, in the time before this expertise is available or during the planning phase, just-in-time tools are essential that provide critical overview of the subject matter written specifically for the decision makers. Recognizing the complexity of the science, risk assessment, and multitude of potential response assets that will be required after a nuclear incident, the Office of the Assistant Secretary for Preparedness and Response, in collaboration with other government and non-government experts, has prepared a practical guide for decision makers. This paper illustrates how the medical decision model process could facilitate onsite decision making that includes using the deliberative reachback process from science and policy experts and describes the tools now available to facilitate timely and effective incident management.

A global optimization algorithm inspired in the behavior of selfish herds.

PubMed

Fausto, Fernando; Cuevas, Erik; Valdivia, Arturo; González, Adrián

2017-10-01

In this paper, a novel swarm optimization algorithm called the Selfish Herd Optimizer (SHO) is proposed for solving global optimization problems. SHO is based on the simulation of the widely observed selfish herd behavior manifested by individuals within a herd of animals subjected to some form of predation risk. In SHO, individuals emulate the predatory interactions between groups of prey and predators by two types of search agents: the members of a selfish herd (the prey) and a pack of hungry predators. Depending on their classification as either a prey or a predator, each individual is conducted by a set of unique evolutionary operators inspired by such prey-predator relationship. These unique traits allow SHO to improve the balance between exploration and exploitation without altering the population size. To illustrate the proficiency and robustness of the proposed method, it is compared to other well-known evolutionary optimization approaches such as Particle Swarm Optimization (PSO), Artificial Bee Colony (ABC), Firefly Algorithm (FA), Differential Evolution (DE), Genetic Algorithms (GA), Crow Search Algorithm (CSA), Dragonfly Algorithm (DA), Moth-flame Optimization Algorithm (MOA) and Sine Cosine Algorithm (SCA). The comparison examines several standard benchmark functions, commonly considered within the literature of evolutionary algorithms. The experimental results show the remarkable performance of our proposed approach against those of the other compared methods, and as such SHO is proven to be an excellent alternative to solve global optimization problems. Copyright © 2017 Elsevier B.V. All rights reserved.

Synchronizing Fireflies

ERIC Educational Resources Information Center

Zhou, Ying; Gall, Walter; Nabb, Karen Mayumi

2006-01-01

"Imagine a tenth of a mile of river front with an unbroken line of trees with fireflies on ever leaf flashing in synchronism. ... Then, if one's imagination is sufficiently vivid, he may form some conception of this amazing spectacle." So wrote the naturalist Hugh Smith. In this article we consider how one might model mathematically the…

Analyzing the impact of the Firefly Trail on economic development in northeast Georgia : final report.

DOT National Transportation Integrated Search

2016-10-01

This research report contains the findings of the analysis undertaken to measure the economic impact of the proposed Firefly Trail on the local economy. An input-output model was constructed to study the economic impact of the project on the local ec...

Histone Methylation and Epigenetic Silencing in Breast Cancer

DTIC Science & Technology

2010-07-01

bars show relative luciferase expression levels (firefly versus Renilla control) in SKBR3 cells treated with a control non-targeted dsRNA (NT2) and red...luciferase expression levels (firefly versus Renilla control) in SKBR3 cells treated with a control non-targeted dsRNA (NT2) and red bars depict

A Grey Wolf Optimizer for Modular Granular Neural Networks for Human Recognition

PubMed Central

Sánchez, Daniela; Melin, Patricia

2017-01-01

A grey wolf optimizer for modular neural network (MNN) with a granular approach is proposed. The proposed method performs optimal granulation of data and design of modular neural networks architectures to perform human recognition, and to prove its effectiveness benchmark databases of ear, iris, and face biometric measures are used to perform tests and comparisons against other works. The design of a modular granular neural network (MGNN) consists in finding optimal parameters of its architecture; these parameters are the number of subgranules, percentage of data for the training phase, learning algorithm, goal error, number of hidden layers, and their number of neurons. Nowadays, there is a great variety of approaches and new techniques within the evolutionary computing area, and these approaches and techniques have emerged to help find optimal solutions to problems or models and bioinspired algorithms are part of this area. In this work a grey wolf optimizer is proposed for the design of modular granular neural networks, and the results are compared against a genetic algorithm and a firefly algorithm in order to know which of these techniques provides better results when applied to human recognition. PMID:28894461

A Grey Wolf Optimizer for Modular Granular Neural Networks for Human Recognition.

PubMed

Sánchez, Daniela; Melin, Patricia; Castillo, Oscar

2017-01-01

A grey wolf optimizer for modular neural network (MNN) with a granular approach is proposed. The proposed method performs optimal granulation of data and design of modular neural networks architectures to perform human recognition, and to prove its effectiveness benchmark databases of ear, iris, and face biometric measures are used to perform tests and comparisons against other works. The design of a modular granular neural network (MGNN) consists in finding optimal parameters of its architecture; these parameters are the number of subgranules, percentage of data for the training phase, learning algorithm, goal error, number of hidden layers, and their number of neurons. Nowadays, there is a great variety of approaches and new techniques within the evolutionary computing area, and these approaches and techniques have emerged to help find optimal solutions to problems or models and bioinspired algorithms are part of this area. In this work a grey wolf optimizer is proposed for the design of modular granular neural networks, and the results are compared against a genetic algorithm and a firefly algorithm in order to know which of these techniques provides better results when applied to human recognition.

Improvement in detection of small wildfires

NASA Astrophysics Data System (ADS)

Sleigh, William J.

1991-12-01

Detecting and imaging small wildfires with an Airborne Scanner is done against generally high background levels. The Airborne Scanner System used is a two-channel thermal IR scanner, with one channel selected for imaging the terrain and the other channel sensitive to hotter targets. If a relationship can be determined between the two channels that quantifies the background signal for hotter targets, then an algorithm can be determined that removes the background signal in that channel leaving only the fire signal. The relationship can be determined anywhere between various points in the signal processing of the radiometric data from the radiometric input to the quantized output of the system. As long as only linear operations are performed on the signal, the relationship will only depend on the system gain and offsets within the range of interest. The algorithm can be implemented either by using a look-up table or performing the calculation in the system computer. The current presentation will describe the algorithm, its derivation, and its implementation in the Firefly Wildfire Detection System by means of an off-the-shelf commercial scanner. Improvement over the previous algorithm used and the margin gained for improving the imaging of the terrain will be demonstrated.

Improvement in detection of small wildfires

NASA Technical Reports Server (NTRS)

Sleigh, William J.

1991-01-01

Detecting and imaging small wildfires with an Airborne Scanner is done against generally high background levels. The Airborne Scanner System used is a two-channel thermal IR scanner, with one channel selected for imaging the terrain and the other channel sensitive to hotter targets. If a relationship can be determined between the two channels that quantifies the background signal for hotter targets, then an algorithm can be determined that removes the background signal in that channel leaving only the fire signal. The relationship can be determined anywhere between various points in the signal processing of the radiometric data from the radiometric input to the quantized output of the system. As long as only linear operations are performed on the signal, the relationship will only depend on the system gain and offsets within the range of interest. The algorithm can be implemented either by using a look-up table or performing the calculation in the system computer. The current presentation will describe the algorithm, its derivation, and its implementation in the Firefly Wildfire Detection System by means of an off-the-shelf commercial scanner. Improvement over the previous algorithm used and the margin gained for improving the imaging of the terrain will be demonstrated.

Searching for Extant Life on Mars - The ATP-Firefly LuciferinLuciferase Technique

NASA Astrophysics Data System (ADS)

Obousy, R. K.; Tziolas, A. C.; Kaltsas, K.; Sims, M. R.; Grant, W. D.

We have investigated the use of the ATP-Firefly Luciferin/Luciferase (FFL) enzymic photoluminescent reaction as a possible means of detecting extant life in the Martian environment. Experiments carried out by the authors illustrate the capacity of the method to successfully detect extant forms of life on Mars assuming ATP is an intrinsic part of the biochemistry of such life-forms. A photodiode based apparatus, built to test the assumptions and applicability of the ATP-Firefly Luciferase/Luciferin technique to an exobiologically inclined mission to Mars, revealed the adequate resolution and reproducibility of the methodology plus areas of improvement. Also detailed are extraction, delivery and analysis system concepts, proposed for future Mars missions.

Total evidence phylogeny and the evolution of adult bioluminescence in fireflies (Coleoptera: Lampyridae).

PubMed

Martin, Gavin J; Branham, Marc A; Whiting, Michael F; Bybee, Seth M

2017-02-01

Fireflies are some of the most captivating organisms on the planet. They have a rich history as subjects of scientific study, especially in relation to their bioluminescent behavior. Yet, the phylogenetic relationships of fireflies are still poorly understood. Here, we present the first total evidence approach to reconstruct lampyrid phylogeny using both a molecular matrix from six loci and an extensive morphological matrix. Using this phylogeny we test the hypothesis that adult bioluminescence evolved after the origin of the firefly clade. The ancestral state of adult bioluminescence is recovered as non-bioluminescent with one to six gains and five to ten subsequent losses. The monophyly of the family, as well as the subfamilies is also tested. Ototretinae, Cyphonocerinae, Luciolinae (incl. Pristolycus), Amydetinae, "cheguevarinae" sensu Jeng 2008, and Photurinae are highly supported as monophyletic. With the exception of four taxa, Lampyrinae is also recovered as monophyletic with high support. Based on phylogenetic and morphological data Lamprohiza, Phausis, and Lamprigera are transferred to Lampyridae incertae sedis. Copyright © 2016 Elsevier Inc. All rights reserved.

Mass spectrometry analysis and transcriptome sequencing reveal glowing squid crystal proteins are in the same superfamily as firefly luciferase

PubMed Central

Gimenez, Gregory; Metcalf, Peter; Paterson, Neil G.; Sharpe, Miriam L.

2016-01-01

The Japanese firefly squid Hotaru-ika (Watasenia scintillans) produces intense blue light from photophores at the tips of two arms. These photophores are densely packed with protein microcrystals that catalyse the bioluminescent reaction using ATP and the substrate coelenterazine disulfate. The squid is the only organism known to produce light using protein crystals. We extracted microcrystals from arm tip photophores and identified the constituent proteins using mass spectrometry and transcriptome libraries prepared from arm tip tissue. The crystals contain three proteins, wsluc1–3, all members of the ANL superfamily of adenylating enzymes. They share 19 to 21% sequence identity with firefly luciferases, which produce light using ATP and the unrelated firefly luciferin substrate. We propose that wsluc1–3 form a complex that crystallises inside the squid photophores, and that in the crystal one or more of the proteins catalyses the production of light using coelenterazine disulfate and ATP. These results suggest that ANL superfamily enzymes have independently evolved in distant species to produce light using unrelated substrates. PMID:27279452

Crystal structure of native and a mutant of Lampyris turkestanicus luciferase implicate in bioluminescence color shift.

PubMed

Kheirabadi, Mitra; Sharafian, Zohreh; Naderi-Manesh, Hossein; Heineman, Udo; Gohlke, Ulrich; Hosseinkhani, Saman

2013-12-01

Firefly bioluminescence reaction in the presence of Mg(2+), ATP and molecular oxygen is carried out by luciferase. The luciferase structure alterations or modifications of assay conditions determine the bioluminescence color of firefly luciferase. Among different beetle luciferases, Phrixothrix hirtus railroad worm emits either yellow or red bioluminescence color. Sequence alignment analysis shows that the red-emitter luciferase from Phrixothrix hirtus has an additional arginine residue at 353 that is absent in other firefly luciferases. It was reported that insertion of Arg in an important flexible loop350-359 showed changes in bioluminescence color from green to red and the optimum temperature activity was also increased. To explain the color tuning mechanism of firefly luciferase, the structure of native and a mutant (E354R/356R/H431Y) of Lampyris turkestanicus luciferase is determined at 2.7Å and 2.2Å resolutions, respectively. The comparison of structure of both types of Lampyris turkestanicus luciferases reveals that the conformation of this flexible loop is significantly changed by addition of two Arg in this region. Moreover, its surface accessibility is affected considerably and some ionic bonds are made by addition of two positive charge residues. Furthermore, we noticed that the hydrogen bonding pattern of His431 with the flexible loop is changed by replacing this residue with Tyr at this position. Juxtaposition of a flexible loop (residues 351-359) in firefly luciferase and corresponding ionic and hydrogen bonds are essential for color emission. © 2013.

Air Force Research Laboratory Sensors Directorate Communications Branch History from 1960-2011

DTIC Science & Technology

2011-12-01

transponders on three UHF Follow-On ( UFO ) satellites to provide high data rate (i.e. up to 23.5 Mbps) broadcast service to ground and shipboard users...Luneberg Lens antenna. The Milstar system was also used as a reach-back channel to Norfolk to request changes in the test sequence. Figure 5 UFO ...UHF SATCOM use a pair of Raytheon ARC- 231 radios through the UHF Follow-On ( UFO ) satellites into military ground entry stations to provide secure

A Firefly Learning Module for Environmental Sustainable Development in Samutsongkhram Province, Thailand

ERIC Educational Resources Information Center

To-Im, Jongdee; Klunklueng, Arunwan

2012-01-01

A firefly learning module for the sustainable development was developed for Thai secondary school students in the study province. A deeper connection between environment, social and economic dimensions, which lies at the core of sustainability, became the key issue for this learning module. Also an important dimension of the module was the…

Dual Luciferase Assay System for Rapid Assessment of Gene Expression in Saccharomyces cerevisiae

PubMed Central

McNabb, David S.; Reed, Robin; Marciniak, Robert A.

2005-01-01

A new reporter system has been developed for quantifying gene expression in the yeast Saccharomyces cerevisiae. The system relies on two different reporter genes, Renilla and firefly luciferase, to evaluate regulated gene expression. The gene encoding Renilla luciferase is fused to a constitutive promoter (PGK1 or SPT15) and integrated into the yeast genome at the CAN1 locus as a control for normalizing the assay. The firefly luciferase gene is fused to the test promoter and integrated into the yeast genome at the ura3 or leu2 locus. The dual luciferase assay is performed by sequentially measuring the firefly and Renilla luciferase activities of the same sample, with the results expressed as the ratio of firefly to Renilla luciferase activity (Fluc/Rluc). The yeast dual luciferase reporter (DLR) was characterized and shown to be very efficient, requiring approximately 1 minute to complete each assay, and has proven to yield data that accurately and reproducibly reflect promoter activity. A series of integrating plasmids were generated that contain either the firefly or Renilla luciferase gene preceded by a multicloning region in two different orientations and the three reading frames to make possible the generation of translational fusions. Additionally, each set of plasmids contains either the URA3 or LEU2 marker for genetic selection in yeast. A series of S288C-based yeast strains, including a two-hybrid strain, were developed to facilitate the use of the yeast DLR assay. This assay can be readily adapted to a high-throughput platform for studies requiring numerous measurements. PMID:16151247

GENERATION OF TWO NOVEL CELL LINES THAT STABLY EXPRESS HAR AND FIREFLY LUCIFERASE GENES FOR ENDOCRINE SCREENING

EPA Science Inventory

Generation of Two Novel Cell Lines that Stably Express hAR and Firefly Luciferase Genes for Endocrine Screening
K.L. Bobseine*1, W.R. Kelce2, P.C. Hartig*1, and L.E. Gray, Jr.1
1USEPA, NHEERL, Reproductive Toxicology Division, RTP, NC, 2Searle, Reproductive Toxicology Divi...

Firefly: an optical lithographic system for the fabrication of holographic security labels

NASA Astrophysics Data System (ADS)

Calderón, Jorge; Rincón, Oscar; Amézquita, Ricardo; Pulido, Iván.; Amézquita, Sebastián.; Bernal, Andrés.; Romero, Luis; Agudelo, Viviana

2016-03-01

This paper introduces Firefly, an optical lithography origination system that has been developed to produce holographic masters of high quality. This mask-less lithography system has a resolution of 418 nm half-pitch, and generates holographic masters with the optical characteristics required for security applications of level 1 (visual verification), level 2 (pocket reader verification) and level 3 (forensic verification). The holographic master constitutes the main core of the manufacturing process of security holographic labels used for the authentication of products and documents worldwide. Additionally, the Firefly is equipped with a software tool that allows for the hologram design from graphic formats stored in bitmaps. The software is capable of generating and configuring basic optical effects such as animation and color, as well as effects of high complexity such as Fresnel lenses, engraves and encrypted images, among others. The Firefly technology gathers together optical lithography, digital image processing and the most advanced control systems, making possible a competitive equipment that challenges the best technologies in the industry of holographic generation around the world. In this paper, a general description of the origination system is provided as well as some examples of its capabilities.

Transcriptome analysis reveals candidate genes involved in luciferin metabolism in Luciola aquatilis (Coleoptera: Lampyridae)

PubMed Central

Vongsangnak, Wanwipa; Chumnanpuen, Pramote

2016-01-01

Bioluminescence, which living organisms such as fireflies emit light, has been studied extensively for over half a century. This intriguing reaction, having its origins in nature where glowing insects can signal things such as attraction or defense, is now widely used in biotechnology with applications of bioluminescence and chemiluminescence. Luciferase, a key enzyme in this reaction, has been well characterized; however, the enzymes involved in the biosynthetic pathway of its substrate, luciferin, remains unsolved at present. To elucidate the luciferin metabolism, we performed a de novo transcriptome analysis using larvae of the firefly species, Luciola aquatilis. Here, a comparative analysis is performed with the model coleopteran insect Tribolium casteneum to elucidate the metabolic pathways in L. aquatilis. Based on a template luciferin biosynthetic pathway, combined with a range of protein and pathway databases, and various prediction tools for functional annotation, the candidate genes, enzymes, and biochemical reactions involved in luciferin metabolism are proposed for L. aquatilis. The candidate gene expression is validated in the adult L. aquatilis using reverse transcription PCR (RT-PCR). This study provides useful information on the bio-production of luciferin in the firefly and will benefit to future applications of the valuable firefly bioluminescence system. PMID:27761329

Bifunctional role of leucine 300 of firefly luciferase in structural rigidity.

PubMed

Yousefi, Farzad; Ataei, Farangis; Mortazavi, Mojtaba; Hosseinkhani, Saman

2017-08-01

Firefly luciferase is susceptible to thermal inactivation, thereby its intracellular half-life decreased. Previous reports indicated that L 300 R mutation (LRR mutant) in E 354 R/Arg 356 double mutant (ERR mutant) from Lampyris turkestanicus luciferase has increased its thermal stability and rigidity through induction of some ionic bonds with Asp 270 and 271. Disruption of the deduced ionic bonds in an ultra-rigid mutant of firefly luciferase did not reverse the flexibility of the protein. In this study, we investigated the effects of this residue to find the truth behind an extraordinary increase in thermal stability and rigidity of luciferase after replacement of leucine 300 by arginine based on previous reports. For this purpose, L 300 R, L 300 K and L 300 E mutations were performed to compare the effects of these mutations on the native firefly luciferase. In spite of increase of intrinsic fluorescence of the mutants a slight increase in thermostability and retention of kinetic properties was observed. Based on our results, we can conclude that L 300 R mutation in LRR mutant accompanying with alteration in a flexible loop (352-359) increased thermostability and rigidity of luciferase. Copyright © 2017 Elsevier B.V. All rights reserved.

An Improved Swarm Optimization for Parameter Estimation and Biological Model Selection

PubMed Central

Abdullah, Afnizanfaizal; Deris, Safaai; Mohamad, Mohd Saberi; Anwar, Sohail

2013-01-01

One of the key aspects of computational systems biology is the investigation on the dynamic biological processes within cells. Computational models are often required to elucidate the mechanisms and principles driving the processes because of the nonlinearity and complexity. The models usually incorporate a set of parameters that signify the physical properties of the actual biological systems. In most cases, these parameters are estimated by fitting the model outputs with the corresponding experimental data. However, this is a challenging task because the available experimental data are frequently noisy and incomplete. In this paper, a new hybrid optimization method is proposed to estimate these parameters from the noisy and incomplete experimental data. The proposed method, called Swarm-based Chemical Reaction Optimization, integrates the evolutionary searching strategy employed by the Chemical Reaction Optimization, into the neighbouring searching strategy of the Firefly Algorithm method. The effectiveness of the method was evaluated using a simulated nonlinear model and two biological models: synthetic transcriptional oscillators, and extracellular protease production models. The results showed that the accuracy and computational speed of the proposed method were better than the existing Differential Evolution, Firefly Algorithm and Chemical Reaction Optimization methods. The reliability of the estimated parameters was statistically validated, which suggests that the model outputs produced by these parameters were valid even when noisy and incomplete experimental data were used. Additionally, Akaike Information Criterion was employed to evaluate the model selection, which highlighted the capability of the proposed method in choosing a plausible model based on the experimental data. In conclusion, this paper presents the effectiveness of the proposed method for parameter estimation and model selection problems using noisy and incomplete experimental data. This study is hoped to provide a new insight in developing more accurate and reliable biological models based on limited and low quality experimental data. PMID:23593445

Luciferin Amides Enable in Vivo Bioluminescence Detection of Endogenous Fatty Acid Amide Hydrolase Activity.

PubMed

Mofford, David M; Adams, Spencer T; Reddy, G S Kiran Kumar; Reddy, Gadarla Randheer; Miller, Stephen C

2015-07-15

Firefly luciferase is homologous to fatty acyl-CoA synthetases. We hypothesized that the firefly luciferase substrate d-luciferin and its analogs are fatty acid mimics that are ideally suited to probe the chemistry of enzymes that release fatty acid products. Here, we synthesized luciferin amides and found that these molecules are hydrolyzed to substrates for firefly luciferase by the enzyme fatty acid amide hydrolase (FAAH). In the presence of luciferase, these molecules enable highly sensitive and selective bioluminescent detection of FAAH activity in vitro, in live cells, and in vivo. The potency and tissue distribution of FAAH inhibitors can be imaged in live mice, and luciferin amides serve as exemplary reagents for greatly improved bioluminescence imaging in FAAH-expressing tissues such as the brain.

Luciferin Amides Enable in Vivo Bioluminescence Detection of Endogenous Fatty Acid Amide Hydrolase Activity

PubMed Central

2015-01-01

Firefly luciferase is homologous to fatty acyl-CoA synthetases. We hypothesized that the firefly luciferase substrate d-luciferin and its analogs are fatty acid mimics that are ideally suited to probe the chemistry of enzymes that release fatty acid products. Here, we synthesized luciferin amides and found that these molecules are hydrolyzed to substrates for firefly luciferase by the enzyme fatty acid amide hydrolase (FAAH). In the presence of luciferase, these molecules enable highly sensitive and selective bioluminescent detection of FAAH activity in vitro, in live cells, and in vivo. The potency and tissue distribution of FAAH inhibitors can be imaged in live mice, and luciferin amides serve as exemplary reagents for greatly improved bioluminescence imaging in FAAH-expressing tissues such as the brain. PMID:26120870

Two techniques for eliminating luminol interference material and flow system configurations for luminol and firefly luciferase systems

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1976-01-01

Two methods for eliminating luminol interference materials are described. One method eliminates interference from organic material by pre-reacting a sample with dilute hydrogen peroxide. The reaction rate resolution method for eliminating inorganic forms of interference is also described. The combination of the two methods makes the luminol system more specific for bacteria. Flow system designs for both the firefly luciferase and luminol bacteria detection systems are described. The firefly luciferase flow system incorporating nitric acid extraction and optimal dilutions has a functional sensitivity of 3 x 100,000 E. coli/ml. The luminol flow system incorporates the hydrogen peroxide pretreatment and the reaction rate resolution techniques for eliminating interference. The functional sensitivity of the luminol flow system is 1 x 10,000 E. coli/ml.

Novel multistep BRET-FRET energy transfer using nanoconjugates of firefly proteins, quantum dots, and red fluorescent proteins

NASA Astrophysics Data System (ADS)

Alam, Rabeka; Zylstra, Joshua; Fontaine, Danielle M.; Branchini, Bruce R.; Maye, Mathew M.

2013-05-01

Sequential bioluminescence resonance energy transfer (BRET) and fluorescence resonance energy transfer (FRET) from firefly luciferase to red fluorescent proteins using quantum dot or rod acceptor/donor linkers is described. The effect of morphology and tuned optical properties on the efficiency of this unique BRET-FRET system was evaluated.Sequential bioluminescence resonance energy transfer (BRET) and fluorescence resonance energy transfer (FRET) from firefly luciferase to red fluorescent proteins using quantum dot or rod acceptor/donor linkers is described. The effect of morphology and tuned optical properties on the efficiency of this unique BRET-FRET system was evaluated. Electronic supplementary information (ESI) available: Experimental details, Fig. S1 and Table S1-S4. See DOI: 10.1039/c3nr01842c

Calculation of a double reactive azeotrope using stochastic optimization approaches

NASA Astrophysics Data System (ADS)

Mendes Platt, Gustavo; Pinheiro Domingos, Roberto; Oliveira de Andrade, Matheus

2013-02-01

An homogeneous reactive azeotrope is a thermodynamic coexistence condition of two phases under chemical and phase equilibrium, where compositions of both phases (in the Ung-Doherty sense) are equal. This kind of nonlinear phenomenon arises from real world situations and has applications in chemical and petrochemical industries. The modeling of reactive azeotrope calculation is represented by a nonlinear algebraic system with phase equilibrium, chemical equilibrium and azeotropy equations. This nonlinear system can exhibit more than one solution, corresponding to a double reactive azeotrope. The robust calculation of reactive azeotropes can be conducted by several approaches, such as interval-Newton/generalized bisection algorithms and hybrid stochastic-deterministic frameworks. In this paper, we investigate the numerical aspects of the calculation of reactive azeotropes using two metaheuristics: the Luus-Jaakola adaptive random search and the Firefly algorithm. Moreover, we present results for a system (with industrial interest) with more than one azeotrope, the system isobutene/methanol/methyl-tert-butyl-ether (MTBE). We present convergence patterns for both algorithms, illustrating - in a bidimensional subdomain - the identification of reactive azeotropes. A strategy for calculation of multiple roots in nonlinear systems is also applied. The results indicate that both algorithms are suitable and robust when applied to reactive azeotrope calculations for this "challenging" nonlinear system.

Adaptive infinite impulse response system identification using modified-interior search algorithm with Lèvy flight.

PubMed

Kumar, Manjeet; Rawat, Tarun Kumar; Aggarwal, Apoorva

2017-03-01

In this paper, a new meta-heuristic optimization technique, called interior search algorithm (ISA) with Lèvy flight is proposed and applied to determine the optimal parameters of an unknown infinite impulse response (IIR) system for the system identification problem. ISA is based on aesthetics, which is commonly used in interior design and decoration processes. In ISA, composition phase and mirror phase are applied for addressing the nonlinear and multimodal system identification problems. System identification using modified-ISA (M-ISA) based method involves faster convergence, single parameter tuning and does not require derivative information because it uses a stochastic random search using the concepts of Lèvy flight. A proper tuning of control parameter has been performed in order to achieve a balance between intensification and diversification phases. In order to evaluate the performance of the proposed method, mean square error (MSE), computation time and percentage improvement are considered as the performance measure. To validate the performance of M-ISA based method, simulations has been carried out for three benchmarked IIR systems using same order and reduced order system. Genetic algorithm (GA), particle swarm optimization (PSO), cat swarm optimization (CSO), cuckoo search algorithm (CSA), differential evolution using wavelet mutation (DEWM), firefly algorithm (FFA), craziness based particle swarm optimization (CRPSO), harmony search (HS) algorithm, opposition based harmony search (OHS) algorithm, hybrid particle swarm optimization-gravitational search algorithm (HPSO-GSA) and ISA are also used to model the same examples and simulation results are compared. Obtained results confirm the efficiency of the proposed method. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Integrated Optoelectronic Networks for Application-Driven Multicore Computing

DTIC Science & Technology

2017-05-08

hybrid photonic torus, the all-optical Corona crossbar, and the hybrid hierarchical Firefly crossbar. • The key challenges for waveguide photonics...improves SXR but with relatively higher EDP overhead. Our evaluation results indicate that the encoding schemes improve worst-case-SXR in Corona and...photonic crossbar architectures ( Corona and Firefly) indicate that our approach improves worst-case signal-to-noise ratio (SNR) by up to 51.7

GENERATION OF TWO STABLE CELL LINES THAT EXPRESS HER-ALPHA OR HER-ALPHA AND -BETA AND FIREFLY LUCIFERASE GENES FOR ENDOCRINE SCREENING

EPA Science Inventory

Generation of Two Stable Cell Lines that Express hERa or
hERa and b and Firefly Luciferase Genes for Endocrine Screening

K.L. Bobseine*1, W.R. Kelce2, P.C. Hartig*1, and L.E. Gray, Jr.1

1USEPA, NHEERL, Reproductive Toxicology Division, RTP, NC, 2Searle, Reprod...

Regulation of AR and (Beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2005-10-01

Renilla luciferase activities were determined using a dual-luciferase reporter assay kit (Promega, Madison, WI), and Renilla activities were not...consistently affected by any of the cotransfected vectors. The firefly luciferase was divided by the control Renilla luciferase and the results, given as...transfected with pTopflash (50 ng) and CMV- Renilla (2.5 ng) reporter plasmids. Firefly versus Renilla luciferase activities were determined and

Modulation of Beta-catenin Activity With PKD1 Prostate Cancer

DTIC Science & Technology

2009-04-01

mutated site as a negative control (FOPFlash) with pRL-TK ( Renilla luciferase) in C4-2- PKD1-GFP cells activated with Bryostatin 1 or DMSO. The...firefly and Renilla luciferase activities were measured with the Dual-Luciferase Reporter (DLR) Assay System. After normalizing the firefly luciferase...activity to that of Renilla luciferase, the FOPFlash reporter plasmid luciferase values were subtracted from the normalized values obtained with the

Design and introduction of a disulfide bridge in firefly luciferase: increase of thermostability and decrease of pH sensitivity.

PubMed

Imani, Mehdi; Hosseinkhani, Saman; Ahmadian, Shahin; Nazari, Mahboobeh

2010-08-01

The thermal sensitivity and pH-sensitive spectral properties of firefly luciferase have hampered its application in a variety of fields. It is proposed that the stability of a protein can be increased by introduction of disulfide bridge that decreases the configurational entropy of unfolding. A disulfide bridge is introduced into Photinus pyralis firefly luciferase to make two separate mutant enzymes with a single bridge. Even though the A103C/S121C mutant showed remarkable thermal stability, its specific activity decreased, whereas the A296C/A326C mutant showed tremendous thermal stability, relative pH insensitivity and 7.3-fold increase of specific activity. Moreover, the bioluminescence emission spectrum of A296C/A326C was resistant against higher temperatures (37 degrees C). Far-UV CD analysis showed slight secondary structure changes for both mutants. Thermal denaturation analysis showed that conformational stabilities of A103C/S121C and A296C/A326C are more than native firefly luciferase. It is proposed that since A296 and A326 are situated in the vicinity of the enzyme active site microenvironment in comparison with A103 and S121, the formation of a disulfide bridge in this region has more impact on enzyme kinetic characteristics.

MicroRNA Inhibitors as Anticancer Therapies

DTIC Science & Technology

2007-08-17

Promoter activity was determined by co-transfection of the pGL3 promoter reporter (400 ng/well) with pRLSV40 ( Renilla luciferase, Promega)(100 ng/well) into...performed in triplicate and standard deviations calculated. Activitywas defined as Firefly/ Renilla ratio, normalized to control vector transfection. For...was defined as Firefly/ Renilla ratio normalized to activity in the absence of transfected E2F1. 5-RACE Mapping of Transcript—HEK-293 cells were tran

The Role of AHR in Breast Cancer Development

DTIC Science & Technology

2005-07-01

Carlsbad, CA) was used according to the manufacturer’s instructions to transfect cells. The renilla luciferase vectorphRL-TK (0.5 [tg/well) was co...the firefly and renilla signals. Briefly, cells were lysed in equal volumes of cell lysis buffer (Promega) and RPMI for 20 min, transferred to a 96...well white wall plate, and analyzed using a Reporter Luminometer (Promega). The renilla signal was read after quenching the firefly output, thus

Near infrared bioluminescence resonance energy transfer from firefly luciferase—quantum dot bionanoconjugates

NASA Astrophysics Data System (ADS)

Alam, Rabeka; Karam, Liliana M.; Doane, Tennyson L.; Zylstra, Joshua; Fontaine, Danielle M.; Branchini, Bruce R.; Maye, Mathew M.

2014-12-01

The bioluminescence resonance energy transfer (BRET) between firefly luciferase enzymes and semiconductive quantum dots (QDs) with near infrared emission is described. The QD were phase transferred to aqueous buffers using a histidine mediated phase transfer route, and incubated with a hexahistidine tagged, green emitting variant of firefly luciferase from Photinus pyralis (PPyGRTS). The PPyGRTS were bound to the QD interface via the hexahistidine tag, which effectively displaces the histidine layer and binds directly to the QD interfaces, allowing for short donor-acceptor distances (˜5.5 nm). Due to this, high BRET efficiency ratios of ˜5 were obtained. These PPyGRTS-QD bio-nano conjugates were characterized by transmission electron microscopy, thermal gravimetric analysis, Fourier transform infrared spectroscopy and BRET emission studies. The final optimized conjugate was easily observable by night vision imaging, demonstrating the potential of these materials in imaging and signaling/sensing applications.

Firefly: A HOT camera core for thermal imagers with enhanced functionality

NASA Astrophysics Data System (ADS)

Pillans, Luke; Harmer, Jack; Edwards, Tim

2015-06-01

Raising the operating temperature of mercury cadmium telluride infrared detectors from 80K to above 160K creates new applications for high performance infrared imagers by vastly reducing the size, weight and power consumption of the integrated cryogenic cooler. Realizing the benefits of Higher Operating Temperature (HOT) requires a new kind of infrared camera core with the flexibility to address emerging applications in handheld, weapon mounted and UAV markets. This paper discusses the Firefly core developed to address these needs by Selex ES in Southampton UK. Firefly represents a fundamental redesign of the infrared signal chain reducing power consumption and providing compatibility with low cost, low power Commercial Off-The-Shelf (COTS) computing technology. This paper describes key innovations in this signal chain: a ROIC purpose built to minimize power consumption in the proximity electronics, GPU based image processing of infrared video, and a software customisable infrared core which can communicate wirelessly with other Battlespace systems.

Molecular descriptor subset selection in theoretical peptide quantitative structure-retention relationship model development using nature-inspired optimization algorithms.

PubMed

Žuvela, Petar; Liu, J Jay; Macur, Katarzyna; Bączek, Tomasz

2015-10-06

In this work, performance of five nature-inspired optimization algorithms, genetic algorithm (GA), particle swarm optimization (PSO), artificial bee colony (ABC), firefly algorithm (FA), and flower pollination algorithm (FPA), was compared in molecular descriptor selection for development of quantitative structure-retention relationship (QSRR) models for 83 peptides that originate from eight model proteins. The matrix with 423 descriptors was used as input, and QSRR models based on selected descriptors were built using partial least squares (PLS), whereas root mean square error of prediction (RMSEP) was used as a fitness function for their selection. Three performance criteria, prediction accuracy, computational cost, and the number of selected descriptors, were used to evaluate the developed QSRR models. The results show that all five variable selection methods outperform interval PLS (iPLS), sparse PLS (sPLS), and the full PLS model, whereas GA is superior because of its lowest computational cost and higher accuracy (RMSEP of 5.534%) with a smaller number of variables (nine descriptors). The GA-QSRR model was validated initially through Y-randomization. In addition, it was successfully validated with an external testing set out of 102 peptides originating from Bacillus subtilis proteomes (RMSEP of 22.030%). Its applicability domain was defined, from which it was evident that the developed GA-QSRR exhibited strong robustness. All the sources of the model's error were identified, thus allowing for further application of the developed methodology in proteomics.

Identification of Small Molecules Targeting the Posttranscriptional Control of ERG Expression

DTIC Science & Technology

2012-10-01

ied. To establish a cell line expressing lucife rase-ERG fusion protein, the vector along pRL-CMV-Rluc expressing Renilla luciferase gene was...expanded, and examined for the e xpression of t wo different luciferases. A clone expressing both Firefly luciferase and Renilla luciferase was selected...treated with the individual chemical at 10 μM for 24 h. The dual luciferase activities were measured. The ratio of Firefly to Renilla lu ciferase

A novel firefly luciferase biosensor enhances the detection of apoptosis induced by ESAT-6 family proteins of Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Junwei; Zhang, Huan; Fang, Liurong

Highlights: • We developed a novel firefly luciferase based biosensor to detect apoptosis. • The novel biosensor 233-DnaE-DEVDG was reliable, sensitive and convenient. • 233-DnaE-DEVDG faithfully indicated ESAT-6 family proteins of Mycobacterium tuberculosis induced apoptosis. • EsxA, esxT and esxL in ESAT-6 family proteins induced apoptosis. • Activation of nuclear factor-κB (NF-κB) participated in esxT-induced apoptosis. - Abstract: The activation of caspase-3 is a key surrogate marker for detecting apoptosis. To quantitate caspase-3 activity, we constructed a biosensor comprising a recombinant firefly luciferase containing a caspase-3 cleavage site. When apoptosis was induced, caspase-3 cleavage of the biosensor activated firefly luciferasemore » by a factor greater than 25. The assay conveniently detected apoptosis in real time, indicating that it will facilitate drug discovery. We screened ESAT-6 family proteins of Mycobacterium tuberculosis and found that esxA, esxT and esxL induced apoptosis. Further, activation of nuclear factor-κB (NF-κB) and the NF-κB-regulated genes encoding tumor necrosis factor-α (TNF-α) and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) participated in esxT-induced apoptosis. We conclude that this assay is useful for high-throughput screening to identify and characterize proteins and drugs that regulate apoptosis.« less

FIREFLY (Fitting IteRativEly For Likelihood analYsis): a full spectral fitting code

NASA Astrophysics Data System (ADS)

Wilkinson, David M.; Maraston, Claudia; Goddard, Daniel; Thomas, Daniel; Parikh, Taniya

2017-12-01

We present a new spectral fitting code, FIREFLY, for deriving the stellar population properties of stellar systems. FIREFLY is a chi-squared minimization fitting code that fits combinations of single-burst stellar population models to spectroscopic data, following an iterative best-fitting process controlled by the Bayesian information criterion. No priors are applied, rather all solutions within a statistical cut are retained with their weight. Moreover, no additive or multiplicative polynomials are employed to adjust the spectral shape. This fitting freedom is envisaged in order to map out the effect of intrinsic spectral energy distribution degeneracies, such as age, metallicity, dust reddening on galaxy properties, and to quantify the effect of varying input model components on such properties. Dust attenuation is included using a new procedure, which was tested on Integral Field Spectroscopic data in a previous paper. The fitting method is extensively tested with a comprehensive suite of mock galaxies, real galaxies from the Sloan Digital Sky Survey and Milky Way globular clusters. We also assess the robustness of the derived properties as a function of signal-to-noise ratio (S/N) and adopted wavelength range. We show that FIREFLY is able to recover age, metallicity, stellar mass, and even the star formation history remarkably well down to an S/N ∼ 5, for moderately dusty systems. Code and results are publicly available.1

The influence of the loop between residues 223-235 in beetle luciferase bioluminescence spectra: a solvent gate for the active site of pH-sensitive luciferases.

PubMed

Viviani, Vadim R; Silva Neto, Antonio J; Arnoldi, Frederico G C; Barbosa, João A R G; Ohmiya, Yoshihiro

2008-01-01

Beetle luciferases emit a wide range of bioluminescence colors, ranging from green to red. Firefly luciferases can shift the spectrum to red in response to pH and temperature changes, whereas click beetle and railroadworm luciferases do not. Despite many studies on firefly luciferases, the origin of pH-sensitivity is far from being understood. Through comparative site-directed mutagenesis and modeling studies, using the pH-sensitive luciferases (Macrolampis and Cratomorphus distinctus fireflies) and the pH-insensitive luciferases (Pyrearinus termitilluminans, Phrixotrix viviani and Phrixotrix hirtus) cloned by our group, here we show that substitutions dramatically affecting bioluminescence colors in both groups of luciferases are clustered in the loop between residues 223-235 (Photinus pyralis sequence). The substitutions at positions 227, 228 and 229 (P. pyralis sequence) cause dramatic redshift and temporal shift in both groups of luciferases, indicating their involvement in labile interactions. Modeling studies showed that the residues Y227 and N229 are buried in the protein core, fixing the loop to other structural elements participating at the bottom of the luciferin binding site. Changes in pH and temperature (in firefly luciferases), as well as point mutations in this loop, may disrupt the interactions of these structural elements exposing the active site and modulating bioluminescence colors.

Different Types of Luciferase Reporters Show Distinct Susceptibility to T3-Evoked Downregulation.

PubMed

Kollár, Anna; Kvárta-Papp, Zsuzsanna; Egri, Péter; Gereben, Balázs

2016-01-01

The firefly luciferase reporter protein is a crucial tool for studies targeting a broad range of biological questions. Importantly, luciferase assays are also widely used to explore mechanisms underlying thyroid hormone dependent regulation of gene expression. However, it was demonstrated that the firefly luciferase reporter is subject to triiodothyronine (T3)-evoked, promoter independent downregulation that is mediated by the thyroid hormone receptor. Since this effect can interfere with readout accuracy, the study aimed to find luciferase reporters that are not susceptible to this phenomenon. Luciferase reporter constructs were generated under the control of a minimal thymidine kinase (TK) promoter and transiently transfected into JEG-3 cells to test their activity upon T3 treatment. Activity of the TK-(dCpG)Luc encoding a synthetic (dCpG)Luciferase and TK-NanoLuc expressing the NanoLuc reporter was not significantly changed by T3 treatment while the firefly luciferase control was suppressed by ∼2.6-fold. T3 also downregulated the activity of Renilla luciferase by ∼30%. Novel types of luciferase reporters, especially the synthetic (dCpG)Luciferase, can be more accurate to study T3-regulated gene expression than the classical firefly luciferase reporter. Renilla luciferase, a popular transfection control of dual luciferase assays, should be used with caution in conditions with T3 treatment.

Regulation of AR and (beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2006-10-01

hrs. cells were harvested for Luciferase reporter Assay. C, CV-1 cells were transfected with Renilla (2.5ng), G5-Luc (10ng), pBIND-LBD (50ng), pACT-AR...stimulation, cells were cultured in 5 to 10% CDS-FBS. Firefly and internal control Renilla lucif- erase activities were determined using a dual luciferase...reporter assay kit (Pro- mega, Madison, WI), and Renilla activities were not consistently affected by any of the cotransfected vectors. The firefly

A Firefly-Inspired Method for Protein Structure Prediction in Lattice Models

PubMed Central

Maher, Brian; Albrecht, Andreas A.; Loomes, Martin; Yang, Xin-She; Steinhöfel, Kathleen

2014-01-01

We introduce a Firefly-inspired algorithmic approach for protein structure prediction over two different lattice models in three-dimensional space. In particular, we consider three-dimensional cubic and three-dimensional face-centred-cubic (FCC) lattices. The underlying energy models are the Hydrophobic-Polar (H-P) model, the Miyazawa–Jernigan (M-J) model and a related matrix model. The implementation of our approach is tested on ten H-P benchmark problems of a length of 48 and ten M-J benchmark problems of a length ranging from 48 until 61. The key complexity parameter we investigate is the total number of objective function evaluations required to achieve the optimum energy values for the H-P model or competitive results in comparison to published values for the M-J model. For H-P instances and cubic lattices, where data for comparison are available, we obtain an average speed-up over eight instances of 2.1, leaving out two extreme values (otherwise, 8.8). For six M-J instances, data for comparison are available for cubic lattices and runs with a population size of 100, where, a priori, the minimum free energy is a termination criterion. The average speed-up over four instances is 1.2 (leaving out two extreme values, otherwise 1.1), which is achieved for a population size of only eight instances. The present study is a test case with initial results for ad hoc parameter settings, with the aim of justifying future research on larger instances within lattice model settings, eventually leading to the ultimate goal of implementations for off-lattice models. PMID:24970205

A firefly-inspired method for protein structure prediction in lattice models.

PubMed

Maher, Brian; Albrecht, Andreas A; Loomes, Martin; Yang, Xin-She; Steinhöfel, Kathleen

2014-01-07

We introduce a Firefly-inspired algorithmic approach for protein structure prediction over two different lattice models in three-dimensional space. In particular, we consider three-dimensional cubic and three-dimensional face-centred-cubic (FCC) lattices. The underlying energy models are the Hydrophobic-Polar (H-P) model, the Miyazawa-Jernigan (M-J) model and a related matrix model. The implementation of our approach is tested on ten H-P benchmark problems of a length of 48 and ten M-J benchmark problems of a length ranging from 48 until 61. The key complexity parameter we investigate is the total number of objective function evaluations required to achieve the optimum energy values for the H-P model or competitive results in comparison to published values for the M-J model. For H-P instances and cubic lattices, where data for comparison are available, we obtain an average speed-up over eight instances of 2.1, leaving out two extreme values (otherwise, 8.8). For six M-J instances, data for comparison are available for cubic lattices and runs with a population size of 100, where, a priori, the minimum free energy is a termination criterion. The average speed-up over four instances is 1.2 (leaving out two extreme values, otherwise 1.1), which is achieved for a population size of only eight instances. The present study is a test case with initial results for ad hoc parameter settings, with the aim of justifying future research on larger instances within lattice model settings, eventually leading to the ultimate goal of implementations for off-lattice models.

Effects of Epigenetic Modulation on Reporter Gene Expression: Implications for Stem Cell Imaging

PubMed Central

Krishnan, Manickam; Park, Jinha M.; Cao, Feng; Wang, Dongxu; Paulmurugan, Ramasay; Tseng, Jeffrey R.; Gonzalgo, Mark L.; Gambhir, Sanjiv S.; Wu, Joseph C.

2013-01-01

Tracking stem cell localization, survival, differentiation, and proliferation following transplantation in living subjects is essential for understanding stem cell biology and physiology. In this study, we investigated the long-term stability of reporter gene expression in an embryonic rat cardiomyoblast cell line and the role of epigenetic modulation on reversing reporter gene silencing. Cells were stably transfected with plasmids carrying cytomegalovirus promoter driving firefly luciferase reporter gene (CMV-Fluc) and passaged repeatedly for 3–8 months. Within the highest expressor clone, the firefly luciferase activity decreased progressively from passage-1 (843±28) to passage-20 (250±10) to passage-40 (44±3) to passage-60 (3±1 RLU/µg) (P<0.05 vs. passage-1). Firefly luciferase activity was maximally rescued by treatment with 5-azacytidine (DNA methyltransferase inhibitor) compared to trichostatin A (histone deacetylase inhibitor) and retinoic acid (transcriptional activator) (P<0.05). Increasing dosages of 5-azacytidine treatment led to higher levels of firefly luciferase mRNA (RT-PCR) and protein (Western blots) and inversely lower levels of methylation in the CMV promoter (DNA nucleotide sequence). These in vitro results were extended to in vivo bioluminescence imaging (BLI) of cell transplant in living animals. Cells treated with 5-azacytidine were monitored for 2 weeks compared to 1 week for untreated cells (P<0.05). These findings should have important implications for reporter gene-based imaging of stem cell transplantation. PMID:16246867

Step-wise addition of disulfide bridge in firefly luciferase controls color shift through a flexible loop: a thermodynamic perspective.

PubMed

Nazari, Mahboobeh; Hosseinkhani, Saman; Hassani, Leila

2013-02-01

Multi-color bioluminescence is developed using the introduction of single/double disulfide bridges in firefly luciferase. The bioluminescence reaction, which uses luciferin, Mg(2+)-ATP and molecular oxygen to yield an electronically excited oxyluciferin, is carried out by the luciferase and emits visible light. The bioluminescence color of firefly luciferases is determined by the luciferase sequence and assay conditions. It has been proposed that the stability of a protein may increase through the introduction of a disulfide bridge that decreases the configurational entropy of unfolding. Single and double disulfide bridges are introduced into Photinus pyralis firefly luciferase to make separate mutant enzymes with a single/double bridge (C(81)-A(105)C, L(306)C-L(309)C, P(451)C-V(469)C; C(81)-A(105)C/P(451)C-V(469)C, and A(296)C-A(326)C/P(451)C-V(469)C). By introduction of disulfide bridges using site-directed mutagenesis in Photinus pyralis luciferase the color of emitted light was changed to red or kept in different extents. The bioluminescence color shift occurred with displacement of a critical loop in the luciferase structure without any change in green emitter mutants. Thermodynamic analysis revealed that among mutants, L(306)C-L(309)C shows a remarkable stability against urea denaturation and also a considerable increase in kinetic stability and a clear shift in bioluminescence spectra towards red.

Brominated Luciferins Are Versatile Bioluminescent Probes

DOE PAGES

Steinhardt, Rachel C.; Rathbun, Colin M.; Krull, Brandon T.; ...

2016-12-08

Here, we report a set of brominated luciferins for bioluminescence imaging. These regioisomeric scaffolds were accessed by using a common synthetic route. All analogues produced light with firefly luciferase, although varying levels of emission were observed. Differences in photon output were analyzed by computation and photophysical measurements. The brightest brominated luciferin was further evaluated in cell and animal models. At low doses, the analogue outperformed the native substrate in cells. The remaining luciferins, although weak emitters with firefly luciferase, were inherently capable of light production and thus potential substrates for orthogonal mutant enzymes.

AR-NcoR Interaction as a Therapeutic Target for Prostate Cancer Prevention and Treatment

DTIC Science & Technology

2005-10-01

mutant AR, VP16-NCoRc, ARE4-luciferase reporter, and control pRL-CMV ( Renilla ) reporter. They were then treated for 24 hrs with 10 nM DHT, 10 nM RU486...or no hormone. Firefly versus Renilla luciferase activities were measure from triplicate samples. Relative light units (RLU) reflect normalized...firefly/ Renilla (+SD). NCoR binding to the RU486 liganded AR is mediated by the C-terminal N1 CoRNR box in NCoR. As NCoR deletion mutants indicated

GAS-611 firefly in zero gravity

NASA Technical Reports Server (NTRS)

Williams, Tony

1988-01-01

The Get Away Special 611 (GAS-611) project will carry a small, self-contained biological experiment into a microgravity environment for a period of 120 hours. The payload will be a colony of Lampyridae (fireflies). The ability of this beetle to produce light with an efficiency of 98 pct will be evaluated in the micro-G environment. The chemical process that occurs could be assisted by the earth's gravitational pull and the very complex tracheae system found within this species of beetle. The effects of microgravity on mating and beetle larvae will also be studied.

Quantum/molecular mechanics study of firefly bioluminescence on luciferase oxidative conformation

NASA Astrophysics Data System (ADS)

Pinto da Silva, Luís; Esteves da Silva, Joaquim C. G.

2014-07-01

This is the first report of a computational study of the color tuning mechanism of firefly bioluminescence, using the oxidative conformation of luciferase. The results of these calculations demonstrated that the electrostatic field generated by luciferase is fundamental both for the emission shift and efficiency. Further calculations indicated that a shift in emission is achieved by modulating the energy, at different degrees, of the emissive and ground states. These differences in energy modulation will then lead to changes in the energy gap between the states.

Space Weather Forecasting at the Joint Space Operations Center (JSpOC)

NASA Astrophysics Data System (ADS)

Nava, O.

2012-12-01

The Joint Space Operations Center (JSpOC) at Vandenberg Air Force Base is the command and control focal point for the operational employment of worldwide joint space forces. The JSpOC focuses on planning and executing US Strategic Command's Joint Functional Component Command for Space (JFCC SPACE) mission. Through the JSpOC, the Weather Specialty Team (WST) monitors space and terrestrial weather effects, plans and assesses weather impacts on military operations, and provides reach-back support for deployed theater solar and terrestrial needs. This presentation will detail how space weather affects the JSpOC mission set and how the scientific community can enhance the WST's capabilities and effectiveness.

Preclinical Evaluation of Robotic-Assisted Sentinel Lymph Node Fluorescence Imaging

PubMed Central

Liss, Michael A.; Farshchi-Heydari, Salman; Qin, Zhengtao; Hickey, Sean A.; Hall, David J.; Kane, Christopher J.; Vera, David R.

2015-01-01

An ideal substance to provide convenient and accurate targeting for sentinel lymph node (SLN) mapping during robotic-assisted surgery has yet to be found. We used an animal model to determine the ability of the FireFly camera system to detect fluorescent SLNs after administration of a dual-labeled molecular imaging agent. Methods We injected the footpads of New Zealand White rabbits with 1.7 or 8.4 nmol of tilmanocept labeled with 99mTc and a near-infrared fluorophore, IRDye800CW. One and 36 h after injection, popliteal lymph nodes, representing the SLNs, were dissected with the assistance of the FireFly camera system, a fluorescence-capable endoscopic imaging system. After excision of the paraaortic lymph nodes, which represented non-SLNs, we assayed all lymph nodes for radioactivity and fluorescence intensity. Results Fluorescence within all popliteal lymph nodes was easily detected by the FireFly camera system. Fluorescence within the lymph channel could be imaged during the 1-h studies. When compared with the paraaortic lymph nodes, the popliteal lymph nodes retain greater than 95% of the radioactivity at both 1 and 36 h after injection. At both doses (1.7 and 8.4 nmol), the popliteal nodes had higher (P < 0.050) optical fluorescence intensity than the paraaortic nodes at the 1- and 36-h time points. Conclusion The FireFly camera system can easily detect tilmanocept labeled with a near-infrared fluorophore at least 36 h after administration. This ability will permit image acquisition and subsequent verification of fluorescence-labeled SLNs during robotic-assisted surgery. PMID:25024425

Preclinical evaluation of robotic-assisted sentinel lymph node fluorescence imaging.

PubMed

Liss, Michael A; Farshchi-Heydari, Salman; Qin, Zhengtao; Hickey, Sean A; Hall, David J; Kane, Christopher J; Vera, David R

2014-09-01

An ideal substance to provide convenient and accurate targeting for sentinel lymph node (SLN) mapping during robotic-assisted surgery has yet to be found. We used an animal model to determine the ability of the FireFly camera system to detect fluorescent SLNs after administration of a dual-labeled molecular imaging agent. We injected the footpads of New Zealand White rabbits with 1.7 or 8.4 nmol of tilmanocept labeled with (99m)Tc and a near-infrared fluorophore, IRDye800CW. One and 36 h after injection, popliteal lymph nodes, representing the SLNs, were dissected with the assistance of the FireFly camera system, a fluorescence-capable endoscopic imaging system. After excision of the paraaortic lymph nodes, which represented non-SLNs, we assayed all lymph nodes for radioactivity and fluorescence intensity. Fluorescence within all popliteal lymph nodes was easily detected by the FireFly camera system. Fluorescence within the lymph channel could be imaged during the 1-h studies. When compared with the paraaortic lymph nodes, the popliteal lymph nodes retain greater than 95% of the radioactivity at both 1 and 36 h after injection. At both doses (1.7 and 8.4 nmol), the popliteal nodes had higher (P < 0.050) optical fluorescence intensity than the paraaortic nodes at the 1- and 36-h time points. The FireFly camera system can easily detect tilmanocept labeled with a near-infrared fluorophore at least 36 h after administration. This ability will permit image acquisition and subsequent verification of fluorescence-labeled SLNs during robotic-assisted surgery. © 2014 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Towards a unified understanding of event-related changes in the EEG: the firefly model of synchronization through cross-frequency phase modulation.

PubMed

Burgess, Adrian P

2012-01-01

Although event-related potentials (ERPs) are widely used to study sensory, perceptual and cognitive processes, it remains unknown whether they are phase-locked signals superimposed upon the ongoing electroencephalogram (EEG) or result from phase-alignment of the EEG. Previous attempts to discriminate between these hypotheses have been unsuccessful but here a new test is presented based on the prediction that ERPs generated by phase-alignment will be associated with event-related changes in frequency whereas evoked-ERPs will not. Using empirical mode decomposition (EMD), which allows measurement of narrow-band changes in the EEG without predefining frequency bands, evidence was found for transient frequency slowing in recognition memory ERPs but not in simulated data derived from the evoked model. Furthermore, the timing of phase-alignment was frequency dependent with the earliest alignment occurring at high frequencies. Based on these findings, the Firefly model was developed, which proposes that both evoked and induced power changes derive from frequency-dependent phase-alignment of the ongoing EEG. Simulated data derived from the Firefly model provided a close match with empirical data and the model was able to account for i) the shape and timing of ERPs at different scalp sites, ii) the event-related desynchronization in alpha and synchronization in theta, and iii) changes in the power density spectrum from the pre-stimulus baseline to the post-stimulus period. The Firefly Model, therefore, provides not only a unifying account of event-related changes in the EEG but also a possible mechanism for cross-frequency information processing.

Towards a Unified Understanding of Event-Related Changes in the EEG: The Firefly Model of Synchronization through Cross-Frequency Phase Modulation

PubMed Central

Burgess, Adrian P.

2012-01-01

Although event-related potentials (ERPs) are widely used to study sensory, perceptual and cognitive processes, it remains unknown whether they are phase-locked signals superimposed upon the ongoing electroencephalogram (EEG) or result from phase-alignment of the EEG. Previous attempts to discriminate between these hypotheses have been unsuccessful but here a new test is presented based on the prediction that ERPs generated by phase-alignment will be associated with event-related changes in frequency whereas evoked-ERPs will not. Using empirical mode decomposition (EMD), which allows measurement of narrow-band changes in the EEG without predefining frequency bands, evidence was found for transient frequency slowing in recognition memory ERPs but not in simulated data derived from the evoked model. Furthermore, the timing of phase-alignment was frequency dependent with the earliest alignment occurring at high frequencies. Based on these findings, the Firefly model was developed, which proposes that both evoked and induced power changes derive from frequency-dependent phase-alignment of the ongoing EEG. Simulated data derived from the Firefly model provided a close match with empirical data and the model was able to account for i) the shape and timing of ERPs at different scalp sites, ii) the event-related desynchronization in alpha and synchronization in theta, and iii) changes in the power density spectrum from the pre-stimulus baseline to the post-stimulus period. The Firefly Model, therefore, provides not only a unifying account of event-related changes in the EEG but also a possible mechanism for cross-frequency information processing. PMID:23049827

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Ultrawidefield microscope for high-speed fluorescence imaging and targeted optogenetic stimulation.

PubMed

Werley, Christopher A; Chien, Miao-Ping; Cohen, Adam E

2017-12-01

The rapid increase in the number and quality of fluorescent reporters and optogenetic actuators has yielded a powerful set of tools for recording and controlling cellular state and function. To achieve the full benefit of these tools requires improved optical systems with high light collection efficiency, high spatial and temporal resolution, and patterned optical stimulation, in a wide field of view (FOV). Here we describe our 'Firefly' microscope, which achieves these goals in a Ø6 mm FOV. The Firefly optical system is optimized for simultaneous photostimulation and fluorescence imaging in cultured cells. All but one of the optical elements are commercially available, yet the microscope achieves 10-fold higher light collection efficiency at its design magnification than the comparable commercially available microscope using the same objective. The Firefly microscope enables all-optical electrophysiology ('Optopatch') in cultured neurons with a throughput and information content unmatched by other neuronal phenotyping systems. This capability opens possibilities in disease modeling and phenotypic drug screening. We also demonstrate applications of the system to voltage and calcium recordings in human induced pluripotent stem cell derived cardiomyocytes.

The evolution of adult light emission color in North American fireflies

PubMed Central

Hall, David W.; Sander, Sarah E.; Pallansch, Jennifer C.; Stanger-Hall, Kathrin F.

2016-01-01

Firefly species (Lampyridae) vary in the color of their adult bioluminescence. It has been hypothesized that color is selected to enhance detection by conspecifics. One mechanism to improve visibility of the signal is to increase contrast against ambient light. High contrast implies that fireflies active early in the evening will emit yellower luminescence to contrast against ambient light reflected from green vegetation, especially in habitats with high vegetation cover. Another mechanism to improve visibility is to use reflection off the background to enhance the light signal. Reflectance predicts that sedentary females will produce greener light to maximize reflection off the green vegetation on which they signal. To test these predictions, we recorded over 7500 light emission spectra and determined peak emission wavelength for 675 males, representing 24 species, at 57 field sites across the Eastern United States. We found support for both hypotheses: males active early in more vegetated habitats produced yellower flashes in comparison to later-active males with greener flashes. Further, in 2 of the 8 species with female data, female light emissions were significantly greener as compared to males. PMID:27412777

High-Performance AC Power Source by Applying Robust Stability Control Technology for Precision Material Machining

NASA Astrophysics Data System (ADS)

Chang, En-Chih

2018-02-01

This paper presents a high-performance AC power source by applying robust stability control technology for precision material machining (PMM). The proposed technology associates the benefits of finite-time convergent sliding function (FTCSF) and firefly optimization algorithm (FOA). The FTCSF maintains the robustness of conventional sliding mode, and simultaneously speeds up the convergence speed of the system state. Unfortunately, when a highly nonlinear loading is applied, the chatter will occur. The chatter results in high total harmonic distortion (THD) output voltage of AC power source, and even deteriorates the stability of PMM. The FOA is therefore used to remove the chatter, and the FTCSF still preserves finite system-state convergence time. By combining FTCSF with FOA, the AC power source of PMM can yield good steady-state and transient performance. Experimental results are performed in support of the proposed technology.

Robotic Low Ligation of the Inferior Mesenteric Artery for Rectal Cancer Using the Firefly Technique.

PubMed

Bae, Sung Uk; Min, Byung Soh; Kim, Nam Kyu

2015-07-01

By integrating intraoperative near infrared fluorescence imaging into a robotic system, surgeons can identify the vascular anatomy in real-time with the technical advantages of robotics that is useful for meticulous lymphovascular dissection. Herein, we report our initial experience of robotic low ligation of the inferior mesenteric artery (IMA) with real-time identification of the vascular system for rectal cancer using the Firefly technique. The study group included 11 patients who underwent a robotic total mesorectal excision with preservation of the left colic artery for rectal cancer using the Firefly technique between July 2013 and December 2013. The procedures included five low anterior resections and six ultra-low anterior resections with loop ileostomy. The median total operation time was 327 min (226-490). The low ligation time was 10 min (6-20), and the time interval between indocyanine green injection and division of the sigmoid artery was 5 min (2-8). The estimated blood loss was 200 mL (100-500). The median time to soft diet was 4 days (4-5), and the median length of stay was 7 days (5-9). Three patients developed postoperative complications; one patients developed anal stricture, one developed ileus, and one developed non-complicated intraabdominal fluid collection. The median total number of lymph nodes harvested was 17 (9-29). Robotic low ligation of the IMA with real-time identification of the vascular system for rectal cancer using the Firefly technique is safe and feasible. This technique can allow for precise lymph node dissection along the IMA and facilitate the identification of the left colic branch of the IMA.

Reporter enzyme inhibitor study to aid assembly of orthogonal reporter gene assays.

PubMed

Ho, Pei-i; Yue, Kimberley; Pandey, Pramod; Breault, Lyne; Harbinski, Fred; McBride, Aaron J; Webb, Brian; Narahari, Janaki; Karassina, Natasha; Wood, Keith V; Hill, Adam; Auld, Douglas S

2013-05-17

Reporter gene assays (RGAs) are commonly used to measure biological pathway modulation by small molecules. Understanding how such compounds interact with the reporter enzyme is critical to accurately interpret RGA results. To improve our understanding of reporter enzymes and to develop optimal RGA systems, we investigated eight reporter enzymes differing in brightness, emission spectrum, stability, and substrate requirements. These included common reporter enzymes such as firefly luciferase (Photinus pyralis), Renilla reniformis luciferase, and β-lactamase, as well as mutated forms of R. reniformis luciferase emitting either blue- or green-shifted luminescence, a red-light emitting form of Luciola cruciata firefly luciferase, a mutated form of Gaussia princeps luciferase, and a proprietary luciferase termed "NanoLuc" derived from the luminescent sea shrimp Oplophorus gracilirostris. To determine hit rates and structure-activity relationships, we screened a collection of 42,460 PubChem compounds at 10 μM using purified enzyme preparations. We then compared hit rates and chemotypes of actives for each enzyme. The hit rates ranged from <0.1% for β-lactamase to as high as 10% for mutated forms of Renilla luciferase. Related luciferases such as Renilla luciferase mutants showed high degrees of inhibitor overlap (40-70%), while unrelated luciferases such as firefly luciferases, Gaussia luciferase, and NanoLuc showed <10% overlap. Examination of representative inhibitors in cell-based assays revealed that inhibitor-based enzyme stabilization can lead to increases in bioluminescent signal for firefly luciferase, Renilla luciferase, and NanoLuc, with shorter half-life reporters showing increased activation responses. From this study we suggest strategies to improve the construction and interpretation of assays employing these reporter enzymes.

Performance comparisons between PCA-EA-LBG and PCA-LBG-EA approaches in VQ codebook generation for image compression

NASA Astrophysics Data System (ADS)

Tsai, Jinn-Tsong; Chou, Ping-Yi; Chou, Jyh-Horng

2015-11-01

The aim of this study is to generate vector quantisation (VQ) codebooks by integrating principle component analysis (PCA) algorithm, Linde-Buzo-Gray (LBG) algorithm, and evolutionary algorithms (EAs). The EAs include genetic algorithm (GA), particle swarm optimisation (PSO), honey bee mating optimisation (HBMO), and firefly algorithm (FF). The study is to provide performance comparisons between PCA-EA-LBG and PCA-LBG-EA approaches. The PCA-EA-LBG approaches contain PCA-GA-LBG, PCA-PSO-LBG, PCA-HBMO-LBG, and PCA-FF-LBG, while the PCA-LBG-EA approaches contain PCA-LBG, PCA-LBG-GA, PCA-LBG-PSO, PCA-LBG-HBMO, and PCA-LBG-FF. All training vectors of test images are grouped according to PCA. The PCA-EA-LBG used the vectors grouped by PCA as initial individuals, and the best solution gained by the EAs was given for LBG to discover a codebook. The PCA-LBG approach is to use the PCA to select vectors as initial individuals for LBG to find a codebook. The PCA-LBG-EA used the final result of PCA-LBG as an initial individual for EAs to find a codebook. The search schemes in PCA-EA-LBG first used global search and then applied local search skill, while in PCA-LBG-EA first used local search and then employed global search skill. The results verify that the PCA-EA-LBG indeed gain superior results compared to the PCA-LBG-EA, because the PCA-EA-LBG explores a global area to find a solution, and then exploits a better one from the local area of the solution. Furthermore the proposed PCA-EA-LBG approaches in designing VQ codebooks outperform existing approaches shown in the literature.

Caged ATP - an internal calibration method for ATP bioluminescence assays.

PubMed

Calvert, R M; Hopkins, H C; Reilly, M J; Forsythe, S J

2000-03-01

ATP bioluminescence, based on the firefly luciferase system, is used for the rapid determination of hygienic practices in the food industry. This study has demonstrated the use of caged ATP as an internal ATP standard and quantified the effects of industrial cleansing solutions, alcoholic beverages and pH on firefly luciferase activity. The light signal was quenched 6-47% by five cleansing solutions at standard working concentrations. Ethanol at 1% (v/v) inhibited bioluminescence by 15% (w/v) whereas concentrations above 4% enhanced the light output. The light signal was quenched by 20-25% at pH values below pH 4 and above pH 10.

Four new species of Luciuranus fireflies from the Brazilian Atlantic Rainforest (Coleoptera: Lampyridae).

PubMed

Silveira, Luiz F L da; Souto, Paula M; Mermudes, J R M

2018-04-20

Luciuranus Silveira, Khattar Mermudes, 2016 is a firefly genus whose species bear an intricate, species-specific lock-and-key mechanism of reproductive isolation. Here we propose four new species, Luciuranus magnoculus sp. nov., L. desideratus sp. nov., L. takiyae sp. nov. and L. carioca sp. nov., and provide illustrations of their diagnostic features and an updated key to species. As previously reported for their congenerics, each of the four new species have stereotypical morphology of both male and female terminalia, and are regarded as prima facie endemics of single massifs of the Serra da Mantiqueira and Serra do Mar, in the Brazilian Atlantic Rainforest.

Several methods for concentrating bacteria in fluid samples

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1976-01-01

The sensitivities of the firefly luciferase - ATP flow system and luminol flow system were established as 300,000 E. coli per milliliter and 10,000 E. coli per milliliter respectively. To achieve the detection limit of 1,000 bacteria per milliliter previously established, a method of concentrating microorganisms using a sartorius membrane filter system is investigated. Catalase in 50% ethanol is found to be a stable luminol standard and can be used up to 24 hours with only a 10% loss of activity. The luminol reagent is also stable over a 24 hour period. A method of preparing relatively inexpensive luciferase from desiccated firefly tails is developed.

Comparative theoretical study of the binding of luciferyl-adenylate and dehydroluciferyl-adenylate to firefly luciferase

NASA Astrophysics Data System (ADS)

Pinto da Silva, Luís; Vieira, João; Esteves da Silva, Joaquim C. G.

2012-08-01

This is the first report of a study employing a computational approach to study the binding of (D/L)-luciferyl-adenlyates and dehydroluciferyl-adenylate to firefly luciferase. A semi-empirical/molecular mechanics methodology was used to study the interaction between these ligands and active site molecules. All adenylates are complexed with the enzyme, mostly due to electrostatic interactions with cationic residues. Dehydroluciferyl-adenylate is expected to be a competitive inhibitor of luciferyl-adenylate, as their binding mechanism and affinity to luciferase are very similar. Both luciferyl-adenylates adopt the L-orientation in the active site of luciferase.

HABITAT EVALUATIONS OF AQUATIC CREATURES USING HSI MODEL CONSIDERING THE RIVER WATER TEMPERATURE

NASA Astrophysics Data System (ADS)

Nukazawa, Kei; Shiraiwa, Jun-Ichi; Kazama, So

Habitats of aquatic creatures (fishes Oncorhynchus masou masou, Plecoglossus altivelis altivel and Cyprinus carpio, fireflies Luciola cruciata and Luciola lateralis, and frogs Anura sp) in the Natori River basin located at the middle of Miyagi prefecture were evaluated dynamically using the water temperature as one of the environmental indices. HSI (Habitat Suitability Index) and WUA (Weighted Useable Area) of aquatic creatures were quantitatively calculated from numerical map information and hydrological simulation with a heat budget model. As results, general HSI of fireflies increased but of frogs decreased by adding the factor water temperature. Migration of Plecoglossus altivelis altivel could be represented by the variation of WUA.

Sound imaging of nocturnal animal calls in their natural habitat.

PubMed

Mizumoto, Takeshi; Aihara, Ikkyu; Otsuka, Takuma; Takeda, Ryu; Aihara, Kazuyuki; Okuno, Hiroshi G

2011-09-01

We present a novel method for imaging acoustic communication between nocturnal animals. Investigating the spatio-temporal calling behavior of nocturnal animals, e.g., frogs and crickets, has been difficult because of the need to distinguish many animals' calls in noisy environments without being able to see them. Our method visualizes the spatial and temporal dynamics using dozens of sound-to-light conversion devices (called "Firefly") and an off-the-shelf video camera. The Firefly, which consists of a microphone and a light emitting diode, emits light when it captures nearby sound. Deploying dozens of Fireflies in a target area, we record calls of multiple individuals through the video camera. We conduct two experiments, one indoors and the other in the field, using Japanese tree frogs (Hyla japonica). The indoor experiment demonstrates that our method correctly visualizes Japanese tree frogs' calling behavior. It has confirmed the known behavior; two frogs call synchronously or in anti-phase synchronization. The field experiment (in a rice paddy where Japanese tree frogs live) also visualizes the same calling behavior to confirm anti-phase synchronization in the field. Experimental results confirm that our method can visualize the calling behavior of nocturnal animals in their natural habitat.

A transgenic rat with ubiquitous expression of firefly luciferase gene

NASA Astrophysics Data System (ADS)

Hakamata, Yoji; Murakami, Takashi; Kobayashi, Eiji

2006-02-01

In vivo imaging strategies provide cellular and molecular events in real time that helps us to understand biological processes in living animals. The development of molecular tags such as green fluorescent proteins and luciferase from the firefly Photinus pyralis has lead to a revolution in the visualization of complex biochemical processes. We developed a novel inbred transgenic rat strain containing firefly luciferase based on the transgenic (Tg) technique in rats. This Tg rat expressed the luciferase gene ubiquitously under control of the ROSA26 promoter. Cellular immune responsiveness against the luciferase protein was evaluated using conventional skin grafting and resulted in the long-term acceptance of Tg rat skin on wild-type rats. Strikingly, organ transplant with heart and small bowel demonstrated organ viability and graft survival, suggesting that cells from luciferase-Tg are transplantable to track their fate. Taking advantage of the less immunogenic luciferase, we also tested the role of hepatocyte-infusion in a liver injury model, and bone marrow-derived cells in a skin defect model. Employed in conjunction with modern advances in optical imaging, this luciferase-Tg rat system provides an innovative animal tool and a new means of facilitating biomedical research such as in the case of regeneration medicine.

Firefly Luciferin-Inspired Biocompatible Chemistry for Protein Labeling and In Vivo Imaging.

PubMed

Wang, Yuqi; An, Ruibing; Luo, Zhiliang; Ye, Deju

2018-04-17

Biocompatible reactions have emerged as versatile tools to build various molecular imaging probes that hold great promise for the detection of biological processes in vitro and/or in vivo. In this Minireview, we describe the recent advances in the development of a firefly luciferin-inspired biocompatible reaction between cyanobenzothiazole (CBT) and cysteine (Cys), and highlight its versatility to label proteins and build multimodality molecular imaging probes. The review starts from the general introduction of biocompatible reactions, which is followed by briefly describing the development of the firefly luciferin-inspired biocompatible chemistry. We then discuss its applications for the specific protein labeling and for the development of multimodality imaging probes (fluorescence, bioluminescence, MRI, PET, photoacoustic, etc.) that enable high sensitivity and spatial resolution imaging of redox environment, furin and caspase-3/7 activity in living cells and mice. Finally, we offer the conclusions and our perspective on the various and potential applications of this reaction. We hope that this review will contribute to the research of biocompatible reactions for their versatile applications in protein labeling and molecular imaging. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The evolution of adult light emission color in North American fireflies.

PubMed

Hall, David W; Sander, Sarah E; Pallansch, Jennifer C; Stanger-Hall, Kathrin F

2016-09-01

Firefly species (Lampyridae) vary in the color of their adult bioluminescence. It has been hypothesized that color is selected to enhance detection by conspecifics. One mechanism to improve visibility of the signal is to increase contrast against ambient light. High contrast implies that fireflies active early in the evening will emit yellower luminescence to contrast against ambient light reflected from green vegetation, especially in habitats with high vegetation cover. Another mechanism to improve visibility is to use reflection off the background to enhance the light signal. Reflectance predicts that sedentary females will produce greener light to maximize reflection off the green vegetation on which they signal. To test these predictions, we recorded over 7500 light emission spectra and determined peak emission wavelength for 675 males, representing 24 species, at 57 field sites across the Eastern United States. We found support for both hypotheses: males active early in more vegetated habitats produced yellower flashes in comparison to later-active males with greener flashes. Further, in two of the eight species with female data, female light emissions were significantly greener as compared to males. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin.

PubMed

Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G; Corydon, Thomas J; Mikkelsen, Jacob Giehm; Aagaard, Lars

2015-08-01

Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo.

Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin

PubMed Central

Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G.; Corydon, Thomas J.; Mikkelsen, Jacob Giehm; Aagaard, Lars

2015-01-01

Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo. PMID:26204415

Biologically inspired LED lens from cuticular nanostructures of firefly lantern

PubMed Central

Kim, Jae-Jun; Lee, Youngseop; Kim, Ha Gon; Choi, Ki-Ju; Kweon, Hee-Seok; Park, Seongchong; Jeong, Ki-Hun

2012-01-01

Cuticular nanostructures found in insects effectively manage light for light polarization, structural color, or optical index matching within an ultrathin natural scale. These nanostructures are mainly dedicated to manage incoming light and recently inspired many imaging and display applications. A bioluminescent organ, such as a firefly lantern, helps to out-couple light from the body in a highly efficient fashion for delivering strong optical signals in sexual communication. However, the cuticular nanostructures, except the light-producing reactions, have not been well investigated for physical principles and engineering biomimetics. Here we report a unique observation of high-transmission nanostructures on a firefly lantern and its biological inspiration for highly efficient LED illumination. Both numerical and experimental results clearly reveal high transmission through the nanostructures inspired from the lantern cuticle. The nanostructures on an LED lens surface were fabricated by using a large-area nanotemplating and reconfigurable nanomolding with heat-induced shear thinning. The biologically inspired LED lens, distinct from a smooth surface lens, substantially increases light transmission over visible ranges, comparable to conventional antireflection coating. This biological inspiration can offer new opportunities for increasing the light extraction efficiency of high-power LED packages. PMID:23112185

Mutagenesis of solvent-exposed amino acids in Photinus pyralis luciferase improves thermostability and pH-tolerance

PubMed Central

Law, G. H. Erica; Gandelman, Olga A.; Tisi, Laurence C.; Lowe, Christopher R.; Murray, James A. H.

2006-01-01

Firefly luciferase catalyses a two-step reaction, using ATP-Mg2+, firefly luciferin and molecular oxygen as substrates, leading to the efficient emission of yellow–green light. We report the identification of novel luciferase mutants which combine improved pH-tolerance and thermostability and that retain the specific activity of the wild-type enzyme. These were identified by the mutagenesis of solvent-exposed non-conserved hydrophobic amino acids to hydrophilic residues in Photinus pyralis firefly luciferase followed by in vivo activity screening. Mutants F14R, L35Q, V182K, I232K and F465R were found to be the preferred substitutions at the respective positions. The effects of these amino acid replacements are additive, since combination of the five substitutions produced an enzyme with greatly improved pH-tolerance and stability up to 45 °C. All mutants, including the mutant with all five substitutions, showed neither a decrease in specific activity relative to the recombinant wild-type enzyme, nor any substantial differences in kinetic constants. It is envisaged that the combined mutant will be superior to wild-type luciferase for many in vitro and in vivo applications. PMID:16551268

Impossibility of asymptotic synchronization for pulse-coupled oscillators with delayed excitatory coupling.

PubMed

Wu, Wei; Chen, Tianping

2009-12-01

Fireflies, as one of the most spectacular examples of synchronization in nature, have been investigated widely. In 1990, Mirollo and Strogatz proposed a pulse-coupled oscillator model to explain the synchronization of South East Asian fireflies (Pteroptyx malaccae). However, transmission delays were not considered in their model. In fact, when transmission delays are introduced, the dynamic behaviors of pulse-coupled networks change a lot. In this paper, pulse-coupled oscillator networks with delayed excitatory coupling are studied. A concept of synchronization, named weak asymptotic synchronization, which is weaker than asymptotic synchronization, is proposed. We prove that for pulse-coupled oscillator networks with delayed excitatory coupling, weak asymptotic synchronization cannot occur.

Gross anatomy of central nervous system in firefly, Pteroptyx tener (Coleoptera: Lampyridae)

NASA Astrophysics Data System (ADS)

Hudawiyah, Nur; Wahida, O. Nurul; Norela, S.

2015-09-01

This paper describes for the first time the organization and fine structure of the central nervous system (CNS) in the fireflies, Pteroptyx tener (Coleoptera: Lampyridae). The morphology of the CNS was examined by using Carl Zeiss AxioScope A1 photomicroscope with iSolution Lite software. Some specific structural features such as the localization of protocerebrum, deutocerebrum and tritocerebrum in the brain region were analyzed. Other than that, the nerve cord and its peripheral structure were also analyzed. This study suggests that, there is a very obvious difference between male and female central nervous system which illustrates that they may differ in function in controlling physiological and behavioral activities.

Creation of High Efficient Firefly Luciferase

NASA Astrophysics Data System (ADS)

Nakatsu, Toru

Firefly emits visible yellow-green light. The bioluminescence reaction is carried out by the enzyme luciferase. The bioluminescence of luciferase is widely used as an excellent tool for monitoring gene expression, the measurement of the amount of ATP and in vivo imaging. Recently a study of the cancer metastasis is carried out by in vivo luminescence imaging system, because luminescence imaging is less toxic and more useful for long-term assay than fluorescence imaging by GFP. However the luminescence is much dimmer than fluorescence. Then bioluminescence imaging in living organisms demands the high efficient luciferase which emits near infrared lights or enhances the emission intensity. Here I introduce an idea for creating the high efficient luciferase based on the crystal structure.

Use of near infrared fluorescence during robot-assisted laparoscopic partial nephrectomy.

PubMed

Cornejo-Dávila, V; Nazmy, M; Kella, N; Palmeros-Rodríguez, M A; Morales-Montor, J G; Pacheco-Gahbler, C

2016-04-01

Partial nephrectomy is the treatment of choice for T1a tumours. The open approach is still the standard method. Robot-assisted laparoscopic surgery offers advantages that are applicable to partial nephrectomy, such as the use of the Firefly® system with near-infrared fluorescence. To demonstrate the implementation of fluorescence in nephron-sparing surgery. This case concerned a 37-year-old female smoker, with obesity. The patient had a right kidney tumour measuring 31 mm, which was found using tomography. She therefore underwent robot-assisted laparoscopic partial nephrectomy, with a warm ischaemia time of 22 minutes and the use of fluorescence with the Firefly® system to guide the resection. There were no complications. The tumour was a pT1aN0M0 renal cell carcinoma, with negative margins. Robot-assisted renal laparoscopic surgery is employed for nephron-sparing surgery, with good oncological and functional results. The combination of the Firefly® technology and intraoperative ultrasound can more accurately delimit the extent of the lesion, increase the negative margins and decrease the ischaemia time. Near-infrared fluorescence in robot-assisted partial nephrectomy is useful for guiding the tumour resection and can potentially improve the oncological and functional results. Copyright © 2015 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

Visual Servoing for an Autonomous Hexarotor Using a Neural Network Based PID Controller.

PubMed

Lopez-Franco, Carlos; Gomez-Avila, Javier; Alanis, Alma Y; Arana-Daniel, Nancy; Villaseñor, Carlos

2017-08-12

In recent years, unmanned aerial vehicles (UAVs) have gained significant attention. However, we face two major drawbacks when working with UAVs: high nonlinearities and unknown position in 3D space since it is not provided with on-board sensors that can measure its position with respect to a global coordinate system. In this paper, we present a real-time implementation of a servo control, integrating vision sensors, with a neural proportional integral derivative (PID), in order to develop an hexarotor image based visual servo control (IBVS) that knows the position of the robot by using a velocity vector as a reference to control the hexarotor position. This integration requires a tight coordination between control algorithms, models of the system to be controlled, sensors, hardware and software platforms and well-defined interfaces, to allow the real-time implementation, as well as the design of different processing stages with their respective communication architecture. All of these issues and others provoke the idea that real-time implementations can be considered as a difficult task. For the purpose of showing the effectiveness of the sensor integration and control algorithm to address these issues on a high nonlinear system with noisy sensors as cameras, experiments were performed on the Asctec Firefly on-board computer, including both simulation and experimenta results.

Visual Servoing for an Autonomous Hexarotor Using a Neural Network Based PID Controller

PubMed Central

Lopez-Franco, Carlos; Alanis, Alma Y.; Arana-Daniel, Nancy; Villaseñor, Carlos

2017-01-01

In recent years, unmanned aerial vehicles (UAVs) have gained significant attention. However, we face two major drawbacks when working with UAVs: high nonlinearities and unknown position in 3D space since it is not provided with on-board sensors that can measure its position with respect to a global coordinate system. In this paper, we present a real-time implementation of a servo control, integrating vision sensors, with a neural proportional integral derivative (PID), in order to develop an hexarotor image based visual servo control (IBVS) that knows the position of the robot by using a velocity vector as a reference to control the hexarotor position. This integration requires a tight coordination between control algorithms, models of the system to be controlled, sensors, hardware and software platforms and well-defined interfaces, to allow the real-time implementation, as well as the design of different processing stages with their respective communication architecture. All of these issues and others provoke the idea that real-time implementations can be considered as a difficult task. For the purpose of showing the effectiveness of the sensor integration and control algorithm to address these issues on a high nonlinear system with noisy sensors as cameras, experiments were performed on the Asctec Firefly on-board computer, including both simulation and experimenta results. PMID:28805689

Proton mediated control of biochemical reactions with bioelectronic pH modulation

NASA Astrophysics Data System (ADS)

Deng, Yingxin; Miyake, Takeo; Keene, Scott; Josberger, Erik E.; Rolandi, Marco

2016-04-01

In Nature, protons (H+) can mediate metabolic process through enzymatic reactions. Examples include glucose oxidation with glucose dehydrogenase to regulate blood glucose level, alcohol dissolution into carboxylic acid through alcohol dehydrogenase, and voltage-regulated H+ channels activating bioluminescence in firefly and jellyfish. Artificial devices that control H+ currents and H+ concentration (pH) are able to actively influence biochemical processes. Here, we demonstrate a biotransducer that monitors and actively regulates pH-responsive enzymatic reactions by monitoring and controlling the flow of H+ between PdHx contacts and solution. The present transducer records bistable pH modulation from an “enzymatic flip-flop” circuit that comprises glucose dehydrogenase and alcohol dehydrogenase. The transducer also controls bioluminescence from firefly luciferase by affecting solution pH.

Robust red-emission spectra and yields in firefly bioluminescence against temperature changes

NASA Astrophysics Data System (ADS)

Mochizuki, Toshimitsu; Wang, Yu; Hiyama, Miyabi; Akiyama, Hidefumi

2014-05-01

We measured the quantitative spectra of firefly (Photinus pyralis) bioluminescence at various temperatures to investigate the temperature dependence of the luciferin-luciferase reaction at 15-34 °C. The quantitative spectra were decomposed very well into red (1.9 eV), orange (2.0 eV), and green (2.2 eV) Gaussian components. The intensity of the green component was the only temperature sensitive quantity that linearly decreased as the temperature increased at pH 7 and 8. We found the quantitative bioluminescence spectra to be robust below 2.0 eV against temperature and other experimental conditions. The revealed robustness of the red emissions should be useful for quantitative applications such as adenosine-5'-triphosphate detection.

Design and feasibility study for a portable oil recovery turbopump

NASA Technical Reports Server (NTRS)

1982-01-01

A portable oil recovery turbopump concept, using the Firefly module as primer mover, for the offloading of distressed tank vessels is examined. The demands to be met both in terms of the type of petroleum to be offloaded, as well as the operational requirements placed on the pump, are studied with respect to the capability of different pump configurations. Two configurations, one a centrifugal type and the other a screw type pump, are developed and evaluated. While the centrifugal configuration is found to be effective in a large proportion of tank vessel offloading situations, the screw type will be required where high viscosity cargoes are involved. The feasibility of the turbopump concept, with the Firefly module as prime mover, is established.

In vivo quantitative bioluminescence tomography using heterogeneous and homogeneous mouse models.

PubMed

Liu, Junting; Wang, Yabin; Qu, Xiaochao; Li, Xiangsi; Ma, Xiaopeng; Han, Runqiang; Hu, Zhenhua; Chen, Xueli; Sun, Dongdong; Zhang, Rongqing; Chen, Duofang; Chen, Dan; Chen, Xiaoyuan; Liang, Jimin; Cao, Feng; Tian, Jie

2010-06-07

Bioluminescence tomography (BLT) is a new optical molecular imaging modality, which can monitor both physiological and pathological processes by using bioluminescent light-emitting probes in small living animal. Especially, this technology possesses great potential in drug development, early detection, and therapy monitoring in preclinical settings. In the present study, we developed a dual modality BLT prototype system with Micro-computed tomography (MicroCT) registration approach, and improved the quantitative reconstruction algorithm based on adaptive hp finite element method (hp-FEM). Detailed comparisons of source reconstruction between the heterogeneous and homogeneous mouse models were performed. The models include mice with implanted luminescence source and tumor-bearing mice with firefly luciferase report gene. Our data suggest that the reconstruction based on heterogeneous mouse model is more accurate in localization and quantification than the homogeneous mouse model with appropriate optical parameters and that BLT allows super-early tumor detection in vivo based on tomographic reconstruction of heterogeneous mouse model signal.

Efficient Stochastic Rendering of Static and Animated Volumes Using Visibility Sweeps.

PubMed

von Radziewsky, Philipp; Kroes, Thomas; Eisemann, Martin; Eisemann, Elmar

2017-09-01

Stochastically solving the rendering integral (particularly visibility) is the de-facto standard for physically-based light transport but it is computationally expensive, especially when displaying heterogeneous volumetric data. In this work, we present efficient techniques to speed-up the rendering process via a novel visibility-estimation method in concert with an unbiased importance sampling (involving environmental lighting and visibility inside the volume), filtering, and update techniques for both static and animated scenes. Our major contributions include a progressive estimate of partial occlusions based on a fast sweeping-plane algorithm. These occlusions are stored in an octahedral representation, which can be conveniently transformed into a quadtree-based hierarchy suited for a joint importance sampling. Further, we propose sweep-space filtering, which suppresses the occurrence of fireflies and investigate different update schemes for animated scenes. Our technique is unbiased, requires little precomputation, is highly parallelizable, and is applicable to a various volume data sets, dynamic transfer functions, animated volumes and changing environmental lighting.

The Bioluminescence Resonance Energy Transfer from Firefly Luciferase to a Synthetic Dye and its Application for the Rapid Homogeneous Immunoassay of Progesterone.

PubMed

Smirnova, Daria V; Samsonova, Jeanne V; Ugarova, Natalia N

2016-01-01

The sensitive BRET system for the homogeneous immunoassay of a low-molecular weight antigen was developed using progesterone as an example. Two thermostable mutants of the Luciola mingrelica firefly luciferase (Luc)-the "red" mutant with λmax.em = 590 nm (RedLuc) and the "green" mutant with λmax.em = 550 nm (GreenLuc)-were tested as the donors. The water-soluble Alexa Fluor 610× (AF) dye was selected as the acceptor because its two absorption maxima, located at 550 and 610 nm, are close to the bioluminescence maxima of the GreenLuc and RedLuc, respectively. The methods for the synthesis of the luciferase-progesterone (Luc-Pg) conjugate and the conjugate of the dye and the polyclonal antiprogesterone antibody (AF-Ab) were developed. Both conjugates retained their functional properties, had high antigen-antibody binding activity, and demonstrated a high BRET signal. The homogeneous immunoassay system based on the BRET from the firefly luciferase to the synthetic dye was established to assay progesterone as a model antigen. Optimization of the assay conditions, the composition of the reaction mixture, and the concentrations of the donor and the acceptor made it possible to reach the minimum detectable progesterone concentration of 0.5 ng mL(-1) . © 2015 The American Society of Photobiology.

Absorption spectrum of the firefly luciferin anion isolated in vacuo.

PubMed

Støchkel, Kristian; Milne, Bruce F; Brøndsted Nielsen, Steen

2011-03-24

The excited-state physics of the firefly luciferin anion depends on its chemical environment, and it is therefore important to establish the intrinsic behavior of the bare ion. Here we report electronic absorption spectra of the anion isolated in vacuo obtained at an electrostatic ion storage ring and an accelerator mass spectrometer where ionic dissociation is monitored on a long time scale (from 33 μs and up to 3 ms) and on a short time scale (0-3 μs), respectively. In the ring experiment the yield of all neutrals (mainly CO(2)) as a function of wavelength was measured whereas in the single pass experiment, the abundance of daughter ions formed after loss of CO(2) was recorded to provide action spectra. We find maxima at 535 and 265 nm, and that the band shape is largely determined by the sampling time interval, which is due to the kinetics of the dissociation process. Calculations at the TD-B3LYP/TZVPP++ level predict maximum absorption at 533 and 275 nm for the carboxylate isomer in excellent agreement with the experimental findings. The phenolate isomer lies higher in energy by 0.22 eV, and also its absorption maximum is calculated to be at 463 nm, which is far away from the experimental value. Our data serve to benchmark future theoretical models for bioluminescence from fireflies.

Overview of Hazard Assessment and Emergency Planning Software of Use to RN First Responders

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waller, E; Millage, K; Blakely, W F

2008-08-26

There are numerous software tools available for field deployment, reach-back, training and planning use in the event of a radiological or nuclear (RN) terrorist event. Specialized software tools used by CBRNe responders can increase information available and the speed and accuracy of the response, thereby ensuring that radiation doses to responders, receivers, and the general public are kept as low as reasonably achievable. Software designed to provide health care providers with assistance in selecting appropriate countermeasures or therapeutic interventions in a timely fashion can improve the potential for positive patient outcome. This paper reviews various software applications of relevance tomore » radiological and nuclear (RN) events that are currently in use by first responders, emergency planners, medical receivers, and criminal investigators.« less

UK role 4 military infection services: past, present and future.

PubMed

Dufty, Ngozi E; Bailey, M S

2013-09-01

NATO describes 'Role 4' military medical services as those provided for the definitive care of patients who cannot be treated within a theatre of operations and these are usually located in a military force's country of origin and may include the involvement of civilian medical services. The UK Defence Medical Services have a proud history of developing and providing clinical services in infectious diseases and tropical medicine, sexual health and HIV medicine, and medical microbiology and virology. These UK Role 4 Military Infection Services have adapted well to recent overseas deployments, but new challenges will arise due to current military cutbacks and a greater diversity of contingency operations in the future. Further evidence-based development of these services will require leadership by military clinicians and improved communication and support for 'reach-back' services.

Design and analysis of tilt integral derivative controller with filter for load frequency control of multi-area interconnected power systems.

PubMed

Kumar Sahu, Rabindra; Panda, Sidhartha; Biswal, Ashutosh; Chandra Sekhar, G T

2016-03-01

In this paper, a novel Tilt Integral Derivative controller with Filter (TIDF) is proposed for Load Frequency Control (LFC) of multi-area power systems. Initially, a two-area power system is considered and the parameters of the TIDF controller are optimized using Differential Evolution (DE) algorithm employing an Integral of Time multiplied Absolute Error (ITAE) criterion. The superiority of the proposed approach is demonstrated by comparing the results with some recently published heuristic approaches such as Firefly Algorithm (FA), Genetic Algorithm (GA) and Particle Swarm Optimization (PSO) optimized PID controllers for the same interconnected power system. Investigations reveal that proposed TIDF controllers provide better dynamic response compared to PID controller in terms of minimum undershoots and settling times of frequency as well as tie-line power deviations following a disturbance. The proposed approach is also extended to two widely used three area test systems considering nonlinearities such as Generation Rate Constraint (GRC) and Governor Dead Band (GDB). To improve the performance of the system, a Thyristor Controlled Series Compensator (TCSC) is also considered and the performance of TIDF controller in presence of TCSC is investigated. It is observed that system performance improves with the inclusion of TCSC. Finally, sensitivity analysis is carried out to test the robustness of the proposed controller by varying the system parameters, operating condition and load pattern. It is observed that the proposed controllers are robust and perform satisfactorily with variations in operating condition, system parameters and load pattern. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Problem areas in the use of the firefly luciferase assay for bacterial detection

NASA Technical Reports Server (NTRS)

Picciolo, G. L.; Chappelle, E. W.; Knust, E. A.; Tuttle, S. A.; Curtis, C. A.

1975-01-01

By purifying the firefly luciferase extract and adding all necessary chemicals but ATP in excess, an assay for ATP was performed by measuring the amount of light produced when a sample containing soluble ATP is added to the luciferase reaction mixture. Instrumentation, applications, and basic characteristics of the luciferase assay are presented. Effect of the growth medium and length of time grown in this medium on ATP per viable E. coli values is shown in graphic form, along with an ATP concentration curve showing relative light units versus ATP injected. Reagent functions and concentration methods are explored. Efforts to develop a fast automatable system to detect the presence of bacteria in biological fluids, especially urine, resulted in the optimization of procedures for use with different types of samples.

Quenching the firefly bioluminescence by various ions.

PubMed

Zhang, Huateng; Bai, Haixiu; Jiang, Tianyu; Ma, Zhao; Cheng, Yanna; Zhou, Yubin; Du, Lupei; Li, Minyong

2016-02-01

The luciferase reporter gene assay system is broadly applied in various biomedical aspects, including signaling pathway dissection, transcriptional activity analysis, and genetic toxicity testing. It significantly improves the experimental accuracy and reduces the experimental error by the addition of an internal control. In the current research, we discovered some specific ions that could selectively inhibit firefly luciferase while having a negligible effect on renilla luciferase in vitro in the dual-reporter gene assay. We showed that these ionic compounds had a high potential of being utilized as quench-and-activate reagents in the dual-reporter assay. Furthermore, results from kinetic studies on ion-mediated quenching effects indicated that different ions have distinct inhibition modes. Our study is anticipated to guide a more affordable design of quench-and-activate reagents in biomedicine and pharmaceutical analysis.

Proton mediated control of biochemical reactions with bioelectronic pH modulation

DOE PAGES

Deng, Yingxin; Miyake, Takeo; Keene, Scott; ...

2016-04-07

In Nature, protons (H +) can mediate metabolic process through enzymatic reactions. Examples include glucose oxidation with glucose dehydrogenase to regulate blood glucose level, alcohol dissolution into carboxylic acid through alcohol dehydrogenase, and voltage-regulated H + channels activating bioluminescence in firefly and jellyfish. Artificial devices that control H + currents and H + concentration (pH) are able to actively influence biochemical processes. Here, we demonstrate a biotransducer that monitors and actively regulates pH-responsive enzymatic reactions by monitoring and controlling the flow of H + between PdH x contacts and solution. The present transducer records bistable pH modulation from an “enzymaticmore » flip-flop” circuit that comprises glucose dehydrogenase and alcohol dehydrogenase. Furthermore, the transducer also controls bioluminescence from firefly luciferase by affecting solution pH.« less

Proton mediated control of biochemical reactions with bioelectronic pH modulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Yingxin; Miyake, Takeo; Keene, Scott

In Nature, protons (H +) can mediate metabolic process through enzymatic reactions. Examples include glucose oxidation with glucose dehydrogenase to regulate blood glucose level, alcohol dissolution into carboxylic acid through alcohol dehydrogenase, and voltage-regulated H + channels activating bioluminescence in firefly and jellyfish. Artificial devices that control H + currents and H + concentration (pH) are able to actively influence biochemical processes. Here, we demonstrate a biotransducer that monitors and actively regulates pH-responsive enzymatic reactions by monitoring and controlling the flow of H + between PdH x contacts and solution. The present transducer records bistable pH modulation from an “enzymaticmore » flip-flop” circuit that comprises glucose dehydrogenase and alcohol dehydrogenase. Furthermore, the transducer also controls bioluminescence from firefly luciferase by affecting solution pH.« less

Real time imaging of live cell ATP leaking or release events by chemiluminescence microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yun

The purpose of this research was to expand the chemiluminescence microscopy applications in live bacterial/mammalian cell imaging and to improve the detection sensitivity for ATP leaking or release events. We first demonstrated that chemiluminescence (CL) imaging can be used to interrogate single bacterial cells. While using a luminometer allows detecting ATP from cell lysate extracted from at least 10 bacterial cells, all previous cell CL detection never reached this sensitivity of single bacteria level. We approached this goal with a different strategy from before: instead of breaking bacterial cell membrane and trying to capture the transiently diluted ATP with themore » firefly luciferase CL assay, we introduced the firefly luciferase enzyme into bacteria using the modern genetic techniques and placed the CL reaction substrate D-luciferin outside the cells. By damaging the cell membrane with various antibacterial drugs including antibiotics such as Penicillins and bacteriophages, the D-luciferin molecules diffused inside the cell and initiated the reaction that produces CL light. As firefly luciferases are large protein molecules which are retained within the cells before the total rupture and intracellular ATP concentration is high at the millmolar level, the CL reaction of firefly luciferase, ATP and D-luciferin can be kept for a relatively long time within the cells acting as a reaction container to generate enough photons for detection by the extremely sensitive intensified charge coupled device (ICCD) camera. The result was inspiring as various single bacterium lysis and leakage events were monitored with 10-s temporal resolution movies. We also found a new way of enhancing diffusion D-luciferin into cells by dehydrating the bacteria. Then we started with this novel single bacterial CL imaging technique, and applied it for quantifying gene expression levels from individual bacterial cells. Previous published result in single cell gene expression quantification mainly used a fluorescence method; CL detection is limited because of the difficulty to introduce enough D-luciferin molecules. Since dehydration could easily cause proper size holes in bacterial cell membranes and facilitate D-luciferin diffusion, we used this method and recorded CL from individual cells each hour after induction. The CL light intensity from each individual cell was integrated and gene expression levels of two strain types were compared. Based on our calculation, the overall sensitivity of our system is already approaching the single enzyme level. The median enzyme number inside a single bacterium from the higher expression strain after 2 hours induction was quantified to be about 550 molecules. Finally we imaged ATP release from astrocyte cells. Upon mechanical stimulation, astrocyte cells respond by increasing intracellular Ca 2+ level and releasing ATP to extracellular spaces as signaling molecules. The ATP release imaged by direct CL imaging using free firefly luciferase and D-luciferin outside cells reflects the transient release as well as rapid ATP diffusion. Therefore ATP release detection at the cell surface is critical to study the ATP release mechanism and signaling propagation pathway. We realized this cell surface localized ATP release imaging detection by immobilizing firefly luciferase to streptavidin beads that attached to the cell surface via streptavidin-biotin interactions. Both intracellular Ca 2+ propagation wave and extracellular ATP propagation wave at the cell surface were recorded with fluorescence and CL respectively. The results imply that at close distances from the stimulation center (<120 μm) extracellular ATP pathway is faster, while at long distances (>120 μm) intracellular Ca 2+ signaling through gap junctions seems more effective.« less

75 FR 20933 - Airworthiness Directives; Arrow Falcon Exporters, Inc. (previously Utah State University...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-22

... Helicopter Services (previously Erickson Air-Crane Co.); Garlick Helicopters, Inc.; Global Helicopter... Forestry; Firefly Aviation Helicopter Services (previously Erickson Air-Crane Co.); Garlick Helicopters...

Immunocompetent Mouse Model for Tracking Cancer Progression | NCI Technology Transfer Center | TTC

Cancer.gov

The National Cancer Institute seeks licensees or research collaborators to develop and commercialize transgenic mice having immunocompetent rat growth hormone-firefly Luciferase-enhanced green fluorescent protein.

Analytical Applications of Bioluminescence and Chemiluminescence

NASA Technical Reports Server (NTRS)

Chappelle, E. W. (Editor); Picciolo, G. L. (Editor)

1975-01-01

Bioluminescence and chemiluminescence studies were used to measure the amount of adenosine triphosphate and therefore the amount of energy available. Firefly luciferase - luciferin enzyme system was emphasized. Photometer designs are also considered.

Field-deployable gamma-radiation detectors for DHS use

NASA Astrophysics Data System (ADS)

Mukhopadhyay, Sanjoy

2007-09-01

Recently, the Department of Homeland Security (DHS) has integrated all nuclear detection research, development, testing, evaluation, acquisition, and operational support into a single office: the Domestic Nuclear Detection Office (DNDO). The DNDO has specific requirements set for all commercial off-the-shelf and government off-the-shelf radiation detection equipment and data acquisition systems. This article would investigate several recent developments in field deployable gamma radiation detectors that are attempting to meet the DNDO specifications. Commercially available, transportable, handheld radio isotope identification devices (RIID) are inadequate for DHS' requirements in terms of sensitivity, resolution, response time, and reach-back capability. The leading commercial vendor manufacturing handheld gamma spectrometer in the United States is Thermo Electron Corporation. Thermo Electron's identiFINDER TM, which primarily uses sodium iodide crystals (3.18 x 2.54cm cylinders) as gamma detectors, has a Full-Width-at-Half-Maximum energy resolution of 7 percent at 662 keV. Thermo Electron has just recently come up with a reach-back capability patented as RadReachBack TM that enables emergency personnel to obtain real-time technical analysis of radiation samples they find in the field1. The current project has the goal to build a prototype handheld gamma spectrometer, equipped with a digital camera and an embedded cell phone to be used as an RIID with higher sensitivity, better resolution, and faster response time (able to detect the presence of gamma-emitting radio isotopes within 5 seconds of approach), which will make it useful as a field deployable tool. The handheld equipment continuously monitors the ambient gamma radiation, and, if it comes across any radiation anomalies with higher than normal gamma gross counts, it sets an alarm condition. When a substantial alarm level is reached, the system automatically triggers the saving of relevant spectral data and software-triggers the digital camera to take a snapshot. The spectral data including in situ analysis and the imagery data will be packaged in a suitable format and sent to a command post using an imbedded cell phone.

Footprints, Fireflies and Flight: Primary Science Magic.

ERIC Educational Resources Information Center

Fine, Edith H.; Josephson, Judith P.

1984-01-01

Provides primary grade level science activities that focus on insects, tracks and trails, water, and flight. For each topic, six major ideas plus related activities and suggestions about resources are given. (RH)

Starshade Test in Nevada

NASA Image and Video Library

2016-08-09

A test of a small-scale starshade model in a dry lake bed in central Nevada's Smith Creek by Northrup Grumman in May-June 2014. A telescope points toward a bright light, which mimics the conditions of starlight in space. Other lights, which are up to 10 million times fainter than the light source standing in for the star, represent the reflected light of planets. Telescopes searching for the relatively dim light of an exoplanet next to its much bright star are faced with a challenge as difficult as searching from Los Angeles for a firefly in New York– if the firefly is also beside a lighthouse. These tests determined that a starshade, or external occulter, is indeed capable of blocking starlight to a degree that reveals the light of a planet. http://photojournal.jpl.nasa.gov/catalog/PIA20908

SpyTag/SpyCatcher Cyclization Enhances the Thermostability of Firefly Luciferase

PubMed Central

Si, Meng; Xu, Qing

2016-01-01

SpyTag can spontaneously form a covalent isopeptide bond with its protein partner SpyCatcher. Firefly luciferase from Photinus pyralis was cyclized in vivo by fusing SpyCatcher at the N terminus and SpyTag at the C terminus. Circular LUC was more thermostable and alkali-tolerant than the wild type, without compromising the specific activity. Structural analysis indicated that the cyclized LUC increased the thermodynamic stability of the structure and remained more properly folded at high temperatures when compared with the wild type. We also prepared an N-terminally and C-terminally shortened form of the SpyCatcher protein and cyclization using this truncated form led to even more thermostability than the original form. Our findings suggest that cyclization with SpyTag and SpyCatcher is a promising and effective strategy to enhance thermostability of enzymes. PMID:27658030

A comparison of certain extracting agents for extraction of adenosine triphosphate (ATP) from microorganisms for use in the firefly luciferase ATP assay

NASA Technical Reports Server (NTRS)

Knust, E. A.; Chappelle, E. W.; Picciolo, G. L.

1975-01-01

Firefly luciferase ATP assay is used in clinical and industrial applications, such as determination of urinary infection levels, microbial susceptibility testing, and monitoring of yeast levels in beverages. Three categories of extractants were investigated for their extracting efficiency. They were ionizing organic solvents, nonionizing organic solvents, and inorganic acids. Dimethylsulfoxide and formamide represented the ionizing organic solvents, while n-butanol, chloroform, ethanol, acetone, and methylene chloride were used for the nonionizing organic solvents. Nitric acid and perchloric acid were chosen for the inorganic acids category. Pathogens were tested with each solvent. They included: Saccharomyces carlsbergensis, E. coli, Staphylococcus aureus, Klebsiella pneumoniae, Enterobacter species, Proteus mirabilis, Proteus vulgaris, Staphylococcus epidermidis, Streptococcus faecalis, Pseudomonas aeruginosa, and Candida albicans. These results are shown in graphic representations.

Next Generation Search Interfaces

NASA Astrophysics Data System (ADS)

Roby, W.; Wu, X.; Ly, L.; Goldina, T.

2015-09-01

Astronomers are constantly looking for easier ways to access multiple data sets. While much effort is spent on VO, little thought is given to the types of User Interfaces we need to effectively search this sort of data. For instance, an astronomer might need to search Spitzer, WISE, and 2MASS catalogs and images then see the results presented together in one UI. Moving seamlessly between data sets is key to presenting integrated results. Results need to be viewed using first class, web based, integrated FITS viewers, XY Plots, and advanced table display tools. These components should be able to handle very large datasets. To make a powerful Web based UI that can manage and present multiple searches to the user requires taking advantage of many HTML5 features. AJAX is used to start searches and present results. Push notifications (Server Sent Events) monitor background jobs. Canvas is required for advanced result displays. Lesser known CSS3 technologies makes it all flow seamlessly together. At IPAC, we have been developing our Firefly toolkit for several years. We are now using it to solve this multiple data set, multiple queries, and integrated presentation problem to create a powerful research experience. Firefly was created in IRSA, the NASA/IPAC Infrared Science Archive (http://irsa.ipac.caltech.edu). Firefly is the core for applications serving many project archives, including Spitzer, Planck, WISE, PTF, LSST and others. It is also used in IRSA's new Finder Chart and catalog and image displays.

Large-scale protein-protein interaction analysis in Arabidopsis mesophyll protoplasts by split firefly luciferase complementation.

PubMed

Li, Jian-Feng; Bush, Jenifer; Xiong, Yan; Li, Lei; McCormack, Matthew

2011-01-01

Protein-protein interactions (PPIs) constitute the regulatory network that coordinates diverse cellular functions. There are growing needs in plant research for creating protein interaction maps behind complex cellular processes and at a systems biology level. However, only a few approaches have been successfully used for large-scale surveys of PPIs in plants, each having advantages and disadvantages. Here we present split firefly luciferase complementation (SFLC) as a highly sensitive and noninvasive technique for in planta PPI investigation. In this assay, the separate halves of a firefly luciferase can come into close proximity and transiently restore its catalytic activity only when their fusion partners, namely the two proteins of interest, interact with each other. This assay was conferred with quantitativeness and high throughput potential when the Arabidopsis mesophyll protoplast system and a microplate luminometer were employed for protein expression and luciferase measurement, respectively. Using the SFLC assay, we could monitor the dynamics of rapamycin-induced and ascomycin-disrupted interaction between Arabidopsis FRB and human FKBP proteins in a near real-time manner. As a proof of concept for large-scale PPI survey, we further applied the SFLC assay to testing 132 binary PPIs among 8 auxin response factors (ARFs) and 12 Aux/IAA proteins from Arabidopsis. Our results demonstrated that the SFLC assay is ideal for in vivo quantitative PPI analysis in plant cells and is particularly powerful for large-scale binary PPI screens.

Starshade Night Test

NASA Image and Video Library

2016-08-09

A night test of a small-scale starshade model, in a dry lake bed in central Nevada's Smith Creek by Northrup Grumman, took place in May to June 2014. A telescope points toward a bright light, which in the darkness of the desert mimics the conditions of starlight in space. Other lights, which are up to 10 million times fainter than the light source standing in for the star, represent the reflected light of planets. Telescopes searching for the relatively dim light of an exoplanet next to its much brighter star are faced with a challenge as difficult as searching from Los Angeles for a firefly in New York -- if the firefly is next to the brightness of a lighthouse. The tests by Northrup Grumman determined that a starshade, or external occulter, is capable of blocking starlight to a degree that can indeed reveal the light of a planet. http://photojournal.jpl.nasa.gov/catalog/PIA20901

Particles Co-orbital to Janus and to Epimetheus: A Firefly Planetary Ring

NASA Astrophysics Data System (ADS)

Winter, Othon C.; Souza, Alexandre P. S.; Sfair, Rafael; Giuliatti Winter, Silvia M.; Mourão, Daniela C.; Foryta, Dietmar W.

2018-01-01

The Cassini spacecraft found a new and unique ring that shares the trajectory of Janus and Epimetheus, co-orbital satellites of Saturn. Performing image analysis, we found this to be a continuous ring. Its width is between 30% and 50% larger than previously announced. We also verified that the ring behaves like a firefly. It can only be seen from time to time, when Cassini, the ring, and the Sun are arranged in a particular geometric configuration, in very high phase angles. Otherwise, it remains “in the dark,” invisible to Cassini’s cameras. Through numerical simulations, we found a very short lifetime for the ring particles, less than a couple of decades. Consequently, the ring needs to be constantly replenished. Using a model of particle production due to micrometeorites impacts on the surfaces of Janus and Epimetheus, we reproduce the ring, explaining its existence and the “firefly” behavior.

Illuminating insights into firefly luciferase and other bioluminescent reporters used in chemical biology

PubMed Central

Thorne, Natasha; Inglese, James; Auld, Douglas S.

2010-01-01

Summary Understanding luciferase enzymology and the structure of compounds that modulate luciferase activity can be used to improve the design of luminescence-based assays. This review provides an overview of these popular reporters with an emphasis on the commonly used firefly luciferase from Photinus pyralis (FLuc). Large-scale chemical profile studies have identified a variety of scaffolds that inhibit FLuc. In some cell-based assays these inhibitors can act in a counter-intuitive way –leading to a gain in luminescent signal. Although formerly attributed to transcriptional activation, intracellular stabilization of FLuc is the primary mechanism underlying this observation. FLuc inhibition/stabilization can be complex, as illustrated by the compound PTC124, which is converted by FLuc in the presence of ATP to a high affinity multi-substrate-adduct inhibitor, PTC124-AMP. The potential influence these findings can have on drug discovery efforts is provided here. PMID:20609414

Posttranslationally caused bioluminescence burst of the Escherichia coli luciferase reporter strain.

PubMed

Ideguchi, Yamato; Oshikoshi, Yuta; Ryo, Masashi; Motoki, Shogo; Kuwano, Takashi; Tezuka, Takafumi; Aoki, Setsuyuki

2016-01-01

We continuously monitored bioluminescence from a wild-type reporter strain of Escherichia coli (lacp::luc+/WT), which carries the promoter of the lac operon (lacp) fused with the firefly luciferase gene (luc+). This strain showed a bioluminescence burst when shifted into the stationary growth phase. Bioluminescence profiles of other wild-type reporter strains (rpsPp::luc+ and argAp::luc+) and gene-deletion reporter strains (lacp::luc+/crp- and lacp::luc+/lacI-) indicate that transcriptional regulation is not responsible for generation of the burst. Consistently, changes in the luciferase protein levels did not recapitulate the profile of the burst. On the other hand, dissolved oxygen levels increased over the period across the burst, suggesting that the burst is, at least partially, caused by an increase in intracellular oxygen levels. We discuss limits of the firefly luciferase when used as a reporter for gene expression and its potential utility for monitoring metabolic changes in cells.

A potential role for imaging technology in anticancer efficacy evaluations.

PubMed

Hollingshead, M G; Bonomi, C A; Borgel, S D; Carter, J P; Shoemaker, R; Melillo, G; Sausville, E A

2004-04-01

The introduction of imaging methods suitable for rodents offers opportunities for new anticancer efficacy models. Traditional models do not provide the level of sensitivity afforded by these precise and quantitative techniques. Bioluminescent endpoints, now feasible because of sensitive charge-coupled device cameras, can be non-invasively detected in live animals. Currently, the most common luminescence endpoint is firefly luciferase, which, in the presence of O(2) and ATP, catalyses the cleavage of the substrate luciferin and results in the emission of a photon of light. In vivo implantation of tumour cells transfected with the luciferase gene allows sequential monitoring of tumour growth within the viscera by measuring these photon signals. Furthermore, tumour cell lines containing the luciferase gene transcribed from an inducible promoter offer opportunities to study molecular-target modulation without the need for ex vivo evaluations of serial tumour samples. In conjunction with this, transgenic mice bearing a luciferase reporter mechanism can be used to monitor the tumour microenvironment as well as to signal when transforming events occur. This technology has the potential to reshape the efficacy evaluations and drug-testing algorithms of the future.

River flow simulation using a multilayer perceptron-firefly algorithm model

NASA Astrophysics Data System (ADS)

Darbandi, Sabereh; Pourhosseini, Fatemeh Akhoni

2018-06-01

River flow estimation using records of past time series is importance in water resources engineering and management and is required in hydrologic studies. In the past two decades, the approaches based on the artificial neural networks (ANN) were developed. River flow modeling is a non-linear process and highly affected by the inputs to the modeling. In this study, the best input combination of the models was identified using the Gamma test then MLP-ANN and hybrid multilayer perceptron (MLP-FFA) is used to forecast monthly river flow for a set of time intervals using observed data. The measurements from three gauge at Ajichay watershed, East Azerbaijani, were used to train and test the models approach for the period from January 2004 to July 2016. Calibration and validation were performed within the same period for MLP-ANN and MLP-FFA models after the preparation of the required data. Statistics, the root mean square error and determination coefficient, are used to verify outputs from MLP-ANN to MLP-FFA models. The results show that MLP-FFA model is satisfactory for monthly river flow simulation in study area.

Inhibitory effects associated with use of modified Photinus pyralis and Renilla reniformis luciferase vectors in dual reporter assays and implications for analysis of ISGs.

PubMed

Ghazawi, Ibtisam; Cutler, Samuel J; Low, Pauline; Mellick, Albert S; Ralph, Stephen J

2005-02-01

Luciferase reporter constructs are widely used for analysis of gene regulation when characterizing promoter and enhancer elements. We report that the recently developed codon-modified Renilla luciferase construct included as an internal standard for cotransfection must be used with great caution with respect to the amount of DNA transfected. Also, the dual-luciferase reporter vectors encoding Photinus pyralis firefly or Renilla reniformis luciferase showed a linear increase in dose-response with increasing amounts of transfected DNA, but at higher levels of transfected DNA, a reduction in expressed levels of luciferase activity resulted. In addition, treatment with type I interferon (IFN) was found to significantly reduce levels of P. pyralis firefly and Renilla luciferase activity. In contrast, cells transfected with a green fluorescent protein (GFP) reporter construct showed no significant IFN-associated change. The reduction in luciferase activity resulting from IFN treatment was not due to IFN-mediated cytotoxicity, as no change in cellular propidium iodide (PI) staining was observed by flow cytometry. IFN treatment did not alter the levels of firefly luciferase activity in cell culture supernatants or the luciferase mRNA levels determined by quantitative real-time RT-PCR analysis. Based on these results, it is probable that the IFN-induced reduction in levels of luciferase activity detected in reporter assays occurs via a posttranscriptional mechanism. Thus, it is important to be aware of these complications when using luciferase reporter systems in general or for analyzing cytokine-mediated responsive regulation of target genes, particularly by the type I IFNs.

Molecular characterisation of four double-flowered mutants of Silene dioica representing four centuries of variation

PubMed Central

Ingle, Elizabeth K. S.; Gilmartin, Philip M.

2015-01-01

Records of double-flowered Silene dioica date from the late sixteenth century and four named varieties are grown today, as previously, for their horticultural interest. Although double-flowered mutants have been characterized in several plants, their study in dioecious species is of particular interest due to influences of the homeotic mutation on the different floral whorl configurations in males and females. We have analysed four double-flowered varieties of Silene dioica: Flore Pleno and Rosea Plena date back to the seventeenth and nineteenth centuries, Thelma Kay and Firefly were recognized in the latter part of the twentieth and early twenty-first centuries. We have analysed the floral structure of the four varieties, which have distinct floral architectures. Based on Y chromosome-specific PCR analysis we show that Firefly is male and that the other three varieties are female: Random Amplification of Polymorphic DNA (RAPD) analyses suggested a common origin for the three female varieties. The double-flowered phenotype in all four varieties is caused by mutation of the C-function MADS-box transcription factor gene SDM1. We show that Firefly carries a unique 44bp insertion into SDM1, revealing an independent origin for this variety. Comparative analysis of SDM1 cDNA and genomic sequences in Flore Pleno, Rosea Plena and Thelma Kay shows that all three are caused by the same 7bp insertion within SDM1 and therefore share a common origin. The three alleles also differ by several single nucleotide polymorphisms, which represent somatic mutations accumulated over four centuries of asexual propagation. PMID:25878355

Hsa-miR-195 targets PCMT1 in hepatocellular carcinoma that increases tumor life span.

PubMed

Amer, Marwa; Elhefnawi, M; El-Ahwany, Eman; Awad, A F; Gawad, Nermen Abdel; Zada, Suher; Tawab, F M Abdel

2014-11-01

MicroRNAs are small 19-25 nucleotides which have been shown to play important roles in the regulation of gene expression in many organisms. Downregulation or accumulation of miRNAs implies either tumor suppression or oncogenic activation. In this study, differentially expressed hsa-miR-195 in hepatocellular carcinoma (HCC) was identified and analyzed. The prediction was done using a consensus approach of tools. The validation steps were done at two different levels in silico and in vitro. FGF7, GHR, PCMT1, CITED2, PEX5, PEX13, NOVA1, AXIN2, and TSPYL2 were detected with high significant (P < 0.005). These genes are involved in important pathways in cancer like MAPK signaling pathway, Jak-STAT signaling pathways, regulation of actin cytoskeleton, angiogenesis, Wnt signaling pathway, and TGF-beta signaling pathway. In vitro target validation was done for protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1). The co-transfection of pmirGLO-PCMT1 and pEGP-miR-195 showed highly significant results. Firefly luciferase was detected using Lumiscensor and t test analysis was done. Firefly luciferase expression was significantly decreased (P < 0.001) in comparison to the control. The low expression of firefly luciferase validates the method of target prediction that we used in this work by working on PCMT1 as a target for miR-195. Furthermore, the rest of the predicted genes are suspected to be real targets for hsa-miR-195. These target genes control almost all the hallmarks of liver cancer which can be used as therapeutic targets in cancer treatment.

Shadow Bowl 2003: a collaborative exercise in community readiness, agency cooperation, and medical response.

PubMed

Balch, David; Taylor, Carl; Rosenthal, David; Bausch, Chris; Warner, Dave; Morris, Ray

2004-01-01

This paper describes a model for homeland security, community readiness, and medical response that was applied during an operational exercise around Super Bowl XXXVII. In addition, it describes the products provided by private companies involved in the exercise and how they would have contributed to a medical disaster had one occurred. The purpose of Shadow Bowl was to demonstrate community readiness and medical response to a mass casualty event. The goals of the project were to: (1) provide enhanced public safety using an advanced communication network and sensor grid; (2) develop mass casualty surge capabilities through medical reach-back; and (3) build a collaboration model between civilian, military, public, and private partners. The results of the Shadow Bowl Exercise accentuated the value of new telehealth and disaster medicine tools in treating large numbers of patients when infrastructure overload occurs.

THE ROLE OF THE CONSEQUENCE MANAGEMENT HOME TEAM IN THE FUKUSHIMA DAIICHI RESPONSE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pemberton, Wendy; Mena, RaJah; Beal, William

The Consequence Management Home Team is a U.S. Department of Energy/National Nuclear Security Administration asset. It assists a variety of response organizations with modeling; radiological operations planning; field monitoring techniques; and the analysis, interpretation, and distribution of radiological data. These reach-back capabilities are activated quickly to support public safety and minimize the social and economic impact of a nuclear or radiological incident. In the Fukushima Daiichi response, the Consequence Management Home Team grew to include a more broad range of support than was historically planned. From the early days of the response to the continuing involvement in supporting late phasemore » efforts, each stage of the Consequence Management Home Team support had distinct characteristics in terms of management of incoming data streams as well as creation of products. Regardless of stage, the Consequence Management Home Team played a critical role in the Fukushima Daiichi response effort.« less

Towards semi-automatic rock mass discontinuity orientation and set analysis from 3D point clouds

NASA Astrophysics Data System (ADS)

Guo, Jiateng; Liu, Shanjun; Zhang, Peina; Wu, Lixin; Zhou, Wenhui; Yu, Yinan

2017-06-01

Obtaining accurate information on rock mass discontinuities for deformation analysis and the evaluation of rock mass stability is important. Obtaining measurements for high and steep zones with the traditional compass method is difficult. Photogrammetry, three-dimensional (3D) laser scanning and other remote sensing methods have gradually become mainstream methods. In this study, a method that is based on a 3D point cloud is proposed to semi-automatically extract rock mass structural plane information. The original data are pre-treated prior to segmentation by removing outlier points. The next step is to segment the point cloud into different point subsets. Various parameters, such as the normal, dip/direction and dip, can be calculated for each point subset after obtaining the equation of the best fit plane for the relevant point subset. A cluster analysis (a point subset that satisfies some conditions and thus forms a cluster) is performed based on the normal vectors by introducing the firefly algorithm (FA) and the fuzzy c-means (FCM) algorithm. Finally, clusters that belong to the same discontinuity sets are merged and coloured for visualization purposes. A prototype system is developed based on this method to extract the points of the rock discontinuity from a 3D point cloud. A comparison with existing software shows that this method is feasible. This method can provide a reference for rock mechanics, 3D geological modelling and other related fields.

Laboratory procedures manual for the firefly luciferase assay for adenosine triphosphate (ATP)

NASA Technical Reports Server (NTRS)

Chappelle, E. W.; Picciolo, G. L.; Curtis, C. A.; Knust, E. A.; Nibley, D. A.; Vance, R. B.

1975-01-01

A manual on the procedures and instruments developed for the adenosine triphosphate (ATP) luciferase assay is presented. Data cover, laboratory maintenance, maintenance of bacterial cultures, bacteria measurement, reagents, luciferase procedures, and determination of microbal susceptibility to antibiotics.

21 CFR 864.7040 - Adenosine triphosphate release assay.

Code of Federal Regulations, 2014 CFR

2014-04-01

... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...

21 CFR 864.7040 - Adenosine triphosphate release assay.

Code of Federal Regulations, 2011 CFR

2011-04-01

... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...

21 CFR 864.7040 - Adenosine triphosphate release assay.

Code of Federal Regulations, 2013 CFR

2013-04-01

... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...

21 CFR 864.7040 - Adenosine triphosphate release assay.

Code of Federal Regulations, 2010 CFR

2010-04-01

... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...

21 CFR 864.7040 - Adenosine triphosphate release assay.

Code of Federal Regulations, 2012 CFR

2012-04-01

... device that measures the release of adenosine triphosphate (ATP) from platelets following aggregation. This measurement is made on platelet-rich plasma using a photometer and a luminescent firefly extract. Simultaneous measurements of platelet aggregation and ATP release are used to evaluate platelet function...

Protein sterilization method of firefly luciferase using reduced pressure and molecular sieves

NASA Technical Reports Server (NTRS)

Chappelle, E. W.; Rich, E., Jr. (Inventor)

1973-01-01

The sterilization of the protein fruitfly luciferase under conditions that prevent denaturation is examined. Denaturation is prevented by heating the protein in contact with molecular seives and under a reduced pressure of the order of 0.00005 millimeters of mercury.

Application of firefly luciferase assay for adenosine triphosphate (ATP) to antimicrobial drug sensitivity testing

NASA Technical Reports Server (NTRS)

Picciolo, G. L.; Tuttle, S. A.; Schrock, C. G.; Deming, J. W.; Barza, M. J.; Wienstein, L.; Chappelle, E. W.

1977-01-01

The development of a rapid method for determining microbial susceptibilities to antibiotics using the firefly luciferase assay for adenosine triphosphate (ATP) is documented. The reduction of bacterial ATP by an antimicrobial agent was determined to be a valid measure of drug effect in most cases. The effect of 12 antibiotics on 8 different bacterial species gave a 94 percent correlation with the standard Kirby-Buer-Agar disc diffusion method. A 93 percent correlation was obtained when the ATP assay method was applied directly to 50 urine specimens from patients with urinary tract infections. Urine samples were centrifuged first to that bacterial pellets could be suspended in broth. No primary isolation or subculturing was required. Mixed cultures in which one species was predominant gave accurate results for the most abundant organism. Since the method is based on an increase in bacterial ATP with time, the presence of leukocytes did not interfere with the interpretation of results. Both the incubation procedure and the ATP assays are compatible with automation.

Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong

PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less

Long Term Non-Invasive Imaging of Embryonic Stem Cells Using Reporter Genes

PubMed Central

Sun, Ning; Lee, Andrew; Wu, Joseph C.

2013-01-01

Development of non-invasive and accurate methods to track cell fate following delivery will greatly expedite transition of embryonic stem (ES) cell therapy to the clinic. Here we describe a protocol for the in vivo monitoring of stem cell survival, proliferation, and migration using reporter genes. We established stable ES cell lines constitutively expressing double fusion (DF; enhanced green fluorescent protein and firefly luciferase) or triple fusion (TF; monomeric red fluorescent protein, firefly luciferase, and herpes simplex virus thymidine kinase) reporter genes using lentiviral transduction. We used fluorescence activated cell sorting to purify these populations in vitro, bioluminescence imaging and positron emission tomography imaging to track them in vivo, and fluorescence immunostaining to confirm the results ex vivo. Unlike other methods of cell tracking such as iron particle and radionuclide labeling, reporter genes are inherited genetically and can be used to monitor cell proliferation and survival for the lifetime of transplanted cells and their progeny. PMID:19617890

First-principles investigation on Rydberg and resonance excitations: A case study of the firefly luciferin anion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noguchi, Yoshifumi, E-mail: y.noguchi@issp.u-tokyo.ac.jp; Hiyama, Miyabi; Akiyama, Hidefumi

2014-07-28

The optical properties of an isolated firefly luciferin anion are investigated by using first-principles calculations, employing the many-body perturbation theory to take into account the excitonic effect. The calculated photoabsorption spectra are compared with the results obtained using the time-dependent density functional theory (TDDFT) employing the localized atomic orbital (AO) basis sets and a recent experiment in vacuum. The present method well reproduces the line shape at the photon energy corresponding to the Rydberg and resonance excitations but overestimates the peak positions by about 0.5 eV. However, the TDDFT-calculated positions of some peaks are closer to those of the experiment.more » We also investigate the basis set dependency in describing the free electron states above vacuum level and the excitons involving the transitions to the free electron states and conclude that AO-only basis sets are inaccurate for free electron states and the use of a plane wave basis set is required.« less

Click beetle luciferase mutant and near infrared naphthyl-luciferins for improved bioluminescence imaging.

PubMed

Hall, Mary P; Woodroofe, Carolyn C; Wood, Monika G; Que, Ivo; Van't Root, Moniek; Ridwan, Yanto; Shi, Ce; Kirkland, Thomas A; Encell, Lance P; Wood, Keith V; Löwik, Clemens; Mezzanotte, Laura

2018-01-09

The sensitivity of bioluminescence imaging in animals is primarily dependent on the amount of photons emitted by the luciferase enzyme at wavelengths greater than 620 nm where tissue penetration is high. This area of work has been dominated by firefly luciferase and its substrate, D-luciferin, due to the system's peak emission (~ 600 nm), high signal to noise ratio, and generally favorable biodistribution of D-luciferin in mice. Here we report on the development of a codon optimized mutant of click beetle red luciferase that produces substantially more light output than firefly luciferase when the two enzymes are compared in transplanted cells within the skin of black fur mice or in deep brain. The mutant enzyme utilizes two new naphthyl-luciferin substrates to produce near infrared emission (730 nm and 743 nm). The stable luminescence signal and near infrared emission enable unprecedented sensitivity and accuracy for performing deep tissue multispectral tomography in mice.

Comparison of human optimized bacterial luciferase, firefly luciferase, and green fluorescent protein for continuous imaging of cell culture and animal models

NASA Astrophysics Data System (ADS)

Close, Dan M.; Hahn, Ruth E.; Patterson, Stacey S.; Baek, Seung J.; Ripp, Steven A.; Sayler, Gary S.

2011-04-01

Bioluminescent and fluorescent reporter systems have enabled the rapid and continued growth of the optical imaging field over the last two decades. Of particular interest has been noninvasive signal detection from mammalian tissues under both cell culture and whole animal settings. Here we report on the advantages and limitations of imaging using a recently introduced bacterial luciferase (lux) reporter system engineered for increased bioluminescent expression in the mammalian cellular environment. Comparison with the bioluminescent firefly luciferase (Luc) system and green fluorescent protein system under cell culture conditions demonstrated a reduced average radiance, but maintained a more constant level of bioluminescent output without the need for substrate addition or exogenous excitation to elicit the production of signal. Comparison with the Luc system following subcutaneous and intraperitoneal injection into nude mice hosts demonstrated the ability to obtain similar detection patterns with in vitro experiments at cell population sizes above 2.5 × 104 cells but at the cost of increasing overall image integration time.

Bug City: Ladybugs & Fireflies [Videotape].

ERIC Educational Resources Information Center

1998

"Bug City" is a video series created to help children (grades 1-6) learn about insects and other small critters. All aspects of bug life are touched upon, including body structure, food, habitat, life cycle, mating habits, camouflage, mutualism (symbiosis), adaptations, social behavior, and more. Each program features dramatic…

Fireflies in the Coalmine: Luciferase Technologies in Next-Generation Toxicity Testing

EPA Science Inventory

Whole-animal studies have been the mainstay of toxicity testing for decades. These approaches are too expensive and laborious to effectively characterize all of the chemicals currently in commercial use. In addition, there are social and ethical pressures to reduce, refine and re...

A new approach to the convective parameterization of the regional atmospheric model BRAMS

NASA Astrophysics Data System (ADS)

Dos Santos, A. F.; Freitas, S. R.; de Campos Velho, H. F.; Luz, E. F.; Gan, M. A.; de Mattos, J. Z.; Grell, G. A.

2013-05-01

The summer characteristics of January 2010 was performed using the atmospheric model Brazilian developments on the Regional Atmospheric Modeling System (BRAMS). The convective parameterization scheme of Grell and Dévényi was used to represent clouds and their interaction with the large scale environment. As a result, the precipitation forecasts can be combined in several ways, generating a numerical representation of precipitation and atmospheric heating and moistening rates. The purpose of this study was to generate a set of weights to compute a best combination of the hypothesis of the convective scheme. It is an inverse problem of parameter estimation and the problem is solved as an optimization problem. To minimize the difference between observed data and forecasted precipitation, the objective function was computed with the quadratic difference between five simulated precipitation fields and observation. The precipitation field estimated by the Tropical Rainfall Measuring Mission satellite was used as observed data. Weights were obtained using the firefly algorithm and the mass fluxes of each closure of the convective scheme were weighted generating a new set of mass fluxes. The results indicated the better skill of the model with the new methodology compared with the old ensemble mean calculation.

Parameter optimization of an inerter-based isolator for passive vibration control of Michelangelo's Rondanini Pietà

NASA Astrophysics Data System (ADS)

Siami, A.; Karimi, H. R.; Cigada, A.; Zappa, E.; Sabbioni, E.

2018-01-01

Preserving cultural heritage against earthquake and ambient vibrations can be an attractive topic in the field of vibration control. This paper proposes a passive vibration isolator methodology based on inerters for improving the performance of the isolation system of the famous statue of Michelangelo Buonarroti Pietà Rondanini. More specifically, a five-degree-of-freedom (5DOF) model of the statue and the anti-seismic and anti-vibration base is presented and experimentally validated. The parameters of this model are tuned according to the experimental tests performed on the assembly of the isolator and the structure. Then, the developed model is used to investigate the impact of actuation devices such as tuned mass-damper (TMD) and tuned mass-damper-inerter (TMDI) in vibration reduction of the structure. The effect of implementation of TMDI on the 5DOF model is shown based on physical limitations of the system parameters. Simulation results are provided to illustrate effectiveness of the passive element of TMDI in reduction of the vibration transmitted to the statue in vertical direction. Moreover, the optimal design parameters of the passive system such as frequency and damping coefficient will be calculated using two different performance indexes. The obtained optimal parameters have been evaluated by using two different optimization algorithms: the sequential quadratic programming method and the Firefly algorithm. The results prove significant reduction in the transmitted vibration to the structure in the presence of the proposed tuned TMDI, without imposing a large amount of mass or modification to the structure of the isolator.

A Genetic Approach to the Identification of Plant Genes Involved in Viral Movement

DTIC Science & Technology

1999-09-30

Arabidopsis.. We plan to create two transgenic plant lines of Arabidopsis, one that expresses the firefly luciferase (Luc) gene, and one that... transgenic plant lines that express Luc or CD upon infection with RCNMV. Phenotypically these lines will either be luminescent (Luc) or sensitive to 5

Automated detection of bacteria in urine

NASA Technical Reports Server (NTRS)

Fleig, A. J.; Picciolo, G. L.; Chappelle, E. W.; Kelbaugh, B. N.

1972-01-01

A method for detecting the presence of bacteria in urine was developed which utilizes the bioluminescent reaction of adenosine triphosphate with luciferin and luciferase derived from the tails of fireflies. The method was derived from work on extraterrestrial life detection. A device was developed which completely automates the assay process.

Tropical skin diseases in British military personnel.

PubMed

Bailey, Mark S

2013-09-01

Skin complaints are common in travellers to foreign countries and are responsible for up to 25% of medical consultations by military personnel during deployments in the tropics. They also have relatively high rates of field hospital admission, medical evacuation and referral to UK Role 4 healthcare facilities. Non-infectious tropical skin diseases include sunburn, heat rash, arthropod bites, venomous bites, contact dermatitis and phytophotodermatitis. During tropical deployments skin infections that commonly occur in military personnel may become more frequent, severe and difficult to treat. Several systemic tropical infections have cutaneous features that can be useful in making early diagnoses. Tropical skin infections such as cutaneous larva migrans, cutaneous myiasis, cutaneous leishmaniasis and leprosy do occur in British troops and require specialist clinical management. This illustrated review focuses on the most significant tropical skin diseases that have occurred in British military personnel in recent years. Clinical management of these conditions on deployments would be improved and medical evacuations could be reduced if a military dermatology 'reach-back' service (including a telemedicine facility) was available.

CLEMSON UNIVERSITY’S VANISHING FIREFLY PROJECT: USING A MOBILE PHONE APP AS EDUCATIONAL AND RESEARCH TOOLS FOR SUSTAINABILITY

EPA Science Inventory

This mobile phone app provides an opportunity for citizens to participate in community-based research project.  This unique hands-on experience will educate general public about the value of forest and natural ecosystems and the concept of sustainable development. The ...

Novel Cell-Based Assays for Detecting Low Levels of Active Ricin Following Decontamination

DTIC Science & Technology

2011-12-01

fluorescent protein, are powerful tools, which have been used for detection assays for ricin protein ( DeWet , 1987). Zhao et al. (2005) have reported a...toxic Type 2 Ribosome-Inactivating Proteins. FEBS Lett. 2004, 563, pp 219–222. DeWet , J.R. et al. Firefly Luciferase Gene: Structure and

Inhibition of Th17 Cell Differentiation as a Treatment for Multiple Sclerosis

DTIC Science & Technology

2012-10-01

sequence) using Lipofectamine . After 48 hours Dual Glo substrate was added to the cells and luciferase activity and Renilla Luciferase activity were...pmirGLO326 and pMR04 (encoding mir-326) using Lipofectamine . After 48 hours Dual Glo substrate was added to the cells and Firefly and Renilla

Geolocating thermal binoculars based on a software defined camera core incorporating HOT MCT grown by MOVPE

NASA Astrophysics Data System (ADS)

Pillans, Luke; Harmer, Jack; Edwards, Tim; Richardson, Lee

2016-05-01

Geolocation is the process of calculating a target position based on bearing and range relative to the known location of the observer. A high performance thermal imager with integrated geolocation functions is a powerful long range targeting device. Firefly is a software defined camera core incorporating a system-on-a-chip processor running the AndroidTM operating system. The processor has a range of industry standard serial interfaces which were used to interface to peripheral devices including a laser rangefinder and a digital magnetic compass. The core has built in Global Positioning System (GPS) which provides the third variable required for geolocation. The graphical capability of Firefly allowed flexibility in the design of the man-machine interface (MMI), so the finished system can give access to extensive functionality without appearing cumbersome or over-complicated to the user. This paper covers both the hardware and software design of the system, including how the camera core influenced the selection of peripheral hardware, and the MMI design process which incorporated user feedback at various stages.

Bioluminescent system for dynamic imaging of cell and animal behavior

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara-Miyauchi, Chikako; Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, Saitama 351-0198; Department of Biophysics and Biochemistry, Graduate School of Health Care Sciences, Tokyo Medical and Dental University, Tokyo 113-8510

2012-03-09

Highlights: Black-Right-Pointing-Pointer We combined a yellow variant of GFP and firefly luciferase to make ffLuc-cp156. Black-Right-Pointing-Pointer ffLuc-cp156 showed improved photon yield in cultured cells and transgenic mice. Black-Right-Pointing-Pointer ffLuc-cp156 enabled video-rate bioluminescence imaging of freely-moving animals. Black-Right-Pointing-Pointer ffLuc-cp156 mice enabled tracking real-time drug delivery in conscious animals. -- Abstract: The current utility of bioluminescence imaging is constrained by a low photon yield that limits temporal sensitivity. Here, we describe an imaging method that uses a chemiluminescent/fluorescent protein, ffLuc-cp156, which consists of a yellow variant of Aequorea GFP and firefly luciferase. We report an improvement in photon yield by over threemore » orders of magnitude over current bioluminescent systems. We imaged cellular movement at high resolution including neuronal growth cones and microglial cell protrusions. Transgenic ffLuc-cp156 mice enabled video-rate bioluminescence imaging of freely moving animals, which may provide a reliable assay for drug distribution in behaving animals for pre-clinical studies.« less

Modelling chemical reactions by QM/MM calculations: the case of the tautomerization in fireflies bioluminescent systems

NASA Astrophysics Data System (ADS)

Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

2018-04-01

In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modelling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.

Excited-state proton transfer dynamics of firefly's chromophore D-luciferin in DMSO-water binary mixture.

PubMed

Kuchlyan, Jagannath; Banik, Debasis; Roy, Arpita; Kundu, Niloy; Sarkar, Nilmoni

2014-12-04

In this article we have investigated intermolecular excited-state proton transfer (ESPT) of firefly's chromophore D-luciferin in DMSO-water binary mixtures using steady-state and time-resolved fluorescence spectroscopy. The unusual behavior of DMSO-water binary mixture as reported by Bagchi et al. (J. Phys. Chem. B 2010, 114, 12875-12882) was also found using D-luciferin as intermolecular ESPT probe. The binary mixture has given evidence of its anomalous nature at low mole fractions of DMSO (below XD = 0.4) in our systematic investigation. Upon excitation of neutral D-luciferin molecule, dual fluorescence emissions (protonated and deprotonated form) are observed in DMSO-water binary mixture. A clear isoemissive point in the time-resolved area normalized emission spectra further indicates two emissive species in the excited state of D-luciferin in DMSO-water binary mixture. DMSO-water binary mixtures of different compositions are fascinating hydrogen bonding systems. Therefore, we have observed unusual changes in the fluorescence emission intensity, fluorescence quantum yield, and fluorescence lifetime of more hydrogen bonding sensitive anionic form of D-luciferin in low DMSO content of DMSO-water binary mixture.

Ultrawidefield microscope for high-speed fluorescence imaging and targeted optogenetic stimulation

PubMed Central

Werley, Christopher A.; Chien, Miao-Ping; Cohen, Adam E.

2017-01-01

The rapid increase in the number and quality of fluorescent reporters and optogenetic actuators has yielded a powerful set of tools for recording and controlling cellular state and function. To achieve the full benefit of these tools requires improved optical systems with high light collection efficiency, high spatial and temporal resolution, and patterned optical stimulation, in a wide field of view (FOV). Here we describe our ‘Firefly’ microscope, which achieves these goals in a Ø6 mm FOV. The Firefly optical system is optimized for simultaneous photostimulation and fluorescence imaging in cultured cells. All but one of the optical elements are commercially available, yet the microscope achieves 10-fold higher light collection efficiency at its design magnification than the comparable commercially available microscope using the same objective. The Firefly microscope enables all-optical electrophysiology (‘Optopatch’) in cultured neurons with a throughput and information content unmatched by other neuronal phenotyping systems. This capability opens possibilities in disease modeling and phenotypic drug screening. We also demonstrate applications of the system to voltage and calcium recordings in human induced pluripotent stem cell derived cardiomyocytes. PMID:29296505

Modeling Chemical Reactions by QM/MM Calculations: The Case of the Tautomerization in Fireflies Bioluminescent Systems

PubMed Central

Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

2018-01-01

In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modeling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods. PMID:29719820

Modeling Chemical Reactions by QM/MM Calculations: The Case of the Tautomerization in Fireflies Bioluminescent Systems.

PubMed

Berraud-Pache, Romain; Garcia-Iriepa, Cristina; Navizet, Isabelle

2018-01-01

In less than half a century, the hybrid QM/MM method has become one of the most used technique to model molecules embedded in a complex environment. A well-known application of the QM/MM method is for biological systems. Nowadays, one can understand how enzymatic reactions work or compute spectroscopic properties, like the wavelength of emission. Here, we have tackled the issue of modeling chemical reactions inside proteins. We have studied a bioluminescent system, fireflies, and deciphered if a keto-enol tautomerization is possible inside the protein. The two tautomers are candidates to be the emissive molecule of the bioluminescence but no outcome has been reached. One hypothesis is to consider a possible keto-enol tautomerization to treat this issue, as it has been already observed in water. A joint approach combining extensive MD simulations as well as computation of key intermediates like TS using QM/MM calculations is presented in this publication. We also emphasize the procedure and difficulties met during this approach in order to give a guide for this kind of chemical reactions using QM/MM methods.

Interaction of firefly luciferase and silver nanoparticles and its impact on enzyme activity

NASA Astrophysics Data System (ADS)

Käkinen, Aleksandr; Ding, Feng; Chen, Pengyu; Mortimer, Monika; Kahru, Anne; Ke, Pu Chun

2013-08-01

We report on the dose-dependent inhibition of firefly luciferase activity induced by exposure of the enzyme to 20 nm citrate-coated silver nanoparticles (AgNPs). The inhibition mechanism was examined by characterizing the physicochemical properties and biophysical interactions of the enzyme and the AgNPs. Consistently, binding of the enzyme induced an increase in zeta potential from -22 to 6 mV for the AgNPs, triggered a red-shift of 44 nm in the absorbance peak of the AgNPs, and rendered a ‘protein corona’ of 20 nm in thickness on the nanoparticle surfaces. However, the secondary structures of the enzyme were only marginally affected upon formation of the protein corona, as verified by circular dichroism spectroscopy measurement and multiscale discrete molecular dynamics simulations. Rather, inductively coupled plasma mass spectrometry measurement revealed a significant ion release from the AgNPs. The released silver ions could readily react with the cysteine residues and N-groups of the enzyme to alter the physicochemical environment of their neighboring catalytic site and subsequently impair the enzymatic activity.

FT-IR, FT-Raman spectra and DFT calculations of melaminium perchlorate monohydrate

NASA Astrophysics Data System (ADS)

Kanagathara, N.; Marchewka, M. K.; Drozd, M.; Renganathan, N. G.; Gunasekaran, S.; Anbalagan, G.

2013-08-01

Melaminium perchlorate monohydrate (MPM), an organic material has been synthesized by slow solvent evaporation method at room temperature. Powder X-ray diffraction analysis confirms that MPM crystal belongs to triclinic system with space group P-1. FTIR and FT Raman spectra are recorded at room temperature. Functional group assignment has been made for the melaminium cations and perchlorate anions. Vibrational spectra have also been discussed on the basis of quantum chemical density functional theory (DFT) calculations using Firefly (PC GAMESS) version 7.1 G. Vibrational frequencies are calculated and scaled values are compared with experimental values. The assignment of the bands has been made on the basis of the calculated PED. The Mulliken charges, HOMO-LUMO orbital energies are analyzed directly from Firefly program log files and graphically illustrated. HOMO-LUMO energy gap and other related molecular properties are also calculated. The theoretically constructed FT-IR and FT-Raman spectra of MPM coincide with the experimental one. The chemical structure of the compound has been established by 1H and 13C NMR spectra. No detectable signal was observed during powder test for second harmonic generation.

Combined Partial Penectomy With Bilateral Robotic Inguinal Lymphadenectomy Using Near-infrared Fluorescence Guidance.

PubMed

Sávio, Luís Felipe; Panizzutti Barboza, Marcelo; Alameddine, Mahmoud; Ahdoot, Michael; Alonzo, David; Ritch, Chad R

2018-03-01

To describe our novel technique for performing a combined partial penectomy and bilateral robotic inguinal lymphadenectomy using intraoperative near-infrared (NIR) fluorescence guidance with indocyanine green (ICG) and the DaVinci Firefly camera system. A 58-year-old man presented status post recent excisional biopsy of a 2-cm lesion on the left coronal aspect of the glans penis. Pathology revealed "invasive squamous cell carcinoma of the penis with multifocal positive margins." His examination was suspicious for cT2 primary and his inguinal nodes were cN0. He was counseled to undergo partial penectomy with possible combined vs staged bilateral robotic inguinal lymphadenectomy. Preoperative computed tomography scan was negative for pathologic lymphadenopathy. Before incision, 5 mL of ICG was injected subcutaneously beneath the tumor. Bilateral thigh pockets were then developed simultaneously and a right, then left robotic modified inguinal lymphadenectomy was performed using NIR fluorescence guidance via the DaVinci Firefly camera. A partial penectomy was then performed in the standard fashion. The combined procedure was performed successfully without complication. Total operative time was 379 minutes and total robotic console time was 95 minutes for the right and 58 minutes to the left. Estimated blood loss on the right and left were 15 and 25 mL, respectively. A total of 24 lymph nodes were retrieved. This video demonstrates a safe and feasible approach for combined partial penectomy and bilateral inguinal lymphadenectomy with NIR guidance using ICG and the DaVinci Firefly camera system. The combined robotic approach has minimal morbidity and avoids the need for a staged procedure. Furthermore, use of NIR guidance with ICG during robotic inguinal lymphadenectomy is feasible and may help identify sentinel lymph nodes and improve the quality of dissection. Further studies are needed to confirm the utility of NIR guidance for robotic sentinel lymph node dissection. Copyright © 2017 Elsevier Inc. All rights reserved.

An ultrasensitive NanoLuc-based luminescence system for monitoring Plasmodium berghei throughout its life cycle.

PubMed

De Niz, Mariana; Stanway, Rebecca R; Wacker, Rahel; Keller, Derya; Heussler, Volker T

2016-04-21

Bioluminescence imaging is widely used for cell-based assays and animal imaging studies, both in biomedical research and drug development. Its main advantages include its high-throughput applicability, affordability, high sensitivity, operational simplicity, and quantitative outputs. In malaria research, bioluminescence has been used for drug discovery in vivo and in vitro, exploring host-pathogen interactions, and studying multiple aspects of Plasmodium biology. While the number of fluorescent proteins available for imaging has undergone a great expansion over the last two decades, enabling simultaneous visualization of multiple molecular and cellular events, expansion of available luciferases has lagged behind. The most widely used bioluminescent probe in malaria research is the Photinus pyralis firefly luciferase, followed by the more recently introduced Click-beetle and Renilla luciferases. Ultra-sensitive imaging of Plasmodium at low parasite densities has not been previously achieved. With the purpose of overcoming these challenges, a Plasmodium berghei line expressing the novel ultra-bright luciferase enzyme NanoLuc, called PbNLuc has been generated, and is presented in this work. NanoLuc shows at least 150 times brighter signal than firefly luciferase in vitro, allowing single parasite detection in mosquito, liver, and sexual and asexual blood stages. As a proof-of-concept, the PbNLuc parasites were used to image parasite development in the mosquito, liver and blood stages of infection, and to specifically explore parasite liver stage egress, and pre-patency period in vivo. PbNLuc is a suitable parasite line for sensitive imaging of the entire Plasmodium life cycle. Its sensitivity makes it a promising line to be used as a reference for drug candidate testing, as well as the characterization of mutant parasites to explore the function of parasite proteins, host-parasite interactions, and the better understanding of Plasmodium biology. Since the substrate requirements of NanoLuc are different from those of firefly luciferase, dual bioluminescence imaging for the simultaneous characterization of two lines, or two separate biological processes, is possible, as demonstrated in this work.

An integrated model of water resources optimization allocation based on projection pursuit model - Grey wolf optimization method in a transboundary river basin

NASA Astrophysics Data System (ADS)

Yu, Sen; Lu, Hongwei

2018-04-01

Under the effects of global change, water crisis ranks as the top global risk in the future decade, and water conflict in transboundary river basins as well as the geostrategic competition led by it is most concerned. This study presents an innovative integrated PPMGWO model of water resources optimization allocation in a transboundary river basin, which is integrated through the projection pursuit model (PPM) and Grey wolf optimization (GWO) method. This study uses the Songhua River basin and 25 control units as examples, adopting the PPMGWO model proposed in this study to allocate the water quantity. Using water consumption in all control units in the Songhua River basin in 2015 as reference to compare with optimization allocation results of firefly algorithm (FA) and Particle Swarm Optimization (PSO) algorithms as well as the PPMGWO model, results indicate that the average difference between corresponding allocation results and reference values are 0.195 bil m3, 0.151 bil m3, and 0.085 bil m3, respectively. Obviously, the average difference of the PPMGWO model is the lowest and its optimization allocation result is closer to reality, which further confirms the reasonability, feasibility, and accuracy of the PPMGWO model. And then the PPMGWO model is adopted to simulate allocation of available water quantity in Songhua River basin in 2018, 2020, and 2030. The simulation results show water quantity which could be allocated in all controls demonstrates an overall increasing trend with reasonable and equal exploitation and utilization of water resources in the Songhua River basin in future. In addition, this study has a certain reference value and application meaning to comprehensive management and water resources allocation in other transboundary river basins.

Damage severity assessment in wind turbine blade laboratory model through fuzzy finite element model updating

NASA Astrophysics Data System (ADS)

Turnbull, Heather; Omenzetter, Piotr

2017-04-01

The recent shift towards development of clean, sustainable energy sources has provided a new challenge in terms of structural safety and reliability: with aging, manufacturing defects, harsh environmental and operational conditions, and extreme events such as lightning strikes wind turbines can become damaged resulting in production losses and environmental degradation. To monitor the current structural state of the turbine, structural health monitoring (SHM) techniques would be beneficial. Physics based SHM in the form of calibration of a finite element model (FEMs) by inverse techniques is adopted in this research. Fuzzy finite element model updating (FFEMU) techniques for damage severity assessment of a small-scale wind turbine blade are discussed and implemented. The main advantage is the ability of FFEMU to account in a simple way for uncertainty within the problem of model updating. Uncertainty quantification techniques, such as fuzzy sets, enable a convenient mathematical representation of the various uncertainties. Experimental frequencies obtained from modal analysis on a small-scale wind turbine blade were described by fuzzy numbers to model measurement uncertainty. During this investigation, damage severity estimation was investigated through addition of small masses of varying magnitude to the trailing edge of the structure. This structural modification, intended to be in lieu of damage, enabled non-destructive experimental simulation of structural change. A numerical model was constructed with multiple variable additional masses simulated upon the blades trailing edge and used as updating parameters. Objective functions for updating were constructed and minimized using both particle swarm optimization algorithm and firefly algorithm. FFEMU was able to obtain a prediction of baseline material properties of the blade whilst also successfully predicting, with sufficient accuracy, a larger magnitude of structural alteration and its location.

Liposomes as protective capsules for active silica sol-gel biocomposite synthesis.

PubMed

Li, Ye; Yip, Wai Tak

2005-09-21

Using liposome to shield an enzyme from hostile chemical environments during the sol-gel formation process has resulted in a novel approach to synthesizing silica sol-gel biocomposite materials. By reporting the encapsulation of horseradish peroxidase and firefly luciferase, we demonstrate that this new protocol can produce silica biocomposites that are more active than trapping the enzymes directly into hydrogels.

Method of detecting and counting bacteria in body fluids

NASA Technical Reports Server (NTRS)

Chappelle, E. W.; Picciolo, G. L. (Inventor)

1973-01-01

A novel method is reported for determining bacterial levels in urine samples, which method depends on the quantitative determination of bacterial adenosine triphosphate (ATP) in the presence of non-bacterial ATP. After the removal of non-bacterial ATP, the bacterial ATP is released by cell rupture and is measured by an enzymatic bioluminescent assay using an enzyme obtained from the firefly.

Firefly

DTIC Science & Technology

2012-05-29

Hunter College has completed work on baseline measurements of relaxation times for pentacene at various temperatures in order to determine optimal...temperatures for measuring relaxation rate as a function of doping. We have also repeated these measurements on pentacene samples at 2 different...P3HT using a time-lag method. 2 Technical Accomplishments This Period Relaxation Measurements on Pentacene . As described initially in the 1Q

Optical imaging of Renilla luciferase, synthetic Renilla luciferase, and firefly luciferase reporter gene expression in living mice.

PubMed

Bhaumik, S; Lewis, X Z; Gambhir, S S

2004-01-01

We have recently demonstrated that Renilla luciferase (Rluc) is a promising bioluminescence reporter gene that can be used for noninvasive optical imaging of reporter gene expression in living mice, with the aid of a cooled charged couple device (CCD) camera. In the current study, we explore the expression of a novel synthetic Renilla luciferase reporter gene (hRluc) in living mice, which has previously been reported to be a more sensitive reporter than native Rluc in mammalian cells. We explore the strategies of simultaneous imaging of both Renilla luciferase enzyme (RL) and synthetic Renilla luciferase enzyme (hRL):coelenterazine (substrate for RL/hRL) in the same living mouse. We also demonstrate that hRL:coelenterazine can yield a higher signal when compared to Firefly luciferase enzyme (FL): D-Luciferin, both in cell culture studies and when imaged from cells at the surface and from lungs of living mice. These studies demonstrate that hRluc should be a useful primary reporter gene with high sensitivity when used alone or in conjunction with other bioluminescence reporter genes for imaging in living rodents. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

A homogeneous biochemiluminescent assay for detection of influenza

NASA Astrophysics Data System (ADS)

Hui, Kwok Min; Li, Xiao Jing; Pan, Lu; Li, X. J.

2015-05-01

Current methods of rapid detection of influenza are based on detection of the nucleic acids or antigens of influenza viruses. Since influenza viruses constantly mutate leading to appearance of new strains or variants of viruses, these detection methods are susceptible to genetic changes in influenza viruses. Type A and B influenza viruses contain neuraminidase, an essential enzyme for virus replication which enables progeny influenza viruses leave the host cells to infect new cells. Here we describe an assay method, the homogeneous biochemiluminescent assay (HBA), for rapid detection of influenza by detecting viral neuraminidase activity. The assay mimics the light production process of a firefly: a viral neuraminidase specific substrate containing a luciferin moiety is cleaved in the presence of influenza virus to release luciferin, which becomes a substrate to firefly luciferase in a light production system. All reagents can be formulated in a single reaction mix so that the assay involves only one manual step, i.e., sample addition. Presence of Type A or B influenza virus in the sample leads to production of strong, stable and easily detectable light signal, which lasts for hours. Thus, this influenza virus assay is suitable for use in point-of-care settings.

FT-IR, FT-Raman spectra and DFT calculations of melaminium perchlorate monohydrate.

PubMed

Kanagathara, N; Marchewka, M K; Drozd, M; Renganathan, N G; Gunasekaran, S; Anbalagan, G

2013-08-01

Melaminium perchlorate monohydrate (MPM), an organic material has been synthesized by slow solvent evaporation method at room temperature. Powder X-ray diffraction analysis confirms that MPM crystal belongs to triclinic system with space group P-1. FTIR and FT Raman spectra are recorded at room temperature. Functional group assignment has been made for the melaminium cations and perchlorate anions. Vibrational spectra have also been discussed on the basis of quantum chemical density functional theory (DFT) calculations using Firefly (PC GAMESS) version 7.1 G. Vibrational frequencies are calculated and scaled values are compared with experimental values. The assignment of the bands has been made on the basis of the calculated PED. The Mulliken charges, HOMO-LUMO orbital energies are analyzed directly from Firefly program log files and graphically illustrated. HOMO-LUMO energy gap and other related molecular properties are also calculated. The theoretically constructed FT-IR and FT-Raman spectra of MPM coincide with the experimental one. The chemical structure of the compound has been established by (1)H and (13)C NMR spectra. No detectable signal was observed during powder test for second harmonic generation. Copyright © 2013 Elsevier B.V. All rights reserved.

Thinking Like a Wolf, a Sheep, or a Firefly: Learning Biology through Constructing and Testing Computational Theories--An Embodied Modeling Approach

ERIC Educational Resources Information Center

Wilensky, Uri; Reisman, Kenneth

2006-01-01

Biological phenomena can be investigated at multiple levels, from the molecular to the cellular to the organismic to the ecological. In typical biology instruction, these levels have been segregated. Yet, it is by examining the connections between such levels that many phenomena in biology, and complex systems in general, are best explained. We…

Beyond D-luciferin: Expanding the Scope of Bioluminescence Imaging in vivo

PubMed Central

Adams, Spencer T.; Miller, Stephen C.

2014-01-01

The light-emitting chemical reaction catalyzed by the enzyme firefly luciferase is widely used for noninvasive imaging in live mice. However, photon emission from the luciferase is critically dependent on the chemical properties of its substrate, D-luciferin. In this review, we describe recent work to replace the natural luciferase substrate with synthetic analogs that extend the scope of bioluminescence imaging. PMID:25078002

Glu311 and Arg337 Stabilize a Closed Active-site Conformation and Provide a Critical Catalytic Base and Countercation for Green Bioluminescence in Beetle Luciferases.

PubMed

Viviani, V R; Simões, A; Bevilaqua, V R; Gabriel, G V M; Arnoldi, F G C; Hirano, T

2016-08-30

Beetle luciferases elicit the emission of different bioluminescence colors from green to red. Whereas firefly luciferases emit yellow-green light and are pH-sensitive, undergoing a typical red-shift at acidic pH and higher temperatures and in the presence of divalent heavy metals, click beetle and railroadworm luciferases emit a wider range of colors from green to red but are pH-independent. Despite many decades of study, the structural determinants and mechanisms of bioluminescence colors and pH sensitivity remain enigmatic. Here, through modeling studies, site-directed mutagenesis, and spectral and kinetic studies using recombinant luciferases from the three main families of bioluminescent beetles that emit different colors of light (Macrolampis sp2 firefly, Phrixotrix hirtus railroadworm, and Pyrearinus termitilluminans click beetle), we investigated the role of E311 and R337 in bioluminescence color determination. All mutations of these residues in firefly luciferase produced red mutants, indicating that the preservation of opposite charges and the lengths of the side chains of E311 and R337 are essential for keeping a salt bridge that stabilizes a closed hydrophobic conformation favorable for green light emission. Kinetic studies indicate that residue R337 is important for binding luciferin and creating a positively charged environment around excited oxyluciferin phenolate. In Pyrearinus green-emitting luciferase, the R334A mutation causes a 27 nm red-shift, whereas in Phrixotrix red-emitting luciferase, the L334R mutation causes a blue-shift that is no longer affected by guanidine. These results provide compelling evidence that the presence of arginine at position 334 is essential for blue-shifting the emission spectra of most beetle luciferases. Therefore, residues E311 and R337 play both structural and catalytic roles in bioluminescence color determination, by stabilizing a closed hydrophobic conformation favorable for green light emission, and also providing a base to accept excited oxyluciferin phenol proton, and a countercation to shield the negative charge of E311 and to stabilize excited oxyluciferin phenolate, blue-shifting emission spectra in most beetle luciferases.

Inhibition of Th17 Cell Differentiation as a Treatment for Multiple Sclerosis

DTIC Science & Technology

2013-10-01

luciferase reporter construct into the cells. This reporter construct allows for both measurement of the transfection efficiency by Renilla luciferase...miR326 (delivered either by lentivirus or cotransfection) should result in reduced Firefly luminescence, with no change in Renilla luminescence. The...using Lipofectamine. After 48 hours Dual Glo substrate was added to the cells and luciferase activity and Renilla Luciferase activity were measured

Redescription of immature stages of central European fireflies, Part 1: Lampyris noctiluca (Linnaeus, 1758) larva, pupa and notes on its biology (Coleoptera: Lampyridae: Lampyrinae).

PubMed

Novák, Martin

2017-03-28

The mature larva of Lampyris noctiluca (Linnaeus, 1758) is redescribed and illustrated in detail, including scanning electron microscope images. Male and female pupae are briefly described, including notes on behaviour as well as light production of the immature stages. Observed structures, life cycle and behaviour of larvae and pupae are discussed.

New Breed of Mice May Improve Accuracy for Preclinical Testing of Cancer Drugs | Poster

Cancer.gov

A new breed of lab animals, dubbed “glowing head mice,” may do a better job than conventional mice in predicting the success of experimental cancer drugs—while also helping to meet an urgent need for more realistic preclinical animal models. The mice were developed to tolerate often-used light-emitting molecules, such as luciferase from fireflies and green fluorescent protein

Bioluminescent magnetic nanoparticles as potential imaging agents for mammalian spermatozoa.

PubMed

Vasquez, Erick S; Feugang, Jean M; Willard, Scott T; Ryan, Peter L; Walters, Keisha B

2016-03-17

Nanoparticles have emerged as key materials for developing applications in nanomedicine, nanobiotechnology, bioimaging and theranostics. Existing bioimaging technologies include bioluminescent resonance energy transfer-conjugated quantum dots (BRET-QDs). Despite the current use of BRET-QDs for bioimaging, there are strong concerns about QD nanocomposites containing cadmium which exhibits potential cellular toxicity. In this study, bioluminescent composites comprised of magnetic nanoparticles and firefly luciferase (Photinus pyralis) are examined as potential light-emitting agents for imaging, detection, and tracking mammalian spermatozoa. Characterization was carried out using infrared spectroscopy, TEM and cryo-TEM imaging, and ζ-potential measurements to demonstrate the successful preparation of these nanocomposites. Binding interactions between the synthesized nanoparticles and spermatozoon were characterized using confocal and atomic/magnetic force microscopy. Bioluminescence imaging and UV-visible-NIR microscopy results showed light emission from sperm samples incubated with the firefly luciferase-modified nanoparticles. Therefore, these newly synthesized luciferase-modified magnetic nanoparticles show promise as substitutes for QD labeling, and can potentially also be used for in vivo manipulation and tracking, as well as MRI techniques. These preliminary data indicate that luciferase-magnetic nanoparticle composites can potentially be used for spermatozoa detection and imaging. Their magnetic properties add additional functionality to allow for manipulation, sorting, or tracking of cells using magnetic techniques.

Hepa1-6-FLuc cell line with the stable expression of firefly luciferase retains its primary properties with promising bioluminescence imaging ability.

PubMed

Li, Yasha; Liu, Mengnan; Cui, Jiejie; Yang, Ke; Zhao, Li; Gong, Mengjia; Wang, Yi; He, Yun; He, Tongchuan; Bi, Yang

2018-05-01

Reliable animal models are required for the in vivo study of the molecular mechanisms and effects of chemotherapeutic drugs in hepatocarcinoma. In vivo tracing techniques based on firefly luciferase (FLuc) may optimize the non-invasive monitoring of experimental animals. The present study established a murine Hepa1-6-FLuc cell line that stably expressed a retrovirus-delivered FLuc protein gene. The cell morphology, proliferation, migration and invasion ability of Hepa1-6-FLuc cells were the same as that of the Hepa1-6 cells, and thus is suitable to replace Hepa1-6 cells in the construction of hepatocarcinoma animal models. No differences in subcutaneous tumor mass and its pathomorphology from implanted Hepa1-6-FLuc cells were observed compared with Hepa1-6 control tumors. Bioluminescence imaging indicated that the Luc signal of the Hepa1-6-FLuc cells was consistently strengthened with increases in tumor mass; however, the Luc signal of Hepa1-6-AdFLuc became weaker and eventually disappeared during tumor development. Therefore, compared with the transient expression by adenovirus, stable expression of the FLuc gene in Hepa1-6 cells may better reflect cell proliferation and survival in vivo , and provide a reliable source for the establishment of hepatocarcinoma models.

Suitability of Macrolampis firefly and Pyrearinus click beetle luciferases for bacterial light off toxicity biosensor.

PubMed

Gabriel, Gabriele V M; Lopes, P S; Viviani, V R

2014-01-15

Bioluminescence is widely used in biosensors. For water toxicity analysis, the naturally bioluminescent bacteria Vibrio fischeri have been used extensively. We investigated the suitability of two new beetle luciferases for Escherichia coli light off biosensors: Macrolampis firefly and Pyrearinus termitilluminans click beetle luciferases. The bioluminescence detection assay using this system is very sensitive, being comparable or superior to V. fischeri. The luciferase of P. termitilluminans produces a strong and sustained bioluminescence that is useful for less sensitive and inexpensive assays that require integration of the emission, whereas Macrolampis luciferase displays a flash-like luminescence that is useful for fast and more sensitive assays. The effect of heavy metals and sanitizing agents was analyzed. Zinc, copper, 1-propanol, and iodide had inhibitory effects on bioluminescence and growth assays; however, in these cases the bioluminescence was not a very reliable indicator of cell growth and metabolic activity because these agents also inhibited the luciferase. On the other hand, mercury and silver strongly affected cell bioluminescence and growth but not the luciferase activity, indicating that bioluminescence was a reliable indicator of cell growth and metabolic activity in this case. Finally, bioluminescent E. coli immobilized in agarose matrix gave a more stable format for environmental assays. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization of luciferases and its paralogue in the Panamanian luminous click beetle Pyrophorus angustus: a click beetle luciferase lacks the fatty acyl-CoA synthetic activity.

PubMed

Oba, Yuichi; Kumazaki, Mizuho; Inouye, Satoshi

2010-02-15

Two luciferase genes (dPaLuc and vPaLuc) and one paralogue of luciferase (PaLL) were isolated from the Panamanian luminous click beetle, Pyrophorus angustus (Elateridae, Pyrophorinae). The transcripts of dPaLuc and vPaLuc were predominantly detected in the body parts with dorsal photophore and ventral photophore, respectively, and the transcript of PaLL was detected in both parts. The gene products of dPaLuc and vPaLuc possessed luminescence activity with firefly luciferin (lambda(max)=536 and 566 nm, respectively) but did not show significant activity of fatty acyl-CoA synthesis. On the other hand, the gene product of PaLL had fatty acyl-CoA synthetic activity with very weak luminescence activity. The catalytic properties of click beetle luciferase are different from our previous results that firefly luciferase has both luminescence activity and fatty acyl-CoA synthetic activity. These results suggested that the ancestral fatty acyl-CoA synthetase in the Pyrophorinae lineage has undergone gene duplication event, followed by specialization of one copy in luciferase. Subsequently, the luciferase was duplicated again and the two copies diverged in their luminescent color and expression pattern. Copyright 2009 Elsevier B.V. All rights reserved.

A novel dual luciferase assay for the simultaneous monitoring of HIV infection and cell viability.

PubMed

Mitsuki, Yu-Ya; Yamamoto, Takuya; Mizukoshi, Fuminori; Momota, Masatoshi; Terahara, Kazutaka; Yoshimura, Kazuhisa; Harada, Shigeyoshi; Tsunetsugu-Yokota, Yasuko

2016-05-01

Human immunodeficiency virus type 1 (HIV-1) reporter cell lines are critical tools for drug development. However, one disadvantage of HIV-1 reporter cell lines is that reductions in reporter gene activity need to be normalized to cytotoxicity, i.e., live cell numbers. Here, we developed a dual luciferase assay based on a R. reniformis luciferase (hRLuc)-expressing R5-type HIV-1 (NLAD8-hRLuc) and a CEM cell line expressing CCR5 and firefly luciferase (R5CEM-FiLuc). The NLAD8-hRLuc reporter virus was replication competent in peripheral blood mononuclear cells. The level of hRLuc was correlated with p24 antigen levels (p<0.001, R=0.862). The target cell line, R5CEM-FiLuc, stably expressed the firefly luciferase (FiLuc) reporter gene and allowed the simultaneous monitoring of compound cytotoxicity. The dual reporter assay combining a NLAD8-hRLuc virus with R5CEM-FiLuc cells permitted the accurate determination of drug susceptibility for entry, reverse transcriptase, integrase, and protease inhibitors at different multiplicities of infection. This dual reporter assay provides a rapid and direct method for the simultaneous monitoring of HIV infection and cell viability. Copyright © 2016 Elsevier B.V. All rights reserved.

Forest Fire Mapping

NASA Technical Reports Server (NTRS)

1990-01-01

The Fire Logistics Airborne Mapping Equipment (FLAME) system, mounted in a twin-engine and airplane operated by the U.S. Forest Service (USFS) of the U.S. Department of Agriculture (USDA), is an airborne instrument for detecting and pinpointing forest fires that might escape ground detection. The FLAME equipment rack includes the operator interface, a video monitor, the system's control panel and film output. FLAME's fire detection sensor is an infrared line scanner system that identifies fire boundaries. Sensor's information is correlated with the aircraft's position and altitude at the time the infrared imagery is acquired to fix the fire's location on a map. System can be sent to a fire locale anywhere in the U.S. at the request of a regional forester. USFS felt a need for a more advanced system to deliver timely fire information to fire management personnel in the decade of the 1990s. The Jet Propulsion Laboratory (JPL) conducted a study, jointly sponsored by NASA and USDA, on what advanced technologies might be employed to produce an end-to-end thermal infrared fire detection and mapping system. That led to initiation of the Firefly system, currently in development at JPL and targeted for operational service beginning in 1992. Firefly will employ satellite-reference position fixing and provide performance superior to FLAME.

Noninvasive imaging of cationic lipid-mediated delivery of optical and PET reporter genes in living mice.

PubMed

Iyer, Meera; Berenji, Manijeh; Templeton, Nancy S; Gambhir, Sanjiv S

2002-10-01

Gene therapy involves the safe and effective delivery of one or more genes of interest to target cells in vivo. The advantages of using nonviral delivery systems include ease of preparation, low toxicity, and weak immunogenicity. Nonviral delivery methods, when combined with a noninvasive, clinically applicable imaging assay, will greatly aid in the optimization of gene therapy approaches for cancer. We demonstrate cationic lipid-mediated noninvasive monitoring of reporter gene expression of firefly (Photinus pyralis) luciferase (fl) and a mutant herpes simplex virus type I thymidine kinase (HSV1-sr39tk, tk) in living mice using a cooled charge coupled device (CCD) camera and positron emission tomography (PET), respectively. We observe a high level of fl and tk reporter gene expression predominantly in the lungs after a single injection of the extruded DOTAP:cholesterol DNA liposome complexes by way of the tail vein, seen to be time- and dose-dependent. We observe a good correlation between the in vivo bioluminescent signal and the ex vivo firefly luciferase enzyme (FL) activity in different organs. We further demonstrate the feasibility of noninvasively imaging both optical and PET reporter gene expression in the same animal using the CCD camera and microPET, respectively.

The role of proline substitutions within flexible regions on thermostability of luciferase.

PubMed

Yu, Haoran; Zhao, Yang; Guo, Chao; Gan, Yiru; Huang, He

2015-01-01

Improving the stability of firefly luciferase has been a critical issue for its wider industrial applications. Studies about hyperthermophile proteins show that flexibility could be an effective indicator to find out weak spots to engineering thermostability of proteins. However, the relationship among flexibility, activity and stability in most of proteins is unclear. Proline is the most rigid residue and can be introduced to rigidify flexible regions to enhance thermostability of proteins. We firstly apply three different methods, molecular dynamics (MD) simulation, B-FITTER and framework rigidity optimized dynamics algorithm (FRODA) to determine the flexible regions of Photinus pyralis luciferase: Fragment 197-207; Fragment 471-481 and Fragment 487-495. Then, introduction of proline is used to rigidify these flexible regions. Two mutants D476P and H489P within most flexible regions are finally designed. In the results, H489P mutant shows improved thermostability while maintaining its catalytic efficiency compared to that of wild type luciferase. Flexibility analysis confirms that the overall rigidity and local rigidity of H489P mutant are greatly strengthened. D476P mutant shows decreased thermosatbility and the reason for this is elucidated at the molecular level. S307P mutation is randomly chosen outside the flexible regions as a control. Thermostability analysis shows that S307P mutation has decreased kinetic stability and enhanced thermodynamic stability. Copyright © 2014 Elsevier B.V. All rights reserved.

The Role of Lymphangiogenesis in Orthotopic Prostatic Tumor-Environment on Regional and Systemic Metastasis

DTIC Science & Technology

2008-01-01

expressing Renilla luciferase and VEGF-C shRNA or irrelevant firefly luciferase shRNA (Ctrl) were implanted orthotopically as before. To determine the...on metastasis in Pten knockout model (Month 10-24): a) Generate Ubc/sVEGFR-3 and Ubc/ Renilla luciferase (RL) lentiviral vectors by subcloning...progression (month 10-12) c) Monitor efficiency of Ubc/lentiviral transduction and expression in Pten (-/-) prostate using optical imaging of Renilla

The Role of AhR in Breast Cancer Development

DTIC Science & Technology

2006-07-01

was used according to the manufacturer’s instructions to transfect cells. The Renilla luciferase vector phRL-TK (0.05 g) was cotransfected with...sequential reading of the Firefly and Renilla signals. Cells were lysed according to the manufacturer’s directions (Promega, Madison, WI, USA...transferred to 96-well white wall plates, and analysed using a Reporter Luminometer (Promega, Madison, WI, USA). The Renilla signal was 7 read after

Improve T Cell Therapy in Neuroblastoma

DTIC Science & Technology

2015-09-01

bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and

Sensitive dual color in vivo bioluminescence imaging using a new red codon optimized firefly luciferase and a green click beetle luciferase.

PubMed

Mezzanotte, Laura; Que, Ivo; Kaijzel, Eric; Branchini, Bruce; Roda, Aldo; Löwik, Clemens

2011-04-22

Despite a plethora of bioluminescent reporter genes being cloned and used for cell assays and molecular imaging purposes, the simultaneous monitoring of multiple events in small animals is still challenging. This is partly attributable to the lack of optimization of cell reporter gene expression as well as too much spectral overlap of the color-coupled reporter genes. A new red emitting codon-optimized luciferase reporter gene mutant of Photinus pyralis, Ppy RE8, has been developed and used in combination with the green click beetle luciferase, CBG99. Human embryonic kidney cells (HEK293) were transfected with vectors that expressed red Ppy RE8 and green CBG99 luciferases. Populations of red and green emitting cells were mixed in different ratios. After addition of the shared single substrate, D-luciferin, bioluminescent (BL) signals were imaged with an ultrasensitive cooled CCD camera using a series of band pass filters (20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that expressed the two luciferases were injected at different depth in the animals. Spectrally-separate images and quantification of the dual BL signals in a mixed population of cells was achieved when cells were either injected subcutaneously or directly into the prostate. We report here the re-engineering of different luciferase genes for in vitro and in vivo dual color imaging applications to address the technical issues of using dual luciferases for imaging. In respect to previously used dual assays, our study demonstrated enhanced sensitivity combined with spatially separate BL spectral emissions using a suitable spectral unmixing algorithm. This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future for more accurate quantitative gene expression studies in vivo by simultaneously monitoring two events in real time.

Sensitive Dual Color In Vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase

PubMed Central

Mezzanotte, Laura; Que, Ivo; Kaijzel, Eric; Branchini, Bruce; Roda, Aldo; Löwik, Clemens

2011-01-01

Background Despite a plethora of bioluminescent reporter genes being cloned and used for cell assays and molecular imaging purposes, the simultaneous monitoring of multiple events in small animals is still challenging. This is partly attributable to the lack of optimization of cell reporter gene expression as well as too much spectral overlap of the color-coupled reporter genes. A new red emitting codon-optimized luciferase reporter gene mutant of Photinus pyralis, Ppy RE8, has been developed and used in combination with the green click beetle luciferase, CBG99. Principal Findings Human embryonic kidney cells (HEK293) were transfected with vectors that expressed red Ppy RE8 and green CBG99 luciferases. Populations of red and green emitting cells were mixed in different ratios. After addition of the shared single substrate, D-luciferin, bioluminescent (BL) signals were imaged with an ultrasensitive cooled CCD camera using a series of band pass filters (20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that expressed the two luciferases were injected at different depth in the animals. Spectrally-separate images and quantification of the dual BL signals in a mixed population of cells was achieved when cells were either injected subcutaneously or directly into the prostate. Significance We report here the re-engineering of different luciferase genes for in vitro and in vivo dual color imaging applications to address the technical issues of using dual luciferases for imaging. In respect to previously used dual assays, our study demonstrated enhanced sensitivity combined with spatially separate BL spectral emissions using a suitable spectral unmixing algorithm. This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future for more accurate quantitative gene expression studies in vivo by simultaneously monitoring two events in real time. PMID:21544210

Critical components required to improve deployable laboratory biological hazards identification

NASA Astrophysics Data System (ADS)

Niemeyer, Debra M.

2004-08-01

An ever-expanding global military mission necessitates quick and accurate identification of biological hazards, whether naturally occurring or man-made. Coupled with an ever-present threat of biological attack, an expanded U.S. presence in worn-torn locations like Southwest Asia presents unique public health challenges. We must heed modern day "lessons learned" from Operation Desert Shield and the Soviet Afghanistan Campaign and guard against rapid incapacitation of troop strength from endemic disease and biological attack. To minimize readiness impacts, field hygiene is enforced, and research on better medical countermeasures such as antibiotics and vaccines continues. However, there are no preventions or remedies for all military-relevant infectious diseases or biological agents. A deployable, streamlined, self-contained diagnostic and public health surveillance laboratory capability with a reach-back communication is critical to meeting global readiness challenges. Current deployable laboratory packages comprise primarily diagnostic or environmental sample testing capabilities. Discussion will focus on critical components needed to improve existing laboratory assets, and to facilitate deployment of small, specialized packages far forward. The ideal laboratory model described will become an essential tool for the Combatant or Incident Commander to maintain force projection in the expeditionary environment.

Development of an Ultra-Low Background Liquid Scintillation Counter for Trace Level Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erchinger, Jennifer L.; Orrell, John L.; Aalseth, Craig E.

2015-09-01

Low-level liquid scintillation counting (LSC) has been established as one of the radiation detection techniques useful in elucidating environmental processes and environmental monitoring around nuclear facilities. The Ultra-Low Background Liquid Scintillation Counter (ULB-LSC) under construction in the Shallow Underground Laboratory at Pacific Northwest National Laboratory aims to further reduce the MDAs and/or required sample processing. Through layers of passive shielding in conjunction with an active veto and 30 meters water equivalent overburden, the background reduction is expected to be 10 to 100 times below typical analytic low-background liquid scintillation systems. Simulations have shown an expected background of around 14 countsmore » per day. A novel approach to the light collection will use a coated hollow light guide cut into the inner copper shielding. Demonstration LSC measurements will show low-energy detection, spectral deconvolution, and alpha/beta discrimination capabilities, from trials with standards of tritium, strontium-90, and actinium-227, respectively. An overview of the system design and expected demonstration measurements will emphasize the potential applications of the ULB-LSC in environmental monitoring for treaty verification, reach-back sample analysis, and facility inspections.« less

Any information, anywhere, anytime for the warfighter

NASA Astrophysics Data System (ADS)

Lazaroff, Mark B.; Sage, Philip A.

1997-06-01

The objective of the DARPA battlefield awareness data dissemination (BADD) program is to deliver battlefield awareness information to the warfighter -- anywhere, anytime. BADD is an advanced concept technology demonstration (ACTD) to support proof of concept technology demonstrations and experiments with a goal of introducing new technology to support the operational needs and acceptance of the warfighter. BADD's information management technology provides a 'smart' push of information to the users by providing information subscription services implemented via user- generated profiles. The system also provides services for warfighter pull or 'reach-back' of information via ad hoc query support. The high bandwidth delivery of informtion via the Global Broadcast System (GBS) satellites enables users to receive battlefield awareness information virtually anywhere. Very similar goals have been established for data warehousing technology -- that is, deliver the right information, to the right user, at the right time so that effective decisions can be made. In this paper, we examine the BADD Phase II architecture and underlying information management technoloyg in the context of data warehousing technology and a data warehouse reference architecture. In particular, we foucs on the BADD segment that PSR is building, the Interface to Information Sources (I2S).

The MERADCOM (Mobility Equipment Research and Development Command) in vitro Biosensor Program.

DTIC Science & Technology

1982-06-01

a negligible decay rate at ATP concentrations less than 1 jim." This development has further increased the great value of the firefly luciferase...formation NADH molecules at a high rate which results in an ampli- fied light signal of the bacterial luciferase readout system. As above, the light...exclusively the oxidation of O-D-glucose. Enzymes are also efficient catalysts facilitating chemical reactions at rates which range from 10 thousand to 1

Characterization of BRCA2 Transcriptional Regulation

DTIC Science & Technology

2000-08-01

Renilla luciferase vector (Promega) with 4 ll of Fugene-6 was used for each transfection. The pRL-TK Renilla luciferase activity was used to control for...experiments, cells received 0.5 jig of BRCA2 promoter construct, 0.1 jig of pRL-TK Renilla luciferase vector, and 0.5 jig of the indicated expression...Myc, and pCMV-Max. Firefly lucifer- ase and renilla luciferase assays were performed using the Dual-Luciferase Reporter Assay Sys- tem (Promega

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

Rational and random mutagenesis of firefly luciferase to identify an efficient emitter of red bioluminescence

NASA Astrophysics Data System (ADS)

Branchini, Bruce R.; Southworth, Tara L.; Khattak, Neelum F.; Murtiashaw, Martha H.; Fleet, Sarah E.

2004-06-01

Firefly luciferase, which emits yellow-green (557 nm) light, and the corresponding cDNA have been used successfully as a bioluminescence reporter of gene expression. One particularly exciting application is in the area of in vivo bioluminescence imaging. Our interest is in developing improved reagents by identifying Photinus pyralis luciferase mutants that efficiently emit red bioluminescence. In this way, the proven advantages of the P. pyralis protein can be combined with the potential advantages of a red-shifted emitter. Using site-directed mutagenesis techniques, we have identified many mutants emitting red bioluminescence. Unfortunately, these enzymes generally have significantly decreased bioluminescence activity. Interestingly, we discovered a mutation, Ile351Ala, that produced a moderate 16 nm red-shift, while maintaining excellent bioluminescence activity. We then undertook a random mutagenesis approach to identify luciferase mutants that emit further red-shifted bioluminescence with minimal loss of activity. Libraries of mutants were created using an error-prone PCR method and the Ile351Ala luciferase mutant as the template DNA. The libraries were screened by in vivo bacterial assays and the promising mutants were purified to enable accurate determination of bioluminescence emission spectra and total bioluminescence activity. We will report the characterization results, including the identification of the randomly altered amino acids, of several mutants that catalyze bioluminescence with emission maxima of approximately 600 nm.

Comparison of red-shifted firefly luciferase Ppy RE9 and conventional Luc2 as bioluminescence imaging reporter genes for in vivo imaging of stem cells

NASA Astrophysics Data System (ADS)

Liang, Yajie; Walczak, Piotr; Bulte, Jeff W. M.

2012-01-01

One critical issue for noninvasive imaging of transplanted bioluminescent cells is the large amount of light absorption in tissue when emission wavelengths below 600 nm are used. Luciferase with a red-shifted spectrum can potentially bypass this limitation. We assessed and compared a mutant of firefly luciferase (Ppy RE9, PRE9) against the yellow luciferase luc2 gene for use in cell transplantation studies. C17.2 neural stem cells expressing PRE9-Venus and luc2-Venus were sorted by flow cytometry and assessed for bioluminescence in vitro in culture and in vivo after transplantation into the brain of immunodeficient Rag2-/- mice. We found that the luminescence from PRE9 was stable, with a peak emission at 620 nm, shifted to the red compared to that of luc2. The emission peak for PRE9 was pH-independent, in contrast to luc2, and much less affected by tissue absorbance compared to that of luc2. However, the total emitted light radiance from PRE9 was substantially lower than that of luc2, both in vitro and in vivo. We conclude that PRE9 has favorable properties as compared to luc2 in terms of pH independence, red-shifted spectrum, tissue light penetration, and signal quantification, justifying further optimization of protein expression and enzymatic activity.

Characterization of BRCA2 Transcriptional Regulation

DTIC Science & Technology

2001-12-01

tig of BRCA2 promoter construct and 0.1 and we verify the role of USF in regulation of basal activity of jig of pRL-TK Renilla luciferase vector...Promega) with 4 1 l of Fugene-6 the promoter. was used for each transfection. The pRL-TK Renilla luciferase activity was used to control for transfection...pCMV-CREB, pCMV-Myc, BRCA2 Reporter Constructs-A BAC clone (B489G) containing the 5’ and pCMV-Max. Firefly luciferase and Renilla luciferase assays

Activation of Alternative Wnt Signaling Pathways in Human Mammary Gland and breast Cancer Cells

DTIC Science & Technology

2005-06-01

or SuperFopFlash with mutated elements (control) and a renilla -luciferase construct in all wells. Transfections were performed in triplicates using...0.18 ýtg of reporter plasmid, 0.02 ug of renilla - luciferase plasmid and 0.45 jig of inducer plasmid in total with 1.3 [A of Lipofectin in OptiMEM...and then were incubated overnight with fresh full endothelial culture media. Cell lysates were prepared the next day and both firefly and renilla

Mapping Wildfires In Nearly Real Time

NASA Technical Reports Server (NTRS)

Nichols, Joseph D.; Parks, Gary S.; Denning, Richard F.; Ibbott, Anthony C.; Scott, Kenneth C.; Sleigh, William J.; Voss, Jeffrey M.

1993-01-01

Airborne infrared-sensing system flies over wildfire as infrared detector in system and navigation subsystem generate data transmitted to firefighters' camp. There, data plotted in form of map of fire, including approximate variations of temperature. System, called Firefly, reveals position of fires and approximate thermal intensities of regions within fires. Firefighters use information to manage and suppress fires. Used for other purposes with minor modifications, such as to spot losses of heat in urban areas and to map disease and pest infestation in vegetation.

The Application of Collaborative Business Intelligence Technology in the Hospital SPD Logistics Management Model.

PubMed

Liu, Tongzhu; Shen, Aizong; Hu, Xiaojian; Tong, Guixian; Gu, Wei

2017-06-01

We aimed to apply collaborative business intelligence (BI) system to hospital supply, processing and distribution (SPD) logistics management model. We searched Engineering Village database, China National Knowledge Infrastructure (CNKI) and Google for articles (Published from 2011 to 2016), books, Web pages, etc., to understand SPD and BI related theories and recent research status. For the application of collaborative BI technology in the hospital SPD logistics management model, we realized this by leveraging data mining techniques to discover knowledge from complex data and collaborative techniques to improve the theories of business process. For the application of BI system, we: (i) proposed a layered structure of collaborative BI system for intelligent management in hospital logistics; (ii) built data warehouse for the collaborative BI system; (iii) improved data mining techniques such as supporting vector machines (SVM) and swarm intelligence firefly algorithm to solve key problems in hospital logistics collaborative BI system; (iv) researched the collaborative techniques oriented to data and business process optimization to improve the business processes of hospital logistics management. Proper combination of SPD model and BI system will improve the management of logistics in the hospitals. The successful implementation of the study requires: (i) to innovate and improve the traditional SPD model and make appropriate implement plans and schedules for the application of BI system according to the actual situations of hospitals; (ii) the collaborative participation of internal departments in hospital including the department of information, logistics, nursing, medical and financial; (iii) timely response of external suppliers.

Comparison of bioluminescent kinase assays using substrate depletion and product formation.

PubMed

Tanega, Cordelle; Shen, Min; Mott, Bryan T; Thomas, Craig J; MacArthur, Ryan; Inglese, James; Auld, Douglas S

2009-12-01

Assays for ATPases have been enabled for high-throughput screening (HTS) by employing firefly luciferase to detect the remaining ATP in the assay. However, for any enzyme assay, measurement of product formation is a more sensitive assay design. Recently, technologies that allow detection of the ADP product from ATPase reactions have been described using fluorescent methods of detection. We describe here the characterization of a bioluminescent assay that employs firefly luciferase in a coupled-enzyme assay format to enable detection of ADP levels from ATPase assays (ADP-Glo, Promega Corp.). We determined the performance of the ADP-Glo assay in 1,536-well microtiter plates using the protein kinase Clk4 and a 1,352 member kinase focused combinatorial library. The ADP-Glo assay was compared to the Clk4 assay performed using a bioluminescence ATP-depletion format (Kinase-Glo, Promega Corp). We performed this analysis using quantitative HTS (qHTS) where we determined potency values for all library members and identified approximately 300 compounds with potencies ranging from as low as 50 nM to >10 microM, yielding a robust dataset for the comparison. Both assay formats showed high performance (Z'-factors approximately 0.9) and showed a similar potency distribution for the actives. We conclude that the bioluminescence ADP detection assay system is a viable generic alternative to the widely used ATP-depletion assay for ATPases and discuss the advantages and disadvantages of both approaches.

Transgenic mice that accept Luciferase- or GFP-expressing syngeneic tumor cells at high efficiencies.

PubMed

Aoyama, Naoki; Miyoshi, Hiroyuki; Miyachi, Hitoshi; Sonoshita, Masahiro; Okabe, Masaru; Taketo, Makoto Mark

2018-05-11

Jellyfish green fluorescent protein (GFP) and firefly luciferase can serve as versatile tracking markers for identification and quantification of transplanted cancer cells in vivo. However, immune reactions against these markers can hamper the formation of syngraft tumors and metastasis that follows. Here, we report two transgenic (Tg) mouse lines that express nonfunctional mutant marker proteins, namely modified firefly luciferase (Luc2) or enhanced GFP (EGFP). These mice, named as Tg-mLuc2 and Tg-mEGFP, turned out to be immunologically tolerant to the respective tracking markers and thus efficiently accepted syngeneic cancer cells expressing the active forms of the markers. We then injected intrarectally the F 1 hybrid Tg mice (BALB/c × C57BL/6J) with Colon-26 (C26) colon cancer cells that originated from a BALB/c mouse. Even when C26 cells expressed active Luc2 or EGFP, they formed primary tumors in the Tg mice with only 10 4 cells per mouse compared with more than 10 6 cells required in the nontransgenic BALB/c hosts. Furthermore, we detected metastatic foci of C26 cells in the liver and lungs of the Tg mice by tracking the specific reporter activities. These results show the usefulness of the Tg mouse lines as recipients for transplantation experiments with the non-self tracking marker-expressing cells. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Luciferin-Regenerating Enzyme Mediates Firefly Luciferase Activation Through Direct Effects of D-Cysteine on Luciferase Structure and Activity.

PubMed

Hemmati, Roohullah; Hosseinkhani, Saman; Sajedi, Reza H; Azad, Taha; Tashakor, Amin; Bakhtiari, Nuredin; Ataei, Farangis

2015-01-01

Luciferin-regenerating enzyme (LRE) contributes to in vitro recycling of D-luciferin. In this study, reinvestigation of the luciferase-based LRE assay is reported. Here, using quick change site-directed mutagenesis seven T-LRE (Lampyris turkestanicusLRE) mutants were constructed and the most functional mutant of T-LRE (T(69)R) was selected for this research and the effects of D- and L-cysteine on T(69)R T-LRE-luciferase-coupled assay are examined. Our results demonstrate that bioluminescent signal of T(69)R T-LRE-luciferase-coupled assay increases and then reach equilibrium state in the presence of 5 mm D-cysteine. In addition, results reveal that 5 mm D- and L-cysteine in the absence of T(69)R T-LRE cause a significant increase in bioluminescence intensity of luciferase over a long time as well as decrease in decay rate. Based on activity measurements, far-UV CD analysis, ANS fluorescence and DLS (Dynamic light scattering) results, D-cysteine increases the activity of luciferase due to weak redox potential, antiaggregatory effects, induction of changes in conformational structure and kinetics properties. In conclusion, in spite of previous reports on the effect of LRE on luciferase bioluminescent intensity, the majority of increase in luciferase light output and time-course originate from the direct effects of D-cysteine on structure and activity of firefly luciferase. © 2015 The American Society of Photobiology.

Surface charge modification increases firefly luciferase rigidity without alteration in bioluminescence spectra.

PubMed

Mortazavi, Mojtaba; Hosseinkhani, Saman

2017-01-01

Protein engineering can provide useful approaches for loop anchoring and mutation of surface-exposed loop residues to Arg for the design of thermostable proteins. In this context and due to the high proportion of surface loops, some of the solvent-exposed residues in the Lampyris turkestanicus luciferase were mutated to Arg. Using the red-emitter mutant luciferase (E354R/Arg356), the single (-Q35R, -I182R, -I232R and -L300R), double (-Q35R/I232R) and triple (-Q35R/I232R/I182R) mutant luciferases were introduced. The relative remaining activity of -I232R, double and triple mutants increased significantly compared to the wild-type at 40°C. The optimal temperature of these mutants increased up to 40°C which were 15°C more than wild-type luciferase. It is anticipated that these mutations increased the local interactions that finally improved the thermostability and optimum temperature of luciferase. It should be noted that Arg substitution at amino acid positions 35, 182 and 232 had no effect on the bioluminescence emission spectra. Furthermore, these mutations have not significantly changed the specific activities of firefly luciferases. Finally, with the use of the homology modeling and molecular docking, the effects of these substitutions were evaluated. In conclusion, this study provides beneficial insights on how the thermal stability of luciferase can be improved by protein engineering for biological applications. Copyright © 2016 Elsevier Inc. All rights reserved.

A method to rapidly and accurately compare relative efficacies of non-invasive imaging reporter genes in a mouse model, and its application to luciferase reporters

PubMed Central

Gil, Jose S.; Machado, Hidevaldo B.; Herschman, Harvey R.

2013-01-01

Purpose Our goal is to develop a simple, quantitative, robust method to compare the efficacy of imaging reporter genes in culture and in vivo. We describe an adenoviral vector-liver transduction procedure, and compare the luciferase reporter efficacies. Procedures Alternative reporter genes are expressed in a common adenoviral vector. Vector amounts used in vivo are based on cell culture titrations, ensuring the same transduction efficacy is used for each vector. After imaging, in vivo and in vitro values are normalized to hepatic vector transduction using quantitative real-time PCR. Results We assayed standard firefly luciferase (FLuc), enhanced firefly luciferase (EFLuc), luciferase 2 (Luc2), humanized Renilla luciferase (hRLuc), Renilla luciferase 8.6-535 (RLuc8.6), and a membrane-bound Gaussia luciferase variant (extGLuc) in cell culture and in vivo. We observed a greater that 100-fold increase in bioluminescent signal for both EFLuc and Luc2 when compared to FLuc, and a greater than 106-fold increase for RLuc8.6 when compared to hRLuc. ExtGLuc was not detectable in liver. Conclusions Our findings contrast, in some cases, with conclusions drawn in prior comparisons of these reporter genes, and demonstrate the need for a standardized method to evaluate alternative reporter genes in vivo. Our procedure can be adapted for reporter genes that utilize alternative imaging modalities (fluorescence, bioluminescence, MRI, SPECT, PET). PMID:21850545

Discovery, adaptation and transcriptional activity of two tick promoters: Construction of a dual luciferase reporter system for optimization of RNA interference in rhipicephalus (boophilus) microplus cell lines.

PubMed

Tuckow, A P; Temeyer, K B

2015-08-01

Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vector of bovine babesiosis and anaplasmosis. Commercial promoters were evaluated for transcriptional activity driving luciferase expression in the tick cell lines. The human phosphoglycerate kinase (PGK) promoter resulted in detectable firefly luciferase activity within 2 days post-transfection of the R. microplus cell line BME26, with maximal activity at 5 days post-transfection. Several other promoters were weaker or inactive in the tick cells, prompting identification and assessment of transcriptional activity of the homologous ribosomal protein L4 (rpL4, GenBank accession no.: KM516205) and elongation factor 1α (EF-1α, GenBank accession no.: KM516204) promoters cloned from R. microplus. Evaluation of luciferase expression driven by various promoters in tick cell culture resulted in selection of the R. microplus rpL4 promoter and the human PGK promoter driving transcription of sequences encoding modified firefly and NanoLuc® luciferases for construction of a dual luciferase reporter system for use in tick cell culture. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

Experimental optimization of the FireFly 600 photovoltaic off-grid system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyson, William Earl; Orozco, Ron; Ralph, Mark E.

2003-10-01

A comprehensive evaluation and experimental optimization of the FireFly{trademark} 600 off-grid photovoltaic system manufactured by Energia Total, Ltd. was conducted at Sandia National Laboratories in May and June of 2001. This evaluation was conducted at the request of the manufacturer and addressed performance of individual system components, overall system functionality and performance, safety concerns, and compliance with applicable codes and standards. A primary goal of the effort was to identify areas for improvement in performance, reliability, and safety. New system test procedures were developed during the effort.

Phase diagram for the Winfree model of coupled nonlinear oscillators.

PubMed

Ariaratnam, J T; Strogatz, S H

2001-05-07

In 1967 Winfree proposed a mean-field model for the spontaneous synchronization of chorusing crickets, flashing fireflies, circadian pacemaker cells, or other large populations of biological oscillators. Here we give the first bifurcation analysis of the model, for a tractable special case. The system displays rich collective dynamics as a function of the coupling strength and the spread of natural frequencies. Besides incoherence, frequency locking, and oscillator death, there exist hybrid solutions that combine two or more of these states. We present the phase diagram and derive several of the stability boundaries analytically.

Watch out for reporter gene assays with Renilla luciferase and paclitaxel.

PubMed

Theile, Dirk; Spalwisz, Adriana; Weiss, Johanna

2013-06-15

Luminescence-based reporter gene assays are widely used in biochemistry. Signals from reporter genes (e.g., firefly luminescence) are usually normalized to signals from constantly luminescing luciferases such as Renilla luciferase. This normalization step can be performed by modern luminometry devices automatically providing final results. Here we demonstrate paclitaxel to strikingly enhance Renilla luminescence, thereby potentially flawing results from reporter gene assays. In consequence, these data advocate for careful examination of raw data and militate against automatic data processing. Copyright © 2013 Elsevier Inc. All rights reserved.

Phase Diagram for the Winfree Model of Coupled Nonlinear Oscillators

NASA Astrophysics Data System (ADS)

Ariaratnam, Joel T.; Strogatz, Steven H.

2001-05-01

In 1967 Winfree proposed a mean-field model for the spontaneous synchronization of chorusing crickets, flashing fireflies, circadian pacemaker cells, or other large populations of biological oscillators. Here we give the first bifurcation analysis of the model, for a tractable special case. The system displays rich collective dynamics as a function of the coupling strength and the spread of natural frequencies. Besides incoherence, frequency locking, and oscillator death, there exist hybrid solutions that combine two or more of these states. We present the phase diagram and derive several of the stability boundaries analytically.

The Application of Collaborative Business Intelligence Technology in the Hospital SPD Logistics Management Model

PubMed Central

LIU, Tongzhu; SHEN, Aizong; HU, Xiaojian; TONG, Guixian; GU, Wei

2017-01-01

Background: We aimed to apply collaborative business intelligence (BI) system to hospital supply, processing and distribution (SPD) logistics management model. Methods: We searched Engineering Village database, China National Knowledge Infrastructure (CNKI) and Google for articles (Published from 2011 to 2016), books, Web pages, etc., to understand SPD and BI related theories and recent research status. For the application of collaborative BI technology in the hospital SPD logistics management model, we realized this by leveraging data mining techniques to discover knowledge from complex data and collaborative techniques to improve the theories of business process. Results: For the application of BI system, we: (i) proposed a layered structure of collaborative BI system for intelligent management in hospital logistics; (ii) built data warehouse for the collaborative BI system; (iii) improved data mining techniques such as supporting vector machines (SVM) and swarm intelligence firefly algorithm to solve key problems in hospital logistics collaborative BI system; (iv) researched the collaborative techniques oriented to data and business process optimization to improve the business processes of hospital logistics management. Conclusion: Proper combination of SPD model and BI system will improve the management of logistics in the hospitals. The successful implementation of the study requires: (i) to innovate and improve the traditional SPD model and make appropriate implement plans and schedules for the application of BI system according to the actual situations of hospitals; (ii) the collaborative participation of internal departments in hospital including the department of information, logistics, nursing, medical and financial; (iii) timely response of external suppliers. PMID:28828316

A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma.

PubMed

Söling, Ariane; Theiss, Christian; Jungmichel, Stephanie; Rainov, Nikolai G

2004-08-04

BACKGROUND: Suicide gene therapy employing the prodrug activating system Herpes simplex virus type 1 thymidine kinase (HSV-TK)/ ganciclovir (GCV) has proven to be effective in killing experimental brain tumors. In contrast, glioma patients treated with HSV-TK/ GCV did not show significant treatment benefit, most likely due to insufficient transgene delivery to tumor cells. Therefore, this study aimed at developing a strategy for real-time noninvasive in vivo monitoring of the activity of a therapeutic gene in brain tumor cells. METHODS: The HSV-TK gene was fused to the firefly luciferase (Luc) gene and the fusion construct HSV-TK-Luc was expressed in U87MG human malignant glioma cells. Nude mice with subcutaneous gliomas stably expressing HSV-TK-Luc were subjected to GCV treatment and tumor response to therapy was monitored in vivo by serial bioluminescence imaging. Bioluminescent signals over time were compared with tumor volumes determined by caliper. RESULTS: Transient and stable expression of the HSV-TK-Luc fusion protein in U87MG glioma cells demonstrated close correlation of both enzyme activities. Serial optical imaging of tumor bearing mice detected in all cases GCV induced death of tumor cells expressing the fusion protein and proved that bioluminescence can be reliably used for repetitive and noninvasive quantification of HSV-TK/ GCV mediated cell kill in vivo. CONCLUSION: This approach may represent a valuable tool for the in vivo evaluation of gene therapy strategies for treatment of malignant disease.

An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences

PubMed Central

Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.

2017-01-01

Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287

A quantitative and high-throughput assay of human papillomavirus DNA replication.

PubMed

Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques

2015-01-01

Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.

Molecular basis for the high-affinity binding and stabilization of firefly luciferase by PTC124

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auld, Douglas S.; Lovell, Scott; Thorne, Natasha

2010-04-07

Firefly luciferase (FLuc), an ATP-dependent bioluminescent reporter enzyme, is broadly used in chemical biology and drug discovery assays. PTC124 Ataluren; (3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid) discovered in an FLuc-based assay targeting nonsense codon suppression, is an unusually potent FLuc-inhibitor. Paradoxically, PTC124 and related analogs increase cellular FLuc activity levels by posttranslational stabilization. In this study, we show that FLuc inhibition and stabilization is the result of an inhibitory product formed during the FLuc-catalyzed reaction between its natural substrate, ATP, and PTC124. A 2.0 {angstrom} cocrystal structure revealed the inhibitor to be the acyl-AMP mixed-anhydride adduct PTC124-AMP, which was subsequently synthesized and shown tomore » be a high-affinity multisubstrate adduct inhibitor (MAI; KD = 120 pM) of FLuc. Biochemical assays, liquid chromatography/mass spectrometry, and near-attack conformer modeling demonstrate that formation of this novel MAI is absolutely dependent upon the precise positioning and reactivity of a key meta-carboxylate of PTC124 within the FLuc active site. We also demonstrate that the inhibitory activity of PTC124-AMP is relieved by free coenzyme A, a component present at high concentrations in luciferase detection reagents used for cell-based assays. This explains why PTC124 can appear to increase, instead of inhibit, FLuc activity in cell-based reporter gene assays. To our knowledge, this is an unusual example in which the 'off-target' effect of a small molecule is mediated by an MAI mechanism.« less

Theoretical mechanics: crowd synchrony on the Millennium Bridge.

PubMed

Strogatz, Steven H; Abrams, Daniel M; McRobie, Allan; Eckhardt, Bruno; Ott, Edward

2005-11-03

Soon after the crowd streamed on to London's Millennium Bridge on the day it opened, the bridge started to sway from side to side: many pedestrians fell spontaneously into step with the bridge's vibrations, inadvertently amplifying them. Here we model this unexpected and now notorious phenomenon--which was not due to the bridge's innovative design as was first thought--by adapting ideas originally developed to describe the collective synchronization of biological oscillators such as neurons and fireflies. Our approach should help engineers to estimate the damping needed to stabilize other exceptionally crowded footbridges against synchronous lateral excitation by pedestrians.

Communication: An efficient approach to compute state-specific nuclear gradients for a generic state-averaged multi-configuration self consistent field wavefunction.

PubMed

Granovsky, Alexander A

2015-12-21

We present a new, very efficient semi-numerical approach for the computation of state-specific nuclear gradients of a generic state-averaged multi-configuration self consistent field wavefunction. Our approach eliminates the costly coupled-perturbed multi-configuration Hartree-Fock step as well as the associated integral transformation stage. The details of the implementation within the Firefly quantum chemistry package are discussed and several sample applications are given. The new approach is routinely applicable to geometry optimization of molecular systems with 1000+ basis functions using a standalone multi-core workstation.

Communication: An efficient approach to compute state-specific nuclear gradients for a generic state-averaged multi-configuration self consistent field wavefunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Granovsky, Alexander A., E-mail: alex.granovsky@gmail.com

We present a new, very efficient semi-numerical approach for the computation of state-specific nuclear gradients of a generic state-averaged multi-configuration self consistent field wavefunction. Our approach eliminates the costly coupled-perturbed multi-configuration Hartree-Fock step as well as the associated integral transformation stage. The details of the implementation within the Firefly quantum chemistry package are discussed and several sample applications are given. The new approach is routinely applicable to geometry optimization of molecular systems with 1000+ basis functions using a standalone multi-core workstation.

Developing an Automated Method for Detection of Operationally Relevant Ocean Fronts and Eddies

NASA Astrophysics Data System (ADS)

Rogers-Cotrone, J. D.; Cadden, D. D. H.; Rivera, P.; Wynn, L. L.

2016-02-01

Since the early 90's, the U.S. Navy has utilized an observation-based process for identification of frontal systems and eddies. These Ocean Feature Assessments (OFA) rely on trained analysts to identify and position ocean features using satellite-observed sea surface temperatures. Meanwhile, as enhancements and expansion of the navy's Hybrid Coastal Ocean Model (HYCOM) and Regional Navy Coastal Ocean Model (RNCOM) domains have proceeded, the Naval Oceanographic Office (NAVO) has provided Tactical Oceanographic Feature Assessments (TOFA) that are based on data-validated model output but also rely on analyst identification of significant features. A recently completed project has migrated OFA production to the ArcGIS-based Acoustic Reach-back Cell Ocean Analysis Suite (ARCOAS), enabling use of additional observational datasets and significantly decreasing production time; however, it has highlighted inconsistencies inherent to this analyst-based identification process. Current efforts are focused on development of an automated method for detecting operationally significant fronts and eddies that integrates model output and observational data on a global scale. Previous attempts to employ techniques from the scientific community have been unable to meet the production tempo at NAVO. Thus, a system that incorporates existing techniques (Marr-Hildreth, Okubo-Weiss, etc.) with internally-developed feature identification methods (from model-derived physical and acoustic properties) is required. Ongoing expansions to the ARCOAS toolset have shown promising early results.

A composite CBRN surveillance and testing service

NASA Astrophysics Data System (ADS)

Niemeyer, Debra M.

2004-08-01

The terrorist threat coupled with a global military mission necessitates quick and accurate identification of environmental hazards, and CBRN early warning. The Air Force Institute for Operational Health (AFIOH) provides fundamental support to protect personnel from and mitigate the effects of untoward hazards exposures. Sustaining healthy communities since 1955, the organizational charter is to enhance warfighter mission effectiveness, protect health, improve readiness and reduce costs, assess and manage risks to human heath and safety, operational performance and the environment. The AFIOH Surveillance Directorate provides forward deployed and reach-back surveillance, agent identification, and environ-mental regulatory compliance testing. Three unique laboratories process and analyze over two million environmental samples and clinical specimens per year, providing analytical chemistry, radiological assessment, and infectious disease testing, in addition to supporting Air Force and Department of Defense (DoD) clinical reference laboratory and force health protection testing. Each laboratory has an applied or investigational testing section where new technologies and techniques are evaluated, and expert consultative support to assist in technology assessments and test analyses. The Epidemiology Surveillance Laboratory and Analytical Chemistry Laboratory are critical assets of the Centers for Disease Control and Prevention (CDC) National Laboratory Response Network. Deployable assets provide direct support to the Combatant Commander and include the Air Force Radiological Assessment Team, and the Biological Augmentation Team. A diverse directorate, the synergistic CBRN response capabilities are a commander"s force protection tool, critical to maintaining combat power.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bordetsky, A; Dougan, A D; Nekoogar, F

The paper addresses technological and operational challenges of developing a global plug-and-play Maritime Domain Security testbed for the Global War on Terrorism mission. This joint NPS-LLNL project is based on the NPS Tactical Network Topology (TNT) composed of long-haul OFDM networks combined with self-forming wireless mesh links to air, surface, ground, and underwater unmanned vehicles. This long-haul network is combined with ultra-wideband (UWB) communications systems for wireless communications in harsh radio propagation channels. LLNL's UWB communication prototypes are designed to overcome shortcomings of the present narrowband communications systems in heavy metallic and constricted corridors inside ships. In the center ofmore » our discussion are networking solutions for the Maritime Interdiction Operation (MIO) Experiments in which geographically distributed command centers and subject matter experts collaborate with the Boarding Party in real time to facilitate situational understanding and course of action selection. The most recent experiment conducted via the testbed extension to the Alameda Island exercised several key technologies aimed at improving MIO. These technologies included UWB communications from within the ship to Boarding Party leader sending data files and pictures, advanced radiation detection equipment for search and identification, biometric equipment to record and send fingerprint files to facilitate rapid positive identification of crew members, and the latest updates of the NPS Tactical Network Topology facilitating reachback to LLNL, Biometric Fusion Center, USCG, and DTRA experts.« less

Inhibition of metastatic tumor growth in mouse lung by repeated administration of polyethylene glycol-conjugated catalase: quantitative analysis with firefly luciferase-expressing melanoma cells.

PubMed

Hyoudou, Kenji; Nishikawa, Makiya; Umeyama, Yukari; Kobayashi, Yuki; Yamashita, Fumiyoshi; Hashida, Mitsuru

2004-11-15

To develop a novel and effective approach to inhibit tumor metastasis based on controlled delivery of catalase, we first evaluated the characteristics of the disposition and proliferation of tumor cells. Then, we examined the effects of polyethylene glycol-conjugated catalase (PEG-catalase) on tumor metastasis. On the basis of the results obtained, PEG-catalase was repetitively administered to completely suppress the growth of tumor cells. Murine melanoma B16-BL6 cells were stably transfected with firefly luciferase gene to obtain B16-BL6/Luc cells. These cells were injected intravenously into syngeneic C57BL/6 mice. PEG-catalase was injected intravenously, and the effect was evaluated by measuring the luciferase activity as the indicator of the number of tumor cells. At 1 hour after injection of B16-BL6/Luc cells, 60 to 90% of the injected cells were recovered in the lung. The numbers decreased to 2 to 4% at 24 hours, then increased. An injection of PEG-catalase just before inoculation significantly reduced the number of tumor cells at 24 hours. Injection of PEG-catalase at 1 or 3 days after inoculation was also effective in reducing the cell numbers. Daily dosing of PEG-catalase greatly inhibited the proliferation and the number assayed at 14 days after inoculation was not significantly different from the minimal number observed at 1 day, suggesting that the growth had been markedly suppressed by the treatment. These findings indicate that sustained catalase activity in the blood circulation can prevent the multiple processes of tumor metastasis in the lung, which could lead to a state of tumor dormancy.

Computational investigation of the effect of pH on the color of firefly bioluminescence by DFT.

PubMed

Pinto da Silva, Luís; Esteves da Silva, Joaquim C G

2011-04-04

In spite of recent advances towards understanding the mechanism of firefly bioluminescence, there is no consensus about which oxyluciferin (OxyLH(2)) species are the red and yellow-green emitters. The crystal structure of Luciola cruciata luciferase (LcLuc) revealed different conformations for the various steps of the bioluminescence reaction, with different degrees of polarity and rigidity of the active-site microenvironment. In this study, these different conformations of luciferase (Luc) are simulated and their effects on the different chemical equilibria of OxyLH(2) are investigated as a function of pH by means of density functional theory with the PBE0 functional. In particular, the thermodynamic properties and the absorption spectra of each species, as well as their relative stabilities in the ground and excited states, were computed in the different conformations of Luc. From the calculations it is possible to derive the acid dissociation and tautomeric constants, and the corresponding distribution diagrams. It is observed that the anionic keto form of OxyLH(2) is both the red and the yellow-green emitter. Consequently, the effect of Luc conformations on the structural and electronic properties of the Keto-(-1) form are studied. Finally, insights into the Luc-catalyzed light-emitting reaction are derived from the calculations. The multicolor bioluminescence can be explained by interactions of the emitter with active-site molecules, the effects of which on light emission are modulated by the internal dielectric constant of the different conformations. These interactions can suffer also from rearrangement due to entry of external solvent and changes in the protonation state of some amino acid residues and adenosine monophosphate (AMP). Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Uric Acid Spherulites in the Reflector Layer of Firefly Light Organ

PubMed Central

Goh, King-Siang; Sheu, Hwo-Shuenn; Hua, Tzu-En; Kang, Mei-Hua; Li, Chia-Wei

2013-01-01

Background In firefly light organs, reflector layer is a specialized tissue which is believed to play a key role for increasing the bioluminescence intensity through reflection. However, the nature of this unique tissue remains elusive. In this report, we investigated the role, fine structure and nature of the reflector layer in the light organ of adult Luciola cerata. Principal Findings Our results indicated that the reflector layer is capable of reflecting bioluminescence, and contains abundant uric acid. Electron microscopy (EM) demonstrated that the cytosol of the reflector layer's cells is filled with densely packed spherical granules, which should be the uric acid granules. These granules are highly regular in size (∼700 nm in diameter), and exhibit a radial internal structure. X-ray diffraction (XRD) analyses revealed that an intense single peak pattern with a d-spacing value of 0.320 nm is specifically detected in the light organ, and is highly similar to the diffraction peak pattern and d-spacing value of needle-formed crystals of monosodium urate monohydrate. However, the molar ratio evaluation of uric acid to various cations (K+, Na+, Ca2+ and Mg2+) in the light organ deduced that only a few uric acid molecules were in the form of urate salts. Thus, non-salt uric acid should be the source of the diffraction signal detected in the light organ. Conclusions In the light organ, the intense single peak diffraction signal might come from a unique needle-like uric acid form, which is different from other known structures of non-salt uric acid form. The finding of a radial structure in the granules of reflector layer implies that the spherical uric acid granules might be formed by the radial arrangement of needle-formed packing matter. PMID:23441187

FireFly: reconfigurable optical wireless networking data centers

NASA Astrophysics Data System (ADS)

Kavehrad, Mohsen; Deng, Peng; Gupta, H.; Longtin, J.; Das, S. R.; Sekar, V.

2017-01-01

We explore a novel, free-space optics based approach for building data center interconnects. Data centers (DCs) are a critical piece of today's networked applications in both private and public sectors. The key factors that have driven this trend are economies of scale, reduced management costs, better utilization of hardware via statistical multiplexing, and the ability to elastically scale applications in response to changing workload patterns. A robust DC network fabric is fundamental to the success of DCs and to ensure that the network does not become a bottleneck for high-performance applications. In this context, DC network design must satisfy several goals: high performance (e.g., high throughput and low latency), low equipment and management cost, robustness to dynamic traffic patterns, incremental expandability to add new servers or racks, and other practical concerns such as cabling complexity, and power and cooling costs. Current DC network architectures do not seem to provide a satisfactory solution, with respect to the above requirements. In particular, traditional static (wired) networks are either overprovisioned or oversubscribed. Recent works have tried to overcome the above limitations by augmenting a static (wired) "core" with some flexible links (RF-wireless or optical). These augmented architectures show promise, but offer only incremental improvement in performance. Specifically, RFwireless based augmented solutions also offer only limited performance improvement, due to inherent interference and range constraints of RF links. This paper explores an alternative design point—a fully flexible and all-wireless DC interrack network based on free-space optical (FSO) links. We call this FireFly as in; Free-space optical Inter-Rack nEtwork with high FLexibilitY. We will present our designs and tests using various configurations that can help the performance and reliability of the FSO links.

Transient, Inducible, Placenta-Specific Gene Expression in Mice

PubMed Central

Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.

2012-01-01

Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919

Simultaneous measurement of adenosine triphosphate release and aggregation potentiates human platelet aggregation responses for some subjects, including persons with Quebec platelet disorder.

PubMed

Hayward, C P M; Moffat, K A; Castilloux, J-F; Liu, Y; Seecharan, J; Tasneem, S; Carlino, S; Cormier, A; Rivard, G E

2012-04-01

Platelet aggregometry and dense granule adenosine triphosphate (ATP) release assays are helpful to diagnose platelet disorders. Some laboratories simultaneously measure aggregation and ATP release using Chronolume® a commercial reagent containing D-luciferin, firefly luciferase and magnesium. Chronolume® can potentiate sub-maximal aggregation responses, normalising canine platelet disorder findings. We investigated if Chronolume® potentiates human platelet aggregation responses after observing discrepancies suspicious of potentiation. Among patients simultaneously tested by light transmission aggregometry (LTA) on two instruments, 18/43 (42%), including 14/24 (58%) with platelet disorders, showed full secondary aggregation with one or more agonists only in tests with Chronolume®. As subjects with Quebec platelet disorder (QPD) did not show the expected absent secondary aggregation responses to epinephrine in tests with Chronolume®, the reason for the discrepancy was investigated using samples from 10 QPD subjects. Like sub-threshold ADP (0.75 μM), Chronolume® significantly increased QPD LTA responses to epinephrine (p<0.0001) and it increased both initial and secondary aggregation responses, leading to dense granule release. This potentiation was not restricted to QPD and it was mimicked adding 1-2 mM magnesium, but not D-luciferin or firefly luciferase, to LTA assays. Chronolume® potentiated the ADP aggregation responses of QPD subjects with a reduced response. Furthermore, it increased whole blood aggregation responses of healthy control samples to multiple agonists, tested at concentrations used for the diagnosis of platelet disorders (p values <0.05). Laboratories should be aware that measuring ATP release with Chronolume® can potentiate LTA and whole blood aggregation responses, which alters findings for some human platelet disorders, including QPD.

Angiotensin-converting enzyme 2 is subject to post-transcriptional regulation by miR-421.

PubMed

Lambert, Daniel W; Lambert, Louise A; Clarke, Nicola E; Hooper, Nigel M; Porter, Karen E; Turner, Anthony J

2014-08-01

ACE2 (angiotensin converting enzyme 2) plays a critical role in the local tissue RAS (renin-angiotensin system) by hydrolysing the potent hypertensive and mitogenic peptide AngII (angiotensin II). Changes in the levels of ACE2 have been observed in a number of pathologies, including cardiovascular disease, but little is known of the mechanisms regulating its expression. In the present study, therefore, the potential role of miRNAs in the regulation of ACE2 expression in primary human cardiac myofibroblasts was examined. Putative miRNA-binding sites were identified in the 3'-UTR of the ACE2 transcript using online prediction algorithms. Two of these, miR-200b and miR-421, were selected for further analysis. A reporter system using the 3'-UTR of ACE2 fused to the coding region of firefly luciferase was used to determine the functionality of the identified binding sites in vitro. This identified miR-421, but not miR-200b, as a potential regulator of ACE2. The ability of miR-421, an miRNA implicated in the development of thrombosis, to down-regulate ACE2 expression was subsequently confirmed by Western blot analysis of both primary cardiac myofibroblasts and transformed cells transfected with a synthetic miR-421 precursor. Real-time PCR analysis of miR-421 revealed widespread expression in human tissues. miR-421 levels in cardiac myofibroblasts showed significant inter-patient variability, in keeping with the variability of ACE2 expression we have observed previously. In conclusion, the present study is the first to demonstrate that ACE2 may be subject to post-transcriptional regulation and reveals a novel potential therapeutic target, miR-421, which could be exploited to modulate ACE2 expression in disease.

A General Purpose Experiment Controller for low cost Space Application

NASA Astrophysics Data System (ADS)

Guzman-Garcia, D.; Rowland, D. E.; Uribe, P.; Nieves-Chinchilla, T.

2012-12-01

Space activities are very expensive and include a high degree of risk. Nowadays, CubeSat missions represent a fast and inexpensive way to conduct scientific space research. These platforms are less expensive to develop and build than conventional satellites. There are ample demonstration that these platforms are well suited for a wide range of science missions in different fields, such as astrobiology, astronomy, atmospheric science, space weather and biology. This paper presents a hybrid "processor in an Field Programmable Gate Array (FPGA)" experiment/spacecraft controller for Cubesat missions. The system has two objectives, first is to obtain a multipurpose and easily customizable system aimed at processing the data from the widest kind of instruments and second, to provide the system with the highest processing capabilities in order to be able to perform complex onboard algorithms. Due to the versatility of the system and its reduced dimensions, it can be employed in different space platforms. The system is envisioned to be employed for the first time as the smart radio receiver for the upcoming NASA FireStation instrument. It is one of four experiments manifested to fly on an experiment pallet the U.S Department of Defense plans to deploy on the International Space Station in 2013. FireStation will continue analyzing the link between the Lightning and the Terrestrial Gamma Rays initiated by the FireFly Cubesat. The system is responsible for the management of a set of small Heliophysics instrumentats, including a photometer, magnetometer, and electric and magnetic field antennas. A description of the system architecture and its main features are presented. The main functional and performance tests during the integration and calibration phase of the instruments are also discussed.

A hybrid SVM-FFA method for prediction of monthly mean global solar radiation

NASA Astrophysics Data System (ADS)

Shamshirband, Shahaboddin; Mohammadi, Kasra; Tong, Chong Wen; Zamani, Mazdak; Motamedi, Shervin; Ch, Sudheer

2016-07-01

In this study, a hybrid support vector machine-firefly optimization algorithm (SVM-FFA) model is proposed to estimate monthly mean horizontal global solar radiation (HGSR). The merit of SVM-FFA is assessed statistically by comparing its performance with three previously used approaches. Using each approach and long-term measured HGSR, three models are calibrated by considering different sets of meteorological parameters measured for Bandar Abbass situated in Iran. It is found that the model (3) utilizing the combination of relative sunshine duration, difference between maximum and minimum temperatures, relative humidity, water vapor pressure, average temperature, and extraterrestrial solar radiation shows superior performance based upon all approaches. Moreover, the extraterrestrial radiation is introduced as a significant parameter to accurately estimate the global solar radiation. The survey results reveal that the developed SVM-FFA approach is greatly capable to provide favorable predictions with significantly higher precision than other examined techniques. For the SVM-FFA (3), the statistical indicators of mean absolute percentage error (MAPE), root mean square error (RMSE), relative root mean square error (RRMSE), and coefficient of determination ( R 2) are 3.3252 %, 0.1859 kWh/m2, 3.7350 %, and 0.9737, respectively which according to the RRMSE has an excellent performance. As a more evaluation of SVM-FFA (3), the ratio of estimated to measured values is computed and found that 47 out of 48 months considered as testing data fall between 0.90 and 1.10. Also, by performing a further verification, it is concluded that SVM-FFA (3) offers absolute superiority over the empirical models using relatively similar input parameters. In a nutshell, the hybrid SVM-FFA approach would be considered highly efficient to estimate the HGSR.

Reporter Proteins in Whole-Cell Optical Bioreporter Detection Systems, Biosensor Integrations, and Biosensing Applications

PubMed Central

Close, Dan M.; Ripp, Steven; Sayler, Gary S.

2009-01-01

Whole-cell, genetically modified bioreporters are designed to emit detectable signals in response to a target analyte or related group of analytes. When integrated with a transducer capable of measuring those signals, a biosensor results that acts as a self-contained analytical system useful in basic and applied environmental, medical, pharmacological, and agricultural sciences. Historically, these devices have focused on signaling proteins such as green fluorescent protein, aequorin, firefly luciferase, and/or bacterial luciferase. The biochemistry and genetic development of these sensor systems as well as the advantages, challenges, and common applications of each one will be discussed. PMID:22291559

High throughput selection of antibiotic-resistant transgenic Arabidopsis plants.

PubMed

Nagashima, Yukihiro; Koiwa, Hisashi

2017-05-15

Kanamycin resistance is the most frequently used antibiotic-resistance marker for Arabidopsis transformations, however, this method frequently causes escape of untransformed plants, particularly at the high seedling density during the selection. Here we developed a robust high-density selection method using top agar for Arabidopsis thaliana. Top agar effectively suppressed growth of untransformed wild-type plants on selection media at high density. Survival of the transformed plants during the selection were confirmed by production of green true leaves and expression of a firefly luciferase reporter gene. Top agar method allowed selection using a large amount of seeds in Arabidopsis transformation. Copyright © 2017 Elsevier Inc. All rights reserved.

Adenosine triphosphate (ATP) as a possible indicator of extraterrestrial biology

NASA Technical Reports Server (NTRS)

Chappelle, E. W.; Picciolo, G. L.

1974-01-01

The ubiquity of adenosine triphosphate (ATP) in terrestrial organisms provides the basis for proposing the assay of this vital metabolic intermediate for detecting extraterrestrial biological activity. If an organic carbon chemistry is present on the planets, the occurrence of ATP is possible either from biosynthetic or purely chemical reactions. However, ATP's relative complexity minimizes the probability of abiogenic synthesis. A sensitive technique for the quantitative detection of ATP was developed using the firefly bioluminescent reaction. The procedure was used successfully for the determination of the ATP content of soil and bacteria. This technique is also being investigated from the standpoint of its application in clinical medicine.

Novel approach for streamflow forecasting using a hybrid ANFIS-FFA model

NASA Astrophysics Data System (ADS)

Yaseen, Zaher Mundher; Ebtehaj, Isa; Bonakdari, Hossein; Deo, Ravinesh C.; Danandeh Mehr, Ali; Mohtar, Wan Hanna Melini Wan; Diop, Lamine; El-shafie, Ahmed; Singh, Vijay P.

2017-11-01

The present study proposes a new hybrid evolutionary Adaptive Neuro-Fuzzy Inference Systems (ANFIS) approach for monthly streamflow forecasting. The proposed method is a novel combination of the ANFIS model with the firefly algorithm as an optimizer tool to construct a hybrid ANFIS-FFA model. The results of the ANFIS-FFA model is compared with the classical ANFIS model, which utilizes the fuzzy c-means (FCM) clustering method in the Fuzzy Inference Systems (FIS) generation. The historical monthly streamflow data for Pahang River, which is a major river system in Malaysia that characterized by highly stochastic hydrological patterns, is used in the study. Sixteen different input combinations with one to five time-lagged input variables are incorporated into the ANFIS-FFA and ANFIS models to consider the antecedent seasonal variations in historical streamflow data. The mean absolute error (MAE), root mean square error (RMSE) and correlation coefficient (r) are used to evaluate the forecasting performance of ANFIS-FFA model. In conjunction with these metrics, the refined Willmott's Index (Drefined), Nash-Sutcliffe coefficient (ENS) and Legates and McCabes Index (ELM) are also utilized as the normalized goodness-of-fit metrics. Comparison of the results reveals that the FFA is able to improve the forecasting accuracy of the hybrid ANFIS-FFA model (r = 1; RMSE = 0.984; MAE = 0.364; ENS = 1; ELM = 0.988; Drefined = 0.994) applied for the monthly streamflow forecasting in comparison with the traditional ANFIS model (r = 0.998; RMSE = 3.276; MAE = 1.553; ENS = 0.995; ELM = 0.950; Drefined = 0.975). The results also show that the ANFIS-FFA is not only superior to the ANFIS model but also exhibits a parsimonious modelling framework for streamflow forecasting by incorporating a smaller number of input variables required to yield the comparatively better performance. It is construed that the FFA optimizer can thus surpass the accuracy of the traditional ANFIS model in general, and is able to remove the false (inaccurately) forecasted data in the ANFIS model for extremely low flows. The present results have wider implications not only for streamflow forecasting purposes, but also for other hydro-meteorological forecasting variables requiring only the historical data input data, and attaining a greater level of predictive accuracy with the incorporation of the FFA algorithm as an optimization tool in an ANFIS model.

Near-optimal alternative generation using modified hit-and-run sampling for non-linear, non-convex problems

NASA Astrophysics Data System (ADS)

Rosenberg, D. E.; Alafifi, A.

2016-12-01

Water resources systems analysis often focuses on finding optimal solutions. Yet an optimal solution is optimal only for the modelled issues and managers often seek near-optimal alternatives that address un-modelled objectives, preferences, limits, uncertainties, and other issues. Early on, Modelling to Generate Alternatives (MGA) formalized near-optimal as the region comprising the original problem constraints plus a new constraint that allowed performance within a specified tolerance of the optimal objective function value. MGA identified a few maximally-different alternatives from the near-optimal region. Subsequent work applied Markov Chain Monte Carlo (MCMC) sampling to generate a larger number of alternatives that span the near-optimal region of linear problems or select portions for non-linear problems. We extend the MCMC Hit-And-Run method to generate alternatives that span the full extent of the near-optimal region for non-linear, non-convex problems. First, start at a feasible hit point within the near-optimal region, then run a random distance in a random direction to a new hit point. Next, repeat until generating the desired number of alternatives. The key step at each iterate is to run a random distance along the line in the specified direction to a new hit point. If linear equity constraints exist, we construct an orthogonal basis and use a null space transformation to confine hits and runs to a lower-dimensional space. Linear inequity constraints define the convex bounds on the line that runs through the current hit point in the specified direction. We then use slice sampling to identify a new hit point along the line within bounds defined by the non-linear inequity constraints. This technique is computationally efficient compared to prior near-optimal alternative generation techniques such MGA, MCMC Metropolis-Hastings, evolutionary, or firefly algorithms because search at each iteration is confined to the hit line, the algorithm can move in one step to any point in the near-optimal region, and each iterate generates a new, feasible alternative. We use the method to generate alternatives that span the near-optimal regions of simple and more complicated water management problems and may be preferred to optimal solutions. We also discuss extensions to handle non-linear equity constraints.

New Breed of Mice May Improve Accuracy for Preclinical Testing of Cancer Drugs | Poster

Cancer.gov

A new breed of lab animals, dubbed “glowing head mice,” may do a better job than conventional mice in predicting the success of experimental cancer drugs—while also helping to meet an urgent need for more realistic preclinical animal models. The mice were developed to tolerate often-used light-emitting molecules, such as luciferase from fireflies and green fluorescent protein (GFP) from jellyfish. These “optical reporters” are useful for monitoring the effect of experimental therapies in live animals over time because they emit an immediate and easily detected light signal showing whether a tumor inside the animal’s body is shrinking as desired.

Use of Humanized RS-ATL8 Reporter System for Detection of Allergen-Specific IgE Sensitization in Human Food Allergy.

PubMed

Ali, Eman Ali; Nakamura, Ryosuke; Falcone, Franco H

2017-01-01

Allergen-specific Immunoglobulin E (IgE) determination lies at the heart of diagnosis of sensitization to food and other allergens. In the past few years, reporter systems capable of detecting the presence of allergen-specific IgE have been developed by several labs. These rely on humanized rat basophil leukemia cell lines stably transfected with reporter genes such as firefly luciferase. In this chapter, we describe protocols for the use of the RS-ATL8 cell line (IgE cross-linking-induced luciferase expression; EXiLE) in 96-well and 384-well formats. We also describe optional treatment steps for enveloped virus and complement inactivation.

Synchronization in a non-uniform network of excitatory spiking neurons

NASA Astrophysics Data System (ADS)

Echeveste, Rodrigo; Gros, Claudius

Spontaneous synchronization of pulse coupled elements is ubiquitous in nature and seems to be of vital importance for life. Networks of pacemaker cells in the heart, extended populations of southeast asian fireflies, and neuronal oscillations in cortical networks, are examples of this. In the present work, a rich repertoire of dynamical states with different degrees of synchronization are found in a network of excitatory-only spiking neurons connected in a non-uniform fashion. In particular, uncorrelated and partially correlated states are found without the need for inhibitory neurons or external currents. The phase transitions between these states, as well the robustness, stability, and response of the network to external stimulus are studied.

The Mechanism of Action of Unique Small Molecules that Inhibit the Pim Protein Kinase Blocking Prostate Cancer Cell Growth

DTIC Science & Technology

2010-05-01

shown. (E) Cap-dependent ( gray bars) and IRES-dependent (black bars) translation in MEFs as measured by Renilla and Firefly luciferase activities...AGC ATC AAC C; EPHA2-R, GTG ACC TCG TAC TTC CAC ACT C. HER3-F, CGA TGC TGA GAA CCA ATA CCA G; HER3-R, ATA GCC TGT CAC TTC TCG AAT C. INSR-F, GGA AGT...TAC GTC TGA TTC GAG G; INSR-R, TGA GTG ATG GTG AGG TTG TG. IGF1R-F, CCT GCA CAA CTC CAT CTT CGT G; IGF1R-R, CGG TGA TGT TGT AGG TGT CTG C. EGFR-F

Long-term ex vivo and in vivo monitoring of tumor progression by using dual luciferases.

PubMed

Morita, Naoki; Haga, Sanae; Ohmiya, Yoshihiro; Ozaki, Michitaka

2016-03-15

We propose a new concept of tumor progression monitoring using dual luciferases in living animals to reduce stress for small animals and the cost of luciferin. The secreted Cypridina luciferase (CLuc) was used as an ex vivo indicator to continuously monitor tumor progression. On the other hand, the non-secreted firefly luciferase was used as an in vivo indicator to analyze the spatial distribution of the tumor at suitable time points indicated by CLuc. Thus, the new monitoring systems that use dual luciferases are available, allowing long-term bioluminescence imaging under minimal stress for the experimental animals. Copyright © 2015 Elsevier Inc. All rights reserved.

Enhanced Beetle Luciferase for High-Resolution Bioluminescence Imaging

PubMed Central

Nakajima, Yoshihiro; Yamazaki, Tomomi; Nishii, Shigeaki; Noguchi, Takako; Hoshino, Hideto; Niwa, Kazuki; Viviani, Vadim R.; Ohmiya, Yoshihiro

2010-01-01

We developed an enhanced green-emitting luciferase (ELuc) to be used as a bioluminescence imaging (BLI) probe. ELuc exhibits a light signal in mammalian cells that is over 10-fold stronger than that of the firefly luciferase (FLuc), which is the most widely used luciferase reporter gene. We showed that ELuc produces a strong light signal in primary cells and tissues and that it enables the visualization of gene expression with high temporal resolution at the single-cell level. Moreover, we successfully imaged the nucleocytoplasmic shuttling of importin α by fusing ELuc at the intracellular level. These results demonstrate that the use of ELuc allows a BLI spatiotemporal resolution far greater than that provided by FLuc. PMID:20368807

Genetic Manipulation of Schistosoma haematobium, the Neglected Schistosome

PubMed Central

Rinaldi, Gabriel; Okatcha, Tunika I.; Popratiloff, Anastas; Ayuk, Mary A.; Suttiprapa, Sutas; Mann, Victoria H.; Liang, Yung-san; Lewis, Fred A.; Loukas, Alex; Brindley, Paul J.

2011-01-01

Background Minimal information on the genome and proteome of Schistosoma haematobium is available, in marked contrast to the situation with the other major species of human schistosomes for which draft genome sequences have been reported. Accordingly, little is known about functional genomics in S. haematobium, including the utility or not of RNA interference techniques that, if available, promise to guide development of new interventions for schistosomiasis haematobia. Methods/Findings Here we isolated and cultured developmental stages of S. haematobium, derived from experimentally infected hamsters. Targeting different developmental stages, we investigated the utility of soaking and/or square wave electroporation in order to transfect S. haematobium with nucleic acid reporters including Cy3-labeled small RNAs, messenger RNA encoding firefly luciferase, and short interfering RNAs (siRNAs). Three hours after incubation of S. haematobium eggs in 50 ng/µl Cy3-labeled siRNA, fluorescent foci were evident indicating that labeled siRNA had penetrated into miracidia developing within the egg shell. Firefly luciferase activity was detected three hours after square wave electroporation of the schistosome eggs and adult worms in 150 ng/µl of mRNA. RNA interference knockdown (silencing) of reporter luciferase activity was seen following the introduction of dsRNA specific for luciferase mRNA in eggs, schistosomules and mixed sex adults. Moreover, introduction of an endogenous gene-specific siRNA into adult schistosomes silenced transcription of tetraspanin 2 (Sh-tsp-2), the apparent orthologue of the Schistosoma mansoni gene Sm-tsp-2 which encodes the surface localized structural and signaling protein Sm-TSP-2. Together, knockdown of reporter luciferase and Sh-tsp-2 indicated the presence of an intact RNAi pathway in S. haematobium. Also, we employed laser scanning confocal microscopy to view the adult stages of S. haematobium. Conclusions These findings and approaches should facilitate analysis of gene function in S. haematobium, which in turn could facilitate the characterization of prospective intervention targets for this neglected tropical disease pathogen. PMID:22022628

Demonstration of protein-fragment complementation assay using purified firefly luciferase fragments

PubMed Central

2013-01-01

Background Human interactome is predicted to contain 150,000 to 300,000 protein-protein interactions, (PPIs). Protein-fragment complementation assay (PCA) is one of the most widely used methods to detect PPI, as well as Förster resonance energy transfer (FRET). To date, successful applications of firefly luciferase (Fluc)-based PCA have been reported in vivo, in cultured cells and in cell-free lysate, owing to its high sensitivity, high signal-to-background (S/B) ratio, and reversible response. Here we show the assay also works with purified proteins with unexpectedly rapid kinetics. Results Split Fluc fragments both fused with a rapamycin-dependently interacting protein pair were made and expressed in E. coli system, and purified to homogeneity. When the proteins were used for PCA to detect rapamycin-dependent PPI, they enabled a rapid detection (~1 s) of PPI with high S/B ratio. When Fn7-8 domains (7 nm in length) that was shown to abrogate GFP mutant-based FRET was inserted between split Fluc and FKBP12 as a rigid linker, it still showed some response, suggesting less limitation in interacting partner’s size. Finally, the stability of the probe was investigated. Preincubation of the probes at 37 degreeC up to 1 h showed marked decrease of the luminescent signal to 1.5%, showing the limited stability of this system. Conclusion Fluc PCA using purified components will enable a rapid and handy detection of PPIs with high S/B ratio, avoiding the effects of concomitant components. Although the system might not be suitable for large-scale screening due to its limited stability, it can detect an interaction over larger distance than by FRET. This would be the first demonstration of Fluc PCA in vitro, which has a distinct advantage over other PPI assays. Our system enables detection of direct PPIs without risk of perturbation by PPI mediators in the complex cellular milieu. PMID:23536995

Extracts of Fruits and Vegetables Activate the Antioxidant Response Element in IMR-32 Cells.

PubMed

Orena, Stephen; Owen, Jennifer; Jin, Fuxia; Fabian, Morgan; Gillitt, Nicholas D; Zeisel, Steven H

2015-09-01

The biological effects of antioxidant nutrients are mediated in part by activation of antioxidant response elements (AREs) on genes for enzymes involved in endogenous pathways that prevent free radical damage. Traditional approaches for identifying antioxidant molecules in foods, such as total phenolic compound (TP) content or oxygen radical absorption capacity (ORAC), do not measure capacity to activate AREs. The goal of this study was to develop an assay to assess the ARE activation capacity of fruit and vegetable extracts and determine whether such capacity was predicted by TP content and/or ORAC activity. Fruits and vegetables were homogenized, extracted with acidified ethanol, lyophilized, and resuspended in growth medium. Human IMR-32 neuroblastoma cells, transfected with an ARE-firefly luciferase reporter, were exposed to extracts for 5 h. Firefly luciferase was normalized to constitutively expressed Renilla luciferase with tertiary butylhydroquinone (tBHQ) as a positive control. TP content and ORAC activity were measured for each extract. Relations between TPs and ORAC and ARE activity were determined. A total of 107 of 134 extracts tested significantly activated the ARE-luciferase reporter from 1.2- to 58-fold above that of the solvent control (P < 0.05) in human IMR-32 cells. ARE activity, TP content, and ORAC ranked higher in peels than in associated flesh. Despite this relation, ARE activity did not correlate with TP content (Spearman ρ = 0.05, P = 0.57) and only modestly but negatively correlated with ORAC (Spearman ρ = -0.24, P < 0.01). Many extracts activated the ARE more than predicted by the TP content or ORAC. The ARE reporter assay identified many active fruit and vegetable extracts in human IMR-32 cells. There are components of fruits and vegetables that activate the ARE but are not phenolic compounds and are low in ORAC. The ARE-luciferase reporter assay is likely a better predictor of the antioxidant benefits of fruits and vegetables than TP or ORAC. © 2015 American Society for Nutrition.

xTract: software for characterizing conformational changes of protein complexes by quantitative cross-linking mass spectrometry.

PubMed

Walzthoeni, Thomas; Joachimiak, Lukasz A; Rosenberger, George; Röst, Hannes L; Malmström, Lars; Leitner, Alexander; Frydman, Judith; Aebersold, Ruedi

2015-12-01

Chemical cross-linking in combination with mass spectrometry generates distance restraints of amino acid pairs in close proximity on the surface of native proteins and protein complexes. In this study we used quantitative mass spectrometry and chemical cross-linking to quantify differences in cross-linked peptides obtained from complexes in spatially discrete states. We describe a generic computational pipeline for quantitative cross-linking mass spectrometry consisting of modules for quantitative data extraction and statistical assessment of the obtained results. We used the method to detect conformational changes in two model systems: firefly luciferase and the bovine TRiC complex. Our method discovers and explains the structural heterogeneity of protein complexes using only sparse structural information.

Evolving technologies in robotic surgery for minimally invasive treatment of gynecologic cancers.

PubMed

Levinson, Kimberly L; Auer, Melinda; Escobar, Pedro F

2013-09-01

Since the introduction of robotic technology, there have been significant changes to the field of gynecologic oncology. The number of minimally invasive procedures has drastically increased, with robotic procedures rising remarkably. With recent evidence suggesting that minimally invasive techniques should be the standard of care for early endometrial and cervical cancers, the push for new technology and advancements has continued. Several emerging robotic technologies have significant potential in the field of gynecologic oncology. The single-site robotic platform enables robotic surgery through a single incision; the Firefly camera detects the fluorescent dye indocyanine green, which may improve sensitivity in sentinel lymph node biopsy; and a robotic vessel-sealing device and stapler will continue to improve efficiency of the robotic surgeon.

Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

PubMed

Streiff, John H; Jones, Keith A

2008-10-01

The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells.

PubMed

Salvi, Alessandro; Sabelli, Cristiano; Moncini, Silvia; Venturin, Marco; Arici, Bruna; Riva, Paola; Portolani, Nazario; Giulini, Stefano M; De Petro, Giuseppina; Barlati, Sergio

2009-06-01

Urokinase-type plasminogen activator (uPA) and c-met play a major role in cancer invasion and metastasis. Evidence has suggested that uPA and c-met overexpression may be coordinated in human hepatocellular carcinoma (HCC). In the present study, to understand whether the expression of these genes might be coregulated by specific microRNAs (miRs) in human cells, we predicted that Homo sapiens microRNA-23b could recognize two sites in the 3'-UTR of uPA and four sites in the c-met 3'-UTR by the algorithm pictar. The miR-23b expression analysis in human tumor and normal cells revealed an inverse trend with uPA and c-met expression, indicating that uPA and c-met negative regulation might depend on miR-23b expression. Transfection of miR-23b molecules in HCC cells (SKHep1C3) led to inhibition of protein expression of the target genes and caused a decrease in cell migration and proliferation capabilities. Furthermore, anti-miR-23b transfection in human normal AB2 dermal fibroblasts upregulated the expression of endogenous uPA and c-met. Cotransfection experiments in HCC cells of the miR-23b with pGL4.71 Renilla luciferase reporter gene constructs, containing the putative uPA and c-met 3'-UTR target sites, and with the pGL3 firefly luciferase-expressing vector showed a decrease in the relative luciferase activity. This would indicate that miR-23b can recognize target sites in the 3'-UTR of uPA and of c-met mRNAs and translationally repress the expression of uPA and c-met in HCC cells. The evidence obtained shows that overexpression of miR-23b leads to uPA and c-met downregulation and to decreased migration and proliferation abilities of HCC cells.

Prediction of luciferase inhibitors by the high-performance MIEC-GBDT approach based on interaction energetic patterns.

PubMed

Chen, Fu; Sun, Huiyong; Liu, Hui; Li, Dan; Li, Youyong; Hou, Tingjun

2017-04-12

High-throughput screening (HTS) is widely applied in many fields ranging from drug discovery to clinical diagnostics and toxicity assessment. Firefly luciferase is commonly used as a reporter to monitor the effect of chemical compounds on the activity of a specific target or pathway in HTS. However, the false positive rate of luciferase-based HTS is relatively high because many artifacts or promiscuous compounds that have direct interaction with the luciferase reporter enzyme are usually identified as active compounds (hits). Therefore, it is necessary to develop a rapid screening method to identify these compounds that can inhibit the luciferase activity directly. In this study, a virtual screening (VS) classification model called MIEC-GBDT (MIEC: Molecular Interaction Energy Components; GBDT: Gradient Boosting Decision Tree) was developed to distinguish luciferase inhibitors from non-inhibitors. The MIECs calculated by Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) free energy decomposition were used to energetically characterize the binding pattern of each small molecule at the active site of luciferase, and then the GBDT algorithm was employed to construct the classifiers based on MIECs. The predictions to the test set show that the optimized MIEC-GBDT model outperformed molecular docking and MM/GBSA rescoring. The best MIEC-GBDT model based on the MIECs with the energy terms of ΔG ele , ΔG vdW , ΔG GB , and ΔG SA achieves the prediction accuracies of 87.2% and 90.3% for the inhibitors and non-inhibitors in the test sets, respectively. Moreover, the energetic analysis of the vital residues suggests that the energetic contributions of the vital residues to the binding of inhibitors are quite different from those to the binding of non-inhibitors. These results suggest that the MIEC-GBDT model is reliable and can be used as a powerful tool to identify potential interference compounds in luciferase-based HTS experiments.

Novel hybrid linear stochastic with non-linear extreme learning machine methods for forecasting monthly rainfall a tropical climate.

PubMed

Zeynoddin, Mohammad; Bonakdari, Hossein; Azari, Arash; Ebtehaj, Isa; Gharabaghi, Bahram; Riahi Madavar, Hossein

2018-09-15

A novel hybrid approach is presented that can more accurately predict monthly rainfall in a tropical climate by integrating a linear stochastic model with a powerful non-linear extreme learning machine method. This new hybrid method was then evaluated by considering four general scenarios. In the first scenario, the modeling process is initiated without preprocessing input data as a base case. While in other three scenarios, the one-step and two-step procedures are utilized to make the model predictions more precise. The mentioned scenarios are based on a combination of stationarization techniques (i.e., differencing, seasonal and non-seasonal standardization and spectral analysis), and normality transforms (i.e., Box-Cox, John and Draper, Yeo and Johnson, Johnson, Box-Cox-Mod, log, log standard, and Manly). In scenario 2, which is a one-step scenario, the stationarization methods are employed as preprocessing approaches. In scenario 3 and 4, different combinations of normality transform, and stationarization methods are considered as preprocessing techniques. In total, 61 sub-scenarios are evaluated resulting 11013 models (10785 linear methods, 4 nonlinear models, and 224 hybrid models are evaluated). The uncertainty of the linear, nonlinear and hybrid models are examined by Monte Carlo technique. The best preprocessing technique is the utilization of Johnson normality transform and seasonal standardization (respectively) (R 2  = 0.99; RMSE = 0.6; MAE = 0.38; RMSRE = 0.1, MARE = 0.06, UI = 0.03 &UII = 0.05). The results of uncertainty analysis indicated the good performance of proposed technique (d-factor = 0.27; 95PPU = 83.57). Moreover, the results of the proposed methodology in this study were compared with an evolutionary hybrid of adaptive neuro fuzzy inference system (ANFIS) with firefly algorithm (ANFIS-FFA) demonstrating that the new hybrid methods outperformed ANFIS-FFA method. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effect of cadmium on lake water bacteria as determined by the luciferase assay of adenosine triphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seyfried, P.L.; Horgan, C.B.L.

1981-10-01

A firefly luciferase assay of bacterial adenosine triphosphate (ATP) was developed to measure the toxic effects of cadmium ions on aquatic organisms. Toxicity was monitored using intracellular (I/C) ATP (in micrograms per litre) as well as plate counts (colony-forming units per millilitre). The bacteria, which belonged mainly to the families Enterobacteriaceae and Pseudomonadaceae, exhibited varying degrees of resistance to up to 100 ppm cadmium when grown in a glucose-salts medium at pH 6.8. Among the organisms tested, cadmium resistance decreased in the following order: Pseudomonas vesicularis > P. aeruginosa > Enterobacter sp. > P. fluorescens > Chromobacter sp. > Serratiamore » sp. A rise in the pH of the growth medium from 5 to 7 resulted in increased toxicity of cadmium.« less

The effect of growth phase and medium on the use of the firefly adenosine triphosphate (ATP) assay for the quantitation of bacteria

NASA Technical Reports Server (NTRS)

Bush, V. N.; Picciolo, G. L.; Chappelle, E. W.

1975-01-01

Luciferase assay for adenosine triphosphate (ATP) was used as a rapid method to determine the number of bacteria in a urine sample after nonbacterial components were removed. Accurate cellular ATP values, determined when bacteria were grown in an environment similar to that in which they were found, were necessary for the calculation of bacterial titer in urine. Cellular ATP values vary depending on the extraction method, the cell growth phase, and cell growth conditions. ATP per cell values of stationary E. coli grown in urine were two times greater than ATP per cell values of cells grown in trypticase soy broth. Glucose and urea were examined as possible components responsible for the cellular ATP variation.

Chemiluminescent activation of the antiviral activity of hypericin: a molecular flashlight.

PubMed Central

Carpenter, S; Fehr, M J; Kraus, G A; Petrich, J W

1994-01-01

Hypericin is a naturally occurring photosensitizer that displays potent antiviral activity in the presence of light. The absence of light in many regions of the body may preclude the use of hypericin and other photosensitizers as therapeutic compounds for the treatment of viral infections in vivo. The chemiluminescent oxidation of luciferin by the luciferase from the North American firefly Photinus pyralis was found to generate sufficiently intense and long-lived emission to induce antiviral activity of hypericin. Light-induced virucidal activity of hypericin was demonstrated against equine infectious anemia virus, a lentivirus structurally, genetically, and antigenically related to the human immunodeficiency virus. The implications for exploiting chemiluminescence as a "molecular flashlight" for effecting photodynamic therapy against virus-infected cells and tumor cells are discussed. PMID:7991618

View of the Saturn V third stage from which the Apollo 8 has separated

NASA Image and Video Library

1968-12-21

AS08-16-2584 (21 Dec. 1968) --- This is a photograph taken from the Apollo 8 spacecraft looking back at the Saturn V third (S-IVB) stage from which the spacecraft had just separated following trans-lunar injection. Attached to the S-IVB is the Lunar Module Test Article (LTA) which simulated the mass of a Lunar Module (LM) on the Apollo 8 lunar orbit mission. The 29-feet panels of the Spacecraft LM Adapter which enclosed the LTA during launch have already been jettisoned and are out of view. Sunlight reflected from small particles shows the "firefly" phenomenon which was reported by astronaut John H. Glenn Jr. during the first Earth-orbital flight, Mercury-Atlas 6 (MA-6) of the Mercury Program.

View of the Saturn V third stage from which the Apollo 8 has separated

NASA Image and Video Library

1968-12-21

AS08-16-2582 (21 Dec. 1968) --- This is a photograph taken from the Apollo 8 spacecraft looking back at the Saturn V third (S-IVB) stage from which the spacecraft had just separated following trans-lunar injection. (Hold picture with S-IVB at top center). Attached to the S-IVB is the Lunar Module Test Article (LTA) which simulated the mass of a Lunar Module (LM) on the Apollo 8 lunar orbit mission. The 29-feet panels of the Spacecraft LM Adapter which enclosed the LTA during launch have already been jettisoned and are out of view. Sunlight reflected from small particles shows the "firefly" phenomenon which was reported by astronaut John H. Glenn Jr. during the first Earth-orbital flight (Mercury-Atlas 6) of the Mercury Program.

View of the Saturn V third stage from which the Apollo 8 has separated

NASA Image and Video Library

1968-12-21

AS08-16-2583 (21 Dec. 1968) --- This is a photograph taken from the Apollo 8 spacecraft looking back at the Saturn V third (S-IVB) stage from which the spacecraft had just separated following trans-lunar injection. Attached to the S-IVB is the Lunar Module Test Article (LTA) which simulated the mass of a Lunar Module (LM) on the Apollo 8 lunar orbit mission. The 29-feet panels of the Spacecraft LM Adapter which enclosed the LTA during launch have already been jettisoned and are out of view. Sunlight reflected from small particles shows the "firefly" phenomenon which was reported by astronaut John H. Glenn Jr. during the first Earth-orbital flight, Mercury-Atlas 6 (MA-6) of the Mercury Program.

Use of a Fluorometric Imaging Plate Reader in high-throughput screening

NASA Astrophysics Data System (ADS)

Groebe, Duncan R.; Gopalakrishnan, Sujatha; Hahn, Holly; Warrior, Usha; Traphagen, Linda; Burns, David J.

1999-04-01

High-throughput screening (HTS) efforts at Abbott Laboratories have been greatly facilitated by the use of a Fluorometric Imaging Plate Reader. The FLIPR consists of an incubated cabinet with integrated 96-channel pipettor and fluorometer. An argon laser is used to excite fluorophores in a 96-well microtiter plate and the emitted fluorometer. An argon laser is used to excite fluorophores in a 96-well microtiter plate and the emitted fluorescence is imaged by a cooled CCD camera. The image data is downloaded from the camera and processed to average the signal form each well of the microtiter pate for each time point. The data is presented in real time on the computer screen, facilitating interpretation and trouble-shooting. In addition to fluorescence, the camera can also detect luminescence form firefly luciferase.

Optimization and Validation of the TZM-bl Assay for Standardized Assessments of Neutralizing Antibodies Against HIV-1

PubMed Central

Sarzotti-Kelsoe, Marcella; Bailer, Robert T; Turk, Ellen; Lin, Chen-li; Bilska, Miroslawa; Greene, Kelli M.; Gao, Hongmei; Todd, Christopher A.; Ozaki, Daniel A.; Seaman, Michael S.; Mascola, John R.; Montefiori, David C.

2014-01-01

The TZM-bl assay measures antibody-mediated neutralization of HIV-1 as a function of reductions in HIV-1 Tat-regulated firefly luciferase (Luc) reporter gene expression after a single round of infection with Env-pseudotyped viruses. This assay has become the main endpoint neutralization assay used for the assessment of preclinical and clinical trial samples by a growing number of laboratories worldwide. Here we present the results of the formal optimization and validation of the TZM-bl assay, performed in compliance with Good Clinical Laboratory Practice (GCLP) guidelines. The assay was evaluated for specificity, accuracy, precision, limits of detection and quantitation, linearity, range and robustness. The validated manual TZM-bl assay was also adapted, optimized and qualified to an automated 384-well format. PMID:24291345

A rapid method for the determination of microbial susceptibility using the firefly luciferase assay for adenosine triphosphate (ATP)

NASA Technical Reports Server (NTRS)

Vellend, H.; Tuttle, S. A.; Barza, M.; Weinstein, L.; Picciolo, G. L.; Chappelle, E. W.

1975-01-01

Luciferase assay for adenosine triphosphate (ATP) was optimized for pure bacteria in broth in order to evaluate if changes in bacterial ATP content could be used as a rapid measure of antibiotic effect on microorganisms. Broth cultures of log phase bacteria were incubated at 310 K (37 C) for 2.5 hours at antimicrobial concentrations which resulted in the best discrimination between sensitive and resistant strains. Eighty-seven strains of 11 bacterial species were studied for their susceptibility to 12 commonly used antimicrobial agents: ampicillin, Penicillin G, nafcillin, carbenicillin, cephalothin, tetracycline, erythromycin, clindamycin, gentamicin, nitrofurantoin, colistin, and chloramplenicol. The major advantage of the ATP system over existing methods of rapid microbial susceptibility testing is that the assay can be made specific for bacterial ATP.

Controlling DNA compaction with cationic amphiphiles for efficient delivery systems A step forward towards non-viral Gene Therapy

NASA Astrophysics Data System (ADS)

Savarala, Sushma

The synthesis of pyridinium cationic lipids, their counter-ion exchange, and the transfection of lipoplexes consisting of these lipids with firefly luciferase plasmid DNA (6.7 KDa), into lung, prostate and breast cancer cell lines was investigated. The transfection ability of these newly synthesized compounds was found to be twice as high as DOTAP/cholesterol and Lipofectamine TM (two commercially available successful transfection agents). The compaction of the DNA onto silica (SiO2) nanoparticles was also investigated. For this purpose, it was necessary to study the stability and fusion studies of colloidal systems composed of DMPC (1,2-dimyristoyl-sn-glycero-3-phosphocholine), a zwitterionic lipid, and mixtures of DMPC with cationic DMTAP (1,2-dimyristoyl-3-trimethylammonium-propane).

Firefly luciferase-based dynamic bioluminescence imaging: a noninvasive technique to assess tumor angiogenesis.

PubMed

Sun, Amy; Hou, Lewis; Prugpichailers, Tiffany; Dunkel, Jason; Kalani, Maziyar A; Chen, Xiaoyuan; Kalani, M Yashar S; Tse, Victor

2010-04-01

Bioluminescence imaging (BLI) is emerging as a cost-effective, high-throughput, noninvasive, and sensitive imaging modality to monitor cell growth and trafficking. We describe the use of dynamic BLI as a noninvasive method of assessing vessel permeability during brain tumor growth. With the use of stereotactic technique, 10 firefly luciferase-transfected GL26 mouse glioblastoma multiforme cells were injected into the brains of C57BL/6 mice (n = 80). After intraperitoneal injection of D-luciferin (150 mg/kg), serial dynamic BLI was performed at 1-minute intervals (30 seconds exposure) every 2 to 3 days until death of the animals. The maximum intensity was used as an indirect measurement of tumor growth. The adjusted slope of initial intensity (I90/Im) was used as a proxy to monitor the flow rate of blood into the vascular tree. Using a modified Evans blue perfusion protocol, we calculated the relative permeability of the vascular tree at various time points. Daily maximum intensity correlated strongly with tumor volume. At postinjection day 23, histology and BLI demonstrated an exponential growth of the tumor mass. Slopes were calculated to reflect the flow in the vessels feeding the tumor (adjusted slope = I90/Im). The increase in BLI intensity was correlated with a decrease in adjusted slope, reflecting a decrease in the rate of blood flow as tumor volume increased (y = 93.8e-0.49, R2 = 0.63). Examination of calculated slopes revealed a peak in permeability around postinjection day 20 (n = 42, P < .02 by 1-way analysis of variance) and showed a downward trend in relation to both postinjection day and maximum intensity observed; as angiogenesis progressed, tumor vessel caliber increased dramatically, resulting in sluggish but increased flow. This trend was correlated with Evans blue histology, revealing an increase in Evans blue dye uptake into the tumor, as slope calculated by BLI increases. Dynamic BLI is a practical, noninvasive technique that can semiquantitatively monitor changes in vascular permeability and therefore facilitate the study of tumor angiogenesis in animal models of disease.

Quantitative bioluminescence imaging of transgene expression in intact porcine antral follicles in vitro.

PubMed

Jung, Song-yi; Willard, Scott T

2014-01-30

The porcine oocyte maturation in vivo occurs within the ovarian follicle and is regulated by the interactions between oocytes and surrounding follicular components, including theca, granulosa, and cumulus cells, and follicular fluid. Therefore, the antral follicle is an essential microenvironment for efficient oocyte maturation and its developmental competence. Quantitative bioluminescence imaging of firefly luciferase reporter genes in an intact antral follicle would allow investigation of changes in cellular and molecular events and in the context of the whole follicles. In this study, we investigate factors influencing bioluminescence measurements as a first step towards developing a new bioluminescence imaging system for intact antral follicles. We analyzed the time course of bioluminescence emitted from transfected living intact follicles using a cationic lipid mediated gene transfer method with increasing doses (1-3 μg) of firefly luciferase reporter gene (pGL4). In addition, a standard luciferase assay was used to confirm the luciferase expression in granulosa cells in the transfected intact antral follicles. Finally, the dose effects of substrate, D-luciferin, were determined for optimal quantitative bioluminescence imaging of intact porcine antral follicles in vitro. The level of luciferase activity of follicles with 3 μg pGL4 was significantly (P < 0.05) greater than the 1 μg and 2 μg groups at 1 min after D-luciferin injection. The bioluminescence intensity of transfected follicles reached a peak at 1 min, and then it was significantly (P < 0.05) reduced within 2 min after injection of D-luciferin; with the level of bioluminescence emission remained constant from 2.5 to 10 min. The bioluminescence emission was maximal with 300 μg of D-luciferin. The results of this study suggested that the investigation of factors influencing bioluminescence measurements is a critical step toward developing a new bioluminescence imaging model. This study is the first to demonstrate that reporter genes can be transferred to intact granulosa cells with a lipid-mediated gene transfer method within intact follicles in vitro, and the level of transgene expression can be assessed by bioluminescence imaging in living intact antral follicles.

Participatory surveillance of diabetes device safety: a social media-based complement to traditional FDA reporting.

PubMed

Mandl, Kenneth D; McNabb, Marion; Marks, Norman; Weitzman, Elissa R; Kelemen, Skyler; Eggleston, Emma M; Quinn, Maryanne

2014-01-01

Malfunctions or poor usability of devices measuring glucose or delivering insulin are reportable to the FDA. Manufacturers submit 99.9% of these reports. We test online social networks as a complementary source to traditional FDA reporting of device-related adverse events. Participatory surveillance of members of a non-profit online social network, TuDiabetes.org, from October 2011 to September 2012. Subjects were volunteers from a group within TuDiabetes, actively engaged online in participatory surveillance. They used the free TuAnalyze app, a privacy-preserving method to report detailed clinical information, available through the network. Network members were polled about finger-stick blood glucose monitors, continuous glucose monitors, and insulin delivery devices, including insulin pumps and insulin pens. Of 549 participants, 75 reported device-related adverse events, nearly half (48.0%) requiring intervention from another person to manage the event. Only three (4.0%) of these were reported by participants to the FDA. All TuAnalyze reports contained outcome information compared with 22% of reports to the FDA. Hypoglycemia and hyperglycemia were experienced by 48.0% and 49.3% of participants, respectively. Members of an online community readily engaged in participatory surveillance. While polling distributed online populations does not yield generalizable, denominator-based rates, this approach can characterize risk within online communities using a bidirectional communication channel that enables reach-back and intervention. Engagement of distributed communities in social networks is a viable complementary approach to traditional public health surveillance for adverse events related to medical devices. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Networked sensors for the combat forces

NASA Astrophysics Data System (ADS)

Klager, Gene

2004-11-01

Real-time and detailed information is critical to the success of ground combat forces. Current manned reconnaissance, surveillance, and target acquisition (RSTA) capabilities are not sufficient to cover battlefield intelligence gaps, provide Beyond-Line-of-Sight (BLOS) targeting, and the ambush avoidance information necessary for combat forces operating in hostile situations, complex terrain, and conducting military operations in urban terrain. This paper describes a current US Army program developing advanced networked unmanned/unattended sensor systems to survey these gaps and provide the Commander with real-time, pertinent information. Networked Sensors for the Combat Forces plans to develop and demonstrate a new generation of low cost distributed unmanned sensor systems organic to the RSTA Element. Networked unmanned sensors will provide remote monitoring of gaps, will increase a unit"s area of coverage, and will provide the commander organic assets to complete his Battlefield Situational Awareness (BSA) picture for direct and indirect fire weapons, early warning, and threat avoidance. Current efforts include developing sensor packages for unmanned ground vehicles, small unmanned aerial vehicles, and unattended ground sensors using advanced sensor technologies. These sensors will be integrated with robust networked communications and Battle Command tools for mission planning, intelligence "reachback", and sensor data management. The network architecture design is based on a model that identifies a three-part modular design: 1) standardized sensor message protocols, 2) Sensor Data Management, and 3) Service Oriented Architecture. This simple model provides maximum flexibility for data exchange, information management and distribution. Products include: Sensor suites optimized for unmanned platforms, stationary and mobile versions of the Sensor Data Management Center, Battle Command planning tools, networked communications, and sensor management software. Details of these products and recent test results will be presented.

Sensor fusion IV: Control paradigms and data structures; Proceedings of the Meeting, Boston, MA, Nov. 12-15, 1991

NASA Technical Reports Server (NTRS)

Schenker, Paul S. (Editor)

1992-01-01

Various papers on control paradigms and data structures in sensor fusion are presented. The general topics addressed include: decision models and computational methods, sensor modeling and data representation, active sensing strategies, geometric planning and visualization, task-driven sensing, motion analysis, models motivated biology and psychology, decentralized detection and distributed decision, data fusion architectures, robust estimation of shapes and features, application and implementation. Some of the individual subjects considered are: the Firefly experiment on neural networks for distributed sensor data fusion, manifold traversing as a model for learning control of autonomous robots, choice of coordinate systems for multiple sensor fusion, continuous motion using task-directed stereo vision, interactive and cooperative sensing and control for advanced teleoperation, knowledge-based imaging for terrain analysis, physical and digital simulations for IVA robotics.

High-throughput Titration of Luciferase-expressing Recombinant Viruses

PubMed Central

Garcia, Vanessa; Krishnan, Ramya; Davis, Colin; Batenchuk, Cory; Le Boeuf, Fabrice; Abdelbary, Hesham; Diallo, Jean-Simon

2014-01-01

Standard plaque assays to determine infectious viral titers can be time consuming, are not amenable to a high volume of samples, and cannot be done with viruses that do not form plaques. As an alternative to plaque assays, we have developed a high-throughput titration method that allows for the simultaneous titration of a high volume of samples in a single day. This approach involves infection of the samples with a Firefly luciferase tagged virus, transfer of the infected samples onto an appropriate permissive cell line, subsequent addition of luciferin, reading of plates in order to obtain luminescence readings, and finally the conversion from luminescence to viral titers. The assessment of cytotoxicity using a metabolic viability dye can be easily incorporated in the workflow in parallel and provide valuable information in the context of a drug screen. This technique provides a reliable, high-throughput method to determine viral titers as an alternative to a standard plaque assay. PMID:25285536

The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

PubMed

de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

2015-11-01

In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

PubMed

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Monitoring protein-protein interactions using split synthetic renilla luciferase protein-fragment-assisted complementation.

PubMed

Paulmurugan, R; Gambhir, S S

2003-04-01

In this study we developed an inducible synthetic renilla luciferase protein-fragment-assisted complementation-based bioluminescence assay to quantitatively measure real time protein-protein interactions in mammalian cells. We identified suitable sites to generate fragments of N and C portions of the protein that yield significant recovered activity through complementation. We validate complementation-based activation of split synthetic renilla luciferase protein driven by the interaction of two strongly interacting proteins, MyoD and Id, in five different cell lines utilizing transient transfection studies. The expression level of the system was also modulated by tumor necrosis factor alpha through NFkappaB-promoter/enhancer elements used to drive expression of the N portion of synthetic renilla luciferase reporter gene. This new system should help in studying protein-protein interactions and when used with other split reporters (e.g., split firefly luciferase) should help to monitor different components of an intracellular network.

Monitoring Protein–Protein Interactions Using Split Synthetic Renilla Luciferase Protein-Fragment-Assisted Complementation

PubMed Central

Paulmurugan, R.; Gambhir, S. S.

2014-01-01

In this study we developed an inducible synthetic renilla luciferase protein-fragment-assisted complementation-based bioluminescence assay to quantitatively measure real time protein–protein interactions in mammalian cells. We identified suitable sites to generate fragments of N and C portions of the protein that yield significant recovered activity through complementation. We validate complementation-based activation of split synthetic renilla luciferase protein driven by the interaction of two strongly interacting proteins, MyoD and Id, in five different cell lines utilizing transient transfection studies. The expression level of the system was also modulated by tumor necrosis factor α through NFκB-promoter/enhancer elements used to drive expression of the N portion of synthetic renilla luciferase reporter gene. This new system should help in studying protein–protein interactions and when used with other split reporters (e.g., split firefly luciferase) should help to monitor different components of an intracellular network. PMID:12705589

Transient transfection of intraerythrocytic Babesia gibsoni using elongation factor-1 alpha promoter.

PubMed

Liu, Mingming; Asada, Masahito; Cao, Shinuo; Adjou Moumouni, Paul Franck; Vudriko, Patrick; Efstratiou, Artemis; Hakimi, Hassan; Masatani, Tatsunori; Sunaga, Fujiko; Kawazu, Shin-Ichiro; Yamagishi, Junya; Xuan, Xuenan

2017-09-01

The development of gene manipulation techniques has been reported in many protozoan parasites over the past few years. However, these techniques have not yet been established for Babesia gibsoni. Here, we report for the first time, the successful transient transfection of B. gibsoni. The plasmid containing the firefly luciferase reporter gene (pBS-ELA) was transfected into B. gibsoni by an AMAXA 4D Nucleofector™ device. Transfection using program FA113 and Lonza buffer SF showed the highest luciferase expression. Twenty micrograms of plasmid produced the highest relative transfection efficiency. The fluorescent protein-expressing parasites were determined by GFP-containing plasmid (pBS-EGA) at 48 and 72h post transfection. This finding is the first step towards a stable transfection method for B. gibsoni, which may contribute to a better understanding of the biology of the parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

Titration-based screening for evaluation of natural product extracts: identification of an aspulvinone family of luciferase inhibitors

PubMed Central

Cruz, Patricia G.; Auld, Douglas S.; Schultz, Pamela J.; Lovell, Scott; Battaile, Kevin P.; MacArthur, Ryan; Shen, Min; Tamayo-Castillo, Giselle; Inglese, James; Sherman, David H.

2011-01-01

The chemical diversity of nature has tremendous potential for discovery of new molecular probes and medicinal agents. However, sensitivity of HTS assays to interfering components of crude extracts derived from plants, macro- and microorganisms has curtailed their use in lead discovery efforts. Here we describe a process for leveraging the concentration-response curves (CRCs) obtained from quantitative HTS to improve the initial selection of “actives” from a library of partially fractionated natural product extracts derived from marine actinomycetes and fungi. By using pharmacological activity, the first-pass CRC paradigm aims to improve the probability that labor-intensive subsequent steps of re-culturing, extraction and bioassay-guided isolation of active component(s) target the most promising strains and growth conditions. We illustrate how this process identified a family of fungal metabolites as potent inhibitors of firefly luciferase, subsequently resolved in molecular detail by x-ray crystallography. PMID:22118678

Development of a chemiluminescent and bioluminescent system for the detection of bacteria in wastewater effluent

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1975-01-01

Automated chemiluminescent and bioluminescent sensors were developed for continuous monitoring of microbial levels in wastewater effluent. Development of the chemiluminescent system included optimization of reagent concentrations as well as two new techniques which will allow for increased sensitivity and specificity. The optimal reagent concentrations are 0.0025 M luminol and 0.0125 M sodium perborate in 0.75N sodium hydroxide before addition of sample. The methods developed to increase specificity include (1) extraction of porphyrins from bacteria collected in a filter using 0.1N NaOH - 50 percent Ethanol, and (2) use of the specific reaction rate characteristics for the different luminol catalysts. Since reaction times are different for each catalyst, the reaction can be made specific for bacteria by measuring only the light emission from the particular reaction time zone specific for bacteria. Developments of the bioluminescent firefly luciferase system were in the area of flow system design.

A DNA-scaffold platform enhances a multi-enzymatic cycling reaction.

PubMed

Mashimo, Yasumasa; Mie, Masayasu; Kobatake, Eiry

2018-04-01

We explored the co-localization of multiple enzymes on a DNA backbone via a DNA-binding protein, Gene-A* (A*-tag) to increase the efficiency of cascade enzymatic reactions. Firefly luciferase (FLuc) and pyruvate orthophosphate dikinase (PPDK) were genetically fused with A*-tag and modified with single-stranded (ss) DNA via A*-tag. The components were assembled on ssDNA by hybridization, thereby enhancing the efficiency of the cascading bioluminescent reaction producing light emission from pyrophosphate. The activity of A*-tag in each enzyme was investigated with dye-labeled DNA. Co-localization of the enzymes via hybridization was examined using a gel shift assay. The multi-enzyme complex showed significant improvement in the overall efficiency of the cascading reaction in comparison to a mixture of free enzymes. A*-tag is highly convenient for ssDNA modification of versatile enzymes, and it can be used for construction of functional DNA-enzyme complexes.

Titration-based screening for evaluation of natural product extracts: identification of an aspulvinone family of luciferase inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruz, P.G.; Auld, D.S.; Schultz, P.J.

2011-11-28

The chemical diversity of nature has tremendous potential for the discovery of molecular probes and medicinal agents. However, sensitivity of HTS assays to interfering components of crude extracts derived from plants, and macro- and microorganisms has curtailed their use in lead discovery. Here, we describe a process for leveraging the concentration-response curves obtained from quantitative HTS to improve the initial selection of actives from a library of partially fractionated natural product extracts derived from marine actinomycetes and fungi. By using pharmacological activity, the first-pass CRC paradigm improves the probability that labor-intensive subsequent steps of reculturing, extraction, and bioassay-guided isolation ofmore » active component(s) target the most promising strains and growth conditions. We illustrate how this process identified a family of fungal metabolites as potent inhibitors of firefly luciferase, subsequently resolved in molecular detail by X-ray crystallography.« less

Dual-Color Click Beetle Luciferase Heteroprotein Fragment Complementation Assays

PubMed Central

Villalobos, Victor; Naik, Snehal; Bruinsma, Monique; Dothager, Robin S.; Pan, Mei-Hsiu; Samrakandi, Mustapha; Moss, Britney; Elhammali, Adnan; Piwnica-Worms, David

2010-01-01

Summary Understanding the functional complexity of protein interactions requires mapping biomolecular complexes within the cellular environment over biologically-relevant time scales. Herein we describe a novel set of reversible, multicolored heteroprotein complementation fragments based on various firefly and click beetle luciferases that utilize the same substrate, D-luciferin. Luciferase heteroprotein fragment complementation systems enabled dual-color quantification of two discreet pairs of interacting proteins simultaneously or two distinct proteins interacting with a third shared protein in live cells. Using real-time analysis of click beetle green and click beetle red luciferase heteroprotein fragment complementation applied to β-TrCP, an E3-ligase common to the regulation of both β-catenin and IκBα, GSK3β was identified as a novel candidate kinase regulating IκBα processing. These dual-color protein interaction switches may enable directed dynamic analysis of a variety of protein interactions in living cells. PMID:20851351

Optogenetic control of ATP release

NASA Astrophysics Data System (ADS)

Lewis, Matthew A.; Joshi, Bipin; Gu, Ling; Feranchak, Andrew; Mohanty, Samarendra K.

2013-03-01

Controlled release of ATP can be used for understanding extracellular purinergic signaling. While coarse mechanical forces and hypotonic stimulation have been utilized in the past to initiate ATP release from cells, these methods are neither spatially accurate nor temporally precise. Further, these methods cannot be utilized in a highly effective cell-specific manner. To mitigate the uncertainties regarding cellular-specificity and spatio-temporal release of ATP, we herein demonstrate use of optogenetics for ATP release. ATP release in response to optogenetic stimulation was monitored by Luciferin-Luciferase assay (North American firefly, photinus pyralis) using luminometer as well as mesoscopic bioluminescence imaging. Our result demonstrates repetitive release of ATP subsequent to optogenetic stimulation. It is thus feasible that purinergic signaling can be directly detected via imaging if the stimulus can be confined to single cell or in a spatially-defined group of cells. This study opens up new avenue to interrogate the mechanisms of purinergic signaling.

Preparation, crystal structure, vibrational spectral and density functional studies of bis (4-nitrophenol)-2,4,6-triamino-1,3,5-triazine monohydrate

NASA Astrophysics Data System (ADS)

Kanagathara, N.; Marchewka, M. K.; Drozd, M.; Renganathan, N. G.; Gunasekaran, S.; Anbalagan, G.

2013-10-01

An organic-organic salt, bis (4-nitrophenol) 2,4,6-triamino 1,3,5-triazine monohydrate (BNPM) has been prepared by slow evaporation technique at room temperature. Single crystal X-ray diffraction analysis reveals that the compound crystallizes in triclinic system with centrosymmetric space group P-1. IR and Raman spectra of BNPM have been recorded and analyzed. The study has been extended to confocal Raman spectral analysis. Band assignments have been made for the melamine and p-nitrophenol molecules. Vibrational spectra have also been discussed on the basis of quantum chemical density functional theory calculations using Firefly (PC GAMESS) Version 7.1 G. Vibrational frequencies are calculated and scaled values are compared with the experimental one. The Mulliken charges, HOMO-LUMO orbital energies are calculated and analyzed. The chemical structure of the compound was established by 1H NMR and 13C NMR spectra.

Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

PubMed

Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

2014-12-01

HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of the activity of multiple HREs under hypoxia and become the basis for hypoxia-targeted imaging and therapy in the future.

Quantitative bioluminescence imaging of transgene expression in intact porcine antral follicles in vitro

PubMed Central

2014-01-01

Background The porcine oocyte maturation in vivo occurs within the ovarian follicle and is regulated by the interactions between oocytes and surrounding follicular components, including theca, granulosa, and cumulus cells, and follicular fluid. Therefore, the antral follicle is an essential microenvironment for efficient oocyte maturation and its developmental competence. Quantitative bioluminescence imaging of firefly luciferase reporter genes in an intact antral follicle would allow investigation of changes in cellular and molecular events and in the context of the whole follicles. In this study, we investigate factors influencing bioluminescence measurements as a first step towards developing a new bioluminescence imaging system for intact antral follicles. Methods We analyzed the time course of bioluminescence emitted from transfected living intact follicles using a cationic lipid mediated gene transfer method with increasing doses (1-3 μg) of firefly luciferase reporter gene (pGL4). In addition, a standard luciferase assay was used to confirm the luciferase expression in granulosa cells in the transfected intact antral follicles. Finally, the dose effects of substrate, D-luciferin, were determined for optimal quantitative bioluminescence imaging of intact porcine antral follicles in vitro. Results The level of luciferase activity of follicles with 3 μg pGL4 was significantly (P < 0.05) greater than the 1 μg and 2 μg groups at 1 min after D-luciferin injection. The bioluminescence intensity of transfected follicles reached a peak at 1 min, and then it was significantly (P < 0.05) reduced within 2 min after injection of D-luciferin; with the level of bioluminescence emission remained constant from 2.5 to 10 min. The bioluminescence emission was maximal with 300 μg of D-luciferin. Conclusions The results of this study suggested that the investigation of factors influencing bioluminescence measurements is a critical step toward developing a new bioluminescence imaging model. This study is the first to demonstrate that reporter genes can be transferred to intact granulosa cells with a lipid-mediated gene transfer method within intact follicles in vitro, and the level of transgene expression can be assessed by bioluminescence imaging in living intact antral follicles. PMID:24479789

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Photomodulating Gene Expression by Using Caged siRNAs with Single-Aptamer Modification.

PubMed

Zhang, Liangliang; Chen, Changmai; Fan, Xinli; Tang, Xinjing

2018-06-18

Caged siRNAs incorporating terminal modification were rationally designed for photochemical regulation of gene silencing induced by RNA interference (RNAi). Through the conjugation of a single oligonucleotide aptamer at the 5' terminus of the antisense RNA strand, enhancement of the blocking effect for RNA-induced silencing complex (RISC) formation/processing was expected, due both/either to the aptamers themselves and/or to their interaction with large binding proteins. Two oligonucleotide aptamers (AS1411 and MUC-1) were chosen for aptamer-siRNA conjugation through a photolabile linker. This caging strategy was successfully used to photoregulate gene expression both of firefly luciferase and of green fluorescent protein (GFP) in cells. Further patterning experiments revealed that spatial regulation of GFP expression was successfully achieved by using the aptamer-modified caged siRNA and light activation. We expect that further optimized caged siRNAs featuring aptamer conjugation will be promising for practical applications to spatiotemporal photoregulation of gene expression in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Frequency and phase synchronization in large groups: Low dimensional description of synchronized clapping, firefly flashing, and cricket chirping

NASA Astrophysics Data System (ADS)

Ott, Edward; Antonsen, Thomas M.

2017-05-01

A common observation is that large groups of oscillatory biological units often have the ability to synchronize. A paradigmatic model of such behavior is provided by the Kuramoto model, which achieves synchronization through coupling of the phase dynamics of individual oscillators, while each oscillator maintains a different constant inherent natural frequency. Here we consider the biologically likely possibility that the oscillatory units may be capable of enhancing their synchronization ability by adaptive frequency dynamics. We propose a simple augmentation of the Kuramoto model which does this. We also show that, by the use of a previously developed technique [Ott and Antonsen, Chaos 18, 037113 (2008)], it is possible to reduce the resulting dynamics to a lower dimensional system for the macroscopic evolution of the oscillator ensemble. By employing this reduction, we investigate the dynamics of our system, finding a characteristic hysteretic behavior and enhancement of the quality of the achieved synchronization.

Development of Neh2-Luciferase Reporter and Its Application for High Throughput Screening and Real-Time Monitoring of Nrf2 Activators

PubMed Central

Smirnova, Natalya A.; Haskew-Layton, Renee E.; Basso, Manuela; Hushpulian, Dmitry M.; Payappilly, Jimmy B.; Speer, Rachel E.; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A.; Pinto, John T.; Ratan, Rajiv R.; Gazaryan, Irina G.

2011-01-01

SUMMARY The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found—nordihydroguaiaretic acid, fisetin, and gedunin—induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

[Rapid bioluminescent antibiotic susceptibility assay].

PubMed

Frundzhian, V G; Ugarova, N N; Blatun, L A; Terekhova, R P; Rusanova, E V

2009-01-01

Rapid testing of pathogen susceptibility to antibiotics is of great practical value for rational chemotherapy of pyoinflammatory deseases and postoperative complications of microbial etiology. The standard microbiological methods, i.e., the disk diffusion method and the method of serial dilutions are labour- and time-consuming (not less than 18-36 hours). The method of the authors is based on measuring bioluminescence resulting from interaction of adenosine-5'-triphosphate (ATP) and ATP reagent, a standard reaction mixture of firefly luciferase (an enzyme) and luciferin. The bioluminescence intensity is proportional to the ATP concentration in the reaction mixture and the ATP concentration is proportional to the number of the pathogen viable cells in the sample. The bioluminescence intensity value in the pathogen suspension aliquots with and without (control) the antibiotic were compared after the incubation for 5 hours and the coefficient of the microbial cell growth inhibition was calculated. Satisfactory correlation (R2 > 88%) of the results of the bioluminescent assay and the assay with the disk diffusion method and the method of serial dilutions was observed.

Picoliter DNA Sequencing Chemistry on an Electrowetting-based Digital Microfluidic Platform

PubMed Central

Ferguson Welch, Erin R.; Lin, Yan-You; Madison, Andrew; Fair, R.B.

2011-01-01

The results of investigations into performing DNA sequencing chemistry on a picoliter-scale electrowetting digital microfluidic platform are reported. Pyrosequencing utilizes pyrophosphate produced during nucleotide base addition to initiate a process ending with detection through a chemiluminescence reaction using firefly luciferase. The intensity of light produced during the reaction can be quantified to determine the number of bases added to the DNA strand. The logic-based control and discrete fluid droplets of a digital microfluidic device lend themselves well to the pyrosequencing process. Bead-bound DNA is magnetically held in a single location, and wash or reagent droplets added or split from it to circumvent product dilution. Here we discuss the dispensing, control, and magnetic manipulation of the paramagnetic beads used to hold target DNA. We also demonstrate and characterize the picoliter-scale reaction of luciferase with adenosine triphosphate to represent the detection steps of pyrosequencing and all necessary alterations for working on this scale. PMID:21298802

Real-time bioluminescence imaging of macroencapsulated fibroblasts reveals allograft protection in rhesus monkeys (Macaca mulatta).

PubMed

Tarantal, Alice F; Lee, C Chang I; Itkin-Ansari, Pamela

2009-07-15

Encapsulation of cells has the potential to eliminate the need for immunosuppression for cellular transplantation. Recently, the TheraCyte device was shown to provide long-term immunoprotection of murine islets in a mouse model of diabetes. In this report, translational studies were undertaken using skin fibroblasts from an unrelated rhesus monkey donor that were transduced with an HIV-1-derived lentiviral vector expressing firefly luciferase permitting the use of bioluminescence imaging (BLI) to monitor cell survival over time and in a noninvasive manner. Encapsulated cells were transplanted subcutaneously (n=2), or cells were injected without encapsulation (n=1) and outcomes compared. BLI was performed to monitor cell survival. The BLI signal from the encapsulated cells remained robust postinsertion and in one animal persisted for up to 1 year. In contrast, the control animal that received unencapsulated cells exhibited a complete loss of cell signal within 14 days. These data demonstrate that TheraCyte encapsulation of allogeneic cells provides robust immune protection in transplanted rhesus monkeys.

Cloning and characterization of a tuberous root-specific promoter from cassava (Manihot esculenta Crantz).

PubMed

Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F

2012-12-01

In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang

2010-01-22

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less

In Vivo Follow-up of Brain Tumor Growth via Bioluminescence Imaging and Fluorescence Tomography

PubMed Central

Genevois, Coralie; Loiseau, Hugues; Couillaud, Franck

2016-01-01

Reporter gene-based strategies are widely used in experimental oncology. Bioluminescence imaging (BLI) using the firefly luciferase (Fluc) as a reporter gene and d-luciferin as a substrate is currently the most widely employed technique. The present paper compares the performances of BLI imaging with fluorescence imaging using the near infrared fluorescent protein (iRFP) to monitor brain tumor growth in mice. Fluorescence imaging includes fluorescence reflectance imaging (FRI), fluorescence diffuse optical tomography (fDOT), and fluorescence molecular Imaging (FMT®). A U87 cell line was genetically modified for constitutive expression of both the encoding Fluc and iRFP reporter genes and assayed for cell, subcutaneous tumor and brain tumor imaging. On cultured cells, BLI was more sensitive than FRI; in vivo, tumors were first detected by BLI. Fluorescence of iRFP provided convenient tools such as flux cytometry, direct detection of the fluorescent protein on histological slices, and fluorescent tomography that allowed for 3D localization and absolute quantification of the fluorescent signal in brain tumors. PMID:27809256

In Vivo Follow-up of Brain Tumor Growth via Bioluminescence Imaging and Fluorescence Tomography.

PubMed

Genevois, Coralie; Loiseau, Hugues; Couillaud, Franck

2016-10-31

Reporter gene-based strategies are widely used in experimental oncology. Bioluminescence imaging (BLI) using the firefly luciferase (Fluc) as a reporter gene and d-luciferin as a substrate is currently the most widely employed technique. The present paper compares the performances of BLI imaging with fluorescence imaging using the near infrared fluorescent protein (iRFP) to monitor brain tumor growth in mice. Fluorescence imaging includes fluorescence reflectance imaging (FRI), fluorescence diffuse optical tomography (fDOT), and fluorescence molecular Imaging (FMT ® ). A U87 cell line was genetically modified for constitutive expression of both the encoding Fluc and iRFP reporter genes and assayed for cell, subcutaneous tumor and brain tumor imaging. On cultured cells, BLI was more sensitive than FRI; in vivo, tumors were first detected by BLI. Fluorescence of iRFP provided convenient tools such as flux cytometry, direct detection of the fluorescent protein on histological slices, and fluorescent tomography that allowed for 3D localization and absolute quantification of the fluorescent signal in brain tumors.

Experimental Validation of Plasma Metasurfaces as Tunable THz Reflectors

NASA Astrophysics Data System (ADS)

Colon Quinones, Roberto; Underwood, Thomas; Cappelli, Mark

2016-10-01

Measurements are presented which validate the use of plasma metasurfaces (PMs) as potential tunable THz reflectors. The PM considered here is an n x n array of laser produced plasma kernels generated by focusing the fundamental output from a 2 J/p Q-switched Nd:YAG laser through a multi-lens array (MLA) and into a gas of varying pressure. An M Squared Firefly-THz laser is used to generate a collimated pulse of THz light, which is then directed to the PM at varying angles of incidence. The reflected energy is measured using a Gentec-EO SDX-1187 joulemeter probe to characterize the surface impedance or reflectivity. In this presentation, we will compare the measured reflectance to values obtained from theoretical predictions and 3D finite-difference time-domain (FDTD) simulations. Work supported by the Air Force Office of Scientific Research (AFOSR). R. Colon Quinones and T. Underwood acknowledge the support of the Department of Defense (DoD) through the National Defense Science & Engineering Graduate Fellowship (NDSEG) Program.

The 5' non-translated region of Varroa destructor virus 1 (genus Iflavirus): structure prediction and IRES activity in Lymantria dispar cells.

PubMed

Ongus, Juliette R; Roode, Els C; Pleij, Cornelis W A; Vlak, Just M; van Oers, Monique M

2006-11-01

Structure prediction of the 5' non-translated region (NTR) of four iflavirus RNAs revealed two types of potential internal ribosome entry site (IRES), which are discriminated by size and level of complexity, in this group of viruses. In contrast to the intergenic IRES of dicistroviruses, the potential 5' IRES structures of iflaviruses do not have pseudoknots. To test the activity of one of these, a bicistronic construct was made in which the 5' NTR of Varroa destructor virus 1 (VDV-1) containing a putative IRES was cloned in between two reporter genes, enhanced green fluorescent protein and firefly luciferase (Fluc). The presence of the 5' NTR of VDV-1 greatly enhanced the expression levels of the second reporter gene (Fluc) in Lymantria dispar Ld652Y cells. The 5' NTR was active in a host-specific manner, as it showed lower activity in Spodoptera frugiperda Sf21 cells and no activity in Drosophila melanogaster S2 cells.

Luminogenic cytochrome P450 assays.

PubMed

Cali, James J; Ma, Dongping; Sobol, Mary; Simpson, Daniel J; Frackman, Susan; Good, Troy D; Daily, William J; Liu, David

2006-08-01

Luminogenic cytochrome P450 (CYP) assays couple CYP enzyme activity to firefly luciferase luminescence in a technology called P450-Glo(TM) (Promega). Luminogenic substrates are used in assays of human CYP1A1, -1A2, -1B1, -2C8, -2C9, -2C19, -2D6, -2J2, -3A4, -3A7, -4A11, -4F3B, -4F12 and -19. The assays detect dose-dependent CYP inhibition by test compounds against recombinant CYP enzymes or liver microsomes. Induction or inhibition of CYP activities in cultured hepatocytes is measured in a nonlytic approach that leaves cells intact for additional analysis. Luminogenic CYP assays offer advantages of speed and safety over HPLC and radiochemical-based methods. Compared with fluorogenic methods the approach offers advantages of improved sensitivity and decreased interference between optical properties of test compound and CYP substrate. These homogenous assays are sensitive and robust tools for high-throughput CYP screening in early drug discovery.

Synchronization of an ensemble of oscillators regulated by their spatial movement.

PubMed

Sarkar, Sumantra; Parmananda, P

2010-12-01

Synchronization for a collection of oscillators residing in a finite two dimensional plane is explored. The coupling between any two oscillators in this array is unidirectional, viz., master-slave configuration. Initially the oscillators are distributed randomly in space and their autonomous time-periods follow a Gaussian distribution. The duty cycles of these oscillators, which work under an on-off scenario, are normally distributed as well. It is realized that random hopping of oscillators is a necessary condition for observing global synchronization in this ensemble of oscillators. Global synchronization in the context of the present work is defined as the state in which all the oscillators are rendered identical. Furthermore, there exists an optimal amplitude of random hopping for which the attainment of this global synchronization is the fastest. The present work is deemed to be of relevance to the synchronization phenomena exhibited by pulse coupled oscillators such as a collection of fireflies. © 2010 American Institute of Physics.

Collective signaling behavior in a networked-oscillator model

NASA Astrophysics Data System (ADS)

Liu, Z.-H.; Hui, P. M.

2007-09-01

We propose and study the collective behavior of a model of networked signaling objects that incorporates several ingredients of real-life systems. These ingredients include spatial inhomogeneity with grouping of signaling objects, signal attenuation with distance, and delayed and impulsive coupling between non-identical signaling objects. Depending on the coupling strength and/or time-delay effect, the model exhibits completely, partially, and locally collective signaling behavior. In particular, a correlated signaling (CS) behavior is observed in which there exist time durations when nearly a constant fraction of oscillators in the system are in the signaling state. These time durations are much longer than the duration of a spike when a single oscillator signals, and they are separated by regular intervals in which nearly all oscillators are silent. Such CS behavior is similar to that observed in biological systems such as fireflies, cicadas, crickets, and frogs. The robustness of the CS behavior against noise is also studied. It is found that properly adjusting the coupling strength and noise level could enhance the correlated behavior.

How Fast Can Networks Synchronize? A Random Matrix Theory Approach

NASA Astrophysics Data System (ADS)

Timme, Marc; Wolf, Fred; Geisel, Theo

2004-03-01

Pulse-coupled oscillators constitute a paradigmatic class of dynamical systems interacting on networks because they model a variety of biological systems including flashing fireflies and chirping crickets as well as pacemaker cells of the heart and neural networks. Synchronization is one of the most simple and most prevailing kinds of collective dynamics on such networks. Here we study collective synchronization [1] of pulse-coupled oscillators interacting on asymmetric random networks. Using random matrix theory we analytically determine the speed of synchronization in such networks in dependence on the dynamical and network parameters [2]. The speed of synchronization increases with increasing coupling strengths. Surprisingly, however, it stays finite even for infinitely strong interactions. The results indicate that the speed of synchronization is limited by the connectivity of the network. We discuss the relevance of our findings to general equilibration processes on complex networks. [5mm] [1] M. Timme, F. Wolf, T. Geisel, Phys. Rev. Lett. 89:258701 (2002). [2] M. Timme, F. Wolf, T. Geisel, cond-mat/0306512 (2003).

Meeting report for Odd Pols 2016: Ann Arbor 2.0.

PubMed

Roy-Engel, Astrid M

2017-05-15

The Tenth International Conference on Transcription by RNA Polymerases I, III, IV and V (the 'Odd Pols') was held June 24-28, 2016 at the University of Michigan, Ann Arbor, USA and organized by David Engelke, Deborah Johnson, Richard Maraia, Lawrence Rothblum, David Schneider, Andrzej Wierzbicki and Astrid Engel. The organizers are grateful for the support from the Rackham Graduate School of the University of Michigan for providing the meeting venue. The environment provided a great background with unexpected encounters with fireflies, free live music and a festive fireworks display. The meeting was composed of eleven oral sessions and a poster session. The keynote speaker, Dave Engelke, opened the meeting with his presentation entitled "A personal history of pol III transcription - how we got here from the 'good old days'." The meeting drew attendees from sixteen countries that shared their research discoveries. Here we present some of the highlights from the meeting using summaries provided by the participants. Copyright © 2016 Elsevier B.V. All rights reserved.

A Multifeatures Fusion and Discrete Firefly Optimization Method for Prediction of Protein Tyrosine Sulfation Residues.

PubMed

Guo, Song; Liu, Chunhua; Zhou, Peng; Li, Yanling

2016-01-01

Tyrosine sulfation is one of the ubiquitous protein posttranslational modifications, where some sulfate groups are added to the tyrosine residues. It plays significant roles in various physiological processes in eukaryotic cells. To explore the molecular mechanism of tyrosine sulfation, one of the prerequisites is to correctly identify possible protein tyrosine sulfation residues. In this paper, a novel method was presented to predict protein tyrosine sulfation residues from primary sequences. By means of informative feature construction and elaborate feature selection and parameter optimization scheme, the proposed predictor achieved promising results and outperformed many other state-of-the-art predictors. Using the optimal features subset, the proposed method achieved mean MCC of 94.41% on the benchmark dataset, and a MCC of 90.09% on the independent dataset. The experimental performance indicated that our new proposed method could be effective in identifying the important protein posttranslational modifications and the feature selection scheme would be powerful in protein functional residues prediction research fields.

A Multifeatures Fusion and Discrete Firefly Optimization Method for Prediction of Protein Tyrosine Sulfation Residues

PubMed Central

Liu, Chunhua; Zhou, Peng; Li, Yanling

2016-01-01

Tyrosine sulfation is one of the ubiquitous protein posttranslational modifications, where some sulfate groups are added to the tyrosine residues. It plays significant roles in various physiological processes in eukaryotic cells. To explore the molecular mechanism of tyrosine sulfation, one of the prerequisites is to correctly identify possible protein tyrosine sulfation residues. In this paper, a novel method was presented to predict protein tyrosine sulfation residues from primary sequences. By means of informative feature construction and elaborate feature selection and parameter optimization scheme, the proposed predictor achieved promising results and outperformed many other state-of-the-art predictors. Using the optimal features subset, the proposed method achieved mean MCC of 94.41% on the benchmark dataset, and a MCC of 90.09% on the independent dataset. The experimental performance indicated that our new proposed method could be effective in identifying the important protein posttranslational modifications and the feature selection scheme would be powerful in protein functional residues prediction research fields. PMID:27034949

In vivo bioluminescence imaging of cell differentiation in biomaterials: a platform for scaffold development.

PubMed

Bagó, Juli R; Aguilar, Elisabeth; Alieva, Maria; Soler-Botija, Carolina; Vila, Olaia F; Claros, Silvia; Andrades, José A; Becerra, José; Rubio, Nuria; Blanco, Jerónimo

2013-03-01

In vivo testing is a mandatory last step in scaffold development. Agile longitudinal noninvasive real-time monitoring of stem cell behavior in biomaterials implanted in live animals should facilitate the development of scaffolds for tissue engineering. We report on a noninvasive bioluminescence imaging (BLI) procedure for simultaneous monitoring of changes in the expression of multiple genes to evaluate scaffold performance in vivo. Adipose tissue-derived stromal mensenchymal cells were dually labeled with Renilla red fluorescent protein and firefly green fluorescent protein chimeric reporters regulated by cytomegalovirus and tissue-specific promoters, respectively. Labeled cells were induced to differentiate in vitro and in vivo, by seeding in demineralized bone matrices (DBMs) and monitored by BLI. Imaging results were validated by RT-polymerase chain reaction and histological procedures. The proposed approach improves molecular imaging and measurement of changes in gene expression of cells implanted in live animals. This procedure, applicable to the simultaneous analysis of multiple genes from cells seeded in DBMs, should facilitate engineering of scaffolds for tissue repair.

In Vivo Bioluminescence Imaging of Cell Differentiation in Biomaterials: A Platform for Scaffold Development

PubMed Central

Bagó, Juli R.; Aguilar, Elisabeth; Alieva, Maria; Soler-Botija, Carolina; Vila, Olaia F.; Claros, Silvia; Andrades, José A.; Becerra, José; Rubio, Nuria

2013-01-01

In vivo testing is a mandatory last step in scaffold development. Agile longitudinal noninvasive real-time monitoring of stem cell behavior in biomaterials implanted in live animals should facilitate the development of scaffolds for tissue engineering. We report on a noninvasive bioluminescence imaging (BLI) procedure for simultaneous monitoring of changes in the expression of multiple genes to evaluate scaffold performance in vivo. Adipose tissue-derived stromal mensenchymal cells were dually labeled with Renilla red fluorescent protein and firefly green fluorescent protein chimeric reporters regulated by cytomegalovirus and tissue-specific promoters, respectively. Labeled cells were induced to differentiate in vitro and in vivo, by seeding in demineralized bone matrices (DBMs) and monitored by BLI. Imaging results were validated by RT-polymerase chain reaction and histological procedures. The proposed approach improves molecular imaging and measurement of changes in gene expression of cells implanted in live animals. This procedure, applicable to the simultaneous analysis of multiple genes from cells seeded in DBMs, should facilitate engineering of scaffolds for tissue repair. PMID:23013334

A Luciferase Functional Quantitative Assay for Measuring NF-ĸB Promoter Transactivation Mediated by HTLV-1 and HTLV-2 Tax Proteins.

PubMed

Bergamo, Elisa; Diani, Erica; Bertazzoni, Umberto; Romanelli, Maria Grazia

2017-01-01

HTLV-1 and HTLV-2 viruses express Tax transactivator proteins required for viral genome transcription and capable of transforming cells in vivo and in vitro. Although Tax oncogenic potential needs to be further elucidated, it is well established that Tax proteins activate, among others, transcription factors of the NF-ĸB family, which are involved in immune and inflammatory responses, cell growth, apoptosis, stress responses and oncogenesis. Here, we describe a reporter gene assay applied for quantitative analysis of Tax-dependent NF-ĸB activation. The procedure is based on co-transfection of two individual vectors containing the cDNA for firefly and Renilla luciferase enzymes and vectors expressing Tax proteins. The luciferase expression is driven by cis-NF-ĸB promoter regulatory elements responsive to Tax transactivating factor. This assay is particularly useful to investigate Tax influence on NF-ĸB activation mediated by viral or host factors.

Establishment of a luciferase assay-based screening system: Fumitremorgin C selectively inhibits cellular proliferation of immortalized astrocytes expressing an active form of AKT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Lei; Sasai, Ken; Akagi, Tsuyoshi

2008-08-29

The AKT pathway is frequently activated in glioblastoma, and as such, inhibitors of this pathway could prove very useful as anti-glioblastoma therapies. Here we established immortalized astrocytes expressing Renilla luciferase as well as those expressing both an active form of AKT and firefly luciferase. Since both luciferase activities represent the numbers of corresponding cell lines, novel inhibitors of the AKT pathway can be identified by treating co-cultures containing the two types of luciferase-expressing cells with individual compounds. Indeed, such a screening system succeeded in identifying fumitremorgin C as an efficient inhibitor of the AKT pathway, which was further confirmed bymore » the ability of fumitremorgin C to selectively inhibit the growth of immortalized astrocytes expressing an active form of AKT. The present study proposes a broadly applicable approach for identifying therapeutic agents that target the pathways and/or molecules responsible for cancer development.« less

Identification of a small molecule inhibitor of Ebola virus genome replication and transcription using in silico screening.

PubMed

Easton, Victoria; McPhillie, Martin; Garcia-Dorival, Isabel; Barr, John N; Edwards, Thomas A; Foster, Richard; Fishwick, Colin; Harris, Mark

2018-06-02

Ebola virus (EBOV) causes a severe haemorrhagic fever in humans and has a mortality rate over 50%. With no licensed drug treatments available, EBOV poses a significant threat. Investigations into possible therapeutics have been severely hampered by the classification of EBOV as a BSL4 pathogen. Here, we describe a drug discovery pathway combining in silico screening of compounds predicted to bind to a hydrophobic pocket on the nucleoprotein (NP); with a robust and rapid EBOV minigenome assay for inhibitor validation at BSL2. One compound (MCCB4) was efficacious (EC 50 4.8 μM), exhibited low cytotoxicity (CC 50  > 100 μM) and was specific, with no effect on either a T7 RNA polymerase driven firefly luciferase or a Bunyamwera virus minigenome. Further investigations revealed that this small molecule inhibitor was able to outcompete established replication complexes, an essential aspect for a potential EBOV treatment. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

Light without substrate amendment: the bacterial luciferase gene cassette as a mammalian bioreporter

NASA Astrophysics Data System (ADS)

Close, Dan M.; Xu, Tingting; Smartt, Abby E.; Jegier, Pat; Ripp, Steven A.; Sayler, Gary S.

2011-06-01

Bioluminescent production represents a facile method for bioreporter detection in mammalian tissues. The lack of endogenous bioluminescent reactions in these tissues allows for high signal to noise ratios even at low signal strength compared to fluorescent signal detection. While the luciferase enzymes commonly employed for bioluminescent detection are those from class Insecta (firefly and click beetle luciferases), these are handicapped in that they require concurrent administration of a luciferin compound to elicit a bioluminescent signal. The bacterial luciferase (lux) gene cassette offers the advantages common to other bioluminescent proteins, but is simultaneously capable of synthesizing its own luciferin substrates using endogenously available cellular compounds. The longstanding shortcoming of the lux cassette has been its recalcitrance to function in the mammalian cellular environment. This paper will present an overview of the work completed to date to overcome this limitation and provide examples of mammalian lux-based bioreporter technologies that could provide the framework for advanced, biomedically relevant real-time sensor development.

Longitudinal Monitoring of Antibody Responses against Tumor Cells Using Magneto-nanosensors with a Nanoliter of Blood.

PubMed

Lee, Jung-Rok; Chan, Carmel T; Ruderman, Daniel; Chuang, Hui-Yen; Gaster, Richard S; Atallah, Michelle; Mallick, Parag; Lowe, Scott W; Gambhir, Sanjiv S; Wang, Shan X

2017-11-08

Each immunoglobulin isotype has unique immune effector functions. The contribution of these functions in the elimination of pathogens and tumors can be determined by monitoring quantitative temporal changes in isotype levels. Here, we developed a novel technique using magneto-nanosensors based on the effect of giant magnetoresistance (GMR) for longitudinal monitoring of total and antigen-specific isotype levels with high precision, using as little as 1 nL of serum. Combining in vitro serologic measurements with in vivo imaging techniques, we investigated the role of the antibody response in the regression of firefly luciferase (FL)-labeled lymphoma cells in spleen, kidney, and lymph nodes in a syngeneic Burkitt's lymphoma mouse model. Regression status was determined by whole body bioluminescent imaging (BLI). The magneto-nanosensors revealed that anti-FL IgG2a and total IgG2a were elevated and sustained in regression mice compared to non-regression mice (p < 0.05). This platform shows promise for monitoring immunotherapy, vaccination, and autoimmunity.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

A novel low cost pulse excitation source to study trap spectroscopy of persistent luminescent materials

NASA Astrophysics Data System (ADS)

Chandrasekhar, Ngangbam; Singh, Nungleppam Monorajan; Gartia, R. K.

2018-04-01

Luminescent techniques require one or the other source of excitations which may vary from high cost X-rays, γ-rays, β-rays etc. to low cost LED. Persistent luminescent materials or Glow-in-the-Dark phosphors are the optical harvesters which store the optical energy from day light illuminating a whole night. They are so sensitive that they can be excited even with the low light of firefly. Therefore, instead of using a high cost excitation source authors have developed a low cost functioning of excitation source controlling short pulses of LED to excite persistent phosphors with the aid of ExpEYES Junior (Hardware/software framework developed by IUAC, New Delhi). Using this, the authors have excited the sample under investigation upto 10 ms. Trap spectroscopy of the pre-excited sample with LED is studied using Thermoluminescence (TL) technique. In this communication, development of the excitation source is discussed and demonstrate the its usefulness in the study of trap spectroscopy of commercially available CaS:Eu2+, Sm3+. Trapping parameters are also evaluated using Computerized Glow Curve Deconvolution (CGCD) technique.

Small heat shock protein AgsA: an effective stabilizer of enzyme activities.

PubMed

Tomoyasu, Toshifumi; Tabata, Atsushi; Ishikawa, Yoko; Whiley, Robert A; Nagamune, Hideaki

2013-01-01

A small heat shock protein, AgsA, possesses chaperone activity that can reduce the amount of heat-aggregated protein in vivo, and suppress the aggregation of chemical- and heat-denatured proteins in vitro. Therefore, we examined the ability of AgsA to stabilize the activity of several enzymes by using this chaperone activity. We observed that AgsA can stabilize the enzymatic activities of Renilla (Renilla reniformis) luciferase, firefly (Photinus pyralis) luciferase, and β-galactosidase, and showed comparable or greater stabilization of these enzymes than bovine serum albumin (BSA), a well-known stabilizer of enzyme activities. In particular, AgsA revealed better stabilization of Renilla luciferase and β-galactosidase than BSA under disulfide bond-reducing conditions with dithiothreitol. In addition, AgsA also increased the enzymatic performance of β-galactosidase and various restriction enzymes to a comparable or greater extent than BSA. These data indicate that AgsA may be useful as a general stabilizer of enzyme activities. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Real-time Bioluminescence Imaging of Macroencapsulated Fibroblasts Reveals Allograft Protection in Rhesus Monkeys (Macaca mulatta)

PubMed Central

Tarantal, Alice F.; Lee, C. Chang I.; Itkin-Ansari, Pamela

2009-01-01

Background Encapsulation of cells has the potential to eliminate the need for immunosuppression for cellular transplantation. Recently, the TheraCyte® device was shown to provide long-term immunoprotection of murine islets in the NOD/SCID mouse model of diabetes. In this report, translational studies were undertaken using skin fibroblasts from an unrelated rhesus monkey donor that were transduced with an HIV-1-derived lentiviral vector expressing firefly luciferase permitting the use of bioluminescence imaging (BLI) to monitor cell survival over time and in a noninvasive manner. Methods Encapsulated cells were transplanted subcutaneously (N=2) or cells were injected without encapsulation (N=1) and outcomes compared. BLI was performed to monitor cell survival. Results The BLI signal from the encapsulated cells remained robust post-insertion, and in one animal persisted for up to 1 year. In contrast, the control animal that received unencapsulated cells exhibited a complete loss of cell signal within 14 days. Conclusions These data demonstrate that TheraCyte® encapsulation of allogeneic cells provides robust immune protection in transplanted rhesus monkeys. PMID:19584678

Replication Competent Molecular Clones of HIV-1 Expressing Renilla Luciferase Facilitate the Analysis of Antibody Inhibition in PBMC

PubMed Central

Edmonds, Tara G.; Ding, Haitao; Yuan, Xing; Wei, Qing; Smith, Kendra S.; Conway, Joan A.; Wieczorek, Lindsay; Brown, Bruce; Polonis, Victoria; West, John T.; Montefiori, David C.; Kappes, John C.; Ochsenbauer, Christina

2010-01-01

Effective vaccine development for human immunodeficiency virus type 1 (HIV-1) will require assays that ascertain the capacity of vaccine immunogens to elicit neutralizing antibodies (NAb) to diverse HIV-1 strains. To facilitate NAb assessment in peripheral blood mononuclear cell (PBMC)-based assays, we developed an assay-adaptable platform based on a Renilla luciferase (LucR) expressing HIV-1 proviral backbone. LucR was inserted into pNL4-3 DNA, preserving all viral open reading frames. The proviral genome was engineered to facilitate expression of diverse HIV-1 env sequences, allowing analysis in an isogenic background. The resulting Env-IMC-LucR viruses are infectious, and LucR is stably expressed over multiple replications in PBMC. HIV-1 neutralization, targeting TZM-bl cells, was highly correlative comparing virus (LucR) and cell (firefly luciferase) readouts. In PBMC, NAb activity can be analyzed either within a single or multiple cycles of replication. These results represent advancement toward a standardizable PBMC-based neutralization assay for assessing HIV-1 vaccine immunogen efficacy. PMID:20863545

Replication competent molecular clones of HIV-1 expressing Renilla luciferase facilitate the analysis of antibody inhibition in PBMC.

PubMed

Edmonds, Tara G; Ding, Haitao; Yuan, Xing; Wei, Qing; Smith, Kendra S; Conway, Joan A; Wieczorek, Lindsay; Brown, Bruce; Polonis, Victoria; West, John T; Montefiori, David C; Kappes, John C; Ochsenbauer, Christina

2010-12-05

Effective vaccine development for human immunodeficiency virus type 1 (HIV-1) will require assays that ascertain the capacity of vaccine immunogens to elicit neutralizing antibodies (NAb) to diverse HIV-1 strains. To facilitate NAb assessment in peripheral blood mononuclear cell (PBMC)-based assays, we developed an assay-adaptable platform based on a Renilla luciferase (LucR) expressing HIV-1 proviral backbone. LucR was inserted into pNL4-3 DNA, preserving all viral open reading frames. The proviral genome was engineered to facilitate expression of diverse HIV-1 env sequences, allowing analysis in an isogenic background. The resulting Env-IMC-LucR viruses are infectious, and LucR is stably expressed over multiple replications in PBMC. HIV-1 neutralization, targeting TZM-bl cells, was highly correlative comparing virus (LucR) and cell (firefly luciferase) readouts. In PBMC, NAb activity can be analyzed either within a single or multiple cycles of replication. These results represent advancement toward a standardizable PBMC-based neutralization assay for assessing HIV-1 vaccine immunogen efficacy. Copyright © 2010 Elsevier Inc. All rights reserved.

Imaging of bioluminescent LNCaP-luc-M6 tumors: a new animal model for the study of metastatic human prostate cancer.

PubMed

Scatena, Caroline D; Hepner, Mischa A; Oei, Yoko A; Dusich, Joan M; Yu, Shang-Fan; Purchio, Tony; Contag, Pamela R; Jenkins, Darlene E

2004-05-15

Animal experiments examining hormone-sensitive metastatic prostate cancer using the human LNCaP cell line have been limited to endpoint analyses. To permit longitudinal studies, we generated a luciferase-expressing cell line and used bioluminescent imaging (BLI) to non-invasively monitor the in vivo growth of primary LNCaP tumors and metastasis. LNCaP.FGC cells were transfected to constitutively express firefly luciferase. LNCaP-luc-M6 cells were tested for bioluminescent signal intensity and hormone responsiveness in vitro. The cells were implanted in subcutaneous and orthotopic sites in SCID-bg mice and imaged over time. The LNCaP-luc-M6 cells formed subcutaneous and orthotopic tumors in SCID-bg mice, and nearly all tumor-bearing animals developed pulmonary metastases. Early detection and temporal growth of primary tumors and metastatic lesions was successfully monitored by BLI. The LNCaP-luc-M6 cell line is a bioluminescent, hormone-sensitive prostate cancer cell line applicable for BLI studies to non-invasively monitor subcutaneous and orthotopic prostate tumor growth and metastasis in vivo. Copyright 2004 Wiley-Liss, Inc.

Synthesis of galactosyl compounds for targeted gene delivery.

PubMed

Ren, T; Zhang, G; Liu, D

2001-11-01

Cell-specific DNA delivery offers a great potential for targeted gene therapy. Toward this end, we have synthesized a series of compounds carrying galactose residues as a targeting ligand for asialoglycoprotein receptors of hepatocytes and primary amine groups as a functional domain for DNA binding. Biological activity of these galactosyl compounds in DNA delivery was evaluated in HepG2 and BL-6 cells and compared with respect to the number of galactose residues as well as primary amine groups in each molecule. Transfection experiments using a firefly luciferase gene as a reporter revealed that compounds with multivalent binding properties were more active in DNA delivery. An optimal transfection activity in HepG2 cells requires seven primary amine groups and a minimum of two galactose residues in each molecule. The transfection activity of compounds carrying multi-galactose residues can be inhibited by asialofetuin, a natural substrate for asialoglycoprotein receptors of hepatocytes, suggesting that gene transfer by these galactosyl compounds is asialoglycoprotein receptor-mediated. These results provide direct evidence in support of our new strategy for the use of small and synthetic compounds for cell specific and targeted gene delivery.

A bright cyan-excitable orange fluorescent protein facilitates dual-emission microscopy and enhances bioluminescence imaging in vivo

PubMed Central

Chu, Jun; Oh, Young-Hee; Sens, Alex; Ataie, Niloufar; Dana, Hod; Macklin, John J.; Laviv, Tal; Welf, Erik S.; Dean, Kevin M.; Zhang, Feijie; Kim, Benjamin B.; Tang, Clement Tran; Hu, Michelle; Baird, Michelle A.; Davidson, Michael W.; Kay, Mark A.; Fiolka, Reto; Yasuda, Ryohei; Kim, Douglas S.; Ng, Ho-Leung; Lin, Michael Z.

2016-01-01

Orange-red fluorescent proteins (FPs) are widely used in biomedical research for multiplexed epifluorescence microscopy with GFP-based probes, but their different excitation requirements make multiplexing with new advanced microscopy methods difficult. Separately, orange-red FPs are useful for deep-tissue imaging in mammals due to the relative tissue transmissibility of orange-red light, but their dependence on illumination limits their sensitivity as reporters in deep tissues. Here we describe CyOFP1, a bright engineered orange-red FP that is excitable by cyan light. We show that CyOFP1 enables single-excitation multiplexed imaging with GFP-based probes in single-photon and two-photon microscopy, including time-lapse imaging in light-sheet systems. CyOFP1 also serves as an efficient acceptor for resonance energy transfer from the highly catalytic blue-emitting luciferase NanoLuc. An optimized fusion of CyOFP1 and NanoLuc, called Antares, functions as a highly sensitive bioluminescent reporter in vivo, producing substantially brighter signals from deep tissues than firefly luciferase and other bioluminescent proteins. PMID:27240196

Bioluminescence imaging of a tumor-selective, thymidine kinase-defective vaccinia virus Guang9 strain after intratumoral or intraperitoneal administration in mice

PubMed Central

Ding, Yuedi; Fan, Jun; Deng, Lili; Peng, Ying; Zhang, Jue; Huang, Biao

2017-01-01

Vaccinia virus has been used as an oncolytic virus because of its capacity to preferentially infect tumors rather than normal tissues. The vaccinia Tian Tan strain, used as a vaccine against smallpox for millions of people in China, is a promising candidate for cancer therapy. In this study, we constructed an attenuated Tian Tan strain of Guang9 with a disrupted thymidine kinase gene to enhance tumor selectivity and an inserted firefly luciferase to monitor the viral distribution by in vivo bioluminescence imaging. Living animal imaging confirmed the high specificity of vaccinia Guang9 for tumor targeting after intratumoral and intraperitoneal administration. In addition, the vaccinia Guang9 strain produced higher in vivo luciferase activity and endured longer in immunocompromised nude mice than in immunocompetent C57BL/6 mice, all of which had been tumor-challenged. The luciferase activity and viral titers in excised tissues confirmed these conclusions. These data provide evidence for the safety and efficacy of the clinical application of vaccinia virus, which would be a promising approach for cancer therapy. PMID:29179469

Intra-adrenal murine TH-MYCN neuroblastoma tumors grow more aggressive and exhibit a distinct tumor microenvironment relative to their subcutaneous equivalents.

PubMed

Kroesen, Michiel; Brok, Ingrid C; Reijnen, Daphne; van Hout-Kuijer, Maaike A; Zeelenberg, Ingrid S; Den Brok, Martijn H; Hoogerbrugge, Peter M; Adema, Gosse J

2015-05-01

In around half of the patients with neuroblastoma (NBL), the primary tumor is located in one of the adrenal glands. We have previously reported on a transplantable TH-MYCN model of subcutaneous (SC) growing NBL in C57Bl/6 mice for immunological studies. In this report, we describe an orthotopic TH-MYCN transplantable model where the tumor cells were injected intra-adrenally (IA) by microsurgery. Strikingly, 9464D cells grew out much faster in IA tumors compared to the subcutis. Tumors were infiltrated by equal numbers of lymphocytes and myeloid cells. Within the myeloid cell population, however, tumor-infiltrating macrophages were more abundant in IA tumors compared to SC tumors and expressed lower levels of MHC class II, indicative of a more immunosuppressive phenotype. Using 9464D cells stably expressing firefly luciferase, enhanced IA tumor growth could be confirmed using bioluminescence. Collectively, these data show that the orthotopic IA localization of TH-MYCN cells impacts the NBL tumor microenvironment, resulting in a more stringent NBL model to study novel immunotherapeutic approaches for NBL.

[Microplate luminometry for toxicity bioassay of chemicals on luciferase].

PubMed

Ge, Hui-Lin; Liu, Shu-Shen; Chen, Fu; Luo, Jin-Hui; Lü, Dai-Zhu; Su, Bing-Xia

2013-10-01

A new microplate luminometry for the toxicity bioassay of chemicals on firefly luciferase, was developed using the multifunctional microplate reader (SpectraMax M5) to measure the luminous intensity of luciferase. Efects of luciferase concentration, luciferin concentration, ATP concentration, pH, temperature, and reaction time on the luminescence were systematically investigated. It was found that ATP exerted a biphasic response on the luciferase luminescence and the maximum relative light units (RLU) occurred at an ATP concentration of 1.1 x 10(-4) mol x L(-1). The method was successfully employed in the toxic effect test of NaF, NaCl, KBr and NaBF4 on luciferase. Using nonlinear least square technique, the dose-response curves (DRC) of the 4 chemicals were accurately fitted with the coefficient of determination (R2) between the fitted and observed responses being greater than 0.99. The median effective concentration (EC50) of the 4 chemicals were accurately measured from the DRC models. Compared with some literatures, the bioassay is a fast easy-operate and cost-effective method with high accuracy.

Utilization of Local Law Enforcement Aerial Resources in Consequence Management (CM) Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wasiolek, Piotr T.; Malchow, Russell L.

2013-03-12

During the past decade the U.S. Department of Homeland Security (DHS) was instrumental in enhancing the nation’s ability to detect and prevent a radiological or nuclear attack in the highest risk cities. Under the DHS Securing the Cities initiative, nearly 13,000 personnel in the New York City region have been trained in preventive radiological and nuclear detection operations, and nearly 8,500 pieces of radiological detection equipment have been funded. As part of the preventive radiological/nuclear detection (PRND) mission, several cities have received funding to purchase commercial aerial radiation detection systems. In 2008, the U.S. Department of Energy, National Nuclear Securitymore » Administration Aerial Measuring System (AMS) program started providing Mobile Aerial Radiological Surveillance (MARS) training to such assets, resulting in over 150 HAZMAT teams’ officers and pilots from 10 law enforcement organizations and fire departments being trained in the aerial radiation detection. From the beginning, the MARS training course covered both the PRND and consequence management (CM) missions. Even if the law enforcement main focus is PRND, their aerial assets can be utilized in the collection of initial radiation data for post-event radiological CM response. Based on over 50 years of AMS operational experience and information collected during MARS training, this presentation will focus on the concepts of CM response using aerial assets as well as utilizing law enforcement/fire department aerial assets in CM. Also discussed will be the need for establishing closer relationships between local jurisdictions’ aerial radiation detection capabilities and state and local radiation control program directors, radiological health department managers, etc. During radiological events these individuals may become primary experts/advisers to Incident Commanders for radiological emergency response, especially in the early stages of a response. The knowledge of the existence, specific capabilities, and use of local aerial radiation detection systems would be critical in planning the response, even before federal assets arrive on the scene. The relationship between local and federal aerial assets and the potential role for the further use of the MARS training and expanded AMS Reachback capabilities in facilitating such interactions will be discussed.« less

Transgenic mouse model harboring the transcriptional fusion ccl20-luciferase as a novel reporter of pro-inflammatory response.

PubMed

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR).

PubMed

Crosby, Priya; Hoyle, Nathaniel P; O'Neill, John S

2017-12-13

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

A new indicator cell line established to monitor bovine foamy virus infection.

PubMed

Guo, Hong-Yan; Liang, Zhi-Bin; Li, Yue; Tan, Juan; Chen, Qi-Min; Qiao, Wen-Tao

2011-10-01

In order to improve the accuracy for quantitating the bovine foamy virus (BFV) in vitro, we developed a baby hamster kidney cell (BHK)-21-derived indicator cell line containing a plasmid that encodes the firefly luciferase driven by the BFV long terminal repeat promoter (LTR, from -7 to 1012). The BFV titer could be determined by detecting the luciferase expression since the viral trans-activator BTas protein activates the promoter activity of the LTR. One clone, designated BFVL, was selected from ten neomycin-resistant clones. BFVL showed a specific and inducible dose- and time-dependent luciferase activity in response to BFV infection. Although the changes in luciferase activity of BFVL peaked at 84 h post infection, it was possible to differentiate infected and uninfected cells at 48 h post infection. A linear relationship was established between the multiplicity of infection (MOI) of BFV and the activated ratio of luciferase expression in BFVL. Moreover, the sensitivity of the BFVL-based assay for detecting infectious BFV was 10,000 times higher than the conventional CPE-based assay at 48 h post infection. These findings suggest that the BFVL-based assay is rapid, easy, sensitive, quantitative and specific for detection of BFV infection.

Functional overload increases beta-MHC promoter activity in rodent fast muscle via the proximal MCAT (betae3) site.

PubMed

Giger, Julia M; Haddad, Fadia; Qin, Anqi X; Baldwin, Kenneth M

2002-03-01

Functional overload (OL) of the rat plantaris muscle by the removal of synergistic muscles induces a shift in the myosin heavy chain (MHC) isoform expression profile from the fast isoforms toward the slow type I, or, beta-MHC isoform. Different length rat beta-MHC promoters were linked to a firefly luciferase reporter gene and injected in control and OL plantaris muscles. Reporter activities of -3,500, -914, -408, and -215 bp promoters increased in response to 1 wk of OL. The smallest -171 bp promoter was not responsive to OL. Mutation analyses of putative regulatory elements within the -171 and -408 bp region were performed. The -408 bp promoters containing mutations of the betae1, distal muscle CAT (MCAT; betae2), CACC, or A/T-rich (GATA), were still responsive to OL. Only the proximal MCAT (betae3) mutation abolished the OL response. Gel mobility shift assays revealed a significantly higher level of complex formation of the betae3 probe with nuclear protein from OL plantaris compared with control plantaris. These results suggest that the betae3 site functions as a putative OL-responsive element in the rat beta-MHC gene promoter.

In vivo gene delivery and expression by bacteriophage lambda vectors.

PubMed

Lankes, H A; Zanghi, C N; Santos, K; Capella, C; Duke, C M P; Dewhurst, S

2007-05-01

Bacteriophage vectors have potential as gene transfer and vaccine delivery vectors because of their low cost, safety and physical stability. However, little is known concerning phage-mediated gene transfer in mammalian hosts. We therefore performed experiments to examine phage-mediated gene transfer in vivo. Mice were inoculated with recombinant lambda phage containing a mammalian expression cassette encoding firefly luciferase (luc). Efficient, dose-dependent in vivo luc expression was detected, which peaked within 24 h of delivery and declined to undetectable levels within a week. Display of an integrin-binding peptide increased cellular internalization of phage in vitro and enhanced phage-mediated gene transfer in vivo. Finally, in vivo depletion of phagocytic cells using clodronate liposomes had only a minor effect on the efficiency of phage-mediated gene transfer. Unmodified lambda phage particles are capable of transducing mammalian cells in vivo, and may be taken up -- at least in part -- by nonphagocytic mechanisms. Surface modifications that enhance phage uptake result in more efficient in vivo gene transfer. These experiments shed light on the mechanisms involved in phage-mediated gene transfer in vivo, and suggest new approaches that may enhance the efficiency of this process.

Interaction of Osmotic Stress, Temperature, and Abscisic Acid in the Regulation of Gene Expression in Arabidopsis

PubMed Central

Xiong, Liming; Ishitani, Manabu; Zhu, Jian-Kang

1999-01-01

The impact of simultaneous environmental stresses on plants and how they respond to combined stresses compared with single stresses is largely unclear. By using a transgene (RD29A-LUC) consisting of the firefly luciferase coding sequence (LUC) driven by the stress-responsive RD29A promoter, we investigated the interactive effects of temperature, osmotic stress, and the phytohormone abscisic acid (ABA) in the regulation of gene expression in Arabidopsis seedlings. Results indicated that both positive and negative interactions exist among the studied stress factors in regulating gene expression. At a normal growth temperature (22°C), osmotic stress and ABA act synergistically to induce the transgene expression. Low temperature inhibits the response to osmotic stress or to combined treatment of osmotic stress and ABA, whereas low temperature and ABA treatments are additive in inducing transgene expression. Although high temperature alone does not activate the transgene, it significantly amplifies the effects of ABA and osmotic stress. The effect of multiple stresses in the regulation of RD29A-LUC expression in signal transduction mutants was also studied. The results are discussed in the context of cold and osmotic stress signal transduction pathways. PMID:9880362

Molecular Imaging of Tumor Angiogenesis and Therapeutic Effects with Dual Bioluminescence.

PubMed

Wang, Ran; Zhang, Kaiyue; Tao, Hongyan; Du, Wei; Wang, Di; Huang, Ziwei; Zhou, Manqian; Xu, Yang; Wang, Yuebing; Liu, Na; Wang, Hui; Li, Zongjin

2017-01-01

Angiogenesis is critical for the growth of tumor by supplying nutrients and oxygen that exacerbates the metastasis and progression of cancer. Noninvasive imaging of angiogenesis during the tumor therapeutic processes may provide novel opportunities for image-guided tumor management. Here, we want to develop a mouse animal model for assessing cancer progression and angiogenesis in the same individuals by molecular imaging. Breast cancer model was developed with mouse breast cancer cell line 4T1 carrying a reporter system encoding a triple fusion (TF) reporter gene consisting of renilla luciferase (Rluc), red fluorescent protein (RFP) and herpes simplex virus truncated thymidine kinase (HSV-ttk) in transgenic mice, which expressed firefly luciferase (Fluc) under the promoter of vascular endothelial growth factor receptor 2 (Vegfr2-luc). The mice were subsequently treated with ganciclovir (GCV) and the tumor angiogenesis was tracked by Fluc imaging and the growth status of tumor was monitored by imaging of Rluc simultaneously. Overall, this traceable breast cancer model can simultaneously image the tumor growth and angiogenesis in single individual, which may facilitate a better understanding the mechanisms of angiogenesis in the progression and regression of tumor. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Gait-Event-Based Synchronization Method for Gait Rehabilitation Robots via a Bioinspired Adaptive Oscillator.

PubMed

Chen, Gong; Qi, Peng; Guo, Zhao; Yu, Haoyong

2017-06-01

In the field of gait rehabilitation robotics, achieving human-robot synchronization is very important. In this paper, a novel human-robot synchronization method using gait event information is proposed. This method includes two steps. First, seven gait events in one gait cycle are detected in real time with a hidden Markov model; second, an adaptive oscillator is utilized to estimate the stride percentage of human gait using any one of the gait events. Synchronous reference trajectories for the robot are then generated with the estimated stride percentage. This method is based on a bioinspired adaptive oscillator, which is a mathematical tool, first proposed to explain the phenomenon of synchronous flashing among fireflies. The proposed synchronization method is implemented in a portable knee-ankle-foot robot and tested in 15 healthy subjects. This method has the advantages of simple structure, flexible selection of gait events, and fast adaptation. Gait event is the only information needed, and hence the performance of synchronization holds when an abnormal gait pattern is involved. The results of the experiments reveal that our approach is efficient in achieving human-robot synchronization and feasible for rehabilitation robotics application.

Bright to Dim Oscillatory Response of the Neurospora Circadian Oscillator

PubMed Central

Gooch, Van D.; Johnson, Alicia E.; Larrondo, Luis F.; Loros, Jennifer J.; Dunlap, Jay C.

2014-01-01

The fungus Neurospora crassa constitutes an important model system extensively used in chronobiology. Several studies have addressed how environmental cues, such as light, can reset or synchronize a circadian system. By means of an optimized firefly luciferase reporter gene and a controllable lighting system, we show that Neurospora can display molecular circadian rhythms in dim light when cultures receive bright light prior to entering dim light conditions. We refer to this behavior as the “bright to dim oscillatory response” (BDOR). The bright light treatment can be applied up to 76 h prior to dim exposure, and it can be as short as 15 min in duration. We have characterized this response in respect to the duration of the light pulse, the time of the light pulse before dim, the intensity of dim light, and the oscillation dynamics in dim light. Although the molecular mechanism that drives the BDOR remains obscure, these findings suggest that a long-term memory of bright light exists as part of the circadian molecular components. It is important to consider the ecological significance of such dim light responses in respect to how organisms naturally maintain their timing mechanism in moonlight. PMID:24492882

Bright to dim oscillatory response of the Neurospora circadian oscillator.

PubMed

Gooch, Van D; Johnson, Alicia E; Larrondo, Luis F; Loros, Jennifer J; Dunlap, Jay C

2014-02-01

The fungus Neurospora crassa constitutes an important model system extensively used in chronobiology. Several studies have addressed how environmental cues, such as light, can reset or synchronize a circadian system. By means of an optimized firefly luciferase reporter gene and a controllable lighting system, we show that Neurospora can display molecular circadian rhythms in dim light when cultures receive bright light prior to entering dim light conditions. We refer to this behavior as the "bright to dim oscillatory response" (BDOR). The bright light treatment can be applied up to 76 h prior to dim exposure, and it can be as short as 15 min in duration. We have characterized this response in respect to the duration of the light pulse, the time of the light pulse before dim, the intensity of dim light, and the oscillation dynamics in dim light. Although the molecular mechanism that drives the BDOR remains obscure, these findings suggest that a long-term memory of bright light exists as part of the circadian molecular components. It is important to consider the ecological significance of such dim light responses in respect to how organisms naturally maintain their timing mechanism in moonlight.

The Fibonacci Life-Chart Method (FLCM) as a foundation for Carl Jung's theory of synchronicity.

PubMed

Sacco, Robert G

2016-04-01

Since the scientific method requires events to be subject to controlled examination it would seem that synchronicities are not scientifically investigable. Jung speculated that because these incredible events are like the random sparks of a firefly they cannot be pinned down. However, doubting Jung's doubts, the author provides a possible method of elucidating these seemingly random and elusive events. The author draws on a new method, designated the Fibonacci Life-Chart Method (FLCM), which categorizes phase transitions and Phi fractal scaling in human development based on the occurrence of Fibonacci numbers in biological cell division and self-organizing systems. The FLCM offers an orientation towards psychological experience that may have relevance to Jung's theory of synchronicity in which connections are deemed to be intrinsically meaningful rather than demonstrable consequences of cause and effect. In such a model synchronistic events can be seen to be, as the self-organizing system enlarges, manifestations of self-organized critical moments and Phi fractal scaling. Recommendations for future studies include testing the results of the FLCM using case reports of synchronistic and spiritual experiences. © 2016, The Society of Analytical Psychology.

Extrachromosomal HPV-16 LCR transcriptional activation by HDACi opposed by cellular differentiation and DNA integration.

PubMed

Bojilova, Ekaterina Dimitrova; Weyn, Christine; Antoine, Marie-Hélène; Fontaine, Véronique

2016-11-15

Histone deacetylase inhibitors (HDACi) have been shown to render HPV-carrying cells susceptible to intrinsic and extrinsic apoptotic signals. As such, these epigenetic drugs have entered clinical trials in the effort to treat cervical cancer. Here, we studied the effect of common HDACi, with an emphasis on Trichostatin A (TSA), on the transcriptional activity of the HPV-16 Long Control Region (LCR) in order to better understand the impact of these agents in the context of the HPV life cycle and infection. HDACi strongly induced transcription of the firefly luciferase reporter gene under the control of the HPV-16 LCR in a variety of cell lines. In the HaCaT keratinocyte cell line undergoing differentiation induced by TSA, we observed a reduction in LCR-controlled transcription. Three major AP-1 binding sites in the HPV-16 LCR are involved in the regulation by TSA. However, whatever the status of differentiation of the HaCaT cells, TSA induced integration of extra-chromosomal transfected DNA into the cellular genome. Although these data suggest caution using HDACi in the treatment of HR HPV infection, further in vivo studies are necessary to better assess the risk.