Probability and Cumulative Density Function Methods for the Stochastic Advection-Reaction Equation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barajas-Solano, David A.; Tartakovsky, Alexandre M.

We present a cumulative density function (CDF) method for the probabilistic analysis of $d$-dimensional advection-dominated reactive transport in heterogeneous media. We employ a probabilistic approach in which epistemic uncertainty on the spatial heterogeneity of Darcy-scale transport coefficients is modeled in terms of random fields with given correlation structures. Our proposed CDF method employs a modified Large-Eddy-Diffusivity (LED) approach to close and localize the nonlocal equations governing the one-point PDF and CDF of the concentration field, resulting in a $(d + 1)$ dimensional PDE. Compared to the classsical LED localization, the proposed modified LED localization explicitly accounts for the mean-field advectivemore » dynamics over the phase space of the PDF and CDF. To illustrate the accuracy of the proposed closure, we apply our CDF method to one-dimensional single-species reactive transport with uncertain, heterogeneous advection velocities and reaction rates modeled as random fields.« less

Adaptation of a visualized loop-mediated isothermal amplification technique for field detection of Plasmodium vivax infection.

PubMed

Tao, Zhi-Yong; Zhou, Hua-Yun; Xia, Hui; Xu, Sui; Zhu, Han-Wu; Culleton, Richard L; Han, Eun-Taek; Lu, Feng; Fang, Qiang; Gu, Ya-Ping; Liu, Yao-Bao; Zhu, Guo-Ding; Wang, Wei-Ming; Li, Ju-Lin; Cao, Jun; Gao, Qi

2011-06-21

Loop-mediated isothermal amplification (LAMP) is a high performance method for detecting DNA and holds promise for use in the molecular detection of infectious pathogens, including Plasmodium spp. However, in most malaria-endemic areas, which are often resource-limited, current LAMP methods are not feasible for diagnosis due to difficulties in accurately interpreting results with problems of sensitive visualization of amplified products, and the risk of contamination resulting from the high quantity of amplified DNA produced. In this study, we establish a novel visualized LAMP method in a closed-tube system, and validate it for the diagnosis of malaria under simulated field conditions. A visualized LAMP method was established by the addition of a microcrystalline wax-dye capsule containing the highly sensitive DNA fluorescence dye SYBR Green I to a normal LAMP reaction prior to the initiation of the reaction. A total of 89 blood samples were collected on filter paper and processed using a simple boiling method for DNA extraction, and then tested by the visualized LAMP method for Plasmodium vivax infection. The wax capsule remained intact during isothermal amplification, and released the DNA dye to the reaction mixture only when the temperature was raised to the melting point following amplification. Soon after cooling down, the solidified wax sealed the reaction mix at the bottom of the tube, thus minimizing the risk of aerosol contamination. Compared to microscopy, the sensitivity and specificity of LAMP were 98.3% (95% confidence interval (CI): 91.1-99.7%) and 100% (95% CI: 88.3-100%), and were in close agreement with a nested polymerase chain reaction method. This novel, cheap and quick visualized LAMP method is feasible for malaria diagnosis in resource-limited field settings.

Monitoring chemical reactions by low-field benchtop NMR at 45 MHz: pros and cons.

PubMed

Silva Elipe, Maria Victoria; Milburn, Robert R

2016-06-01

Monitoring chemical reactions is the key to controlling chemical processes where NMR can provide support. High-field NMR gives detailed structural information on chemical compounds and reactions; however, it is expensive and complex to operate. Conversely, low-field NMR instruments are simple and relatively inexpensive alternatives. While low-field NMR does not provide the detailed information as the high-field instruments as a result of their smaller chemical shift dispersion and the complex secondary coupling, it remains of practical value as a process analytical technology (PAT) tool and is complimentary to other established methods, such as ReactIR and Raman spectroscopy. We have tested a picoSpin-45 (currently under ThermoFisher Scientific) benchtop NMR instrument to monitor three types of reactions by 1D (1) H NMR: a Fischer esterification, a Suzuki cross-coupling, and the formation of an oxime. The Fischer esterification is a relatively simple reaction run at high concentration and served as proof of concept. The Suzuki coupling is an example of a more complex, commonly used reaction involving overlapping signals. Finally, the oxime formation involved a reaction in two phases that cannot be monitored by other PAT tools. Here, we discuss the pros and cons of monitoring these reactions at a low-field of 45 MHz by 1D (1) H NMR. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Reactions between NO/+/ and metal atoms using magnetically confined afterglows

NASA Technical Reports Server (NTRS)

Lo, H. H.; Clendenning, L. M.; Fite, W. L.

1977-01-01

A new method of studying thermal energy ion-neutral collision processes involving nongaseous neutral atoms is described. A long magnetic field produced by a solenoid in a vacuum chamber confines a thermal-energy plasma generated by photoionization of gas at very low pressure. As the plasma moves toward the end of the field, it is crossed by a metal atom beam. Ionic products of ion-atom reactions are trapped by the field and both the reactant and product ions move to the end of the magnetic field where they are detected by a quadrupole mass filter. The cross sections for charge transfer between NO(+) and Na, Mg, Ca, and Sr and that for rearrangement between NO(+) and Ca have been obtained. The charge-transfer reaction is found strongly dominant over the rearrangement reaction that forms metallic oxide ions.

Use of portable analytical methods to determine the stoichiometry of reaction for hexahydrotriazine-based hydrogen sulfide scavenger operations.

PubMed

Taylor, Grahame N; Matherly, Ron

2014-05-20

During the reaction between 1,3,5-tris(2-hydroxyethyl)hexahydro-s-triazine and hydrogen sulphide, the principle by-product is the organic sulphide 5-(2-hydroxyethyl)dithiazine. It can be determined by a novel, portable, field-capable ion mobility spectrometry method described herein and enables the "degree spent" to be determined. Dependant upon the level of carbon dioxide in the produced gas, a mixture of ethanolaminium bicarbonate and ethanolamine bisulphide is also produced. Using a field capable spectrophotometric method the level of inorganic sulphide can be determined, thus allowing the ethanolaminium bisulphide concentration to be calculated. Provided the fluid is only partially spent, and there is some unreacted 1,3,5-tris(2-hydroxyethyl)hexahydro-s-triazine remaining; the only source of inorganic sulphide is the amine salt. From a knowledge of the original fluid concentration, the combination of these two methods allows the effective stoichiometry, or observed molar reaction proportions between 1,3,5-tris(2-hydroxyethyl)hexahydro-s-triazine and hydrogen sulphide, to be measured for a specific field location.

An image-based reaction field method for electrostatic interactions in molecular dynamics simulations of aqueous solutions

NASA Astrophysics Data System (ADS)

Lin, Yuchun; Baumketner, Andrij; Deng, Shaozhong; Xu, Zhenli; Jacobs, Donald; Cai, Wei

2009-10-01

In this paper, a new solvation model is proposed for simulations of biomolecules in aqueous solutions that combines the strengths of explicit and implicit solvent representations. Solute molecules are placed in a spherical cavity filled with explicit water, thus providing microscopic detail where it is most needed. Solvent outside of the cavity is modeled as a dielectric continuum whose effect on the solute is treated through the reaction field corrections. With this explicit/implicit model, the electrostatic potential represents a solute molecule in an infinite bath of solvent, thus avoiding unphysical interactions between periodic images of the solute commonly used in the lattice-sum explicit solvent simulations. For improved computational efficiency, our model employs an accurate and efficient multiple-image charge method to compute reaction fields together with the fast multipole method for the direct Coulomb interactions. To minimize the surface effects, periodic boundary conditions are employed for nonelectrostatic interactions. The proposed model is applied to study liquid water. The effect of model parameters, which include the size of the cavity, the number of image charges used to compute reaction field, and the thickness of the buffer layer, is investigated in comparison with the particle-mesh Ewald simulations as a reference. An optimal set of parameters is obtained that allows for a faithful representation of many structural, dielectric, and dynamic properties of the simulated water, while maintaining manageable computational cost. With controlled and adjustable accuracy of the multiple-image charge representation of the reaction field, it is concluded that the employed model achieves convergence with only one image charge in the case of pure water. Future applications to pKa calculations, conformational sampling of solvated biomolecules and electrolyte solutions are briefly discussed.

Microalloying of transition metal silicides by mechanical activation and field-activated reaction

DOEpatents

Munir, Zuhair A [Davis, CA; Woolman, Joseph N [Davis, CA; Petrovic, John J [Los Alamos, NM

2003-09-02

Alloys of transition metal suicides that contain one or more alloying elements are fabricated by a two-stage process involving mechanical activation as the first stage and densification and field-activated reaction as the second stage. Mechanical activation, preferably performed by high-energy planetary milling, results in the incorporation of atoms of the alloying element(s) into the crystal lattice of the transition metal, while the densification and field-activated reaction, preferably performed by spark plasma sintering, result in the formation of the alloyed transition metal silicide. Among the many advantages of the process are its ability to accommodate materials that are incompatible in other alloying methods.

Empirical Force Fields for Mechanistic Studies of Chemical Reactions in Proteins.

PubMed

Das, A K; Meuwly, M

2016-01-01

Following chemical reactions in atomistic detail is one of the most challenging aspects of current computational approaches to chemistry. In this chapter the application of adiabatic reactive MD (ARMD) and its multistate version (MS-ARMD) are discussed. Both methods allow to study bond-breaking and bond-forming processes in chemical and biological processes. Particular emphasis is put on practical aspects for applying the methods to investigate the dynamics of chemical reactions. The chapter closes with an outlook of possible generalizations of the methods discussed. © 2016 Elsevier Inc. All rights reserved.

Mean field treatment of heterogeneous steady state kinetics

NASA Astrophysics Data System (ADS)

Geva, Nadav; Vaissier, Valerie; Shepherd, James; Van Voorhis, Troy

2017-10-01

We propose a method to quickly compute steady state populations of species undergoing a set of chemical reactions whose rate constants are heterogeneous. Using an average environment in place of an explicit nearest neighbor configuration, we obtain a set of equations describing a single fluctuating active site in the presence of an averaged bath. We apply this Mean Field Steady State (MFSS) method to a model of H2 production on a disordered surface for which the activation energy for the reaction varies from site to site. The MFSS populations quantitatively reproduce the KMC results across the range of rate parameters considered.

Surface- and Tip-Enhanced Raman Spectroscopy in Catalysis

PubMed Central

2016-01-01

Surface- and tip-enhanced Raman spectroscopy (SERS and TERS) techniques exhibit highly localized chemical sensitivity, making them ideal for studying chemical reactions, including processes at catalytic surfaces. Catalyst structures, adsorbates, and reaction intermediates can be observed in low quantities at hot spots where electromagnetic fields are the strongest, providing ample opportunities to elucidate reaction mechanisms. Moreover, under ideal measurement conditions, it can even be used to trigger chemical reactions. However, factors such as substrate instability and insufficient signal enhancement still limit the applicability of SERS and TERS in the field of catalysis. By the use of sophisticated colloidal synthesis methods and advanced techniques, such as shell-isolated nanoparticle-enhanced Raman spectroscopy, these challenges could be overcome. PMID:27075515

Hierarchically Nanostructured Transition Metal Oxides for Lithium‐Ion Batteries

PubMed Central

Zheng, Mingbo; Tang, Hao; Li, Lulu; Hu, Qin; Zhang, Li; Xue, Huaiguo

2018-01-01

Abstract Lithium‐ion batteries (LIBs) have been widely used in the field of portable electric devices because of their high energy density and long cycling life. To further improve the performance of LIBs, it is of great importance to develop new electrode materials. Various transition metal oxides (TMOs) have been extensively investigated as electrode materials for LIBs. According to the reaction mechanism, there are mainly two kinds of TMOs, one is based on conversion reaction and the other is based on intercalation/deintercalation reaction. Recently, hierarchically nanostructured TMOs have become a hot research area in the field of LIBs. Hierarchical architecture can provide numerous accessible electroactive sites for redox reactions, shorten the diffusion distance of Li‐ion during the reaction, and accommodate volume expansion during cycling. With rapid research progress in this field, a timely account of this advanced technology is highly necessary. Here, the research progress on the synthesis methods, morphological characteristics, and electrochemical performances of hierarchically nanostructured TMOs for LIBs is summarized and discussed. Some relevant prospects are also proposed. PMID:29593962

Hierarchically Nanostructured Transition Metal Oxides for Lithium-Ion Batteries.

PubMed

Zheng, Mingbo; Tang, Hao; Li, Lulu; Hu, Qin; Zhang, Li; Xue, Huaiguo; Pang, Huan

2018-03-01

Lithium-ion batteries (LIBs) have been widely used in the field of portable electric devices because of their high energy density and long cycling life. To further improve the performance of LIBs, it is of great importance to develop new electrode materials. Various transition metal oxides (TMOs) have been extensively investigated as electrode materials for LIBs. According to the reaction mechanism, there are mainly two kinds of TMOs, one is based on conversion reaction and the other is based on intercalation/deintercalation reaction. Recently, hierarchically nanostructured TMOs have become a hot research area in the field of LIBs. Hierarchical architecture can provide numerous accessible electroactive sites for redox reactions, shorten the diffusion distance of Li-ion during the reaction, and accommodate volume expansion during cycling. With rapid research progress in this field, a timely account of this advanced technology is highly necessary. Here, the research progress on the synthesis methods, morphological characteristics, and electrochemical performances of hierarchically nanostructured TMOs for LIBs is summarized and discussed. Some relevant prospects are also proposed.

[Principle of LAMP method--a simple and rapid gene amplification method].

PubMed

Ushikubo, Hiroshi

2004-06-01

So far nucleic acid test (NAT) has been employed in various fields, including infectious disease diagnoses. However, due to its complicated procedures and relatively high cost, it has not been widely utilized in many actual diagnostic applications. We have therefore developed a simple and rapid gene amplification technology, Loop-mediated Isothermal Amplification (LAMP) method, which has shown prominent results of surpassing the performance of the conventional gene amplification methods. LAMP method acquires three main features: (1) all reaction can be carried out under isothermal conditions; (2) the amplification efficiency is extremely high and tremendous amount of amplification products can be obtained; and (3) the reaction is highly specific. Furthermore, developed from the standard LAMP method, a rapid LAMP method, by adding in the loop primers, can reduce the amplification time from the previous 1 hour to less than 30 minutes. Enormous amount of white precipitate of magnesium pyrophosphate is produced as a by-product of the amplification, therefore, direct visual detection is possible without using any reaction indicators and detection equipments. We believe LAMP technology, with the integration of these features, can rightly apply to clinical genetic testing, food and environmental analysis, as well as NAT in different fields.

Kinetic phase evolution of spinel cobalt oxide during lithiation

DOE PAGES

Li, Jing; He, Kai; Meng, Qingping; ...

2016-09-15

Spinel cobalt oxide has been proposed to undergo a multiple-step reaction during the electrochemical lithiation process. Understanding the kinetics of the lithiation process in this compound is crucial to optimize its performance and cyclability. In this work, we have utilized a low-angle annular dark-field scanning transmission electron microscopy method to visualize the dynamic reaction process in real time and study the reaction kinetics at different rates. We show that the particles undergo a two-step reaction at the single-particle level, which includes an initial intercalation reaction followed by a conversion reaction. At low rates, the conversion reaction starts after the intercalationmore » reaction has fully finished, consistent with the prediction of density functional theoretical calculations. At high rates, the intercalation reaction is overwhelmed by the subsequently nucleated conversion reaction, and the reaction speeds of both the intercalation and conversion reactions are increased. Phase-field simulations show the crucial role of surface diffusion rates of lithium ions in controlling this process. Furthermore, this work provides microscopic insights into the reaction dynamics in non-equilibrium conditions and highlights the effect of lithium diffusion rates on the overall reaction homogeneity as well as the performance.« less

Kinetic phase evolution of spinel cobalt oxide during lithiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jing; He, Kai; Meng, Qingping

Spinel cobalt oxide has been proposed to undergo a multiple-step reaction during the electrochemical lithiation process. Understanding the kinetics of the lithiation process in this compound is crucial to optimize its performance and cyclability. In this work, we have utilized a low-angle annular dark-field scanning transmission electron microscopy method to visualize the dynamic reaction process in real time and study the reaction kinetics at different rates. We show that the particles undergo a two-step reaction at the single-particle level, which includes an initial intercalation reaction followed by a conversion reaction. At low rates, the conversion reaction starts after the intercalationmore » reaction has fully finished, consistent with the prediction of density functional theoretical calculations. At high rates, the intercalation reaction is overwhelmed by the subsequently nucleated conversion reaction, and the reaction speeds of both the intercalation and conversion reactions are increased. Phase-field simulations show the crucial role of surface diffusion rates of lithium ions in controlling this process. Furthermore, this work provides microscopic insights into the reaction dynamics in non-equilibrium conditions and highlights the effect of lithium diffusion rates on the overall reaction homogeneity as well as the performance.« less

Functionalized linear and cyclic polyolefins

DOEpatents

Tuba, Robert; Grubbs, Robert H.

2018-02-13

This invention relates to methods and compositions for preparing linear and cyclic polyolefins. More particularly, the invention relates to methods and compositions for preparing functionalized linear and cyclic polyolefins via olefin metathesis reactions. Polymer products produced via the olefin metathesis reactions of the invention may be utilized for a wide range of materials applications. The invention has utility in the fields of polymer and materials chemistry and manufacture.

Predicting Upscaled Behavior of Aqueous Reactants in Heterogeneous Porous Media

NASA Astrophysics Data System (ADS)

Wright, E. E.; Hansen, S. K.; Bolster, D.; Richter, D. H.; Vesselinov, V. V.

2017-12-01

When modeling reactive transport, reaction rates are often overestimated due to the improper assumption of perfect mixing at the support scale of the transport model. In reality, fronts tend to form between participants in thermodynamically favorable reactions, leading to segregation of reactants into islands or fingers. When such a configuration arises, reactions are limited to the interface between the reactive solutes. Closure methods for estimating control-volume-effective reaction rates in terms of quantities defined at the control volume scale do not presently exist, but their development is crucial for effective field-scale modeling. We attack this problem through a combination of analytical and numerical means. Specifically, we numerically study reactive transport through an ensemble of realizations of two-dimensional heterogeneous porous media. We then employ regression analysis to calibrate an analytically-derived relationship between reaction rate and various dimensionless quantities representing conductivity-field heterogeneity and the respective strengths of diffusion, reaction and advection.

Numerical Analysis of Microwave Heating on Saponification Reaction

NASA Astrophysics Data System (ADS)

Huang, Kama; Jia, Kun

2005-01-01

Currently, microwave is widely used in chemical industry to accelerate chemical reactions. Saponification reaction has important applications in industry; some research results have shown that microwave heating can significantly accelerate the reaction [1]. But so far, no efficient method has been reported for the analysis of the heating process and design of an efficient reactor powered by microwave. In this paper, we present a method to study the microwave heating process on saponification reaction, where the reactant in a test tube is considered as a mixture of dilute solution. According to the preliminary measurement results, the effective permittivity of the mixture is approximately the permittivity of water, but the conductivity, which could change with the reaction, is derived from the reaction equation (RE). The electromagnetic field equation and reaction equation are coupled by the conductivity. Following that, the whole heating processes, which is described by Maxwell's equations, the reaction equation and heat transport equation (HTE), is analyzed by finite difference time domain (FDTD) method. The temperature rising in the test tube are measured and compared with the computational results. Good agreement can be seen between the measured and calculated results.

Theoretical research program to study chemical reactions in AOTV bow shock tubes

NASA Technical Reports Server (NTRS)

Taylor, P.

1986-01-01

Progress in the development of computational methods for the characterization of chemical reactions in aerobraking orbit transfer vehicle (AOTV) propulsive flows is reported. Two main areas of code development were undertaken: (1) the implementation of CASSCF (complete active space self-consistent field) and SCF (self-consistent field) analytical first derivatives on the CRAY X-MP; and (2) the installation of the complete set of electronic structure codes on the CRAY 2. In the area of application calculations the main effort was devoted to performing full configuration-interaction calculations and using these results to benchmark other methods. Preprints describing some of the systems studied are included.

A practical approach to calculate the time evolutions of magnetic field effects on photochemical reactions in nano-structured materials.

PubMed

Yago, Tomoaki; Wakasa, Masanobu

2015-04-21

A practical method to calculate time evolutions of magnetic field effects (MFEs) on photochemical reactions involving radical pairs is developed on the basis of the theory of the chemically induced dynamic spin polarization proposed by Pedersen and Freed. In theory, the stochastic Liouville equation (SLE), including the spin Hamiltonian, diffusion motions of the radical pair, chemical reactions, and spin relaxations, is solved by using the Laplace and the inverse Laplace transformation technique. In our practical approach, time evolutions of the MFEs are successfully calculated by applying the Miller-Guy method instead of the final value theorem to the inverse Laplace transformation process. Especially, the SLE calculations are completed in a short time when the radical pair dynamics can be described by the chemical kinetics consisting of diffusions, reactions and spin relaxations. The SLE analysis with a short calculation time enables one to examine the various parameter sets for fitting the experimental date. Our study demonstrates that simultaneous fitting of the time evolution of the MFE and of the magnetic field dependence of the MFE provides valuable information on the diffusion motions of the radical pairs in nano-structured materials such as micelles where the lifetimes of radical pairs are longer than hundreds of nano-seconds and the magnetic field dependence of the spin relaxations play a major role for the generation of the MFE.

Spacecraft momentum unloading using controlled magnetic torques

NASA Technical Reports Server (NTRS)

Linder, David M. (Inventor); Goodzeit, Neil E. (Inventor); Schwarzschild, Marc (Inventor)

1992-01-01

A method for maintaining the attitude of a three-axis controlled satellite by use of magnetic torquers includes using magnetometers for measuring the direction of the ambient geomagnetic field. The direction of the net reaction wheel momentum is also determined. The angle between the direction of the geomagnetic field and the net reaction wheel momentum is determined. The angle is compared with a threshold value. Magnetic torquer power consumption is reduced by operating the magnetic torquers only when the angle exceeds the threshold value.

Determination of phosphate in soil extracts in the field: A green chemistry enzymatic method.

PubMed

Campbell, Ellen R; Warsko, Kayla; Davidson, Anna-Marie; Bill Campbell, Wilbur H

2015-01-01

Measurement of ortho-phosphate in soil extracts usually involves sending dried samples of soil to a laboratory for analysis and waiting several weeks for the results. Phosphate determination methods often involve use of strong acids, heavy metals, and organic dyes. To overcome limitations of this approach, we have developed a phosphate determination method which can be carried out in the field to obtain results on the spot. This new method uses: •Small volumes.•An enzymatic reaction.•Green chemistry. First, the soil sample is extracted with deionized water and filtered. Next, an aliquot of the soil extract (0.5 mL) is transferred to a disposable cuvette, containing 0.5 mL of reaction mixture [200 mM HEPES, pH 7.6, 20 mM MgCl2, with 80 nmol 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG) and 1 unit of recombinant purine nucleoside phosphorylase (PNP; EC 2.4.2.1)], mixed, and incubated for 10 min at field temperature. Absorbance of the completed reaction is measured at 360 nm in open-source, portable photometer linked by bluetooth to a smartphone. The phosphate and phosphorus content of the soil is determined by comparison of its absorbance at 360 nm to a previously prepared standard phosphate curve, which is stored in the smartphone app.

Determination of phosphate in soil extracts in the field: A green chemistry enzymatic method

PubMed Central

Campbell, Ellen R.; Warsko, Kayla; Davidson, Anna-Marie; (Bill) Campbell, Wilbur H.

2015-01-01

Measurement of ortho-phosphate in soil extracts usually involves sending dried samples of soil to a laboratory for analysis and waiting several weeks for the results. Phosphate determination methods often involve use of strong acids, heavy metals, and organic dyes. To overcome limitations of this approach, we have developed a phosphate determination method which can be carried out in the field to obtain results on the spot. This new method uses: • Small volumes. • An enzymatic reaction. • Green chemistry. First, the soil sample is extracted with deionized water and filtered. Next, an aliquot of the soil extract (0.5 mL) is transferred to a disposable cuvette, containing 0.5 mL of reaction mixture [200 mM HEPES, pH 7.6, 20 mM MgCl2, with 80 nmol 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG) and 1 unit of recombinant purine nucleoside phosphorylase (PNP; EC 2.4.2.1)], mixed, and incubated for 10 min at field temperature. Absorbance of the completed reaction is measured at 360 nm in open-source, portable photometer linked by bluetooth to a smartphone. The phosphate and phosphorus content of the soil is determined by comparison of its absorbance at 360 nm to a previously prepared standard phosphate curve, which is stored in the smartphone app. PMID:26150991

Novel 1H low field nuclear magnetic resonance applications for the field of biodiesel

PubMed Central

2013-01-01

Background Biodiesel production has increased dramatically over the last decade, raising the need for new rapid and non-destructive analytical tools and technologies. 1H Low Field Nuclear Magnetic Resonance (LF-NMR) applications, which offer great potential to the field of biodiesel, have been developed by the Phyto Lipid Biotechnology Lab research team in the last few years. Results Supervised and un-supervised chemometric tools are suggested for screening new alternative biodiesel feedstocks according to oil content and viscosity. The tools allowed assignment into viscosity groups of biodiesel-petrodiesel samples whose viscosity is unknown, and uncovered biodiesel samples that have residues of unreacted acylglycerol and/or methanol, and poorly separated and cleaned glycerol and water. In the case of composite materials, relaxation time distribution, and cross-correlation methods were successfully applied to differentiate components. Continuous distributed methods were also applied to calculate the yield of the transesterification reaction, and thus monitor the progress of the common and in-situ transesterification reactions, offering a tool for optimization of reaction parameters. Conclusions Comprehensive applied tools are detailed for the characterization of new alternative biodiesel resources in their whole conformation, monitoring of the biodiesel transesterification reaction, and quality evaluation of the final product, using a non-invasive and non-destructive technology that is new to the biodiesel research area. A new integrated computational-experimental approach for analysis of 1H LF-NMR relaxometry data is also presented, suggesting improved solution stability and peak resolution. PMID:23590829

Visualizing non-equilibrium lithiation of spinel oxide via in situ transmission electron microscopy

PubMed Central

He, Kai; Zhang, Sen; Li, Jing; Yu, Xiqian; Meng, Qingping; Zhu, Yizhou; Hu, Enyuan; Sun, Ke; Yun, Hongseok; Yang, Xiao-Qing; Zhu, Yimei; Gan, Hong; Mo, Yifei; Stach, Eric A.; Murray, Christopher B.; Su, Dong

2016-01-01

Spinel transition metal oxides are important electrode materials for lithium-ion batteries, whose lithiation undergoes a two-step reaction, whereby intercalation and conversion occur in a sequential manner. These two reactions are known to have distinct reaction dynamics, but it is unclear how their kinetics affects the overall electrochemical response. Here we explore the lithiation of nanosized magnetite by employing a strain-sensitive, bright-field scanning transmission electron microscopy approach. This method allows direct, real-time, high-resolution visualization of how lithiation proceeds along specific reaction pathways. We find that the initial intercalation process follows a two-phase reaction sequence, whereas further lithiation leads to the coexistence of three distinct phases within single nanoparticles, which has not been previously reported to the best of our knowledge. We use phase-field theory to model and describe these non-equilibrium reaction pathways, and to directly correlate the observed phase evolution with the battery's discharge performance. PMID:27157119

Periodic MHD flow with temperature dependent viscosity and thermal conductivity past an isothermal oscillating cylinder

NASA Astrophysics Data System (ADS)

Ahmed, Rubel; Rana, B. M. Jewel; Ahmmed, S. F.

2017-06-01

Temperature dependent viscosity and thermal conducting heat and mass transfer flow with chemical reaction and periodic magnetic field past an isothermal oscillating cylinder have been considered. The partial dimensionless equations governing the flow have been solved numerically by applying explicit finite difference method with the help Compaq visual 6.6a. The obtained outcome of this inquisition has been discussed for different values of well-known flow parameters with different time steps and oscillation angle. The effect of chemical reaction and periodic MHD parameters on the velocity field, temperature field and concentration field, skin-friction, Nusselt number and Sherwood number have been studied and results are presented by graphically. The novelty of the present problem is to study the streamlines by taking into account periodic magnetic field.

Bio-Organic Reaction Animations (BioORA): Student Performance, Student Perceptions, and Instructor Feedback

ERIC Educational Resources Information Center

Gunersel, Adalet Baris; Fleming, Steven

2014-01-01

Research shows that computer animations are especially helpful in fields such as chemistry and in this mixed-methods study, we investigate the educational effectiveness of Bio-Organic Reaction Animations (BioORA), a 3-D software, in four undergraduate biochemistry classes at different universities. Statistically significant findings indicate that…

QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

EPA Science Inventory

Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

PubMed Central

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

Elementary reaction profile and chemical kinetics study of [C(1D)/(3P) + SiH4] with the CCSD(T) method

NASA Astrophysics Data System (ADS)

Ranka, Karnamohit; Perera, Ajith; Bartlett, Rodney J.

2017-07-01

Carbon and silicon-based molecules are omnipresent in the fields of combustion, atmospheric, semiconductor, and astronomical chemistry, among others. This paper reports the underlying elementary reactions for the [C(1D) + SiH4] and [C(3P) + SiH4] reaction profiles, optimized geometries of the intermediates, transition states (at the CCSD(T) level), RRKM and TST rate constants, and the corresponding branching ratios. Previously unreported van der Waals complex intermediates have been found for both reactions.

Plasmonic Imaging of Electrochemical Reactions of Single Nanoparticles.

PubMed

Fang, Yimin; Wang, Hui; Yu, Hui; Liu, Xianwei; Wang, Wei; Chen, Hong-Yuan; Tao, N J

2016-11-15

Electrochemical reactions are involved in many natural phenomena, and are responsible for various applications, including energy conversion and storage, material processing and protection, and chemical detection and analysis. An electrochemical reaction is accompanied by electron transfer between a chemical species and an electrode. For this reason, it has been studied by measuring current, charge, or related electrical quantities. This approach has led to the development of various electrochemical methods, which have played an essential role in the understanding and applications of electrochemistry. While powerful, most of the traditional methods lack spatial and temporal resolutions desired for studying heterogeneous electrochemical reactions on electrode surfaces and in nanoscale materials. To overcome the limitations, scanning probe microscopes have been invented to map local electrochemical reactions with nanometer resolution. Examples include the scanning electrochemical microscope and scanning electrochemical cell microscope, which directly image local electrochemical reaction current using a scanning electrode or pipet. The use of a scanning probe in these microscopes provides high spatial resolution, but at the expense of temporal resolution and throughput. This Account discusses an alternative approach to study electrochemical reactions. Instead of measuring electron transfer electrically, it detects the accompanying changes in the reactant and product concentrations on the electrode surface optically via surface plasmon resonance (SPR). SPR is highly surface sensitive, and it provides quantitative information on the surface concentrations of reactants and products vs time and electrode potential, from which local reaction kinetics can be analyzed and quantified. The plasmonic approach allows imaging of local electrochemical reactions with high temporal resolution and sensitivity, making it attractive for studying electrochemical reactions in biological systems and nanoscale materials with high throughput. The plasmonic approach has two imaging modes: electrochemical current imaging and interfacial impedance imaging. The former images local electrochemical current associated with electrochemical reactions (faradic current), and the latter maps local interfacial impedance, including nonfaradic contributions (e.g., double layer charging). The plasmonic imaging technique can perform voltammetry (cyclic or square wave) in an analogous manner to the traditional electrochemical methods. It can also be integrated with bright field, dark field, and fluorescence imaging capabilities in one optical setup to provide additional capabilities. To date the plasmonic imaging technique has found various applications, including mapping of heterogeneous surface reactions, analysis of trace substances, detection of catalytic reactions, and measurement of graphene quantum capacitance. The plasmonic and other emerging optical imaging techniques (e.g., dark field and fluorescence microscopy), together with the scanning probe-based electrochemical imaging and single nanoparticle analysis techniques, provide new capabilities for one to study single nanoparticle electrochemistry with unprecedented spatial and temporal resolutions. In this Account, we focus on imaging of electrochemical reactions at single nanoparticles.

Ionization signals from diamond detectors in fast-neutron fields

NASA Astrophysics Data System (ADS)

Weiss, C.; Frais-Kölbl, H.; Griesmayer, E.; Kavrigin, P.

2016-09-01

In this paper we introduce a novel analysis technique for measurements with single-crystal chemical vapor deposition (sCVD) diamond detectors in fast-neutron fields. This method exploits the unique electronic property of sCVD diamond sensors that the signal shape of the detector current is directly proportional to the initial ionization profile. In fast-neutron fields the diamond sensor acts simultaneously as target and sensor. The interaction of neutrons with the stable isotopes 12 C and 13 C is of interest for fast-neutron diagnostics. The measured signal shapes of detector current pulses are used to identify individual types of interactions in the diamond with the goal to select neutron-induced reactions in the diamond and to suppress neutron-induced background reactions as well as γ-background. The method is verified with experimental data from a measurement in a 14.3 MeV neutron beam at JRC-IRMM, Geel/Belgium, where the 13C(n, α)10Be reaction was successfully extracted from the dominating background of recoil protons and γ-rays and the energy resolution of the 12C(n, α)9Be reaction was substantially improved. The presented analysis technique is especially relevant for diagnostics in harsh radiation environments, like fission and fusion reactors. It allows to extract the neutron spectrum from the background, and is particularly applicable to neutron flux monitoring and neutron spectroscopy.

Online low-field NMR spectroscopy for process control of an industrial lithiation reaction-automated data analysis.

PubMed

Kern, Simon; Meyer, Klas; Guhl, Svetlana; Gräßer, Patrick; Paul, Andrea; King, Rudibert; Maiwald, Michael

2018-05-01

Monitoring specific chemical properties is the key to chemical process control. Today, mainly optical online methods are applied, which require time- and cost-intensive calibration effort. NMR spectroscopy, with its advantage being a direct comparison method without need for calibration, has a high potential for enabling closed-loop process control while exhibiting short set-up times. Compact NMR instruments make NMR spectroscopy accessible in industrial and rough environments for process monitoring and advanced process control strategies. We present a fully automated data analysis approach which is completely based on physically motivated spectral models as first principles information (indirect hard modeling-IHM) and applied it to a given pharmaceutical lithiation reaction in the framework of the European Union's Horizon 2020 project CONSENS. Online low-field NMR (LF NMR) data was analyzed by IHM with low calibration effort, compared to a multivariate PLS-R (partial least squares regression) approach, and both validated using online high-field NMR (HF NMR) spectroscopy. Graphical abstract NMR sensor module for monitoring of the aromatic coupling of 1-fluoro-2-nitrobenzene (FNB) with aniline to 2-nitrodiphenylamine (NDPA) using lithium-bis(trimethylsilyl) amide (Li-HMDS) in continuous operation. Online 43.5 MHz low-field NMR (LF) was compared to 500 MHz high-field NMR spectroscopy (HF) as reference method.

Continuum description of solvent dielectrics in molecular-dynamics simulations of proteins

NASA Astrophysics Data System (ADS)

Egwolf, Bernhard; Tavan, Paul

2003-02-01

We present a continuum approach for efficient and accurate calculation of reaction field forces and energies in classical molecular-dynamics (MD) simulations of proteins in water. The derivation proceeds in two steps. First, we reformulate the electrostatics of an arbitrarily shaped molecular system, which contains partially charged atoms and is embedded in a dielectric continuum representing the water. A so-called fuzzy partition is used to exactly decompose the system into partial atomic volumes. The reaction field is expressed by means of dipole densities localized at the atoms. Since these densities cannot be calculated analytically for general systems, we introduce and carefully analyze a set of approximations in a second step. These approximations allow us to represent the dipole densities by simple dipoles localized at the atoms. We derive a system of linear equations for these dipoles, which can be solved numerically by iteration. After determining the two free parameters of our approximate method we check its quality by comparisons (i) with an analytical solution, which is available for a perfectly spherical system, (ii) with forces obtained from a MD simulation of a soluble protein in water, and (iii) with reaction field energies of small molecules calculated by a finite difference method.

Numerical simulation of Trichel pulses of negative DC corona discharge based on a plasma chemical model

NASA Astrophysics Data System (ADS)

Chen, Xiaoyue; Lan, Lei; Lu, Hailiang; Wang, Yu; Wen, Xishan; Du, Xinyu; He, Wangling

2017-10-01

A numerical simulation method of negative direct current (DC) corona discharge based on a plasma chemical model is presented, and a coaxial cylindrical gap is adopted. There were 15 particle species and 61 kinds of collision reactions electrons involved, and 22 kinds of reactions between ions are considered in plasma chemical reactions. Based on this method, continuous Trichel pulses are calculated on about a 100 us timescale, and microcosmic physicochemical process of negative DC corona discharge in three different periods is discussed. The obtained results show that the amplitude of Trichel pulses is between 1-2 mA, and that pulse interval is in the order of 10-5 s. The positive ions produced by avalanche ionization enhanced the electric field near the cathode at the beginning of the pulse, then disappeared from the surface of cathode. The electric field decreases and the pulse ceases to develop. The negative ions produced by attachment slowly move away from the cathode, and the electric field increases gradually until the next pulse begins to develop. The positive and negative ions with the highest density during the corona discharge process are O4+ and O3- , respectively.

Anomalous dimension in a two-species reaction-diffusion system

NASA Astrophysics Data System (ADS)

Vollmayr-Lee, Benjamin; Hanson, Jack; McIsaac, R. Scott; Hellerick, Joshua D.

2018-01-01

We study a two-species reaction-diffusion system with the reactions A+A\\to (0, A) and A+B\\to A , with general diffusion constants D A and D B . Previous studies showed that for dimensions d≤slant 2 the B particle density decays with a nontrivial, universal exponent that includes an anomalous dimension resulting from field renormalization. We demonstrate via renormalization group methods that the scaled B particle correlation function has a distinct anomalous dimension resulting in the asymptotic scaling \\tilde CBB(r, t) ˜ tφf(r/\\sqrt{t}) , where the exponent ϕ results from the renormalization of the square of the field associated with the B particles. We compute this exponent to first order in \

Combining in situ characterization methods in one set-up: looking with more eyes into the intricate chemistry of the synthesis and working of heterogeneous catalysts.

PubMed

Bentrup, Ursula

2010-12-01

Several in situ techniques are known which allow investigations of catalysts and catalytic reactions under real reaction conditions using different spectroscopic and X-ray methods. In recent years, specific set-ups have been established which combine two or more in situ methods in order to get a more detailed understanding of catalytic systems. This tutorial review will give a summary of currently available set-ups equipped with multiple techniques for in situ catalyst characterization, catalyst preparation, and reaction monitoring. Besides experimental and technical aspects of method coupling including X-ray techniques, spectroscopic methods (Raman, UV-vis, FTIR), and magnetic resonance spectroscopies (NMR, EPR), essential results will be presented to demonstrate the added value of multitechnique in situ approaches. A special section is focussed on selected examples of use which show new developments and application fields.

Experimental evidence of quantum radiation reaction in aligned crystals.

PubMed

Wistisen, Tobias N; Di Piazza, Antonino; Knudsen, Helge V; Uggerhøj, Ulrik I

2018-02-23

Quantum radiation reaction is the influence of multiple photon emissions from a charged particle on the particle's dynamics, characterized by a significant energy-momentum loss per emission. Here we report experimental radiation emission spectra from ultrarelativistic positrons in silicon in a regime where quantum radiation reaction effects dominate the positron's dynamics. Our analysis shows that while the widely used quantum approach is overall the best model, it does not completely describe all the data in this regime. Thus, these experimental findings may prompt seeking more generally valid methods to describe quantum radiation reaction. This experiment is a fundamental test of quantum electrodynamics in a regime where the dynamics of charged particles is strongly influenced not only by the external electromagnetic fields but also by the radiation field generated by the charges themselves and where each photon emission may significantly reduce the energy of the charge.

Solvent electronic polarization effects on a charge transfer excitation studied by the mean-field QM/MM method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakano, Hiroshi; Elements Strategy Initiative for Catalysts and Batteries, Kyoto University, Kyoto 615-8245

2015-12-31

Electronic polarization effects of a medium can have a significant impact on a chemical reaction in condensed phases. We discuss the effects on the charge transfer excitation of a chromophore, N,N-dimethyl-4-nitroaniline, in various solvents using the mean-field QM/MM method with a polarizable force field. The results show that the explicit consideration of the solvent electronic polarization effects is important especially for a solvent with a low dielectric constant when we study the solvatochromism of the chromophore.

Computational prediction of chemical reactions: current status and outlook.

PubMed

Engkvist, Ola; Norrby, Per-Ola; Selmi, Nidhal; Lam, Yu-Hong; Peng, Zhengwei; Sherer, Edward C; Amberg, Willi; Erhard, Thomas; Smyth, Lynette A

2018-06-01

Over the past few decades, various computational methods have become increasingly important for discovering and developing novel drugs. Computational prediction of chemical reactions is a key part of an efficient drug discovery process. In this review, we discuss important parts of this field, with a focus on utilizing reaction data to build predictive models, the existing programs for synthesis prediction, and usage of quantum mechanics and molecular mechanics (QM/MM) to explore chemical reactions. We also outline potential future developments with an emphasis on pre-competitive collaboration opportunities. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular dynamics simulation of highly charged proteins: Comparison of the particle-particle particle-mesh and reaction field methods for the calculation of electrostatic interactions

PubMed Central

Gargallo, Raimundo; Hünenberger, Philippe H.; Avilés, Francesc X.; Oliva, Baldomero

2003-01-01

Molecular dynamics (MD) simulations of the activation domain of porcine procarboxypeptidase B (ADBp) were performed to examine the effect of using the particle-particle particle-mesh (P3M) or the reaction field (RF) method for calculating electrostatic interactions in simulations of highly charged proteins. Several structural, thermodynamic, and dynamic observables were derived from the MD trajectories, including estimated entropies and solvation free energies and essential dynamics (ED). The P3M method leads to slightly higher atomic positional fluctuations and deviations from the crystallographic structure, along with somewhat lower values of the total energy and solvation free energy. However, the ED analysis of the system leads to nearly identical results for both simulations. Because of the strong similarity between the results, both methods appear well suited for the simulation of highly charged globular proteins in explicit solvent. However, the lower computational demand of the RF method in the present implementation represents a clear advantage over the P3M method. PMID:14500874

A MATLAB-based finite-element visualization of quantum reactive scattering. I. Collinear atom-diatom reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warehime, Mick; Alexander, Millard H., E-mail: mha@umd.edu

We restate the application of the finite element method to collinear triatomic reactive scattering dynamics with a novel treatment of the scattering boundary conditions. The method provides directly the reactive scattering wave function and, subsequently, the probability current density field. Visualizing these quantities provides additional insight into the quantum dynamics of simple chemical reactions beyond simplistic one-dimensional models. Application is made here to a symmetric reaction (H+H{sub 2}), a heavy-light-light reaction (F+H{sub 2}), and a heavy-light-heavy reaction (F+HCl). To accompany this article, we have written a MATLAB code which is fast, simple enough to be accessible to a wide audience,more » as well as generally applicable to any problem that can be mapped onto a collinear atom-diatom reaction. The code and user's manual are available for download from http://www2.chem.umd.edu/groups/alexander/FEM.« less

Application of multiplex PCR, pulsed-field gel electrophoresis (PFGE), and BOX-PCR for molecular analysis of enterococci

USDA-ARS?s Scientific Manuscript database

The objective of the study was to use band-based molecular methods including BOX-PCR (Polymerase Chain Reaction) and Pulsed-Field Gel Electrophoresis (PFGE) to determine if genetically related enterococci were found among different stores, food types, or years. Enterococci were also characterized f...

A variational approach to parameter estimation in ordinary differential equations.

PubMed

Kaschek, Daniel; Timmer, Jens

2012-08-14

Ordinary differential equations are widely-used in the field of systems biology and chemical engineering to model chemical reaction networks. Numerous techniques have been developed to estimate parameters like rate constants, initial conditions or steady state concentrations from time-resolved data. In contrast to this countable set of parameters, the estimation of entire courses of network components corresponds to an innumerable set of parameters. The approach presented in this work is able to deal with course estimation for extrinsic system inputs or intrinsic reactants, both not being constrained by the reaction network itself. Our method is based on variational calculus which is carried out analytically to derive an augmented system of differential equations including the unconstrained components as ordinary state variables. Finally, conventional parameter estimation is applied to the augmented system resulting in a combined estimation of courses and parameters. The combined estimation approach takes the uncertainty in input courses correctly into account. This leads to precise parameter estimates and correct confidence intervals. In particular this implies that small motifs of large reaction networks can be analysed independently of the rest. By the use of variational methods, elements from control theory and statistics are combined allowing for future transfer of methods between the two fields.

Investigation of hydrogenation of toluene to methylcyclohexane in a trickle bed reactor by low-field nuclear magnetic resonance spectroscopy.

PubMed

Guthausen, Gisela; von Garnier, Agnes; Reimert, Rainer

2009-10-01

Low-field nuclear magnetic resonance (NMR) spectroscopy is applied to study the hydrogenation of toluene in a lab-scale reactor. A conventional benchtop NMR system was modified to achieve chemical shift resolution. After an off-line validity check of the approach, the reaction product is analyzed on-line during the process, applying chemometric data processing. The conversion of toluene to methylcyclohexane is compared with off-line gas chromatographic analysis. Both classic analytical and chemometric data processing was applied. As the results, which are obtained within a few tens of seconds, are equivalent within the experimental accuracy of both methods, low-field NMR spectroscopy was shown to provide an analytical tool for reaction characterization and immediate feedback.

Alkyne Benzannulation Reactions for the Synthesis of Novel Aromatic Architectures.

PubMed

Hein, Samuel J; Lehnherr, Dan; Arslan, Hasan; J Uribe-Romo, Fernando; Dichtel, William R

2017-11-21

Aromatic compounds and polymers are integrated into organic field effect transistors, light-emitting diodes, photovoltaic devices, and redox-flow batteries. These compounds and materials feature increasingly complex designs, and substituents influence energy levels, bandgaps, solution conformation, and crystal packing, all of which impact performance. However, many polycyclic aromatic hydrocarbons of interest are difficult to prepare because their substitution patterns lie outside the scope of current synthetic methods, as strategies for functionalizing benzene are often unselective when applied to naphthalene or larger systems. For example, cross-coupling and nucleophilic aromatic substitution reactions rely on prefunctionalized arenes, and even directed metalation methods most often modify positions near Lewis basic sites. Similarly, electrophilic aromatic substitutions access single regioisomers under substrate control. Cycloadditions provide a convergent route to densely functionalized aromatic compounds that compliment the above methods. After surveying cycloaddition reactions that might be used to modify the conjugated backbone of poly(phenylene ethynylene)s, we discovered that the Asao-Yamamoto benzannulation reaction is notably efficient. Although this reaction had been reported a decade earlier, its scope and usefulness for synthesizing complex aromatic systems had been under-recognized. This benzannulation reaction combines substituted 2-(phenylethynyl)benzaldehydes and substituted alkynes to form 2,3-substituted naphthalenes. The reaction tolerates a variety of sterically congested alkynes, making it well-suited for accessing poly- and oligo(ortho-arylene)s and contorted hexabenzocoronenes. In many cases in which asymmetric benzaldehyde and alkyne cycloaddition partners are used, the reaction is regiospecific based on the electronic character of the alkyne substrate. Recognizing these desirable features, we broadened the substrate scope to include silyl- and halogen-substituted alkynes. Through a combined experimental and computational approach, we have elucidated mechanistic insight and key principles that govern the regioselectivity outcome of the benzannulation of structurally diverse alkynes. We have applied these methods to prepare sterically hindered, shape-persistent aromatic systems, heterocyclic aromatic compounds, functionalized 2-aryne precursors, polyheterohalogenated naphthalenes, ortho-arylene foldamers, and graphene nanoribbons. As a result of these new synthetic avenues, aromatic structures with interesting properties were uncovered such as ambipolar charge transport in field effect transistors based on our graphene nanoribbons, conformational aspects of ortho-arylene architectures resulting from intramolecular π-stacking, and modulation of frontier molecular orbitals via protonation of heteroatom containing aromatic systems. Given the availability of many substituted 2-(phenylethynyl)benzaldehydes and the regioselectivity of the benzannulation reaction, naphthalenes can be prepared with control of the substitution pattern at seven of the eight substitutable positions. Researchers in a range of fields are likely to benefit directly from newly accessible molecular and polymeric systems derived from polyfunctionalized naphthalenes.

Measurements of neutron distribution in neutrons-gamma-rays mixed field using imaging plate for neutron capture therapy.

PubMed

Tanaka, Kenichi; Endo, Satoru; Hoshi, Masaharu

2010-01-01

The imaging plate (IP) technique is tried to be used as a handy method to measure the spatial neutron distribution via the (157)Gd(n,gamma)(158)Gd reaction for neutron capture therapy (NCT). For this purpose, IP is set in a water phantom and irradiated in a mixed field of neutrons and gamma-rays. The Hiroshima University Radiobiological Research Accelerator is utilized for this experiment. The neutrons are moderated with 20-cm-thick D(2)O to obtain suitable neutron field for NCT. The signal for IP doped with Gd as a neutron-response enhancer is subtracted with its contribution by gamma-rays, which was estimated using IP without Gd. The gamma-ray response of Gd-doped IP to non-Gd IP is set at 1.34, the value measured for (60)Co gamma-rays, in estimating the gamma-ray contribution to Gd-doped IP signal. Then measured distribution of the (157)Gd(n,gamma)(158)Gd reaction rate agrees within 10% with the calculated value based on the method that has already been validated for its reproducibility of Au activation. However, the evaluated distribution of the (157)Gd(n,gamma)(158)Gd reaction rate is so sensitive to gamma-ray energy, e.g. the discrepancy of the (157)Gd(n,gamma)(158)Gd reaction rate between measurement and calculation becomes 30% for the photon energy change from 33keV to 1.253MeV.

Silicon Field Effect Transistors as Dual-Use Sensor-Heater Hybrids

PubMed Central

Reddy, Bobby; Elibol, Oguz H.; Nair, Pradeep R.; Dorvel, Brian R.; Butler, Felice; Ahsan, Zahab; Bergstrom, Donald E.; Alam, Muhammad A.; Bashir, Rashid

2011-01-01

We demonstrate the temperature mediated applications of a previously proposed novel localized dielectric heating method on the surface of dual purpose silicon field effect transistor (FET) sensor-heaters and perform modeling and characterization of the underlying mechanisms. The FETs are first shown to operate as electrical sensors via sensitivity to changes in pH in ionic fluids. The same devices are then demonstrated as highly localized heaters via investigation of experimental heating profiles and comparison to simulation results. These results offer further insight into the heating mechanism and help determine the spatial resolution of the technique. Two important biosensor platform applications spanning different temperature ranges are then demonstrated: a localized heat-mediated DNA exchange reaction and a method for dense selective functionalization of probe molecules via the heat catalyzed complete desorption and reattachment of chemical functionalization to the transistor surfaces. Our results show that the use of silicon transistors can be extended beyond electrical switching and field-effect sensing to performing localized temperature controlled chemical reactions on the transistor itself. PMID:21214189

Multi-scale Methods in Quantum Field Theory

NASA Astrophysics Data System (ADS)

Polyzou, W. N.; Michlin, Tracie; Bulut, Fatih

2018-05-01

Daubechies wavelets are used to make an exact multi-scale decomposition of quantum fields. For reactions that involve a finite energy that take place in a finite volume, the number of relevant quantum mechanical degrees of freedom is finite. The wavelet decomposition has natural resolution and volume truncations that can be used to isolate the relevant degrees of freedom. The application of flow equation methods to construct effective theories that decouple coarse and fine scale degrees of freedom is examined.

Bayesian Estimation of Thermonuclear Reaction Rates for Deuterium+Deuterium Reactions

NASA Astrophysics Data System (ADS)

Gómez Iñesta, Á.; Iliadis, C.; Coc, A.

2017-11-01

The study of d+d reactions is of major interest since their reaction rates affect the predicted abundances of D, 3He, and 7Li. In particular, recent measurements of primordial D/H ratios call for reduced uncertainties in the theoretical abundances predicted by Big Bang nucleosynthesis (BBN). Different authors have studied reactions involved in BBN by incorporating new experimental data and a careful treatment of systematic and probabilistic uncertainties. To analyze the experimental data, Coc et al. used results of ab initio models for the theoretical calculation of the energy dependence of S-factors in conjunction with traditional statistical methods based on χ 2 minimization. Bayesian methods have now spread to many scientific fields and provide numerous advantages in data analysis. Astrophysical S-factors and reaction rates using Bayesian statistics were calculated by Iliadis et al. Here we present a similar analysis for two d+d reactions, d(d, n)3He and d(d, p)3H, that has been translated into a total decrease of the predicted D/H value by 0.16%.

Gas-Phase Reaction Pathways and Rate Coefficients for the Dichlorosilane-Hydrogen and Trichlorosilane-Hydrogen Systems

NASA Technical Reports Server (NTRS)

Dateo, Christopher E.; Walch, Stephen P.

2002-01-01

As part of NASA Ames Research Center's Integrated Process Team on Device/Process Modeling and Nanotechnology our goal is to create/contribute to a gas-phase chemical database for use in modeling microelectronics devices. In particular, we use ab initio methods to determine chemical reaction pathways and to evaluate reaction rate coefficients. Our initial studies concern reactions involved in the dichlorosilane-hydrogen (SiCl2H2--H2) and trichlorosilane-hydrogen (SiCl2H-H2) systems. Reactant, saddle point (transition state), and product geometries and their vibrational harmonic frequencies are determined using the complete-active-space self-consistent-field (CASSCF) electronic structure method with the correlation consistent polarized valence double-zeta basis set (cc-pVDZ). Reaction pathways are constructed by following the imaginary frequency mode of the saddle point to both the reactant and product. Accurate energetics are determined using the singles and doubles coupled-cluster method that includes a perturbational estimate of the effects of connected triple excitations (CCSD(T)) extrapolated to the complete basis set limit. Using the data from the electronic structure calculations, reaction rate coefficients are obtained using conventional and variational transition state and RRKM theories.

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

PubMed

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Coarse-graining and hybrid methods for efficient simulation of stochastic multi-scale models of tumour growth.

PubMed

de la Cruz, Roberto; Guerrero, Pilar; Calvo, Juan; Alarcón, Tomás

2017-12-01

The development of hybrid methodologies is of current interest in both multi-scale modelling and stochastic reaction-diffusion systems regarding their applications to biology. We formulate a hybrid method for stochastic multi-scale models of cells populations that extends the remit of existing hybrid methods for reaction-diffusion systems. Such method is developed for a stochastic multi-scale model of tumour growth, i.e. population-dynamical models which account for the effects of intrinsic noise affecting both the number of cells and the intracellular dynamics. In order to formulate this method, we develop a coarse-grained approximation for both the full stochastic model and its mean-field limit. Such approximation involves averaging out the age-structure (which accounts for the multi-scale nature of the model) by assuming that the age distribution of the population settles onto equilibrium very fast. We then couple the coarse-grained mean-field model to the full stochastic multi-scale model. By doing so, within the mean-field region, we are neglecting noise in both cell numbers (population) and their birth rates (structure). This implies that, in addition to the issues that arise in stochastic-reaction diffusion systems, we need to account for the age-structure of the population when attempting to couple both descriptions. We exploit our coarse-graining model so that, within the mean-field region, the age-distribution is in equilibrium and we know its explicit form. This allows us to couple both domains consistently, as upon transference of cells from the mean-field to the stochastic region, we sample the equilibrium age distribution. Furthermore, our method allows us to investigate the effects of intracellular noise, i.e. fluctuations of the birth rate, on collective properties such as travelling wave velocity. We show that the combination of population and birth-rate noise gives rise to large fluctuations of the birth rate in the region at the leading edge of front, which cannot be accounted for by the coarse-grained model. Such fluctuations have non-trivial effects on the wave velocity. Beyond the development of a new hybrid method, we thus conclude that birth-rate fluctuations are central to a quantitatively accurate description of invasive phenomena such as tumour growth.

Coarse-graining and hybrid methods for efficient simulation of stochastic multi-scale models of tumour growth

NASA Astrophysics Data System (ADS)

de la Cruz, Roberto; Guerrero, Pilar; Calvo, Juan; Alarcón, Tomás

2017-12-01

The development of hybrid methodologies is of current interest in both multi-scale modelling and stochastic reaction-diffusion systems regarding their applications to biology. We formulate a hybrid method for stochastic multi-scale models of cells populations that extends the remit of existing hybrid methods for reaction-diffusion systems. Such method is developed for a stochastic multi-scale model of tumour growth, i.e. population-dynamical models which account for the effects of intrinsic noise affecting both the number of cells and the intracellular dynamics. In order to formulate this method, we develop a coarse-grained approximation for both the full stochastic model and its mean-field limit. Such approximation involves averaging out the age-structure (which accounts for the multi-scale nature of the model) by assuming that the age distribution of the population settles onto equilibrium very fast. We then couple the coarse-grained mean-field model to the full stochastic multi-scale model. By doing so, within the mean-field region, we are neglecting noise in both cell numbers (population) and their birth rates (structure). This implies that, in addition to the issues that arise in stochastic-reaction diffusion systems, we need to account for the age-structure of the population when attempting to couple both descriptions. We exploit our coarse-graining model so that, within the mean-field region, the age-distribution is in equilibrium and we know its explicit form. This allows us to couple both domains consistently, as upon transference of cells from the mean-field to the stochastic region, we sample the equilibrium age distribution. Furthermore, our method allows us to investigate the effects of intracellular noise, i.e. fluctuations of the birth rate, on collective properties such as travelling wave velocity. We show that the combination of population and birth-rate noise gives rise to large fluctuations of the birth rate in the region at the leading edge of front, which cannot be accounted for by the coarse-grained model. Such fluctuations have non-trivial effects on the wave velocity. Beyond the development of a new hybrid method, we thus conclude that birth-rate fluctuations are central to a quantitatively accurate description of invasive phenomena such as tumour growth.

Simulation of loss mechanisms in organic solar cells: A description of the mesoscopic Monte Carlo technique and an evaluation of the first reaction method.

PubMed

Groves, Chris; Kimber, Robin G E; Walker, Alison B

2010-10-14

In this letter we evaluate the accuracy of the first reaction method (FRM) as commonly used to reduce the computational complexity of mesoscale Monte Carlo simulations of geminate recombination and the performance of organic photovoltaic devices. A wide range of carrier mobilities, degrees of energetic disorder, and applied electric field are considered. For the ranges of energetic disorder relevant for most polyfluorene, polythiophene, and alkoxy poly(phenylene vinylene) materials used in organic photovoltaics, the geminate separation efficiency predicted by the FRM agrees with the exact model to better than 2%. We additionally comment on the effects of equilibration on low-field geminate separation efficiency, and in doing so emphasize the importance of the energy at which geminate carriers are created upon their subsequent behavior.

Taming cut-off induced artifacts in molecular dynamics studies of solvated polypeptides. The reaction field method.

PubMed

Schreiber, H; Steinhauser, O

1992-12-05

In this paper we present a model system of a solvated polypeptide, which is a suitable reference platform for the systematic exploration of methods for taming artifacts introduced by an incorrect treatment of long-range Coulomb forces. The essential feature of the system composed of an alpha-helical peptide and 1021 water molecules is the strict neutrality of all charge groups. The dynamical properties of the peptide, i.e. unfolding or maintenance of the helix, already give first hints on the influence of boundary effects. A rigorous and deeper insight is gained, however, if analyzing the system by means of the generalized Kirkwood g-factor, which projects the net dipole moment of concentric spheres onto the respective dipole moment of the reference charge group. The g-factor is a global measure for, and a sensitive probe of, the orientational structure, which in its turn reflects even the smallest inconsistencies in the treatment of long-range forces. While the cut-off scheme failed the g-factor test, the "reaction field" method, the simplest cut-off correction scheme, enables a consistent description. In other words, with the aid of the reaction field, the correct orientational structure is restored. As a consequence, the helix stability is regained and we were able to calculate the dielectric constant epsilon approximately 55 to 60 for our system, which is slightly below the corresponding value epsilon SPC = 66 of the pure solvent.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Phosphoryl Transfer Reaction in RNA in Alkaline Conditions.

PubMed

Bertran, Joan; Oliva, Antoni; Branchadell, Vicenç; Acosta-Silva, Carles

2018-06-25

In this work we have studied the phosphoryl transfer reaction in RNA in alkaline conditions by theoretically exploring the influence of several solvents. The calculations have been carried out using the M06-2X functional while the solvents are taken as a continuum using the SMD method. The main results are that the O2'-P-O5' angle in the reactants, the free activation energies and the reaction mechanism are clearly dependent on the dielectric constant of the environment, thus showing that the electrostatic term is determining for this chemical system with two negative charges. Our study seems to indicate that water, the solvent with the greatest dielectric constant, would be the one that mostly increases the reaction rate. As this is not the case in enzymatic catalysis, one has to conclude that, in the case of proteins as well as in the case of ribozymes, the enzymatic catalysis is not mainly due to the solvent reaction field, but to local electrical fields due to the enzyme preorganization. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Automated Training of ReaxFF Reactive Force Fields for Energetics of Enzymatic Reactions.

PubMed

Trnka, Tomáš; Tvaroška, Igor; Koča, Jaroslav

2018-01-09

Computational studies of the reaction mechanisms of various enzymes are nowadays based almost exclusively on hybrid QM/MM models. Unfortunately, the success of this approach strongly depends on the selection of the QM region, and computational cost is a crucial limiting factor. An interesting alternative is offered by empirical reactive molecular force fields, especially the ReaxFF potential developed by van Duin and co-workers. However, even though an initial parametrization of ReaxFF for biomolecules already exists, it does not provide the desired level of accuracy. We have conducted a thorough refitting of the ReaxFF force field to improve the description of reaction energetics. To minimize the human effort required, we propose a fully automated approach to generate an extensive training set comprised of thousands of different geometries and molecular fragments starting from a few model molecules. Electrostatic parameters were optimized with QM electrostatic potentials as the main target quantity, avoiding excessive dependence on the choice of reference atomic charges and improving robustness and transferability. The remaining force field parameters were optimized using the VD-CMA-ES variant of the CMA-ES optimization algorithm. This method is able to optimize hundreds of parameters simultaneously with unprecedented speed and reliability. The resulting force field was validated on a real enzymatic system, ppGalNAcT2 glycosyltransferase. The new force field offers excellent qualitative agreement with the reference QM/MM reaction energy profile, matches the relative energies of intermediate and product minima almost exactly, and reduces the overestimation of transition state energies by 27-48% compared with the previous parametrization.

Particle beam injection system

DOEpatents

Jassby, Daniel L.; Kulsrud, Russell M.

1977-01-01

This invention provides a poloidal divertor for stacking counterstreaming ion beams to provide high intensity colliding beams. To this end, method and apparatus are provided that inject high energy, high velocity, ordered, atomic deuterium and tritium beams into a lower energy, toroidal, thermal equilibrium, neutral, target plasma column that is magnetically confined along an endless magnetic axis in a strong restoring force magnetic field having helical field lines to produce counterstreaming deuteron and triton beams that are received bent, stacked and transported along the endless axis, while a poloidal divertor removes thermal ions and electrons all along the axis to increase the density of the counterstreaming ion beams and the reaction products resulting therefrom. By balancing the stacking and removal, colliding, strong focused particle beams, reaction products and reactions are produced that convert one form of energy into another form of energy.

Reactive sintering process of ferromagnetic MnBi under high magnetic fields

NASA Astrophysics Data System (ADS)

Mitsui, Yoshifuru; Umetsu, Rie Y.; Takahashi, Kohki; Koyama, Keiichi

2018-05-01

The magnetic field effect on the reactive sintering process of MnBi was investigated. Magnetic-field-induced enhancement of the reaction was found to be exhibited at the initial stages. The coercivity field decreased with an increase in the in-field annealing time. The kinetics of the reaction were in good agreement with the diffusion-controlled reaction model. It is suggested that the decrease in activation energy at the initial stages of reaction increased the amount of formed MnBi phases, resulting in enhancement of the reaction Mn + Bi to MnBi phase by in-field reactive sintering.

Hydrocarbonaceous material processing methods and apparatus

DOEpatents

Brecher, Lee E [Laramie, WY

2011-07-12

Methods and apparatus are disclosed for possibly producing pipeline-ready heavy oil from substantially non-pumpable oil feeds. The methods and apparatus may be designed to produce such pipeline-ready heavy oils in the production field. Such methods and apparatus may involve thermal soaking of liquid hydrocarbonaceous inputs in thermal environments (2) to generate, though chemical reaction, an increased distillate amount as compared with conventional boiling technologies.

Functional tooth restoration utilising split germs through re-regionalisation of the tooth-forming field

PubMed Central

Yamamoto, Naomi; Oshima, Masamitsu; Tanaka, Chie; Ogawa, Miho; Nakajima, Kei; Ishida, Kentaro; Moriyama, Keiji; Tsuji, Takashi

2015-01-01

The tooth is an ectodermal organ that arises from a tooth germ under the regulation of reciprocal epithelial-mesenchymal interactions. Tooth morphogenesis occurs in the tooth-forming field as a result of reaction-diffusion waves of specific gene expression patterns. Here, we developed a novel mechanical ligation method for splitting tooth germs to artificially regulate the molecules that control tooth morphology. The split tooth germs successfully developed into multiple correct teeth through the re-regionalisation of the tooth-forming field, which is regulated by reaction-diffusion waves in response to mechanical force. Furthermore, split teeth erupted into the oral cavity and restored physiological tooth function, including mastication, periodontal ligament function and responsiveness to noxious stimuli. Thus, this study presents a novel tooth regenerative technology based on split tooth germs and the re-regionalisation of the tooth-forming field by artificial mechanical force. PMID:26673152

Electrostatics of proteins in dielectric solvent continua. II. Hamiltonian reaction field dynamics

NASA Astrophysics Data System (ADS)

Bauer, Sebastian; Tavan, Paul; Mathias, Gerald

2014-03-01

In Paper I of this work [S. Bauer, G. Mathias, and P. Tavan, J. Chem. Phys. 140, 104102 (2014)] we have presented a reaction field (RF) method, which accurately solves the Poisson equation for proteins embedded in dielectric solvent continua at a computational effort comparable to that of polarizable molecular mechanics (MM) force fields. Building upon these results, here we suggest a method for linearly scaling Hamiltonian RF/MM molecular dynamics (MD) simulations, which we call "Hamiltonian dielectric solvent" (HADES). First, we derive analytical expressions for the RF forces acting on the solute atoms. These forces properly account for all those conditions, which have to be self-consistently fulfilled by RF quantities introduced in Paper I. Next we provide details on the implementation, i.e., we show how our RF approach is combined with a fast multipole method and how the self-consistency iterations are accelerated by the use of the so-called direct inversion in the iterative subspace. Finally we demonstrate that the method and its implementation enable Hamiltonian, i.e., energy and momentum conserving HADES-MD, and compare in a sample application on Ac-Ala-NHMe the HADES-MD free energy landscape at 300 K with that obtained in Paper I by scanning of configurations and with one obtained from an explicit solvent simulation.

Development of a loop-mediated isothermal amplification method for rapid mass-screening of sand flies for Leishmania infection.

PubMed

Nzelu, Chukwunonso O; Gomez, Eduardo A; Cáceres, Abraham G; Sakurai, Tatsuya; Martini-Robles, Luiggi; Uezato, Hiroshi; Mimori, Tatsuyuki; Katakura, Ken; Hashiguchi, Yoshihisa; Kato, Hirotomo

2014-04-01

Entomological monitoring of Leishmania infection in leishmaniasis endemic areas offers epidemiologic advantages for predicting the risk and expansion of the disease, as well as evaluation of the effectiveness of control programs. In this study, we developed a highly sensitive loop-mediated isothermal amplification (LAMP) method for the mass screening of sand flies for Leishmania infection based on the 18S rRNA gene. The LAMP technique could detect 0.01 parasites, which was more sensitive than classical PCR. The method was robust and could amplify the target DNA within 1h from a crude sand fly template without DNA purification. Amplicon detection could be accomplished by the newly developed colorimetric malachite green (MG)--mediated naked eye visualization. Pre-addition of MG to the LAMP reaction solution did not inhibit amplification efficiency. The field applicability of the colorimetric MG-based LAMP assay was demonstrated with 397 field-caught samples from the endemic areas of Ecuador and eight positive sand flies were detected. The robustness, superior sensitivity, and ability to produce better visual discriminatory reaction products than existing LAMP fluorescence and turbidity assays indicated the field potential usefulness of this new method for surveillance and epidemiological studies of leishmaniasis in developing countries. Copyright © 2013 Elsevier B.V. All rights reserved.

Preparation of Silica Nanoparticles Through Microwave-assisted Acid-catalysis

PubMed Central

Lovingood, Derek D.; Owens, Jeffrey R.; Seeber, Michael; Kornev, Konstantin G.; Luzinov, Igor

2013-01-01

Microwave-assisted synthetic techniques were used to quickly and reproducibly produce silica nanoparticle sols using an acid catalyst with nanoparticle diameters ranging from 30-250 nm by varying the reaction conditions. Through the selection of a microwave compatible solvent, silicic acid precursor, catalyst, and microwave irradiation time, these microwave-assisted methods were capable of overcoming the previously reported shortcomings associated with synthesis of silica nanoparticles using microwave reactors. The siloxane precursor was hydrolyzed using the acid catalyst, HCl. Acetone, a low-tan δ solvent, mediates the condensation reactions and has minimal interaction with the electromagnetic field. Condensation reactions begin when the silicic acid precursor couples with the microwave radiation, leading to silica nanoparticle sol formation. The silica nanoparticles were characterized by dynamic light scattering data and scanning electron microscopy, which show the materials' morphology and size to be dependent on the reaction conditions. Microwave-assisted reactions produce silica nanoparticles with roughened textured surfaces that are atypical for silica sols produced by Stöber's methods, which have smooth surfaces. PMID:24379052

Monitoring mass transport in heterogeneously catalyzed reactions by field-gradient NMR for assessing reaction efficiency in a single pellet

NASA Astrophysics Data System (ADS)

Buljubasich, L.; Blümich, B.; Stapf, S.

2011-09-01

An important aspect in assessing the performance of a catalytically active reactor is the accessibility of the reactive sites inside the individual pellets, and the mass transfer of reactants and products to and from these sites. Optimal design often requires a suitable combination of micro- and macropores in order to facilitate mass transport inside the pellet. In an exothermic reaction, fluid exchange between the pellet and the surrounding medium is enhanced by convection, and often by the occurrence of gas bubbles. Determining mass flow in the vicinity of a pellet thus represents a parameter for quantifying the reaction efficiency and its dependence on time or external reaction conditions. Field gradient Nuclear Magnetic Resonance (NMR) methods are suggested as a tool for providing parameters sensitive to this mass flow in a contact-free and non-invasive way. For the example of bubble-forming hydrogen peroxide decomposition in an alumina pellet, the dependence of the mean-squared displacement of fluid molecules on spatial direction, observation time and reaction time is presented, and multi-pulse techniques are employed in order to separate molecular displacements from coherent and incoherent motion on the timescale of the experiment. The reaction progress is followed until the complete decomposition of H 2O 2.

Internal force corrections with machine learning for quantum mechanics/molecular mechanics simulations.

PubMed

Wu, Jingheng; Shen, Lin; Yang, Weitao

2017-10-28

Ab initio quantum mechanics/molecular mechanics (QM/MM) molecular dynamics simulation is a useful tool to calculate thermodynamic properties such as potential of mean force for chemical reactions but intensely time consuming. In this paper, we developed a new method using the internal force correction for low-level semiempirical QM/MM molecular dynamics samplings with a predefined reaction coordinate. As a correction term, the internal force was predicted with a machine learning scheme, which provides a sophisticated force field, and added to the atomic forces on the reaction coordinate related atoms at each integration step. We applied this method to two reactions in aqueous solution and reproduced potentials of mean force at the ab initio QM/MM level. The saving in computational cost is about 2 orders of magnitude. The present work reveals great potentials for machine learning in QM/MM simulations to study complex chemical processes.

Method and apparatus to produce high specific impulse and moderate thrust from a fusion-powered rocket engine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cohen, Samuel A.; Pajer, Gary A.; Paluszek, Michael A.

A system and method for producing and controlling high thrust and desirable specific impulse from a continuous fusion reaction is disclosed. The resultant relatively small rocket engine will have lower cost to develop, test, and operate that the prior art, allowing spacecraft missions throughout the planetary system and beyond. The rocket engine method and system includes a reactor chamber and a heating system for heating a stable plasma to produce fusion reactions in the stable plasma. Magnets produce a magnetic field that confines the stable plasma. A fuel injection system and a propellant injection system are included. The propellant injectionmore » system injects cold propellant into a gas box at one end of the reactor chamber, where the propellant is ionized into a plasma. The propellant and fusion products are directed out of the reactor chamber through a magnetic nozzle and are detached from the magnetic field lines producing thrust.« less

Unraveling the mysteries of microwave chemistry using silicon carbide reactor technology.

PubMed

Kappe, C Oliver

2013-07-16

In the past few years, the use of microwave energy to heat chemical reactions has become an increasingly popular theme in the scientific community. This nonclassical heating technique has slowly progressed from a laboratory curiosity to an established method commonly used both in academia and in industry. Because of its efficiency, microwave heating dramatically reduces reaction times (from days and hours to minutes and seconds) and improves product purities or material properties among other advantages. Since the early days of microwave chemistry, researchers have observed rate-accelerations and, in some cases, altered product distributions as compared with reactions carried out using classical oil-bath heating. As a result, researchers have speculated that so-called specific or nonthermal microwave effects could be responsible for these differences. Much of the debate has centered on the question of whether the electromagnetic field can exert a direct influence on a chemical transformation outside of the simple macroscopic change in bulk reaction temperature. In 2009, our group developed a relatively simple "trick" that allows us to rapidly evaluate whether an observed effect seen in a microwave-assisted reaction results from a purely thermal phenomenon, or involves specific or nonthermal microwave effects. We use a microwave reaction vessel made from silicon carbide (SiC) ceramic. Because of its high microwave absorptivity, the vessel shields its contents from the electromagnetic field. As a result, we can easily mimic a conventionally heated autoclave experiment inside a microwave reactor under carefully controlled reaction conditions. The switch from an almost microwave transparent glass (Pyrex) to a strongly microwave absorbing SiC reaction vial under otherwise identical reaction conditions (temperature profiles, pressure, stirring speed) then allows us to carefully evaluate the influence of the electromagnetic field on the particular chemical transformation. Over the past five years we have subjected a wide variety of chemical transformations, including organic reactions, preparations of inorganic nanoparticles, and the hydrolysis of proteins, to the "SiC test." In nearly all of the studied examples, we obtained identical results from reactions carried out in Pyrex vials and those carried out in SiC vials. The data obtained from these investigations confirm that in the overwhelming majority of cases a bulk temperature phenomenon drives the enhancements in microwave chemistry and that the electromagnetic field has no direct influence on the reaction pathway.

Dynamic target ionization using an ultrashort pulse of a laser field

NASA Astrophysics Data System (ADS)

Makarov, D. N.; Matveev, V. I.; Makarova, K. A.

2014-09-01

Ionization processes under the interaction of an ultrashort pulse of an electromagnetic field with atoms in nonstationary states are considered. As an example, the ionization probability of the hydrogen-like atom upon the decay of quasi-stationary state is calculated. The method developed can be applied to complex systems, including targets in collisional states and various chemical reactions.

Photo point monitoring handbook—Part A: Field procedures; Part B: Concepts and analysis.

Treesearch

Frederick C. Hall

2002-01-01

This handbook describes quick, effective methods for documenting change in vegetation and soil through repeat photography. It is published in two parts: field procedures in part A and concepts and office analysis in part B. Topics may be effects of logging, change in wildlife habitat, livestock grazing impacts, or stream channel reaction to land management. Land...

Unorthodox theoretical methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nedd, Sean

2012-01-01

The use of the ReaxFF force field to correlate with NMR mobilities of amine catalytic substituents on a mesoporous silica nanosphere surface is considered. The interfacing of the ReaxFF force field within the Surface Integrated Molecular Orbital/Molecular Mechanics (SIMOMM) method, in order to replicate earlier SIMOMM published data and to compare with the ReaxFF data, is discussed. The development of a new correlation consistent Composite Approach (ccCA) is presented, which incorporates the completely renormalized coupled cluster method with singles, doubles and non-iterative triples corrections towards the determination of heats of formations and reaction pathways which contain biradical species.

Nanoribbon field-effect transistors as direct and label-free sensors of enzyme-substrate interactions

NASA Astrophysics Data System (ADS)

Mu, Luye; Droujinine, Ilia; Rajan, Nitin; Sawtelle, Sonya; Reed, Mark

2015-03-01

The ability to measure enzyme-substrate interactions is essential in areas such as diagnostics, treatment, and biochemical screens. Many enzymatic reactions alter the pH of its environment, suggesting of a simple and direct method for detection. We show the ability of Al2O3-coated Si nanoribbon field-effect transistor biosensors to sensitively measure various aspects of enzyme-substrate interactions through measuring the pH. Urea in phosphate buffered saline (PBS) and penicillinase in PBS and urine were measured to limits of <200 μM and 0.02 units/mL, respectively. We also show the ability to extract accurate kinetics from the interaction of acetylcholine and its esterase. Prior work on FET sensors has been limited by the use of surface functionalization, which not only alters enzyme-substrate affinity, but also makes enzyme activity quantification difficult. Our method involves direct detection of reactions in solution without requiring alteration to the reactants, allowing us to obtain repeatable results and sensitive limits of detection. This method is a simple, inexpensive, and effective platform for detection of enzymatic reactions, and can be readily generalized to many unrelated classes of reactants. This work was supported in part by U.S. Army Research Office and Air Force Research Laboratory.

Nanoengineered CIGS thin films for low cost photovoltaics

NASA Astrophysics Data System (ADS)

Eldada, Louay; Taylor, Matthew; Sang, Baosheng; McWilliams, Scott; Oswald, Robert; Stanbery, Billy J.

2008-08-01

Low cost manufacturing of Cu(In,Ga)Se2 (CIGS) films for high efficiency photovoltaic devices by the innovative Field-Assisted Simultaneous Synthesis and Transfer (FASST®) process is reported. The FASST® process is a two-stage reactive transfer printing method relying on chemical reaction between two separate precursor films to form CIGS, one deposited on the substrate and the other on a printing plate in the first stage. In the second stage these precursors are brought into intimate contact and rapidly reacted under pressure in the presence of an applied electrostatic field. The method utilizes physical mechanisms characteristic of anodic wafer bonding and rapid thermal annealing, effectively creating a sealed micro-reactor that ensures high material utilization efficiency, direct control of reaction pressure, and low thermal budget. The use of two independent ink-based or PVD-based nanoengineered precursor thin films provides the benefits of independent composition and flexible deposition technique optimization, and eliminates pre-reaction prior to the second stage FASST® synthesis of CIGS. High quality CIGS with large grains on the order of several microns are formed in just several minutes based on compositional and structural analysis by XRF, SIMS, SEM and XRD. Cell efficiencies of 12.2% have been achieved using this method.

Theoretical determination of chemical rate constants using novel time-dependent methods

NASA Technical Reports Server (NTRS)

Dateo, Christopher E.

1994-01-01

The work completed within the grant period 10/1/91 through 12/31/93 falls primarily in the area of reaction dynamics using both quantum and classical mechanical methodologies. Essentially four projects have been completed and have been or are in preparation of being published. The majority of time was spent in the determination of reaction rate coefficients in the area of hydrocarbon fuel combustion reactions which are relevant to NASA's High Speed Research Program (HSRP). These reaction coefficients are important in the design of novel jet engines with low NOx emissions, which through a series of catalytic reactions contribute to the deterioration of the earth's ozone layer. A second area of research studied concerned the control of chemical reactivity using ultrashort (femtosecond) laser pulses. Recent advances in pulsed-laser technologies have opened up a vast new field to be investigated both experimentally and theoretically. The photodissociation of molecules adsorbed on surfaces using novel time-independent quantum mechanical methods was a third project. And finally, using state-of-the-art, high level ab initio electronic structure methods in conjunction with accurate quantum dynamical methods, the rovibrational energy levels of a triatomic molecule with two nonhydrogen atoms (HCN) were calculated to unprecedented levels of agreement between theory and experiment.

Chemical Detection using Electrically Open Circuits having no Electrical Connections

NASA Technical Reports Server (NTRS)

Woodward, Stanley E.; Olgesby, Donald M.; Taylor, Bryant D.; Shams, Qamar A.

2008-01-01

This paper presents investigations to date on chemical detection using a recently developed method for designing, powering and interrogating sensors as electrically open circuits having no electrical connections. In lieu of having each sensor from a closed circuit with multiple electrically connected components, an electrically conductive geometric pattern that is powered using oscillating magnetic fields and capable of storing an electric field and a magnetic field without the need of a closed circuit or electrical connections is used. When electrically active, the patterns respond with their own magnetic field whose frequency, amplitude and bandwidth can be correlated with the magnitude of the physical quantities being measured. Preliminary experimental results of using two different detection approaches will be presented. In one method, a thin film of a reactant is deposited on the surface of the open-circuit sensor. Exposure to a specific targeted reactant shifts the resonant frequency of the sensor. In the second method, a coating of conductive material is placed on a thin non-conductive plastic sheet that is placed over the surface of the sensor. There is no physical contact between the sensor and the electrically conductive material. When the conductive material is exposed to a targeted reactant, a chemical reaction occurs that renders the material non-conductive. The change in the material s electrical resistance within the magnetic field of the sensor alters the sensor s response bandwidth and amplitude, allowing detection of the reaction without having the reactants in physical contact with the sensor.

Preface: Special Topic on Reaction Pathways

NASA Astrophysics Data System (ADS)

Clementi, Cecilia; Henkelman, Graeme

2017-10-01

This Special Topic Issue on Reaction Pathways collects original research articles illustrating the state of the art in the development and application of methods to describe complex chemical systems in terms of relatively simple mechanisms and collective coordinates. A broad range of applications is presented, spanning the sub-fields of biophysics and material science, in an attempt to showcase the similarities in the formulation of the approaches and highlight the different needs of the different application domains.

Superconducting Solenoid for Superfast THz Spectroscopy

NASA Astrophysics Data System (ADS)

Bragin, A. V.; Khrushchev, S. V.; Kubarev, V. V.; Mezencev, N. A.; Tsukanov, V. M.; Sozinov, G. I.; Shkaruba, V. A.

This project is related to new spectroscopy method in little-developed THz range. The method is founded on using of a free electron laser (NovoFEL) with high spectral power radiation which can be smoothly tuned in desirable range of spectrum. The objects of research of this method are fast processes in physics, chemical and biological reactions. Uniform magnetic field of 6 T value in the research area can considerably increase possibilities of this method. The magnetic field will modulate radiation of free molecules induction on characteristic frequencies of the Zeeman splitting that gives more possibilities of identification of molecules having even weak magnetic momentum. Moreover, the use of magnetic field allows essentially increase sensitivity of this method due to almost complete separation of weak measuring signals from powerful radiation of the laser. A superconducting solenoid was developed for this method. Its design and peculiarities are described in this paper.

Stepwise formation of H3O(+)(H2O)n in an ion drift tube: Empirical effective temperature of association/dissociation reaction equilibrium in an electric field.

PubMed

Nakai, Yoichi; Hidaka, Hiroshi; Watanabe, Naoki; Kojima, Takao M

2016-06-14

We measured equilibrium constants for H3O(+)(H2O)n-1 + H2O↔H3O(+)(H2O)n (n = 4-9) reactions taking place in an ion drift tube with various applied electric fields at gas temperatures of 238-330 K. The zero-field reaction equilibrium constants were determined by extrapolation of those obtained at non-zero electric fields. From the zero-field reaction equilibrium constants, the standard enthalpy and entropy changes, ΔHn,n-1 (0) and ΔSn,n-1 (0), of stepwise association for n = 4-8 were derived and were in reasonable agreement with those measured in previous studies. We also examined the electric field dependence of the reaction equilibrium constants at non-zero electric fields for n = 4-8. An effective temperature for the reaction equilibrium constants at non-zero electric field was empirically obtained using a parameter describing the electric field dependence of the reaction equilibrium constants. Furthermore, the size dependence of the parameter was thought to reflect the evolution of the hydrogen-bond structure of H3O(+)(H2O)n with the cluster size. The reflection of structural information in the electric field dependence of the reaction equilibria is particularly noteworthy.

Identification of the population density of a species model with nonlocal diffusion and nonlinear reaction

NASA Astrophysics Data System (ADS)

Tuan, Nguyen Huy; Van Au, Vo; Khoa, Vo Anh; Lesnic, Daniel

2017-05-01

The identification of the population density of a logistic equation backwards in time associated with nonlocal diffusion and nonlinear reaction, motivated by biology and ecology fields, is investigated. The diffusion depends on an integral average of the population density whilst the reaction term is a global or local Lipschitz function of the population density. After discussing the ill-posedness of the problem, we apply the quasi-reversibility method to construct stable approximation problems. It is shown that the regularized solutions stemming from such method not only depend continuously on the final data, but also strongly converge to the exact solution in L 2-norm. New error estimates together with stability results are obtained. Furthermore, numerical examples are provided to illustrate the theoretical results.

Capillary electrophoresis of Big-Dye terminator sequencing reactions for human mtDNA Control Region haplotyping in the identification of human remains.

PubMed

Montesino, Marta; Prieto, Lourdes

2012-01-01

Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.

Time-dependent mean-field determination of the excitation energy in transfer reactions: Application to the reaction 238U on 12C at 6.14 MeV/nucleon

NASA Astrophysics Data System (ADS)

Scamps, G.; Rodríguez-Tajes, C.; Lacroix, D.; Farget, F.

2017-02-01

The internal excitation of nuclei after multinucleon transfer is estimated by using the time-dependent mean-field theory. Transfer probabilities for each channel as well as the energy loss after reseparation are calculated. By combining these two pieces of information, we show that the excitation energy distribution of the transfer fragments can be obtained separately for the different transfer channels. The method is applied to the reaction involving a 238U beam on a 12C target, which has recently been measured at GANIL. It is shown that the excitation energy calculated with the microscopic theory compares well with the experimental observation, provided that the competition with fusion is properly taken into account. The reliability of the excitation energy is further confirmed by the comparison with the phenomenological heavy-ion phase-space model at higher center-of-mass energies.

Reaction of positronium with doped ions in silica-based glasses in the size determination of subnanometer structural open spaces

NASA Astrophysics Data System (ADS)

Inoue, K.; Kataoka, H.; Nagai, Y.; Hasegawa, M.; Kobayashi, Y.

2013-10-01

Positron annihilation spectroscopy is employed to estimate the size of subnanometer-scale open spaces in insulating materials. In most cases, the size is estimated from the lifetime of long-lived ortho-positronium (o-Ps) by pickoff annihilation using a simplified model. However, reactions of Ps with surrounding electrons other than the pickoff reaction, such as spin conversion or chemical reaction, could give a substantially underestimated size using the simplified model. In the present paper, we report that the size of the open spaces can be evaluated correctly by the angular correlation of positron annihilation radiation (ACAR) with a magnetic field using the spin-polarization effect on Ps formation, even if such reactions of Ps occur in the material. This method is applied to the subnanometer-scale structural open spaces of silica-based glass doped with Fe. We demonstrate the influence of the Ps reaction on size-estimation of the open spaces from the o-Ps lifetime. Furthermore, the type of reaction, whether spin conversion or chemical, is distinguished from the magnetic field dependence of the Ps self-annihilation component intensity in the ACAR spectra. The Ps reaction in silica-based glass doped with Fe is a chemical reaction (most likely oxidation) rather than spin conversion, with Fe ions. The chemical quenching rate with Fe ions is determined from the dependence of the o-Ps lifetime on the Fe content.

METHOD OF PRODUCING NEUTRONS

DOEpatents

Imhoff, D.H.; Harker, W.H.

1964-02-01

A method for producing neutrons is described in which there is employed a confinement zone defined between longitudinally spaced localized gradient regions of an elongated magnetic field. Changed particles and neutralizing electrons, more specifically deuterons and tritons and neutralizng electrons, are injected into the confinement field from ion sources located outside the field. The rotational energy of the parrticles is increased at the gradients by imposing an oscillating transverse electrical field thereacross. The imposition of such oscillating transverse electrical fields improves the reflection capability of such gradient fielda so that the reactive particles are retained more effectively within the zone. With the attainment of appropriate densities of plasma particles and provided that such particles are at a sufficiently high temperature, neutron-producing reactions ensue and large quantities of neutrons emerge from the containment zone. (AEC)

Low-temperature rapid synthesis and superconductivity of Fe-based oxypnictide superconductors.

PubMed

Fang, Ai-Hua; Huang, Fu-Qiang; Xie, Xiao-Ming; Jiang, Mian-Heng

2010-03-17

Fe-based oxypnictide superconductors were successfully synthesized at lower reaction temperatures and with shorter reaction times made possible by starting with less stable compounds, which provide a larger driving force for reactions. Using ball-milled powders of intermediate compounds, phase-pure superconductors with T(c) above 50 K were synthesized at 1173 K in 20 min. This method is particularly advantageous for retaining F, a volatile dopant that enhances superconductivity. Bulk superconductivity and high upper critical fields up to 392 T in Sm(0.85)Nd(0.15)FeAsO(0.85)F(0.15) were demonstrated.

Effects of magnetic, radiation and chemical reaction on unsteady heat and mass transfer flow of an oscillating cylinder

NASA Astrophysics Data System (ADS)

Ahmed, Rubel; Rana, B. M. Jewel; Ahmmed, S. F.

2017-06-01

The effects of magnetic, radiation and chemical reaction parameters on the unsteady heat and mass transfer boundary layer flow past an oscillating cylinder is considered. The dimensionless momentum, energy and concentration equations are solved numerically by using explicit finite difference method with the help of a computer programming language Compaq visual FORTRAN 6.6a. The obtained results of this study have been discussed for different values of well-known parameters with different time steps. The effect of these parameters on the velocity field, temperature field and concentration field, skin-friction, Nusselt number, streamlines and isotherms has been studied and results are presented by graphically represented by the tabular form quantitatively. The stability and convergence analysis of the solution parameters that have been used in the mathematical model have been tested.

A dual-rating method for evaluating impact noise isolation of floor-ceiling assemblies.

PubMed

LoVerde, John J; Dong, D Wayland

2017-01-01

Impact Insulation Class (IIC), the single-number rating for evaluating the impact noise insulation of a floor-ceiling assembly, and the associated field testing ratings, are unsatisfactory because they do not have strong correlation with subjective reaction nor provide suitable detailed information for evaluation or design of floor-ceiling assemblies. Various proposals have been made for improving the method, but the data presented indicate that no single-number rating can adequately characterize the impact noise isolation of an assembly. For realistic impact noise sources and floor-ceiling assembly types, there are two frequency domains for impact noise, and the impact noise levels in the two domains can vary independently. Therefore, two ratings are required in order to satisfactorily evaluate the impact isolation provided by a floor-ceiling assembly. Two different ratings are introduced for measuring field impact isolation in the two frequency domains, using the existing impact source and measurement method. They are named low-frequency impact rating (LIR) and high-frequency impact rating (HIR). LIR and HIR are proposed to improve the current method for design and evaluation of floor-ceiling assemblies and also provide a better method for predicting subjective reaction.

Efficient Defect Engineering for Solution Combustion Processed In-Zn-O thin films for high performance transistors

NASA Astrophysics Data System (ADS)

Liang, Xiaoci; Wang, Chengcai; Liang, Jun; Liu, Chuan; Pei, Yanli

2017-09-01

The oxygen related defects in the solution combustion-processed InZnO vitally affect the field-effect mobility and on-off characteristics in thin film transistors (TFTs). We use photoelectron spectroscopy to reveal that these defects can be well controlled by adjusting the atmosphere and flow rate during the combustion reaction, but are hardly affected by further post-annealing after the reaction. In device performance, the threshold voltage of the InZnO-TFTs was regulated in a wide range from 3.5 V to 11.0 V. To compromise the high field-effect mobility and good subthreshold properties, we fabricate the TFTs with double active layers of InZnO to achieve vertical gradience in defect distribution. The resulting TFT exhibits much higher field-effect mobility as 17.5 cm2 · V-1 · s-1, a low reversed sub-threshold slope as 0.35 V/decade, and a high on-off ratio as 107. The presented understandings and methods on defect engineering are efficient in improving the device performance of TFTs made from the combustion reaction process.

Alkali content of fly ash : measuring and testing strategies for compliance : [tech transfer summary].

DOT National Transportation Integrated Search

2015-04-01

This study investigated the test methods used to determine the : alkali content of fly ash. It also evaluated if high-alkali fly ash : exacerbates alkali-silica reaction in laboratory tests and field : concrete.

Direct synthesis of bimetallic PtCo mesoporous nanospheres as efficient bifunctional electrocatalysts for both oxygen reduction reaction and methanol oxidation reaction

NASA Astrophysics Data System (ADS)

Wang, Hongjing; Yu, Hongjie; Li, Yinghao; Yin, Shuli; Xue, Hairong; Li, Xiaonian; Xu, You; Wang, Liang

2018-04-01

The engineering of electrocatalysts with high performance for cathodic and/or anodic catalytic reactions is of great urgency for the development of direct methanol fuel cells. Pt-based bimetallic alloys have recently received considerable attention in the field of fuel cells because of their superior catalytic performance towards both fuel molecule electro-oxidation and oxygen reduction. In this work, bimetallic PtCo mesoporous nanospheres (PtCo MNs) with uniform size and morphology have been prepared by a one-step method with a high yield. The as-made PtCo MNs show superior catalytic activities for both oxygen reduction reaction and methanol oxidation reaction relative to Pt MNs and commercial Pt/C catalyst, attributed to their mesoporous structure and bimetallic composition.

Partial homogeneity based high-resolution nuclear magnetic resonance spectra under inhomogeneous magnetic fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Zhiliang; Lin, Liangjie; Lin, Yanqin, E-mail: linyq@xmu.edu.cn, E-mail: chenz@xmu.edu.cn

2014-09-29

In nuclear magnetic resonance (NMR) technique, it is of great necessity and importance to obtain high-resolution spectra, especially under inhomogeneous magnetic fields. In this study, a method based on partial homogeneity is proposed for retrieving high-resolution one-dimensional NMR spectra under inhomogeneous fields. Signals from series of small voxels, which characterize high resolution due to small sizes, are recorded simultaneously. Then, an inhomogeneity correction algorithm is developed based on pattern recognition to correct the influence brought by field inhomogeneity automatically, thus yielding high-resolution information. Experiments on chemical solutions and fish spawn were carried out to demonstrate the performance of the proposedmore » method. The proposed method serves as a single radiofrequency pulse high-resolution NMR spectroscopy under inhomogeneous fields and may provide an alternative of obtaining high-resolution spectra of in vivo living systems or chemical-reaction systems, where performances of conventional techniques are usually degenerated by field inhomogeneity.« less

A study of hydriding kinetics of metal hydrides using a physically based model

NASA Astrophysics Data System (ADS)

Voskuilen, Tyler G.

The reaction of hydrogen with metals to form metal hydrides has numerous potential energy storage and management applications. The metal hydrogen system has a high volumetric energy density and is often reversible with a high cycle life. The stored hydrogen can be used to produce energy through combustion, reaction in a fuel cell, or electrochemically in metal hydride batteries. The high enthalpy of the metal-hydrogen reaction can also be used for rapid heat removal or delivery. However, improving the often poor gravimetric performance of such systems through the use of lightweight metals usually comes at the cost of reduced reaction rates or the requirement of pressure and temperature conditions far from the desired operating conditions. In this work, a 700 bar Sievert system was developed at the Purdue Hydrogen Systems Laboratory to study the kinetic and thermodynamic behavior of high pressure hydrogen absorption under near-ambient temperatures. This system was used to determine the kinetic and thermodynamic properties of TiCrMn, an intermetallic metal hydride of interest due to its ambient temperature performance for vehicular applications. A commonly studied intermetallic hydride, LaNi5, was also characterized as a base case for the phase field model. The analysis of the data obtained from such a system necessitate the use of specialized techniques to decouple the measured reaction rates from experimental conditions. These techniques were also developed as a part of this work. Finally, a phase field model of metal hydride formation in mass-transport limited interstitial solute reactions based on the regular solution model was developed and compared with measured kinetics of LaNi5 and TiCrMn. This model aided in the identification of key reaction features and was used to verify the proposed technique for the analysis of gas-solid reaction rates determined volumetrically. Additionally, the phase field model provided detailed quantitative predictions of the effects of multidimensional phase growth and transitions between rate-limiting processes on the experimentally determined reaction rates. Unlike conventional solid state reaction analysis methods, this model relies fully on rate parameters based on the physical mechanisms occurring in the hydride reaction and can be extended to reactions in any dimension.

ROTATING PLASMA DEVICE

DOEpatents

Boyer, K.; Hammel, J.E.; Longmire, C.L.; Nagle, D.E.; Ribe, F.L.; Tuck, J.L.

1961-10-24

ABS>A method and device are described for obtaining fusion reactions. The basic concept is that of using crossed electric and magnetic fields to induce a plasma rotation in which the ionized particles follow a circumferential drift orbit on wldch a cyclotron mode of motion is superimposed, the net result being a cycloidal motion about the axis of symmetry. The discharge tube has a radial electric field and a longitudinal magnetic field. Mirror machine geometry is utilized. The device avoids reliance on the pinch effect and its associated instability problems. (AEC)

Monitoring mass transport in heterogeneously catalyzed reactions by field-gradient NMR for assessing reaction efficiency in a single pellet.

PubMed

Buljubasich, L; Blümich, B; Stapf, S

2011-09-01

An important aspect in assessing the performance of a catalytically active reactor is the accessibility of the reactive sites inside the individual pellets, and the mass transfer of reactants and products to and from these sites. Optimal design often requires a suitable combination of micro- and macropores in order to facilitate mass transport inside the pellet. In an exothermic reaction, fluid exchange between the pellet and the surrounding medium is enhanced by convection, and often by the occurrence of gas bubbles. Determining mass flow in the vicinity of a pellet thus represents a parameter for quantifying the reaction efficiency and its dependence on time or external reaction conditions. Field gradient Nuclear Magnetic Resonance (NMR) methods are suggested as a tool for providing parameters sensitive to this mass flow in a contact-free and non-invasive way. For the example of bubble-forming hydrogen peroxide decomposition in an alumina pellet, the dependence of the mean-squared displacement of fluid molecules on spatial direction, observation time and reaction time is presented, and multi-pulse techniques are employed in order to separate molecular displacements from coherent and incoherent motion on the timescale of the experiment. The reaction progress is followed until the complete decomposition of H2O2. Copyright © 2011 Elsevier Inc. All rights reserved.

Chemical Continuous Time Random Walks

NASA Astrophysics Data System (ADS)

Aquino, T.; Dentz, M.

2017-12-01

Traditional methods for modeling solute transport through heterogeneous media employ Eulerian schemes to solve for solute concentration. More recently, Lagrangian methods have removed the need for spatial discretization through the use of Monte Carlo implementations of Langevin equations for solute particle motions. While there have been recent advances in modeling chemically reactive transport with recourse to Lagrangian methods, these remain less developed than their Eulerian counterparts, and many open problems such as efficient convergence and reconstruction of the concentration field remain. We explore a different avenue and consider the question: In heterogeneous chemically reactive systems, is it possible to describe the evolution of macroscopic reactant concentrations without explicitly resolving the spatial transport? Traditional Kinetic Monte Carlo methods, such as the Gillespie algorithm, model chemical reactions as random walks in particle number space, without the introduction of spatial coordinates. The inter-reaction times are exponentially distributed under the assumption that the system is well mixed. In real systems, transport limitations lead to incomplete mixing and decreased reaction efficiency. We introduce an arbitrary inter-reaction time distribution, which may account for the impact of incomplete mixing. This process defines an inhomogeneous continuous time random walk in particle number space, from which we derive a generalized chemical Master equation and formulate a generalized Gillespie algorithm. We then determine the modified chemical rate laws for different inter-reaction time distributions. We trace Michaelis-Menten-type kinetics back to finite-mean delay times, and predict time-nonlocal macroscopic reaction kinetics as a consequence of broadly distributed delays. Non-Markovian kinetics exhibit weak ergodicity breaking and show key features of reactions under local non-equilibrium.

Method of fabricating free-form, high-aspect ratio components for high-current, high-speed microelectrics

DOEpatents

Maxwell, James L; Rose, Chris R; Black, Marcie R; Springer, Robert W

2014-03-11

Microelectronic structures and devices, and method of fabricating a three-dimensional microelectronic structure is provided, comprising passing a first precursor material for a selected three-dimensional microelectronic structure into a reaction chamber at temperatures sufficient to maintain said precursor material in a predominantly gaseous state; maintaining said reaction chamber under sufficient pressures to enhance formation of a first portion of said three-dimensional microelectronic structure; applying an electric field between an electrode and said microelectronic structure at a desired point under conditions whereat said first portion of a selected three-dimensional microelectronic structure is formed from said first precursor material; positionally adjusting either said formed three-dimensional microelectronic structure or said electrode whereby further controlled growth of said three-dimensional microelectronic structure occurs; passing a second precursor material for a selected three-dimensional microelectronic structure into a reaction chamber at temperatures sufficient to maintain said precursor material in a predominantly gaseous state; maintaining said reaction chamber under sufficient pressures whereby a second portion of said three-dimensional microelectronic structure formation is enhanced; applying an electric field between an electrode and said microelectronic structure at a desired point under conditions whereat said second portion of a selected three-dimensional microelectronic structure is formed from said second precursor material; and, positionally adjusting either said formed three-dimensional microelectronic structure or said electrode whereby further controlled growth of said three-dimensional microelectronic structure occurs.

Measurement of hydroxyl radical production in ultrasonic aqueous solutions by a novel chemiluminescence method.

PubMed

Hu, Yufei; Zhang, Zhujun; Yang, Chunyan

2008-07-01

Measurement methods for ultrasonic fields are important for reasons of safety. The investigation of an ultrasonic field can be performed by detecting the yield of hydroxyl radicals resulting from ultrasonic cavitations. In this paper, a novel method is introduced for detecting hydroxyl radicals by a chemiluminescence (CL) reaction of luminol-hydrogen peroxide (H2O2)-K5[Cu(HIO6)2](DPC). The yield of hydroxyl radicals is calculated directly by the relative CL intensity according to the corresponding concentration of H2O2. This proposed CL method makes it possible to perform an in-line and real-time assay of hydroxyl radicals in an ultrasonic aqueous solution. With flow injection (FI) technology, this novel CL reaction is sensitive enough to detect ultra trace amounts of H2O2 with a limit of detection (3sigma) of 4.1 x 10(-11) mol L(-1). The influences of ultrasonic output power and ultrasonic treatment time on the yield of hydroxyl radicals by an ultrasound generator were also studied. The results indicate that the amount of hydroxyl radicals increases with the increase of ultrasonic output power (< or = 15 W mL(-1)). There is a linear relationship between the time of ultrasonic treatment and the yield of H2O2. The ultrasonic field of an ultrasonic cleaning baths has been measured by calculating the yield of hydroxyl radicals.

Enhanced Peroxidase-Like Performance of Gold Nanoparticles by Hot Electrons.

PubMed

Wang, Chen; Shi, Yi; Dan, Yuan-Yuan; Nie, Xing-Guo; Li, Jian; Xia, Xing-Hua

2017-05-17

Enzyme mimics have been widely used as alternatives to natural enzymes. However, the catalytic performances of enzyme mimics are often decreased due to different spatial structures or absence of functional groups compared to natural enzymes. Here, we report a highly efficient enzyme-like catalytic performance of gold nanoparticles (AuNPs) by visible-light stimulation. The enzyme-like reaction is evaluated by the catalytic reaction of AuNPs oxidizing a typical chromogenic substrate 3,3',5,5'-tetramethylbenzydine (TMB) with hydrogen peroxide as an oxidant. From investigations of the wavelength-dependent reaction rate, radical capture, hole-donor addition, and dark-field scattering spectroscopy experiments, it is revealed that the strong plasmonic absorption of AuNPs facilitates generation of hot electrons, which are transfered from AuNPs to the adsorbed reactant molecule, greatly promoting the catalytic performance of the enzyme-like catalytic reaction. The present work provides a simple method for improving the performance of enzyme mimics, which is expected to find further application in the field of plasmon-enhanced biocatalysis and biosensors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evaluation of the user experience of "astronaut training device": an immersive, vr-based, motion-training system

NASA Astrophysics Data System (ADS)

Yue, Kang; Wang, Danli; Yang, Xinpan; Hu, Haichen; Liu, Yuqing; Zhu, Xiuqing

2016-10-01

To date, as the different application fields, most VR-based training systems have been different. Therefore, we should take the characteristics of application field into consideration and adopt different evaluation methods when evaluate the user experience of these training systems. In this paper, we propose a method to evaluate the user experience of virtual astronauts training system. Also, we design an experiment based on the proposed method. The proposed method takes learning performance as one of the evaluation dimensions, also combines with other evaluation dimensions such as: presence, immersion, pleasure, satisfaction and fatigue to evaluation user experience of the System. We collect subjective and objective data, the subjective data are mainly from questionnaire designed based on the evaluation dimensions and user interview conducted before and after the experiment. While the objective data are consisted of Electrocardiogram (ECG), reaction time, numbers of reaction error and the video data recorded during the experiment. For the analysis of data, we calculate the integrated score of each evaluation dimension by using factor analysis. In order to improve the credibility of the assessment, we use the ECG signal and reaction test data before and after experiment to validate the changes of fatigue during the experiment, and the typical behavioral features extracted from the experiment video to explain the result of subjective questionnaire. Experimental results show that the System has a better user experience and learning performance, but slight visual fatigue exists after experiment.

Rotor assembly and assay method

DOEpatents

Burtis, C.A.; Johnson, W.F.; Walker, W.A.

1993-09-07

A rotor assembly for carrying out an assay includes a rotor body which is rotatable about an axis of rotation, and has a central chamber and first, second, third, fourth, fifth, and sixth chambers which are in communication with and radiate from the central chamber. The rotor assembly further includes a shuttle which is movable through the central chamber and insertable into any of the chambers, the shuttle including a reaction cup carrying an immobilized antigen or an antibody for transport among the chambers. A method for carrying out an assay using the rotor assembly includes moving the reaction cup among the six chambers by passing the cup through the central chamber between centrifugation steps in order to perform the steps of: separating plasma from blood cells, binding plasma antibody or antigen, washing, drying, binding enzyme conjugate, reacting with enzyme substrate and optically comparing the resulting reaction product with unreacted enzyme substrate solution. The movement of the reaction cup can be provided by attaching a magnet to the reaction cup and supplying a moving magnetic field to the rotor. 34 figures.

Rotor assembly and assay method

DOEpatents

Burtis, Carl A.; Johnson, Wayne F.; Walker, William A.

1993-01-01

A rotor assembly for carrying out an assay includes a rotor body which is rotatable about an axis of rotation, and has a central chamber and first, second, third, fourth, fifth, and sixth chambers which are in communication with and radiate from the central chamber. The rotor assembly further includes a shuttle which is movable through the central chamber and insertable into any of the chambers, the shuttle including a reaction cup carrying an immobilized antigen or an antibody for transport among the chambers. A method for carrying out an assay using the rotor assembly includes moving the reaction cup among the six chambers by passing the cup through the central chamber between centrifugation steps in order to perform the steps of: separating plasma from blood cells, binding plasma antibody or antigen, washing, drying, binding enzyme conjugate, reacting with enzyme substrate and optically comparing the resulting reaction product with unreacted enzyme substrate solution. The movement of the reaction cup can be provided by attaching a magnet to the reaction cup and supplying a moving magnetic field to the rotor.

Interplay between inhibited transport and reaction in nanoporous materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ackerman, David Michael

2013-01-01

This work presents a detailed formulation of reaction and diffusion dynamics of molecules in confined pores such as mesoporous silica and zeolites. A general reaction-diffusion model and discrete Monte Carlo simulations are presented. Both transient and steady state behavior is covered. Failure of previous mean-field models for these systems is explained and discussed. A coarse-grained, generalized hydrodynamic model is developed that accurately captures the interplay between reaction and restricted transport in these systems. This method incorporates the non-uniform chemical diffusion behavior present in finite pores with multi-component diffusion. Two methods of calculating these diffusion values are developed: a random walkmore » based approach and a driven diffusion model based on an extension of Fick's law. The effects of reaction, diffusion, pore length, and catalytic site distribution are investigated. In addition to strictly single file motion, quasi-single file diffusion is incorporated into the model to match a range of experimental systems. The connection between these experimental systems and model parameters is made through Langevin dynamics modeling of particles in confined pores.« less

Acoustic Sensing Based on Density Shift of Microspheres by Surface Binding of Gold Nanoparticles.

PubMed

Miyagawa, Akihisa; Inoue, Yoshinori; Harada, Makoto; Okada, Tetsuo

2017-01-01

Herein, we propose a concept for sensing based on density changes of microparticles (MPs) caused by a biochemical reaction. The MPs are levitated by a combined acoustic-gravitational force at a position determined by the density and compressibility. Importantly, the levitation is independent of the MPs sizes. When gold nanoparticles (AuNPs) are bound on the surface of polymer MPs through a reaction, the density of the MPs dramatically increases, and their levitation position in the acoustic-gravitational field is lowered. Because the shift of the levitation position is proportional to the number of AuNPs bound on one MP, we can determine the number of molecules involved in the reaction. The avidin-biotin reaction is used to demonstrate the effectiveness of this concept. The number of molecules involved in the reaction is very small because the reaction space is small for an MP; thus, the method has potential for highly sensitive detection.

Exact PDF equations and closure approximations for advective-reactive transport

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venturi, D.; Tartakovsky, Daniel M.; Tartakovsky, Alexandre M.

2013-06-01

Mathematical models of advection–reaction phenomena rely on advective flow velocity and (bio) chemical reaction rates that are notoriously random. By using functional integral methods, we derive exact evolution equations for the probability density function (PDF) of the state variables of the advection–reaction system in the presence of random transport velocity and random reaction rates with rather arbitrary distributions. These PDF equations are solved analytically for transport with deterministic flow velocity and a linear reaction rate represented mathematically by a heterog eneous and strongly-correlated random field. Our analytical solution is then used to investigate the accuracy and robustness of the recentlymore » proposed large-eddy diffusivity (LED) closure approximation [1]. We find that the solution to the LED-based PDF equation, which is exact for uncorrelated reaction rates, is accurate even in the presence of strong correlations and it provides an upper bound of predictive uncertainty.« less

Characterization of the Minimum Energy Paths and Energetics for the Reaction of Vinylidene with Acetylene

NASA Technical Reports Server (NTRS)

Walch, Stephen P.; Taylor, Peter R.

1995-01-01

The reaction of vinylidene (CH2C) with acetylene may be an initiating reaction in soot formation. We report minimum energy paths and accurate energetics for a pathway leading to vinyl-acetylene and for a number of isomers of C4H4. The calculations use complete active space self-consistent field (CASSCF) derivative methods to characterize the stationary points and internally contacted configuration interaction (ICCI) and/or coupled cluster singles and doubles with a perturbational estimate of triple excitations (CCSD(T)) to determine the energetics. We find an entrance channel barrier of about 5 kcal/mol for the addition of vinylidene to acetylene, but no barriers above reactants for the reaction pathway leading to vinyl-acetylene.

Characterization of the Minimum Energy Paths and Energetics for the reaction of Vinylidene with Acetylene

NASA Technical Reports Server (NTRS)

Walch, Stephen P.; Taylor, Peter R.

1995-01-01

The reaction of vinylidene (CH2C) with acetylene may be an initiating reaction in soot formation. We report minimum energy paths and accurate energetics for a pathway leading to vinylacetylene and for a number of isomers Of C4H4. The calculations use complete active space self-consistent field (CASSCF) derivative methods to characterize the stationary points and internally contacted configuration interaction (ICCI) and/or coupled cluster singles and doubles with a perturbational estimate of triple excitations (CCSD(T)) to determine the energetics. We find an entrance channel barrier of about 5 kcal/mol for the addition of vinylidene to acetylene, but no barriers above reactants for the reaction pathway leading to vinylacetylene.

The effect of reaction temperature on the particle size of bismuth oxide nanoparticles synthesized via hydrothermal method

NASA Astrophysics Data System (ADS)

Zulkifli, Zulfa Aiza; Razak, Khairunisak Abdul; Rahman, Wan Nordiana Wan Abdul

2018-05-01

Bismuth oxide (Bi2O3) nanoparticles have been synthesized at different temperatures from 70 to 120˚C without any subsequent heat treatment using hydrothermal method. The particle size, and crystal structure of as-synthesized particles were investigated by X-ray diffraction (XRD), Field Emission Scanning Electron Microscope (FESEM), Energy-dispersive X-ray spectroscopy (EDX) and Fourier transform Infra-Red (FTIR). The nanoparticles are of a pure moniclinic Bi2O3 phase with rods shape. The average size of nanoparticles increases with the increase of reaction temperature. It was clear that longer reaction temperature allows precipitation completely occured and form larger nanoparticles (NPs). The crystallinity of Bi2O3 also are of high purity even at lower reaction temperature. The FTIR spectrum showed the absorption band at 845 cm-1 which is attributed to Bi-O-Bi bond, and the strong absorption band recorded at 424 cm-1 that is due to the stretching mode of Bi-O.

Microwave Enhancement of Autocatalytic Growth of Nanometals.

PubMed

Ashley, Bridgett; Vakil, Parth N; Lynch, Brian B; Dyer, Christopher M; Tracy, Joseph B; Owens, Jeffery; Strouse, Geoffrey F

2017-10-24

The desire for designing efficient synthetic methods that lead to industrially important nanomaterials has led a desire to more fully understand the mechanism of growth and how modern synthetic techniques can be employed. Microwave (MW) synthesis is one such technique that has attracted attention as a green, sustainable method. The reports of enhancement of formation rates and improved quality for MW driven reactions are intriguing, but the lack of understanding of the reaction mechanism and how coupling to the MW field leads to these observations is concerning. In this manuscript, the growth of a metal nanoparticles (NPs) in a microwave cavity is spectroscopically analyzed and compared with the classical autocatalytic method of NP growth to elucidate the underpinnings for the observed enhanced growth behavior for metal NPs prepared in a MW field. The study illustrates that microwave synthesis of nickel and gold NPs below saturation conditions follows the Finke-Watzky mechanism of nucleation and growth. The enhancement of the reaction arises from the size-dependent increase in MW absorption cross section for the metal NPs. For Ni, the presence of oxides is considered via theoretical computations and compared to dielectric measurements of isolated nickel NPs. The study definitively shows that MW growth can be modeled by an autocatalytic mechanism that directly leads to the observed enhanced rates and improved quality widely reported in the nanomaterial community when MW irradiation is employed.

Rapid ELISA Using a Film-Stack Reaction Field with Micropillar Arrays

PubMed Central

Suzuki, Yuma; Morioka, Kazuhiro; Ohata, Soichiro; Nakajima, Hizuru; Uchiyama, Katsumi; Yang, Ming

2017-01-01

A film-stack reaction field with a micropillar array using a motor stirrer was developed for the high sensitivity and rapid enzyme-linked immunosorbent assay (ELISA) reaction. The effects of the incubation time of a protein (30 s, 5 min, and 10 min) on the fluorescence intensity in ELISAs were investigated using a reaction field with different micropillar array dimensions (5-µm, 10-µm and 50-µm gaps between the micropillars). The difference in fluorescence intensity between the well with the reaction field of 50-µm gap for the incubation time of 30 s and the well without the reaction field with for incubation time of 10 min was 6%. The trend of the fluorescence intensity in the gap between the micro pillars in the film-stack reaction field was different between the short incubation time and the long incubation time. The theoretical analysis of the physical parameters related with the biomolecule transport indicated that the reaction efficiency defined in this study was the dominant factor determining the fluorescence intensity for the short incubation time, whereas the volumetric rate of the circulating flow through the space between films and the specific surface area were the dominant factors for the long incubation time. PMID:28696378

Rapid ELISA Using a Film-Stack Reaction Field with Micropillar Arrays.

PubMed

Suzuki, Yuma; Morioka, Kazuhiro; Ohata, Soichiro; Shimizu, Tetsuhide; Nakajima, Hizuru; Uchiyama, Katsumi; Yang, Ming

2017-07-11

A film-stack reaction field with a micropillar array using a motor stirrer was developed for the high sensitivity and rapid enzyme-linked immunosorbent assay (ELISA) reaction. The effects of the incubation time of a protein (30 s, 5 min, and 10 min) on the fluorescence intensity in ELISAs were investigated using a reaction field with different micropillar array dimensions (5-µm, 10-µm and 50-µm gaps between the micropillars). The difference in fluorescence intensity between the well with the reaction field of 50-µm gap for the incubation time of 30 s and the well without the reaction field with for incubation time of 10 min was 6%. The trend of the fluorescence intensity in the gap between the micro pillars in the film-stack reaction field was different between the short incubation time and the long incubation time. The theoretical analysis of the physical parameters related with the biomolecule transport indicated that the reaction efficiency defined in this study was the dominant factor determining the fluorescence intensity for the short incubation time, whereas the volumetric rate of the circulating flow through the space between films and the specific surface area were the dominant factors for the long incubation time.

Mode Reduction and Upscaling of Reactive Transport Under Incomplete Mixing

NASA Astrophysics Data System (ADS)

Lester, D. R.; Bandopadhyay, A.; Dentz, M.; Le Borgne, T.

2016-12-01

Upscaling of chemical reactions in partially-mixed fluid environments is a challenging problem due to the detailed interactions between inherently nonlinear reaction kinetics and complex spatio-temporal concentration distributions under incomplete mixing. We address this challenge via the development of an order reduction method for the advection-diffusion-reaction equation (ADRE) via projection of the reaction kinetics onto a small number N of leading eigenmodes of the advection-diffusion operator (the so-called "strange eigenmodes" of the flow) as an N-by-N nonlinear system, whilst mixing dynamics only are projected onto the remaining modes. For simple kinetics and moderate Péclet and Damkhöler numbers, this approach yields analytic solutions for the concentration mean, evolving spatio-temporal distribution and PDF in terms of the well-mixed reaction kinetics and mixing dynamics. For more complex kinetics or large Péclet or Damkhöler numbers only a small number of modes are required to accurately quantify the mixing and reaction dynamics in terms of the concentration field and PDF, facilitating greatly simplified approximation and analysis of reactive transport. Approximate solutions of this low-order nonlinear system provide quantiative predictions of the evolving concentration PDF. We demonstrate application of this method to a simple random flow and various mass-action reaction kinetics.

Approaching magnetic field effects in biology using the radical pair mechanism

NASA Astrophysics Data System (ADS)

Canfield, Jeffrey Michael

1997-11-01

The overall goal of this thesis has been to explain any of the reported magnetic field effects in biology (magnetic orientation of many species and/or health effects, such as cancer, due to man-made electromagnetic fields) using the radical pair mechanism, a quantum mechanical mechanism known for over 20 years that lets singlet-to-triplet yields (which can be related to reaction rates) of radical pair reactions depend on applied magnetic fields. This goal seems reasonable considering the known roles of many biological free radicals in cancer, disease, aging, development, and cellular signaling, the constant reminders in the media to take anti-oxidant vitamins to protect against certain deleterious free radicals, and the success of the radical pair mechanism in explaining magnetic field effects in photosynthetic reaction centers. To approach the above goal, this thesis develops several methods (using perturbation theory and other techniques in the Schrodinger and Liouville formalisms) for calculating singlet-to-triplet yields in combinations of steady and oscillating fields (some of these algorithms are more versatile or efficient while others give more insight, and all serve as cross-checks on each other) and uses these tools to explore and explain a number of interesting phenomena such as yields sensitive to the magnitude and orientation of earth-strength (0.5 G) steady fields as well as the magnitude, orientation, and frequency of very weak (7 mG or less) oscillating fields. In particular, this thesis examines such effects in several coenzyme B12 systems, systems long studied by EPR (Electron Paramagnetic Resonance, the chief method for determining the spin Hamiltonians, spin relaxation rates, and other parameters needed for calculations) in which organometallic cobalt-carbon bonds are often cleaved homolytically to form radical pairs. Among the B12-dependent enzymes are ribonucleotide reductase (which converts RNA to DNA nucleotides), methyl malonyl CoA mutase (which controls the metabolism of certain fatty acids in mammals), and methionine synthase (which in mammals is used to regenerate active methyl groups on S-adenosyl methionine, which is involved in DNA methylation, melatonin and epinephrine synthesis, myelination, and methylation of chemotaxis proteins).* ftn*Originally published in DAI Vol. 58, No. 10. Reprinted here with revised abstract.

Electromagnetic dissociation effects in galactic heavy-ion fragmentation

NASA Technical Reports Server (NTRS)

Norbury, J. W.; Townsend, L. W.

1986-01-01

Methods for calculating cross sections for the breakup of galactic heavy ions by the Coulomb fields of the interacting nuclei are presented. By using the Weizsacker-Williams method of virtual quanta, estimates of electromagnetic dissociation cross sections for a variety of reactions applicable to galactic cosmic ray shielding studies are presented and compared with other predictions and with available experimental data.

A Multilevel, Hierarchical Sampling Technique for Spatially Correlated Random Fields

DOE PAGES

Osborn, Sarah; Vassilevski, Panayot S.; Villa, Umberto

2017-10-26

In this paper, we propose an alternative method to generate samples of a spatially correlated random field with applications to large-scale problems for forward propagation of uncertainty. A classical approach for generating these samples is the Karhunen--Loève (KL) decomposition. However, the KL expansion requires solving a dense eigenvalue problem and is therefore computationally infeasible for large-scale problems. Sampling methods based on stochastic partial differential equations provide a highly scalable way to sample Gaussian fields, but the resulting parametrization is mesh dependent. We propose a multilevel decomposition of the stochastic field to allow for scalable, hierarchical sampling based on solving amore » mixed finite element formulation of a stochastic reaction-diffusion equation with a random, white noise source function. Lastly, numerical experiments are presented to demonstrate the scalability of the sampling method as well as numerical results of multilevel Monte Carlo simulations for a subsurface porous media flow application using the proposed sampling method.« less

A Multilevel, Hierarchical Sampling Technique for Spatially Correlated Random Fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osborn, Sarah; Vassilevski, Panayot S.; Villa, Umberto

In this paper, we propose an alternative method to generate samples of a spatially correlated random field with applications to large-scale problems for forward propagation of uncertainty. A classical approach for generating these samples is the Karhunen--Loève (KL) decomposition. However, the KL expansion requires solving a dense eigenvalue problem and is therefore computationally infeasible for large-scale problems. Sampling methods based on stochastic partial differential equations provide a highly scalable way to sample Gaussian fields, but the resulting parametrization is mesh dependent. We propose a multilevel decomposition of the stochastic field to allow for scalable, hierarchical sampling based on solving amore » mixed finite element formulation of a stochastic reaction-diffusion equation with a random, white noise source function. Lastly, numerical experiments are presented to demonstrate the scalability of the sampling method as well as numerical results of multilevel Monte Carlo simulations for a subsurface porous media flow application using the proposed sampling method.« less

Detection of Papaya leaf distortion mosaic virus by reverse-transcription loop-mediated isothermal amplification.

PubMed

Shen, Wentao; Tuo, Decai; Yan, Pu; Li, Xiaoying; Zhou, Peng

2014-01-01

Papaya leaf distortion mosaic virus (PLDMV) can infect transgenic papaya resistant to a related pathogen, Papaya ringspot virus (PRSV), posing a substantial threat to papaya production in China. Current detection methods, however, are unable to be used for rapid detection in the field. Here, a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the detection of PLDMV, using a set of four RT-LAMP primers designed based on the conserved sequence of PLDMV CP. The RT-LAMP method detected specifically PLDMV and was highly sensitive, with a detection limit of 1.32×10(-6) μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR, while also requiring significantly less time and equipment. The effectiveness of RT-LAMP and one-step RT-PCR in detecting the virus were compared using 90 field samples of non-transgenic papaya and 90 field samples of commercialized PRSV-resistant transgenic papaya from Hainan Island. None of the non-transgenic papaya tested positive for PLDMV using either method. In contrast, 19 of the commercialized PRSV-resistant transgenic papaya samples tested positive by RT-LAMP assay, and 6 of those tested negative by RT-PCR. Therefore, the PLDMV-specific RT-LAMP is a simple, rapid, sensitive, and cost-effective tool in the field diagnosis and control of PLDMV. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection of ultratrace phosphorus and sulfur by quadrupole ICPMS with dynamic reaction cell.

PubMed

Bandura, Dmitry R; Baranov, Vladimir I; Tanner, Scott D

2002-04-01

A method of detection of ultratrace phosphorus and sulfur that uses reaction with O2 in a dynamic reaction cell (DRC) to oxidize S+ and P+ to allow their detection as SO+ and PO+ is described. The method reduces the effect of polyatomic isobaric interferences at m/z = 31 and 32 by detecting P+ and S+ as the product oxide ions that are less interfered. Use of an axial field in the DRC improves transmission of the product oxide ions 4-6 times. With no axial field, detection limits (3sigma, 5-s integration) of 0.20 and 0.52 ng/mL, with background equivalent concentrations of 0.53 and 4.8 ng/mL, respectively, are achieved. At an optimum axial field potential (200 V), the detection limits are 0.06 ng/mL for P and 0.2 ng/mL for S, respectively. The method is used for determining the degree of phosphorylation of beta-casein, and regular and dephosphorylated alpha-caseins at 10-1000 fmol/microL concentration, with 5-10% v/v organic sample matrix (acetonitrile, formic acid, ammonium bicarbonate). The measured degree of phosphorylation for beta-casein (4.9 phosphorus atoms/molecule) and regular alpha-casein (8.8 phoshorus atoms/molecule) are in good agreement with the structural data for the proteins. The P/S ratio for regular alpha-casein (1.58) is in good agreement with the ratio of the number of phosphorylation sites to the number of sulfur-containing amino acid residues cysteine and methionine. The P/S ratio for commercially available dephosphorylated alpha-casein is measured at 0.41 (approximately 26% residual phosphate).

The Effect of Electric Field on the Explosive Sensitivity of Silver Azide

NASA Astrophysics Data System (ADS)

Rodzevich, A. P.; Gazenaur, E. G.; Kuzmina, L. V.; Krasheninin, V. I.; Gazenaur, N. V.

2017-05-01

The effect of a constant contactless electric field on the rate of a chemical reaction in silver azide is explored in this paper. The technology of growing and processing silver azide whiskers in the constant contactless electric field (field intensity was varied in the range from 10-3 V/m to 100 V/m) allows supervising their explosive sensitivity, therefore, the results of experiments can be relevant for purposeful controlling the resistance of explosive materials. This paper is one of the first attempts to develop efficient methods to affect the explosive sensitivity of energy-related materials in a weak electric field (up to 10-3 V/m).

4th Penn State Bioinorganic Workshop

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krebs, Carsten

The research area of biological inorganic chemistry encompasses a wide variety of subfields, including molecular biology, biochemistry, biophysics, inorganic chemistry, analytical chemistry, physical chemistry, and theoretical chemistry, as well as many different methods, such as biochemical characterization of enzymes, reaction kinetics, a plethora of spectroscopic techniques, and computational methods. The above methods are combined to understand the formation, function, and regulation of the many metallo-cofactors found in Nature as well as to identify novel metallo-cofactors. Many metalloenzyme-catalyzed reactions are extremely complex, but are of fundamental importance to science and society. Examples include (i) the reduction of the chemically inert molecule,more » dinitrogen, to ammonia by the enzyme nitrogenase (this reaction is fundamental for the production of nitrogen fertilizers); (ii) the oxidation of water to dioxygen by the Mn4Ca cluster found in photosystem II; and (iii) myriad reactions in which aliphatic, inert C-H bonds are cleaved for subsequent functionalization of the carbon atoms (the latter reactions are important in the biosynthesis of many natural products). Because of the broad range of areas and techniques employed in this field, research in bioinorganic chemistry is typically carried out collaboratively between two or more research groups. It is of paramount importance that researchers working in this field have a good, basic, working knowledge of many methods and approaches employed in the field, in order to design and discuss experiments with collaborators. Therefore, the training of students working in bioinorganic chemistry is an important aspect of this field. Hugely successful “bioinorganic workshops” were offered in the 1990s at The University of Georgia. These workshops laid the foundation for many of the extant collaborative research efforts in this area today. The large and diverse group of bioinorganic chemists at The Pennsylvania State University and our unique laboratory space are well suited for the continuation of such training workshops. The co-principal investigators of this award lead these efforts. After a smaller “trial workshop” in 2010, the Penn State bioinorganic group, led by the co-PIs, offers these workshops biennially. The 2012, 2014, and 2016 workshops provided training to 123, 162, and 153 participants, respectively, by offering (i) a series of lectures given by faculty experts on the given topic, (ii) hands-on training in small groups by experts in the various methods, and (iii) sharing research results of the participants by oral and poster presentations. The centerpiece of the workshops is the hands-on training, in which approximately half of the participants from all ranks (undergraduate students to faculty) served as teachers. In this section, the traditional roles of teachers and students were sometimes reversed to the extent that undergraduate students taught faculty in the students' areas of specialty. We anticipate that these workshops will facilitate research in bioinorganic chemistry and will help establish future collaborations among “workshop alumni” to carry out cutting-edge research in bioinorganic chemistry that will address many important topics relevant to our society.« less

Chemical Reaction Rates from Ring Polymer Molecular Dynamics: Zero Point Energy Conservation in Mu + H2 → MuH + H.

PubMed

Pérez de Tudela, Ricardo; Aoiz, F J; Suleimanov, Yury V; Manolopoulos, David E

2012-02-16

A fundamental issue in the field of reaction dynamics is the inclusion of the quantum mechanical (QM) effects such as zero point energy (ZPE) and tunneling in molecular dynamics simulations, and in particular in the calculation of chemical reaction rates. In this work we study the chemical reaction between a muonium atom and a hydrogen molecule. The recently developed ring polymer molecular dynamics (RPMD) technique is used, and the results are compared with those of other methods. For this reaction, the thermal rate coefficients calculated with RPMD are found to be in excellent agreement with the results of an accurate QM calculation. The very minor discrepancies are within the convergence error even at very low temperatures. This exceptionally good agreement can be attributed to the dominant role of ZPE in the reaction, which is accounted for extremely well by RPMD. Tunneling only plays a minor role in the reaction.

Using terahertz time-domain spectroscopical technique to monitor cocrystal formation between piracetam and 2,5-dihydroxybenzoic acid

NASA Astrophysics Data System (ADS)

Du, Yong; Xia, Yi; Zhang, Huili; Hong, Zhi

2013-07-01

Far-infrared vibrational absorption of cocrystal formation between 2,5-dihydroxybenzoic acid (2,5-DHBA) and piracetam compounds under solvent evaporation and grinding methods have been investigated using terahertz time-domain spectroscopy (THz-TDS) at room temperature. The experimental results show large difference among absorption spectra of the formed cocrystals and the involved individual parent molecules in 0.20-1.50 THz region, which probably originated from the intra-molecular and inter-molecular hydrogen bonds due to the presence of two hydroxyl groups in 2,5-DHBA and amide moieties in piracetam compound. The THz absorption spectra of two formed cocrystals with different methods are almost identical. With grinding method, the reaction process can be monitored directly from both time-domain and frequency-domain spectra using THz-TDS technique. The results indicate that THz-TDS technology can absolutely offer us a high potential method to identify and characterize the formed cocrystals, and also provide the rich information about their reaction dynamic process involving two or more molecular crystals in situ to better know the corresponding reaction mechanism in pharmaceutical fields.

A computational method for the coupled solution of reaction-diffusion equations on evolving domains and manifolds: Application to a model of cell migration and chemotaxis.

PubMed

MacDonald, G; Mackenzie, J A; Nolan, M; Insall, R H

2016-03-15

In this paper, we devise a moving mesh finite element method for the approximate solution of coupled bulk-surface reaction-diffusion equations on an evolving two dimensional domain. Fundamental to the success of the method is the robust generation of bulk and surface meshes. For this purpose, we use a novel moving mesh partial differential equation (MMPDE) approach. The developed method is applied to model problems with known analytical solutions; these experiments indicate second-order spatial and temporal accuracy. Coupled bulk-surface problems occur frequently in many areas; in particular, in the modelling of eukaryotic cell migration and chemotaxis. We apply the method to a model of the two-way interaction of a migrating cell in a chemotactic field, where the bulk region corresponds to the extracellular region and the surface to the cell membrane.

Modelling of spatial contaminant probabilities of occurrence of chlorinated hydrocarbons in an urban aquifer.

PubMed

Greis, Tillman; Helmholz, Kathrin; Schöniger, Hans Matthias; Haarstrick, Andreas

2012-06-01

In this study, a 3D urban groundwater model is presented which serves for calculation of multispecies contaminant transport in the subsurface on the regional scale. The total model consists of two submodels, the groundwater flow and reactive transport model, and is validated against field data. The model equations are solved applying finite element method. A sensitivity analysis is carried out to perform parameter identification of flow, transport and reaction processes. Coming from the latter, stochastic variation of flow, transport, and reaction input parameters and Monte Carlo simulation are used in calculating probabilities of pollutant occurrence in the domain. These probabilities could be part of determining future spots of contamination and their measure of damages. Application and validation is exemplarily shown for a contaminated site in Braunschweig (Germany), where a vast plume of chlorinated ethenes pollutes the groundwater. With respect to field application, the methods used for modelling reveal feasible and helpful tools to assess natural attenuation (MNA) and the risk that might be reduced by remediation actions.

The Maillard reaction and its control during food processing. The potential of emerging technologies.

PubMed

Jaeger, H; Janositz, A; Knorr, D

2010-06-01

The Maillard reaction between reducing sugars and amino acids is a common reaction in foods which undergo thermal processing. Desired consequences like the formation of flavor and brown color of some cooked foods but also the destruction of essential amino acids and the production of anti-nutritive compounds require the consideration of the Maillard reaction and relevant mechanisms for its control. This paper aims to exemplify the recent advances in food processing with regard to the controllability of heat-induced changes in the food quality. Firstly, improved thermal technologies, such as ohmic heating, which allows direct heating of the product and overcoming the heat transfer limitations of conventional thermal processing are presented in terms of their applicability to reduce the thermal exposure during food preservation. Secondly, non-thermal technologies such as high hydrostatic pressure and pulsed electric fields and their ability to extend the shelf life of food products without the application of heat, thus also preserving the quality attributes of the food, will be discussed. Finally, an innovative method for the removal of Maillard reaction substrates in food raw materials by the application of pulsed electric field cell disintegration and extraction as well as enzymatic conversion is presented in order to demonstrate the potential of the combination of processes to control the occurrence of the Maillard reaction in food processing. (c) 2009 Elsevier Masson SAS. All rights reserved.

A Lattice Kinetic Monte Carlo Solver for First-Principles Microkinetic Trend Studies

DOE PAGES

Hoffmann, Max J.; Bligaard, Thomas

2018-01-22

Here, mean-field microkinetic models in combination with Brønsted–Evans–Polanyi like scaling relations have proven highly successful in identifying catalyst materials with good or promising reactivity and selectivity. Analysis of the microkinetic model by means of lattice kinetic Monte Carlo promises a faithful description of a range of atomistic features involving short-range ordering of species in the vicinity of an active site. In this paper, we use the “fruit fly” example reaction of CO oxidation on fcc(111) transition and coinage metals to motivate and develop a lattice kinetic Monte Carlo solver suitable for the numerically challenging case of vastly disparate rate constants.more » As a result, we show that for the case of infinitely fast diffusion and absence of adsorbate-adsorbate interaction it is, in fact, possible to match the prediction of the mean-field-theory method and the lattice kinetic Monte Carlo method. As a corollary, we conclude that lattice kinetic Monte Carlo simulations of surface chemical reactions are most likely to provide additional insight over mean-field simulations if diffusion limitations or adsorbate–adsorbate interactions have a significant influence on the mixing of the adsorbates.« less

A Lattice Kinetic Monte Carlo Solver for First-Principles Microkinetic Trend Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoffmann, Max J.; Bligaard, Thomas

Here, mean-field microkinetic models in combination with Brønsted–Evans–Polanyi like scaling relations have proven highly successful in identifying catalyst materials with good or promising reactivity and selectivity. Analysis of the microkinetic model by means of lattice kinetic Monte Carlo promises a faithful description of a range of atomistic features involving short-range ordering of species in the vicinity of an active site. In this paper, we use the “fruit fly” example reaction of CO oxidation on fcc(111) transition and coinage metals to motivate and develop a lattice kinetic Monte Carlo solver suitable for the numerically challenging case of vastly disparate rate constants.more » As a result, we show that for the case of infinitely fast diffusion and absence of adsorbate-adsorbate interaction it is, in fact, possible to match the prediction of the mean-field-theory method and the lattice kinetic Monte Carlo method. As a corollary, we conclude that lattice kinetic Monte Carlo simulations of surface chemical reactions are most likely to provide additional insight over mean-field simulations if diffusion limitations or adsorbate–adsorbate interactions have a significant influence on the mixing of the adsorbates.« less

Deconstructing field-induced ketene isomerization through Lagrangian descriptors.

PubMed

Craven, Galen T; Hernandez, Rigoberto

2016-02-07

The time-dependent geometrical separatrices governing state transitions in field-induced ketene isomerization are constructed using the method of Lagrangian descriptors. We obtain the stable and unstable manifolds of time-varying transition states as dynamic phase space objects governing configurational changes when the ketene molecule is subjected to an oscillating electric field. The dynamics of the isomerization reaction are modeled through classical trajectory studies on the Gezelter-Miller potential energy surface and an approximate dipole moment model which is coupled to a time-dependent electric field. We obtain a representation of the reaction geometry, over varying field strengths and oscillation frequencies, by partitioning an initial phase space into basins labeled according to which product state is reached at a given time. The borders between these basins are in agreement with those obtained using Lagrangian descriptors, even in regimes exhibiting chaotic dynamics. Major outcomes of this work are: validation and extension of a transition state theory framework built from Lagrangian descriptors, elaboration of the applicability for this theory to periodically- and aperiodically-driven molecular systems, and prediction of regimes in which isomerization of ketene and its derivatives may be controlled using an external field.

Pd-mediated rapid cross-couplings using [(11) C]methyl iodide: groundbreaking labeling methods in (11) C radiochemistry.

PubMed

Doi, Hisashi

2015-03-01

Prof. Bengt Långström is a pioneer in the field of chemistry-driven positron emission tomography (PET) imaging. He has developed a variety of excellent radiolabeling methodologies using the methods of organic chemistry, with the aim of widening the potential of PET in the study of life. Among his groundbreaking achievements in (11) C radiochemistry, there is the discovery of the Pd-mediated rapid cross-coupling reaction using [(11) C]methyl iodide. It was first reported by his Uppsala group in 1994-1995 and was further investigated by his and other groups with a view of enhancing its generality and practicability. This reaction is currently considered one of the basic methods for (11) C-labeling of low-weight organic compounds. This paper presents a short summary of the background and the development of Pd-mediated rapid cross-couplings of [(11) C]methyl iodide, with a focus not only on organostannanes, but also on organoboranes, organozincs, and terminal acetylene compounds. All these reactions have proven to be dependable (11) C-labeling methodologies that use chemically reliable carbon-carbon bond formation reactions. Copyright © 2015 John Wiley & Sons, Ltd.

QM/MM Geometry Optimization on Extensive Free-Energy Surfaces for Examination of Enzymatic Reactions and Design of Novel Functional Properties of Proteins.

PubMed

Hayashi, Shigehiko; Uchida, Yoshihiro; Hasegawa, Taisuke; Higashi, Masahiro; Kosugi, Takahiro; Kamiya, Motoshi

2017-05-05

Many remarkable molecular functions of proteins use their characteristic global and slow conformational dynamics through coupling of local chemical states in reaction centers with global conformational changes of proteins. To theoretically examine the functional processes of proteins in atomic detail, a methodology of quantum mechanical/molecular mechanical (QM/MM) free-energy geometry optimization is introduced. In the methodology, a geometry optimization of a local reaction center is performed with a quantum mechanical calculation on a free-energy surface constructed with conformational samples of the surrounding protein environment obtained by a molecular dynamics simulation with a molecular mechanics force field. Geometry optimizations on extensive free-energy surfaces by a QM/MM reweighting free-energy self-consistent field method designed to be variationally consistent and computationally efficient have enabled examinations of the multiscale molecular coupling of local chemical states with global protein conformational changes in functional processes and analysis and design of protein mutants with novel functional properties.

QM/MM Geometry Optimization on Extensive Free-Energy Surfaces for Examination of Enzymatic Reactions and Design of Novel Functional Properties of Proteins

NASA Astrophysics Data System (ADS)

Hayashi, Shigehiko; Uchida, Yoshihiro; Hasegawa, Taisuke; Higashi, Masahiro; Kosugi, Takahiro; Kamiya, Motoshi

2017-05-01

Many remarkable molecular functions of proteins use their characteristic global and slow conformational dynamics through coupling of local chemical states in reaction centers with global conformational changes of proteins. To theoretically examine the functional processes of proteins in atomic detail, a methodology of quantum mechanical/molecular mechanical (QM/MM) free-energy geometry optimization is introduced. In the methodology, a geometry optimization of a local reaction center is performed with a quantum mechanical calculation on a free-energy surface constructed with conformational samples of the surrounding protein environment obtained by a molecular dynamics simulation with a molecular mechanics force field. Geometry optimizations on extensive free-energy surfaces by a QM/MM reweighting free-energy self-consistent field method designed to be variationally consistent and computationally efficient have enabled examinations of the multiscale molecular coupling of local chemical states with global protein conformational changes in functional processes and analysis and design of protein mutants with novel functional properties.

Method of plasma enhanced chemical vapor deposition of diamond using methanol-based solutions

NASA Technical Reports Server (NTRS)

Tzeng, Yonhua (Inventor)

2009-01-01

Briefly described, methods of forming diamond are described. A representative method, among others, includes: providing a substrate in a reaction chamber in a non-magnetic-field microwave plasma system; introducing, in the absence of a gas stream, a liquid precursor substantially free of water and containing methanol and at least one carbon and oxygen containing compound having a carbon to oxygen ratio greater than one, into an inlet of the reaction chamber; vaporizing the liquid precursor; and subjecting the vaporized precursor, in the absence of a carrier gas and in the absence in a reactive gas, to a plasma under conditions effective to disassociate the vaporized precursor and promote diamond growth on the substrate in a pressure range from about 70 to 130 Torr.

Using supercritical fluids to refine hydrocarbons

DOEpatents

Yarbro, Stephen Lee

2014-11-25

This is a method to reactively refine hydrocarbons, such as heavy oils with API gravities of less than 20.degree. and bitumen-like hydrocarbons with viscosities greater than 1000 cp at standard temperature and pressure using a selected fluid at supercritical conditions. The reaction portion of the method delivers lighter weight, more volatile hydrocarbons to an attached contacting device that operates in mixed subcritical or supercritical modes. This separates the reaction products into portions that are viable for use or sale without further conventional refining and hydro-processing techniques. This method produces valuable products with fewer processing steps, lower costs, increased worker safety due to less processing and handling, allow greater opportunity for new oil field development and subsequent positive economic impact, reduce related carbon dioxide, and wastes typical with conventional refineries.

Contamination Detection and Mitigation Strategies for Unsymmetric Dimethylhydrazine/Nitrogen Tetroxide Non-Combustion Product Residues

NASA Technical Reports Server (NTRS)

Greene, Benjamin; Buchanan, Vanessa D.; Baker, David L.

2006-01-01

Dimethylamine and nitrite, which are non-combustion reaction products of unsymmetrical dimethylhydrazine (UDMH) and nitrogen tetroxide (NTO) propellants, can contaminate spacesuits during extra-vehicular activity (EVA) operations. They can react with water in the International Space Station (ISS) airlock to form N-nitrosodimethylamine (NDMA), a carcinogen. Detection methods for assessing nitrite and dimethylamine contamination were investigated. The methods are based on color-forming reactions in which intensity of color is proportional to concentration. A concept color detection kit using a commercially available presumptive field test for methamphetamine coupled with nitrite test strips was developed and used to detect dimethylamine and nitrite. Contamination mitigation strategies were also developed.

Numerical Simulation of the Detonation of Condensed Explosives

NASA Astrophysics Data System (ADS)

Wang, Cheng; Ye, Ting; Ning, Jianguo

Detonation process of a condensed explosive was simulated using a finite difference method. Euler equations were applied to describe the detonation flow field, an ignition and growth model for the chemical reaction and Jones-Wilkins-Lee (JWL) equations of state for the state of explosives and detonation products. Based on the simple mixture rule that assumes the reacting explosives to be a mixture of the reactant and product components, 1D and 2D codes were developed to simulate the detonation process of high explosive PBX9404. The numerical results are in good agreement with the experimental results, which demonstrates that the finite difference method, mixture rule and chemical reaction proposed in this paper are adequate and feasible.

Predictors of severe systemic anaphylactic reactions in patients with Hymenoptera venom allergy: importance of baseline serum tryptase-a study of the European Academy of Allergology and Clinical Immunology Interest Group on Insect Venom Hypersensitivity.

PubMed

Ruëff, Franziska; Przybilla, Bernhard; Biló, Maria Beatrice; Müller, Ulrich; Scheipl, Fabian; Aberer, Werner; Birnbaum, Joëlle; Bodzenta-Lukaszyk, Anna; Bonifazi, Floriano; Bucher, Christoph; Campi, Paolo; Darsow, Ulf; Egger, Cornelia; Haeberli, Gabrielle; Hawranek, Thomas; Körner, Michael; Kucharewicz, Iwona; Küchenhoff, Helmut; Lang, Roland; Quercia, Oliviero; Reider, Norbert; Severino, Maurizio; Sticherling, Michael; Sturm, Gunter Johannes; Wüthrich, Brunello

2009-11-01

Severe anaphylaxis to honeybee or vespid stings is associated with a variety of risk factors, which are poorly defined. Our aim was to evaluate the association of baseline serum tryptase concentrations and other variables routinely recorded during patient evaluation with the frequency of past severe anaphylaxis after a field sting. In this observational multicenter study, we enrolled 962 patients with established bee or vespid venom allergy who had a systemic reaction after a field sting. Data were collected on tryptase concentration, age, sex, culprit insect, cardiovascular medication, and the number of preceding minor systemic reactions before the index field sting. A severe reaction was defined as anaphylactic shock, loss of consciousness, or cardiopulmonary arrest. The index sting was defined as the hitherto first, most severe systemic field-sting reaction. Relative rates were calculated with generalized additive models. Two hundred six (21.4%) patients had a severe anaphylactic reaction after a field sting. The frequency of this event increased significantly with higher tryptase concentrations (nonlinear association). Other factors significantly associated with severe reactions after a field sting were vespid venom allergy, older age, male sex, angiotensin-converting enzyme inhibitor medication, and 1 or more preceding field stings with a less severe systemic reaction. In patients with honeybee or vespid venom allergy, baseline serum tryptase concentrations are associated with the risk for severe anaphylactic reactions. Preventive measures should include substitution of angiotensin-converting enzyme inhibitors.

Uncaria gambir Roxb. mediated green synthesis of silver nanoparticles using diethanolamine as capping agent

NASA Astrophysics Data System (ADS)

Labanni, A.; Zulhadjri; Handayani, D.; Arief, S.

2018-01-01

Studies of silver nanoparticles preparation has been developed increasingly due to the wide application in various areas and field, such as medicine, energy, catalysis, and electronic. An environmental-friendly method is needed to fabricate biocompatible silver nanoparticles without producing hazardous materials to the environment. In this study, we synthesized silver nanoparticles by green synthesis method, using leaf extract of gambir (Uncaria gambir Roxb.) as bioreducing agent and aqueous diethanolamine (DEA) solution as capping agents. The AgNO3/DEA molar ratio was varied to investigate the effect of DEA concentration to the properties of silver nanoparticles. The formation of silver nanoparticles was indicated by colour changes to yellowish brown and confirmed by result of UV-Vis spectrophotometer analysis which shown absorption band at 400 to 410 nm. The absorbance was increased to the reaction time of 24 hours, and was decrease by the increasing of DEA concentration in reaction. TEM analysis showed that prepared silver nanoparticles were spherical in shape with diameter of 3,5 - 45,5 nm. The diameter of DEA capped silver nanoparticles was 13 nm, smaller than uncapped silver nanoparticles which was 26 nm It exhibited good stability to time reaction of one month which was potential to be developed in some fields.

Implanting intra-abdominal radiotransmitters with external whip antennas in ducks

USGS Publications Warehouse

Korschgen, C.E.; Kenow, K.P.; Gendron-Fitzpatrick, A.; Green, W.L.; Dein, F.J.

1996-01-01

We developed and evaluated a surgical procedure for implanting intra-abdominal radiotransmitters with external whip antennas in captive mallards (Anas platyrhynchos). Transmitters were implanted in the abdominal cavity and the antennas exited through the caudal abdominal wall and skin. Birds with implanted transmitters developed mild to moderate localized air sac reactions. These reactions involved adhesions of the right anterior abdominal air sac to the liver with contractions around the transmitters and antenna catheters. The adhesions were reinforced by a proliferation of connective tissue and lined by multinucleated giant cells (foreign body reaction). Casual observation indicated that neither behavior nor activity of the birds was altered by the histological reaction to the transmitter implant. No increase in systemic lesions (particularly liver or kidney) could be correlated with the histological reactions. Our evaluations indicate that the procedure is a reliable method for radiomarking ducks and the technique has been successfully used in 2 field studies.

Oxidative Dehydrogenation on Nanocarbon: Insights into the Reaction Mechanism and Kinetics via in Situ Experimental Methods.

PubMed

Qi, Wei; Yan, Pengqiang; Su, Dang Sheng

2018-03-20

Sustainable and environmentally benign catalytic processes are vital for the future to supply the world population with clean energy and industrial products. The replacement of conventional metal or metal oxide catalysts with earth abundant and renewable nonmetallic materials has attracted considerable research interests in the field of catalysis and material science. The stable and efficient catalytic performance of nanocarbon materials was discovered at the end of last century, and these materials are considered as potential alternatives for conventional metal-based catalysts. With its rapid development in the past 20 years, the research field of carbon catalysis has been experiencing a smooth transition from the discovery of novel nanocarbon materials or related new reaction systems to the atomistic-level mechanistic understanding on the catalytic process and the subsequent rational design of the practical catalytic reaction systems. In this Account, we summarize the recent progress in the kinetic and mechanistic studies on nanocarbon catalyzed alkane oxidative dehydrogenation (ODH) reactions. The paper attempts to extract general concepts and basic regularities for carbon catalytic process directing us on the way for rational design of novel efficient metal-free catalysts. The nature of the active sites for ODH reactions has been revealed through microcalorimetric analysis, ambient pressure X-ray photoelectron spectroscopy (XPS) measurement, and in situ chemical titration strategies. The detailed kinetic analysis and in situ catalyst structure characterization suggests that carbon catalyzed ODH reactions involve the redox cycles of the ketonic carbonyl-hydroxyl pairs, and the key physicochemical parameters (activation energy, reaction order, and rate/equilibrium constants, etc.) of the carbon catalytic systems are proposed and compared with conventional transition metal oxide catalysts. The proposal of the intrinsic catalytic activity (TOF) provides the possibility for the fair comparisons of different nanocarbon catalysts and the consequent structure-function relation regularity. Surface modification and heteroatom doping are proved as the most effective strategies to adjust the catalytic property (activity and product selectivity etc.) of the nanocarbon catalysts. Nanocarbon is actually a proper candidate platform helping us to understand the classical catalytic reaction mechanism better, since there is no lattice oxygen and all the catalytic process happens on nanocarbon surface. This Account also exhibits the importance of the in situ structural characterizations for heterogeneous nanocarbon catalysis. The research strategy and methods proposed for carbon catalysts may also shed light on other complicated catalytic systems or fields concerning the applications of nonmetallic materials, such as energy storage and environment protection etc.

Probing fast ribozyme reactions under biological conditions with rapid quench-flow kinetics.

PubMed

Bingaman, Jamie L; Messina, Kyle J; Bevilacqua, Philip C

2017-05-01

Reaction kinetics on the millisecond timescale pervade the protein and RNA fields. To study such reactions, investigators often perturb the system with abiological solution conditions or substrates in order to slow the rate to timescales accessible by hand mixing; however, such perturbations can change the rate-limiting step and obscure key folding and chemical steps that are found under biological conditions. Mechanical methods for collecting data on the millisecond timescale, which allow these perturbations to be avoided, have been developed over the last few decades. These methods are relatively simple and can be conducted on affordable and commercially available instruments. Here, we focus on using the rapid quench-flow technique to study the fast reaction kinetics of RNA enzymes, or ribozymes, which often react on the millisecond timescale under biological conditions. Rapid quench of ribozymes is completely parallel to the familiar hand-mixing approach, including the use of radiolabeled RNAs and fractionation of reactions on polyacrylamide gels. We provide tips on addressing and preventing common problems that can arise with the rapid-quench technique. Guidance is also offered on ensuring the ribozyme is properly folded and fast-reacting. We hope that this article will facilitate the broader use of rapid-quench instrumentation to study fast-reacting ribozymes under biological reaction conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

Probing fast ribozyme reactions under biological conditions with rapid quench-flow kinetics

PubMed Central

Bingaman, Jamie L.; Messina, Kyle J.; Bevilacqua, Philip C.

2017-01-01

Reaction kinetics on the millisecond timescale pervade the protein and RNA fields. To study such reactions, investigators often perturb the system with abiological solution conditions or substrates in order to slow the rate to timescales accessible by hand-mixing; however, such perturbations can change the rate-limiting step and obscure key folding and chemical steps that are found under biological conditions. Mechanical methods for collecting data on the millisecond timescale, which allow these perturbations to be avoided, have been developed over the last few decades. These methods are relatively simple and can be conducted on affordable and commercially available instruments. Here, we focus on using the rapid quench-flow technique to study the fast reaction kinetics of RNA enzymes, or ribozymes, which often react on the millisecond timescale under biological conditions. Rapid quench of ribozymes is completely parallel to the familiar hand-mixing approach, including the use of radiolabeled RNAs and fractionation of reactions on polyacrylamide gels. We provide tips on addressing and preventing common problems that can arise with the rapid-quench technique. Guidance is also offered on ensuring the ribozyme is properly folded and fast-reacting. We hope that this article will facilitate the broader use of rapid-quench instrumentation to study fast-reacting ribozymes under biological reaction conditions. PMID:28315484

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

Probabilistic maturation reaction norms assessed from mark–recaptures of wild fish in their natural habitat

PubMed Central

Olsen, Esben M; Serbezov, Dimitar; Vøllestad, Leif A

2014-01-01

Reaction norms are a valuable tool in evolutionary biology. Lately, the probabilistic maturation reaction norm approach, describing probabilities of maturing at combinations of age and body size, has been much applied for testing whether phenotypic changes in exploited populations of fish are mainly plastic or involving an evolutionary component. However, due to typical field data limitations, with imperfect knowledge about individual life histories, this demographic method still needs to be assessed. Using 13 years of direct mark–recapture observations on individual growth and maturation in an intensively sampled population of brown trout (Salmo trutta), we show that the probabilistic maturation reaction norm approach may perform well even if the assumption of equal survival of juvenile and maturing fish does not hold. Earlier studies have pointed out that growth effects may confound the interpretation of shifts in maturation reaction norms, because this method in its basic form deals with body size rather than growth. In our case, however, we found that juvenile body size, rather than annual growth, was more strongly associated with maturation. Viewed against earlier studies, our results also underscore the challenges of generalizing life-history patterns among species and populations. PMID:24967078

Automated Transition State Search and Its Application to Diverse Types of Organic Reactions.

PubMed

Jacobson, Leif D; Bochevarov, Art D; Watson, Mark A; Hughes, Thomas F; Rinaldo, David; Ehrlich, Stephan; Steinbrecher, Thomas B; Vaitheeswaran, S; Philipp, Dean M; Halls, Mathew D; Friesner, Richard A

2017-11-14

Transition state search is at the center of multiple types of computational chemical predictions related to mechanistic investigations, reactivity and regioselectivity predictions, and catalyst design. The process of finding transition states in practice is, however, a laborious multistep operation that requires significant user involvement. Here, we report a highly automated workflow designed to locate transition states for a given elementary reaction with minimal setup overhead. The only essential inputs required from the user are the structures of the separated reactants and products. The seamless workflow combining computational technologies from the fields of cheminformatics, molecular mechanics, and quantum chemistry automatically finds the most probable correspondence between the atoms in the reactants and the products, generates a transition state guess, launches a transition state search through a combined approach involving the relaxing string method and the quadratic synchronous transit, and finally validates the transition state via the analysis of the reactive chemical bonds and imaginary vibrational frequencies as well as by the intrinsic reaction coordinate method. Our approach does not target any specific reaction type, nor does it depend on training data; instead, it is meant to be of general applicability for a wide variety of reaction types. The workflow is highly flexible, permitting modifications such as a choice of accuracy, level of theory, basis set, or solvation treatment. Successfully located transition states can be used for setting up transition state guesses in related reactions, saving computational time and increasing the probability of success. The utility and performance of the method are demonstrated in applications to transition state searches in reactions typical for organic chemistry, medicinal chemistry, and homogeneous catalysis research. In particular, applications of our code to Michael additions, hydrogen abstractions, Diels-Alder cycloadditions, carbene insertions, and an enzyme reaction model involving a molybdenum complex are shown and discussed.

Modules based on the geochemical model PHREEQC for use in scripting and programming languages

USGS Publications Warehouse

Charlton, Scott R.; Parkhurst, David L.

2011-01-01

The geochemical model PHREEQC is capable of simulating a wide range of equilibrium reactions between water and minerals, ion exchangers, surface complexes, solid solutions, and gases. It also has a general kinetic formulation that allows modeling of nonequilibrium mineral dissolution and precipitation, microbial reactions, decomposition of organic compounds, and other kinetic reactions. To facilitate use of these reaction capabilities in scripting languages and other models, PHREEQC has been implemented in modules that easily interface with other software. A Microsoft COM (component object model) has been implemented, which allows PHREEQC to be used by any software that can interface with a COM server—for example, Excel®, Visual Basic®, Python, or MATLAB". PHREEQC has been converted to a C++ class, which can be included in programs written in C++. The class also has been compiled in libraries for Linux and Windows that allow PHREEQC to be called from C++, C, and Fortran. A limited set of methods implements the full reaction capabilities of PHREEQC for each module. Input methods use strings or files to define reaction calculations in exactly the same formats used by PHREEQC. Output methods provide a table of user-selected model results, such as concentrations, activities, saturation indices, and densities. The PHREEQC module can add geochemical reaction capabilities to surface-water, groundwater, and watershed transport models. It is possible to store and manipulate solution compositions and reaction information for many cells within the module. In addition, the object-oriented nature of the PHREEQC modules simplifies implementation of parallel processing for reactive-transport models. The PHREEQC COM module may be used in scripting languages to fit parameters; to plot PHREEQC results for field, laboratory, or theoretical investigations; or to develop new models that include simple or complex geochemical calculations.

Modules based on the geochemical model PHREEQC for use in scripting and programming languages

USGS Publications Warehouse

Charlton, S.R.; Parkhurst, D.L.

2011-01-01

The geochemical model PHREEQC is capable of simulating a wide range of equilibrium reactions between water and minerals, ion exchangers, surface complexes, solid solutions, and gases. It also has a general kinetic formulation that allows modeling of nonequilibrium mineral dissolution and precipitation, microbial reactions, decomposition of organic compounds, and other kinetic reactions. To facilitate use of these reaction capabilities in scripting languages and other models, PHREEQC has been implemented in modules that easily interface with other software. A Microsoft COM (component object model) has been implemented, which allows PHREEQC to be used by any software that can interface with a COM server-for example, Excel??, Visual Basic??, Python, or MATLAB??. PHREEQC has been converted to a C++ class, which can be included in programs written in C++. The class also has been compiled in libraries for Linux and Windows that allow PHREEQC to be called from C++, C, and Fortran. A limited set of methods implements the full reaction capabilities of PHREEQC for each module. Input methods use strings or files to define reaction calculations in exactly the same formats used by PHREEQC. Output methods provide a table of user-selected model results, such as concentrations, activities, saturation indices, and densities. The PHREEQC module can add geochemical reaction capabilities to surface-water, groundwater, and watershed transport models. It is possible to store and manipulate solution compositions and reaction information for many cells within the module. In addition, the object-oriented nature of the PHREEQC modules simplifies implementation of parallel processing for reactive-transport models. The PHREEQC COM module may be used in scripting languages to fit parameters; to plot PHREEQC results for field, laboratory, or theoretical investigations; or to develop new models that include simple or complex geochemical calculations. ?? 2011.

Chemistry with spatial control using particles and streams†

PubMed Central

Kalinin, Yevgeniy V.; Murali, Adithya

2012-01-01

Spatial control of chemical reactions, with micro- and nanometer scale resolution, has important consequences for one pot synthesis, engineering complex reactions, developmental biology, cellular biochemistry and emergent behavior. We review synthetic methods to engineer this spatial control using chemical diffusion from spherical particles, shells and polyhedra. We discuss systems that enable both isotropic and anisotropic chemical release from isolated and arrayed particles to create inhomogeneous and spatially patterned chemical fields. In addition to such finite chemical sources, we also discuss spatial control enabled with laminar flow in 2D and 3D microfluidic networks. Throughout the paper, we highlight applications of spatially controlled chemistry in chemical kinetics, reaction-diffusion systems, chemotaxis and morphogenesis. PMID:23145348

Past and future detector arrays for complete event reconstruction in heavy-ion reactions

NASA Astrophysics Data System (ADS)

Cardella, G.; Acosta, L.; Auditore, L.; Boiano, C.; Castoldi, A.; D'Andrea, M.; De Filippo, E.; Dell'Aquila, D.; De Luca, S.; Fichera, F.; Giudice, N.; Gnoffo, B.; Grimaldi, A.; Guazzoni, C.; Lanzalone, G.; Librizzi, F.; Lombardo, I.; Maiolino, C.; Maffesanti, S.; Martorana, N. S.; Norella, S.; Pagano, A.; Pagano, E. V.; Papa, M.; Parsani, T.; Passaro, G.; Pirrone, S.; Politi, G.; Previdi, F.; Quattrocchi, L.; Rizzo, F.; Russotto, P.; Saccà, G.; Salemi, G.; Sciliberto, D.; Trifirò, A.; Trimarchi, M.; Vigilante, M.

2017-11-01

Complex and more and more complete detector arrays have been developed in the last two decades, or are in advanced design stage, in different laboratories. Such arrays are necessary to fully characterize nuclear reactions induced by stable and exotic beams. The need for contemporary detection of charged particles, and/or γ -rays, and/or neutrons, has been stressed in many fields of nuclear structure and reaction dynamics, with particular attention to the improvement of both high angular and energy resolution. Some examples of detection systems adapted to various energy ranges is discussed. Emphasis is given to the possible update of relatively old 4π detectors with new electronics and new detection methods.

Bond formations by intermolecular and intramolecular trappings of acylketenes and their applications in natural product synthesis†

PubMed Central

Reber, Keith P.; Tilley, S. David

2011-01-01

The reactive intermediates known as acylketenes exhibit a rich chemistry and have been extensively utilized for many types of inter- and intramolecular bond-forming reactions within the field of organic synthesis. Characteristic reactions of acylketenes include cycloadditions, carbon–carbon bond-forming reactions, and nucleophilic capture with alcohols or amines to give β-keto acid derivatives. In particular, the intramolecular capture of acylketene intermediates with pendant nucleophiles represents a powerful method for forming both medium-sized rings and macrocycles, often in high yield. This tutorial review examines the history, generation, and reactivity of acylketenes with a special focus on their applications in the synthesis of natural products. PMID:19847338

Microwave-assisted solvothermal synthesis of hierarchical TiO2 microspheres for efficient electro-field-assisted-photocatalytic removal of tributyltin in tannery wastewater.

PubMed

Zhao, Yang; Huang, Zhiding; Chang, Wenkai; Wei, Chao; Feng, Xugen; Ma, Lin; Qi, Xiaoxia; Li, Zenghe

2017-07-01

Organotin compounds have been widely used in recent decades, however, the residential tributyltin (TBT) in environment has potential harmful effects on human health due to the disruption of endocrine system even at trace level. Herein, this work reports on an effective electro-field-assisted-photocatalytic technique for removal of TBT by applying an electric field to photocatalysis of as-prepared hierarchical TiO 2 microspheres. The synthesis of catalytic materials is based on a self-assembly process induced by microwave-assisted solvothermal reaction. Hierarchical TiO 2 microspheres consisting of nanowires can be obtained in short time with this facile method and possess high surface area and superior optical properties. As the catalyst, it was found that the reaction rate constant of electro-field-assisted-photocatalytic removal (0.0488 min -1 ) of TBT exhibited almost a 9 fold improvement as compared to that of photocatalysis (0.0052 min -1 ). The proposed mechanism of electro-field-assisted-photocatalytic removal of TBT was verified by using 117 Sn-enriched TBT spike solution as an isotopic tracer. In addition, varying impacts from some key reaction conditions, such as voltage of potential, pH value and the presence of Cr and formaldehyde were also discussed. The overall satisfactory TBT removal performance of the proposed electro-field-assisted-photocatalysis procedure with hierarchical TiO 2 microspheres, which was validated using actual tannery wastewater samples from three different kinds of tanning procedures. These attributes suggest that this electro-field-assisted-photocatalysis may have broad applications for the treatment of tannery wastewater. Copyright © 2017 Elsevier Ltd. All rights reserved.

Substrate-Coated Illumination Droplet Spray Ionization: Real-Time Monitoring of Photocatalytic Reactions

NASA Astrophysics Data System (ADS)

Zhang, Hong; Li, Na; Zhao, Dandan; Jiang, Jie; You, Hong

2017-09-01

Real-time monitoring of photocatalytic reactions facilitates the elucidation of the mechanisms of the reactions. However, suitable tools for real-time monitoring are lacking. Herein, a novel method based on droplet spray ionization named substrate-coated illumination droplet spray ionization (SCI-DSI) for direct analysis of photocatalytic reaction solution is reported. SCI-DSI addresses many of the analytical limitations of electrospray ionization (ESI) for analysis of photocatalytic-reaction intermediates, and has potential for both in situ analysis and real-time monitoring of photocatalytic reactions. In SCI-DSI-mass spectrometry (MS), a photocatalytic reaction occurs by loading sample solutions onto the substrate-coated cover slip and by applying UV light above the modified slip; one corner of this slip adjacent to the inlet of a mass spectrometer is the high-electric-field location for launching a charged-droplet spray. After both testing and optimizing the performance of SCI-DSI, the value of this method for in situ analysis and real-time monitoring of photocatalytic reactions was demonstrated by the removal of cyclophosphamide (CP) in TiO2/UV. Reaction times ranged from seconds to minutes, and the proposed reaction intermediates were captured and identified by tandem mass spectrometry. Moreover, the free hydroxyl radical (·OH) was identified as the main radicals for CP removal. These results show that SCI-DSI is suitable for in situ analysis and real-time monitoring of CP removal under TiO2-based photocatalytic reactions. SCI-DSI is also a potential tool for in situ analysis and real-time assessment of the roles of radicals during CP removal under TiO2-based photocatalytic reactions. Graphical Abstract[Figure not available: see fulltext.

Adaptive two-regime method: Application to front propagation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Martin, E-mail: martin.robinson@maths.ox.ac.uk; Erban, Radek, E-mail: erban@maths.ox.ac.uk; Flegg, Mark, E-mail: mark.flegg@monash.edu

2014-03-28

The Adaptive Two-Regime Method (ATRM) is developed for hybrid (multiscale) stochastic simulation of reaction-diffusion problems. It efficiently couples detailed Brownian dynamics simulations with coarser lattice-based models. The ATRM is a generalization of the previously developed Two-Regime Method [Flegg et al., J. R. Soc., Interface 9, 859 (2012)] to multiscale problems which require a dynamic selection of regions where detailed Brownian dynamics simulation is used. Typical applications include a front propagation or spatio-temporal oscillations. In this paper, the ATRM is used for an in-depth study of front propagation in a stochastic reaction-diffusion system which has its mean-field model given in termsmore » of the Fisher equation [R. Fisher, Ann. Eugen. 7, 355 (1937)]. It exhibits a travelling reaction front which is sensitive to stochastic fluctuations at the leading edge of the wavefront. Previous studies into stochastic effects on the Fisher wave propagation speed have focused on lattice-based models, but there has been limited progress using off-lattice (Brownian dynamics) models, which suffer due to their high computational cost, particularly at the high molecular numbers that are necessary to approach the Fisher mean-field model. By modelling only the wavefront itself with the off-lattice model, it is shown that the ATRM leads to the same Fisher wave results as purely off-lattice models, but at a fraction of the computational cost. The error analysis of the ATRM is also presented for a morphogen gradient model.« less

Adjoint method and runaway electron avalanche

DOE PAGES

Liu, Chang; Brennan, Dylan P.; Boozer, Allen H.; ...

2016-12-16

The adjoint method for the study of runaway electron dynamics in momentum space Liu et al (2016 Phys. Plasmas 23 010702) is rederived using the Green's function method, for both the runaway probability function (RPF) and the expected loss time (ELT). The RPF and ELT obtained using the adjoint method are presented, both with and without the synchrotron radiation reaction force. In conclusion, the adjoint method is then applied to study the runaway electron avalanche. Both the critical electric field and the growth rate for the avalanche are calculated using this fast and novel approach.

Molecular Origin of Color Variation in Firefly (Beetle) Bioluminescence: A Chemical Basis for Biological Imaging.

PubMed

Hirano, Takashi

2016-01-01

Firefly shows bioluminescence by "luciferin-luciferase" (L-L) reaction using luciferin, luciferase, ATP and O2. The chemical photon generation by an enzymatic reaction is widely utilized for analytical methods including biological imaging in the life science fields. To expand photondetecting analyses with firefly bioluminescence, it is important for users to understand the chemical basis of the L-L reaction. In particular, the emission color variation of the L-L reaction is one of the distinguishing characteristics for multicolor luciferase assay and in vivo imaging. From the viewpoint of fundamental chemistry, this review explains the recent progress in the studies on the molecular mechanism of emission color variation after showing the outline of the reaction mechanism of the whole L-L reaction. On the basis of the mechanism, the progresses in organic synthesis of luciferin analogs modulating their emission colors are also presented to support further developments of red/near infrared in vivo biological imaging utility of firefly bioluminescence.

Chem I Supplement: Nuclear Synthesis and Identification of New Elements.

ERIC Educational Resources Information Center

Seaborg, Glenn T.

1985-01-01

As background material for a paper on the transuranium elements (SE 537 837), this article reviews: (1) several descriptive terms; (2) nuclear reactions; (3) radioactive decay modes; (4) chemical background; and (5) experimental methods used in this field of research and more broadly in nuclear chemistry. (Author/JN)

A new electromagnetic NDI-technique based on the measurement of source-sample reaction forces

NASA Astrophysics Data System (ADS)

Fitzpatrick, G. L.; Skaugset, R. L.; Shih, W. C. L.

2001-04-01

Faraday's law of induction, Lenz's law, the Lorentz force law and Newton's third law, taken together, insure that sources (e.g., coil sources) of time-dependent electromagnetic fields, and nearby "nonmagnetic" electrical conductors (e.g., aluminum), always experience mutually repulsive (source-conductor) forces. This fact forms the basis for a new method for detecting cracks and corrosion in (aging) multi-layer airframes. The presence of cracks or corrosion (e.g., material thinning) in these structures is observed to reduce (second-harmonic) source-conductor reaction forces.

Prediction of Stereochemistry using Q2MM

PubMed Central

2016-01-01

Conspectus The standard method of screening ligands for selectivity in asymmetric, transition metal-catalyzed reactions requires experimental testing of hundreds of ligands from ligand libraries. This “trial and error” process is costly in terms of time as well as resources and, in general, is scientifically and intellectually unsatisfying as it reveals little about the underlying mechanism behind the selectivity. The accurate computational prediction of stereoselectivity in enantioselective catalysis requires adequate conformational sampling of the selectivity-determining transition state but has to be fast enough to compete with experimental screening techniques to be useful for the synthetic chemist. Although electronic structure calculations are accurate and general, they are too slow to allow for sampling or fast screening of ligand libraries. The combined requirements can be fulfilled by using appropriately fitted transition state force fields (TSFFs) that represent the transition state as a minimum and allow fast conformational sampling using Monte Carlo. Quantum-guided molecular mechanics (Q2MM) is an automated force field parametrization method that generates accurate, reaction-specific TSFFs by fitting the functional form of an arbitrary force field using only electronic structure calculations by minimization of an objective function. A key feature that distinguishes the Q2MM method from many other automated parametrization procedures is the use of the Hessian matrix in addition to geometric parameters and relative energies. This alleviates the known problems of overfitting of TSFFs. After validation of the TSFF by comparison to electronic structure results for a test set and available experimental data, the stereoselectivity of a reaction can be calculated by summation over the Boltzman-averaged relative energies of the conformations leading to the different stereoisomers. The Q2MM method has been applied successfully to perform virtual ligand screens on a range of transition metal-catalyzed reactions that are important from both an industrial and an academic perspective. In this Account, we provide an overview of the continued improvement of the prediction of stereochemistry using Q2MM-derived TSFFs using four examples from different stages of development: (i) Pd-catalyzed allylation, (ii) OsO4-catalyzed asymmetric dihydroxylation (AD) of alkenes, (iii) Rh-catalyzed hydrogenation of enamides, and (iv) Ru-catalyzed hydrogenation of ketones. In the current form, correlation coefficients of 0.8–0.9 between calculated and experimental ee values are typical for a wide range of substrate–ligand combinations, and suitable ligands can be predicted for a given substrate with ∼80% accuracy. Although the generation of a TSFF requires an initial effort and will therefore be most useful for widely used reactions that require frequent screening campaigns, the method allows for a rapid virtual screen of large ligand libraries to focus experimental efforts on the most promising substrate–ligand combinations. PMID:27064579

New developments in high field electron paramagnetic resonance with applications in structural biology

NASA Astrophysics Data System (ADS)

Bennati, Marina; Prisner, Thomas F.

2005-02-01

Recent developments in microwave technologies have led to a renaissance of electron paramagnetic resonance (EPR) due to the implementation of new spectrometers operating at frequencies >=90 GHz. EPR at high fields and high frequencies (HF-EPR) has been established up to THz (very high frequency (VHF) EPR) in continuous wave (cw) operation and up to about 300 GHz in pulsed operation. To date, its most prominent application field is structural biology. This review article first gives an overview of the theoretical basics and the technical aspects of HF-EPR methodologies, such as cw and pulsed HF-EPR, as well as electron nuclear double resonance at high fields (HF-ENDOR). In the second part, the article illustrates different application areas of HF-EPR in studies of protein structure and function. In particular, HF-EPR has delivered essential contributions to disentangling complex spectra of radical cofactors or reaction intermediates in photosynthetic reaction centres, radical enzymes (such as ribonucleotide reductase) and in metalloproteins. Furthermore, HF-EPR combined with site-directed spin labelling in membranes and soluble proteins provides new methods of investigating complex molecular dynamics and intermolecular distances.

Thermo-stoichiometric behavior of aluminum-nickel nanoheater particles fabricated by galvanic replacement reaction

NASA Astrophysics Data System (ADS)

Buckley, Jacqueline L.

2010-03-01

Al-Ni reactive nano-structures are gaining interest for various applications in aerospace, nano-manufacturing, and biomedical fields. However, nano-material behavior can vary from macro-scale. There has been no systematic study of Al-Ni exothermic reaction and intermetallic formation for nano-scale reactants. Therefore, this study aims to investigate deviations from the established Al-Ni phase diagram, with the premise that the intermetallic formation temperatures are expected to be lower for nano-reactants due to higher surface energy. Additionally, it is important to gain better understanding and control of the galvanic replacement reaction (GRR) fabrication method, which, in terms of producing Al-Ni bi-metallic nanoparticles, is a completely novel scheme. With an adapted phase diagram, intermetallic product and heat output of nanoparticles from any given stage of GRR process can be predicted. Al-Ni nanoparticles having ignitable Al-Ni ratios were fabricated via GRR method. Effects of composition and temperature on intermetallic formation were studied by in-situ XRD analysis. Effects of environment and heating rate on the Al-Ni exothermic reaction were also investigated.

Acceleration and sensitivity analysis of lattice kinetic Monte Carlo simulations using parallel processing and rate constant rescaling

NASA Astrophysics Data System (ADS)

Núñez, M.; Robie, T.; Vlachos, D. G.

2017-10-01

Kinetic Monte Carlo (KMC) simulation provides insights into catalytic reactions unobtainable with either experiments or mean-field microkinetic models. Sensitivity analysis of KMC models assesses the robustness of the predictions to parametric perturbations and identifies rate determining steps in a chemical reaction network. Stiffness in the chemical reaction network, a ubiquitous feature, demands lengthy run times for KMC models and renders efficient sensitivity analysis based on the likelihood ratio method unusable. We address the challenge of efficiently conducting KMC simulations and performing accurate sensitivity analysis in systems with unknown time scales by employing two acceleration techniques: rate constant rescaling and parallel processing. We develop statistical criteria that ensure sufficient sampling of non-equilibrium steady state conditions. Our approach provides the twofold benefit of accelerating the simulation itself and enabling likelihood ratio sensitivity analysis, which provides further speedup relative to finite difference sensitivity analysis. As a result, the likelihood ratio method can be applied to real chemistry. We apply our methodology to the water-gas shift reaction on Pt(111).

Theoretical and experimental studies on silica-coated carbon spheres composites

NASA Astrophysics Data System (ADS)

Guo, Xingmei; Liu, Haixing; Shen, Yinghua; Niu, Mei; Yang, Yongzhen; Liu, Xuguang

2013-10-01

In order to prepare carbon-based photonic crystals, first of all, theoretical modeling calculation was used to predict the bandgap characteristics of silica-coated carbon spheres. Then, silica-coated carbon spheres composites were synthesized using tetraethyl orthosilicate as precursor of silica by a sol-gel method combined with Stöber method. Effect of reaction conditions on surface coating of carbon spheres with silica, including the pH, the amount of precursor and reaction time, was emphasized. The morphology and structure of the composites and the effect coating of carbon spheres with silica were characterized by field-emission scanning electron microscopy, high resolution transmission electron microscopy and Fourier-transform infrared spectrometry. The coating ratio of silica was investigated by thermogravimetry. The results show that pH value played an important role in coating reaction, the dosage of the precursor and reaction time had significant effect on coating layer thickness, that is, coating ratio. Carbon spheres coated with silica had good dispersibility and dispersion stability in water and ethanol, which is preconditions of reactivity of carbon spheres in liquid phase and lays the basis for the application of carbon spheres.

Enzymatic mechanisms of biological magnetic sensitivity.

PubMed

Letuta, Ulyana G; Berdinskiy, Vitaly L; Udagawa, Chikako; Tanimoto, Yoshifumi

2017-10-01

Primary biological magnetoreceptors in living organisms is one of the main research problems in magnetobiology. Intracellular enzymatic reactions accompanied by electron transfer have been shown to be receptors of magnetic fields, and spin-dependent ion-radical processes can be a universal mechanism of biological magnetosensitivity. Magnetic interactions in intermediate ion-radical pairs, such as Zeeman and hyperfine (HFI) interactions, in accordance with proposed strict quantum mechanical theory, can determine magnetic-field dependencies of reactions that produce biologically important molecules needed for cell growth. Hyperfine interactions of electrons with nuclear magnetic moments of magnetic isotopes can explain the most important part of biomagnetic sensitivities in a weak magnetic field comparable to the Earth's magnetic field. The theoretical results mean that magnetic-field dependencies of enzymatic reaction rates in a weak magnetic field that can be independent of HFI constant a, if H < a, and are determined by the rate constant of chemical transformations in the enzyme active site. Both Zeeman and HFI interactions predict strong magnetic-field dependence in weak magnetic fields and magnetic-field independence of enzymatic reaction rate constants in strong magnetic fields. The theoretical results can explain the magnetic sensitivity of E. coli cell and demonstrate that intracellular enzymatic reactions are primary magnetoreceptors in living organisms. Bioelectromagnetics. 38:511-521, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Single-drop reactive extraction/extractive reaction with forced convective diffusion and interphase mass transfer

NASA Technical Reports Server (NTRS)

Kleinman, Leonid S.; Red, X. B., Jr.

1995-01-01

An algorithm has been developed for time-dependent forced convective diffusion-reaction having convection by a recirculating flow field within the drop that is hydrodynamically coupled at the interface with a convective external flow field that at infinity becomes a uniform free-streaming flow. The concentration field inside the droplet is likewise coupled with that outside by boundary conditions at the interface. A chemical reaction can take place either inside or outside the droplet, or reactions can take place in both phases. The algorithm has been implemented, and for comparison results are shown here for the case of no reaction in either phase and for the case of an external first order reaction, both for unsteady behavior. For pure interphase mass transfer, concentration isocontours, local and average Sherwood numbers, and average droplet concentrations have been obtained as a function of the physical properties and external flow field. For mass transfer enhanced by an external reaction, in addition to the above forms of results, we present the enhancement factor, with the results now also depending upon the (dimensionless) rate of reaction.

Single-drop reactive extraction/extractive reaction with forced convective diffusion and interphase mass transfer

NASA Technical Reports Server (NTRS)

Kleinman, Leonid S.; Reed, X. B., Jr.

1995-01-01

An algorithm has been developed for the forced convective diffusion-reaction problem for convection inside and outside a droplet by a recirculating flow field hydrodynamically coupled at the droplet interface with an external flow field that at infinity becomes a uniform streaming flow. The concentration field inside the droplet is likewise coupled with that outside by boundary conditions at the interface. A chemical reaction can take place either inside or outside the droplet or reactions can take place in both phases. The algorithm has been implemented and results are shown here for the case of no reaction and for the case of an external first order reaction, both for unsteady behavior. For pure interphase mass transfer, concentration isocontours, local and average Sherwood numbers, and average droplet concentrations have been obtained as a function of the physical properties and external flow field. For mass transfer enhanced by an external reaction, in addition to the above forms of results, we present the enhancement factor, with the results now also depending upon the (dimensionless) rate of reaction.

Reaction of N,N'-dimethylformamide and divalent viologen molecule to generate an organic dopant for molybdenum disulfide

NASA Astrophysics Data System (ADS)

Fukui, A.; Miura, K.; Ichimiya, H.; Tsurusaki, A.; Kariya, K.; Yoshimura, T.; Ashida, A.; Fujimura, N.; Kiriya, D.

2018-05-01

Tuning the carrier concentration is essential for semiconducting materials to apply optoelectronic devices. Molybdenum disulfide (MoS2) is a semiconducting material composed of atomically thin (˜0.7 nm thickness) layers. To dope thin MoS2, instead of using conventional atom/ion injection processes, a surface charge transfer method was successfully applied. In this study, we report a simple preparation method of a molecular dopant applicable to the doping process. The method follows a previous report for producing a molecular dopant, benzyl viologen (BV) which shows electron doping to MoS2. To prepare dopant BV molecules, a reduction process with a commercially available divalent BV by sodium borohydride (NaBH4) is required; however, the reaction requires a large consumption of NaBH4. NaBH4 drastically reacts with the solvent water itself. We found a reaction process of BV in an organic solvent, N,N'-dimethylformamide (DMF), by adding a small amount of water dissolving the divalent BV. The reaction is mild (at room temperature) and is autonomous once DMF comes into contact with the divalent BV aqueous solution. The reaction can be monitored with a UV-Vis spectrometer, and kinetic analysis indicates two reaction steps between divalent/monovalent/neutral viologen isomers. The product was soluble in toluene and did not dissolve in water, indicating it is similar to the reported dopant BV. The synthesized molecule was found to act as a dopant for MoS2 by applying a metal-oxide-semiconductor field-effect-transistor (MOSFET) structure. The process is a general method and applicable to other viologen-related dopants to tune the electronic structure of 2D materials to facilitate generating atomically thin devices.

Moving from Batch to Field Using the RT3D Reactive Transport Modeling System

NASA Astrophysics Data System (ADS)

Clement, T. P.; Gautam, T. R.

2002-12-01

The public domain reactive transport code RT3D (Clement, 1997) is a general-purpose numerical code for solving coupled, multi-species reactive transport in saturated groundwater systems. The code uses MODFLOW to simulate flow and several modules of MT3DMS to simulate the advection and dispersion processes. RT3D employs the operator-split strategy which allows the code solve the coupled reactive transport problem in a modular fashion. The coupling between reaction and transport is defined through a separate module where the reaction equations are specified. The code supports a versatile user-defined reaction option that allows users to define their own reaction system through a Fortran-90 subroutine, known as the RT3D-reaction package. Further a utility code, known as BATCHRXN, allows the users to independently test and debug their reaction package. To analyze a new reaction system at a batch scale, users should first run BATCHRXN to test the ability of their reaction package to model the batch data. After testing, the reaction package can simply be ported to the RT3D environment to study the model response under 1-, 2-, or 3-dimensional transport conditions. This paper presents example problems that demonstrate the methods for moving from batch to field-scale simulations using BATCHRXN and RT3D codes. The first example describes a simple first-order reaction system for simulating the sequential degradation of Tetrachloroethene (PCE) and its daughter products. The second example uses a relatively complex reaction system for describing the multiple degradation pathways of Tetrachloroethane (PCA) and its daughter products. References 1) Clement, T.P, RT3D - A modular computer code for simulating reactive multi-species transport in 3-Dimensional groundwater aquifers, Battelle Pacific Northwest National Laboratory Research Report, PNNL-SA-28967, September, 1997. Available at: http://bioprocess.pnl.gov/rt3d.htm.

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Synchronization criteria for generalized reaction-diffusion neural networks via periodically intermittent control.

PubMed

Gan, Qintao; Lv, Tianshi; Fu, Zhenhua

2016-04-01

In this paper, the synchronization problem for a class of generalized neural networks with time-varying delays and reaction-diffusion terms is investigated concerning Neumann boundary conditions in terms of p-norm. The proposed generalized neural networks model includes reaction-diffusion local field neural networks and reaction-diffusion static neural networks as its special cases. By establishing a new inequality, some simple and useful conditions are obtained analytically to guarantee the global exponential synchronization of the addressed neural networks under the periodically intermittent control. According to the theoretical results, the influences of diffusion coefficients, diffusion space, and control rate on synchronization are analyzed. Finally, the feasibility and effectiveness of the proposed methods are shown by simulation examples, and by choosing different diffusion coefficients, diffusion spaces, and control rates, different controlled synchronization states can be obtained.

Different Relative Orientation of Static and Alternative Magnetic Fields and Cress Roots Direction of Growth Changes Their Gravitropic Reaction

NASA Astrophysics Data System (ADS)

Sheykina, Nadiia; Bogatina, Nina

The following variants of roots location relatively to static and alternative components of magnetic field were studied. At first variant the static magnetic field was directed parallel to the gravitation vector, the alternative magnetic field was directed perpendicular to static one; roots were directed perpendicular to both two fields’ components and gravitation vector. At the variant the negative gravitropysm for cress roots was observed. At second variant the static magnetic field was directed parallel to the gravitation vector, the alternative magnetic field was directed perpendicular to static one; roots were directed parallel to alternative magnetic field. At third variant the alternative magnetic field was directed parallel to the gravitation vector, the static magnetic field was directed perpendicular to the gravitation vector, roots were directed perpendicular to both two fields components and gravitation vector; At forth variant the alternative magnetic field was directed parallel to the gravitation vector, the static magnetic field was directed perpendicular to the gravitation vector, roots were directed parallel to static magnetic field. In all cases studied the alternative magnetic field frequency was equal to Ca ions cyclotron frequency. In 2, 3 and 4 variants gravitropism was positive. But the gravitropic reaction speeds were different. In second and forth variants the gravitropic reaction speed in error limits coincided with the gravitropic reaction speed under Earth’s conditions. At third variant the gravitropic reaction speed was slowed essentially.

A geochemical examination of humidity cell tests

USGS Publications Warehouse

Maest, Ann; Nordstrom, D. Kirk

2017-01-01

Humidity cell tests (HCTs) are long-term (20 to >300 weeks) leach tests that are considered by some to be the among the most reliable geochemical characterization methods for estimating the leachate quality of mined materials. A number of modifications have been added to the original HCT method, but the interpretation of test results varies widely. We suggest that the HCTs represent an underutilized source of geochemical data, with a year-long test generating approximately 2500 individual chemical data points. The HCT concentration peaks and valleys can be thought of as a “chromatogram” of reactions that may occur in the field, whereby peaks in concentrations are associated with different geochemical processes, including sulfate salt dissolution, sulfide oxidation, and dissolution of rock-forming minerals, some of which can neutralize acid. Some of these reactions occur simultaneously, some do not, and geochemical modeling can be used to help distinguish the dominant processes. Our detailed examination, including speciation and inverse modeling, of HCTs from three projects with different geology and mineralization shows that rapid sulfide oxidation dominates over a limited period of time that starts between 40 and 200 weeks of testing. The applicability of laboratory tests results to predicting field leachate concentrations, loads, or rates of reaction has not been adequately demonstrated, although early flush releases and rapid sulfide oxidation rates in HCTs should have some relevance to field conditions. Knowledge of possible maximum solute concentrations is needed to design effective treatment and mitigation approaches. Early flush and maximum sulfide oxidation results from HCTs should be retained and used in environmental models. Factors that complicate the use of HCTs include: sample representation, time for microbial oxidizers to grow, sample storage before testing, geochemical reactions that add or remove constituents, and the HCT results chosen for use in modeling the environmental performance at mine sites. Improved guidance is needed for more consistent interpretation and use of HCT results that rely on identifying: the geochemical processes; the mineralogy, including secondary mineralogy; the available surface area for reactions; and the influence of hydrologic processes on leachate concentrations in runoff, streams, and groundwater.

Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.

PubMed

Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P

2015-01-01

Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Thermal phenomena under microwave field in the organic synthesis processes: Application to the Diels Alder reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saillard, R.; Poux, M.; Audhuy-Peaudecerf, M.

1996-12-31

The influence of the microwave heating on chemical reactions were investigated. The kinetic of the Diels Alder reaction were studied under microwave irradiation at a frequency of 2.45 GHz in a single mode cavity and were compared to the kinetic obtained by a conventional heating. Experiments were carried out in a liquid solvent in order to have a better control of the medium temperature measurement. In a second part, the presence of a catalytic solid phase was introduced. Some thermal fluctuations which are due to an heterogeneity of the electric field were detected in the medium. They reduce the precisionmore » of the results and cause problems of experimental reproducibility. A thermoluminescent material allow a good visualization of these phenomena. In addition, the profiles of the electric field intensity were modelled by a 2D finite elements method in the reactor in the presence of a solvent. Despite the small size of the sample and the use of a monomode cavity which both limited the heterogeneities of the medium temperature, the authors showed a great heterogeneity of the electric field intensity and as a result the heterogeneity of the temperature in their sample. In order to avoid these phenomena which induce a lack of reproducibility, a stirring device was developed. The values of the kinetics obtained under the 2 heating modes with the introduction of the stirring device. So, it induces a good control of the medium temperature. All those investigations prompted the authors to the conclusion that there is no difference between microwave heating and a classical heating in the studied reaction.« less

Reaction Dynamics Following Ionization of Ammonia Dimer Adsorbed on Ice Surface.

PubMed

Tachikawa, Hiroto

2016-09-22

The ice surface provides an effective two-dimensional reaction field in interstellar space. However, how the ice surface affects the reaction mechanism is still unknown. In the present study, the reaction of an ammonia dimer cation adsorbed both on water ice and cluster surface was theoretically investigated using direct ab initio molecular dynamics (AIMD) combined with our own n-layered integrated molecular orbital and molecular mechanics (ONIOM) method, and the results were compared with reactions in the gas phase and on water clusters. A rapid proton transfer (PT) from NH3(+) to NH3 takes place after the ionization and the formation of intermediate complex NH2(NH4(+)) is found. The reaction rate of PT was significantly affected by the media connecting to the ammonia dimer. The time of PT was calculated to be 50 fs (in the gas phase), 38 fs (on ice), and 28-33 fs (on water clusters). The dissociation of NH2(NH4(+)) occurred on an ice surface. The reason behind the reaction acceleration on an ice surface is discussed.

Shining a light on LAMP assays--a comparison of LAMP visualization methods including the novel use of berberine.

PubMed

Fischbach, Jens; Xander, Nina Carolin; Frohme, Marcus; Glökler, Jörn Felix

2015-04-01

The need for simple and effective assays for detecting nucleic acids by isothermal amplification reactions has led to a great variety of end point and real-time monitoring methods. Here we tested direct and indirect methods to visualize the amplification of potato spindle tuber viroid (PSTVd) by loop-mediated isothermal amplification (LAMP) and compared features important for one-pot in-field applications. We compared the performance of magnesium pyrophosphate, hydroxynaphthol blue (HNB), calcein, SYBR Green I, EvaGreen, and berberine. All assays could be used to distinguish between positive and negative samples in visible or UV light. Precipitation of magnesium-pyrophosphate resulted in a turbid reaction solution. The use of HNB resulted in a color change from violet to blue, whereas calcein induced a change from orange to yellow-green. We also investigated berberine as a nucleic acid-specific dye that emits a fluorescence signal under UV light after a positive LAMP reaction. It has a comparable sensitivity to SYBR Green I and EvaGreen. Based on our results, an optimal detection method can be chosen easily for isothermal real-time or end point screening applications.

Using terahertz time-domain spectroscopical technique to monitor cocrystal formation between piracetam and 2,5-dihydroxybenzoic acid.

PubMed

Du, Yong; Xia, Yi; Zhang, Huili; Hong, Zhi

2013-07-01

Far-infrared vibrational absorption of cocrystal formation between 2,5-dihydroxybenzoic acid (2,5-DHBA) and piracetam compounds under solvent evaporation and grinding methods have been investigated using terahertz time-domain spectroscopy (THz-TDS) at room temperature. The experimental results show large difference among absorption spectra of the formed cocrystals and the involved individual parent molecules in 0.20-1.50 THz region, which probably originated from the intra-molecular and inter-molecular hydrogen bonds due to the presence of two hydroxyl groups in 2,5-DHBA and amide moieties in piracetam compound. The THz absorption spectra of two formed cocrystals with different methods are almost identical. With grinding method, the reaction process can be monitored directly from both time-domain and frequency-domain spectra using THz-TDS technique. The results indicate that THz-TDS technology can absolutely offer us a high potential method to identify and characterize the formed cocrystals, and also provide the rich information about their reaction dynamic process involving two or more molecular crystals in situ to better know the corresponding reaction mechanism in pharmaceutical fields. Copyright © 2013 Elsevier B.V. All rights reserved.

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

PubMed Central

2011-01-01

In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV), a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP). We selected an 829 bp fragment of the nucleoprotein (N) gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively. PMID:21352564

Actuation method and apparatus, micropump, and PCR enhancement method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ullakko, Kari; Mullner, Peter; Hampikian, Greg

An actuation apparatus includes at least one magnetic shape memory (MSM) element containing a material configured to expand and/or contract in response to exposure to a magnetic field. Among other things, the MSM element may be configured to pump fluid through a micropump by expanding and/or contracting in response to the magnetic field. The magnetic field may rotate about an axis of rotation and exhibit a distribution having a component substantially perpendicular to the axis of rotation. Further, the magnetic field distribution may include at least two components substantially orthogonal to one another lying in one or more planes perpendicularmore » to the axis of rotation. The at least one MSM element may contain nickel, manganese, and gallium. A polymerase chain reaction (PCR) may be enhanced by contacting a PCR reagent and DNA material with the MSM element.« less

Novel method for immunofluorescence staining of mammalian eggs using non-contact alternating-current electric-field mixing of microdroplets

PubMed Central

Hiromitsu, Shirasawa; Jin, Kumagai; Emiko, Sato; Katsuya, Kabashima; Yukiyo, Kumazawa; Wataru, Sato; Hiroshi, Miura; Ryuta, Nakamura; Hiroshi, Nanjo; Yoshihiro, Minamiya; Yoichi, Akagami; Yukihiro, Terada

2015-01-01

Recently, a new technique was developed for non-catalytically mixing microdroplets. In this method, an alternating-current (AC) electric field is used to promote the antigen–antibody reaction within the microdroplet. Previously, this technique has only been applied to histological examinations of flat structures, such as surgical specimens. In this study, we applied this technique for the first time to immunofluorescence staining of three-dimensional structures, specifically, mammalian eggs. We diluted an antibody against microtubules from 1:1,000 to 1:16,000, and compared the chromatic degree and extent of fading across dilutions. In addition, we varied the frequency of AC electric-field mixing from 5 Hz to 46 Hz and evaluated the effect on microtubule staining. Microtubules were more strongly stained after AC electric-field mixing for only 5 minutes, even when the concentration of primary antibody was 10 times lower than in conventional methods. AC electric-field mixing also alleviated microtubule fading. At all frequencies tested, AC electric-field mixing resulted in stronger microtubule staining than in controls. There was no clear difference in a microtubule staining between frequencies. These results suggest that the novel method could reduce antibody consumption and shorten immunofluorescence staining time. PMID:26477850

New Developments in the Field of Reaction Technology: The Multiparallel Reactor HPMR 50-96

PubMed Central

Allwardt, Arne; Wendler, Christian; Thurow, Kerstin

2005-01-01

Catalytic high-pressure reactions play an important role in classic bulk chemistry. The optimization of common reactions, the search for new and more effective catalysts, and the increasing use of catalytic pressure reactions in the field of drug development call for high-parallel reaction systems. A crucial task of current developments, apart from the parameters of pressure, temperature, and number of reaction chambers, is, in this respect, the systems' integration into complex laboratory automation environments. PMID:18924722

Surface chemistry in photodissociation regions

NASA Astrophysics Data System (ADS)

Esplugues, G. B.; Cazaux, S.; Meijerink, R.; Spaans, M.; Caselli, P.

2016-06-01

Context. The presence of dust can strongly affect the chemical composition of the interstellar medium. We model the chemistry in photodissociation regions (PDRs) using both gas-phase and dust-phase chemical reactions. Aims: Our aim is to determine the chemical compositions of the interstellar medium (gas/dust/ice) in regions with distinct (molecular) gas densities that are exposed to radiation fields with different intensities. Methods: We have significantly improved the Meijerink PDR code by including 3050 new gas-phase chemical reactions and also by implementing surface chemistry. In particular, we have included 117 chemical reactions occurring on grain surfaces covering different processes, such as adsorption, thermal desorption, chemical desorption, two-body reactions, photo processes, and cosmic-ray processes on dust grains. Results: We obtain abundances for different gas and solid species as a function of visual extinction, depending on the density and radiation field. We also analyse the rates of the formation of CO2 and H2O ices in different environments. In addition, we study how chemistry is affected by the presence/absence of ice mantles (bare dust or icy dust) and the impact of considering different desorption probabilities. Conclusions: The type of substrate (bare dust or icy dust) and the probability of desorption can significantly alter the chemistry occurring on grain surfaces, leading to differences of several orders of magnitude in the abundances of gas-phase species, such as CO, H2CO, and CH3OH. The type of substrate, together with the density and intensity of the radiation field, also determine the threshold extinction to form ices of CO2 and H2O. We also conclude that H2CO and CH3OH are mainly released into the gas phase of low, far-ultraviolet illuminated PDRs through chemical desorption upon two-body surface reactions, rather than through photodesorption.

Field Demonstration of a Multiplexed Point-of-Care Diagnostic Platform for Plant Pathogens.

PubMed

Lau, Han Yih; Wang, Yuling; Wee, Eugene J H; Botella, Jose R; Trau, Matt

2016-08-16

Effective disease management strategies to prevent catastrophic crop losses require rapid, sensitive, and multiplexed detection methods for timely decision making. To address this need, a rapid, highly specific and sensitive point-of-care method for multiplex detection of plant pathogens was developed by taking advantage of surface-enhanced Raman scattering (SERS) labeled nanotags and recombinase polymerase amplification (RPA), which is a rapid isothermal amplification method with high specificity. In this study, three agriculturally important plant pathogens (Botrytis cinerea, Pseudomonas syringae, and Fusarium oxysporum) were used to demonstrate potential translation into the field. The RPA-SERS method was faster, more sensitive than polymerase chain reaction, and could detect as little as 2 copies of B. cinerea DNA. Furthermore, multiplex detection of the three pathogens was demonstrated for complex systems such as the Arabidopsis thaliana plant and commercial tomato crops. To demonstrate the potential for on-site field applications, a rapid single-tube RPA/SERS assay was further developed and successfully performed for a specific target outside of a laboratory setting.

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

PubMed Central

2017-01-01

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

Numerical solutions of several reflected shock-wave flow fields with nonequilibrium chemical reactions

NASA Technical Reports Server (NTRS)

Hanson, R. K.; Presley, L. L.; Williams, E. V.

1972-01-01

The method of characteristics for a chemically reacting gas is used in the construction of the time-dependent, one-dimensional flow field resulting from the normal reflection of an incident shock wave at the end wall of a shock tube. Nonequilibrium chemical reactions are allowed behind both the incident and reflected shock waves. All the solutions are evaluated for oxygen, but the results are generally representative of any inviscid, nonconducting, and nonradiating diatomic gas. The solutions clearly show that: (1) both the incident- and reflected-shock chemical relaxation times are important in governing the time to attain steady state thermodynamic properties; and (2) adjacent to the end wall, an excess-entropy layer develops wherein the steady state values of all the thermodynamic variables except pressure differ significantly from their corresponding Rankine-Hugoniot equilibrium values.

A coupled model of transport-reaction-mechanics with trapping. Part I - Small strain analysis

NASA Astrophysics Data System (ADS)

Salvadori, A.; McMeeking, R.; Grazioli, D.; Magri, M.

2018-05-01

A fully coupled model for mass and heat transport, mechanics, and chemical reactions with trapping is proposed. It is rooted in non-equilibrium rational thermodynamics and assumes that displacements and strains are small. Balance laws for mass, linear and angular momentum, energy, and entropy are stated. Thermodynamic restrictions are identified, based on an additive strain decomposition and on the definition of the Helmholtz free energy. Constitutive theory and chemical kinetics are studied in order to finally write the governing equations for the multi-physics problem. The field equations are solved numerically with the finite element method, stemming from a three-fields variational formulation. Three case-studies on vacancies redistribution in metals, hydrogen embrittlement, and the charge-discharge of active particles in Li-ion batteries demonstrate the features and the potential of the proposed model.

An Automated Method of Scanning Probe Microscopy (SPM) Data Analysis and Reactive Site Tracking for Mineral-Water Interface Reactions Observed at the Nanometer Scale

NASA Astrophysics Data System (ADS)

Campbell, B. D.; Higgins, S. R.

2008-12-01

Developing a method for bridging the gap between macroscopic and microscopic measurements of reaction kinetics at the mineral-water interface has important implications in geological and chemical fields. Investigating these reactions on the nanometer scale with SPM is often limited by image analysis and data extraction due to the large quantity of data usually obtained in SPM experiments. Here we present a computer algorithm for automated analysis of mineral-water interface reactions. This algorithm automates the analysis of sequential SPM images by identifying the kinetically active surface sites (i.e., step edges), and by tracking the displacement of these sites from image to image. The step edge positions in each image are readily identified and tracked through time by a standard edge detection algorithm followed by statistical analysis on the Hough Transform of the edge-mapped image. By quantifying this displacement as a function of time, the rate of step edge displacement is determined. Furthermore, the total edge length, also determined from analysis of the Hough Transform, combined with the computed step speed, yields the surface area normalized rate of the reaction. The algorithm was applied to a study of the spiral growth of the calcite(104) surface from supersaturated solutions, yielding results almost 20 times faster than performing this analysis by hand, with results being statistically similar for both analysis methods. This advance in analysis of kinetic data from SPM images will facilitate the building of experimental databases on the microscopic kinetics of mineral-water interface reactions.

Description and evaluation of a peracetic acid air sampling and analysis method.

PubMed

Nordling, John; Kinsky, Owen R; Osorio, Magdalena; Pechacek, Nathan

2017-12-01

Peracetic acid (PAA) is a corrosive chemical with a pungent odor, which is extensively used in occupational settings and causes various health hazards in exposed workers. Currently, there is no US government agency recommended method that could be applied universally for the sampling and analysis of PAA. Legacy methods for determining airborne PAA vapor levels frequently suffered from cross-reactivity with other chemicals, particularly hydrogen peroxide (H 2 O 2 ). Therefore, to remove the confounding factor of cross-reactivity, a new viable, sensitive method was developed for assessment of PAA exposure levels, based on the differential reaction kinetics of PAA with methyl p-tolylsulfide (MTS), relative to H 2 O 2 , to preferentially derive methyl p-tolysulfoxide (MTSO). By quantifying MTSO concentration produced in the liquid capture solution from an air sampler, using an internal standard, and utilizing the reaction stoichiometry of PAA and MTS, the original airborne concentration of PAA is determined. After refining this liquid trap high-performance liquid chromatography (HPLC) method in the laboratory, it was tested in five workplace settings where PAA products were used. PAA levels ranged from the detection limit of 0.013 parts per million (ppm) to 0.4 ppm. The results indicate a viable and potentially dependable method to assess the concentrations of PAA vapors under occupational exposure scenarios, though only a small number of field measurements were taken while field testing this method. However, the low limit of detection and precision offered by this method makes it a strong candidate for further testing and validation to expand the uses of this liquid trap HPLC method.

Magnetic Field Noise Changes Effect of Combined Magnetic Field on Gravitropic Reaction of Cress Roots.

NASA Astrophysics Data System (ADS)

Bogatina, Nina; Kordyum, Elizabeth; Sheykina, Nadezhda

The gravitropic reaction of cress roots in combined magnetic field was studied in details. It was shown that the negative roots gravitropism observed at the frequency of alternating component of combined magnetic field adjusted to the Ca ion cyclotron frequency could be observed only at Nayquist magnetic field noise level under 5 nT/Hz. While the magnetic noise level was increasing the negative gravitropism was disappearing. The inhibition of gravitropic reaction was observed in all cases. The effect was accompanied by the changes in the noise spectrum generated by cress roots.

Kinetic calorimetry in the study of the mechanism of low-temperature chemical reactions

NASA Astrophysics Data System (ADS)

Barkalov, I. M.; Kiryukhin, D. P.

Chemical reactions are always followed by a change in the reacting system enthalpy, hence, calorimetry as a method of enthalpy and heat capacity measuring is a universal and, sometimes, even the only possible way of studying chemical reaction kinetics. Throughout its long history, the calorimeter, having preserved the positions of the main method of thermodynamic studies, has conquered a new field of application: that of kinetic study of chemical reactions. The advantages and disadvantages of the kinetic calorimeter are now obvious. First, the advantages are: (1) the possibility of measuring the rate of a chemical reaction without any special requirements being imposed on the reaction medium (solid, viscous, multicomponent systems); (2) the high efficiency: a large volume of kinetic information in one experiment and a non-destructive character of changes; (3) the possibility of measuring directly in the field of ionizing radiation (γ-radiation, accelerated electrons) and light; and (4) recording of the chemical conversion directly at the time of its occurrence. The disadvantages of this method are: (1) the high inertia of standard calorimeter systems (τC⋍102-103S), which restricts the possibilities of studying fast processes; and (2) the complexity of the correct organization of the calorimeter experiment when the parameters of the process are changed (overheating in the sample, conversion of the process to explosive and auto wave regimens). One of the oldest and most universal methods of studying the mechanism of chemical reactions, calorimetry, is now passing through a period of turbulent development due to the advances in electronics and computerization. The wide variety of types of calorimeter set-ups and the large assortment of measurement schemes in the currently described methods complicate the experimental selection of the necessary instrument rather than facilitate it. The basic principles of the method, the types of calorimeters, and the measuring schemes are described [1-5]. However, despite the high working characteristics of modern calorimeters (Perkin-Elmer, Du Pont, LKB, etc.), all of them have one principal disadvantage: a cell with a sample is placed in them at room temperature. In cryochemical investigation, when the sample has metastable formations, the loading is made `from nitrogen to nitrogen', i.e. the sample prepared at 77 K should be loaded into a calorimeter at 77 K. Besides, the existing installations do not allow measurements at the temperatures <110K. For this reason, the Laboratory of Cryochemistry and Radiation Chemistry at the Institute of Chemical Physics in Chernogolovka has created original calorimetric techniques which allow: (1) the carrying out phase analysis and the determination of the main thermodynamic characteristic of individual substances and complicated systems in the temperature range 5 300 K. Sample loading can be conducted at 77 K that allows us to study the systems containing: tetrafiuoroethylene, hexafluoropropylene, ethylene, carbon monoxide, nitrogen, methane, hydrogen, oxygen, ozone, formaldehyde and many other gaseous substances; (2) the study of the dynamics of chemical reactions and to measure the main kinetic parameters of the processes-the elementary rate constants and the activation energies. The experiment can be conducted both under direct action of radiation and UV light and in the post-effect mode [5,6].

Mixed Redox Catalytic Destruction of Chlorinated Solvents in Soils and Groundwater: From the Laboratory to the Field

PubMed Central

Gao, Song; Rupp, Erik; Bell, Suzanne; Willinger, Martin; Foley, Theresa; Barbaris, Brian; Sáez, A. Eduardo; Arnold, Robert G.; Betterton, Eric

2010-01-01

A new thermocatalytic method to destroy chlorinated solvents has been developed in the laboratory and tested in a pilot field study. The method employs a conventional Pt/Rh catalyst on a ceramic honeycomb. Reactions proceed at moderate temperatures in the simultaneous presence of oxygen and a reductant (mixed redox conditions) to minimize catalyst deactivation. In the laboratory, stable operation with high conversions (above 90% at residence times shorter than 1 s) for perchloroethylene (PCE) is achieved using hydrogen as the reductant. A molar ratio of H2/O2 = 2 yields maximum conversions; the temperature required to produce maximum conversions is sensitive to influent PCE concentration. When a homologous series of aliphatic alkanes is used to replace hydrogen as the reductant, the resultant mixed redox conditions also produce high PCE conversions. It appears that the dissociation energy of the C–H bond in the respective alkane molecule is a strong determinant of the activation energy, and therefore the reaction rate, for PCE conversion. This new method was employed in a pilot field study in Tucson, Arizona. The mixed redox system was operated semicontinuously for 240 days with no degradation of catalyst performance and complete destruction of PCE and trichloroethylene in a soil vapor extraction gas stream. Use of propane as the reductant significantly reduced operating costs. Mixed redox destruction of chlorinated solvents provides a potentially viable alternative to current soil and groundwater remediation technologies. PMID:18991945

Symmetry and asymmetry of reaction time and body tissue composition of upper limbs in young female basketball players.

PubMed

Poliszczuk, Tatiana; Mańkowska, Maja; Poliszczuk, Dmytro; Wiśniewski, Andrzej

2013-01-01

The role of psychomotor abilities and their relationship to the morphofunctional characteristics of athletes is becoming more and more emphasized in studies on the subject, especially for disciplines that require athletes to notice and to respond to signals originating in dynamically changing conditions. At the same time, athletes who perform symmetrically are more effective and less likely to sustain an injury through unilateral strain. Assessment of the degree of symmetry and asymmetry of reaction time to stimuli in the central and peripheral visual fields, and assessment of body composition of upper limbs in young female basketball players. Participants of the study comprised 17 young female basketball players. Their average age was 18.11-0.8 years. On average, they had been training basketball for 6.83-1.75 years. Body tissue composition was measured using the bioelectrical impedance method. The degree of symmetry and asymmetry of reaction time to signals in the central and peripheral visual fields were measured using the Reaction Test (RT-S1) and a modified Peripheral Perception (PP) test within the Vienna Test System. An analysis of body tissue composition of the upper right and upper left limbs found an asymmetry (p<0.01 and p<0.05) in the FAT [%], FAT MASS [kg], and FFM [kg] parameters. The values of these parameters were higher for the non-dominant arm. No statistically significant differences were found in reaction time and motor time for the dominant and non-dominant arm. A correlation was found between motor time and the FFM [kg] (r=-0.62; p<0.05) and PMM [kg] (r=-0.63; p<0.05) parameters. A significant asymmetry was found in the body tissue composition of the upper limbs. Asymmetry of reaction time was found only for signals in the peripheral visual field.

Electrostatics of proteins in dielectric solvent continua. I. An accurate and efficient reaction field description

NASA Astrophysics Data System (ADS)

Bauer, Sebastian; Mathias, Gerald; Tavan, Paul

2014-03-01

We present a reaction field (RF) method which accurately solves the Poisson equation for proteins embedded in dielectric solvent continua at a computational effort comparable to that of an electrostatics calculation with polarizable molecular mechanics (MM) force fields. The method combines an approach originally suggested by Egwolf and Tavan [J. Chem. Phys. 118, 2039 (2003)] with concepts generalizing the Born solution [Z. Phys. 1, 45 (1920)] for a solvated ion. First, we derive an exact representation according to which the sources of the RF potential and energy are inducible atomic anti-polarization densities and atomic shielding charge distributions. Modeling these atomic densities by Gaussians leads to an approximate representation. Here, the strengths of the Gaussian shielding charge distributions are directly given in terms of the static partial charges as defined, e.g., by standard MM force fields for the various atom types, whereas the strengths of the Gaussian anti-polarization densities are calculated by a self-consistency iteration. The atomic volumes are also described by Gaussians. To account for covalently overlapping atoms, their effective volumes are calculated by another self-consistency procedure, which guarantees that the dielectric function ɛ(r) is close to one everywhere inside the protein. The Gaussian widths σi of the atoms i are parameters of the RF approximation. The remarkable accuracy of the method is demonstrated by comparison with Kirkwood's analytical solution for a spherical protein [J. Chem. Phys. 2, 351 (1934)] and with computationally expensive grid-based numerical solutions for simple model systems in dielectric continua including a di-peptide (Ac-Ala-NHMe) as modeled by a standard MM force field. The latter example shows how weakly the RF conformational free energy landscape depends on the parameters σi. A summarizing discussion highlights the achievements of the new theory and of its approximate solution particularly by comparison with so-called generalized Born methods. A follow-up paper describes how the method enables Hamiltonian, efficient, and accurate MM molecular dynamics simulations of proteins in dielectric solvent continua.

Electrostatics of proteins in dielectric solvent continua. I. An accurate and efficient reaction field description.

PubMed

Bauer, Sebastian; Mathias, Gerald; Tavan, Paul

2014-03-14

We present a reaction field (RF) method which accurately solves the Poisson equation for proteins embedded in dielectric solvent continua at a computational effort comparable to that of an electrostatics calculation with polarizable molecular mechanics (MM) force fields. The method combines an approach originally suggested by Egwolf and Tavan [J. Chem. Phys. 118, 2039 (2003)] with concepts generalizing the Born solution [Z. Phys. 1, 45 (1920)] for a solvated ion. First, we derive an exact representation according to which the sources of the RF potential and energy are inducible atomic anti-polarization densities and atomic shielding charge distributions. Modeling these atomic densities by Gaussians leads to an approximate representation. Here, the strengths of the Gaussian shielding charge distributions are directly given in terms of the static partial charges as defined, e.g., by standard MM force fields for the various atom types, whereas the strengths of the Gaussian anti-polarization densities are calculated by a self-consistency iteration. The atomic volumes are also described by Gaussians. To account for covalently overlapping atoms, their effective volumes are calculated by another self-consistency procedure, which guarantees that the dielectric function ε(r) is close to one everywhere inside the protein. The Gaussian widths σ(i) of the atoms i are parameters of the RF approximation. The remarkable accuracy of the method is demonstrated by comparison with Kirkwood's analytical solution for a spherical protein [J. Chem. Phys. 2, 351 (1934)] and with computationally expensive grid-based numerical solutions for simple model systems in dielectric continua including a di-peptide (Ac-Ala-NHMe) as modeled by a standard MM force field. The latter example shows how weakly the RF conformational free energy landscape depends on the parameters σ(i). A summarizing discussion highlights the achievements of the new theory and of its approximate solution particularly by comparison with so-called generalized Born methods. A follow-up paper describes how the method enables Hamiltonian, efficient, and accurate MM molecular dynamics simulations of proteins in dielectric solvent continua.

The Next-Generation PCR-Based Quantification Method for Ambient Waters: Digital PCR.

PubMed

Cao, Yiping; Griffith, John F; Weisberg, Stephen B

2016-01-01

Real-time quantitative PCR (qPCR) is increasingly being used for ambient water monitoring, but development of digital polymerase chain reaction (digital PCR) has the potential to further advance the use of molecular techniques in such applications. Digital PCR refines qPCR by partitioning the sample into thousands to millions of miniature reactions that are examined individually for binary endpoint results, with DNA density calculated from the fraction of positives using Poisson statistics. This direct quantification removes the need for standard curves, eliminating the labor and materials associated with creating and running standards with each batch, and removing biases associated with standard variability and mismatching amplification efficiency between standards and samples. Confining reactions and binary endpoint measurements to small partitions also leads to other performance advantages, including reduced susceptibility to inhibition, increased repeatability and reproducibility, and increased capacity to measure multiple targets in one analysis. As such, digital PCR is well suited for ambient water monitoring applications and is particularly advantageous as molecular methods move toward autonomous field application.

Numerical simulations of turbulent jet ignition and combustion

NASA Astrophysics Data System (ADS)

Validi, Abdoulahad; Irannejad, Abolfazl; Jaberi, Farhad

2013-11-01

The ignition and combustion of a homogeneous lean hydrogen-air mixture by a turbulent jet flow of hot combustion products injected into a colder gas mixture are studied by a high fidelity numerical model. Turbulent jet ignition can be considered as an efficient method for starting and controlling the reaction in homogeneously charged combustion systems used in advanced internal combustion and gas turbine engines. In this work, we study in details the physics of turbulent jet ignition in a fundamental flow configuration. The flow and combustion are modeled with the hybrid large eddy simulation/filtered mass density function (LES/FMDF) approach, in which the filtered form the compressible Navier-Stokes equations are solved with a high-order finite difference scheme for the turbulent velocity and the FMDF transport equations are solved with a Lagrangian stochastic method to obtain the scalar (temperature and species mass fractions) field. The hydrogen oxidation is described by a detailed reaction mechanism with 37 elementary reactions and 9 species.

Kinetic Methods for Understanding Linker Exchange in Metal-Organic Frameworks

NASA Astrophysics Data System (ADS)

Morabito, Joseph V.

Exchange reactions have enabled a new level of control in the rational, stepwise preparation of metal-organic framework (MOF) materials. However, their full potential is limited by a lack of understanding of the molecular mechanisms by which they occur. This dissertation describes our efforts to understand this important class of reactions in two parts. The first reports our use of a linker exchange process to encapsulate guest molecules larger than the limiting pore aperture of the MOF. The concept is demonstrated, along with evidence for guest encapsulation and its relation to a dissociative linker exchange process. The second part describes our development of the first quantitative kinetic method for studying MOF linker exchange reactions and our application of this method to understand the solvent dependence of the reaction of ZIF-8 with imidazole. This project involved the collection of the largest set of rate data available on any MOF linker exchange reaction. The combination of this dataset with small molecule encapsulation experiments allowed us to formulate a mechanistic model that could account for all the observed kinetic and structural data. By comparison with the kinetic behavior of complexes in solution, we were able to fit the kinetic behavior of ZIF-8 into the broader family of coordination compounds. Aside from the specific use that our kinetic data may have in predicting the reactivity of ZIF linker exchange, we hope that the conceptual bridges made between MOFs and related metal?organic compounds can help reveal underlying patterns in behavior and advance the field.

Three dimensional radiative flow of magnetite-nanofluid with homogeneous-heterogeneous reactions

NASA Astrophysics Data System (ADS)

Hayat, Tasawar; Rashid, Madiha; Alsaedi, Ahmed

2018-03-01

Present communication deals with the effects of homogeneous-heterogeneous reactions in flow of nanofluid by non-linear stretching sheet. Water based nanofluid containing magnetite nanoparticles is considered. Non-linear radiation and non-uniform heat sink/source effects are examined. Non-linear differential systems are computed by Optimal homotopy analysis method (OHAM). Convergent solutions of nonlinear systems are established. The optimal data of auxiliary variables is obtained. Impact of several non-dimensional parameters for velocity components, temperature and concentration fields are examined. Graphs are plotted for analysis of surface drag force and heat transfer rate.

Esculin hydrolysis by Gram positive bacteria. A rapid test and it's comparison with other methods.

PubMed

Qadri, S M; Smith, J C; Zubairi, S; DeSilva, M I

1981-01-01

A number of bacteria hydrolyze esculin enzymatically to esculetin. This characteristic is used by taxonomists and clinical microbiologists in the differentiation and identification of bacteria, especially to distinguish Lance-field group D streptococci from non-group D organisms and Listeria monocytogenes from morphologically similar Erysipelothrix rhusipoathiae and diphtheroids. Conventional methods used for esculin hydrolysis require 4--48 h for completion. We developed and evaluated a medium which gives positive results more rapidly. The 2,330 isolates used in this study consisted of 1,680 esculin positive and 650 esculin negative organisms. The sensitivity and specificity of this method were compared with the PathoTec esculin hydrolysis strip and the procedure of Vaughn and Levine (VL). Of the 1,680 esculin positive organisms, 97% gave positive reactions within 30 minutes with the rapid test whereas PathoTec required 3--4 h incubation for the same number of organisms to yield a positive reaction.

Simple glucose reduction route for one-step synthesis of copper nanofluids

NASA Astrophysics Data System (ADS)

Shenoy, U. Sandhya; Shetty, A. Nityananda

2014-01-01

One-step method has been employed in the synthesis of copper nanofluids. Copper nitrate is reduced by glucose in the presence of sodium lauryl sulfate. The synthesized particles are characterized by X-ray diffraction technique for the phase structure; electron diffraction X-ray analysis for chemical composition; transmission electron microscopy and field emission scanning electron microscopy for the morphology; Fourier-transform infrared spectroscopy and ultraviolet-visible spectroscopy for the analysis of ingredients of the solution. Thermal conductivity, sedimentation and rheological measurements have also been carried out. It is found that the reaction parameters have considerable effect on the size of the particle formed and rate of the reaction. The techniques confirm that the synthesized particles are copper. The reported method showed promising increase in the thermal conductivity of the base fluid and is found to be reliable, simple and cost-effective method for preparing heat transfer fluids with higher stability.

Calibration of an analyzing magnet using the 12C(d, p0)13C nuclear reaction with a thick carbon target

NASA Astrophysics Data System (ADS)

Andrade, E.; Canto, C. E.; Rocha, M. F.

2017-09-01

The absolute energy of an ion beam produced by an accelerator is usually determined by an electrostatic or magnetic analyzer, which in turn must be calibrated. Various methods for accelerator energy calibration are extensively reported in the literature, like nuclear reaction resonances, neutron threshold, and time of flight, among others. This work reports on a simple method to calibrate the magnet associated to a vertical 5.5 MV Van de Graaff accelerator. The method is based on bombarding with deuteron beams a thick carbon target and measuring with a surface barrier detector the particle energy spectra produced. The analyzer magnetic field is measured for each spectrum and the beam energy is deduced by the best fit of the simulation of the spectrum with the SIMNRA code that includes 12C(d,p0)13C nuclear cross sections.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

Thermal quantum time-correlation functions from classical-like dynamics

NASA Astrophysics Data System (ADS)

Hele, Timothy J. H.

2017-07-01

Thermal quantum time-correlation functions are of fundamental importance in quantum dynamics, allowing experimentally measurable properties such as reaction rates, diffusion constants and vibrational spectra to be computed from first principles. Since the exact quantum solution scales exponentially with system size, there has been considerable effort in formulating reliable linear-scaling methods involving exact quantum statistics and approximate quantum dynamics modelled with classical-like trajectories. Here, we review recent progress in the field with the development of methods including centroid molecular dynamics , ring polymer molecular dynamics (RPMD) and thermostatted RPMD (TRPMD). We show how these methods have recently been obtained from 'Matsubara dynamics', a form of semiclassical dynamics which conserves the quantum Boltzmann distribution. We also apply the Matsubara formalism to reaction rate theory, rederiving t → 0+ quantum transition-state theory (QTST) and showing that Matsubara-TST, like RPMD-TST, is equivalent to QTST. We end by surveying areas for future progress.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

USGS Publications Warehouse

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

A new method for solving the quantum hydrodynamic equations of motion: application to two-dimensional reactive scattering.

PubMed

Pauler, Denise K; Kendrick, Brian K

2004-01-08

The de Broglie-Bohm hydrodynamic equations of motion are solved using a meshless method based on a moving least squares approach and an arbitrary Lagrangian-Eulerian frame of reference. A regridding algorithm adds and deletes computational points as needed in order to maintain a uniform interparticle spacing, and unitary time evolution is obtained by propagating the wave packet using averaged fields. The numerical instabilities associated with the formation of nodes in the reflected portion of the wave packet are avoided by adding artificial viscosity to the equations of motion. The methodology is applied to a two-dimensional model collinear reaction with an activation barrier. Reaction probabilities are computed as a function of both time and energy, and are in excellent agreement with those based on the quantum trajectory method. (c) 2004 American Institute of Physics

Taking the plunge: chemical reaction dynamics in liquids.

PubMed

Orr-Ewing, Andrew J

2017-12-11

The dynamics of chemical reactions in liquid solutions are now amenable to direct study using ultrafast laser spectroscopy techniques and advances in computer simulation methods. The surrounding solvent affects the chemical reaction dynamics in numerous ways, which include: (i) formation of complexes between reactants and solvent molecules; (ii) modifications to transition state energies and structures relative to the reactants and products; (iii) coupling between the motions of the reacting molecules and the solvent modes, and exchange of energy; (iv) solvent caging of reactants and products; and (v) structural changes to the solvation shells in response to the changing chemical identity of the solutes, on timescales which may be slower than the reactive events. This article reviews progress in the study of bimolecular chemical reaction dynamics in solution, concentrating on reactions which occur on ground electronic states. It illustrates this progress with reference to recent experimental and computational studies, and considers how the various ways in which a solvent affects the chemical reaction dynamics can be unravelled. Implications are considered for research in fields such as mechanistic synthetic chemistry.

On Study of Application of Micro-reactor in Chemistry and Chemical Field

NASA Astrophysics Data System (ADS)

Zhang, Yunshen

2018-02-01

Serving as a micro-scale chemical reaction system, micro-reactor is characterized by high heat transfer efficiency and mass transfer, strictly controlled reaction time and good safety performance; compared with the traditional mixing reactor, it can effectively shorten reaction time by virtue of these advantages and greatly enhance the chemical reaction conversion rate. However, problems still exist in the process where micro-reactor is used for production in chemistry and chemical field, and relevant researchers are required to optimize and perfect the performance of micro-reactor. This paper analyzes specific application of micro-reactor in chemistry and chemical field.

[Effect of air-electric fields on driving and reaction patterns. Test subjects in the car driving simulator (author's transl)].

PubMed

Anselm, D; Danner, M; Kirmaier, N; König, H L; Müller-Limmroth, W; Reis, A; Schauerte, W

1977-06-10

In the relevant frequency range of about 10 Hertz cars can be considered very largely as Faraday cages and consequently as screens against air-electric fields. This may have a negative influence on driving and reaction patterns as a result. In an extensive investigation 48 subjects in a driving simulator were exposed to definite artificially produced air-electric fields. The self-rating of the performance and concentration of the subjects, reaction times and driving errors were determined. While the reaction times remained practically constant, the driving behavior of the subjects improved.

Magnetic field amplification by the r-mode instability

NASA Astrophysics Data System (ADS)

Chugunov, A. I.; Friedman, J. L.; Lindblom, L.; Rezzolla, L.

2017-12-01

We discuss the magnetic field enhancement by unstable r-modes (driven by the gravitational radiation reaction force) in rotating stars. In the absence of a magnetic field, gravitational radiation exponentially increases the r-mode amplitude α, and accelerates differential rotation (secular motion of fluid elements). For a magnetized star, differential rotation enhances the magnetic field energy. Rezzolla et al (2000-2001) argued that if the magnetic energy grows faster than the gravitational radiation reaction force pumps energy into the r-modes, then the r-mode instability is suppressed. Chugunov (2015) demonstrated that without gravitational radiation, differential rotation can be treated as a degree of freedom decoupled from the r-modes and controlled by the back reaction of the magnetic field. In particular, the magnetic field windup does not damp r-modes. Here we discuss the effect of the back reaction of the magnetic field on differential rotation of unstable r-modes, and show that it limits the generated magnetic field and the magnetic energy growth rate preventing suppression of the r-mode instability by magnetic windup at low saturation amplitudes, α ≪ 1, predicted by current models.

Organized one dimensional nanomaterials: From preparations to applications

NASA Astrophysics Data System (ADS)

Wen, Xiaogang

This thesis is mainly concerned with the development of organized one dimensional (1D) nanomaterials and their applications. We have synthesized Ag2S, Cu2S nanowires, Fe2O3 nanobelt and nanowire arrays and ZnO nanobelt arrays from corresponding metal substrate respectively via gas solid reaction methods under different growth conditions. The effect of various parameters including temperature, reaction time, composition of gas, surface pre-oxidation, size of source materials etc. on the growth of metal oxide/sulfide 1D nanostructure have been studied systemically. The size and morphology of these 1D nanomaterials could be rationally controlled by adjusting the growth conditions. A tip growth mechanism has been confirmed based our results. The properties including PL, Raman, field effect transistors, and field emission of these materials have been measured. Cu(OH)2 nanoribbons have been synthesized by a solution solid reaction method using Cu and Cu2S nanowires as precursors. Cu(OH) 2 nanoribbons can form well-aligned arrays on Cu substrate. Low temperature facilitate the formation of Cu(OH)2 nanoribbon arrays. Reaction conditions affect the morphology, crystal structure, even composition of the products much. CuO nanorod arrays of several nm in diameter could be synthesis in changed condition. Cu(OH)2 nanoribbon arrays are good sacrifice template for synthesizing other Cu-based 1D nanomaterials. It has been converted to CuO, Cu2O, Cu8S9, Cu etc. 1D nanostructure through different physical and chemical reaction process. Au/Cu2S core/sheath nanowires have been synthesized in solution phase via a simple template-induced redox deposition process, after removing the Cu2S template, Au nanotubes have been formed. The photoelectrochemistry (PEC) properties of it have been studied. Ag dendritic nanostructures have been prepared via solution reaction. We have revealed that the stem, branch, and sub-branch grow along <100>, <111> and <100> directions, respectively. Such a preferential growth pattern along <100> and <111> alternately lead to the formation of the Ag nanodendrites. In another development, we have synthesized unltrathin Zn nanowires (<5nm) by a vapor transport method. Small molecules are induced into the gas phase as capping reagents. In this process, the small molecules serve as capping reagents or templates to confine the lateral growth and facilitate the formation of ultrathin 1D nanostructures. (Abstract shortened by UMI.)

Combined Uncertainty and A-Posteriori Error Bound Estimates for CFD Calculations: Theory and Implementation

NASA Technical Reports Server (NTRS)

Barth, Timothy J.

2014-01-01

Simulation codes often utilize finite-dimensional approximation resulting in numerical error. Some examples include, numerical methods utilizing grids and finite-dimensional basis functions, particle methods using a finite number of particles. These same simulation codes also often contain sources of uncertainty, for example, uncertain parameters and fields associated with the imposition of initial and boundary data,uncertain physical model parameters such as chemical reaction rates, mixture model parameters, material property parameters, etc.

Systems biology approaches for identifying adverse drug reactions and elucidating their underlying biological mechanisms.

PubMed

Boland, Mary Regina; Jacunski, Alexandra; Lorberbaum, Tal; Romano, Joseph D; Moskovitch, Robert; Tatonetti, Nicholas P

2016-01-01

Small molecules are indispensable to modern medical therapy. However, their use may lead to unintended, negative medical outcomes commonly referred to as adverse drug reactions (ADRs). These effects vary widely in mechanism, severity, and populations affected, making ADR prediction and identification important public health concerns. Current methods rely on clinical trials and postmarket surveillance programs to find novel ADRs; however, clinical trials are limited by small sample size, whereas postmarket surveillance methods may be biased and inherently leave patients at risk until sufficient clinical evidence has been gathered. Systems pharmacology, an emerging interdisciplinary field combining network and chemical biology, provides important tools to uncover and understand ADRs and may mitigate the drawbacks of traditional methods. In particular, network analysis allows researchers to integrate heterogeneous data sources and quantify the interactions between biological and chemical entities. Recent work in this area has combined chemical, biological, and large-scale observational health data to predict ADRs in both individual patients and global populations. In this review, we explore the rapid expansion of systems pharmacology in the study of ADRs. We enumerate the existing methods and strategies and illustrate progress in the field with a model framework that incorporates crucial data elements, such as diet and comorbidities, known to modulate ADR risk. Using this framework, we highlight avenues of research that may currently be underexplored, representing opportunities for future work. © 2015 Wiley Periodicals, Inc.

A Luenberger observer for reaction-diffusion models with front position data

NASA Astrophysics Data System (ADS)

Collin, Annabelle; Chapelle, Dominique; Moireau, Philippe

2015-11-01

We propose a Luenberger observer for reaction-diffusion models with propagating front features, and for data associated with the location of the front over time. Such models are considered in various application fields, such as electrophysiology, wild-land fire propagation and tumor growth modeling. Drawing our inspiration from image processing methods, we start by proposing an observer for the eikonal-curvature equation that can be derived from the reaction-diffusion model by an asymptotic expansion. We then carry over this observer to the underlying reaction-diffusion equation by an ;inverse asymptotic analysis;, and we show that the associated correction in the dynamics has a stabilizing effect for the linearized estimation error. We also discuss the extension to joint state-parameter estimation by using the earlier-proposed ROUKF strategy. We then illustrate and assess our proposed observer method with test problems pertaining to electrophysiology modeling, including with a realistic model of cardiac atria. Our numerical trials show that state estimation is directly very effective with the proposed Luenberger observer, while specific strategies are needed to accurately perform parameter estimation - as is usual with Kalman filtering used in a nonlinear setting - and we demonstrate two such successful strategies.

Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

PubMed

Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

1994-02-01

We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

Temperature field calculation with allowance for heat of chemical reactions under electroexplosion nickel plating of aluminum

NASA Astrophysics Data System (ADS)

Romanov, Denis A.; Semina, Olga A.; Stepikov, Maksim A.; Gromov, Victor E.

2017-01-01

The analysis of stress-strained state at the boundary «faced surface layer - substrate» is performed by methods of elasticity theory of inhomogeneous media, on exposure to the load distributed in a circle. The fundamental aspects of Kelvin - Helmholtz and Richtmayer - Meshkov instabilities are considered. The following methods are used for the research. The analytical method of solution is used for finding the temperature distribution of substrate and coating material as well as distribution of speed of material motion in deposition of the coating. Finite element method is required in accounting for the parameters of convective mixing. For the analysis of the proposed thickness and dispersion of the coating the concepts of hydrodynamic Kelvin - Helmholtz and Richtmayer - Meshkov instabilities are used. Using the mass, energy and momentum conservation laws, with allowance for the possible exothermal reactions, the system of equations of the mathematical model of electroexplosion synthesis on the basis of thermoreacting components of Ni-Al system is formulated. The degree of effect of model's parameters on dispersion and thickness of the coating is determined. The comparison of the modeling and experimental data is carried out. It is established that the due regard to the thermal effect of chemical reaction increases considerably the time of existence of the reacting elements in the liquid state and it facilitates the participation of the entire nickel in the reaction. The increased time of heat effect enables the other processes to occur more completely.

Pre-recombination quenching of the radiation induced fluorescence as the approach to study kinetics of ion-molecular reactions

NASA Astrophysics Data System (ADS)

Borovkov, V. I.; Ivanishko, I. S.

2011-04-01

This study deals with the geminate ion recombination in the presence of bulk scavengers, that is the so-called scavenger problem, as well as with the effect of the scavenging reaction on the radiation-induced recombination fluorescence. Borovkov and Velizhanin (2004) have proposed a method to determine the rate constant of the bulk reaction between neutral scavengers and one of the geminate ions if the ion-molecular reaction prevented the formation of electronically excited states upon recombination involving a newly formed ion. If such pre-recombination quenching of the radiation-induced fluorescence took place, it manifested itself as a progressive decrease in the decay of the fluorescence intensity. The relative change in the fluorescence decay as caused by the scavengers was believed to be closely related to the kinetics of the scavenging reaction. The goal of the present study is to support this method, both computationally and experimentally because there are two factors, which cast doubt on the intuitively obvious approach to the scavenger problem: spatial correlations between the particles involved and the drift of the charged reagent in the electric field of its geminate partner. Computer simulation of geminate ions recombination with an explicit modeling of the motion trajectories of scavengers has been performed for media of low dielectric permittivity, i.e. for the maximal Coulomb interaction between the ions. The simulation has shown that upon continuous diffusion of the particles involved, the joint effect of the two above factors can be considered as insignificant with a high accuracy. Besides, it is concluded then that the method of pre-recombination quenching could be applied to study parallel and consecutive reactions where the yields of excited states in the reaction pathways are different with the use of very simple analytical relations of the formal chemical kinetics. The conclusion has been confirmed experimentally by the example of the reactions of electron transfer from the diphenylacetylene radical anion to dibromoethane and hexafluorobenzene in n-dodecane solutions.

Stability of the discretization of the electron avalanche phenomenon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Villa, Andrea, E-mail: andrea.villa@rse-web.it; Barbieri, Luca, E-mail: luca.barbieri@rse-web.it; Gondola, Marco, E-mail: marco.gondola@rse-web.it

2015-09-01

The numerical simulation of the discharge inception is an active field of applied physics with many industrial applications. In this work we focus on the drift-reaction equation that describes the electron avalanche. This phenomenon is one of the basic building blocks of the streamer model. The main difficulty of the electron avalanche equation lies in the fact that the reaction term is positive when a high electric field is applied. It leads to exponentially growing solutions and this has a major impact on the behavior of numerical schemes. We analyze the stability of a reference finite volume scheme applied tomore » this latter problem. The stability of the method may impose a strict mesh spacing, therefore a proper stabilized scheme, which is stable whatever spacing is used, has been developed. The convergence of the scheme is treated as well as some numerical experiments.« less

Exploitation of the complexation reaction of ortho-dihydroxylated anthocyanins with aluminum(III) for their quantitative spectrophotometric determination in edible sources.

PubMed

Bernal, Freddy A; Orduz-Diaz, Luisa L; Coy-Barrera, Ericsson

2015-10-15

Anthocyanins are natural pigments known for their color and antioxidant activity. These properties allow their use in various fields, including food and pharmaceutical ones. Quantitative determination of anthocyanins had been performed by non-specific methods that limit the accuracy and reliability of the results. Therefore, a novel, simple spectrophotometric method for the anthocyanins quantification based on a formation of blue-colored complexes by the known reaction between catechol- and pyrogallol-containing anthocyanins and aluminum(III) is presented. The method demonstrated to be reproducible, repetitive (RSD<1.5%) and highly sensitive to ortho-dihydroxylated anthocyanins (LOD = 0.186 μg/mL). Compliance with Beer's law was also evident in a range of concentrations (2-16 μg/mL for cyanidin 3-O-glucoside). Good recoveries (98.8-103.3%) were calculated using anthocyanin-rich plant samples. The described method revealed direct correlation to pH differential method results for several common anthocyanin-containing fruits indicating its great analytical potential. The presented method was successfully validated. Copyright © 2015 Elsevier Ltd. All rights reserved.

The classification of magnetohydrodynamic regimes of thermonuclear combustion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Remming, Ian S.; Khokhlov, Alexei M.

2014-10-10

Physical properties of magnetohydrodynamic (MHD) reaction fronts are studied as functions of the thermodynamic conditions, and the strength and orientation of the magnetic field in the unburned matter through which the fronts propagate. We determine the conditions for the existence of the various types of MHD reaction fronts and the character of the changes in physical quantities across these reaction fronts. The analysis is carried out in general for a perfect gas equation of state and a constant energy release, and then extended to thermonuclear reaction fronts in degenerate carbon-oxygen mixtures and degenerate helium in conditions typical of Type Iamore » supernova explosions. We find that as unburned matter enters perpendicular to a reaction front, the release of energy through burning generates shear velocity in the reacting gas that, depending on the type of reaction front, strengthens or weakens the magnetic field. In addition, we find that the steady-state propagation of a reaction front is impossible for certain ranges of magnetic field direction. Our results provide insight into the phenomena of MHD thermonuclear combustion that is relevant to the interpretation of future simulations of SN Ia explosions that have magnetic fields systematically incorporated.« less

Electromagnetic effects on explosive reaction and plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tasker, Douglas G; Whitley, Von H; Mace, Jonathan L

2010-01-01

A number of studies have reported that electric fields can have quantifiable effects on the initiation and growth of detonation, yet the mechanisms of these effects are not clear. Candidates include Joule heating of the reaction zone, perturbations to the activation energy for chemical reaction, reduction of the Peierls energy barrier that facilitates dislocation motion, and acceleration of plasma projected from the reaction zone. In this study the possible role of plasma in the initiation and growth of explosive reaction is investigated. The effects of magnetic and electric field effects on reaction growth will be reviewed and recent experiments reported.

Dynamics assembly of magnetic microparticles suspended in moving droplets under the influence of magnetic fields

NASA Astrophysics Data System (ADS)

Strey, Helmut; Brouzes, Eric; Kruse, Travis

2013-03-01

Droplet microfluidics has experienced tremendous growth, particularly since it is well suited for single-cell manipulation and analysis. As mature methods for high throughput droplet manipulation have been developed a technological bottleneck of current droplet microfluidics is that because droplets are separated, sequential chemical reactions are more difficult to achieve. For example, it is very difficult to concentrate target molecules, especially since every reaction step adds volume to the droplets. Our solution to this problem is to employ functionalized magnetic beads inside droplets. The basic idea is that an external magnetic field could be used to concentrate the magnetic beads in one part of the droplet and those could then be extracted by splitting the droplet. Here we present an experimental study of the self-assembly of superparamagnetic microparticles that are suspended in moving droplets and experience a combination of forces due to the internal fluid flow fields and external magnetic fields. We observed that this interplay of flow fields coupled to the formation of particle assemblies leads to the formations of stable patterns depending on the flow speed and magnetic field strength. An understanding of this dynamic assembly is critical in employing external forces for applications in separation and sorting. Funding through NYSTAR, Center for Advanced Technology and a grant from NIH-NHGRI (1 R21 HG006206-01).

Processes of ionization of atoms in nonstationary states by the field of an attosecond pulse

NASA Astrophysics Data System (ADS)

Makarov, D. N.; Matveev, V. I.

2015-02-01

Processes of ionization at the interaction of attosecond pulses of an electromagnetic field with atoms in nonstationary states have been considered. The probabilities and ionization cross section at the radiative relaxation of an excited state of a single-electron atom and at the Auger decay of the autoionization state of a two-electron atom have been calculated. The developed method allows the expansion to the case of more complex targets, including those in the collision state, and to various chemical reactions.

Transport equations for partially ionized reactive plasma in magnetic field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhdanov, V. M.; Stepanenko, A. A.

2016-06-08

Transport equations for partially ionized reactive plasma in magnetic field taking into account the internal degrees of freedom and electronic excitation of plasma particles are derived. As a starting point of analysis the kinetic equation with a binary collision operator written in the Wang-Chang and Uhlenbeck form and with a reactive collision integral allowing for arbitrary chemical reactions is used. The linearized variant of Grad’s moment method is applied to deduce the systems of moment equations for plasma and also full and reduced transport equations for plasma species nonequilibrium parameters.

A spectral mimetic least-squares method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bochev, Pavel; Gerritsma, Marc

We present a spectral mimetic least-squares method for a model diffusion–reaction problem, which preserves key conservation properties of the continuum problem. Casting the model problem into a first-order system for two scalar and two vector variables shifts material properties from the differential equations to a pair of constitutive relations. We also use this system to motivate a new least-squares functional involving all four fields and show that its minimizer satisfies the differential equations exactly. Discretization of the four-field least-squares functional by spectral spaces compatible with the differential operators leads to a least-squares method in which the differential equations are alsomore » satisfied exactly. Additionally, the latter are reduced to purely topological relationships for the degrees of freedom that can be satisfied without reference to basis functions. Furthermore, numerical experiments confirm the spectral accuracy of the method and its local conservation.« less

A spectral mimetic least-squares method

DOE PAGES

Bochev, Pavel; Gerritsma, Marc

2014-09-01

We present a spectral mimetic least-squares method for a model diffusion–reaction problem, which preserves key conservation properties of the continuum problem. Casting the model problem into a first-order system for two scalar and two vector variables shifts material properties from the differential equations to a pair of constitutive relations. We also use this system to motivate a new least-squares functional involving all four fields and show that its minimizer satisfies the differential equations exactly. Discretization of the four-field least-squares functional by spectral spaces compatible with the differential operators leads to a least-squares method in which the differential equations are alsomore » satisfied exactly. Additionally, the latter are reduced to purely topological relationships for the degrees of freedom that can be satisfied without reference to basis functions. Furthermore, numerical experiments confirm the spectral accuracy of the method and its local conservation.« less

Field Analysis of Microbial Contamination Using Three Molecular Methods in Parallel

NASA Technical Reports Server (NTRS)

Morris, H.; Stimpson, E.; Schenk, A.; Kish, A.; Damon, M.; Monaco, L.; Wainwright, N.; Steele, A.

2010-01-01

Advanced technologies with the capability of detecting microbial contamination remain an integral tool for the next stage of space agency proposed exploration missions. To maintain a clean, operational spacecraft environment with minimal potential for forward contamination, such technology is a necessity, particularly, the ability to analyze samples near the point of collection and in real-time both for conducting biological scientific experiments and for performing routine monitoring operations. Multiple molecular methods for detecting microbial contamination are available, but many are either too large or not validated for use on spacecraft. Two methods, the adenosine- triphosphate (ATP) and Limulus Amebocyte Lysate (LAL) assays have been approved by the NASA Planetary Protection Office for the assessment of microbial contamination on spacecraft surfaces. We present the first parallel field analysis of microbial contamination pre- and post-cleaning using these two methods as well as universal primer-based polymerase chain reaction (PCR).

Radiation-reaction force on a small charged body to second order

NASA Astrophysics Data System (ADS)

Moxon, Jordan; Flanagan, Éanna

2018-05-01

In classical electrodynamics, an accelerating charged body emits radiation and experiences a corresponding radiation-reaction force, or self-force. We extend to higher order in the total charge a previous rigorous derivation of the electromagnetic self-force in flat spacetime by Gralla, Harte, and Wald. The method introduced by Gralla, Harte, and Wald computes the self-force from the Maxwell field equations and conservation of stress-energy in a limit where the charge, size, and mass of the body go to zero, and it does not require regularization of a singular self-field. For our higher-order computation, an adjustment of the definition of the mass of the body is necessary to avoid including self-energy from the electromagnetic field sourced by the body in the distant past. We derive the evolution equations for the mass, spin, and center-of-mass position of the body through second order. We derive, for the first time, the second-order acceleration dependence of the evolution of the spin (self-torque), as well as a mixing between the extended body effects and the acceleration-dependent effects on the overall body motion.

Fusion Ash Separation in the Princeton Field-Reversed Configuration Reactor

NASA Astrophysics Data System (ADS)

Abbate, Joseph; Yeh, Meagan; McGreivy, Nick; Cohen, Samuel

2016-10-01

The Princeton Field-Reversed Configuration (PFRC) concept relies on low-neutron production by D-3He fusion to enable small, safe nuclear-fusion reactors to be built, an approach requiring rapid and efficient extraction of fusion ash and energy produced by D-3He fusion reactions. The ash exhaust stream would contain energetic (0.1-1 MeV) protons, T, 3He, and 4He ions and nearly 1e5 cooler (ca. 100 eV) D ions. The T extracted from the reactor would be a valuable fusion product in that it decays into 3He, which could be used as fuel. If the T were not extracted it would be troublesome because of neutron production by the D-T reaction. This paper discusses methods to separate the various species in a PFRC reactor's exhaust stream. First, we discuss the use of curved magnetic fields to separate the energetic from the cool components. Then we discuss exploiting material properties, specifically reflection, sputtering threshold, and permeability, to allow separation of the hydrogen from the helium isotopes. DOE Contract Number DE-AC02-09CH11466.

Confocal laser scanning microscopic photoconversion: a new method to stabilize fluorescently labeled cellular elements for electron microscopic analysis.

PubMed

Colello, Raymond J; Tozer, Jordan; Henderson, Scott C

2012-01-01

Photoconversion, the method by which a fluorescent dye is transformed into a stable, osmiophilic product that can be visualized by electron microscopy, is the most widely used method to enable the ultrastructural analysis of fluorescently labeled cellular structures. Nevertheless, the conventional method of photoconversion using widefield fluorescence microscopy requires long reaction times and results in low-resolution cell targeting. Accordingly, we have developed a photoconversion method that ameliorates these limitations by adapting confocal laser scanning microscopy to the procedure. We have found that this method greatly reduces photoconversion times, as compared to conventional wide field microscopy. Moreover, region-of-interest scanning capabilities of a confocal microscope facilitate the targeting of the photoconversion process to individual cellular or subcellular elements within a fluorescent field. This reduces the area of the cell exposed to light energy, thereby reducing the ultrastructural damage common to this process when widefield microscopes are employed. © 2012 by John Wiley & Sons, Inc.

Local bias-induced phase transitions

DOE PAGES

Seal, Katyayani; Baddorf, Arthur P.; Jesse, Stephen; ...

2008-11-27

Electrical bias-induced phase transitions underpin a wide range of applications from data storage to energy generation and conversion. The mechanisms behind these transitions are often quite complex and in many cases are extremely sensitive to local defects that act as centers for local transformations or pinning. Furthermore, using ferroelectrics as an example, we review methods for probing bias-induced phase transitions and discuss the current limitations and challenges for extending the methods to field-induced phase transitions and electrochemical reactions in energy storage, biological and molecular systems.

A novel simulation theory and model system for multi-field coupling pipe-flow system

NASA Astrophysics Data System (ADS)

Chen, Yang; Jiang, Fan; Cai, Guobiao; Xu, Xu

2017-09-01

Due to the lack of a theoretical basis for multi-field coupling in many system-level models, a novel set of system-level basic equations for flow/heat transfer/combustion coupling is put forward. Then a finite volume model of quasi-1D transient flow field for multi-species compressible variable-cross-section pipe flow is established by discretising the basic equations on spatially staggered grids. Combining with the 2D axisymmetric model for pipe-wall temperature field and specific chemical reaction mechanisms, a finite volume model system is established; a set of specific calculation methods suitable for multi-field coupling system-level research is structured for various parameters in this model; specific modularisation simulation models can be further derived in accordance with specific structures of various typical components in a liquid propulsion system. This novel system can also be used to derive two sub-systems: a flow/heat transfer two-field coupling pipe-flow model system without chemical reaction and species diffusion; and a chemical equilibrium thermodynamic calculation-based multi-field coupling system. The applicability and accuracy of two sub-systems have been verified through a series of dynamic modelling and simulations in earlier studies. The validity of this system is verified in an air-hydrogen combustion sample system. The basic equations and the model system provide a unified universal theory and numerical system for modelling and simulation and even virtual testing of various pipeline systems.

A new type of power energy for accelerating chemical reactions: the nature of a microwave-driving force for accelerating chemical reactions.

PubMed

Zhou, Jicheng; Xu, Wentao; You, Zhimin; Wang, Zhe; Luo, Yushang; Gao, Lingfei; Yin, Cheng; Peng, Renjie; Lan, Lixin

2016-04-27

The use of microwave (MW) irradiation to increase the rate of chemical reactions has attracted much attention recently in nearly all fields of chemistry due to substantial enhancements in reaction rates. However, the intrinsic nature of the effects of MW irradiation on chemical reactions remains unclear. Herein, the highly effective conversion of NO and decomposition of H2S via MW catalysis were investigated. The temperature was decreased by several hundred degrees centigrade. Moreover, the apparent activation energy (Ea') decreased substantially under MW irradiation. Importantly, for the first time, a model of the interactions between microwave electromagnetic waves and molecules is proposed to elucidate the intrinsic reason for the reduction in the Ea' under MW irradiation, and a formula for the quantitative estimation of the decrease in the Ea' was determined. MW irradiation energy was partially transformed to reduce the Ea', and MW irradiation is a new type of power energy for speeding up chemical reactions. The effect of MW irradiation on chemical reactions was determined. Our findings challenge both the classical view of MW irradiation as only a heating method and the controversial MW non-thermal effect and open a promising avenue for the development of novel MW catalytic reaction technology.

A new type of power energy for accelerating chemical reactions: the nature of a microwave-driving force for accelerating chemical reactions

PubMed Central

Zhou, Jicheng; Xu, Wentao; You, Zhimin; Wang, Zhe; Luo, Yushang; Gao, Lingfei; Yin, Cheng; Peng, Renjie; Lan, Lixin

2016-01-01

The use of microwave (MW) irradiation to increase the rate of chemical reactions has attracted much attention recently in nearly all fields of chemistry due to substantial enhancements in reaction rates. However, the intrinsic nature of the effects of MW irradiation on chemical reactions remains unclear. Herein, the highly effective conversion of NO and decomposition of H2S via MW catalysis were investigated. The temperature was decreased by several hundred degrees centigrade. Moreover, the apparent activation energy (Ea’) decreased substantially under MW irradiation. Importantly, for the first time, a model of the interactions between microwave electromagnetic waves and molecules is proposed to elucidate the intrinsic reason for the reduction in the Ea’ under MW irradiation, and a formula for the quantitative estimation of the decrease in the Ea’ was determined. MW irradiation energy was partially transformed to reduce the Ea’, and MW irradiation is a new type of power energy for speeding up chemical reactions. The effect of MW irradiation on chemical reactions was determined. Our findings challenge both the classical view of MW irradiation as only a heating method and the controversial MW non-thermal effect and open a promising avenue for the development of novel MW catalytic reaction technology. PMID:27118640

Anisotropic transverse mixing and its effect on reaction rates in multi-scale, 3D heterogeneous porous media

NASA Astrophysics Data System (ADS)

Engdahl, N. B.

2016-12-01

Mixing rates in porous media have been a heavily research topic in recent years covering analytic, random, and structured fields. However, there are some persistent assumptions and common features to these models that raise some questions about the generality of the results. One of these commonalities is the orientation of the flow field with respect to the heterogeneity structure, which are almost always defined to be parallel each other if there is an elongated axis of permeability correlation. Given the vastly different tortuosities for flow parallel to bedding and flow transverse to bedding, this assumption of parallel orientation may have significant effects on reaction rates when natural flows deviate from this assumed setting. This study investigates the role of orientation on mixing and reaction rates in multi-scale, 3D heterogeneous porous media with varying degrees of anisotropy in the correlation structure. Ten realizations of a small flow field, with three anisotropy levels, were simulated for flow parallel and transverse to bedding. Transport was simulated in each model with an advective-diffusive random walk and reactions were simulated using the chemical Langevin equation. The reaction system is a vertically segregated, transverse mixing problem between two mobile reactants. The results show that different transport behaviors and reaction rates are obtained by simply rotating the direction of flow relative to bedding, even when the net flux in both directions is the same. This kind of behavior was observed for three different weightings of the initial condition: 1) uniform, 2) flux-based, and 3) travel time based. The different schemes resulted in 20-50% more mass formation in the transverse direction than the longitudinal. The greatest variability in mass was observed for the flux weights and these were proportionate to the level of anisotropy. The implications of this study are that flux or travel time weights do not provide any guarantee of a fair comparison in this kind of a mixing scenario and that the role of directional tendencies on reaction rates can be significant. Further, it may be necessary to include anisotropy in future upscaled models to create robust methods that give representative reaction rates for any flow direction relative to geologic bedding.

Silicon nanowire field-effect transistors for the detection of proteins

NASA Astrophysics Data System (ADS)

Madler, Carsten

In this dissertation I present results on our efforts to increase the sensitivity and selectivity of silicon nanowire ion-sensitive field-effect transistors for the detection of biomarkers, as well as a novel method for wireless power transfer based on metamaterial rectennas for their potential use as implantable sensors. The sensing scheme is based on changes in the conductance of the semiconducting nanowires upon binding of charged entities to the surface, which induces a field-effect. Monitoring the differential conductance thus provides information of the selective binding of biological molecules of interest to previously covalently linked counterparts on the nanowire surface. In order to improve on the performance of the nanowire sensing, we devised and fabricated a nanowire Wheatstone bridge, which allows canceling out of signal drift due to thermal fluctuations and dynamics of fluid flow. We showed that balancing the bridge significantly improves the signal-to-noise ratio. Further, we demonstrated the sensing of novel melanoma biomarker TROY at clinically relevant concentrations and distinguished it from nonspecific binding by comparing the reaction kinetics. For increased sensitivity, an amplification method was employed using an enzyme which catalyzes a signal-generating reaction by changing the redox potential of a redox pair. In addition, we investigated the electric double layer, which forms around charges in an electrolytic solution. It causes electrostatic screening of the proteins of interest, which puts a fundamental limitation on the biomarker detection in solutions with high salt concentrations, such as blood. We solved the coupled Nernst-Planck and Poisson equations for the electrolyte under influence of an oscillating electric field and discovered oscillations of the counterion concentration at a characteristic frequency. In addition to exploring different methods for improved sensing capabilities, we studied an innovative method to supply power to implantable biosensors wirelessly, eliminating the need for batteries. A metamaterial split ring resonator is integrated with a rectifying circuit for efficient conversion of microwave radiation to direct electrical power. We studied the near-field behavior of this rectenna with respect to distance, polarization, power, and frequency. Using a 100 mW microwave power source, we demonstrated operating a simple silicon nanowire pH sensor with light indicator.

Atomistically determined phase-field modeling of dislocation dissociation, stacking fault formation, dislocation slip, and reactions in fcc systems

NASA Astrophysics Data System (ADS)

Rezaei Mianroodi, Jaber; Svendsen, Bob

2015-04-01

The purpose of the current work is the development of a phase field model for dislocation dissociation, slip and stacking fault formation in single crystals amenable to determination via atomistic or ab initio methods in the spirit of computational material design. The current approach is based in particular on periodic microelasticity (Wang and Jin, 2001; Bulatov and Cai, 2006; Wang and Li, 2010) to model the strongly non-local elastic interaction of dislocation lines via their (residual) strain fields. These strain fields depend in turn on phase fields which are used to parameterize the energy stored in dislocation lines and stacking faults. This energy storage is modeled here with the help of the "interface" energy concept and model of Cahn and Hilliard (1958) (see also Allen and Cahn, 1979; Wang and Li, 2010). In particular, the "homogeneous" part of this energy is related to the "rigid" (i.e., purely translational) part of the displacement of atoms across the slip plane, while the "gradient" part accounts for energy storage in those regions near the slip plane where atomic displacements deviate from being rigid, e.g., in the dislocation core. Via the attendant global energy scaling, the interface energy model facilitates an atomistic determination of the entire phase field energy as an optimal approximation of the (exact) atomistic energy; no adjustable parameters remain. For simplicity, an interatomic potential and molecular statics are employed for this purpose here; alternatively, ab initio (i.e., DFT-based) methods can be used. To illustrate the current approach, it is applied to determine the phase field free energy for fcc aluminum and copper. The identified models are then applied to modeling of dislocation dissociation, stacking fault formation, glide and dislocation reactions in these materials. As well, the tensile loading of a dislocation loop is considered. In the process, the current thermodynamic picture is compared with the classical mechanical one as based on the Peach-Köhler force.

Holographic free energy and thermodynamic geometry

NASA Astrophysics Data System (ADS)

Ghorai, Debabrata; Gangopadhyay, Sunandan

2016-12-01

We obtain the free energy and thermodynamic geometry of holographic superconductors in 2+1 dimensions. The gravitational theory in the bulk dual to this 2+1-dimensional strongly coupled theory lives in the 3+1 dimensions and is that of a charged AdS black hole together with a massive charged scalar field. The matching method is applied to obtain the nature of the fields near the horizon using which the holographic free energy is computed through the gauge/gravity duality. The critical temperature is obtained for a set of values of the matching point of the near horizon and the boundary behaviour of the fields in the probe limit approximation which neglects the back reaction of the matter fields on the background spacetime geometry. The thermodynamic geometry is then computed from the free energy of the boundary theory. From the divergence of the thermodynamic scalar curvature, the critical temperature is obtained once again. We then compare this result for the critical temperature with that obtained from the matching method.

Uranium 238U/235U isotope ratios as indicators of reduction: Results from an in situ biostimulation experiment at Rifle, Colorado, USA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bopp IV, C.J.; Lundstrom, C.C.; Johnson, T.M.

2010-02-01

The attenuation of groundwater contamination via chemical reaction is traditionally evaluated by monitoring contaminant concentration through time. However, this method can be confounded by common transport processes (e.g. dilution, sorption). Isotopic techniques bypass the limits of concentration methods, and so may provide improved accuracy in determining the extent of reaction. We apply measurements of {sup 238}U/{sup 235}U to a U bioremediation field experiment at the Rifle Integrated Field Research Challenge Site in Rifle, Colorado (USA). An array of monitoring and injection wells was installed on a 100 m{sup 2} plot where U(VI) contamination was present in the groundwater. Acetate-amended groundwatermore » was injected along an up-gradient gallery to encourage the growth of dissimilatory metal reducing bacteria (e.g. Geobacter species). During amendment, U concentration dropped by an order of magnitude in the experiment plot. We measured {sup 238}U/{sup 235}U in samples from one monitoring well by MC-ICP-MS using a double isotope tracer method. A significant {approx}1.00{per_thousand} decrease in {sup 238}U/{sup 235}U occurred in the groundwater as U(VI) concentration decreased. The relationship between {sup 238}U/{sup 235}U and concentration corresponds approximately to a Rayleigh distillation curve with an effective fractionation factor ({alpha}) of 1.00046. We attribute the observed U isotope fractionation to a nuclear field shift effect during enzymatic reduction of U(VI){sub (aq)} to U(IV){sub (s)}.« less

Hybrid approaches for multiple-species stochastic reaction-diffusion models

NASA Astrophysics Data System (ADS)

Spill, Fabian; Guerrero, Pilar; Alarcon, Tomas; Maini, Philip K.; Byrne, Helen

2015-10-01

Reaction-diffusion models are used to describe systems in fields as diverse as physics, chemistry, ecology and biology. The fundamental quantities in such models are individual entities such as atoms and molecules, bacteria, cells or animals, which move and/or react in a stochastic manner. If the number of entities is large, accounting for each individual is inefficient, and often partial differential equation (PDE) models are used in which the stochastic behaviour of individuals is replaced by a description of the averaged, or mean behaviour of the system. In some situations the number of individuals is large in certain regions and small in others. In such cases, a stochastic model may be inefficient in one region, and a PDE model inaccurate in another. To overcome this problem, we develop a scheme which couples a stochastic reaction-diffusion system in one part of the domain with its mean field analogue, i.e. a discretised PDE model, in the other part of the domain. The interface in between the two domains occupies exactly one lattice site and is chosen such that the mean field description is still accurate there. In this way errors due to the flux between the domains are small. Our scheme can account for multiple dynamic interfaces separating multiple stochastic and deterministic domains, and the coupling between the domains conserves the total number of particles. The method preserves stochastic features such as extinction not observable in the mean field description, and is significantly faster to simulate on a computer than the pure stochastic model.

Hybrid approaches for multiple-species stochastic reaction-diffusion models.

PubMed

Spill, Fabian; Guerrero, Pilar; Alarcon, Tomas; Maini, Philip K; Byrne, Helen

2015-10-15

Reaction-diffusion models are used to describe systems in fields as diverse as physics, chemistry, ecology and biology. The fundamental quantities in such models are individual entities such as atoms and molecules, bacteria, cells or animals, which move and/or react in a stochastic manner. If the number of entities is large, accounting for each individual is inefficient, and often partial differential equation (PDE) models are used in which the stochastic behaviour of individuals is replaced by a description of the averaged, or mean behaviour of the system. In some situations the number of individuals is large in certain regions and small in others. In such cases, a stochastic model may be inefficient in one region, and a PDE model inaccurate in another. To overcome this problem, we develop a scheme which couples a stochastic reaction-diffusion system in one part of the domain with its mean field analogue, i.e. a discretised PDE model, in the other part of the domain. The interface in between the two domains occupies exactly one lattice site and is chosen such that the mean field description is still accurate there. In this way errors due to the flux between the domains are small. Our scheme can account for multiple dynamic interfaces separating multiple stochastic and deterministic domains, and the coupling between the domains conserves the total number of particles. The method preserves stochastic features such as extinction not observable in the mean field description, and is significantly faster to simulate on a computer than the pure stochastic model.

Synthesis of layered double hydroxides containing Mg2+, Zn2+, Ca2+ and Al3+ layer cations by co-precipitation methods-A review

NASA Astrophysics Data System (ADS)

Theiss, Frederick L.; Ayoko, Godwin A.; Frost, Ray L.

2016-10-01

Co-precipitation is a common method for the preparation of layered double hydroxides (LDHs) and related materials. This review article is aimed at providing newcomers to the field with some examples of the types of co-precipitation reactions that have been reported previously and to briefly investigate some of the properties of the products of these reactions. Due to the sheer volume of literature on the subject, the authors have had to limit this article to the synthesis of Mg/Al, Zn/Al and Ca/Al LDHs by co-precipitation and directly related methods. LDHs have been synthesised from various reagents including metal salts, oxides and hydroxides. Co-precipitation is also useful for the direct synthesis of LDHs with a wide range of interlayer anions and various bases have been successfully employed to prepare LDHs. Examples of other synthesis techniques including the urea method, hydrothermal synthesis and various mechanochemical methods that are undoubtedly related to co-precipitation have also been included in this review. The effect of post synthesis hydrothermal has also been summarised.

Computing organic stereoselectivity - from concepts to quantitative calculations and predictions.

PubMed

Peng, Qian; Duarte, Fernanda; Paton, Robert S

2016-11-07

Advances in theory and processing power have established computation as a valuable interpretative and predictive tool in the discovery of new asymmetric catalysts. This tutorial review outlines the theory and practice of modeling stereoselective reactions. Recent examples illustrate how an understanding of the fundamental principles and the application of state-of-the-art computational methods may be used to gain mechanistic insight into organic and organometallic reactions. We highlight the emerging potential of this computational tool-box in providing meaningful predictions for the rational design of asymmetric catalysts. We present an accessible account of the field to encourage future synergy between computation and experiment.

Synthesis and Characterization of Antimicrobial Nanomaterials

DTIC Science & Technology

2013-01-01

coatings have broad application in medical and food processing fields. Additional potential exists for active disinfection/decontamination processes as well...technique to form homogenous silica nanoparticles. The reaction also provides a method to entrap additional enzyme in silica matrices. When additional ...elucidate the mechanism of lysozyme-mediated silica formation.22 The biocidal spectrum of the material can be broadened by addition of other

Refined Calculations of Secondary Nuclear Reactions in Magneto-Inertial Fusion Plasmas

NASA Astrophysics Data System (ADS)

Schmit, Paul; Knapp, Patrick; Hansen, Stephanie; Gomez, Matthew; Hahn, Kelly; Sinars, Daniel; Peterson, Kyle; Slutz, Stephen; Sefkow, Adam; Awe, Thomas; Harding, Eric; Jennings, Christopher

2014-10-01

Diagnosing the degree of magnetic flux compression at stagnation in magneto-inertial fusion (MIF) is critical for charting the performance of any MIF concept. In pure deuterium plasma, the transport of high-energy tritons produced by the aneutronic DD fusion reaction depends strongly on the magnetic field. The tritons probe and occasionally react with the fuel, emitting secondary DT neutrons. We show that the DT/DD neutron yield ratio and the secondary DT neutron spectra can be used to infer the magnetic field-radius product (BR), the critical confinement parameter for MIF. The amount of fuel-pusher mix also can be constrained by secondary reactions. We discuss the sensitivity to plasma inhomogeneities of the calculations and outline methods to relate secondary yields to alpha particle energy deposition in ignition-relevant experiments employing DT fuel. We compare our calculations to recent tests of the Magnetized Liner Inertial Fusion (MagLIF) concept on the Z Pulsed Power Facility. Supported in part by the SNL Truman Fellowship, which is part of the LDRD Program, and sponsored by Sandia Corporation (a wholly owned subsidiary of Lockheed Martin Corporation) as Operator of SNL under its U.S. DoE Contract No. DE-AC04-94AL85000.

Transport-reaction model for defect and carrier behavior within displacement cascades in gallium arsenide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wampler, William R.; Myers, Samuel M.

2014-02-01

A model is presented for recombination of charge carriers at displacement damage in gallium arsenide, which includes clustering of the defects in atomic displacement cascades produced by neutron or ion irradiation. The carrier recombination model is based on an atomistic description of capture and emission of carriers by the defects with time evolution resulting from the migration and reaction of the defects. The physics and equations on which the model is based are presented, along with details of the numerical methods used for their solution. The model uses a continuum description of diffusion, field-drift and reaction of carriers and defectsmore » within a representative spherically symmetric cluster. The initial radial defect profiles within the cluster were chosen through pair-correlation-function analysis of the spatial distribution of defects obtained from the binary-collision code MARLOWE, using recoil energies for fission neutrons. Charging of the defects can produce high electric fields within the cluster which may influence transport and reaction of carriers and defects, and which may enhance carrier recombination through band-to-trap tunneling. Properties of the defects are discussed and values for their parameters are given, many of which were obtained from density functional theory. The model provides a basis for predicting the transient response of III-V heterojunction bipolar transistors to pulsed neutron irradiation.« less

Surface Protonics Promotes Catalysis

PubMed Central

Manabe, R.; Okada, S.; Inagaki, R.; Oshima, K.; Ogo, S.; Sekine, Y.

2016-01-01

Catalytic steam reforming of methane for hydrogen production proceeds even at 473 K over 1 wt% Pd/CeO2 catalyst in an electric field, thanks to the surface protonics. Kinetic analyses demonstrated the synergetic effect between catalytic reaction and electric field, revealing strengthened water pressure dependence of the reaction rate when applying an electric field, with one-third the apparent activation energy at the lower reaction temperature range. Operando–IR measurements revealed that proton conduction via adsorbed water on the catalyst surface occurred during electric field application. Methane was activated by proton collision at the Pd–CeO2 interface, based on the inverse kinetic isotope effect. Proton conduction on the catalyst surface plays an important role in methane activation at low temperature. This report is the first describing promotion of the catalytic reaction by surface protonics. PMID:27905505

Microscopic description of production cross sections including deexcitation effects

NASA Astrophysics Data System (ADS)

Sekizawa, Kazuyuki

2017-07-01

Background: At the forefront of the nuclear science, production of new neutron-rich isotopes is continuously pursued at accelerator laboratories all over the world. To explore the currently unknown territories in the nuclear chart far away from the stability, reliable theoretical predictions are inevitable. Purpose: To provide a reliable prediction of production cross sections taking into account secondary deexcitation processes, both particle evaporation and fission, a new method called TDHF+GEMINI is proposed, which combines the microscopic time-dependent Hartree-Fock (TDHF) theory with a sophisticated statistical compound-nucleus deexcitation model, GEMINI++. Methods: Low-energy heavy ion reactions are described based on three-dimensional Skyrme-TDHF calculations. Using the particle-number projection method, production probabilities, total angular momenta, and excitation energies of primary reaction products are extracted from the TDHF wave function after collision. Production cross sections for secondary reaction products are evaluated employing GEMINI++. Results are compared with available experimental data and widely used grazing calculations. Results: The method is applied to describe cross sections for multinucleon transfer processes in 40Ca+124Sn (Ec .m .≃128.54 MeV ), 48Ca+124Sn (Ec .m .≃125.44 MeV ), 40Ca+208Pb (Ec .m .≃208.84 MeV ), 58Ni+208Pb (Ec .m .≃256.79 MeV ), 64Ni+238U (Ec .m .≃307.35 MeV ), and 136Xe+198Pt (Ec .m .≃644.98 MeV ) reactions at energies close to the Coulomb barrier. It is shown that the inclusion of secondary deexcitation processes, which are dominated by neutron evaporation in the present systems, substantially improves agreement with the experimental data. The magnitude of the evaporation effects is very similar to the one observed in grazing calculations. TDHF+GEMINI provides better description of the absolute value of the cross sections for channels involving transfer of more than one proton, compared to the grazing results. However, there remain discrepancies between the measurements and the calculated cross sections, indicating a limit of the theoretical framework that works with a single mean-field potential. Possible causes of the discrepancies are discussed. Conclusions: To perfectly reproduce experimental cross sections for multinucleon transfer processes, one should go beyond the standard self-consistent mean-field description. Nevertheless, the proposed method will provide valuable information to optimize production mechanisms of new neutron-rich nuclei through its microscopic, nonempirical predictions.

Human short-term exposure to electromagnetic fields emitted by mobile phones decreases computer-assisted visual reaction time.

PubMed

Mortazavi, S M J; Rouintan, M S; Taeb, S; Dehghan, N; Ghaffarpanah, A A; Sadeghi, Z; Ghafouri, F

2012-06-01

The worldwide dramatic increase in mobile phone use has generated great concerns about the detrimental effects of microwave radiations emitted by these communication devices. Reaction time plays a critical role in performing tasks necessary to avoid hazards. As far as we know, this study is the first survey that reports decreased reaction time after exposure to electromagnetic fields generated by a high specific absorption rate mobile phone. It is also the first study in which previous history of mobile phone use is taken into account. The aim of this study was to assess both the acute and chronic effects of electromagnetic fields emitted by mobile phones on reaction time in university students. Visual reaction time (VRT) of young university students was recorded with a simple blind computer-assisted-VRT test, before and after a 10 min real/sham exposure to electromagnetic fields of mobile phones. Participants were 160 right-handed university students aged 18-31. To assess the effect of chronic exposures, the reaction time in sham-exposed phases were compared among low level, moderate and frequent users of mobile phones. The mean ± SD reaction time after real exposure and sham exposure were 286.78 ± 31.35 ms and 295.86 ± 32.17 ms (P < 0.001), respectively. The age of students did not significantly alter the reaction time either in talk or in standby mode. The reaction time either in talk or in standby mode was shorter in male students. The students' VRT was significantly affected by exposure to electromagnetic fields emitted by a mobile phone. It can be concluded that these exposures cause decreased reaction time, which may lead to a better response to different hazards. In this light, this phenomenon might decrease the chances of human errors and fatal accidents.

Pyrolysis characteristics and kinetics of oil-based drilling cuttings in shale gas developing

NASA Astrophysics Data System (ADS)

Huang, Chuan; Li, Tong; Xu, Tengtun; Zeng, Yunmin; Song, Xue

2018-03-01

In this paper, the thermal behavior of waste oil-based drilling cuttings (from shale gas fields in Chongqing) was examined at different heating rates ranging from 5 to 15 °C min-1 in inert atmosphere using a sync analyzer of thermogravimetry (TG) and differential scanning calorimetry (DSC). Four methods were used to analyze the distributions and variations of kinetics parameter (active energy (E) and frequency gene (A)): Coats-Redfern and other three iso-conversion rate methods (Flynn-Wall-Ozawa, Vyazovkin and Friedman). The experimental results indicated that the process consists of three steps, i.e., water evaporation, volatilization of light oil component and heavy oil cracking. TG curves moved toward higher temperature zone caused by thermal hysteresis with the increase of temperature rising rate. For volatilization of lightweight components, the E calculated by three iso-conversion rate methods changed a little with conversion, and had almost the same results as the CR method (14.39˜20.08 kJ.mol-1). For reactions of heavy oil cracking with mixed mechanism, corresponding E rose gradually with the increase of reaction time. The CR method shows nonlinear trends and the reaction models and kinetic parameters cannot be extracted from CR curves. The results by three iso-conversion methods showed that apparent activation energy was given as 155.74˜561.10 kJ.mol-1, 141.06˜524.96 kJ.mol-1 and 74.37˜605.10 kJ.mol-1, respectively.

Non-steady state mass action dynamics without rate constants: dynamics of coupled reactions using chemical potentials

NASA Astrophysics Data System (ADS)

Cannon, William R.; Baker, Scott E.

2017-10-01

Comprehensive and predictive simulation of coupled reaction networks has long been a goal of biology and other fields. Currently, metabolic network models that utilize enzyme mass action kinetics have predictive power but are limited in scope and application by the fact that the determination of enzyme rate constants is laborious and low throughput. We present a statistical thermodynamic formulation of the law of mass action for coupled reactions at both steady states and non-stationary states. The formulation uses chemical potentials instead of rate constants. When used to model deterministic systems, the method corresponds to a rescaling of the time dependent reactions in such a way that steady states can be reached on the same time scale but with significantly fewer computational steps. The relationships between reaction affinities, free energy changes and generalized detailed balance are central to the discussion. The significance for applications in systems biology are discussed as is the concept and assumption of maximum entropy production rate as a biological principle that links thermodynamics to natural selection.

A miniature and field-applicable multipumping flow analyzer for ammonium monitoring in seawater with fluorescence detection.

PubMed

Horstkotte, Burkhard; Duarte, Carlos M; Cerdà, Víctor

2011-07-15

In this article, a simple, economic, and miniature flow analyzer for ammonium in seawater based on the solenoid micropumps is presented. A single reagent of sodium tetraborate, ortho-phthaldialdehyde (OPA), and sodium sulfite was used and optimized applying the modified SIMPLEX method. A special-made detection cell for fluorescence detection of the reaction product isoindol-1-sulfonat was made and combined with a commercial photomultiplier tube, a long-pass optical filter, and an UV-LED as excitation light source. A LOD down to 13 nmol/L was achieved. The fabrication and application of a miniature reaction coil heating device for reaction rate enhancement is further described. The system featured an injection frequency of 32 h(-1) at average standard deviation of 3%. Copyright © 2011 Elsevier B.V. All rights reserved.

Comparison of experimental and theoretical reaction rail currents, rail voltages, and airgap fields for the linear induction motor research vehicle

NASA Technical Reports Server (NTRS)

Elliott, D. G.

1977-01-01

Measurements of reaction rail currents, reaction rail voltages, and airgap magnetic fields in tests of the Linear Induction Motor Research Vehicle (LIMRV) were compared with theoretical calculations from the mesh/matrix theory. It was found that the rail currents and magnetic fields predicted by the theory are within 20 percent of the measured currents and fields at most motor locations in most of the runs, but differ by as much as a factor of two in some cases. The most consistent difference is a higher experimental than theoretical magnetic field near the entrance of the motor and a lower experimental than theoretical magnetic field near the exit. The observed differences between the theoretical and experimental magnetic fields and currents do not account for the differences of as much as 26 percent between the theoretical and experimental thrusts.

Mechanisms and time-resolved dynamics for trihydrogen cation (H 3 +) formation from organic molecules in strong laser fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ekanayake, Nagitha; Nairat, Muath; Kaderiya, Balram

Strong-field laser-matter interactions often lead to exotic chemical reactions. Trihydrogen cation formation from organic molecules is one such case that requires multiple bonds to break and form. Here, we present evidence for the existence of two different reaction pathways for H 3 + formation from organic molecules irradiated by a strong-field laser. Assignment of the two pathways was accomplished through analysis of femtosecond time-resolved strong-field ionization and photoion-photoion coincidence measurements carried out on methanol isotopomers, ethylene glycol, and acetone. Ab initio molecular dynamics simulations suggest the formation occurs via two steps: the initial formation of a neutral hydrogen molecule, followedmore » by the abstraction of a proton from the remaining CHOH 2+ fragment by the roaming H 2 molecule. This reaction has similarities to the H 2+H 2 + mechanism leading to formation of H 3 + in the universe. These exotic chemical reaction mechanisms, involving roaming H 2 molecules, are found to occur in the ~100 fs timescale. Roaming molecule reactions may help to explain unlikely chemical processes, involving dissociation and formation of multiple chemical bonds, occurring under strong laser fields.« less

Mechanisms and time-resolved dynamics for trihydrogen cation (H 3 +) formation from organic molecules in strong laser fields

DOE PAGES

Ekanayake, Nagitha; Nairat, Muath; Kaderiya, Balram; ...

2017-07-05

Strong-field laser-matter interactions often lead to exotic chemical reactions. Trihydrogen cation formation from organic molecules is one such case that requires multiple bonds to break and form. Here, we present evidence for the existence of two different reaction pathways for H 3 + formation from organic molecules irradiated by a strong-field laser. Assignment of the two pathways was accomplished through analysis of femtosecond time-resolved strong-field ionization and photoion-photoion coincidence measurements carried out on methanol isotopomers, ethylene glycol, and acetone. Ab initio molecular dynamics simulations suggest the formation occurs via two steps: the initial formation of a neutral hydrogen molecule, followedmore » by the abstraction of a proton from the remaining CHOH 2+ fragment by the roaming H 2 molecule. This reaction has similarities to the H 2+H 2 + mechanism leading to formation of H 3 + in the universe. These exotic chemical reaction mechanisms, involving roaming H 2 molecules, are found to occur in the ~100 fs timescale. Roaming molecule reactions may help to explain unlikely chemical processes, involving dissociation and formation of multiple chemical bonds, occurring under strong laser fields.« less

Field ion microscopic studies of the CO oxidation on platinum: Field ion imaging and titration reactions

NASA Astrophysics Data System (ADS)

Gorodetskii, V.; Drachsel, W.; Block, J. H.

1994-05-01

Elementary steps of the CO oxidation—which are important for understanding the oscillatory behavior of this catalytic reaction—are investigated simultaneously on different Pt-single crystal surfaces by field ion microscopy. Due to preferential ionization probabilities of oxygen as imaging gas on those surface sites, which are adsorbed with oxygen, these sites can be imaged in a lateral resolution on the atomic scale. In the titration reaction a COad-precovered field emitter surface reacts with gaseous oxygen adsorbed from the gas phase or, vice versa, the Oad-precovered surface with carbon monoxide adsorbed from the gas phase. The competition of the manifold of single crystal planes exposed to the titration reaction at the field emitter tip is studied. The surface specificity can be documented in the specific reaction delay times of the different planes and in the propagation rates of the reaction-diffusion wave fronts measured on these individual planes during the titration reaction with a time resolution of 40 ms. At 300 K the COad-precovered surfaces display the {011} regions, precisely the {331} planes as the most active, followed by {012}, {122}, {001}, and finally by {111}. Reaction wave fronts move with a velocity of 8 Å/s at {012}, with ≊0.8 Å/s at {111}, and have a very fast ``switch-on'' reaction at the (001) plane with 500 Å/s. At higher temperature, T=350 K, an acceleration of reaction rates is combined with shorter delay times. The titration reaction of a precovered Oad surface with COgas at T=373 K shows the formation of CO islands starting in the {011} regions with a quickly moving reaction front into the other surface areas without showing particular delay times for different surface symmetries. The two reverse titration reactions have a largely different character. The titration of COad with oxygen adsorbed from the gas phase consists of three different steps, (i) the induction times, (ii) the highly surface specific reaction, and (iii) different rates of wave front propagation. The reaction of COgas with a precovered Oad layer on the other hand starts with nucleating islands around the {011} planes from where the whole emitter surface is populated with COad without pronounced surface specifity.

Direct reaction theories for exotic nuclei: An introduction via semi-classical methods

NASA Astrophysics Data System (ADS)

Bonaccorso, Angela

2018-07-01

The structure of exotic nuclei has only been studied from around 1985, because they are very short lived and because before that, it was not possible to produce and deliver them as beams on a target. They have large N / Z or Z / N ratios, are weakly bound and quite extended most of the time. Thus breakup, transfer and/or inelastic excitations of the surface are some of their most common reaction mechanisms. Direct reactions, for their simplicity, have played a fundamental role in the last thirty years in the process of understanding such "new" type of structures. On the other hand, direct reactions have been studied and understood for a much longer time, starting with the pioneering experiments in the early '50 on deuteron-induced reactions and the reaction models developed by S.T. Butler and collaborators. Both subjects are extremely vast and there is a large literature available of books, review articles and original papers. I will discuss here only a few selected examples of the many interesting problems that have been encountered and solved in all those years. I consider them breakthroughs in the field and as such I hope they can inspire young generations of researchers.

Improved synthesis with high yield and increased molecular weight of poly(alpha,beta-malic acid) by direct polycondensation.

PubMed

Kajiyama, Tetsuto; Kobayashi, Hisatoshi; Taguchi, Tetsushi; Kataoka, Kazunori; Tanaka, Junzo

2004-01-01

The development of synthetic biodegradable polymers, such as poly(alpha-hydroxy acid), is particularly important for constructing medical devices, including scaffolds and sutures, and has attracted growing interest in the biomedical field. Here, we report a novel approach to preparing high molecular weight poly(malic acid) (HMW--PMA) as a biodegradable and bioabsorbable water-soluble polymer. We investigated in detail the reaction conditions for the simple direct polycondensation of l-malic acid, including the reaction times, temperatures, and catalysts. The molecular weight of synthesized alpha,beta-PMA is dependent on both the reaction temperature and time. The optimum reaction condition to obtain alpha,beta-PMA by direct polycondensation using tin(II) chloride as a catalyst was thus determined to be 110 degrees C for 45 h with a molecular weight of 5300. The method for alpha,beta-PMA synthesis established here will facilitate production of alpha,beta-PMA of various molecular weights, which may have a potential utility as biomaterials.

A New Global Potential Energy Surface for the Hydroperoxyl Radical, HO2: Reaction Coefficients for H + O2 and Vibrational Splittings for H Atom Transfer

NASA Technical Reports Server (NTRS)

Dateo, Christopher E.; Arnold, James O. (Technical Monitor)

1994-01-01

A new analytic global potential energy surface describing the hydroperoxyl radical system H((sup 2)S) + O2(X (sup 3)Sigma((sup -)(sub g))) (reversible reaction) HO2 ((X-tilde) (sup 2)A'') (reversible reaction) O((sup 3)P) + O H (X (sup 2)Pi) has been fitted using the ab initio complete active space SCF (self-consistent-field)/externally contracted configuration interaction (CASSCF/CCI) energy calculations of Walch and Duchovic. Results of quasiclassical trajectory studies to determine the rate coefficients of the forward and reverse reactions at combustion temperatures will be presented. In addition, vibrational energy levels were calculated using the quantum DVR-DGB (discrete variable representation-distributed Gaussian basis) method and the splitting due to H atom migration is investigated. The material of the proposed presentation was reviewed and the technical content will not reveal any information not already in the public domain and will not give any foreign industry or government a competitive advantage.

Primal-mixed formulations for reaction-diffusion systems on deforming domains

NASA Astrophysics Data System (ADS)

Ruiz-Baier, Ricardo

2015-10-01

We propose a finite element formulation for a coupled elasticity-reaction-diffusion system written in a fully Lagrangian form and governing the spatio-temporal interaction of species inside an elastic, or hyper-elastic body. A primal weak formulation is the baseline model for the reaction-diffusion system written in the deformed domain, and a finite element method with piecewise linear approximations is employed for its spatial discretization. On the other hand, the strain is introduced as mixed variable in the equations of elastodynamics, which in turn acts as coupling field needed to update the diffusion tensor of the modified reaction-diffusion system written in a deformed domain. The discrete mechanical problem yields a mixed finite element scheme based on row-wise Raviart-Thomas elements for stresses, Brezzi-Douglas-Marini elements for displacements, and piecewise constant pressure approximations. The application of the present framework in the study of several coupled biological systems on deforming geometries in two and three spatial dimensions is discussed, and some illustrative examples are provided and extensively analyzed.

Analysis of the Maillard reaction in human hair using Fourier transform infrared spectroscopic imaging and a focal-plane array detector.

PubMed

Jung, In-Keun; Park, Sang-Chul; Bin, Sung-Ah; Roh, Young Sup; Lee, John Hwan; Kim, Boo-Min

2016-03-01

The Maillard reaction has been well researched and used in the food industry and the fields of environmental science and organic chemistry. Here, we induced the Maillard reaction inside human hair and analyzed its effects by using Fourier transform infrared spectroscopy with a focal-plane array (FTIR-FPA) detector. We used arginine (A), glycine (G), and D-xylose (X) to generate the Maillard reaction by dissolving them in purified water and heating it to 150 °C. This label-free process generated a complex compound (named AGX after its ingredients) with a monomer structure, which was determined by using nuclear magnetic resonance (NMR) and FTIR-FPA. This compound was stable in hair and substantially increased its tensile strength. To our knowledge, we are the first to report the formation of this monomer in human hair, and our study provides insights into a new method that could be used to improve the condition of damaged or aging hair.

Photocatalytic fluoroalkylation reactions of organic compounds.

PubMed

Barata-Vallejo, Sebastián; Bonesi, Sergio M; Postigo, Al

2015-12-14

Photocatalytic methods for fluoroalkyl-radical generation provide more convenient alternatives to the classical perfluoroalkyl-radical (Rf) production through chemical initiators, such as azo or peroxide compounds or the employment of transition metals through a thermal electron transfer (ET) initiation process. The mild photocatalytic reaction conditions tolerate a variety of functional groups and, thus, are handy to the late-stage modification of bioactive molecules. Transition metal-photocatalytic reactions for Rf radical generation profit from the redox properties of coordinatively saturated Ru or Ir organocomplexes to act as both electron donor and reductive species, thus allowing for the utilization of electron accepting and donating fluoroalkylating agents for Rf radical production. On the other hand, laboratory-available and inexpensive photoorgano catalysts (POC), in the absence of transition metals, can also act as electron exchange species upon excitation, resulting in ET reactions that produce Rf radicals. In this work, a critical account of transition metal and transition metal-free Rf radical production will be described with photoorgano catalysts, studying classical examples and the most recent investigations in the field.

Rapid, chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun

PubMed Central

Shahi, Payam; Abate, Adam R.

2017-01-01

Droplet microfluidics can form and process millions of picoliter droplets with speed and ease, allowing the execution of huge numbers of biological reactions for high-throughput studies. However, at the conclusion of most experiments, the emulsions must be broken to recover and analyze their contents. This is usually achieved with demulsifiers, like perfluorooctanol and chloroform, which can interfere with downstream reactions and harm cells. Here, we describe a simple approach to rapidly and efficiently break microfluidic emulsions, which requires no chemicals. Our method allows one-pot multi-step reactions, making it useful for large scale automated processing of reactions requiring demulsification. Using a hand-held antistatic gun, we pulse emulsions with the electric field, coalescing ∼100 μl of droplets in ∼10 s. We show that while emulsions broken with chemical demulsifiers exhibit potent PCR inhibition, the antistatic-broken emulsions amplify efficiently. The ability to break emulsions quickly without chemicals should make our approach valuable for most demulsification needs in microfluidics. PMID:28794817

Useful visual field in patients with schizophrenia: a choice reaction time study.

PubMed

Matsuda, Yukihisa; Matsui, Mie; Tonoya, Yasuhiro; Ebihara, Naokuni; Kurachi, Masayoshi

2011-04-01

This study examined the size of the useful visual field in patients (9 men, 6 women) with schizophrenia. A choice reaction task was conducted, and performances at 2.5, 5, 7, 10, and 25 degrees in both visual fields were measured. Three key findings were shown. First, patients had slower choice reaction times (choice RTs) than normal controls. Second, patients had slower choice RTs in the right visual field than in the left visual field. Third, patients and normal controls showed the same U-shaped choice RT pattern. The first and second findings were consistent with those of other studies. The third finding was a clear indication of the patients' performance in peripheral vision, and a comparison with normal controls suggested that there was no difference in the size of the useful visual field, at least within

Electromagnetic Radiation Reaction in General Relativity.

NASA Astrophysics Data System (ADS)

O'Donnell, Nuala

Available from UMI in association with The British Library. This thesis examines the electromagnetic radiation reaction felt by a charged body falling freely in an external gravitational field in general relativity. The original objective was to find a new derivation of the radiation reaction force F^{i} of DeWitt and DeWitt^1 which was calculated for the special case of a point charge falling in slow motion in a weak, static gravitational field: F ^{i} = {2over 3}e^2R^{i}_{0j0 }v^{j}. This may be thought of as a local expression since it involves the particle's velocity v^{j } and the local Riemann curvature tensor R ^{i}_{0j0}. Its derivation involves integrals over the whole history of the particle, covering distances of approximately the length scale on which R^{i}_{0j0 } changes. This is different from calculations of the Abraham-Lorentz force of flat space-time involving integrals over distances only a few times the size of the charge. This work was motivated by the wish to find a "local" derivation of the local reaction force. Using Schutz's^2 local initial value method to solve the problem of a charged, rigid, spherically symmetric body moving in an external gravitational field of arbitrary metric. Calculations are done in a Riemann normal coordinate system ^3 and are only valid in a normal neighbourhood of the origin, where geodesics have not begun to cross one another. We solve Maxwell's equations for the self -force by making a slow-motion approximation and keeping terms to first order only in the Riemann tensor and velocity. It is surprising that we find no local radiation reaction. Consider two particles in a static spacetime with the same initial conditions at t = 0. Particle A is that of DeWitt and DeWitt; it feels a reaction force F^{i} = {2over 3}e^2R^{i }_{0j0}v^{j}. Particle B is accelerated from rest to the same small velocity; it feels no reaction force. The two particles therefore follow different trajectories. We conclude that there is a certain amount of history dependence in curved spacetime which is absent in flat spacetime where the Abraham-Lorentz reaction force acts equally on both particles. ftn ^1C. M. DeWitt and B. S. Brehme, Falling Charges, Phys., 1, 3 (1964). ^2B. F. Schutz, Statistical Formulation of Gravitational Radiation Reaction, Phys. Rev. D., 22, 249 (1980). ^3See for example A. Z. Petrov, Einstein Spaces, p.33, Pergamon Press (1969).

Resonance dependence of gravitropicreactionof cress roots in weak combined magnetic fields.

NASA Astrophysics Data System (ADS)

Bogatina, N. I.; Sheykina, N. V.; Kordyum, E. L.

The gravitropic reaction of cress was studied in combined magnetic fields, that is the static magnetic field of the order of Earth's one and parallel to it alternating magnetic field. The frequency region for alternating magnetic field was varied in wide diapason ( from 1 Hz up to 45 Hz). The magnitude of alternating magnetic field was equal to 6 microT. The magnetic field conditions were well reproducible. For this purpose the external magnetic field was shielded in the work volume and artificial magnetic field was created in the volume. Both ferromagnetic metal shield and superconductive one with warm volume for work were used. The magnetic noises inside both of ferromagnetic metal and superconductive shields were measured to provide the well reproducible characteristics of artificial field created in the work volume. The objects of investigation were the roots of cress after 2-3-days germination. They were located in the closed humid room, that was located inside the shield in the artificially created magnetic field. All roots were in the darkness. For control we used the analogous roots located in the analogous volume but only in the static magnetic field of the Earth. We measured the divergence angle of the root from its primary direction of growing. We obtained the following results. The curve of dependence of measured angles on the frequency of alternating component of magnetic field had series of sharp peaks. These peaks were well reproducible and their location depended on the magnitude of the static component of magnetic field. The frequency of peak location is in direct proportion with its magnitude. The analysis showed that the location of peaks coincided very well with the cyclotron frequencies of the following ions: Ca+2, Cu+1 , K+1: Fe+3: Ag+1: and with the cyclotron frequencies of ions of phytohormons such as ions of indolile-acetic acid, abscise acid and gibberellins. Some quantitive analogies between the gravitropic process and the effect of combined magnetic field are discussed at the molecular level. In particularly it was shown that in the gravity field the pressure difference between the upper and down parts of the root was of the order of the pressure difference created by the Lorenz force. The displacement of the point where the pressure approached the maximum value on membrane surface could lead to the changes in the ion transport direction and so to the changes of the gravitropic reaction direction. The possibilities of the method for the studying the gravitropic reaction were discussed.

Impingement effect of service module reaction control system engine plumes. Results of service module reaction control system plume model force field application to an inflight Skylab mission proximity operation situation with the inflight Skylab response

NASA Technical Reports Server (NTRS)

Lobb, J. D., Jr.

1978-01-01

Plume impingement effects of the service module reaction control system thruster firings were studied to determine if previous flight experience would support the current plume impingement model for the orbiter reaction control system engines. The orbiter reaction control system is used for rotational and translational maneuvers such as those required during rendezvous, braking, docking, and station keeping. Therefore, an understanding of the characteristics and effects of the plume force fields generated by the reaction control system thruster firings were examined to develop the procedures for orbiter/payload proximity operations.

Fail-safe reactivity compensation method for a nuclear reactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nygaard, Erik T.; Angelo, Peter L.; Aase, Scott B.

The present invention relates generally to the field of compensation methods for nuclear reactors and, in particular to a method for fail-safe reactivity compensation in solution-type nuclear reactors. In one embodiment, the fail-safe reactivity compensation method of the present invention augments other control methods for a nuclear reactor. In still another embodiment, the fail-safe reactivity compensation method of the present invention permits one to control a nuclear reaction in a nuclear reactor through a method that does not rely on moving components into or out of a reactor core, nor does the method of the present invention rely on themore » constant repositioning of control rods within a nuclear reactor in order to maintain a critical state.« less

A hybrid approach to simulation of electron transfer in complex molecular systems

PubMed Central

Kubař, Tomáš; Elstner, Marcus

2013-01-01

Electron transfer (ET) reactions in biomolecular systems represent an important class of processes at the interface of physics, chemistry and biology. The theoretical description of these reactions constitutes a huge challenge because extensive systems require a quantum-mechanical treatment and a broad range of time scales are involved. Thus, only small model systems may be investigated with the modern density functional theory techniques combined with non-adiabatic dynamics algorithms. On the other hand, model calculations based on Marcus's seminal theory describe the ET involving several assumptions that may not always be met. We review a multi-scale method that combines a non-adiabatic propagation scheme and a linear scaling quantum-chemical method with a molecular mechanics force field in such a way that an unbiased description of the dynamics of excess electron is achieved and the number of degrees of freedom is reduced effectively at the same time. ET reactions taking nanoseconds in systems with hundreds of quantum atoms can be simulated, bridging the gap between non-adiabatic ab initio simulations and model approaches such as the Marcus theory. A major recent application is hole transfer in DNA, which represents an archetypal ET reaction in a polarizable medium. Ongoing work focuses on hole transfer in proteins, peptides and organic semi-conductors. PMID:23883952

Automated property optimization via ab initio O(N) elongation method: Application to (hyper-)polarizability in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orimoto, Yuuichi, E-mail: orimoto.yuuichi.888@m.kyushu-u.ac.jp; Aoki, Yuriko; Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012

An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method,more » and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.« less

Automated property optimization via ab initio O(N) elongation method: Application to (hyper-)polarizability in DNA.

PubMed

Orimoto, Yuuichi; Aoki, Yuriko

2016-07-14

An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between "choose-maximum" (choose a base pair giving the maximum β for each step) and "choose-minimum" (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.

Rapid molecular assays for the detection of yellow fever virus in low-resource settings.

PubMed

Escadafal, Camille; Faye, Oumar; Sall, Amadou Alpha; Faye, Ousmane; Weidmann, Manfred; Strohmeier, Oliver; von Stetten, Felix; Drexler, Josef; Eberhard, Michael; Niedrig, Matthias; Patel, Pranav

2014-03-01

Yellow fever (YF) is an acute viral hemorrhagic disease transmitted by Aedes mosquitoes. The causative agent, the yellow fever virus (YFV), is found in tropical and subtropical areas of South America and Africa. Although a vaccine is available since the 1930s, YF still causes thousands of deaths and several outbreaks have recently occurred in Africa. Therefore, rapid and reliable diagnostic methods easy to perform in low-resources settings could have a major impact on early detection of outbreaks and implementation of appropriate response strategies such as vaccination and/or vector control. The aim of this study was to develop a YFV nucleic acid detection method applicable in outbreak investigations and surveillance studies in low-resource and field settings. The method should be simple, robust, rapid and reliable. Therefore, we adopted an isothermal approach and developed a recombinase polymerase amplification (RPA) assay which can be performed with a small portable instrument and easy-to-use lyophilized reagents. The assay was developed in three different formats (real-time with or without microfluidic semi-automated system and lateral-flow assay) to evaluate their application for different purposes. Analytical specificity and sensitivity were evaluated with a wide panel of viruses and serial dilutions of YFV RNA. Mosquito pools and spiked human plasma samples were also tested for assay validation. Finally, real-time RPA in portable format was tested under field conditions in Senegal. The assay was able to detect 20 different YFV strains and demonstrated no cross-reactions with closely related viruses. The RPA assay proved to be a robust, portable method with a low detection limit (<21 genome equivalent copies per reaction) and rapid processing time (<20 min). Results from real-time RPA field testing were comparable to results obtained in the laboratory, thus confirming our method is suitable for YFV detection in low-resource settings.

Rapid Molecular Assays for the Detection of Yellow Fever Virus in Low-Resource Settings

PubMed Central

Escadafal, Camille; Faye, Oumar; Sall, Amadou Alpha; Faye, Ousmane; Weidmann, Manfred; Strohmeier, Oliver; von Stetten, Felix; Drexler, Josef; Eberhard, Michael; Niedrig, Matthias; Patel, Pranav

2014-01-01

Background Yellow fever (YF) is an acute viral hemorrhagic disease transmitted by Aedes mosquitoes. The causative agent, the yellow fever virus (YFV), is found in tropical and subtropical areas of South America and Africa. Although a vaccine is available since the 1930s, YF still causes thousands of deaths and several outbreaks have recently occurred in Africa. Therefore, rapid and reliable diagnostic methods easy to perform in low-resources settings could have a major impact on early detection of outbreaks and implementation of appropriate response strategies such as vaccination and/or vector control. Methodology The aim of this study was to develop a YFV nucleic acid detection method applicable in outbreak investigations and surveillance studies in low-resource and field settings. The method should be simple, robust, rapid and reliable. Therefore, we adopted an isothermal approach and developed a recombinase polymerase amplification (RPA) assay which can be performed with a small portable instrument and easy-to-use lyophilized reagents. The assay was developed in three different formats (real-time with or without microfluidic semi-automated system and lateral-flow assay) to evaluate their application for different purposes. Analytical specificity and sensitivity were evaluated with a wide panel of viruses and serial dilutions of YFV RNA. Mosquito pools and spiked human plasma samples were also tested for assay validation. Finally, real-time RPA in portable format was tested under field conditions in Senegal. Conclusion/Significance The assay was able to detect 20 different YFV strains and demonstrated no cross-reactions with closely related viruses. The RPA assay proved to be a robust, portable method with a low detection limit (<21 genome equivalent copies per reaction) and rapid processing time (<20 min). Results from real-time RPA field testing were comparable to results obtained in the laboratory, thus confirming our method is suitable for YFV detection in low-resource settings. PMID:24603874

Nickel-Aluminum Layered Double Hydroxide Coating on the Surface of Conductive Substrates by Liquid Phase Deposition.

PubMed

Maki, Hideshi; Takigawa, Masashi; Mizuhata, Minoru

2015-08-12

The direct synthesis of the adhered Ni-Al LDH thin film onto the surface of electrically conductive substrates by the liquid phase deposition (LPD) reaction is carried out for the development of the positive electrode. The complexation and solution equilibria of the dissolved species in the LPD reaction have been clarified by a theoretical approach, and the LPD reaction conditions for the Ni-Al LDH depositions are shown to be optimized by controlling the fluoride ion concentration and the pH of the LPD reaction solutions. The yields of metal oxides and hydroxides by the LPD method are very sensitive to the supersaturation state of the hydroxide in the reaction solution. The surfaces of conductive substrates are completely covered by the minute mesh-like Ni-Al LDH thin film; furthermore, there is no gap between the surfaces of conductive substrates and the deposited Ni-Al LDH thin film. The active material layer thickness was able to be controlled within the range from 100 nm to 1 μm by the LPD reaction time. The high-crystallinity and the arbitrary-thickness thin films on the conductive substrate surface will be beneficial for the interface control of charge transfer reaction fields and the internal resistance reduction of various secondary batteries.

Simple model for estimating dry deposition velocity of ozone and its destruction in a polluted nocturnal boundary layer

NASA Astrophysics Data System (ADS)

Lin, Ching-Ho; Lai, Chin-Hsing; Wu, Yee-Lin; Chen, Ming-Jen

2010-11-01

Determining the destructions of both ozone and odd oxygen, O x, in the nocturnal boundary layer (NBL) is important to evaluate the regional ozone budget and overnight ozone accumulation. This work develops a simple method to determine the dry deposition velocity of ozone and its destruction at a polluted nocturnal boundary layer. The destruction of O x can also be determined simultaneously. The method is based on O 3 and NO 2 profiles and their surface measurements. Linkages between the dry deposition velocities of O 3 and NO 2 and between the dry deposition loss of O x and its chemical loss are constructed and used. Field measurements are made at an agricultural site to demonstrate the application of the model. The model estimated nocturnal O 3 dry deposition velocities from 0.13 to 0.19 cm s -1, very close to those previously obtained for similar land types. Additionally, dry deposition and chemical reactions account for 60 and 40% of the overall nocturnal ozone loss, respectively; ozone dry deposition accounts for 50% of the overall nocturnal loss of O x, dry deposition of NO 2 accounts for another 20%, and chemical reactions account for the remaining 30%. The proposed method enables the use of measurements made in typical ozone field studies to evaluate various nocturnal destructions of O 3 and O x in a polluted environment.

Gamma-Ray Dose Measurement with Radio-Photoluminescence Glass Dosimeter in Mixed Radiation Field for BNCT

NASA Astrophysics Data System (ADS)

Hiramatsu, K.; Yoshihashi, S.; Kusaka, S.; Sato, F.; Hoashi, E.; Murata, I.

2017-09-01

Accelerator based neutron sources (ABNS) are being developed as the next generation neutron irradiation system for BNCT. From the ABNS, unnecessary gamma-rays will be generated by neutron capture reactions, as well as fast neutrons. To control the whole-body radiation dose to the patient, measurement of gamma-ray dose in the irradiation room is necessary. In this study, the objective is to establish a method to measure gamma-ray dose separately in a neutron/gamma mixed field by using RPL glass dosimeter. For this purpose, we proposed a lead filter method which uses a pair of RPL glasses with and without a lead filter outside. In order to realize this method, the basic characteristics of glass dosimeter was verified in the gamma-ray field, before adapting it in the mixture field. From the result of the experiment using the lead filter, the simulation result especially for the case with a lead filter overestimated the absorbed does obtained from measurement. We concluded that the reason of the discrepancy is caused by existence of gradient of the dose distribution in the glass, and the difference of sensitivity to low-energy photon between measurement and theory.

Dual field effects in electrolyte-gated spinel ferrite: electrostatic carrier doping and redox reactions.

PubMed

Ichimura, Takashi; Fujiwara, Kohei; Tanaka, Hidekazu

2014-07-24

Controlling the electronic properties of functional oxide materials via external electric fields has attracted increasing attention as a key technology for next-generation electronics. For transition-metal oxides with metallic carrier densities, the electric-field effect with ionic liquid electrolytes has been widely used because of the enormous carrier doping capabilities. The gate-induced redox reactions revealed by recent investigations have, however, highlighted the complex nature of the electric-field effect. Here, we use the gate-induced conductance modulation of spinel ZnxFe₃₋xO₄ to demonstrate the dual contributions of volatile and non-volatile field effects arising from electronic carrier doping and redox reactions. These two contributions are found to change in opposite senses depending on the Zn content x; virtual electronic and chemical field effects are observed at appropriate Zn compositions. The tuning of field-effect characteristics via composition engineering should be extremely useful for fabricating high-performance oxide field-effect devices.

Flow field description of the Space Shuttle Vernier reaction control system exhaust plumes

NASA Technical Reports Server (NTRS)

Cerimele, Mary P.; Alred, John W.

1987-01-01

The flow field for the Vernier Reaction Control System (VRCS) jets of the Space Shuttle Orbiter has been calculated from the nozzle throat to the far-field region. The calculations involved the use of recently improved rocket engine nozzle/plume codes. The flow field is discussed, and a brief overview of the calculation techniques is presented. In addition, a proposed on-orbit plume measurement experiment, designed to improve future estimations of the Vernier flow field, is addressed.

Low temperature magnetic properties of GdFeO3

NASA Astrophysics Data System (ADS)

Paul, Pralay; Prajapat, C. L.; Rajarajan, A. K.; Rao, T. V. Chandrasekhar

2018-04-01

Polycrystalline GdFeO3 was prepared using conventional solid state reaction method. Magnetization studies at low temperatures show antiferromagnetic ordering of Gd moments at ˜2.5K. Saturation in magnetization is noted at 2K under moderate magnetic fields, a result hitherto unreported. We conjecture that such a saturation is indicative of weakening of Dzyaloshinskii-Moriya interaction between Gd and Fe sublattices.

The externally corrected coupled cluster approach with four- and five-body clusters from the CASSCF wave function.

PubMed

Xu, Enhua; Li, Shuhua

2015-03-07

An externally corrected CCSDt (coupled cluster with singles, doubles, and active triples) approach employing four- and five-body clusters from the complete active space self-consistent field (CASSCF) wave function (denoted as ecCCSDt-CASSCF) is presented. The quadruple and quintuple excitation amplitudes within the active space are extracted from the CASSCF wave function and then fed into the CCSDt-like equations, which can be solved in an iterative way as the standard CCSDt equations. With a size-extensive CASSCF reference function, the ecCCSDt-CASSCF method is size-extensive. When the CASSCF wave function is readily available, the computational cost of the ecCCSDt-CASSCF method scales as the popular CCSD method (if the number of active orbitals is small compared to the total number of orbitals). The ecCCSDt-CASSCF approach has been applied to investigate the potential energy surface for the simultaneous dissociation of two O-H bonds in H2O, the equilibrium distances and spectroscopic constants of 4 diatomic molecules (F2(+), O2(+), Be2, and NiC), and the reaction barriers for the automerization reaction of cyclobutadiene and the Cl + O3 → ClO + O2 reaction. In most cases, the ecCCSDt-CASSCF approach can provide better results than the CASPT2 (second order perturbation theory with a CASSCF reference function) and CCSDT methods.

A compartmentalized solute transport model for redox zones in contaminated aquifers: 2. Field‐scale simulations

USGS Publications Warehouse

Abrams , Robert H.; Loague, Keith

2000-01-01

This paper, the second of two parts [see Abrams and Loague, this issue], reports the field‐scale application of COMPTRAN (compartmentalized solute transport model) for simulating the development of redox zones. COMPTRAN is fully developed and described in the companion paper. Redox zones, which are often delineated by the relative concentrations of dissolved oxygen, have been observed around the globe. The distribution of other redox‐sensitive species is affected by redox zonation. At the U.S. Geological Survey's Cape Cod research site, an anoxic zone containing high concentrations of dissolved iron has been observed. Field data were abstracted from the Cape Cod site for the one‐dimensional and two‐dimensional COMPTRAN simulations reported in this paper. The purpose of the concept‐development simulations was to demonstrate that the compartmentalized approach reported by Abrams et al. [1998] can be linked with a solute transport model to simulate field‐scale phenomena. The results presented in this paper show that COMPTRAN successfully simulated the development of redox zones at the field scale, including trends in pH and alkalinity. Thermodynamic constraints were used to prevent lower‐energy redox reactions from occurring under infeasible geochemical conditions without imposing equilibrium among all redox species. Empirical methods of reaction inhibition were not needed for the simulations conducted for this study. COMPTRAN can be extended easily to include additional compartments and reactions and is capable of handling complex velocity fields in more than one dimension.

Assessing occupational exposure to sea lamprey pesticides

PubMed Central

Ceballos, Diana M; Beaucham, Catherine C; Kurtz, Kristine; Musolin, Kristin

2015-01-01

Background: Sea lampreys are parasitic fish found in lakes of the United States and Canada. Sea lamprey is controlled through manual application of the pesticides 3-trifluoromethyl-4-nitrophenol (TFM) and BayluscideTM into streams and tributaries. 3-Trifluoromethyl-4-nitrophenol may cause irritation and central nervous system depression and Bayluscide may cause irritation, dermatitis, blisters, cracking, edema, and allergic skin reactions. Objectives: To assess occupational exposures to sea lamprey pesticides. Methods: We developed a wipe method for evaluating surface and skin contamination with these pesticides. This method was field tested at a biological field station and at a pesticide river application. We also evaluated exposures using control banding tools. Results: We verified TFM surface contamination at the biological station. At the river application, we found surfaces and worker’s skin contaminated with pesticides. Conclusion: We recommended minimizing exposures by implementing engineering controls and improved use of personal protective equipment. PMID:25730600

Structure reactivity relationships during N2O hydrogenation over Au-Ag alloys: A study by field emission techniques

NASA Astrophysics Data System (ADS)

Jacobs, Luc; Barroo, Cédric; Gilis, Natalia; Lambeets, Sten V.; Genty, Eric; Visart de Bocarmé, Thierry

2018-03-01

To make available atomic oxygen at the surface of a catalyst is the key step for oxidation reactions on Au-based catalysts. In this context, Au-Ag alloys catalysts exhibit promising properties for selective oxidation reactions of alcohols: low temperature activity and high selectivity. The presence of O(ads) and its effects on the catalytic reactivity is studied via the N2O dissociative adsorption and subsequent hydrogenation. Field emission techniques are particularly suited to study this reaction: Field Ion Microscopy (FIM) and Field Emission Microscopy (FEM) enable to image the extremity of sharp metallic tips, the size and morphology of which are close to those of one single catalytic particle. The reaction dynamics is studied in the 300-320 K temperature range and at a pressure of 3.5 × 10-3 Pa. The main results are a strong structure/reactivity relationship during N2O + H2 reaction over Au-8.8 at.%Ag model catalysts. Comparison of high-resolution FIM images of the clean sample and FEM images during reaction shows a sensitivity of the reaction to the local structure of the facets, independently of the used partial pressures of both N2O and H2. This suggests a localised dissociative adsorption step for N2O and H2 with the formation of a reactive interface around the {210} facets.

A powerless on-the-spot detection protocol for transgenic crops within 30 min, from leaf sampling up to results.

PubMed

Wang, Liu; Wang, Rui; Yu, Yonghua; Zhang, Fang; Wang, Xiaofu; Ying, Yibin; Wu, Jian; Xu, Junfeng

2016-01-01

The requirement of power-dependent instruments or excessive operation time usually restricts current nucleic acid amplification methods from being used for detection of transgenic crops in the field. In this paper, an easy and rapid detection method which requires no electricity supply has been developed. The time-consuming process of nucleic acid purification is omitted in this method. DNA solution obtained from leaves with 0.5 M sodium hydroxide (NaOH) can be used for loop-mediated isothermal amplification (LAMP) only after simple dilution. Traditional instruments like a polymerase chain reaction (PCR) amplifier and water bath used for DNA amplification are abandoned. Three kinds of dewar flasks were tested and it turned out that the common dewar flask was the best. Combined with visual detection of LAMP amplicons by phosphate (Pi)-induced coloration reaction, the whole process of detection of transgenic crops via genetically pure material (leaf material of one plant) could be accomplished within 30 min. The feasibility of this method was also verified by analysis of practical samples.

Advanced methodology to determine plant stresses using in-situ spectral data

NASA Astrophysics Data System (ADS)

Polinova, Maria; Brook, Anna; Housh, Mashor

2017-04-01

Fluorescence method in remote sensing has long been a traditional method estimating plant state. Vegetation indices (VIs) are tool for assessment plants' state based on its spectral characteristics. During the last half-century, in this domain were developed many vegetation indices and even more modifications of these indices. Nowadays, visible range across electromagnetic waves allows assessing plants' health and calculating its physical parameters. One of the VI's capabilities is detecting stress in plants. This approach has application in different areas. For discerning external environment (unnatural) stress from features of plant's development most of VIs have border values for greenness and health. This is the reason for these methods to be superficial and insufficient detecting and estimating stresses on the early stages. This limits plays especial importance in agriculture. Late stress detection leads to irreversible damage in crops and yield loss. We propose new principle of VI analysis for determination unnatural stress on early stages. Novelty of this method is common consideration several VIs related to plant's pigmentation: chlorophyll, carotenoids and anthocyanins. We have tasted this method on two agriculture fields: tomatoes and cotton. The goal of study was to determinate water crop stress at its beginning. A single VI shows reactions on emergence growth stage, fruit producing and ripening phase. It was hard to isolate crops' reaction on water from reaction on growth changes. Nevertheless, we have noted that there is correlation between chlorophyll VIs and carotenoid VIs. The correlation strength was depended on stress type. Based on common VIs analysis we were able to identify dryness and over irrigation stress. In addition, we have determine reaction on fertilizers input. Common VIs analysis can improve existing fluorescence method of remote sensing monitoring. It can find application in areas where the early plant's stress detection is very impotent (e.g. agriculture). Another advantage of this method is identifying stress type. It can increase the role of spectral data for design making.

Origin of Nanobubbles Electrochemically Formed in a Magnetic Field: Ionic Vacancy Production in Electrode Reaction

NASA Astrophysics Data System (ADS)

Aogaki, Ryoichi; Sugiyama, Atsushi; Miura, Makoto; Oshikiri, Yoshinobu; Miura, Miki; Morimoto, Ryoichi; Takagi, Satoshi; Mogi, Iwao; Yamauchi, Yusuke

2016-07-01

As a process complementing conventional electrode reactions, ionic vacancy production in electrode reaction was theoretically examined; whether reaction is anodic or cathodic, based on the momentum conservation by Newton’s second law of motion, electron transfer necessarily leads to the emission of original embryo vacancies, and dielectric polarization endows to them the same electric charge as trans- ferred in the reaction. Then, the emitted embryo vacancies immediately receive the thermal relaxation of solution particles to develop steady-state vacancies. After the vacancy production, nanobubbles are created by the collision of the vacancies in a vertical magnetic field.

Investigations on landmine detection by neutron-based techniques.

PubMed

Csikai, J; Dóczi, R; Király, B

2004-07-01

Principles and techniques of some neutron-based methods used to identify the antipersonnel landmines (APMs) are discussed. New results have been achieved in the field of neutron reflection, transmission, scattering and reaction techniques. Some conclusions are as follows: The neutron hand-held detector is suitable for the observation of anomaly caused by a DLM2-like sample in different soils with a scanning speed of 1m(2)/1.5 min; the reflection cross section of thermal neutrons rendered the determination of equivalent thickness of different soil components possible; a simple method was developed for the determination of the thermal neutron flux perturbation factor needed for multi-elemental analysis of bulky samples; unfolded spectra of elastically backscattered neutrons using broad-spectrum sources render the identification of APMs possible; the knowledge of leakage spectra of different source neutrons is indispensable for the determination of the differential and integrated reaction rates and through it the dimension of the interrogated volume; the precise determination of the C/O atom fraction requires the investigations on the angular distribution of the 6.13MeV gamma-ray emitted in the (16)O(n,n'gamma) reaction. These results, in addition to the identification of landmines, render the improvement of the non-intrusive neutron methods possible.

Reactions of the nervous system to magnetic fields

NASA Technical Reports Server (NTRS)

Kholodov, Y. A.

1974-01-01

This magnetobiological survey considers sensory, nervous, stress and genetic effects of magnetic fields on man and animals. It is shown that the nervous system plays an important role in the reactions of the organism to magnetic fields; the final biological effect is a function of the strength of the magnetic fields, the gradient, direction of the lines of force, duration and location of the action, and the functional status of the organism.

Advances in Green Organic Sonochemistry.

PubMed

Draye, Micheline; Kardos, Nathalie

2016-10-01

Over the past 15 years, sustainable chemistry has emerged as a new paradigm in the development of chemistry. In the field of organic synthesis, green chemistry rhymes with relevant choice of starting materials, atom economy, methodologies that minimize the number of chemical steps, appropriate use of benign solvents and reagents, efficient strategies for product isolation and purification and energy minimization. In that context, unconventional methods, and especially ultrasound, can be a fine addition towards achieving these green requirements. Undoubtedly, sonochemistry is considered as being one of the most promising green chemical methods (Cravotto et al. Catal Commun 63: 2-9, 2015). This review is devoted to the most striking results obtained in green organic sonochemistry between 2006 and 2016. Furthermore, among catalytic transformations, oxidation reactions are the most polluting reactions in the chemical industry; thus, we have focused a part of our review on the very promising catalytic activity of ultrasound for oxidative purposes.

Nanostructured electrocatalysts with tunable activity and selectivity

NASA Astrophysics Data System (ADS)

Mistry, Hemma; Varela, Ana Sofia; Kühl, Stefanie; Strasser, Peter; Cuenya, Beatriz Roldan

2016-04-01

The field of electrocatalysis has undergone tremendous advancement in the past few decades, in part owing to improvements in catalyst design at the nanoscale. These developments have been crucial for the realization of and improvement in alternative energy technologies based on electrochemical reactions such as fuel cells. Through the development of novel synthesis methods, characterization techniques and theoretical methods, rationally designed nanoscale electrocatalysts with tunable activity and selectivity have been achieved. This Review explores how nanostructures can be used to control electrochemical reactivity, focusing on three model reactions: O2 electroreduction, CO2 electroreduction and ethanol electrooxidation. The mechanisms behind nanoscale control of reactivity are discussed, such as the presence of low-coordinated sites or facets, strain, ligand effects and bifunctional effects in multimetallic materials. In particular, studies of how particle size, shape and composition in nanostructures can be used to tune reactivity are highlighted.

The Dynamic Mutation Characteristics of Thermonuclear Reaction in Tokamak

PubMed Central

Li, Jing; Quan, Tingting; Zhang, Wei; Deng, Wei

2014-01-01

The stability and bifurcations of multiple limit cycles for the physical model of thermonuclear reaction in Tokamak are investigated in this paper. The one-dimensional Ginzburg-Landau type perturbed diffusion equations for the density of the plasma and the radial electric field near the plasma edge in Tokamak are established. First, the equations are transformed to the average equations with the method of multiple scales and the average equations turn to be a Z 2-symmetric perturbed polynomial Hamiltonian system of degree 5. Then, with the bifurcations theory and method of detection function, the qualitative behavior of the unperturbed system and the number of the limit cycles of the perturbed system for certain groups of parameter are analyzed. At last, the stability of the limit cycles is studied and the physical meaning of Tokamak equations under these parameter groups is given. PMID:24892099

Fast and inexpensive synthesis of pentacene with high yield using 6,13-pentacenequinone as precursor

NASA Astrophysics Data System (ADS)

Mota, María L.; Rodriguez, Bibiana; Carrillo, Amanda; Ambrosio, Roberto C.; Luque, Priscy A.; Mireles, Marcela; Vivaldo, Israel; Quevedo, Manuel A.

2018-02-01

Pentacene is an important semiconductor in the field of organic electronics. In this work is presented an alternative synthesis procedure to obtain pentacene from 6,13-pentacenequinone as a precursor. Synthesis of pentacene was performed in two reactions, Diels-Adler cycloaddition of 6,13-pentacenequinone followed by 6,13-pentacenequinone reduction to pentacene, employing LiAlH4 as reducing agent. The products were characterized by Fourier Transform Infrared Spectroscopy (FTIR), 1H-Nuclear Magnetic Resonance Spectroscopy (1H-NMR), X-Ray Diffraction (XRD), Thermogravimetric Analysis (TGA) and Ultraviolet-Visible Spectroscopy (UV-VIS). In this work, 6,13-pentacenequinone was synthetized with a high yield (55%) using an alternative method. The optimization process resulted in an overall reduction of reaction time while exhibiting high yield. The method presented here provides an affordable pentacene synthesis route with high purity, which can be further applied for research and development of organic electronic applications.

Prediction of Surface and pH-Specific Binding of Peptides to Metal and Oxide Nanoparticles

NASA Astrophysics Data System (ADS)

Heinz, Hendrik; Lin, Tzu-Jen; Emami, Fateme Sadat; Ramezani-Dakhel, Hadi; Naik, Rajesh; Knecht, Marc; Perry, Carole C.; Huang, Yu

2015-03-01

The mechanism of specific peptide adsorption onto metallic and oxidic nanostructures has been elucidated in atomic resolution using novel force fields and surface models in comparison to measurements. As an example, variations in peptide adsorption on Pd and Pt nanoparticles depending on shape, size, and location of peptides on specific bounding facets are explained. Accurate computational predictions of reaction rates in C-C coupling reactions using particle models derived from HE-XRD and PDF data illustrate the utility of computational methods for the rational design of new catalysts. On oxidic nanoparticles such as silica and apatites, it is revealed how changes in pH lead to similarity scores of attracted peptides lower than 20%, supported by appropriate model surfaces and data from adsorption isotherms. The results demonstrate how new computational methods can support the design of nanoparticle carriers for drug release and the understanding of calcification mechanisms in the human body.

Correlations between emission timescale of fragments and isospin dynamics in 124Sn+64Ni and 112Sn+58Ni reactions at 35A MeV

NASA Astrophysics Data System (ADS)

De Filippo, E.; Pagano, A.; Russotto, P.; Amorini, F.; Anzalone, A.; Auditore, L.; Baran, V.; Berceanu, I.; Borderie, B.; Bougault, R.; Bruno, M.; Cap, T.; Cardella, G.; Cavallaro, S.; Chatterjee, M. B.; Chbihi, A.; Colonna, M.; D'Agostino, M.; Dayras, R.; Di Toro, M.; Frankland, J.; Galichet, E.; Gawlikowicz, W.; Geraci, E.; Grzeszczuk, A.; Guazzoni, P.; Kowalski, S.; La Guidara, E.; Lanzalone, G.; Lanzanò, G.; Le Neindre, N.; Lombardo, I.; Maiolino, C.; Papa, M.; Piasecki, E.; Pirrone, S.; Płaneta, R.; Politi, G.; Pop, A.; Porto, F.; Rivet, M. F.; Rizzo, F.; Rosato, E.; Schmidt, K.; Siwek-Wilczyńska, K.; Skwira-Chalot, I.; Trifirò, A.; Trimarchi, M.; Verde, G.; Vigilante, M.; Wieleczko, J. P.; Wilczyński, J.; Zetta, L.; Zipper, W.

2012-07-01

We present a new experimental method to correlate the isotopic composition of intermediate mass fragments (IMF) emitted at midrapidity in semiperipheral collisions with the emission timescale: IMFs emitted in the early stage of the reaction show larger values of isospin asymmetry, stronger angular anisotropies, and reduced odd-even staggering effects in neutron to proton ratio distributions than those produced in sequential statistical emission. All these effects support the concept of isospin “migration”, that is sensitive to the density gradient between participant and quasispectator nuclear matter, in the so called neck fragmentation mechanism. By comparing the data to a stochastic mean field (SMF) simulation we show that this method gives valuable constraints on the symmetry energy term of nuclear equation of state at subsaturation densities. An indication emerges for a linear density dependence of the symmetry energy.

Study on the syhthesis process of tetracaine hydrochloride

NASA Astrophysics Data System (ADS)

Li, Wenli; Zhao, Jie; Cui, Yujie

2017-05-01

Tetrachloride hydrochloride is a local anesthetic with long-acting ester, and it is usually present in the form of a hydrochloride salt. Firsleb first synthesized the tetracaine by experiment in 1928, which is one of the recognized clinical potent anesthetics. This medicine has the advantages of stable physical and chemical properties, the rapid role and long maintenance. Tetracaine is also used for ophthalmic surface anesthesia as one of the main local anesthetic just like conduction block anesthesia, mucosal surface anesthesia and epidural anesthesia. So far, the research mainly engaged in its clinical application research, and the research strength is relatively small in the field of synthetic technology. The general cost of the existing production process is high, and the yield is low. In addition, the reaction time is long and the reaction conditions are harsh. In this paper, a new synthetic method was proposed for the synthesis of tetracaine hydrochloride. The reaction route has the advantages of few steps, high yield, short reaction time and mild reaction conditions. The cheap p-nitrobenzoic acid was selected as raw material. By esterification with ethanol and reaction with n-butyraldehyde (the reaction process includes nitro reduction, aldol condensation and hydrogenation reduction), the intermediate was transesterified with dimethylaminoethanol under basic conditions. Finally, the PH value was adjusted in the ethanol solvent. After experiencing 4 steps reaction, the crude tetracaine hydrochloride was obtained.

Construction of monoenergetic neutron calibration fields using 45Sc(p, n)45Ti reaction at JAEA.

PubMed

Tanimura, Y; Saegusa, J; Shikaze, Y; Tsutsumi, M; Shimizu, S; Yoshizawa, M

2007-01-01

The 8 and 27 keV monoenergetic neutron calibration fields have been developed by using (45)Sc(p, n)(45)Ti reaction. Protons from a 4-MV Pelletron accelerator are used to bombard a thin scandium target evaporated onto a platinum disc. The proton energies are finely adjusted to the resonance to generate the 8 and 27 keV neutrons by applying a high voltage to the target assemblies. The neutron energies were measured using the time-of-flight method with a lithium glass scintillation detector. The neutron fluences at a calibration point located at 50 cm from the target were evaluated using Bonner spheres. A long counter was placed at 2.2 m from the target and at 60 degrees to the direction of the proton beam in order to monitor the fluence at the calibration point. Fluence and dose equivalent rates at the calibration point are sufficient to calibrate many types of the neutron survey metres.

Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

PubMed Central

Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

2011-01-01

The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

PubMed

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Equatorial Ligand Perturbations Influence the Reactivity of Manganese(IV)-Oxo Complexes.

PubMed

Massie, Allyssa A; Denler, Melissa C; Cardoso, Luísa Thiara; Walker, Ashlie N; Hossain, M Kamal; Day, Victor W; Nordlander, Ebbe; Jackson, Timothy A

2017-04-03

Manganese(IV)-oxo complexes are often invoked as intermediates in Mn-catalyzed C-H bond activation reactions. While many synthetic Mn IV -oxo species are mild oxidants, other members of this class can attack strong C-H bonds. The basis for these reactivity differences is not well understood. Here we describe a series of Mn IV -oxo complexes with N5 pentadentate ligands that modulate the equatorial ligand field of the Mn IV center, as assessed by electronic absorption, electron paramagnetic resonance, and Mn K-edge X-ray absorption methods. Kinetic experiments show dramatic rate variations in hydrogen-atom and oxygen-atom transfer reactions, with faster rates corresponding to weaker equatorial ligand fields. For these Mn IV -oxo complexes, the rate enhancements are correlated with both 1) the energy of a low-lying 4 E excited state, which has been postulated to be involved in a two-state reactivity model, and 2) the Mn III/IV reduction potentials. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stream-water storage in the ocean using an impermeable membrane

NASA Astrophysics Data System (ADS)

Murabayashi, E. T.; Asuka, M.; Yamada, R.; Fok, Y. S.; Gee, H. K.

1983-05-01

The conceptual feasibility of storing fresh water in the ocean was investigated using a plastic membrane as the reservoir liner. In the initial phase, two physical hydraulic models were constructed to test the concept. The first was a water-filled, glass-sided box to observe the movement and reaction of the membrane to various simulated effects of currents, waves, and sediment deposition. The second was a 1:400-scale model (6.7 x 6.1 m) of West Loch, Pearl Harbor (a potential field application site), with 1:24 vertical exaggeration for similitude. The curtain method was used because it can enclose a large water body. The effect of wind, waves, tides, and currents on the curtain were simulated and the reactions observed. Although modeling is a useful tool for investigating initial concepts, its direct field application is limited because of scaling. Curtains, floating reservoirs, and bags were constructed of polyethylene sheets and deployed. All worked well after modifications were made following initial testing.

Electronic excitation spectra of molecules in solution calculated using the symmetry-adapted cluster-configuration interaction method in the polarizable continuum model with perturbative approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuda, Ryoichi, E-mail: fukuda@ims.ac.jp; Ehara, Masahiro; Elements Strategy Initiative for Catalysts and Batteries

A perturbative approximation of the state specific polarizable continuum model (PCM) symmetry-adapted cluster-configuration interaction (SAC-CI) method is proposed for efficient calculations of the electronic excitations and absorption spectra of molecules in solutions. This first-order PCM SAC-CI method considers the solvent effects on the energies of excited states up to the first-order with using the zeroth-order wavefunctions. This method can avoid the costly iterative procedure of the self-consistent reaction field calculations. The first-order PCM SAC-CI calculations well reproduce the results obtained by the iterative method for various types of excitations of molecules in polar and nonpolar solvents. The first-order contribution ismore » significant for the excitation energies. The results obtained by the zeroth-order PCM SAC-CI, which considers the fixed ground-state reaction field for the excited-state calculations, are deviated from the results by the iterative method about 0.1 eV, and the zeroth-order PCM SAC-CI cannot predict even the direction of solvent shifts in n-hexane for many cases. The first-order PCM SAC-CI is applied to studying the solvatochromisms of (2,2{sup ′}-bipyridine)tetracarbonyltungsten [W(CO){sub 4}(bpy), bpy = 2,2{sup ′}-bipyridine] and bis(pentacarbonyltungsten)pyrazine [(OC){sub 5}W(pyz)W(CO){sub 5}, pyz = pyrazine]. The SAC-CI calculations reveal the detailed character of the excited states and the mechanisms of solvent shifts. The energies of metal to ligand charge transfer states are significantly sensitive to solvents. The first-order PCM SAC-CI well reproduces the observed absorption spectra of the tungsten carbonyl complexes in several solvents.« less

The Synthesis and Photoluminescent Properties of CaMoO₄:Eu³⁺ Nanocrystals by a Soft Chemical Route.

PubMed

Li, Fuhai; Yu, Lixin; Sun, Jiaju; Li, Songchu; Wei, Shuilin

2017-04-01

In this paper, the CaMoO4:Eu3+ phosphors were prepared by a simple hydrothermal method assisted by the citric acid as the surfactant, and characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM), and fluorescent spectrophotometry. The results of XRD show that the as-prepared samples are single phase. The process of the Ostwald ripening is controlled by the content of the citric acid in the hydrothermal reaction. The pH value of the precursor affects the shift of the charge transition band (CTB) in the excitation spectra. The reaction condition can strongly affect the luminescent intensity of the samples.

Electromagnetic Formation Flight (EMFF) for Sparse Aperture Arrays

NASA Technical Reports Server (NTRS)

Kwon, Daniel W.; Miller, David W.; Sedwick, Raymond J.

2004-01-01

Traditional methods of actuating spacecraft in sparse aperture arrays use propellant as a reaction mass. For formation flying systems, propellant becomes a critical consumable which can be quickly exhausted while maintaining relative orientation. Additional problems posed by propellant include optical contamination, plume impingement, thermal emission, and vibration excitation. For these missions where control of relative degrees of freedom is important, we consider using a system of electromagnets, in concert with reaction wheels, to replace the consumables. Electromagnetic Formation Flight sparse apertures, powered by solar energy, are designed differently from traditional propulsion systems, which are based on V. This paper investigates the design of sparse apertures both inside and outside the Earth's gravity field.

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

NASA Astrophysics Data System (ADS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-03-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

Ultrafine cobalt nanoparticles supported on reduced graphene oxide: Efficient catalyst for fast reduction of hexavalent chromium at room temperature

NASA Astrophysics Data System (ADS)

Xu, Tingting; Xue, Jinjuan; Zhang, Xiaolei; He, Guangyu; Chen, Haiqun

2017-04-01

A novel composite ultrafine cobalt nanoparticles-reduced graphene oxide (Co-RGO) was firstly synthesized through a modified one-step solvothermal method with Co(OH)2 as the precursor. The prepared low-cost Co-RGO composite exhibited excellent catalytic activity for the reduction of highly toxic Cr(VI) to nontoxic Cr(III) at room temperature when formic acid (HCOOH) was employed as the reductant, and its catalytic performance was even comparable with that of noble metal-based catalysts in the same reduction reaction. Moreover, Co-RGO composite could be readily recovered under an external magnetic field and efficiently participated in recycled reaction for Cr(VI) reduction.

Quantitative polymerase chain reaction for transforming growth factor-β applied to a field study of fish health in Chesapeake Bay tributaries

USGS Publications Warehouse

Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.

2000-01-01

Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.

Advancing the frontiers in nanocatalysis, biointerfaces, and renewable energy conversion by innovations of surface techniques.

PubMed

Somorjai, Gabor A; Frei, Heinz; Park, Jeong Y

2009-11-25

The challenge of chemistry in the 21st century is to achieve 100% selectivity of the desired product molecule in multipath reactions ("green chemistry") and develop renewable energy based processes. Surface chemistry and catalysis play key roles in this enterprise. Development of in situ surface techniques such as high-pressure scanning tunneling microscopy, sum frequency generation (SFG) vibrational spectroscopy, time-resolved Fourier transform infrared methods, and ambient pressure X-ray photoelectron spectroscopy enabled the rapid advancement of three fields: nanocatalysts, biointerfaces, and renewable energy conversion chemistry. In materials nanoscience, synthetic methods have been developed to produce monodisperse metal and oxide nanoparticles (NPs) in the 0.8-10 nm range with controlled shape, oxidation states, and composition; these NPs can be used as selective catalysts since chemical selectivity appears to be dependent on all of these experimental parameters. New spectroscopic and microscopic techniques have been developed that operate under reaction conditions and reveal the dynamic change of molecular structure of catalysts and adsorbed molecules as the reactions proceed with changes in reaction intermediates, catalyst composition, and oxidation states. SFG vibrational spectroscopy detects amino acids, peptides, and proteins adsorbed at hydrophobic and hydrophilic interfaces and monitors the change of surface structure and interactions with coadsorbed water. Exothermic reactions and photons generate hot electrons in metal NPs that may be utilized in chemical energy conversion. The photosplitting of water and carbon dioxide, an important research direction in renewable energy conversion, is discussed.

Interfacial Reaction Studies Using ONIOM

NASA Technical Reports Server (NTRS)

Cardelino, Beatriz H.

2003-01-01

In this report, we focus on the calculations of the energetics and chemical kinetics of heterogeneous reactions for Organometallic vapor phase epitaxy (OMVPE). The work described in this report builds upon our own previous thermochemical and chemical kinetics studies. The first of these articles refers to the prediction of thermochemical properties, and the latter one deals with the prediction of rate constants for gaseous homolytic dissociation reactions. The calculations of this investigation are at the microscopic level. The systems chosen consisted of a gallium nitride (GaN) substrate, and molecular nitrogen (N2) and ammonia (NH3) as adsorbants. The energetics for the adsorption and the adsorbant dissociation processes were estimated, and reaction rate constants for the dissociation reactions of free and adsorbed molecules were predicted. The energetics for substrate decomposition was also computed. The ONIOM method, implemented in the Gaussian98 program, was used to perform the calculations. This approach has been selected since it allows dividing the system into two layers that can be treated at different levels of accuracy. The atoms of the substrate were modeled using molecular mechanics6 with universal force fields, whereas the adsorbed molecules were approximated using quantum mechanics, based on density functional theory methods with B3LYP functionals and 6-311G(d,p) basis sets. Calculations for the substrate were performed in slabs of several unit cells in each direction. The N2 and NH3 adsorbates were attached to a central location at the Ga-lined surface.

High-resolution mineralogical characterization and biogeochemical modeling of uranium reaction pathways at the FRC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen Zhu

2006-06-15

High-Resolution Mineralogical Characterization and Biogeochemical Modeling of Uranium Reduction Pathways at the Oak Ridge Field-Research Center (FRC) Chen Zhu, Indiana University, David R. Veblen, Johns Hopkins University We have successfully completed a proof-of-concept, one-year grant on a three-year proposal from the former NABIR program, and here we seek additional two-year funding to complete and publish the research. Using a state-of-the-art 300-kV, atomic resolution, Field Emission Gun Transmission Electron Microscope (TEM), we have successfully identified three categories of mineral hosts for uranium in contaminated soils: (1) iron oxides; (2) mixed manganese-iron oxides; and (3) uranium phosphates. Method development using parallel electronmore » energy loss spectroscopy (EELS) associated with the TEM shows great promise for characterizing the valence states of immobilized U during bioremediation. We have also collected 27 groundwater samples from two push-pull field biostimulation tests, which form two time series from zero to approximately 600 hours. The temporal evolution in major cations, anions, trace elements, and the stable isotopes 34S, 18O in sulfate, 15N in nitrate, and 13C in dissolved inorganic carbon (DIC) clearly show that biostimulation resulted in reduction of nitrate, Mn(IV), Fe(III), U(VI), sulfate, and Tc(VII), and these reduction reactions were intimately coupled with a complex network of inorganic reactions evident from alkalinity, pH, Na, K, Mg, and Ca concentrations. From these temporal trends, apparent zero order rates were regressed. However, our extensive suite of chemical and isotopic data sets, perhaps the first and only comprehensive data set available at the FRC, show that the derived rates from these field biostimulation experiments are composite and lump-sum rates. There were several reactions that were occurring at the same time but were masked by these pseudo-zero order rates. A reaction-path model comprising a total of nine redox couples (NO3–/NH4+, MnO2(s)/Mn2+, Fe(OH)3(s) /Fe2+, TcO4–/TcO2(s), UO22+/UO2(s), SO42–/HS–, CO2/CH4, ethanol/acetate, and H+/H2.) is used to simulate the temporal biogeochemical evolution observed in the field tests. Preliminary results show that the models based on thermodynamics and more complex rate laws can generate the apparent zero order rates when several concurrent or competing reactions occur. Professor Alex Halliday of Oxford University, UK, and his postdoctoral associates are measuring the uranium isotopes in our groundwater samples. Newly developed state-of-the-art analytical techniques in measuring variability in 235U/238U offer the potential to distinguish biotic and abiotic uranium reductive mechanisms.« less

Quantification of diesel exhaust gas phase organics by a thermal desorption proton transfer reaction mass spectrometer

NASA Astrophysics Data System (ADS)

Erickson, M. H.; Wallace, H. W.; Jobson, B. T.

2012-02-01

A new approach was developed to measure the total abundance of long chain alkanes (C12 and above) in urban air using thermal desorption with a proton transfer reaction mass spectrometer (PTR-MS). These species are emitted in diesel exhaust and may be important precursors to secondary organic aerosol production in urban areas. Long chain alkanes undergo dissociative proton transfer reactions forming a series of fragment ions with formula CnH2n+1. The yield of the fragment ions is a function of drift conditions. At a drift field strength of 80 Townsends, the most abundant ion fragments from C10 to C16 n-alkanes were m/z 57, 71 and 85. The PTR-MS is insensitive to n-alkanes less than C8 but displays an increasing sensitivity for larger alkanes. Higher drift field strengths yield greater normalized sensitivity implying that the proton affinity of the long chain n-alkanes is less than H2O. Analysis of diesel fuel shows the mass spectrum was dominated by alkanes (CnH2n+1), monocyclic aromatics, and an ion group with formula CnH2n-1 (m/z 97, 111, 125, 139). The PTR-MS was deployed in Sacramento, CA during the Carbonaceous Aerosols and Radiative Effects Study field experiment in June 2010. The ratio of the m/z 97 to 85 ion intensities in ambient air matched that found in diesel fuel. Total diesel exhaust alkane concentrations calculated from the measured abundance of m/z 85 ranged from the method detection limit of ~1 μg m-3 to 100 μg m-3 in several air pollution episodes. The total diesel exhaust alkane concentration determined by this method was on average a factor of 10 greater than the sum of alkylbenzenes associated with spark ignition vehicle exhaust.

Reaction formulation for radiation and scattering from plates, corner reflectors and dielectric-coated cylinders

NASA Technical Reports Server (NTRS)

Wang, N. N.

1974-01-01

The reaction concept is employed to formulate an integral equation for radiation and scattering from plates, corner reflectors, and dielectric-coated conducting cylinders. The surface-current density on the conducting surface is expanded with subsectional bases. The dielectric layer is modeled with polarization currents radiating in free space. Maxwell's equation and the boundary conditions are employed to express the polarization-current distribution in terms of the surface-current density on the conducting surface. By enforcing reaction tests with an array of electric test sources, the moment method is employed to reduce the integral equation to a matrix equation. Inversion of the matrix equation yields the current distribution, and the scattered field is then obtained by integrating the current distribution. The theory, computer program and numerical results are presented for radiation and scattering from plates, corner reflectors, and dielectric-coated conducting cylinders.

Characterization of the Minimum Energy Path for the Reaction of Singlet Methylene with N2: The Role of Singlet Methylene in Prompt NO

NASA Technical Reports Server (NTRS)

Walch, Stephen P.

1995-01-01

We report calculations of the minimum energy pathways connecting CH2 + N2 to diazomethane and diazirine, for the rearrangement of diazirine to diazomethane, for the dissociation of diazirine to HCN2+H, and of diazomethane to CH2N+N. The calculations use Complete Active Space Self-Consistent Field (CASSCF) derivative methods to characterize the stationary points and Internally Contracted Configuration Interaction (ICCI) to determine the energetics. The calculations suggest a potential new source of prompt NO from the reaction CH2 with N2 to give diazirine, and subsequent reaction of diazirine with hydrogen abstracters to form doublet HCN2, which leads to HCN+N(S-4) on the previously studied CH+N2 surface. The calculations also predict accurate 0 K heats of formation of 77.7 kcal/mol and 68.0 kcal/mol for diazirine and diazomethane, respectively.

Lifetime and g-factor measurements of excited states using Coulomb excitation and alpha transfer reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guevara, Z. E., E-mail: zjguevaram@unal.edu.co; Torres, D. A., E-mail: datorresg@unal.edu.co

2016-07-07

In this contribution the challenges in the use of a setup to simultaneously measure lifetimes and g-factor values will be presented. The simultaneous use of the transient field technique and the Doppler Shift Attenuation Method, to measure magnetic moments and lifetimes respectively, allows to obtain a complete characterization of the currents of nucleons and the deformation in excited states close to the ground state. The technique is at the moment limited to Coulomb excitation and alpha-transfer reactions, what opens an interesting perspective to consider this type of experiments with radioactive beams. The use of deep-inelastic and fusion-evaporation reactions will bemore » discussed. An example of a setup that makes use of a beam of {sup 106}Cd to study excited states of {sup 110}Sn and the beam nuclei itself will be presented.« less

Rapid Detection of Prunus Necrotic Ringspot Virus by Reverse Transcription-cross-priming Amplification Coupled with Nucleic Acid Test Strip Cassette.

PubMed

Huo, Ya-Yun; Li, Gui-Fen; Qiu, Yan-Hong; Li, Wei-Min; Zhang, Yong-Jiang

2017-11-23

Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid test strip cassette (NATSC), a vertical flow (VF) visualization, for PNRSV detection. The RT-CPA-NATSC assay targets the encoding gene of the PNRSV coat protein with a limit of detection of 72 copies per reaction and no cross-reaction with the known Prunus pathogenic viruses and viroids, demonstrating high sensitivity and specificity. The reaction is performed on 60 °C and can be completed less than 90 min with the prepared template RNA. Field sample test confirmed the reliability of RT-CPA-NATSC, indicating the potential application of this simple and rapid detection method in routine test of PNRSV.

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

An inexpensive and rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplification

PubMed Central

Soliman, Hatem; El-Matbouli, Mansour

2005-01-01

Background Koi Herpesvirus (KHV) affects both juvenile and adult common carp and koi, and is especially lethal to fry. The high mortalities caused by the disease have had a negative impact on the international koi trade. Different diagnostic techniques have been used to detect KHV, including: isolation of the virus in cell culture, electron microscopy, several PCR tests, ELISA and in situ hybridisation. All of these methods are time consuming, laborious and require specialised equipment. Results A rapid field diagnosis of KHV in common and koi carp was developed using loop-mediated isothermal amplification (LAMP). The LAMP reaction rapidly amplified nucleic acid with high specificity and efficiency under isothermal conditions using a simple water bath. Two methods of extracting DNA from host tissue were compared: extraction by boiling and by using a commercial extraction kit. A set of six primers – two inner primers, two outer primers and two loop primers – was designed from a KHV amplicon. The reaction conditions were optimised for detection of KHV in 60 min at 65°C using Bst (Bacillus stearothermophilus) DNA polymerase. When visualised by gel electrophoresis, the products of the KHV LAMP assay appeared as a ladder pattern, with many bands of different sizes from 50 base-pairs (bp) up to the loading well. The KHV LAMP product could also be simply detected visually by adding SYBR Green I to the reaction tube and observing a colour change from orange to green. All samples positive for KHV by visual detection were confirmed positive by gel electrophoresis. The KHV LAMP had the same sensitivity as a standard PCR assay for the detection of KHV. Conclusion This paper describes an accelerated LAMP assay for diagnosis of KHV. The entire procedure took only 90 minutes to produce a result: 15 minutes for DNA extraction; 60 min for the LAMP reaction; 2 min for visual detection using SYBR Green I. The test can be used under field conditions because the only equipment it requires is a water bath. PMID:16216123

Future electro-optical sensors and processing in urban operations

NASA Astrophysics Data System (ADS)

Grönwall, Christina; Schwering, Piet B.; Rantakokko, Jouni; Benoist, Koen W.; Kemp, Rob A. W.; Steinvall, Ove; Letalick, Dietmar; Björkert, Stefan

2013-10-01

In the electro-optical sensors and processing in urban operations (ESUO) study we pave the way for the European Defence Agency (EDA) group of Electro-Optics experts (IAP03) for a common understanding of the optimal distribution of processing functions between the different platforms. Combinations of local, distributed and centralized processing are proposed. In this way one can match processing functionality to the required power, and available communication systems data rates, to obtain the desired reaction times. In the study, three priority scenarios were defined. For these scenarios, present-day and future sensors and signal processing technologies were studied. The priority scenarios were camp protection, patrol and house search. A method for analyzing information quality in single and multi-sensor systems has been applied. A method for estimating reaction times for transmission of data through the chain of command has been proposed and used. These methods are documented and can be used to modify scenarios, or be applied to other scenarios. Present day data processing is organized mainly locally. Very limited exchange of information with other platforms is present; this is performed mainly at a high information level. Main issues that arose from the analysis of present-day systems and methodology are the slow reaction time due to the limited field of view of present-day sensors and the lack of robust automated processing. Efficient handover schemes between wide and narrow field of view sensors may however reduce the delay times. The main effort in the study was in forecasting the signal processing of EO-sensors in the next ten to twenty years. Distributed processing is proposed between hand-held and vehicle based sensors. This can be accompanied by cloud processing on board several vehicles. Additionally, to perform sensor fusion on sensor data originating from different platforms, and making full use of UAV imagery, a combination of distributed and centralized processing is essential. There is a central role for sensor fusion of heterogeneous sensors in future processing. The changes that occur in the urban operations of the future due to the application of these new technologies will be the improved quality of information, with shorter reaction time, and with lower operator load.

General Dialdehyde Click Chemistry for Amine Bioconjugation.

PubMed

Elahipanah, Sina; O'Brien, Paul J; Rogozhnikov, Dmitry; Yousaf, Muhammad N

2017-05-17

The development of methods for conjugating a range of molecules to primary amine functional groups has revolutionized the fields of chemistry, biology, and material science. The primary amine is a key functional group and one of the most important nucleophiles and bases used in all of synthetic chemistry. Therefore, tremendous interest in the synthesis of molecules containing primary amines and strategies to devise chemical reactions to react with primary amines has been at the core of chemical research. In particular, primary amines are a ubiquitous functional group found in biological systems as free amino acids, as key side chain lysines in proteins, and in signaling molecules and metabolites and are also present in many natural product classes. Due to its abundance, the primary amine is the most convenient functional group handle in molecules for ligation to other molecules for a broad range of applications that impact all scientific fields. Because of the primary amine's central importance in synthetic chemistry, acid-base chemistry, redox chemistry, and biology, many methods have been developed to efficiently react with primary amines, including activated carboxylic acids, isothiocyanates, Michael addition type systems, and reaction with ketones or aldehydes followed by in situ reductive amination. Herein, we introduce a new traceless, high-yield, fast click-chemistry method based on the rapid and efficient trapping of amine groups via a functionalized dialdehyde group. The click reaction occurs in mild conditions in organic solvents or aqueous media and proceeds in high yield, and the starting dialdehyde reagent and resulting dialdehyde click conjugates are stable. Moreover, no catalyst or dialdehyde-activating group is required, and the only byproduct is water. The initial dialdehyde and the resulting conjugate are both straightforward to characterize, and the reaction proceeds with high atom economy. To demonstrate the broad scope of this new click-conjugation strategy, we designed a straightforward scheme to synthesize a suite of dialdehyde reagents. The dialdehyde molecules were used for applications in cell-surface engineering and for tailoring surfaces for material science applications. We anticipate the broad utility of the general dialdehyde click chemistry to primary amines in all areas of chemical research, ranging from polymers and bioconjugation to material science and nanoscience.

Extraction of contaminants from a gas

DOEpatents

Babko-Malyi, Sergei

2000-01-01

A method of treating industrial gases to remove contaminants is disclosed. Ions are generated in stream of injectable gas. These ions are propelled through the contaminated gas as it flows through a collection unit. An electric field is applied to the contaminated gas. The field causes the ions to move through the contaminated gases, producing electrical charges on the contaminants. The electrically charged contaminants are then collected at one side of the electric field. The injectable gas is selected to produce ions which will produce reactions with particular contaminants. The process is thus capable of removing particular contaminants. The process does not depend on diffusion as a transport mechanism and is therefore suitable for removing contaminants which exist in very low concentrations.

Apparatus for extraction of contaminants from a gas

DOEpatents

Babko-Malyi, Sergei

2001-01-01

A method of treating industrial gases to remove contaminants is disclosed. Ions are generated in stream of injectable gas. These ions are propelled through the contaminated gas as it flows through a collection unit. An electric field is applied to the contaminated gas. The field causes the ions to move through the contaminated gases, producing electrical charges on the contaminants. The electrically charged contaminants are then collected at one side of the electric field. The injectable gas is selected to produce ions which will produce reactions with particular contaminants. The process is thus capable of removing particular contaminants. The process does not depend on diffusion as a transport mechanism and is therefore suitable for removing contaminants which exist in very low concentrations.

Development of monitoring method of spatial neutron distribution in neutrons-gamma rays mixed field using imaging plate for NCT--depression of the field.

PubMed

Tanaka, Kenichi; Endo, Satoru; Hoshi, Masaharu; Takada, Jun

2011-12-01

The degree of depression in the neutron field caused by neutron absorption in the materials of an imaging plate (IP) was investigated using MCNP-4C. Consequently, the IP doped with Gd, which reproduced the distribution of (157)Gd(n,γ)(158)Gd reaction rate in the previous study, depresses the relative distribution by about 50%. The depression for the IP in which Gd is replaced with similar amount of B atoms was estimated to be about 10%. The signal intensity for this IP is estimated to be at a similar level with that for Gd-doped IP. Copyright © 2011 Elsevier Ltd. All rights reserved.

Development of a field method for measuring manganese in welding fume.

PubMed

Dale Marcy, A; Drake, Pamela L

2007-11-01

Workers who perform routine welding tasks are potentially exposed to fume that may contain manganese. Manganese may cause respiratory problems and is implicated in causing the occurrence of Parkinson-like symptoms. In this study, a field colorimetric method for extracting and measuring manganese in welding fume was developed. The method uses ultrasonic extraction with an acidic hydrogen peroxide solution to extract welding fume collected on polyvinyl chloride filters. Commercially available pre-packaged reagents are used to produce a colored solution, created by a reaction of manganese(ii) with 1-(2-pyridylazo)-2-naphthol. Absorbance measurements are then made using a portable spectrophotometer. The method detection limit and limit of quantification (LOQ) were 5.2 microg filter(-1) and 17 microg filter(-1), respectively, with a dynamic range up to 400 microg filter(-1). When the results are above the LOQ for the colorimetric method, the manganese masses are equivalent to those measured by the International Organization for Standardization Method 15202-2, which employs a strong acid digestion and analysis using inductively coupled plasma-optical emission spectrometry.

Coupled charge migration and fluid mixing in reactive fronts

NASA Astrophysics Data System (ADS)

Ghosh, Uddipta; Bandopadhyay, Aditya; Jougnot, Damien; Le Borgne, Tanguy; Meheust, Yves

2017-04-01

Quantifying fluid mixing in subsurface environments and its consequence on biogeochemical reactions is of paramount importance owing to its role in processes such as contaminant migration, aquifer remediation, CO2 sequestration or clogging processes, to name a few (Dentz et al. 2011). The presence of strong velocity gradients in porous media is expected to lead to enhanced diffusive mixing and augmented reaction rates (Le Borgne et al. 2014). Accurate in situ imaging of subsurface reactive solute transport and mixing remains to date a challenging proposition: the opacity of the medium prevents optical imaging and field methods based on tracer tests do not provide spatial information. Recently developed geophysical methods based on the temporal monitoring of electrical conductivity and polarization have shown promises for mapping and monitoring biogeochemical reactions in the subsurface although it remains challenging to decipher the multiple sources of electrical signals (e.g. Knight et al. 2010). In this work, we explore the coupling between fluid mixing, reaction and charge migration in porous media to evaluate the potential of mapping reaction rates from electrical measurements. To this end, we develop a new theoretical framework based on a lamellar mixing model (Le Borgne et al. 2013) to quantify changes in electrical mobility induced by chemical reactions across mixing fronts. Electrical conductivity and induced polarization are strongly dependent on the concentration of ionic species, which in turn depend on the local reaction rates. Hence, our results suggest that variation in real and complex electrical conductivity may be quantitatively related to the mixing and reaction dynamics. Thus, the presented theory provides a novel upscaling framework for quantifying the coupling between mixing, reaction and charge migration in heterogeneous porous media flows. References: Dentz. et al., Mixing, spreading and reaction in heterogeneous media: A brief review J. Contam. Hydrol. 120-121, 1 (2011). Le Borgne et al. Impact of Fluid Deformation on Mixing-Induced Chemical Reactions in heterogeneous Flows, Geophys. Res. Lett. 41, 7898 (2014). Knight, et al., Geophysics at the interface: Response of geophysical properties to solid-fluid, fluid-fluid, and solid-solid interfaces. Rev. Geophys. 48, (2010). Le Borgne et al. (2013) Stretching, coalescence and mixing in porous media, Phys. Rev. Lett., 110, 204501

Variational and perturbative formulations of quantum mechanical/molecular mechanical free energy with mean-field embedding and its analytical gradients.

PubMed

Yamamoto, Takeshi

2008-12-28

Conventional quantum chemical solvation theories are based on the mean-field embedding approximation. That is, the electronic wavefunction is calculated in the presence of the mean field of the environment. In this paper a direct quantum mechanical/molecular mechanical (QM/MM) analog of such a mean-field theory is formulated based on variational and perturbative frameworks. In the variational framework, an appropriate QM/MM free energy functional is defined and is minimized in terms of the trial wavefunction that best approximates the true QM wavefunction in a statistically averaged sense. Analytical free energy gradient is obtained, which takes the form of the gradient of effective QM energy calculated in the averaged MM potential. In the perturbative framework, the above variational procedure is shown to be equivalent to the first-order expansion of the QM energy (in the exact free energy expression) about the self-consistent reference field. This helps understand the relation between the variational procedure and the exact QM/MM free energy as well as existing QM/MM theories. Based on this, several ways are discussed for evaluating non-mean-field effects (i.e., statistical fluctuations of the QM wavefunction) that are neglected in the mean-field calculation. As an illustration, the method is applied to an S(N)2 Menshutkin reaction in water, NH(3)+CH(3)Cl-->NH(3)CH(3) (+)+Cl(-), for which free energy profiles are obtained at the Hartree-Fock, MP2, B3LYP, and BHHLYP levels by integrating the free energy gradient. Non-mean-field effects are evaluated to be <0.5 kcal/mol using a Gaussian fluctuation model for the environment, which suggests that those effects are rather small for the present reaction in water.

Pulsed-High Field/High-Frequency EPR Spectroscopy

NASA Astrophysics Data System (ADS)

Fuhs, Michael; Moebius, Klaus

Pulsed high-field/high-frequency electron paramagnetic resonance (EPR) spectroscopy is used to disentangle many kinds of different effects often obscured in continuous wave (cw) EPR spectra at lower magnetic fields/microwave frequencies. While the high magnetic field increases the resolution of G tensors and of nuclear Larmor frequencies, the high frequencies allow for higher time resolution for molecular dynamics as well as for transient paramagnetic intermediates studied with time-resolved EPR. Pulsed EPR methods are used for example for relaxation-time studies, and pulsed Electron Nuclear DOuble Resonance (ENDOR) is used to resolve unresolved hyperfine structure hidden in inhomogeneous linewidths. In the present article we introduce the basic concepts and selected applications to structure and mobility studies on electron transfer systems, reaction centers of photosynthesis as well as biomimetic models. The article concludes with an introduction to stochastic EPR which makes use of an other concept for investigating resonance systems in order to increase the excitation bandwidth of pulsed EPR. The limited excitation bandwidth of pulses at high frequency is one of the main limitations which, so far, made Fourier transform methods hardly feasible.

Discussion of the Investigation Method on the Reaction Kinetics of Metallurgical Reaction Engineering

NASA Astrophysics Data System (ADS)

Du, Ruiling; Wu, Keng; Zhang, Jiazhi; Zhao, Yong

Reaction kinetics of metallurgical physical chemistry which was successfully applied in metallurgy (as ferrous metallurgy, non-ferrous metallurgy) became an important theoretical foundation for subject system of traditional metallurgy. Not only the research methods were very perfect, but also the independent structures and systems of it had been formed. One of the important tasks of metallurgical reaction engineering was the simulation of metallurgical process. And then, the mechanism of reaction process and the conversion time points of different control links should be obtained accurately. Therefore, the research methods and results of reaction kinetics in metallurgical physical chemistry were not very suitable for metallurgical reaction engineering. In order to provide the definite conditions of transmission, reaction kinetics parameters and the conversion time points of different control links for solving the transmission and reaction equations in metallurgical reaction engineering, a new method for researching kinetics mechanisms in metallurgical reaction engineering was proposed, which was named stepwise attempt method. Then the comparison of results between the two methods and the further development of stepwise attempt method were discussed in this paper. As a new research method for reaction kinetics in metallurgical reaction engineering, stepwise attempt method could not only satisfy the development of metallurgical reaction engineering, but also provide necessary guarantees for establishing its independent subject system.

A Green's function method for simulation of time-dependent solute transport and reaction in realistic microvascular geometries

PubMed Central

Secomb, Timothy W.

2016-01-01

A novel theoretical method is presented for simulating the spatially resolved convective and diffusive transport of reacting solutes between microvascular networks and the surrounding tissues. The method allows for efficient computational solution of problems involving convection and non-linear binding of solutes in blood flowing through microvascular networks with realistic 3D geometries, coupled with transvascular exchange and diffusion and reaction in the surrounding tissue space. The method is based on a Green's function approach, in which the solute concentration distribution in the tissue is expressed as a sum of fields generated by time-varying distributions of discrete sources and sinks. As an example of the application of the method, the washout of an inert diffusible tracer substance from a tissue region perfused by a network of microvessels is simulated, showing its dependence on the solute's transvascular permeability and tissue diffusivity. Exponential decay of the washout concentration is predicted, with rate constants that are about 10–30% lower than the rate constants for a tissue cylinder model with the same vessel length, vessel surface area and blood flow rate per tissue volume. PMID:26443811

Sensitive detection of point mutation using exponential strand displacement amplification-based surface enhanced Raman spectroscopy.

PubMed

Huang, Si-Qiang; Hu, Juan; Zhu, Guichi; Zhang, Chun-Yang

2015-03-15

Accurate identification of point mutation is particularly imperative in the field of biomedical research and clinical diagnosis. Here, we develop a sensitive and specific method for point mutation assay using exponential strand displacement amplification (SDA)-based surface enhanced Raman spectroscopy (SERS). In this method, a discriminating probe and a hairpin probe are designed to specifically recognize the sequence of human K-ras gene. In the presence of K-ras mutant target (C→T), the 3'-terminal of discriminating probe and the 5'-terminal of hairpin probe can be ligated to form a SDA template. Subsequently, the 3'-terminal of hairpin probe can function as a primer to initiate the SDA reaction, producing a large amount of triggers. The resultant triggers can further hybridize with the discriminating probes to initiate new rounds of SDA reaction, leading to an exponential amplification reaction. With the addition of capture probe-modified gold nanoparticles (AuNPs) and the Rox-labeled reporter probes, the amplified triggers can be assembled on the surface of AuNPs through the formation of sandwich hybrids of capture probe-trigger-reporter probe, generating a strong Raman signal. While in the presence of K-ras wild-type target (C), neither ligation nor SDA reaction can be initiated and no Raman signal is observed. The proposed method exhibits high sensitivity with a detection limit of 1.4pM and can accurately discriminate as low as 1% variant frequency from the mixture of mutant target and wild-type target. Importantly, this method can be further applied to analyze the mutant target in the spiked HEK293T cell lysate, holding great potential for genetic analysis and disease prognosis. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular environmental geochemistry

NASA Astrophysics Data System (ADS)

O'Day, Peggy A.

1999-05-01

The chemistry, mobility, and bioavailability of contaminant species in the natural environment are controlled by reactions that occur in and among solid, aqueous, and gas phases. These reactions are varied and complex, involving changes in chemical form and mass transfer among inorganic, organic, and biochemical species. The field of molecular environmental geochemistry seeks to apply spectroscopic and microscopic probes to the mechanistic understanding of environmentally relevant chemical processes, particularly those involving contaminants and Earth materials. In general, empirical geochemical models have been shown to lack uniqueness and adequate predictive capability, even in relatively simple systems. Molecular geochemical tools, when coupled with macroscopic measurements, can provide the level of chemical detail required for the credible extrapolation of contaminant reactivity and bioavailability over ranges of temperature, pressure, and composition. This review focuses on recent advances in the understanding of molecular chemistry and reaction mechanisms at mineral surfaces and mineral-fluid interfaces spurred by the application of new spectroscopies and microscopies. These methods, such as synchrotron X-ray absorption and scattering techniques, vibrational and resonance spectroscopies, and scanning probe microscopies, provide direct chemical information that can elucidate molecular mechanisms, including element speciation, ligand coordination and oxidation state, structural arrangement and crystallinity on different scales, and physical morphology and topography of surfaces. Nonvacuum techniques that allow examination of reactions in situ (i.e., with water or fluids present) and in real time provide direct links between molecular structure and reactivity and measurements of kinetic rates or thermodynamic properties. Applications of these diverse probes to laboratory model systems have provided fundamental insight into inorganic and organic reactions at mineral surfaces and mineral-water interfaces. A review of recent studies employing molecular characterizations of soils, sediments, and biological samples from contaminated sites exemplifies the utility and benefits, as well as the challenge, of applying molecular probes to complicated natural materials. New techniques, technological advances, and the crossover of methods from other disciplines such as biochemistry and materials science promise better examination of environmental chemical processes in real time and at higher resolution, and will further the integration of molecular information into field-scale chemical and hydrologic models.

Single-molecule enzymology based on the principle of the Millikan oil drop experiment.

PubMed

Leiske, Danielle L; Chow, Andrea; Dettloff, Roger; Farinas, Javier

2014-03-01

The ability to monitor the progress of single-molecule enzyme reactions is often limited by the need to use fluorogenic substrates. A method based on the principle of the Millikan oil drop experiment was developed to monitor the change in charge of substrates bound to a nanoparticle and offers a means of detecting single-enzyme reactions without fluorescence detection. As a proof of principle of the ability to monitor reactions that result in a change in substrate charge, polymerization on a single DNA template was detected. A custom oligonucleotide was synthesized that allowed for the attachment of single DNA templates to gold nanoparticles with a single polymer tether. The nanoparticles were then tethered to the surface of a microfluidic channel where the positions of the nanoparticles, subjected to an oscillating electric field, were monitored using dark field microscopy. With short averaging times, the signal-to-noise level was low enough to discriminate changes in charge of less than 1.2%. Polymerization of a long DNA template demonstrated the ability to use the system to monitor single-molecule enzymatic activity. Finally, nanoparticle surfaces were modified with thiolated moieties to reduce and/or shield the number of unproductive charges and allow for improved sensitivity. Copyright © 2013 Elsevier Inc. All rights reserved.

Magnetic field dependence of Griffith phase and magnetocaloric effect in Ca0.85Dy0.15MnO3

NASA Astrophysics Data System (ADS)

Nag, Ripan; Sarkar, Bidyut; Pal, Sudipta

2018-03-01

Temperature and Magnetic field dependent magnetization properties of electron doped polycrystalline sample Ca0.85Dy0.15MnO3 (CDMO) prepared by solid state reaction method have been studied. The sample undergoes ferromagnetic to paramagnetic phase transition at about 111k. From the study of magnetic properties in terms of Arrot plots it is observed that the phase transition is of 2nd order. The Griffith phase behavior of the sample is suppressed with the increase of the applied magnetic field strength H. We have estimated the magnetic entropy change from experimental magnetization and temperature data. For a magnetic field change of 8000 Oe, the maximum value of magnetic entropy change arrives at a value of 1.126 J-kg-1 k-1 in this magnetocaloric material.

Visual Detection of West Nile Virus Using Reverse Transcription Loop-Mediated Isothermal Amplification Combined with a Vertical Flow Visualization Strip.

PubMed

Cao, Zengguo; Wang, Hualei; Wang, Lina; Li, Ling; Jin, Hongli; Xu, Changping; Feng, Na; Wang, Jianzhong; Li, Qian; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Lu, Yiyu; Yang, Songtao; Xia, Xianzhu

2016-01-01

West Nile virus (WNV) causes a severe zoonosis, which can lead to a large number of casualties and considerable economic losses. A rapid and accurate identification method for WNV for use in field laboratories is urgently needed. Here, a method utilizing reverse transcription loop-mediated isothermal amplification combined with a vertical flow visualization strip (RT-LAMP-VF) was developed to detect the envelope (E) gene of WNV. The RT-LAMP-VF assay could detect 10(2) copies/μl of an WNV RNA standard using a 40 min amplification reaction followed by a 2 min incubation of the amplification product on the visualization strip, and no cross-reaction with other closely related members of the Flavivirus genus was observed. The assay was further evaluated using cells and mouse brain tissues infected with a recombinant rabies virus expressing the E protein of WNV. The assay produced sensitivities of 10(1.5) TCID50/ml and 10(1.33) TCID50/ml for detection of the recombinant virus in the cells and brain tissues, respectively. Overall, the RT-LAMP-VF assay developed in this study is rapid, simple and effective, and it is therefore suitable for clinical application in the field.

Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

PubMed

Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

2016-07-01

Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

Review on the progress in synthesis and application of magnetic carbon nanocomposites.

PubMed

Zhu, Maiyong; Diao, Guowang

2011-07-01

This review focuses on the synthesis and application of nanostructured composites containing magnetic nanostructures and carbon-based materials. Great progress in fabrication of magnetic carbon nanocomposites has been made by developing methods including filling process, template-based synthesis, chemical vapor deposition, hydrothermal/solvothermal method, pyrolysis procedure, sol-gel process, detonation induced reaction, self-assembly method, etc. The applications of magnetic carbon nanocomposites expanded to a wide range of fields such as environmental treatment, microwave absorption, magnetic recording media, electrochemical sensor, catalysis, separation/recognization of biomolecules and drug delivery are discussed. Finally, some future trends and perspectives in this research area are outlined.

Review on the progress in synthesis and application of magnetic carbon nanocomposites

NASA Astrophysics Data System (ADS)

Zhu, Maiyong; Diao, Guowang

2011-07-01

This review focuses on the synthesis and application of nanostructured composites containing magnetic nanostructures and carbon-based materials. Great progress in fabrication of magnetic carbon nanocomposites has been made by developing methods including filling process, template-based synthesis, chemical vapor deposition, hydrothermal/solvothermal method, pyrolysis procedure, sol-gel process, detonation induced reaction, self-assembly method, etc. The applications of magnetic carbon nanocomposites expanded to a wide range of fields such as environmental treatment, microwave absorption, magnetic recording media, electrochemical sensor, catalysis, separation/recognization of biomolecules and drug delivery are discussed. Finally, some future trends and perspectives in this research area are outlined.

groEL is a suitable genetic marker for detecting Vibrio parahaemolyticus by loop-mediated isothermal amplification assay.

PubMed

Siddique, M P; Jang, W J; Lee, J M; Ahn, S H; Suraiya, S; Kim, C H; Kong, I S

2017-08-01

A groEL gene-based loop-mediated isothermal amplification (LAMP) assay was developed to detect Vibrio parahaemolyticus in contaminated seafood and water. The assay was optimized and conducted at 63°C for 40 min using Bacillus stearothermophilus (Bst) DNA polymerase, large fragment. Amplification was analysed via multiple detection methods, including opacity, formation of white precipitate, DNA intercalating dyes (ethidium bromide and SYBR Green I), metal ion-binding indicator dye, calcein, and 2% agarose gel electrophoresis. A characteristic ladder-like band pattern on agarose gel and the desired colour changes when using different dyes were observed in positive cases, and these were species-specific for V. parahaemolyticus when compared with other closely related Vibrio spp. The limit of detection (LoD) of this assay was 100 fg per reaction, 100-fold higher than that for conventional polymerase chain reaction (PCR). When tested on artificially contaminated seafood and seawater, the LoDs of the LAMP assay were 120 and 150 fg per reaction respectively, and those of conventional PCR were 120 and 150 pg per reaction respectively. Based on our results, the groEL gene-based LAMP assay is rapid, specific, sensitive, and reliable for detecting V. parahaemolyticus, and it could be used in field diagnosis. The loop-mediated isothermal amplification (LAMP) assay using groEL gene (an abundant, highly conserved gene and member of the groESL chaperone gene family) provided rapid, species-specific and highly sensitive method for detecting Vibrio parahaemolyticus, the leading causal agent of seafood-borne diseases worldwide. Moreover, groEL LAMP revealed high efficiency than conventional PCR assay for V. parahaemolyticus using template both from pure culture and artificially contaminated seafood and water, which indicated the applicability in the field and environmental screening purpose for the organism. © 2017 The Society for Applied Microbiology.

Modeling chemical gradients in sediments under losing and gaining flow conditions: The GRADIENT code

NASA Astrophysics Data System (ADS)

Boano, Fulvio; De Falco, Natalie; Arnon, Shai

2018-02-01

Interfaces between sediments and water bodies often represent biochemical hotspots for nutrient reactions and are characterized by steep concentration gradients of different reactive solutes. Vertical profiles of these concentrations are routinely collected to obtain information on nutrient dynamics, and simple codes have been developed to analyze these profiles and determine the magnitude and distribution of reaction rates within sediments. However, existing publicly available codes do not consider the potential contribution of water flow in the sediments to nutrient transport, and their applications to field sites with significant water-borne nutrient fluxes may lead to large errors in the estimated reaction rates. To fill this gap, the present work presents GRADIENT, a novel algorithm to evaluate distributions of reaction rates from observed concentration profiles. GRADIENT is a Matlab code that extends a previously published framework to include the role of nutrient advection, and provides robust estimates of reaction rates in sediments with significant water flow. This work discusses the theoretical basis of the method and shows its performance by comparing the results to a series of synthetic data and to laboratory experiments. The results clearly show that in systems with losing or gaining fluxes, the inclusion of such fluxes is critical for estimating local and overall reaction rates in sediments.

Investigations of turbulent scalar fields using probability density function approach

NASA Technical Reports Server (NTRS)

Gao, Feng

1991-01-01

Scalar fields undergoing random advection have attracted much attention from researchers in both the theoretical and practical sectors. Research interest spans from the study of the small scale structures of turbulent scalar fields to the modeling and simulations of turbulent reacting flows. The probability density function (PDF) method is an effective tool in the study of turbulent scalar fields, especially for those which involve chemical reactions. It has been argued that a one-point, joint PDF approach is the one to choose from among many simulation and closure methods for turbulent combustion and chemically reacting flows based on its practical feasibility in the foreseeable future for multiple reactants. Instead of the multi-point PDF, the joint PDF of a scalar and its gradient which represents the roles of both scalar and scalar diffusion is introduced. A proper closure model for the molecular diffusion term in the PDF equation is investigated. Another direction in this research is to study the mapping closure method that has been recently proposed to deal with the PDF's in turbulent fields. This method seems to have captured the physics correctly when applied to diffusion problems. However, if the turbulent stretching is included, the amplitude mapping has to be supplemented by either adjusting the parameters representing turbulent stretching at each time step or by introducing the coordinate mapping. This technique is still under development and seems to be quite promising. The final objective of this project is to understand some fundamental properties of the turbulent scalar fields and to develop practical numerical schemes that are capable of handling turbulent reacting flows.

Use of Sensitive and Specific Biomolecular and Mass Spectrometric Techniques to Monitor the Performance of In-Situ Hydrocarbon Biodegradation

NASA Astrophysics Data System (ADS)

Beller, H. R.; Kane, S. R.; Legler, T. C.

2008-12-01

Monitored natural attenuation (MNA) can be a cost-effective and viable approach for remediation of hydrocarbon-contaminated groundwater. However, regulatory acceptance of the approach is often contingent on monitoring that can convincingly demonstrate the role of microbial degradation. Recent advances in anaerobic hydrocarbon biochemistry, analytical chemistry, and molecular biology have fostered the development of powerful techniques that can be applied to MNA of BTEX (benzene, toluene, ethylbenzene, and xylenes). Here, I discuss two independent methods that have been developed to monitor in situ, anaerobic biodegradation of toluene and xylenes. A method has been developed for rapid, sensitive, and highly selective detection of distinctive indicators of anaerobic alkylbenzene metabolism. The target metabolites, benzylsuccinic acid and methylbenzylsuccinic acid isomers, have no known sources other than anaerobic toluene or xylene degradation; thus, their mere presence in groundwater provides definitive evidence of in situ metabolism. The method, which involves small sample size (<1 mL) and no extraction/concentration steps, relies on isotope dilution liquid chromatography/tandem mass spectrometry (LC/MS/MS) with selected reaction monitoring. Detection limits for benzylsuccinates were determined to be ca. 0.3 μg/L and accuracy and precision were favorable in a groundwater matrix. A monitoring method based on quantitative Polymerase Chain Reaction (qPCR) analysis has been developed to specifically quantify populations of anaerobic methylbenzene-degrading bacteria in aquifer sediment. The method targets a catabolic gene (bssA) associated with the first step of anaerobic toluene and xylene degradation. The method has proven to be sensitive (detection limit ca. 5 gene copies) and has a linear range of > 7 orders of magnitude. Application of these two methods in field studies will be discussed in the context of the methods' strengths and limitations. Field data will include a side-by-side comparison of the two methods during a controlled release of BTX and ethanol, simulating release of gasohol from a leaking underground storage tank.

Influence of static and combined magnetic fields' noises on the adaptation of the gravitropic reaction of the cress and maize roots.

NASA Astrophysics Data System (ADS)

Bogatina, Nina; Sheykina, Nadiia

Dependencies of gravitropic reactions in the static magnetic field and at different frequencies of alternative component of the combined magnetic fields were investigated. These frequencies were equal to the cyclotron frequencies of Ca2+, Mg2+ ions and ions of auxin and abscisic acid. It was shown that the increasing of magnetic field noise assisted both to the observation of biological effects and to the acceleration of adaptation processes.

Products and Mechanism of Aerosol Formation from the Reaction of β-Pinene with NO3 Radicals: Role of Oligomer Formation

NASA Astrophysics Data System (ADS)

Claflin, M. S.; Ziemann, P. J.

2017-12-01

Large amounts of organic nitrates have been reported in aerosol analyzed during field studies conducted around the world. Although organic nitrates can be formed in daytime from the oxidation of volatile organic compounds in the presence of NOx, it has recently been proposed that the nighttime reaction of monoterpenes with NO3 radicals may account for a substantial fraction of these compounds. While past studies have made progress quantifying the aerosol forming potential of these reactions, relatively little is known about the gas-phase oxidation mechanism, the identities of stable products, and their fate after they partition into aerosol. In an effort to better understand these reactions, we conducted environmental chamber experiments in which β-pinene was reacted with NO3 radicals and the secondary organic aerosol (SOA) that formed was analyzed online using a thermal desorption particle beam mass spectrometer and offline using a variety of methods. SOA was collected on filters, extracted, and analyzed using derivatization-spectrophotometric methods to quantify carbonyl, hydroxyl, carboxyl, nitrate, peroxide, and ester functional groups; and molecular products were identified and quantified by coupling high performance liquid chromatography with UV-Vis detection and mass spectrometry with electrospray ionization, electron ionization, and chemical ionization. We identified and quantified >98% of the products in the SOA and found that 95% were oligomers formed through hemiacetal and acetal reactions. This information was used to determine the yields of monomer building blocks, which in turn were combined with modeling to estimate branching ratios in the gas-phase oxidation reaction and timescales of oligomer formation within the aerosol. The results of this study highlight several key processes in the formation of SOA from reactions of monoterpenes with NO3 radicals: (1) alkoxy radical chemistry, including the role of ring opening through decomposition (2) particle-phase reactions and (3) formation of separate organic and aqueous phases within aerosol.

A PDF projection method: A pressure algorithm for stand-alone transported PDFs

NASA Astrophysics Data System (ADS)

Ghorbani, Asghar; Steinhilber, Gerd; Markus, Detlev; Maas, Ulrich

2015-03-01

In this paper, a new formulation of the projection approach is introduced for stand-alone probability density function (PDF) methods. The method is suitable for applications in low-Mach number transient turbulent reacting flows. The method is based on a fractional step method in which first the advection-diffusion-reaction equations are modelled and solved within a particle-based PDF method to predict an intermediate velocity field. Then the mean velocity field is projected onto a space where the continuity for the mean velocity is satisfied. In this approach, a Poisson equation is solved on the Eulerian grid to obtain the mean pressure field. Then the mean pressure is interpolated at the location of each stochastic Lagrangian particle. The formulation of the Poisson equation avoids the time derivatives of the density (due to convection) as well as second-order spatial derivatives. This in turn eliminates the major sources of instability in the presence of stochastic noise that are inherent in particle-based PDF methods. The convergence of the algorithm (in the non-turbulent case) is investigated first by the method of manufactured solutions. Then the algorithm is applied to a one-dimensional turbulent premixed flame in order to assess the accuracy and convergence of the method in the case of turbulent combustion. As a part of this work, we also apply the algorithm to a more realistic flow, namely a transient turbulent reacting jet, in order to assess the performance of the method.

A novel kit for rapid detection of Vibrio cholerae O1.

PubMed

Hasan, J A; Huq, A; Tamplin, M L; Siebeling, R J; Colwell, R R

1994-01-01

We report on the development and testing of a novel, rapid, colorimetric immunodiagnostic kit, Cholera SMART, for direct detection of the presence of Vibrio cholerae O1 in clinical specimens. Unlike conventional culture methods requiring several days to complete, the Cholera SMART kit can be used directly in the field by untrained or minimally skilled personnel to detect V. cholerae O1 in less than 15 min, without cumbersome laboratory equipment. A total of 120 clinical and environmental bacterial strains, including both O1 and non-O1 serotypes of V. cholerae isolated from samples collected from a variety of geographical regions, were tested, and positive reactions were observed only with V. cholerae O1. Also, results of a field trial in Bangladesh, employing Cholera SMART, showed 100% specificity and 96% sensitivity compared with conventional culture methods. Another field trial, in Mexico, showed that Cholera SMART was 100% in agreement with a recently described coagglutination test when 108 stool specimens were tested.

Desktop NMR spectroscopy for real-time monitoring of an acetalization reaction in comparison with gas chromatography and NMR at 9.4 T.

PubMed

Singh, Kawarpal; Danieli, Ernesto; Blümich, Bernhard

2017-12-01

Monitoring of chemical reactions in real-time is in demand for process control. Different methods such as gas chromatography (GC), mass spectroscopy, infrared spectroscopy, and nuclear magnetic resonance (NMR) are used for that purpose. The current state-of-the-art compact NMR systems provide a useful method to employ with various reaction conditions for studying chemical reactions inside the fume hood at the chemical workplace. In the present study, an acetalization reaction was investigated with compact NMR spectroscopy in real-time. Acetalization is used for multistep synthesis of the variety of organic compounds to protect particular chemical groups. A compact 1 T NMR spectrometer with a permanent magnet was employed to monitor the acid catalyzed acetalization of the p-nitrobenzaldehyde with ethylene glycol. The concentrations of both reactant and product were followed by peak integrals in single-scan 1 H NMR spectra as a function of time. The reaction conditions were varied in terms of temperature, agitation speed, catalyst loading, and feed concentrations in order to determine the activation energy with the help of a pseudo-homogeneous kinetic model. For low molar ratios of aldehyde and glycol, the equilibrium conversions were lower than for the stoichiometric ratio. Increasing catalyst concentration leads to faster conversion. The data obtained with low-field NMR spectroscopy were compared with data from GC and NMR spectroscopy at 9.4 T acquired in batch mode by extracting samples at regular time intervals. The reaction kinetics followed by either method agreed well. The activation energies for forward and backward reactions were determined by real-time monitoring with compact NMR at 1 T were 48 ± 5 and 60 ± 4 kJ/mol, respectively. The activation energies obtained with gas chromatography for forward and backward reactions were 48 ± 4 and 51 ± 4 kJ/mol. The equilibrium constant decreases with increasing temperature as expected for an exothermic reaction. The impact of dense sampling with online NMR and sparse sampling with GC was observed on the kinetic outcome using the same kinetic model. Graphical abstract Acetalization reaction kinetics were monitored with real-time desktop NMR spectroscopy at 1 T. Each data point was obtained at regular intervals with a single shot in 15 s. The kinetics was compared with sparsely sampled data obtained with GC and NMR at 9.4 T.

Alkyl hydrogen atom abstraction reactions of the CN radical with ethanol

NASA Astrophysics Data System (ADS)

Athokpam, Bijyalaxmi; Ramesh, Sai G.

2018-04-01

We present a study of the abstraction of alkyl hydrogen atoms from the β and α positions of ethanol by the CN radical in solution using the Empirical Valence Bond (EVB) method. We have built separate 2 × 2 EVB models for the Hβ and Hα reactions, where the atom transfer is parameterized using ab initio calculations. The intra- and intermolecular potentials of the reactant and product molecules were modelled with the General AMBER Force Field, with some modifications. We have carried out the dynamics in water and chloroform, which are solvents of contrasting polarity. We have computed the potential of mean force for both abstractions in each of the solvents. They are found to have a small and early barrier along the reaction coordinate with a large energy release. Analyzing the solvent structure around the reaction system, we have found two solvents to have little effect on either reaction. Simulating the dynamics from the transition state, we also study the fate of the energies in the HCN vibrational modes. The HCN molecule is born vibrationally hot in the CH stretch in both reactions and additionally in the HCN bends for the Hα abstraction reaction. In the early stage of the dynamics, we find that the CN stretch mode gains energy at the expense of the energy in CH stretch mode.

Mixing and non-equilibrium chemical reaction in a compressible mixing layer. M.S. Thesis Final Report

NASA Technical Reports Server (NTRS)

Steinberger, Craig J.

1991-01-01

The effects of compressibility, chemical reaction exothermicity, and non-equilibrium chemical modeling in a reacting plane mixing layer were investigated by means of two dimensional direct numerical simulations. The chemical reaction was irreversible and second order of the type A + B yields Products + Heat. The general governing fluid equations of a compressible reacting flow field were solved by means of high order finite difference methods. Physical effects were then determined by examining the response of the mixing layer to variation of the relevant non-dimensionalized parameters. The simulations show that increased compressibility generally results in a suppressed mixing, and consequently a reduced chemical reaction conversion rate. Reaction heat release was found to enhance mixing at the initial stages of the layer growth, but had a stabilizing effect at later times. The increased stability manifested itself in the suppression or delay of the formation of large coherent structures within the flow. Calculations were performed for a constant rate chemical kinetics model and an Arrhenius type kinetic prototype. The choice of the model was shown to have an effect on the development of the flow. The Arrhenius model caused a greater temperature increase due to reaction than the constant kinetic model. This had the same effect as increasing the exothermicity of the reaction. Localized flame quenching was also observed when the Zeldovich number was relatively large.

Palladium-platinum core-shell electrocatalysts for oxygen reduction reaction prepared with the assistance of citric acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Lulu; Su, Dong; Zhu, Shangqian

Core–shell structure is a promising alternative to solid platinum (Pt) nanoparticles as electrocatalyst for oxygen reduction reaction (ORR) in proton exchange membrane fuel cells (PEMFCs). A simple method of preparing palladium (Pd)–platinum (Pt) core–shell catalysts (Pd@Pt/C) in a gram-batch was developed with the assistance of citric acid. The Pt shell deposition involves three different pathways: galvanic displacement reaction between Pd atoms and Pt cations, chemical reduction by citric acid, and reduction by negative charges on Pd surfaces. The uniform ultrathin (~0.4 nm) Pt shell was characterized by in situ X-ray diffraction (XRD) and high-angle annular dark-field scanning transmission electron microscopymore » (HAADF-STEM) images combined with electron energy loss spectroscopy (EELS). Compared with state-of-the-art Pt/C, the Pd@Pt/C core–shell catalyst showed 4 times higher Pt mass activity and much better durability upon potential cycling. As a result, both the mass activity and durability were comparable to that of Pd@Pt/C synthesized by a Cu-mediated-Pt-displacement method, which is more complicated and difficult for mass production.« less

Palladium-platinum core-shell electrocatalysts for oxygen reduction reaction prepared with the assistance of citric acid

DOE PAGES

Zhang, Lulu; Su, Dong; Zhu, Shangqian; ...

2016-04-26

Core–shell structure is a promising alternative to solid platinum (Pt) nanoparticles as electrocatalyst for oxygen reduction reaction (ORR) in proton exchange membrane fuel cells (PEMFCs). A simple method of preparing palladium (Pd)–platinum (Pt) core–shell catalysts (Pd@Pt/C) in a gram-batch was developed with the assistance of citric acid. The Pt shell deposition involves three different pathways: galvanic displacement reaction between Pd atoms and Pt cations, chemical reduction by citric acid, and reduction by negative charges on Pd surfaces. The uniform ultrathin (~0.4 nm) Pt shell was characterized by in situ X-ray diffraction (XRD) and high-angle annular dark-field scanning transmission electron microscopymore » (HAADF-STEM) images combined with electron energy loss spectroscopy (EELS). Compared with state-of-the-art Pt/C, the Pd@Pt/C core–shell catalyst showed 4 times higher Pt mass activity and much better durability upon potential cycling. As a result, both the mass activity and durability were comparable to that of Pd@Pt/C synthesized by a Cu-mediated-Pt-displacement method, which is more complicated and difficult for mass production.« less

Influence of reaction time on the structural, optical and electrical performance of copper antimony sulfide nanoparticles using solvothermal method

NASA Astrophysics Data System (ADS)

John, Bincy; Genifer Silvena, G.; Leo Rajesh, A.

2018-05-01

The less toxic and cost effective ternary Cu-Sb-S nanoparticles and thin films were synthesized and deposited using solvothermal and drop casting method. The reactions were carried out at different timings as 12-48 h, in steps of 12 h using ethylene glycol as solvent and polyvinylpyrrolidone (PVP) as surfactant. Systematic analysis revealed that due to the influence of different reaction time, significant and unique changes were occurring on the crystal structure, optical and electrical properties of the material. The synthesized nanopowders and deposited films were characterized by means of X-ray diffraction, Raman analysis, field emission scanning electron microscope with energy dispersive spectrometer, UV-Vis-NIR diffuse reflectance spectroscopy and hall measurement. XRD results showed that as the time increases crystallinity improves and phase transformation from chalcostibite to tetrahedrite occurs. The Optical performance revealed that the bandgap of nanoparticles were in the range of 1.21-1.49 eV. Hall measurements showed that the deposited Cu12Sb4S13 and CuSbS2 films exhibited p-type conductivity with carrier concentration ranging from 1016-1019 cm-3, indicating a promising p-type absorber material for photovoltaic applications.

Mean-field hierarchical equations for some A+BC catalytic reaction models

NASA Astrophysics Data System (ADS)

Cortés, Joaquín; Puschmann, Heinrich; Valencia, Eliana

1998-10-01

A mean-field study of the (A+BC→AC+1/2B2) system is developed from hierarchical equations, considering mechanisms that include dissociation, reaction with finite rates, desorption, and diffusion of the adsorbed species. The phase diagrams are compared to Monte Carlo simulations.

A New Low Cost Wide-Field Illumination Method for Photooxidation of Intracellular Fluorescent Markers

PubMed Central

da Silva Filho, Manoel; Santos, Daniel Valle Vasconcelos; Costa, Kauê Machado

2013-01-01

Analyzing cell morphology is crucial in the fields of cell biology and neuroscience. One of the main methods for evaluating cell morphology is by using intracellular fluorescent markers, including various commercially available dyes and genetically encoded fluorescent proteins. These markers can be used as free radical sources in photooxidation reactions, which in the presence of diaminobenzidine (DAB) forms an opaque and electron-dense precipitate that remains localized within the cellular and organelle membranes. This method confers many methodological advantages for the investigator, including absence of photo-bleaching, high visual contrast and the possibility of correlating optical imaging with electron microscopy. However, current photooxidation techniques require the continuous use of fluorescent or confocal microscopes, which wastes valuable mercury lamp lifetime and limits the conversion process to a few cells at a time. We developed a low cost optical apparatus for performing photooxidation reactions and propose a new procedure that solves these methodological restrictions. Our “photooxidizer” consists of a high power light emitting diode (LED) associated with a custom aluminum and acrylic case and a microchip-controlled current source. We demonstrate the efficacy of our method by converting intracellular DiI in samples of developing rat neocortex and post-mortem human retina. DiI crystals were inserted in the tissue and allowed to diffuse for 20 days. The samples were then processed with the new photooxidation technique and analyzed under optical microscopy. The results show that our protocols can unveil the fine morphology of neurons in detail. Cellular structures such as axons, dendrites and spine-like appendages were well defined. In addition to its low cost, simplicity and reliability, our method precludes the use of microscope lamps for photooxidation and allows the processing of many labeled cells simultaneously in relatively large tissue samples with high efficacy. PMID:23441199

Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids.

PubMed

Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

2016-01-01

Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm(2) area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10(-1) to 4 × 10(-3) copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings.

Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids

PubMed Central

Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

2016-01-01

Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm2 area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10-1 to 4 × 10-3 copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings. PMID:27074005

Kinetic Evaluation of Lipid Oils Conversion to Biofuel Using Layered Double Hydroxide Doped with Triazabicyclodece Catalyst

NASA Astrophysics Data System (ADS)

Nato Lopez, Frank D.

Worldwide, there is an ever increasing need for sustainable, renewable fuels that will accommodate the rapidly increasing energy demand and provide independence from fossil fuels. The search for a sustainable alternative to petroleum based fuels has been a great challenge to the scientific community; therefore, great efforts are being made to overcome the fossil fuels dependence by exploring the prominent field of biofuels (bioethanol and biodiesel). Traditional biodiesel is produced from feedstocks such as vegetable oils and animal fats by converting the triglycerides with methanol in the presence of a homogeneous catalyst to produce fatty acid methyl esters (FAMEs). However, drawbacks of this process are the undesired glycerol byproduct and post reaction processing, including separation from reaction mixture, that results in high costs factors. In the present work, the reaction kinetics of a glycerol-free biodiesel method is studied. This method consists of the transesterification of a vegetable oil (i.e. canola oil) using dimethyl carbonate (DMC) as an alternative methylating agent in presence of layered double hydroxides doped with triazabicyclodecene catalyst (a basic organocatalyst). Furthermore, is theorized that this heterogeneous catalyst (TBD/LDH) simultaneously converts both FFAs and triglycerides due to acid sites formed by Al3+ active sites of the LDH structure. Additionally, the versatility of the Raman in situ technique was used as quantitative analysis tool to monitor the reaction kinetics and collect real time data.

Extended lattice Boltzmann scheme for droplet combustion.

PubMed

Ashna, Mostafa; Rahimian, Mohammad Hassan; Fakhari, Abbas

2017-05-01

The available lattice Boltzmann (LB) models for combustion or phase change are focused on either single-phase flow combustion or two-phase flow with evaporation assuming a constant density for both liquid and gas phases. To pave the way towards simulation of spray combustion, we propose a two-phase LB method for modeling combustion of liquid fuel droplets. We develop an LB scheme to model phase change and combustion by taking into account the density variation in the gas phase and accounting for the chemical reaction based on the Cahn-Hilliard free-energy approach. Evaporation of liquid fuel is modeled by adding a source term, which is due to the divergence of the velocity field being nontrivial, in the continuity equation. The low-Mach-number approximation in the governing Navier-Stokes and energy equations is used to incorporate source terms due to heat release from chemical reactions, density variation, and nonluminous radiative heat loss. Additionally, the conservation equation for chemical species is formulated by including a source term due to chemical reaction. To validate the model, we consider the combustion of n-heptane and n-butanol droplets in stagnant air using overall single-step reactions. The diameter history and flame standoff ratio obtained from the proposed LB method are found to be in good agreement with available numerical and experimental data. The present LB scheme is believed to be a promising approach for modeling spray combustion.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

PubMed

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Episodic Tremor and Slip (ETS) as a chaotic multiphysics spring

NASA Astrophysics Data System (ADS)

Veveakis, E.; Alevizos, S.; Poulet, T.

2017-03-01

Episodic Tremor and Slip (ETS) events display a rich behaviour of slow and accelerated slip with simple oscillatory to complicated chaotic time series. It is commonly believed that the fast events appearing as non volcanic tremors are signatures of deep fluid injection. The fluid source is suggested to be related to the breakdown of hydrous phyllosilicates, mainly the serpentinite group minerals such as antigorite or lizardite that are widespread in the top of the slab in subduction environments. Similar ETS sequences are recorded in different lithologies in exhumed crustal carbonate-rich thrusts where the fluid source is suggested to be the more vigorous carbonate decomposition reaction. If indeed both types of events can be understood and modelled by the same generic fluid release reaction AB(solid) ⇌A(solid) +B(fluid) , the data from ETS sequences in subduction zones reveal a geophysically tractable temporal evolution with no access to the fault zone. This work reviews recent advances in modelling ETS events considering the multiphysics instabilities triggered by the fluid release reaction and develops a thermal-hydraulic-mechanical-chemical oscillator (THMC spring) model for such mineral reactions (like dehydration and decomposition) in Megathrusts. We describe advanced computational methods for THMC instabilities and discuss spectral element and finite element solutions. We apply the presented numerical methods to field examples of this important mechanism and reproduce the temporal signature of the Cascadia and Hikurangi trench with a serpentinite oscillator.

Mechanism of spiral formation in heterogeneous discretized excitable media.

PubMed

Kinoshita, Shu-ichi; Iwamoto, Mayuko; Tateishi, Keita; Suematsu, Nobuhiko J; Ueyama, Daishin

2013-06-01

Spiral waves on excitable media strongly influence the functions of living systems in both a positive and negative way. The spiral formation mechanism has thus been one of the major themes in the field of reaction-diffusion systems. Although the widely believed origin of spiral waves is the interaction of traveling waves, the heterogeneity of an excitable medium has recently been suggested as a probable cause. We suggest one possible origin of spiral waves using a Belousov-Zhabotinsky reaction and a discretized FitzHugh-Nagumo model. The heterogeneity of the reaction field is shown to stochastically generate unidirectional sites, which can induce spiral waves. Furthermore, we found that the spiral wave vanished with only a small reduction in the excitability of the reaction field. These results reveal a gentle approach for controlling the appearance of a spiral wave on an excitable medium.

Multiscale simulations of patchy particle systems combining Molecular Dynamics, Path Sampling and Green's Function Reaction Dynamics

NASA Astrophysics Data System (ADS)

Bolhuis, Peter

Important reaction-diffusion processes, such as biochemical networks in living cells, or self-assembling soft matter, span many orders in length and time scales. In these systems, the reactants' spatial dynamics at mesoscopic length and time scales of microns and seconds is coupled to the reactions between the molecules at microscopic length and time scales of nanometers and milliseconds. This wide range of length and time scales makes these systems notoriously difficult to simulate. While mean-field rate equations cannot describe such processes, the mesoscopic Green's Function Reaction Dynamics (GFRD) method enables efficient simulation at the particle level provided the microscopic dynamics can be integrated out. Yet, many processes exhibit non-trivial microscopic dynamics that can qualitatively change the macroscopic behavior, calling for an atomistic, microscopic description. The recently developed multiscale Molecular Dynamics Green's Function Reaction Dynamics (MD-GFRD) approach combines GFRD for simulating the system at the mesocopic scale where particles are far apart, with microscopic Molecular (or Brownian) Dynamics, for simulating the system at the microscopic scale where reactants are in close proximity. The association and dissociation of particles are treated with rare event path sampling techniques. I will illustrate the efficiency of this method for patchy particle systems. Replacing the microscopic regime with a Markov State Model avoids the microscopic regime completely. The MSM is then pre-computed using advanced path-sampling techniques such as multistate transition interface sampling. I illustrate this approach on patchy particle systems that show multiple modes of binding. MD-GFRD is generic, and can be used to efficiently simulate reaction-diffusion systems at the particle level, including the orientational dynamics, opening up the possibility for large-scale simulations of e.g. protein signaling networks.

The Dynamics of Chemical Reactions: Atomistic Visualizations of Organic Reactions, and Homage to van 't Hoff.

PubMed

Yang, Zhongyue; Houk, K N

2018-03-15

Jacobus Henricus van 't Hoff was the first Nobel Laureate in Chemistry. He pioneered in the study of chemical dynamics, which referred at that time to chemical kinetics and thermodynamics. The term has evolved in modern times to refer to the exploration of chemical transformations in a time-resolved fashion. Chemical dynamics has been driven by the development of molecular dynamics trajectory simulations, which provide atomic visualization of chemical processes and illuminate how dynamic effects influence chemical reactivity and selectivity. In homage to the legend of van 't Hoff, we review the development of the chemical dynamics of organic reactions, our area of research. We then discuss our trajectory simulations of pericyclic reactions, and our development of dynamic criteria for concerted and stepwise reaction mechanisms. We also describe a method that we call environment-perturbed transition state sampling, which enables trajectory simulations in condensed-media using quantum mechanics and molecular mechanics (QM/MM). We apply the method to reactions in solvent and in enzyme. Jacobus Henricus van 't Hoff (1852, Rotterdam-1911, Berlin) received the Nobel Prize for Chemistry in 1901 "in recognition of the extraordinary services he has rendered by the discovery of the laws of chemical dynamics and osmotic pressure in solutions". van 't Hoff was born the Netherlands, and earned his doctorate in Utrecht in 1874. In 1896 he moved to Berlin, where he was offered a position with more research and less teaching. van 't Hoff is considered one of the founders of physical chemistry. A key step in establishing this new field was the start of Zeitschrift für Physikalische Chemie in 1887. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of solvent-free ambient mass spectrometry for green chemistry applications.

PubMed

Liu, Pengyuan; Forni, Amanda; Chen, Hao

2014-04-15

Green chemistry minimizes chemical process hazards in many ways, including eliminating traditional solvents or using alternative recyclable solvents such as ionic liquids. This concept is now adopted in this study for monitoring solvent-free reactions and analysis of ionic liquids, solids, and catalysts by mass spectrometry (MS), without using any solvent. In our approach, probe electrospray ionization (PESI), an ambient ionization method, was employed for this purpose. Neat viscous room-temperature ionic liquids (RTILs) in trace amounts (e.g., 25 nL) could be directly analyzed without sample carryover effect, thereby enabling high-throughput analysis. With the probe being heated, it can also ionize ionic solid compounds such as organometallic complexes as well as a variety of neat neutral solid chemicals (e.g., amines). More importantly, moisture-sensitive samples (e.g., [bmim][AlCl4]) can be successfully ionized. Furthermore, detection of organometallic catalysts (including air-sensitive [Rh-MeDuPHOS][OTf]) in ionic liquids, a traditionally challenging task due to strong ion suppression effect from ionic liquids, can be enabled using PESI. In addition, PESI can be an ideal approach for monitoring solvent-free reactions. Using PESI-MS, we successfully examined the alkylation of amines by alcohols, the conversion of pyrylium into pyridinium, and the condensation of aldehydes with indoles as well as air- and moisture-sensitive reactions such as the oxidation of ferrocene and the condensation of pyrazoles with borohydride. Interestingly, besides the expected reaction products, the reaction intermediates such as the monopyrazolylborate ion were also observed, providing insightful information for reaction mechanisms. We believe that the presented solvent-free PESI-MS method would impact the green chemistry field.

On the importance of excited state dynamic response electron correlation in polarizable embedding methods.

PubMed

Eriksen, Janus J; Sauer, Stephan P A; Mikkelsen, Kurt V; Jensen, Hans J Aa; Kongsted, Jacob

2012-09-30

We investigate the effect of including a dynamic reaction field at the lowest possible ab inito wave function level of theory, namely the Hartree-Fock (HF) self-consistent field level within the polarizable embedding (PE) formalism. We formulate HF based PE within the linear response theory picture leading to the PE-random-phase approximation (PE-RPA) and bridge the expressions to a second-order polarization propagator approximation (SOPPA) frame such that dynamic reaction field contributions are included at the RPA level in addition to the static response described at the SOPPA level but with HF induced dipole moments. We conduct calculations on para-nitro-aniline and para-nitro-phenolate using said model in addition to dynamic PE-RPA and PE-CAM-B3LYP. We compare the results to recently published PE-CCSD data and demonstrate how the cost effective SOPPA-based model successfully recovers a great portion of the inherent PE-RPA error when the observable is the solvatochromic shift. We furthermore demonstrate that whenever the change in density resulting from the ground state-excited state electronic transition in the solute is not associated with a significant change in the electric field, dynamic response contributions formulated at the HF level of theory manage to capture the majority of the system response originating from derivative densities. Copyright © 2012 Wiley Periodicals, Inc.

Protein biomarker discovery and fast monitoring for the identification and detection of Anisakids by parallel reaction monitoring (PRM) mass spectrometry.

PubMed

Carrera, Mónica; Gallardo, José M; Pascual, Santiago; González, Ángel F; Medina, Isabel

2016-06-16

Anisakids are fish-borne parasites that are responsible for a large number of human infections and allergic reactions around the world. World health organizations and food safety authorities aim to control and prevent this emerging health problem. In the present work, a new method for the fast monitoring of these parasites is described. The strategy is divided in three steps: (i) purification of thermostable proteins from fish-borne parasites (Anisakids), (ii) in-solution HIFU trypsin digestion and (iii) monitoring of several peptide markers by parallel reaction monitoring (PRM) mass spectrometry. This methodology allows the fast detection of Anisakids in <2h. An affordable assay utilizing this methodology will facilitate testing for regulatory and safety applications. The work describes for the first time, the Protein Biomarker Discovery and the Fast Monitoring for the identification and detection of Anisakids in fishery products. The strategy is based on the purification of thermostable proteins, the use of accelerated in-solution trypsin digestions under an ultrasonic field provided by High-Intensity Focused Ultrasound (HIFU) and the monitoring of several peptide biomarkers by Parallel Reaction Monitoring (PRM) Mass Spectrometry in a linear ion trap mass spectrometer. The workflow allows the unequivocal detection of Anisakids, in <2h. The present strategy constitutes the fastest method for Anisakids detection, whose application in the food quality control area, could provide to the authorities an effective and rapid method to guarantee the safety to the consumers. Copyright © 2016 Elsevier B.V. All rights reserved.

Simulation of the effects of sub-breakdown electric fields on the chemical kinetics in nonpremixed counterflow methane/air flames

NASA Astrophysics Data System (ADS)

Belhi, Memdouh; Im, Hong; Computational Reacting Flows Laboratory, Clean Combustion Research Center Team

2017-11-01

The effects of an electric field on the combustion kinetics in nonpremixed counterflow methane/air flames were investigated via one-dimensional numerical simulations. A classical fluid model coupling Poison's equation with transport equations for combustion species and electric field-induced particles was used. A methane-air reaction mechanism accounting for the natural ionization in flames was combined with a set of reactions that describe the formation of active particles induced by the electric field. Kinetic parameters for electron-impact reactions and transport coefficients of electrons were modeled as functions of reduced electric field via solutions to the Boltzmann kinetic equation using the BOLSIG code. Mobility of ions was computed based on the (n,6,4) and coulomb interaction potentials, while the diffusion coefficient was approximated from the mobility using Einstein relation. Contributions of electron dissociation, excitation and ionization processes were characterized quantitatively. An analysis to identify the plasma regime where the electric field can alter the combustion kinetic was proposed.

Assessing occupational exposure to sea lamprey pesticides.

PubMed

Ceballos, Diana M; Beaucham, Catherine C; Kurtz, Kristine; Musolin, Kristin

2015-01-01

Sea lampreys are parasitic fish found in lakes of the United States and Canada. Sea lamprey is controlled through manual application of the pesticides 3-trifluoromethyl-4-nitrophenol (TFM) and Bayluscide(TM) into streams and tributaries. 3-Trifluoromethyl-4-nitrophenol may cause irritation and central nervous system depression and Bayluscide may cause irritation, dermatitis, blisters, cracking, edema, and allergic skin reactions. To assess occupational exposures to sea lamprey pesticides. We developed a wipe method for evaluating surface and skin contamination with these pesticides. This method was field tested at a biological field station and at a pesticide river application. We also evaluated exposures using control banding tools. We verified TFM surface contamination at the biological station. At the river application, we found surfaces and worker's skin contaminated with pesticides. We recommended minimizing exposures by implementing engineering controls and improved use of personal protective equipment.

Anomalous dielectric relaxation with linear reaction dynamics in space-dependent force fields.

PubMed

Hong, Tao; Tang, Zhengming; Zhu, Huacheng

2016-12-28

The anomalous dielectric relaxation of disordered reaction with linear reaction dynamics is studied via the continuous time random walk model in the presence of space-dependent electric field. Two kinds of modified reaction-subdiffusion equations are derived for different linear reaction processes by the master equation, including the instantaneous annihilation reaction and the noninstantaneous annihilation reaction. If a constant proportion of walkers is added or removed instantaneously at the end of each step, there will be a modified reaction-subdiffusion equation with a fractional order temporal derivative operating on both the standard diffusion term and a linear reaction kinetics term. If the walkers are added or removed at a constant per capita rate during the waiting time between steps, there will be a standard linear reaction kinetics term but a fractional order temporal derivative operating on an anomalous diffusion term. The dielectric polarization is analyzed based on the Legendre polynomials and the dielectric properties of both reactions can be expressed by the effective rotational diffusion function and component concentration function, which is similar to the standard reaction-diffusion process. The results show that the effective permittivity can be used to describe the dielectric properties in these reactions if the chemical reaction time is much longer than the relaxation time.

Transition state theory for activated systems with driven anharmonic barriers.

PubMed

Revuelta, F; Craven, Galen T; Bartsch, Thomas; Borondo, F; Benito, R M; Hernandez, Rigoberto

2017-08-21

Classical transition state theory has been extended to address chemical reactions across barriers that are driven and anharmonic. This resolves a challenge to the naive theory that necessarily leads to recrossings and approximate rates because it relies on a fixed dividing surface. We develop both perturbative and numerical methods for the computation of a time-dependent recrossing-free dividing surface for a model anharmonic system in a solvated environment that interacts strongly with an oscillatory external field. We extend our previous work, which relied either on a harmonic approximation or on periodic force driving. We demonstrate that the reaction rate, expressed as the long-time flux of reactive trajectories, can be extracted directly from the stability exponents, namely, Lyapunov exponents, of the moving dividing surface. Comparison to numerical results demonstrates the accuracy and robustness of this approach for the computation of optimal (recrossing-free) dividing surfaces and reaction rates in systems with Markovian solvation forces. The resulting reaction rates are in strong agreement with those determined from the long-time flux of reactive trajectories.

A computation study on the interplay between surface morphology and electrochemical performance of patterned thin film electrodes for Li-ion batteries

NASA Astrophysics Data System (ADS)

Gur, Sourav; Frantziskonis, George N.; Aifantis, Katerina E.

2017-08-01

Recent experiments illustrate that the morphology of the electrode surface impacts the voltage - capacity curves and long term cycling performance of Li-ion batteries. The present study systematically explores the role of the electrode surface morphology and uncertainties in the reactions that occur during electrochemical cycling, by performing kinetic Monte Carlo (kMC) simulations using the lattice Boltzmann method (LBM). This allows encoding of the inherent stochasticity at discrete microscale reaction events over the deterministic mean field reaction dynamics that occur in Li-ion cells. The electrodes are taken to be dense thin films whose surfaces are patterned with conical, trapezoidal, dome-shaped, or pillar-shaped structures. It is shown that the inherent perturbations in the reactions together with the characteristics of the electrode surface configuration can significantly improve battery performance, mainly because patterned surfaces, as opposed to flat surfaces, result in a smaller voltage drop. The most efficient pattern was the trapezoidal, which is consistent with experimental evidence on Si patterned electrodes.

Detection of peroxyl radicals from polluted air by free radical reaction combined with liquid chromatography signal amplification technique.

PubMed

Wang, Guoying; Jia, Shiming; Niu, Xiuli; Liu, Yanrong; Tian, Haoqi; Chen, Xuefu; Shi, Gaofeng

2018-01-22

Free radicals play an important role in the oxidizing power of polluted air, the development of aging-related diseases, the formation of ozone, and the production of secondary particulate matter. The high variability of peroxyl radical concentration has prevented the detection of possible trends or distributions in the concentration of free radicals. We present a new method, free radical reaction combined with liquid chromatography photodiode array detection, for identifying and quantifying peroxyl radicals in polluted air. Functionalized graphene was used for loading peroxyl radicals and reactive molecules in air sampling system, which can facilitate reaction kinetics (charge transfers) between peroxyl radicals and reaction molecules. Separation was performed with and without a preliminary exposure of the polluted air sample to reactive molecule(s) system. The integral chromatographic peak areas before and after air sampling are used to quantify the atmospheric peroxyl radicals in polluted air. The utility of the new technique was tested with measurements carried out in the field. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Power of Non-Hydrolytic Sol-Gel Chemistry: A Review

DOE PAGES

Styskalik, Ales; Skoda, David; Barnes, Craig; ...

2017-05-25

This review is devoted to non-hydrolytic sol-gel chemistry. During the last 25 years, non-hydrolytic sol-gel (NHSG) techniques were found to be attractive and versatile methods for the preparation of oxide materials. Compared to conventional hydrolytic approaches, the NHSG route allows reaction control at the atomic scale resulting in homogeneous and well defined products. Due to these features and the ability to design specific materials, the products of NHSG reactions have been used in many fields of application. The aim of this review therefore is to present an overview of NHSG research in recent years with an emphasis on the synthesesmore » of mixed oxides, silicates and phosphates. The first part of the review highlights well known condensation reactions with some deeper insights into their mechanism and also presents novel condensation reactions established in NHSG chemistry in recent years. In the second section we discuss porosity control and novel compositions of selected materials. In the last part, the applications of NHSG derived materials as heterogeneous catalysts and supports, luminescent materials and electrode materials in Li-ion batteries are described.« less

Novel route to WOx nanorods and WS2 nanotubes from WS2 inorganic fullerenes.

PubMed

Li, Yan-Hui; Zhao, Yi Min; Ma, Ren Zhi; Zhu, Yan Qiu; Fisher, Niles; Jin, Yi Zheng; Zhang, Xin Ping

2006-09-21

WO(x) (2 < x < 3) and WS(2) nanostructures have been widely praised due to applications as catalysts, solid lubricants, field emitters, and optical components. Many methods have been developed to fabricate these nanomaterials; however, most attention was focused on the same dimensional transformation from WO(x) nanoparticles or nanorods to WS(2) nanoparticles or nanotubes. In a solid-vapor reaction, by simply controlling the quantity of water vapor and reaction temperature, we have realized the transformation from quasi-zero-dimensional WS(2) nanoparticles to one-dimensional W(18)O(49) nanorods, and subsequent sulfuration reactions have further converted these W(18)O(49) nanorods into WS(2) nanotubes. The reaction temperature, quantity of water vapor, and pretreatment of the WS(2) nanoparticle precursors are important process parameters for long, thin, and homogeneous W(18)O(49) nanorods growth. The morphologies, crystal structures, and circling transformation mechanisms of sulfide-oxide-sulfide are discussed, and the photoluminescence properties of the resulting nanorods are investigated using a Xe lamp under an excitation of 270 nm.

Simulating chemical reactions in ionic liquids using QM/MM methodology.

PubMed

Acevedo, Orlando

2014-12-18

The use of ionic liquids as a reaction medium for chemical reactions has dramatically increased in recent years due in large part to the numerous reported advances in catalysis and organic synthesis. In some extreme cases, ionic liquids have been shown to induce mechanistic changes relative to conventional solvents. Despite the large interest in the solvents, a clear understanding of the molecular factors behind their chemical impact is largely unknown. This feature article reviews our efforts developing and applying mixed quantum and molecular mechanical (QM/MM) methodology to elucidate the microscopic details of how these solvents operate to enhance rates and alter mechanisms for industrially and academically important reactions, e.g., Diels-Alder, Kemp eliminations, nucleophilic aromatic substitutions, and β-eliminations. Explicit solvent representation provided the medium dependence of the activation barriers and atomic-level characterization of the solute-solvent interactions responsible for the experimentally observed "ionic liquid effects". Technical advances are also discussed, including a linear-scaling pairwise electrostatic interaction alternative to Ewald sums, an efficient polynomial fitting method for modeling proton transfers, and the development of a custom ionic liquid OPLS-AA force field.

The Power of Non-Hydrolytic Sol-Gel Chemistry: A Review

DOE Office of Scientific and Technical Information (OSTI.GOV)

Styskalik, Ales; Skoda, David; Barnes, Craig

This review is devoted to non-hydrolytic sol-gel chemistry. During the last 25 years, non-hydrolytic sol-gel (NHSG) techniques were found to be attractive and versatile methods for the preparation of oxide materials. Compared to conventional hydrolytic approaches, the NHSG route allows reaction control at the atomic scale resulting in homogeneous and well defined products. Due to these features and the ability to design specific materials, the products of NHSG reactions have been used in many fields of application. The aim of this review therefore is to present an overview of NHSG research in recent years with an emphasis on the synthesesmore » of mixed oxides, silicates and phosphates. The first part of the review highlights well known condensation reactions with some deeper insights into their mechanism and also presents novel condensation reactions established in NHSG chemistry in recent years. In the second section we discuss porosity control and novel compositions of selected materials. In the last part, the applications of NHSG derived materials as heterogeneous catalysts and supports, luminescent materials and electrode materials in Li-ion batteries are described.« less

Human beings' adaptability to extreme environmental changes from medical and physical points of view

NASA Astrophysics Data System (ADS)

Khabarova, Olga; Ragulskaya, Maria; Dimitrova, Svetla; Safaraly-Oghlu Babayev, Elchin; Samsonov, Sergey; Med. Dimitry Markov, Of; Nazarova, Of Med. Olga N.; Rudenchik, Evgeny

The question about features of human reaction on the sharp environmental physical activity (EPA) changes is considered by international group of physicists and physicians on the base of results of monitoring of human health state in different cities spread on latitude and longitude. The typical reaction of human body on the influences, exceeding the organisms' ability to adaptation, is of stress-reaction character. From medical point of view there is no significant difference for human body -what external (EPA) agent shocked an organism (emotional or some physical threats). First attempt of the organism to restore its homeostasis is stress-reaction, being universal for many stress-factors. Its main stages (such as alarm, resistance, and exhaustion) are detectable by different medical equipments, but we tried to find universal, non-traumatic method of daily measurements, enough sensitive and appropriate for observation of people reaction both on weather and space weather (geomagnetic activity) changes. The experiment was based on a method of electrical conductivity measurements of biologically active (acupunctural) points of human skin. The used method (electroacupunctural method by Dr. R.Voll) is very sensitive to current state of an organism and characterize the functional condition of different organs and systems of human body and allows to express so-called "group's health status" in the units, suitable for comparison with meteorological and heliogeophysical parameters. We conduct the parallel investigations as a part of collaborative study in different geographic latitudes-longitudes (Baku:40° 23'43"N -49° 52'56"E, Troitsk (Moscow region): 55° 28'40"N -37° 18'42"E, Yakutsk: 62° 02'00"N -129° 44'00"E). Measurements were carried out on daily basis with permanent group of functionally healthy persons (Moscow -19, Yakutsk -22, CityBaku -12 volunteers). Daily monitoring of nervous, endocrinological, lymphatic systems, blood, lungs, thick and thin intestine, heart and parenhimatic organs, allergy and hypophisis was conducted simultaneously with analyses of space weather (parameters of solar and geomagnetic activities) as well as local meteorological parameters (temperature, atmospheric pressure, humidity, wind speed, etc.). It was proved that it is possible to consider not only weather changes but also geomagnetic field variations as a stressor. It is concluded that : 1. human reaction on the sharp changes of selected external (environmental) physical activity parameters goes like typical stress-reaction; 2. features of stress-reaction depend on history of previous failures of an organism and on state of external background (frequent stresses deplete human organism possibility to adaptation); 3. features of stress-reaction depend on the geographic location (latitude). Possible physi-cal explanation of human organism stress-reaction on changes of geomagnetic oscillatory regime and atmospheric thermobaric variations is discussed.

Emotional Reactions of Students in Field Education: An Exploratory Study

ERIC Educational Resources Information Center

Litvack, Andrea; Mishna, Faye; Bogo, Marion

2010-01-01

An exploratory study using qualitative methodology was undertaken with recent MSW graduates (N=12) from 2 graduate social work programs to identify and describe the students' emotional reactions to experiences in field education. Significant and interrelated themes emerged including the subjective and unique definitions of emotionally charged…

INTEGRATED LABORATORY AND FIELD CHARACTERIZATION OF ORGANIC CARBON IN PM 2.5 FORMED THROUGH CHEMICAL REACTIONS

EPA Science Inventory

An integrated laboratory and field research program is underway at the National Exposure Research Laboratory (NERL) to characterize organic carbon in PM_2.5 (particulate matter) formed through chemical reactions. Information from this study will provide critical data ne...

First Measurement of the 19F(α, p)22Ne Reaction at Energies of Astrophysical Relevance

NASA Astrophysics Data System (ADS)

Pizzone, R. G.; D'Agata, G.; La Cognata, M.; Indelicato, I.; Spitaleri, C.; Blagus, S.; Cherubini, S.; Figuera, P.; Grassi, L.; Guardo, G. L.; Gulino, M.; Hayakawa, S.; Kshetri, R.; Lamia, L.; Lattuada, M.; Mijatović, T.; Milin, M.; Miljanić D., Đ.; Prepolec, L.; Rapisarda, G. G.; Romano, S.; Sergi, M. L.; Skukan, N.; Soić, N.; Tokić, V.; Tumino, A.; Uroić, M.

2017-02-01

The observational 19F abundance in stellar environments systematically exceeds the predicted one, thus representing one of the unsolved challenges for stellar modeling. It is therefore clear that further investigation is needed in this field. In this work, we focus our attention on the measurement of the {}19{{F}}{(α ,p)}22{Ne} reaction in the astrophysical energy range, between 0.2 and 0.8 MeV (far below the Coulomb barrier, 3.8 MeV), as it represents the main destruction channel in He-rich environments. The lowest energy at which this reaction has been studied with direct measurements is ˜0.66 MeV, covering only the upper tail of the Gamow window, causing the reaction-rate evaluation to be based on extrapolation. To investigate lower energies, the {}19{{F}}{(α ,p)}22{Ne} reaction has been studied by means of the Trojan horse method, applied to the quasi-free {}6{Li}{{(}19{{F}},{p}22{Ne})}2{{H}} reaction at E beam = 6 MeV. The indirect cross section of the {}19{{F}}{(α ,p)}22{Ne} reaction at energies ≲1 MeV was extracted, fully covering the astrophysical region of interest and overlapping existing direct data for normalization. Several resonances have been detected for the first time inside the Gamow window. The reaction rate has been calculated, showing an increase up to a factor of 4 with respect to the literature at astrophysical temperatures. This might lead to potential major astrophysical implications.

Preparation of tungsten fiber reinforced-tungsten/copper composite for plasma facing component

NASA Astrophysics Data System (ADS)

He, Gang; Xu, Kunyuan; Guo, Shibin; Qian, Xueqiang; Yang, Zengchao; Liu, Guanghua; Li, Jiangtao

2014-12-01

W fiber reinforced-W/Cu composite is designed as a transition layer between CuCrZr heat sink material and W plasma facing material. A novel method was developed for the preparation of W fiber reinforced-W/Cu composite by combining combustion synthesis with centrifugal infiltration. Cu melt with a transient temperature over 2000 °C produced by the thermite reaction was infiltrated into the W powder and fiber bed with the assistance of a high gravity field. It was found that the W particles were sintered and bonded to the W fibers due to the high temperature produced by the thermite reaction. The bending strength of W/Cu composite improved 12.7% through W fibers reinforcement.

Chemoselective Reactions for the Synthesis of Glycoconjugates from Unprotected Carbohydrates.

PubMed

Villadsen, Klaus; Martos-Maldonado, Manuel C; Jensen, Knud J; Thygesen, Mikkel B

2017-04-04

Glycobiology is the comprehensive biological investigation of carbohydrates. The study of the role and function of complex carbohydrates often requires the attachment of carbohydrates to surfaces, their tagging with fluorophores, or their conversion into natural or non-natural glycoconjugates, such as glycopeptides or glycolipids. Glycobiology and its "omics", glycomics, require easy and robust chemical methods for the construction of these glycoconjugates. This review gives an overview of the rapidly expanding field of chemical reactions that selectively convert unprotected carbohydrates into glycoconjugates through the anomeric position. The discussion is divided in terms of the anomeric bond type of the newly formed glycoconjugates, including O-, N-, S-, and C-glycosides. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electrically detected displacement assay (EDDA): a practical approach to nucleic acid testing in clinical or medical diagnosis.

PubMed

Liepold, P; Kratzmüller, T; Persike, N; Bandilla, M; Hinz, M; Wieder, H; Hillebrandt, H; Ferrer, E; Hartwich, G

2008-07-01

This paper introduces the electrically detected displacement assay (EDDA), a electrical biosensor detection principle for applications in medical and clinical diagnosis, and compares the method to currently available microarray technologies in this field. The sensor can be integrated into automated systems of routine diagnosis, but may also be used as a sensor that is directly applied to the polymerase chain reaction (PCR) reaction vessel to detect unlabeled target amplicons within a few minutes. Major aspects of sensor assembly like immobilization procedure, accessibility of the capture probes, and prevention from nonspecific target adsorption, that are a prerequisite for a robust and reliable performance of the sensor, are demonstrated. Additionally, exemplary results from a human papillomavirus assay are presented.

Incorporating microbiota data into epidemiologic models: examples from vaginal microbiota research.

PubMed

van de Wijgert, Janneke H; Jespers, Vicky

2016-05-01

Next generation sequencing and quantitative polymerase chain reaction technologies are now widely available, and research incorporating these methods is growing exponentially. In the vaginal microbiota (VMB) field, most research to date has been descriptive. The purpose of this article is to provide an overview of different ways in which next generation sequencing and quantitative polymerase chain reaction data can be used to answer clinical epidemiologic research questions using examples from VMB research. We reviewed relevant methodological literature and VMB articles (published between 2008 and 2015) that incorporated these methodologies. VMB data have been analyzed using ecologic methods, methods that compare the presence or relative abundance of individual taxa or community compositions between different groups of women or sampling time points, and methods that first reduce the complexity of the data into a few variables followed by the incorporation of these variables into traditional biostatistical models. To make future VMB research more clinically relevant (such as studying associations between VMB compositions and clinical outcomes and the effects of interventions on the VMB), it is important that these methods are integrated with rigorous epidemiologic methods (such as appropriate study designs, sampling strategies, and adjustment for confounding). Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

A rapid and high-throughput microplate spectrophotometric method for field measurement of nitrate in seawater and freshwater.

PubMed

Wu, Jiapeng; Hong, Yiguo; Guan, Fengjie; Wang, Yan; Tan, Yehui; Yue, Weizhong; Wu, Meilin; Bin, Liying; Wang, Jiaping; Wen, Jiali

2016-02-01

The well-known zinc-cadmium reduction method is frequently used for determination of nitrate. However, this method is seldom to be applied on field research of nitrate due to the long time consuming and large sample volume demand. Here, we reported a modified zinc-cadmium reduction method (MZCRM) for measurement of nitrate at natural-abundance level in both seawater and freshwater. The main improvements of MZCRM include using small volume disposable tubes for reaction, a vortex apparatus for shaking to increase reduction rate, and a microplate reader for high-throughput spectrophotometric measurements. Considering salt effect, two salinity sections (5~10 psu and 20~35 psu) were set up for more accurate determination of nitrate in low and high salinity condition respectively. Under optimized experimental conditions, the reduction rates were stabilized on 72% and 63% on the salinity of 5 and 20 psu respectively. The lowest detection limit for nitrate was 0.5 μM and was linear up to 100 μM (RSDs was 4.8%). Environmental samples assay demonstrated that MZCRM was well consistent with conventional zinc-cadmium reduction method. In total, this modified method improved accuracy and efficiency of operations greatly, and would be realized a rapid and high-throughput determination of nitrate in field analysis of nitrate with low cost.

A novel approach for in vitro studies applying electrical fields to cell cultures by transformer-like coupling.

PubMed

Hess, R; Neubert, H; Seifert, A; Bierbaum, S; Hart, D A; Scharnweber, D

2012-12-01

The purpose of this study was to develop a new apparatus for in vitro studies applying low frequency electrical fields to cells without interfering side effects like biochemical reactions or magnetic fields which occur in currently available systems. We developed a non-invasive method by means of the principle of transformer-like coupling where the magnetic field is concentrated in a toroid and, therefore, does not affect the cell culture. Next to an extensive characterization of the electrical field parameters, initial cell culture studies have focused on examining the response of bone marrow-derived human mesenchymal stem cells (MSCs) to pulsed electrical fields. While no significant differences in the proliferation of human MSCs could be detected, significant increases in ALP activity as well as in gene expression of other osteogenic markers were observed. The results indicate that transformer-like coupled electrical fields can be used to influence osteogenic differentiation of human MSCs in vitro and can pose a useful tool in understanding the influence of electrical fields on the cellular and molecular level.

Reactive Fluid Flow and Applications to Diagenesis, Mineral Deposits, and Crustal Rocks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rye, Danny M.; Bolton, Edward W.

2002-11-04

The objective is to initiate new: modeling of coupled fluid flow and chemical reactions of geologic environments; experimental and theoretical studies of water-rock reactions; collection and interpretation of stable isotopic and geochemical field data at many spatial scales of systems involving fluid flow and reaction in environments ranging from soils to metamorphic rocks. Theoretical modeling of coupled fluid flow and chemical reactions, involving kinetics, has been employed to understand the differences between equilibrium, steady-state, and non-steady-state behavior of the chemical evolution of open fluid-rock systems. The numerical codes developed in this project treat multi-component, finite-rate reactions combined with advective andmore » dispersive transport in multi-dimensions. The codes incorporate heat, mass, and isotopic transfer in both porous and fractured media. Experimental work has obtained the kinetic rate laws of pertinent silicate-water reactions and the rates of Sr release during chemical weathering. Ab-initio quantum mechanical techniques have been applied to obtain the kinetics and mechanisms of silicate surface reactions and isotopic exchange between water and dissolved species. Geochemical field-based studies were carried out on the Wepawaug metamorphic schist, on the Irish base-metal sediment-hosted ore system, in the Dalradian metamorphic complex in Scotland, and on weathering in the Columbia River flood basalts. The geochemical and isotopic field data, and the experimental and theoretical rate data, were used as constraints on the numerical models and to determine the length and time scales relevant to each of the field areas.« less

Phase-locked scroll waves defy turbulence induced by negative filament tension.

PubMed

Li, Teng-Chao; Gao, Xiang; Zheng, Fei-Fei; Cai, Mei-Chun; Li, Bing-Wei; Zhang, Hong; Dierckx, Hans

2016-01-01

Scroll waves in a three-dimensional media may develop into turbulence due to negative tension of the filament. Such negative tension-induced instability of scroll waves has been observed in the Belousov-Zhabotinsky reaction systems. Here we propose a method to restabilize scroll wave turbulence caused by negative tension in three-dimensional chemical excitable media using a circularly polarized (rotating) external field. The stabilization mechanism is analyzed in terms of phase-locking caused by the external field, which makes the effective filament tension positive. The phase-locked scroll waves that have positive tension and higher frequency defy the turbulence and finally restore order. A linear theory for the change of filament tension caused by a generic rotating external field is presented and its predictions closely agree with numerical simulations.

Visible-Light Actinometry and Intermittent Illumination as Convenient Tools to Study Ru(bpy)3Cl2 Mediated Photoredox Transformations

PubMed Central

Pitre, Spencer P.; McTiernan, Christopher D.; Vine, Wyatt; DiPucchio, Rebecca; Grenier, Michel; Scaiano, Juan C.

2015-01-01

Photoredox catalysis provides many green opportunities for radical-mediated synthetic transformations. However, the determination of the underlying mechanisms has been challenging due to lack of quantitative methods that can be easily implemented in synthetic labs, where this research tends to be centered. We report here on the development, characterization and calibration of a novel actinometer based on the photocatalyst tris(2,2′-bipyridyl)ruthenium(II) chloride (Ru(bpy)3Cl2). By using the same molecule as the photocatalyst and the actinometer, we eliminate problems associated with matching sample spectral distribution, lamp-sample spectral overlap and other problems intrinsic to doing quantitative photochemistry in a laboratory that has little expertise in this area. In order to validate our actinometer system in determining the quantum yield of a Ru(bpy)3Cl2 photosensitized reaction, we test the Ru(bpy)3Cl2 catalyzed oxidation of benzhydrol to benzophenone as a model chain reaction. We also revive the rotating sector method by updating the technique for modern LED technologies and demonstrate how intermittent illumination on the timescale of milliseconds to seconds can help probe a chain reaction, using the benzhydrol to benzophenone oxidation to validate the technique. We envision these methods to have great implications in the field of photoredox catalysis, providing researchers with valuable research tools. PMID:26578341

MurD ligase from E. coli: Tetrahedral intermediate formation study by hybrid quantum mechanical/molecular mechanical replica path method.

PubMed

Perdih, Andrej; Hodoscek, Milan; Solmajer, Tom

2009-02-15

MurD (UDP-N-acetylmuramoyl-L-alanine:D-glutamate ligase), a three-domain bacterial protein, catalyses a highly specific incorporation of D-glutamate to the cytoplasmic intermediate UDP-N-acetyl-muramoyl-L-alanine (UMA) utilizing ATP hydrolysis to ADP and P(i). This reaction is part of a biosynthetic path yielding bacterial peptidoglycan. On the basis of structural studies of MurD complexes, a stepwise catalytic mechanism was proposed that commences with a formation of the acyl-phosphate intermediate, followed by a nucleophilic attack of D-glutamate that, through the formation of a tetrahedral reaction intermediate and subsequent phosphate dissociation, affords the final product, UDP-N-acetyl-muramoyl-L-alanine-D-glutamate (UMAG). A hybrid quantum mechanical/molecular mechanical (QM/MM) molecular modeling approach was utilized, combining the B3LYP QM level of theory with empirical force field simulations to evaluate three possible reaction pathways leading to tetrahedral intermediate formation. Geometries of the starting structures based on crystallographic experimental data and tetrahedral intermediates were carefully examined together with a role of crucial amino acids and water molecules. The replica path method was used to generate the reaction pathways between the starting structures and the corresponding tetrahedral reaction intermediates, offering direct comparisons with a sequential kinetic mechanism and the available structural data for this enzyme. The acquired knowledge represents new and valuable information to assist in the ongoing efforts leading toward novel inhibitors of MurD as potential antibacterial drugs. (c) 2008 Wiley-Liss, Inc.

Modeling ultrafast solvated electronic dynamics using time-dependent density functional theory and polarizable continuum model.

PubMed

Liang, Wenkel; Chapman, Craig T; Ding, Feizhi; Li, Xiaosong

2012-03-01

A first-principles solvated electronic dynamics method is introduced. Solvent electronic degrees of freedom are coupled to the time-dependent electronic density of a solute molecule by means of the implicit reaction field method, and the entire electronic system is propagated in time. This real-time time-dependent approach, incorporating the polarizable continuum solvation model, is shown to be very effective in describing the dynamical solvation effect in the charge transfer process and yields a consistent absorption spectrum in comparison to the conventional linear response results in solution. © 2012 American Chemical Society

Controlled droplet microfluidic systems for multistep chemical and biological assays.

PubMed

Kaminski, T S; Garstecki, P

2017-10-16

Droplet microfluidics is a relatively new and rapidly evolving field of science focused on studying the hydrodynamics and properties of biphasic flows at the microscale, and on the development of systems for practical applications in chemistry, biology and materials science. Microdroplets present several unique characteristics of interest to a broader research community. The main distinguishing features include (i) large numbers of isolated compartments of tiny volumes that are ideal for single cell or single molecule assays, (ii) rapid mixing and negligible thermal inertia that all provide excellent control over reaction conditions, and (iii) the presence of two immiscible liquids and the interface between them that enables new or exotic processes (the synthesis of new functional materials and structures that are otherwise difficult to obtain, studies of the functions and properties of lipid and polymer membranes and execution of reactions at liquid-liquid interfaces). The most frequent application of droplet microfluidics relies on the generation of large numbers of compartments either for ultrahigh throughput screens or for the synthesis of functional materials composed of millions of droplets or particles. Droplet microfluidics has already evolved into a complex field. In this review we focus on 'controlled droplet microfluidics' - a portfolio of techniques that provide convenient platforms for multistep complex reaction protocols and that take advantage of automated and passive methods of fluid handling on a chip. 'Controlled droplet microfluidics' can be regarded as a group of methods capable of addressing and manipulating droplets in series. The functionality and complexity of controlled droplet microfluidic systems can be positioned between digital microfluidics (DMF) addressing each droplet individually using 2D arrays of electrodes and ultrahigh throughput droplet microfluidics focused on the generation of hundreds of thousands or even millions of picoliter droplets that cannot be individually addressed by their location on a chip.

Nonenzymatic and enzymatic hydrolysis of alkyl halides: A theoretical study of the SN2 reactions of acetate and hydroxide ions with alkyl chlorides

PubMed Central

Maulitz, Andreas H.; Lightstone, Felice C.; Zheng, Ya-Jun; Bruice, Thomas C.

1997-01-01

The SN2 displacements of chloride ion from CH3Cl, C2H5Cl, and C2H4Cl2 by acetate and hydroxide ions have been investigated, using ab initio molecular orbital theory at the HF/6–31+G(d), MP2/6–31+G(d), and MP4/6–31+G(d) levels of theory. The central barriers (calculated from the initial ion–molecule complex) of the reactions, the differences of the overall reaction energies, and the geometries of the transition states are compared. Essential stereochemical changes before and after the displacement reactions are described for selected cases. The gas phase reactions of hydroxide with CH3Cl, C2H5Cl, and C2H4Cl2 have no overall barrier, but there is a small overall barrier for the reactions of acetate with CH3Cl, C2H5Cl, and C2H4Cl2. A self-consistent reaction field solvation model was used to examine the SN2 reactions between methyl chloride and hydroxide ion and between 1,2-dichloroethane and acetate in solution. As expected, the reactions in polar solvent have a large barrier. However, the transition state structures determined by ab initio calculations change only slightly in the presence of a highly polar solvent as compared with the gas phase. We also calibrated the PM3 method for future study of an enzymatic SN2 displacement of halogen. PMID:9192609

Plasma-assisted synthesis and study of structural and magnetic properties of Fe/C core shell

NASA Astrophysics Data System (ADS)

Shinde, K. P.; Ranot, M.; Choi, C. J.; Kim, H. S.; Chung, K. C.

2017-07-01

Pure and carbon-encapsulated iron nanoparticles with an average diameter of 25 nm were synthesized by using the DC plasma arc discharge method. Fe core nanoparticles were encapsulated with carbon layer, which is acting as protection layer against both oxidation and chemical reaction. The morphology and the Fe/C core/shell structure of the nanoparticles were studied by using field emission scanning electron microscopy and transmission electron microscopy. The x-ray diffraction study showed that the α-Fe phase exists with γ-Fe as an impurity. The studied samples have been interrelated with the variation of saturation magnetization, remanent magnetization and coercive field with the amount of carbon coating. The pure α-Fe sample shows saturation magnetization = 172 emu/g, and coercive field = 150 Oe, on the other hand few layer carbon coated α-Fe sample shows saturation magnetization =169 emu/g with higher coercive field 398 Oe.

Encouragement of Enzyme Reaction Utilizing Heat Generation from Ferromagnetic Particles Subjected to an AC Magnetic Field.

PubMed

Suzuki, Masashi; Aki, Atsushi; Mizuki, Toru; Maekawa, Toru; Usami, Ron; Morimoto, Hisao

2015-01-01

We propose a method of activating an enzyme utilizing heat generation from ferromagnetic particles under an ac magnetic field. We immobilize α-amylase on the surface of ferromagnetic particles and analyze its activity. We find that when α-amylase/ferromagnetic particle hybrids, that is, ferromagnetic particles, on which α-amylase molecules are immobilized, are subjected to an ac magnetic field, the particles generate heat and as a result, α-amylase on the particles is heated up and activated. We next prepare a solution, in which α-amylase/ferromagnetic particle hybrids and free, nonimmobilized chitinase are dispersed, and analyze their activities. We find that when the solution is subjected to an ac magnetic field, the activity of α-amylase immobilized on the particles increases, whereas that of free chitinase hardly changes; in other words, only α-amylase immobilized on the particles is selectively activated due to heat generation from the particles.

TRAVELING WAVE PYROTRON

DOEpatents

Post, R.F.

1963-06-11

The invention relates to a pyrotron, i.e., magnetic mirror device, designed for continuous operation in producing a high-temperature fusion reaction plasma and for directly converting the plasma energy into electrical power. The device utilizes a system in which an axially symmetric magnetic field is produced and transports plasma through a first zone of progressively rising field intensity, a second reaction zone of slowly increasing intensity, and thenceforth through a third zone of progressively decreasing intensity wherein the plasma expands against the magnetic field thereby producing electrical current in magnetic field generating solenoids associated with said third zone. (AEC)

Activated by Combined Magnrtic Field Gravitropic Reaction Reply on Nanodose of Biologicaly Active Compounds

NASA Astrophysics Data System (ADS)

Sheykina, Nadezhda; Bogatina, Nina

The new science direction nanotechnologies initiated a big jump in the pharmacology and medicine. This leads to the big development of homeopathy. The most interest appeared while investigating of the reaction of biological object on the nano dose of iologically substances. The changing of concentration (in nmol/l) of biologically active material is also possible during weak energy action. For instance, weak combined magnetic field may change a little the concentration of ions that are oriented parallel to the external magnetic field and, by the analogy with said above, lead to the similar effects. Simple estimations give the value for the threshold to the magnetic field by two orders smaller than the geomagnetic field. By this investigation we wanted to understand whether the analogy in the action of nano dose of biologically active substances and weak combined magnetic field presents and whether the action of one of these factors may be replaced by other one. The effect of one of biologically active substances NPA (Naphtyl-Phtalame Acid) solution with the concentration 0.01 mol/l on the gravitropic reaction of cress roots was investigated. It was shown that its effect was the inhibition of cress roots gravitropic reaction. The same inhibition was achieved by the combined magnetic field action on the cress roots, germinated in water. The alternative component of the combined magnetic field coincided formally with the cyclotron frequency of NPA ions. So the analogy in the action of nano dose of biologically active substances and weak combined magnetic field was shown. The combined magnetic field using allows to decrease sufficiently the dose of biologically active substances. This fact can be of great importance in pharmacy and medicine.

Vespa crabro immunotherapy versus Vespula-venom immunotherapy in Vespa crabro allergy: a comparison study in field re-stings.

PubMed

Macchia, Donatella; Cortellini, Gabriele; Mauro, Marina; Meucci, Elisa; Quercia, Oliviero; Manfredi, Mariangela; Massolo, Alessandro; Valentini, Maurizio; Severino, Maurizio; Passalacqua, Giovanni

2018-01-01

In ascertained allergic sensitization to Vespa crabro (VC) venom, the European guidelines still consider venom immunotherapy (VIT) with Vespula (VE) venom sufficient to achieve an adequate protection against VC. However, antigen 5 immunoblotting studies showed that a genuine sensitization to VC venom may exist. In such cases, a specific VC venom would be preferable for VIT treatment. Since in the last few years, VC venom extracts became available for diagnosis and desensitization, we assessed the efficacy and safety of VIT with a VC-VIT, compared to VE extract. Patients stung by VC, and carefully diagnosed for specific sensitization and indication to VIT underwent a 5-year course of immunotherapy with either VE or VC extracts . The severity of reactions at the first sting (pre-VIT) and after field re-stings (during VIT) were compared. Eighty-three patients, treated with VE extract and 130 patients treated with VC extract completed the 5-year course of VIT. Only a fraction of those patients (43,8%) were field-re-stung by VC: 64 patients on VC VIT and 69 on VE VIT. In the VC VIT group, reactions at re-sting were: 50 negative, 12 large local reactions, 4 systemic reactions (Muller grade I). In this group the VC VIT efficacy was 93,8%. In the VE VIT treated group the reactions at VC re-sting were: 51 negative, 10 large local reactions and 9 systemic reactions (5 Muller I, 3 Mueller III, 1 Muller IV). In this group the overall efficacy of VIT was 87,0%. The difference in efficacy between the two groups was not statistically significant, as previously reported in literature. Nonetheless, field sting systemic reactions Muller III and IV were recorded only in those patients receiving VE VIT. This observation suggests that in patients with ascertained VC-induced allergic reactions a specific VC VIT, where available, would be more adequate, at least concerning the safety profile.

Highway concrete pavement technology development and testing. Volume I, Field evaluation of strategic highway research program (SHRP) C-202 test sites (alkali-silica reactions (ASR))

DOT National Transportation Integrated Search

2006-08-01

This study consists of continued field evaluations of treatments to four pavements suffering from distress due to alkali-silica reaction (ASR). One set of treatments was evaluated on existing pavements in Delaware, California, and Nevada that already...

Gauge field back reaction on a black hole

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hochberg, D.; Kephart, T.W.

1993-02-15

The order-[h bar] fluctuations of gauge fields in the vicinity of a black hole can create a repulsive antigravity region extending out beyond the renormalized Schwarzschild horizon. If the strength of this repulsive force increases as higher orders in the back reaction are included, the formation of a wormholelike object could occur.

Development of field-deployable instrumentation based on “antigen–antibody” reactions for detection of hemorrhagic disease in ruminants

USDA-ARS?s Scientific Manuscript database

Development of field-deployable methodology utilizing antigen–antibody reactions and the surface Plasmon resonance (SPR) effect to provide a rapid diagnostic test for recognition of the blue tongue virus (BTV) and epizootic hemorrhage disease virus (EHDV) in wild and domestic ruminants is reported. ...

Field Evaluation of Two Geophysical Techniques for Real-Time Mapping of Smouldering Remediation (STAR)

NASA Astrophysics Data System (ADS)

Trento, L. M.; Tsourlos, P.; McMaster, M.; Liefl, D.; Sims, A.; Dominguez, J. L. G.; Vidumsky, J.; Gerhard, J.

2016-12-01

Self-sustaining Treatment for Active Remediation (STAR) technology destroys non-aqueous phase liquid (NAPL) in situ using principles of smouldering combustion. It involves propagating an exothermic (400-1000C) oxidation reaction outwards from an ignition well. A full-scale STAR system is currently being applied at an industrial site contaminated with coal tar below the water table in New Jersey, USA. STAR is typically tracked using multi-level thermocouples, which are discrete and sparse in space and time. This study evaluates two surface-based geophysical methods - Electrical Resistivity Tomography (ERT) and Self-Potential (SP) - for the ability to map the STAR reaction in real time at the New Jersey site. Both techniques involve placing electrode arrays on the surface and monitoring electrical signals over time (i.e., time-lapse). It is hypothesized that ERT should be able to monitor the resistive dry zone that precedes the reaction front and/or the growing NAPL-depleted zone. SP is expected to be able to detect the potential difference associated with thermal gradients generated by the reaction. Approximately 72 ERT electrodes in a "swiss cross" pattern plus 10 SP electrodes will be emplaced over single STAR treatment cell (six ignition wells). This setup will be employed to monitor both a deep (25 feet) and shallow (8 feet) STAR treatments. The geophysics will be complemented by in situ temperature measurements, continuous gas measurements, and pre- and post-treatment coring. The primary goal of this research is to evaluate the effectiveness of using ERT and SP for STAR under field conditions. The tests will be conducted in August 2016.

Safety and efficacy of venom immunotherapy: a real life study

PubMed Central

Kołaczek, Agnieszka; Skorupa, Dawid; Antczak-Marczak, Monika; Kuna, Piotr

2017-01-01

Introduction Venom immunotherapy (VIT) is recommended as the first-line treatment for patients allergic to Hymenoptera venom. Aim To analyze the safety and efficacy of VIT in a real life setting. Material and methods One hundred and eighty patients undergoing VIT were studied to evaluate the safety, efficacy, incidence and nature of symptoms after field stings and adverse reactions to VIT. Results Significantly more patients were allergic to wasp than bee venom (146 vs. 34, p < 0.0001). Early and late side effects were more common during the maintenance (48 patients, 26.7%) than during the induction of VIT (32 patients, 17.8%), were more frequent in patients allergic to bees, and were not associated with angiotensin convertase inhibitors (ACEi) or β-adrenergic antagonists use. Systemic reactions were observed in 4 individuals on wasp VIT (2.7%) and in 6 patients allergic to bees (17.65%). The VIT was efficacious as most patients reported no reactions (50%) or reported only mild local reactions (43.75%) to field stings. The decrease in sIgE at completion of VIT correlated with the dose of vaccine received (r = 0.53, p = 0.004). Beekeeping (RR = 29.54, p < 0.0001) and female sex (RR = 1.27, p = 0.033) were associated with a higher risk of venom allergy. Conclusions Venom immunotherapy is highly efficacious and safe as most of the adverse events during the induction and maintenance phase are mild and local. Side effects of VIT are more common in subjects on bee VIT. Beekeeping and female sex are associated with a higher risk of allergy to Hymenoptera venom. PMID:28507496

Decolorization of Acid Orange 7 by an electric field-assisted modified orifice plate hydrodynamic cavitation system: Optimization of operational parameters.

PubMed

Jung, Kyung-Won; Park, Dae-Seon; Hwang, Min-Jin; Ahn, Kyu-Hong

2015-09-01

In this study, the decolorization of Acid Orange 7 (AO-7) with intensified performance was obtained using hydrodynamic cavitation (HC) combined with an electric field (graphite electrodes). As a preliminary step, various HC systems were compared in terms of decolorization, and, among them, the electric field-assisted modified orifice plate HC (EFM-HC) system exhibited perfect decolorization performance within 40 min of reaction time. Interestingly, when H2O2 was injected into the EFM-HC system as an additional oxidant, the reactor performance gradually decreased as the dosing ratio increased; thus, the remaining experiments were performed without H2O2. Subsequently, an optimization process was conducted using response surface methodology with a Box-Behnken design. The inlet pressure, initial pH, applied voltage, and reaction time were chosen as operational key factors, while decolorization was selected as the response variable. The overall performance revealed that the selected parameters were either slightly interdependent, or had significant interactive effects on the decolorization. In the verification test, complete decolorization was observed under statistically optimized conditions. This study suggests that EFM-HC is a useful method for pretreatment of dye wastewater with positive economic and commercial benefits. Copyright © 2015 Elsevier B.V. All rights reserved.

The suppression of radiation reaction and laser field depletion in laser-electron beam interaction

NASA Astrophysics Data System (ADS)

Ong, J. F.; Moritaka, T.; Takabe, H.

2018-03-01

The effects of radiation reaction (RR) have been studied extensively by using the interaction of ultraintense lasers with a counter-propagating relativistic electron. At the laser intensity at the order of 1023 W/cm2, the effects of RR are significant in a few laser periods for a relativistic electron. However, a laser at such intensity is tightly focused and the laser energy is usually assumed to be fixed. Then, the signal of RR and energy conservation cannot be guaranteed. To assess the effects of RR in a tightly focused laser pulse and the evolution of the laser energy, we simulated this interaction with a beam of 109 electrons by means of a Particle-In-Cell method. We observe that the effects of RR are suppressed due to the ponderomotive force and accompanied by a non-negligible amount of laser field energy reduction. This is because the ponderomotive force prevents the electrons from approaching the center of the laser pulse and leads to an interaction at the weaker field region. At the same time, the laser energy is absorbed through ponderomotive acceleration. Thus, the kinetic energy of the electron beam has to be carefully selected such that the effects of RR become obvious.

Visible and UV-curable chitosan derivatives for immobilization of biomolecules.

PubMed

Kim, Eun-Hye; Han, Ga-Dug; Kim, Jae-Won; Noh, Seung-Hyun; Lee, Jae-Gwan; Ito, Yoshihiro; Son, Tae-Il

2017-11-01

Chitosan, which has many biocompatible properties, is used widely in medical field like wound healing, drug delivery and so on. Chitosan could be used as a biomaterial to immobilize protein-drug. There are many methods to immobilize protein-drug, but they have some drawbacks such as low efficiency and denaturation of protein. Therefore, photo-immobilization method is suggested to immobilize protein-drug. Photo-immobilization method is simple-reaction and also needs no additional crosslinking reagent. There has been some effort to modify chitosan to have an ability of photo-immobilization. Generally, visible and UV light reactive chitosan derivatives were prepared. Various types of photo-curable chitosan derivatives showed possibility for application to medical field. For example, they showed ability for protein-immobilization and some of them showed wound-healing effect, anti-adhesive effect, or property to interact directly with titanium surface. In this study, we introduce many types of photo-curable chitosan derivative and their possibility of medical application. Copyright © 2017 Elsevier B.V. All rights reserved.

Cheap but accurate calculation of chemical reaction rate constants from ab initio data, via system-specific, black-box force fields

NASA Astrophysics Data System (ADS)

Steffen, Julien; Hartke, Bernd

2017-10-01

Building on the recently published quantum-mechanically derived force field (QMDFF) and its empirical valence bond extension, EVB-QMDFF, it is now possible to generate a reliable potential energy surface for any given elementary reaction step in an essentially black box manner. This requires a limited and pre-defined set of reference data near the reaction path and generates an accurate approximation of the reference potential energy surface, on and off the reaction path. This intermediate representation can be used to generate reaction rate data, with far better accuracy and reliability than with traditional approaches based on transition state theory (TST) or variational extensions thereof (VTST), even if those include sophisticated tunneling corrections. However, the additional expense at the reference level remains very modest. We demonstrate all this for three arbitrarily chosen example reactions.

Hydrogeochemical investigations in the Osgood mountains, north-central Nevada. Chapter B.

USGS Publications Warehouse

Wanty, Richard B.; Berger, Byron R.; Tuttle, Michele L.W.; Briggs, Paul H.; Meier, Allen L.; Crock, James G.; Stillings, Lisa L.

2006-01-01

Field investigations performed in the Osgood Mountains during the summers of 1999 and 2000 were designed to test methods of combining geologic, hydrologic, and geochemical investigations. The goals were to develop a more thorough understanding of the movement of water through the study area and to understand the water-rock reactions that may occur along flow paths. The Osgood Mountains were chosen for study because they represent a well-defined geologic system, based on existing and new field data. New work in the area focused on gathering more data about fractures, faults, and joints and on collecting water samples to evaluate the role of geologic structures on hydrologic and geochemical properties of the ground-water/surface-water system. Chemical methods employed in the study included measuring traditional field parameters (e.g., pH, temperature, conductivity, dissolved oxygen) as well as Fe2+ and collecting a variety of samples that were preserved for later laboratory analysis. Hydrologic methods included closely spaced evaluations of substream hydraulic head to define ground-water discharge and recharge zones as well as some measurements of stream discharge. Geologic investigations focused on the locations and orientations of fractures and kinematic indicators of slip observable in outcrops.

An efficient graph theory based method to identify every minimal reaction set in a metabolic network

PubMed Central

2014-01-01

Background Development of cells with minimal metabolic functionality is gaining importance due to their efficiency in producing chemicals and fuels. Existing computational methods to identify minimal reaction sets in metabolic networks are computationally expensive. Further, they identify only one of the several possible minimal reaction sets. Results In this paper, we propose an efficient graph theory based recursive optimization approach to identify all minimal reaction sets. Graph theoretical insights offer systematic methods to not only reduce the number of variables in math programming and increase its computational efficiency, but also provide efficient ways to find multiple optimal solutions. The efficacy of the proposed approach is demonstrated using case studies from Escherichia coli and Saccharomyces cerevisiae. In case study 1, the proposed method identified three minimal reaction sets each containing 38 reactions in Escherichia coli central metabolic network with 77 reactions. Analysis of these three minimal reaction sets revealed that one of them is more suitable for developing minimal metabolism cell compared to other two due to practically achievable internal flux distribution. In case study 2, the proposed method identified 256 minimal reaction sets from the Saccharomyces cerevisiae genome scale metabolic network with 620 reactions. The proposed method required only 4.5 hours to identify all the 256 minimal reaction sets and has shown a significant reduction (approximately 80%) in the solution time when compared to the existing methods for finding minimal reaction set. Conclusions Identification of all minimal reactions sets in metabolic networks is essential since different minimal reaction sets have different properties that effect the bioprocess development. The proposed method correctly identified all minimal reaction sets in a both the case studies. The proposed method is computationally efficient compared to other methods for finding minimal reaction sets and useful to employ with genome-scale metabolic networks. PMID:24594118

Development and testing of a compartmentalized reaction network model for redox zones in contaminated aquifers

USGS Publications Warehouse

Abrams , Robert H.; Loague, Keith; Kent, Douglas B.

1998-01-01

The work reported here is the first part of a larger effort focused on efficient numerical simulation of redox zone development in contaminated aquifers. The sequential use of various electron acceptors, which is governed by the energy yield of each reaction, gives rise to redox zones. The large difference in energy yields between the various redox reactions leads to systems of equations that are extremely ill-conditioned. These equations are very difficult to solve, especially in the context of coupled fluid flow, solute transport, and geochemical simulations. We have developed a general, rational method to solve such systems where we focus on the dominant reactions, compartmentalizing them in a manner that is analogous to the redox zones that are often observed in the field. The compartmentalized approach allows us to easily solve a complex geochemical system as a function of time and energy yield, laying the foundation for our ongoing work in which we couple the reaction network, for the development of redox zones, to a model of subsurface fluid flow and solute transport. Our method (1) solves the numerical system without evoking a redox parameter, (2) improves the numerical stability of redox systems by choosing which compartment and thus which reaction network to use based upon the concentration ratios of key constituents, (3) simulates the development of redox zones as a function of time without the use of inhibition factors or switching functions, and (4) can reduce the number of transport equations that need to be solved in space and time. We show through the use of various model performance evaluation statistics that the appropriate compartment choice under different geochemical conditions leads to numerical solutions without significant error. The compartmentalized approach described here facilitates the next phase of this effort where we couple the redox zone reaction network to models of fluid flow and solute transport.

Sub-millitesla magnetic field effects on the recombination reaction of flavin and ascorbic acid radicals

NASA Astrophysics Data System (ADS)

Evans, Emrys W.; Kattnig, Daniel R.; Henbest, Kevin B.; Hore, P. J.; Mackenzie, Stuart R.; Timmel, Christiane R.

2016-08-01

Even though the interaction of a <1 mT magnetic field with an electron spin is less than a millionth of the thermal energy at room temperature (kBT), it still can have a profound effect on the quantum yields of radical pair reactions. We present a study of the effects of sub-millitesla magnetic fields on the photoreaction of flavin mononucleotide with ascorbic acid. Direct control of the reaction pathway is achieved by varying the rate of electron transfer from ascorbic acid to the photo-excited flavin. At pH 7.0, we verify the theoretical prediction that, apart from a sign change, the form of the magnetic field effect is independent of the initial spin configuration of the radical pair. The data agree well with model calculations based on a Green's function approach that allows multinuclear spin systems to be treated including the diffusive motion of the radicals, their spin-selective recombination reactions, and the effects of the inter-radical exchange interaction. The protonation states of the radicals are uniquely determined from the form of the magnetic field-dependence. At pH 3.0, the effects of two chemically distinct radical pair complexes combine to produce a pronounced response to ˜500 μT magnetic fields. These findings are relevant to the magnetic responses of cryptochromes (flavin-containing proteins proposed as magnetoreceptors in birds) and may aid the evaluation of effects of weak magnetic fields on other biologically relevant electron transfer processes.

Intense Femtosecond Laser-Mediated Electrical Discharge Enables Preparation of Amorphous Nickel Phosphide Nanoparticles.

PubMed

Ma, Zhuo-Chen; Chen, Qi-Dai; Han, Bing; Li, He-Long; Wang, Lei; Zhang, Yong-Lai; Sun, Hong-Bo

2018-05-09

Reported here is a high-efficiency preparation method of amorphous nickel phosphide (Ni-P) nanoparticles by intense femtosecond laser irradiation of nickel sulfate and sodium hypophosphite aqueous solution. The underlying mechanism of the laser-assisted preparation was discussed in terms of the breaking of chemical bond in reactants via highly intense electric field discharge generated by the intense femtosecond laser. The morphology and size of the nanoparticles can be tuned by varying the reaction parameters such as ion concentration, ion molar ratio, laser power, and irradiation time. X-ray diffraction and transmission electron microscopy results demonstrated that the nanoparticles were amorphous. Finally, the thermogravimetric-differential thermal analysis experiment verified that the as-synthesized noncrystalline Ni-P nanoparticles had an excellent catalytic capability toward thermal decomposition of ammonium perchlorate. This strategy of laser-mediated electrical discharge under such an extremely intense field may create new opportunities for the decomposition of molecules or chemical bonds that could further facilitate the recombination of new atoms or chemical groups, thus bringing about new possibilities for chemical reaction initiation and nanomaterial synthesis that may not be realized under normal conditions.

A chromophoric study of 2-ethylhexyl p-methoxycinnamate

NASA Astrophysics Data System (ADS)

Alves, Leonardo F.; Gargano, Ricardo; Alcanfor, Silvia K. B.; Romeiro, Luiz A. S.; Martins, João B. L.

2011-11-01

Ultraviolet absorption spectra of 2-ethylhexyl p-methoxycinnamate have been recorded in different solvents and calculated using the time dependent density functional theory. The calculations were performed with the aid of B3LYP, PBE1PBE, M06, and PBEPBE functionals and 6-31+G(2d) basis set. The geometries were initially optimized using PM5 semiempirical method for the conformational search. The calculations of excited states were carried out using the time dependent with IEF-PCM solvent reaction field method. The experimental data were obtained in the wavelength range from 200 to 400 nm using 10 different solvents. The TD-PBE1PBE method shows the best agreement to the experimental results.

Study of grid independence of finite element method on MHD free convective casson fluid flow with slip effect

NASA Astrophysics Data System (ADS)

Raju, R. Srinivasa; Ramesh, K.

2018-05-01

The purpose of this work is to study the grid independence of finite element method on MHD Casson fluid flow past a vertically inclined plate filled in a porous medium in presence of chemical reaction, heat absorption, an external magnetic field and slip effect has been investigated. For this study of grid independence, a mathematical model is developed and analyzed by using appropriate mathematical technique, called finite element method. Grid study discussed with the help of numerical values of velocity, temperature and concentration profiles in tabular form. avourable comparisons with previously published work on various special cases of the problem are obtained.

Interpreting the Coulomb-field approximation for generalized-Born electrostatics using boundary-integral equation theory.

PubMed

Bardhan, Jaydeep P

2008-10-14

The importance of molecular electrostatic interactions in aqueous solution has motivated extensive research into physical models and numerical methods for their estimation. The computational costs associated with simulations that include many explicit water molecules have driven the development of implicit-solvent models, with generalized-Born (GB) models among the most popular of these. In this paper, we analyze a boundary-integral equation interpretation for the Coulomb-field approximation (CFA), which plays a central role in most GB models. This interpretation offers new insights into the nature of the CFA, which traditionally has been assessed using only a single point charge in the solute. The boundary-integral interpretation of the CFA allows the use of multiple point charges, or even continuous charge distributions, leading naturally to methods that eliminate the interpolation inaccuracies associated with the Still equation. This approach, which we call boundary-integral-based electrostatic estimation by the CFA (BIBEE/CFA), is most accurate when the molecular charge distribution generates a smooth normal displacement field at the solute-solvent boundary, and CFA-based GB methods perform similarly. Conversely, both methods are least accurate for charge distributions that give rise to rapidly varying or highly localized normal displacement fields. Supporting this analysis are comparisons of the reaction-potential matrices calculated using GB methods and boundary-element-method (BEM) simulations. An approximation similar to BIBEE/CFA exhibits complementary behavior, with superior accuracy for charge distributions that generate rapidly varying normal fields and poorer accuracy for distributions that produce smooth fields. This approximation, BIBEE by preconditioning (BIBEE/P), essentially generates initial guesses for preconditioned Krylov-subspace iterative BEMs. Thus, iterative refinement of the BIBEE/P results recovers the BEM solution; excellent agreement is obtained in only a few iterations. The boundary-integral-equation framework may also provide a means to derive rigorous results explaining how the empirical correction terms in many modern GB models significantly improve accuracy despite their simple analytical forms.

Immunisation against East Coast fever by the infection and treatment method: evaluation of the use of ice baths for field delivery and appraisal of an acid formulation of long-acting tetracycline.

PubMed

Marcotty, T; Billiouw, M; Chaka, G; Berkvens, D; Losson, B; Brandt, J

2001-08-20

Immunisation by the infection and treatment method using the Katete strain is currently the most efficient prophylactic technique to control East Coast fever (ECF) in the endemic areas of the Eastern Province of Zambia. The maintenance of the cold chain in liquid nitrogen up to the time of inoculation and the cost of the reference long-acting oxytetracycline (Terramycin LA, Pfizer) are the main drawbacks of the method. The work presented in this paper aims at reducing the cost of immunisation against ECF by using an ice bath for the field delivery and a cheaper long-acting oxytetracycline formulation as chemotherapeutic agent. In experimental conditions, the results from 40 calves immunised after various periods of storage on ice ranging from 4 to 32 h indicate that deferred immunisation performed with a stabilate kept on ice for up to 6h after thawing has an efficiency of 90%. Moreover, sporozoites kept on ice were still surviving 32 h after thawing. In a field trial, 91 calves were inoculated with a stabilate kept for 3.5-5.5 h after thawing and dilution whereas 86 calves were immunised using the standard method. Clinical and parasitological reactions to immunisation were monitored as well as the seroconversion. In the field trial, the deferred immunisation was more efficient than the standard method. The acid formulation of oxytetracycline that was tested was found as suitable as the reference alkaline formulation for the chemotherapeutic control of the Katete strain in ECF immunisation. One indoor trial was carried out on 10 animals and a field trial involved 93 calves.

Method for determination of some soluble atmospheric carbonyl compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Y.N.; Zhou, X.

1993-04-01

A technique was developed for the measurement of soluble atmospheric carbonyl compounds, which uses a pyrex coil gas-liquid scrubber sampler in conjunction with a high-performance liquid chromatograph equipped with a UV-visible detector for separation and identification following derivatization with 2,4-dinitrophenylhydrazine. Carbonyls exhibiting a Henry's law solubility similar to or greater than that of formaldehyde (FA) can be determined by this method; these include FA, glycolaldehyde (GA), glyoxal (GL), and methylglyoxal (MG). Based on liquid standards and field-developed chromatographic characteristics, the limits of detection are about 0.005 ppb (in the gas phase) for MG, about 0.01 ppb for GL, and aboutmore » 0.02 ppb for FA and GA. Because of the short air-liquid contact time in the coil sampler (smaller than 10 s), interferences from aqueous-phase reactions of ozone are insignificant. Also, at the low pH of the scrubbing solution, interference resulting from reactions of carbonyls with S(IV) is unimportant. 43 refs., 7 figs., 3 tabs.« less

Flow chemistry to control the synthesis of nano and microparticles for biomedical applications.

PubMed

Hassan, Natalia; Oyarzun-Ampuero, Felipe; Lara, Pablo; Guerrero, Simón; Cabuil, Valérie; Abou-Hassan, Ali; Kogan, Marcelo J

2014-03-01

In this article we review the flow chemistry methodologies for the controlled synthesis of different kind of nano and microparticles for biomedical applications. Injection mechanism has emerged as new alternative for the synthesis of nanoparticles due to this strategy allows achieving superior levels of control of self-assemblies, leading to higher-ordered structures and rapid chemical reactions. Self-assembly events are strongly dependent on factors such as the local concentration of reagents, the mixing rates, and the shear forces, which can be finely tuned, as an example, in a microfluidic device. Injection methods have also proved to be optimal to elaborate microsystems comprising polymer solutions. Concretely, extrusion based methods can provide controlled fluid transport, rapid chemical reactions, and cost-saving advantages over conventional reactors. We provide an update of synthesis of nano and microparticles such as core/shell, Janus, nanocrystals, liposomes, and biopolymeric microgels through flow chemistry, its potential bioapplications and future challenges in this field are discussed.

Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lovrinovic, Marina; Niemeyer, Christof M.

2005-09-30

We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter weremore » ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.« less

Blindsight modulation of motion perception.

PubMed

Intriligator, James M; Xie, Ruiman; Barton, Jason J S

2002-11-15

Monkey data suggest that of all perceptual abilities, motion perception is the most likely to survive striate damage. The results of studies on motion blindsight in humans, though, are mixed. We used an indirect strategy to examine how responses to visible stimuli were modulated by blind-field stimuli. In a 26-year-old man with focal striate lesions, discrimination of visible optic flow was enhanced about 7% by blind-field flow, even though discrimination of optic flow in the blind field alone (the direct strategy) was at chance. Pursuit of an imagined target using peripheral cues showed reduced variance but not increased gain with blind-field cues. Preceding blind-field prompts shortened reaction times to visible targets by about 10 msec, but there was no attentional crowding of visible stimuli by blind-field distractors. A similar efficacy of indirect blind-field optic flow modulation was found in a second patient with residual vision after focal striate damage, but not in a third with more extensive medial occipito-temporal damage. We conclude that indirect modulatory strategies are more effective than direct forced-choice methods at revealing residual motion perception after focal striate lesions.

Stability of flat spacetime in quantum gravity

NASA Astrophysics Data System (ADS)

Jordan, R. D.

1987-12-01

In a previous paper, a modified effective-action formalism was developed which produces equations satisfied by the expectation value of the field, rather than the usual in-out average. Here this formalism is applied to a quantized scalar field in a background which is a small perturbation from Minkowski spacetime. The one-loop effective field equation describes the back reaction of created particles on the gravitational field, and is calculated in this paper to linear order in the perturbation. In this way we rederive an equation first found by Horowitz using completely different methods. This equation possesses exponentially growing solutions, so we confirm Horowitz's conclusion that flat spacetime is unstable in this approximation to the theory. The new derivation shows that the field equation is just as useful as the one-loop approximation to the in-out equation, contrary to earlier arguments. However, the instability suggests that the one-loop approximation cannot be trusted for gravity. These results are compared with the corresponding situation in QED and QCD.

Nonthermal microwave effects revisited: on the importance of internal temperature monitoring and agitation in microwave chemistry.

PubMed

Herrero, M Antonia; Kremsner, Jennifer M; Kappe, C Oliver

2008-01-04

The concept of nonthermal microwave effects has received considerable attention in recent years and is the subject of intense debate in the scientific community. Nonthermal microwave effects have been postulated to result from a direct stabilizing interaction of the electric field with specific (polar) molecules in the reaction medium that is not related to a macroscopic temperature effect. In order to probe the existence of nonthermal microwave effects, four synthetic transformations (Diels-Alder cycloaddition, alkylation of triphenylphosphine and 1,2,4-triazole, direct amide bond formation) were reevaluated under both microwave dielectric heating and conventional thermal heating. In all four cases, previous studies have claimed the existence of nonthermal microwave effects in these reactions. Experimentally, significant differences in conversion and/or product distribution comparing the conventionally and microwave-heated experiments performed at the same measured reaction temperature were found. The current reevaluation of these reactions was performed in a dedicated reactor setup that allowed accurate internal reaction temperature measurements using a multiple fiber-optic probe system. Using this technology, the importance of efficient stirring and internal temperature measurement in microwave-heated reactions was made evident. Inefficient agitation leads to temperature gradients within the reaction mixture due to field inhomogeneities in the microwave cavity. Using external infrared temperature sensors in some cases results in significant inaccuracies in the temperature measurement. Applying the fiber-optic probe temperature monitoring device, a critical reevaluation of all four reactions has provided no evidence for the existence of nonthermal microwave effects. Ensuring efficient agitation of the reaction mixture via magnetic stirring, no significant differences in terms of conversion and selectivity between experiments performed under microwave or oil bath conditions at the same internally measured reaction temperatures were experienced. The observed effects were purely thermal and not related to the microwave field.

Solutions to a reduced Poisson–Nernst–Planck system and determination of reaction rates

PubMed Central

Li, Bo; Lu, Benzhuo; Wang, Zhongming; McCammon, J. Andrew

2010-01-01

We study a reduced Poisson–Nernst–Planck (PNP) system for a charged spherical solute immersed in a solvent with multiple ionic or molecular species that are electrostatically neutralized in the far field. Some of these species are assumed to be in equilibrium. The concentrations of such species are described by the Boltzmann distributions that are further linearized. Others are assumed to be reactive, meaning that their concentrations vanish when in contact with the charged solute. We present both semi-analytical solutions and numerical iterative solutions to the underlying reduced PNP system, and calculate the reaction rate for the reactive species. We give a rigorous analysis on the convergence of our simple iteration algorithm. Our numerical results show the strong dependence of the reaction rates of the reactive species on the magnitude of its far field concentration as well as on the ionic strength of all the chemical species. We also find non-monotonicity of electrostatic potential in certain parameter regimes. The results for the reactive system and those for the non-reactive system are compared to show the significant differences between the two cases. Our approach provides a means of solving a PNP system which in general does not have a closed-form solution even with a special geometrical symmetry. Our findings can also be used to test other numerical methods in large-scale computational modeling of electro-diffusion in biological systems. PMID:20228879

A Green's function method for simulation of time-dependent solute transport and reaction in realistic microvascular geometries.

PubMed

Secomb, Timothy W

2016-12-01

A novel theoretical method is presented for simulating the spatially resolved convective and diffusive transport of reacting solutes between microvascular networks and the surrounding tissues. The method allows for efficient computational solution of problems involving convection and non-linear binding of solutes in blood flowing through microvascular networks with realistic 3D geometries, coupled with transvascular exchange and diffusion and reaction in the surrounding tissue space. The method is based on a Green's function approach, in which the solute concentration distribution in the tissue is expressed as a sum of fields generated by time-varying distributions of discrete sources and sinks. As an example of the application of the method, the washout of an inert diffusible tracer substance from a tissue region perfused by a network of microvessels is simulated, showing its dependence on the solute's transvascular permeability and tissue diffusivity. Exponential decay of the washout concentration is predicted, with rate constants that are about 10-30% lower than the rate constants for a tissue cylinder model with the same vessel length, vessel surface area and blood flow rate per tissue volume. © The authors 2015. Published by Oxford University Press on behalf of the Institute of Mathematics and its Applications. All rights reserved.

An improved pollen collection and cryopreservation method for highly recalcitrant tropical fruit species of mango (Mangifera indica L.) and litchi (Litchi chinensis Sonn.).

PubMed

Chaudhury, Rekha; Malik, S K; Rajan, S

2010-01-01

An improved method for pollen collection from freshly dehiscing anthers of mango (Mangifera indica L.) and litchi (Litchi chinensis Sonn.) using the organic solvent cyclohexane has been devised. Using this method pollen quantity sufficient for large scale pollinations could be collected and stored for future use. Transport of pollen in viable conditions over long distances, from site of collection (field genebank) to cryolab was successfully devised for both these fruit species. Cryopreservation was successfully applied to achieve long-term pollen storage over periods of up to four years. Pollen viability was tested using in vitro germination, the fluorochromatic reaction (FCR) method and by fruit set following field pollination. On retesting, four year cryostored pollen of different mango and litchi varieties showed high percentage viability as good as fresh control pollens. Pollens of more than 180 cultivars of mango and 19 cultivars of litchi have been stored in the cryogenebank using the technology developed, thus facilitating breeding programmes over the long-term.

Vortex-scalar element calculations of a diffusion flame stabilized on a plane mixing layer

NASA Technical Reports Server (NTRS)

Ghoniem, Ahmed F.; Givi, Peyman

1987-01-01

The vortex-scalar element method, a scheme which utilizes vortex elements to discretize the region of high vorticity and scalar elements to represent species or temperature fields, is utilized in the numerical simulations of a two-dimensional reacting mixing layer. Computations are performed for a diffusion flame at high Reynolds and Peclet numbers without resorting to turbulence models. In the nonreacting flow, the mean and fluctuation profiles of a conserved scalar show good agreement with experimental measurements. Results for the reacting flow indicate that for temperature independent kinetics, the chemical reaction begins immediately downstream of the splitter plate where mixing starts. Results for the reacting flow with Arrhenius kinetics show an ignition delay, which depends on reactant temperature, before significant chemical reaction occurs. Harmonic forcing changes the structure of the layer, and concomitantly the rates of mixing and reaction, in accordance with experimental results. Strong stretch within the braids in the nonequilibrium kinetics case causes local flame quenching due to the temperature drop associated with the large convective fluxes.

Atomistic Modeling of Corrosion Events at the Interface between a Metal and Its Environment

DOE PAGES

Taylor, Christopher D.

2012-01-01

Atomistic simulation is a powerful tool for probing the structure and properties of materials and the nature of chemical reactions. Corrosion is a complex process that involves chemical reactions occurring at the interface between a material and its environment and is, therefore, highly suited to study by atomistic modeling techniques. In this paper, the complex nature of corrosion processes and mechanisms is briefly reviewed. Various atomistic methods for exploring corrosion mechanisms are then described, and recent applications in the literature surveyed. Several instances of the application of atomistic modeling to corrosion science are then reviewed in detail, including studies ofmore » the metal-water interface, the reaction of water on electrified metallic interfaces, the dissolution of metal atoms from metallic surfaces, and the role of competitive adsorption in controlling the chemical nature and structure of a metallic surface. Some perspectives are then given concerning the future of atomistic modeling in the field of corrosion science.« less

A Specific Nucleophilic Ring-Opening Reaction of Aziridines as a Unique Platform for the Construction of Hydrogen Polysulfides Sensors

DOE PAGES

Chen, Wei; Rosser, Ethan W.; Zhang, Di; ...

2015-05-11

Hydrogen polysulfides (H 2S n, n>1) have been recently suggested to be the actual signalling molecules that involved in sulfur-related redox biology. However the exact mechanisms of H 2S n are still poorly understood and a major hurdle in this field is the lack of reliable and convenient methods for H 2S n detection. In this work we report a unique ring-opening reaction of N-sulfonylaziridine by Na 2S 2 under mild conditions. Based on this reaction a novel H 2S n-specific fluorescent probe (AP) was developed. The probe showed high sensitivity and selectivity for H 2S n. Notably, the fluorescentmore » turn-on product, i.e. compound 1, exhibited excellent two-photon photophysical properties and a large Stokes shift. Moreover, the high solid state luminescent efficiency of compound 1 makes it a potential candidate for organic emitters and solid-state lighting devices.« less

Characterization of the Minimum Energy Path for the Reaction of Singlet Methylene with N2: The Role of Singlet Methylene in Prompt NO

NASA Technical Reports Server (NTRS)

Walch, Stephen P.

1995-01-01

We report calculations of the minimum energy pathways connecting (1)CH2+N2 to diazomethane and diazirine, for the rearrangement of diazirine to diazomethane, for the dissociation of diazirine to HCN2+H, and of diazomethane to CH2N+N. The calculations use complete active space self-consistent field (CASSCF) derivative methods to characterize the stationary points and internally contracted configuration interaction (ICCI) to determine the energetics. The calculations suggest a potential new source of prompt NO from the reaction of (1)CH2 with N2 to give diazirine, and subsequent reaction of diazirine with hydrogen abstracters to form doublet HCN2, which leads to HCN+N(S-4) on the previously studied CH+N2 Surface. The calculations also predict accurate 0 K heats of formation of 77.7 kcal/mol and 68.0 kcal/mol for diazirine and diazomethane, respectively.

Kinetics of lithium peroxide monohydrate thermal decomposition

NASA Astrophysics Data System (ADS)

Nefedov, Roman; Posternak, Nikolay; Ferapontov, Yuriy

2017-11-01

Topochemical dehydration of lithium peroxide was studied to determine kinetic parameters at the range of temperatures from 90°C to 147°C in non-isothermal conditions by derivatographic method. The study was conducted to select optimal conditions of lithium peroxide synthesis in dehydration reaction of triple LiOH-H2O2-H2O system in ultra-high frequency radiation field. Conditions of dehydration reaction were caused by the thermal conductivity of LiOH -H2O2-H2O system. It is determined that dehydration process runs close to the first order reaction (n=0.85±0.03). The activation energy and pre-exponential factor values were found as Eak = 86.0 ± 0.8 kJ/mol, k0 = (2.19 ± 0.16) .1011 min-1, correspondingly. It is supposed that there is a similarity between the dehydration mechanism of lithium peroxide monohydrate and peroxide hydrates of alkaline-earth metals (calcium, barium and strontium).

Evolution of Photospheric Flow and Magnetic Fields Associated with the 2015 June 22 M6.5 Flare

NASA Astrophysics Data System (ADS)

Wang, Jiasheng; Liu, Chang; Deng, Na; Wang, Haimin

2018-02-01

The evolution of photospheric flow and magnetic fields before and after flares can provide important information regarding the flare triggering and back-reaction processes. However, such studies on the flow field are rare due to the paucity of high-resolution observations covering the entire flaring period. Here we study the structural evolution of penumbra and shear flows associated with the 2015 June 22 M6.5 flare in NOAA AR 12371, using high-resolution imaging observation in the TiO band taken by the 1.6 m Goode Solar Telescope at Big Bear Solar Observatory, with the aid of the differential affine velocity estimator method for flow tracking. The accompanied photospheric vector magnetic field changes are also analyzed using data from the Helioseismic and Magnetic Imager. As a result, we found, for a penumbral segment in the negative field adjacent to the magnetic polarity inversion line (PIL), an enhancement of penumbral flows (up to an unusually high value of ∼2 km s‑1) and extension of penumbral fibrils after the first peak of the flare hard X-ray emission. We also found an area at the PIL, which is co-spatial with a precursor brightening kernel, that exhibits a gradual increase of shear flow velocity (up to ∼0.9 km s‑1) after the flare. The enhancing penumbral and shear flow regions are also accompanied by an increase of horizontal field and decrease of magnetic inclination angle (measured from the solar surface). These results are discussed in the context of the theory of back-reaction of coronal restructuring on the photosphere as a result of flare energy release.

A hybrid numerical technique for predicting the aerodynamic and acoustic fields of advanced turboprops

NASA Technical Reports Server (NTRS)

Homicz, G. F.; Moselle, J. R.

1985-01-01

A hybrid numerical procedure is presented for the prediction of the aerodynamic and acoustic performance of advanced turboprops. A hybrid scheme is proposed which in principle leads to a consistent simultaneous prediction of both fields. In the inner flow a finite difference method, the Approximate-Factorization Alternating-Direction-Implicit (ADI) scheme, is used to solve the nonlinear Euler equations. In the outer flow the linearized acoustic equations are solved via a Boundary-Integral Equation (BIE) method. The two solutions are iteratively matched across a fictitious interface in the flow so as to maintain continuity. At convergence the resulting aerodynamic load prediction will automatically satisfy the appropriate free-field boundary conditions at the edge of the finite difference grid, while the acoustic predictions will reflect the back-reaction of the radiated field on the magnitude of the loading source terms, as well as refractive effects in the inner flow. The equations and logic needed to match the two solutions are developed and the computer program implementing the procedure is described. Unfortunately, no converged solutions were obtained, due to unexpectedly large running times. The reasons for this are discussed and several means to alleviate the situation are suggested.

Highly efficient catalytic systems based on Pd-coated microbeads

NASA Astrophysics Data System (ADS)

Lim, Jin Hyun; Cho, Ahyoung; Lee, Seung Hwan; Park, Bumkyo; Kang, Dong Woo; Koo, Chong Min; Yu, Taekyung; Park, Bum Jun

2018-01-01

The efficiency of two prototype catalysis systems using palladium (Pd)-coated microparticles was investigated with regard to the recovery and recyclability of the catalytic particles. One such system was the interface-adsorption method, in which polymer particles coated with Pd nanoparticles strongly and irreversibly attach to the oil-water interface. Due to the irreversible adsorption of the catalytic particles to the interface, particle loss was completely prevented while mixing the aqueous solution and while collecting the products. The other system was based on the magnetic field-associated particle recovery method. The use of polymeric microparticles containing Pd nanoparticles and magnetite nanoparticles accelerated the sedimentation of the particles in the aqueous phase by applying a strong magnetic field, consequently suppressing drainage of the particles from the reactor along the product stream. Upon multiple runs of the catalytic reactions, it was found that conversion does not change significantly, demonstrating the excellent recyclability and performance efficiency in the catalytic processes.

The hybrid RANS/LES of partially premixed supersonic combustion using G/Z flamelet model

NASA Astrophysics Data System (ADS)

Wu, Jinshui; Wang, Zhenguo; Bai, Xuesong; Sun, Mingbo; Wang, Hongbo

2016-10-01

In order to describe partially premixed supersonic combustion numerically, G/Z flamelet model is developed and compared with finite rate model in hybrid RANS/LES simulation to study the strut-injection supersonic combustion flow field designed by the German Aerospace Center. A new temperature calculation method based on time-splitting method of total energy is introduced in G/Z flamelet model. Simulation results show that temperature predictions in partially premixed zone by G/Z flamelet model are more consistent with experiment than finite rate model. It is worth mentioning that low temperature reaction zone behind the strut is well reproduced. Other quantities such as average velocity and average velocity fluctuation obtained by developed G/Z flamelet model are also in good agreement with experiment. Besides, simulation results by G/Z flamelet also reveal the mechanism of partially premixed supersonic combustion by the analyses of the interaction between turbulent burning velocity and flow field.

A Field-expedient Method for Detection of Leptospirosis Causative Agents in Rodents

DTIC Science & Technology

2012-01-01

carboxytetramethylrhodamine (TAMRA)) (Roche Molecular Diagnostics, Pleasanton, California).24,25 Polymerase Chain Reaction. Wet reagent LPS PCR assay...City, Utah). Primers and probe were optimized with R.A.P.I.D. wet reagents and the optimum condition was 5 mmol/L MgCl2, 400 nmol/L primers, 100 nmol...for 20 seconds of combined annealing and primer extension. Linearity and Limit of Detection. The linearity of the LPS freeze-dried assay was

Development and Application of Asymmetric Organocatalytic Mukaiyama and Vinylogous-Mukaiyama-Type Reactions.

PubMed

Alemán, José; Garrido, Alberto; Fraile, Alberto; Yuste, Francisco; Frias, Maria; Cieslik, Wioleta; Rosado, Anielka

2018-04-23

Organocatalysis is a growing area that is benefiting from advances in many fields. Its implementation has begun in areas such as supramolecular chemistry, organic chemistry and natural product syntheses. While a considerable number of important publications in the field of organocatalytic Mukaiyama-type additions have been reported, they are yet to be fully covered in a review. Therefore, we would like to highlight the applications of various kinds of organocatalysts in Mukaiyama-type reactions, while also including the vinylogous Mukaiyama variant. Herein we describe and discuss the development and current state of the art of the organocatalytic Mukaiyama reaction, vinylogous Mukaiyama and related reactions. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rapid visual detection of cyprinid herpesvirus 2 by recombinase polymerase amplification combined with a lateral flow dipstick.

PubMed

Wang, H; Sun, M; Xu, D; Podok, P; Xie, J; Jiang, Ys; Lu, Lq

2018-05-28

Herpesviral haematopoietic necrosis (HVHN), caused by cyprinid herpesvirus 2 (CyHV-2), causes significant losses in crucian carp (Carassius carassius) aquaculture. Rapid and convenient DNA assay detection of CyHV-2 is useful for field diagnosis. Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that can amplify DNA within 30 min at ~37°C by simulating in vivo DNA recombination. Herein, a rapid and convenient detection assay based on RPA with a lateral flow dipstick (LFD) was developed for detecting CyHV-2. The highly conserved ORF72 of CyHV-2 was targeted by specific and sensitive primers and probes. The optimized assay takes only 15 min at 38°C using a water bath, with analysis of products by 2% agarose gel electrophoresis within 30 min. A simple lateral flow strip based on the unique probe in reaction buffer was developed for visualization. The entire RPA-LFD assay takes 50 min less than the routine PCR method, is 100 times more sensitive and displays no cross-reaction with other aquatic viruses. The combined isothermal RPA and lateral flow assay (RPA-LFD) provides a simple, rapid, reliable method that could improve field diagnosis of CyHV-2 when resources are limited. © 2018 John Wiley & Sons Ltd.

A replaceable dual-enzyme capillary microreactor using magnetic beads and its application for simultaneous detection of acetaldehyde and pyruvate.

PubMed

Shi, Jing; Zhao, Wenwen; Chen, Yuanfang; Guo, Liping; Yang, Li

2012-07-01

A novel replaceable dual-enzyme capillary microreactor was developed and evaluated using magnetic fields to immobilize the alcohol dehydrogenase (ADH)- and lactate dehydrogenase (LDH)-coated magnetic beads at desired positions in the capillary. The dual-enzyme assay was achieved by measuring the two consumption peaks of the coenzyme β-nicotinamide adenine dinucleotide (NADH), which were related to the ADH reaction and LDH reaction. The dual-enzyme capillary microreactor was constructed using magnetic beads without any modification of the inner surface of the capillary, and showed great stability and reproducibility. The electrophoretic resolution for different analytes can be easily controlled by altering the relative distance of different enzyme-coated magnetic beads. The apparent K(m) values for acetaldehyde with ADH-catalyzed reaction and for pyruvate with LDH-catalyzed reaction were determined. The detection limits for acetaldehyde and pyruvate determination are 0.01 and 0.016 mM (S/N = 3), respectively. The proposed method was successfully applied to simultaneously determine the acetaldehyde and pyruvate contents in beer samples. The results indicated that combing magnetic beads with CE is of great value to perform replaceable and controllable multienzyme capillary microreactor for investigation of a series of enzyme reactions and determination of multisubstrates. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Curing behavior and reaction kinetics of binder resins for 3D-printing investigated by dielectric analysis (DEA)

NASA Astrophysics Data System (ADS)

Möginger, B.; Kehret, L.; Hausnerova, B.; Steinhaus, J.

2016-05-01

3D-Printing is an efficient method in the field of additive manufacturing. In order to optimize the properties of manufactured parts it is essential to adapt the curing behavior of the resin systems with respect to the requirements. Thus, effects of resin composition, e.g. due to different additives such as thickener and curing agents, on the curing behavior have to be known. As the resin transfers from a liquid to a solid glass the time dependent ion viscosity was measured using DEA with flat IDEX sensors. This allows for a sensitive measurement of resin changes as the ion viscosity changes two to four decades. The investigated resin systems are based on the monomers styrene and HEMA. To account for the effects of copolymerization in the calculation of the reaction kinetics it was assumed that the reaction can be considered as a homo-polymerization having a reaction order n≠1. Then the measured ion viscosity curves are fitted with the solution of the reactions kinetics - the time dependent degree of conversion (DC-function) - for times exceeding the initiation phase representing the primary curing. The measured ion viscosity curves can nicely be fitted with the DC-function and the determined fit parameters distinguish distinctly between the investigated resin compositions.

Supersonic molecular beam experiments on surface chemical reactions.

PubMed

Okada, Michio

2014-10-01

The interaction of a molecule and a surface is important in various fields, and in particular in complex systems like biomaterials and their related chemistry. However, the detailed understanding of the elementary steps in the surface chemistry, for example, stereodynamics, is still insufficient even for simple model systems. In this Personal Account, I review our recent studies of chemical reactions on single-crystalline Cu and Si surfaces induced by hyperthermal oxygen molecular beams and by oriented molecular beams, respectively. Studies of oxide formation on Cu induced by hyperthermal molecular beams demonstrate a significant role of the translational energy of the incident molecules. The use of hyperthermal molecular beams enables us to open up new chemical reaction paths specific for the hyperthermal energy region, and to develop new methods for the fabrication of thin films. On the other hand, oriented molecular beams also demonstrate the possibility of understanding surface chemical reactions in detail by varying the orientation of the incident molecules. The steric effects found on Si surfaces hint at new ways of material fabrication on Si surfaces. Controlling the initial conditions of incoming molecules is a powerful tool for finely monitoring the elementary step of the surface chemical reactions and creating new materials on surfaces. Copyright © 2014 The Chemical Society of Japan and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rate-dependent carbon and nitrogen kinetic isotope fractionation in hydrolysis of isoproturon.

PubMed

Penning, Holger; Cramer, Christopher J; Elsner, Martin

2008-11-01

Stable isotope fractionation permits quantifying contaminant degradation in the field when the transformation reaction is associated with a consistent isotope enrichment factor epsilon. When interpreted in conjunction with dual isotope plots, isotope fractionation is also particularly useful for elucidating reaction mechanisms. To assess the consistency of epsilon and dual isotope slopes in a two-step reaction, we investigated the abiotic hydrolysis of the herbicide isoproturon (3-(4-isopropylphenyl)-1,1-dimethylurea) using a fragmentation method that allows measuring isotope ratios in different parts of the molecule. Carbon and nitrogen position-specific isotope fractionation, as well as slopes in dual isotope plots, varied linearly with rate constants k(obs) depending on the presence of buffers that mediate the initial zwitterion formation. The correlation can be explained by two consecutive reaction steps (zwitterion formation followed by dimethylamine elimination) each of which has a different kinetic isotope effect and may be rate-limiting. Intrinsic isotope effects for both steps, extracted from our kinetic data using a novel theoretical treatment, agree well with values computed from density functional calculations. Our study therefore demonstrates that more variable isotope fractionation may be observed in simple chemical reactions than commonly thought, but that consistent epsilon or dual isotope slopes may nonetheless be encountered in certain molecular fragments.

A quantum protective mechanism in photosynthesis

NASA Astrophysics Data System (ADS)

Marais, Adriana; Sinayskiy, Ilya; Petruccione, Francesco; van Grondelle, Rienk

2015-03-01

Since the emergence of oxygenic photosynthesis, living systems have developed protective mechanisms against reactive oxygen species. During charge separation in photosynthetic reaction centres, triplet states can react with molecular oxygen generating destructive singlet oxygen. The triplet product yield in bacteria is observed to be reduced by weak magnetic fields. Reaction centres from plants' photosystem II share many features with bacterial reaction centres, including a high-spin iron whose function has remained obscure. To explain observations that the magnetic field effect is reduced by the iron, we propose that its fast-relaxing spin plays a protective role in photosynthesis by generating an effective magnetic field. We consider a simple model of the system, derive an analytical expression for the effective magnetic field and analyse the resulting triplet yield reduction. The protective mechanism is robust for realistic parameter ranges, constituting a clear example of a quantum effect playing a macroscopic role vital for life.

A quantum protective mechanism in photosynthesis.

PubMed

Marais, Adriana; Sinayskiy, Ilya; Petruccione, Francesco; van Grondelle, Rienk

2015-03-03

Since the emergence of oxygenic photosynthesis, living systems have developed protective mechanisms against reactive oxygen species. During charge separation in photosynthetic reaction centres, triplet states can react with molecular oxygen generating destructive singlet oxygen. The triplet product yield in bacteria is observed to be reduced by weak magnetic fields. Reaction centres from plants' photosystem II share many features with bacterial reaction centres, including a high-spin iron whose function has remained obscure. To explain observations that the magnetic field effect is reduced by the iron, we propose that its fast-relaxing spin plays a protective role in photosynthesis by generating an effective magnetic field. We consider a simple model of the system, derive an analytical expression for the effective magnetic field and analyse the resulting triplet yield reduction. The protective mechanism is robust for realistic parameter ranges, constituting a clear example of a quantum effect playing a macroscopic role vital for life.

In situ synthesis of semiconducting single-walled carbon nanotubes by modified arc discharging method

NASA Astrophysics Data System (ADS)

Zhao, Tingkai; Ji, Xianglin; Jin, Wenbo; Yang, Wenbo; Zhao, Xing; Dang, Alei; Li, Hao; Li, Tiehu

2017-02-01

Semiconducting single-walled carbon nanotubes (s-SWCNTs) were in situ synthesized by a temperature-controlled arc discharging furnace with DC electric field using Co-Ni alloy powder as catalyst in helium gas. The microstructures of s-SWCNTs were characterized using high-resolution transmission electron microscopy, electron diffraction, and Raman spectrometry apparatus. The experimental results indicated that the best voltage value in DC electric field is 54 V, and the environmental temperature of the reaction chamber is 600 °C. The mean diameter of s-SWCNTs was estimated about 1.3 nm. The chiral vector ( n, m) of s-SWCNTs was calculated to be (10, 10) type according to the electron diffraction patterns.

(Photosynthesis in intact plants)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

Progress in the two years since the last renewal application has been excellent. We have made substantial contributions on both main fronts of the projects, and are particularly happy with the progress of our research on intact plants. The approach of basing our field work on a sound foundation of laboratory studies has enabled is to use methods which provide unambiguous assays of well characterized reactions. We have also made excellent progress in several laboratory studies which will have direct applications in future field work, and have introduced to the laboratory a range of molecular genetics techniques which will allowmore » us to explore new options in the attempt to understand function at the level of molecular structure.« less

Mass-Related Dynamical Barriers in Triatomic Reactions

NASA Astrophysics Data System (ADS)

Yanao, T.; Koon, W. S.; Marsden, J. E.

2006-06-01

A methodology is given to determine the effect of different mass distributions for triatomic reactions using the geometry of shape space. Atomic masses are incorporated into the non-Euclidean shape space metric after the separation of rotations. Using the equations of motion in this non-Euclidean shape space, an averaged field of velocity-dependent fictitious forces is determined. This force field, as opposed to the force arising from the potential, dominates branching ratios of isomerization dynamics of a triatomic molecule. This methodology may be useful for qualitative prediction of branching ratios in general triatomic reactions.

Copper Corrosion Under Non-uniform Magnetic Field in 0.5 M Hydrochloric Acid

NASA Astrophysics Data System (ADS)

Garcia-Ochoa, E.; Corvo, F.; Genesca, J.; Sosa, V.; Estupiñán, P.

2017-05-01

The influence of a magnetic field on the electrochemical reactions taking place at the surface of a copper electrode immersed in a 0.5 M HCl solution at room temperature has been studied. The symmetry axis of the magnetic field was lined up in the same direction of the ion flow to minimize the Lorentz forces. Measurements of potentiodynamic polarization curves, electrochemical impedance spectroscopy and electrochemical noise allow concluding that the magnetic field significantly affects the cathodic reactions, with corrosion rates increasing under the presence of oxygen in acid media and decreasing when oxygen is eliminated.

Cutaneous and systemic hypersensitivity reactions to metallic implants.

PubMed

Basko-Plluska, Juliana L; Thyssen, Jacob P; Schalock, Peter C

2011-01-01

Cutaneous reactions to metal implants, orthopedic or otherwise, are well documented in the literature. The first case of a dermatitis reaction over a stainless steel fracture plate was described in 1966. Most skin reactions are eczematous and allergic in nature, although urticarial, bullous, and vasculitic eruptions may occur. Also, more complex immune reactions may develop around the implants, resulting in pain, inflammation, and loosening. Nickel, cobalt, and chromium are the three most common metals that elicit both cutaneous and extracutaneous allergic reactions from chronic internal exposure. However, other metal ions as well as bone cement components can cause such hypersensitivity reactions. To complicate things, patients may also develop delayed-type hypersensitivity reactions to metals (ie, in-stent restenosis, prosthesis loosening, inflammation, pain, or allergic contact dermatitis) following the insertion of intravascular stents, dental implants, cardiac pacemakers, or implanted gynecologic devices. Despite repeated attempts by researchers and clinicians to further understand this difficult area of medicine, the association between metal sensitivity and cutaneous allergic reactions remains to be fully understood. This review provides an update of the current knowledge in this field and should be valuable to health care providers who manage patients with conditions related to this field.

Theoretical verification of nonthermal microwave effects on intramolecular reactions.

PubMed

Kanno, Manabu; Nakamura, Kosuke; Kanai, Eri; Hoki, Kunihito; Kono, Hirohiko; Tanaka, Motohiko

2012-03-08

There have been a growing number of articles that report dramatic improvements in the experimental performance of chemical reactions by microwave irradiation compared to that under conventional heating conditions. We theoretically examined whether nonthermal microwave effects on intramolecular reactions exist or not, in particular, on Newman-Kwart rearrangements and intramolecular Diels-Alder reactions. The reaction rates of the former calculated by the transition state theory, which consider only the thermal effects of microwaves, agree quantitatively with experimental data, and thus, the increases in reaction rates can be ascribed to dielectric heating of the solvent by microwaves. In contrast, for the latter, the temperature dependence of reaction rates can be explained qualitatively by thermal effects but the possibility of nonthermal effects still remains regardless of whether competitive processes are present or not. The effective intramolecular potential energy surface in the presence of a microwave field suggests that nonthermal effects arising from potential distortion are vanishingly small in intramolecular reactions. It is useful in the elucidation of the reaction mechanisms of microwave synthesis to apply the present theoretical approach with reference to the experiments where thermal and nonthermal effects are separated by screening microwave fields.

WE-EF-BRA-08: Cell Survival in Modulated Radiation Fields and Altered DNA-Repair at Field Edges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bartzsch, S; Oelfke, U; Eismann, S

2015-06-15

Purpose: Tissue damage prognoses in radiotherapy are based on clonogenic assays that provide dose dependent cell survival rates. However, recent work has shown that apart from dose, systemic reactions and cell-cell communication crucially influence the radiation response. These effects are probably a key in understanding treatment approaches such as microbeam radiation therapy (MRT). In this study we tried to quantify the effects on a cellular level in spatially modulated radiation fields. Methods: Pancreas carcinoma cells were cultured, plated and irradiated by spatially modulated radiation fields with an X-ray tube and at a synchrotron. During and after treatment cells were ablemore » to communicate via the intercellular medium. Afterwards we stained for DNA and DNA damage and imaged with a fluorescence microscope. Results: Intriguingly we found that DNA damage does not strictly increase with dose. Two cell entities appear that have either a high or a low amount of DNA lesions, indicating that DNA damage is also a cell stress reaction. Close to radiation boundaries damage-levels became alike; they were higher than expected at low and lower than expected at high doses. Neighbouring cells reacted similarly. 6 hours after exposure around 40% of the cells resembled in their reactions neighbouring cells more than randomly chosen cells that received the same dose. We also observed that close to radiation boundaries the radiation induced cell-cycle arrest disappeared and the size of DNA repair-centres increased. Conclusion: Cell communication plays an important role in the radiation response of tissues and may be both, protective and destructive. These effects may not only have the potential to affect conventional radiotherapy but may also be exploited to spare organs at risk by intelligently designing irradiation geometries. To that end intensive work is required to shed light on the still obscure processes in cell-signalling and radiation biology.« less

Detection of asymptomatic renal Leptospira infection in abattoir slaughtered cattle in southeastern Georgia, United States

PubMed Central

Ilha, Marcia; Woldemeskel, Moges; Berghaus, Roy D; Pence, Mel E

2014-01-01

Objectives: Leptospirosis is one of the most widespread zoonotic infectious diseases affecting humans and animals. Several animal species, including cattle, can act as potential asymptomatic carriers facilitating zoonotic transmission of Leptospira. This study was conducted to assess the occurrence of asymptomatic renal Leptospira carriers among cattle slaughtered in southeastern Georgia, United States. Methods: A battery of diagnostic tests, including dark field microscopy, direct fluorescent antibody staining, polymerase chain reaction, and culture, were performed on a set of bovine kidneys (n = 37) collected from an abattoir in southeastern Georgia, United States. Virulence of a field isolate obtained from this study was tested in a hamster experimental model. Results: Motile spirochete-like structures were observed by dark field microscopy in 23 (59%) out of 37 kidney samples tested. In all, 29 samples (78%) were positive by direct fluorescent antibody staining. Only 11 (29.7%) samples by polymerase chain reaction and 3 (8.1%) by culture were positive for Leptospira sp. The isolates obtained by culture were confirmed as Leptospira borgpetersenii. Hamsters experimentally infected with one of the Leptospira field isolates obtained from this study did not show clinical signs but developed renal infection with interstitial nephritis and tubular necrosis. Conclusions: This study confirms that asymptomatic Leptospira renal infection is present among cattle in the region. Our findings underscore the need for future studies to assess the potential environmental contamination and transmission to humans in contact with infected cattle. PMID:26770734

Numerical verification of three point bending experiment of magnetorheological elastomer (MRE) in magnetic field

NASA Astrophysics Data System (ADS)

Miedzinska, Danuta; Boczkowska, Anna; Zubko, Konrad

2010-07-01

In the article a method of numerical verification of experimental results for magnetorheological elastomer samples (MRE) is presented. The samples were shaped into cylinders with diameter of 8 mm and height of 20 mm with various carbonyl iron volume shares (1,5%, 11,5% and 33%). The diameter of soft ferromagnetic substance particles ranged from 6 to 9 μm. During the experiment, initially bended samples were exposed to the magnetic field with intensity levels at 0,1T, 0,3T, 0,5T, 0,7 and 1T. The reaction of the sample to the field action was measured as a displacement of a specimen. Numerical calculation was carried out with the MSC Patran/Marc computer code. For the purpose of numerical analysis the orthotropic material model with the material properties of magnetorheological elastomer along the iron chains, and of the pure elastomer along other directions, was applied. The material properties were obtained from the experimental tests. During the numerical analysis, the initial mechanical load resulting from cylinder deflection was set. Then, the equivalent external force, that was set on the basis of analytical calculations of intermolecular reaction within iron chains in the specific magnetic field, was put on the bended sample. Correspondence of such numerical model with results of the experiment was verified. Similar results of the experiments and both theoretical and FEM analysis indicates that macroscopic modeling of magnetorheological elastomer mechanical properties as orthotropic material delivers accurate enough description of the material's behavior.

A general method for multimetallic platinum alloy nanowires as highly active and stable oxygen reduction catalysts

DOE PAGES

Bu, Lingzheng; Ding, Jiabao; Yao, Jianlin; ...

2015-10-13

The production of inorganic nanoparticles (NPs) with precise control over structures has always been a central target in various fields of chemistry and physics because the properties of NPs can be desirably manipulated by their structure. [1-4] There has been an intense search for high-performance noble metal NP catalysts particular for Pt. [5-9] Precious platinum (Pt) NPs are active catalysts for various heterogeneous reactions and show particularly superior performance in both the anodic oxidation reaction and the cathodic ORR in the fuel cells, but their rare content and high cost largely impede the practical application. [10-12] A potential strategy tomore » address this tremendous challenge is alloying Pt NPs with the transition metals (TM). [13-16]« less

Thiol-yne click reactions on alkynyl-dopamine-modified reduced graphene oxide.

PubMed

Kaminska, Izabela; Qi, Wang; Barras, Alexandre; Sobczak, Janusz; Niedziolka-Jonsson, Joanna; Woisel, Patrice; Lyskawa, Joel; Laure, William; Opallo, Marcin; Li, Musen; Boukherroub, Rabah; Szunerits, Sabine

2013-06-24

The large-scale preparation of graphene is of great importance due to its potential applications in various fields. We report herein a simple method for the simultaneous exfoliation and reduction of graphene oxide (GO) to reduced GO (rGO) by using alkynyl-terminated dopamine as the reducing agent. The reaction was performed under mild conditions to yield rGO functionalized with the dopamine derivative. The chemical reactivity of the alkynyl function was demonstrated by post-functionalization with two thiolated precursors, namely 6-(ferrocenyl)hexanethiol and 1H,1H,2H,2H-perfluorodecanethiol. X-ray photoelectron spectroscopy, UV/Vis spectrophotometry, Raman spectroscopy, conductivity measurements, and cyclic voltammetry were used to characterize the resulting surfaces. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

MHD Convective Flow of Jeffrey Fluid Due to a Curved Stretching Surface with Homogeneous-Heterogeneous Reactions

PubMed Central

Imtiaz, Maria; Hayat, Tasawar; Alsaedi, Ahmed

2016-01-01

This paper looks at the flow of Jeffrey fluid due to a curved stretching sheet. Effect of homogeneous-heterogeneous reactions is considered. An electrically conducting fluid in the presence of applied magnetic field is considered. Convective boundary conditions model the heat transfer analysis. Transformation method reduces the governing nonlinear partial differential equations into the ordinary differential equations. Convergence of the obtained series solutions is explicitly discussed. Characteristics of sundry parameters on the velocity, temperature and concentration profiles are analyzed by plotting graphs. Computations for pressure, skin friction coefficient and surface heat transfer rate are presented and examined. It is noted that fluid velocity and temperature through curvature parameter are enhanced. Increasing values of Biot number correspond to the enhancement in temperature and Nusselt number. PMID:27583457

Synthesis of Helical Carbon Fibers and Related Materials: A Review on the Past and Recent Developments

PubMed Central

Raghubanshi, Himanshu; Dikio, Ezekiel Dixon

2015-01-01

Helical carbon fibers (HCFs) have been widely studied due to their unique helical morphology and superior properties, which make them efficient materials for several potential applications. This review summarizes the past and current advancement on the synthesis of HCFs. The review focuses and discusses synthesis strategies and effect of experimental parameters on the growth of HCFs. The effect of preparation method of catalyst, catalyst nature, catalyst composition, catalyst size, catalyst initial and final shape, reaction temperature, reaction time, carbon source, impurities, and electromagnetic field on the growth of HCFs is reviewed. We also discuss the growth mechanism for HCFs and the synthesis of HCFs related materials. Finally, we conclude with a brief summary and an outlook on the challenges and future prospects of HCFs. PMID:28347045

Astrophysical Nuclear Reaction Rates in the Dense Metallic Environments

NASA Astrophysics Data System (ADS)

Kilic, Ali Ihsan

2017-09-01

Nuclear reaction rates can be enhanced by many orders of magnitude in dense and relatively cold astrophysical plasmas such as in white dwarfs, brown dwarfs, and giant planets. Similar conditions are also present in supernova explosions where the ignition conditions are vital for cosmological models. White dwarfs are compact objects that have both extremely high interior densities and very strong local magnetic fields. For the first time, a new formula has been developed to explain cross section and reaction rate quantities for light elements that includes not only the nuclear component but also the material dependence, magnetic field, and crystal structure dependency in dense metallic environments. I will present the impact of the developed formula on the cross section and reaction rates for light elements. This could have possible technological applications in energy production using nuclear fusion reactions.

Radiation reaction for spinning bodies in effective field theory. I. Spin-orbit effects

NASA Astrophysics Data System (ADS)

Maia, Natália T.; Galley, Chad R.; Leibovich, Adam K.; Porto, Rafael A.

2017-10-01

We compute the leading post-Newtonian (PN) contributions at linear order in the spin to the radiation-reaction acceleration and spin evolution for binary systems, which enter at fourth PN order. The calculation is carried out, from first principles, using the effective field theory framework for spinning compact objects, in both the Newton-Wigner and covariant spin supplementary conditions. A nontrivial consistency check is performed on our results by showing that the energy loss induced by the resulting radiation-reaction force is equivalent to the total emitted power in the far zone, up to so-called "Schott terms." We also find that, at this order, the radiation reaction has no net effect on the evolution of the spins. The spin-spin contributions to radiation reaction are reported in a companion paper.

Contributions of intrinsic and extrinsic polarization species to energy storage properties of Ba0.95Ca0.05Zr0.2Ti0.8O3 ceramics

NASA Astrophysics Data System (ADS)

Zhan, Di; Xu, Qing; Huang, Duan-Ping; Liu, Han-Xing; Chen, Wen; Zhang, Feng

2018-03-01

Ba0.95Ca0.05Zr0.2Ti0.8O3 ceramics were prepared at different sintering temperatures by citrate precursor and solid-state reaction methods, respectively. The crystal structure and microstructure of the specimens were characterized. In view of energy storage capacitor utilizations, the dielectric properties of the specimens were investigated at room temperature as a function of frequency and applied electric field. Moreover, the nature of mobile charge carriers in the specimens was diagnosed by complex impedance spectroscopy at elevated temperatures. While the dielectric constants of the specimens prepared by different methods are quite different (4.4 × 103-2.2 × 104 at 10 kHz) at zero electric field, the energy storage densities at an identical strong electric field are similar (e.g. 0.32-0.41 J/cm3 at 120 kV/cm). The dielectric constants under bias electric field were fitted to a multipolarization mechanism model to resolve the contributions of intrinsic and extrinsic polarization mechanisms. It turned out that the extrinsic contributions fade out within low electric field range (<20 kV/cm) and thereby the intrinsic lattice polarization governs the overall dielectric responses at higher fields. Based on the fitting result, the energy storage properties of the specimens were interpreted.

The technique for Simulation of Transient Combustion Processes in the Rocket Engine Operating with Gaseous Fuel “Hydrogen and Oxygen”

NASA Astrophysics Data System (ADS)

Zubanov, V. M.; Stepanov, D. V.; Shabliy, L. S.

2017-01-01

The article describes the method for simulation of transient combustion processes in the rocket engine. The engine operates on gaseous propellant: oxygen and hydrogen. Combustion simulation was performed using the ANSYS CFX software. Three reaction mechanisms for the stationary mode were considered and described in detail. Reactions mechanisms have been taken from several sources and verified. The method for converting ozone properties from the Shomate equation to the NASA-polynomial format was described in detail. The way for obtaining quick CFD-results with intermediate combustion components using an EDM model was found. Modeling difficulties with combustion model Finite Rate Chemistry, associated with a large scatter of reference data were identified and described. The way to generate the Flamelet library with CFX-RIF is described. Formulated adequate reaction mechanisms verified at a steady state have also been tested for transient simulation. The Flamelet combustion model was recognized as adequate for the transient mode. Integral parameters variation relates to the values obtained during stationary simulation. A cyclic irregularity of the temperature field, caused by precession of the vortex core, was detected in the chamber with the proposed simulation technique. Investigations of unsteady processes of rocket engines including the processes of ignition were proposed as the area for application of the described simulation technique.

CO2 valorization by means of Dielectric Barrier Discharge

NASA Astrophysics Data System (ADS)

Machrafi, H.; Cavadias, S.; Amouroux, J.

2011-01-01

As atmospheric pollution is causing several environmental problems it is incumbent to reduce the impact of pollution on the environment. One particular problem is the production of CO2 by many transport and industrial applications. Instead of stocking CO2 and instead of being a product, it can be used as a source. The case considered is the CO2 reformation of methane producing hydrogen and CO. It is an endothermic reaction, for which the activation barrier needs to be surpassed. This can be done efficiently by the method of Dielectric Barrier Discharge. The process relies on the collision of electrons, which are accelerated under an electrical field that is created in the discharge area. This leads to the formation of reactive species, which facilitate the abovementioned reaction. This study is performed using a Matlab program with the Reaction Engineering module in COMSOL (with an incorporated kinetic mechanism) in order to model the discharge phase. Then COMSOL (continuity and Navier-Stokes equations) is used to model the flow in the post-discharge phase. The results showed that both a 2D and 3D model can be used to model the chemical-plasma process. These methods need strongly reduced kinetic mechanism, which in some cases can cause loss of precision.

Use of reverse transcription loop-mediated isothermal amplification combined with lateral flow dipstick for an easy and rapid detection of Jembrana disease virus.

PubMed

Kusumawati, Asmarani; Tampubolon, Issabellina Dwades; Hendarta, Narendra Yoga; Salasia, Siti Isrina Oktavia; Wanahari, Tenri Ashari; Mappakaya, Basofi Ashari; Hartati, Sri

2015-09-01

Jembrana disease virus (JDV) is a viral pathogen that causes Jembrana disease in Bali cattle (Bos javanicus) with high mortality rate. An easy and rapid diagnostic method is essential for further control this disease. We used a reverse transcription loop-mediated isothermal amplification (RT-LAMP) combined with lateral flow dipstick (LFD), based on conserved tm subunit of Jembrana disease virus env gene. The RT-LAMP conditions were optimized by varying the concentration of MgSO4, betaine, dNTP, and temperature as well as the time and duration of reaction. The primers sensitivity for JDV was confirmed. The method was able to detect env-tm gene dilution which contained 2 × 10(-15) g of template. Comparatively, the sensitivity of RT-LAMP/LFD was 100-fold more sensitive than reverse transcription-polymerase chain reaction. The primers specificity for JDV was also confirmed using positive and negative controls. This work also showed that virus detection could be done not only on total RNA extracted from blood but various organs could also be analyzed for the presence of JDV using RT-LAMP/LFD method. The whole process, including the LAMP reaction and the LFD hybridization step only lasts approximately 75 min. Results of analysis can be easily observed with naked eyes without addition of any chemical or further analysis. The combination of RT-LAMP with LFD makes the method a more suitable diagnostic tool in conditions where sophisticated and expensive equipments are not available for field investigations on Jembrana disease in Bali cattle.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

Nuclear quantum effects and kinetic isotope effects in enzyme reactions.

PubMed

Vardi-Kilshtain, Alexandra; Nitoker, Neta; Major, Dan Thomas

2015-09-15

Enzymes are extraordinarily effective catalysts evolved to perform well-defined and highly specific chemical transformations. Studying the nature of rate enhancements and the mechanistic strategies in enzymes is very important, both from a basic scientific point of view, as well as in order to improve rational design of biomimetics. Kinetic isotope effect (KIE) is a very important tool in the study of chemical reactions and has been used extensively in the field of enzymology. Theoretically, the prediction of KIEs in condensed phase environments such as enzymes is challenging due to the need to include nuclear quantum effects (NQEs). Herein we describe recent progress in our group in the development of multi-scale simulation methods for the calculation of NQEs and accurate computation of KIEs. We also describe their application to several enzyme systems. In particular we describe the use of combined quantum mechanics/molecular mechanics (QM/MM) methods in classical and quantum simulations. The development of various novel path-integral methods is reviewed. These methods are tailor suited to enzyme systems, where only a few degrees of freedom involved in the chemistry need to be quantized. The application of the hybrid QM/MM quantum-classical simulation approach to three case studies is presented. The first case involves the proton transfer in alanine racemase. The second case presented involves orotidine 5'-monophosphate decarboxylase where multidimensional free energy simulations together with kinetic isotope effects are combined in the study of the reaction mechanism. Finally, we discuss the proton transfer in nitroalkane oxidase, where the enzyme employs tunneling as a catalytic fine-tuning tool. Copyright © 2015 Elsevier Inc. All rights reserved.

Microwave-assisted green synthesis of silver nanostructures.

PubMed

Nadagouda, Mallikarjuna N; Speth, Thomas F; Varma, Rajender S

2011-07-19

Over the past 25 years, microwave (MW) chemistry has moved from a laboratory curiosity to a well-established synthetic technique used in many academic and industrial laboratories around the world. Although the overwhelming number of MW-assisted applications today are still performed on a laboratory (mL) scale, we expect that this enabling technology may be used on a larger, perhaps even production, scale in conjunction with radio frequency or conventional heating. Microwave chemistry is based on two main principles, the dipolar mechanism and the electrical conductor mechanism. The dipolar mechanism occurs when, under a very high frequency electric field, a polar molecule attempts to follow the field in the same alignment. When this happens, the molecules release enough heat to drive the reaction forward. In the second mechanism, the irradiated sample is an electrical conductor and the charge carriers, ions and electrons, move through the material under the influence of the electric field and lead to polarization within the sample. These induced currents and any electrical resistance will heat the sample. This Account summarizes a microwave (MW)-assisted synthetic approach for producing silver nanostructures. MW heating has received considerable attention as a promising new method for the one-pot synthesis of metallic nanostructures in solutions. Researchers have successfully demonstrated the application of this method in the preparation of silver (Ag), gold (Au), platinum (Pt), and gold-palladium (Au-Pd) nanostructures. MW heating conditions allow not only for the preparation of spherical nanoparticles within a few minutes but also for the formation of single crystalline polygonal plates, sheets, rods, wires, tubes, and dendrites. The morphologies and sizes of the nanostructures can be controlled by changing various experimental parameters, such as the concentration of metallic salt precursors, the surfactant polymers, the chain length of the surfactant polymers, the solvents, and the operation reaction temperature. In general, nanostructures with smaller sizes, narrower size distributions, and a higher degree of crystallization have been obtained more consistently via MW heating than by heating with a conventional oil-bath. The use of microwaves to heat samples is a viable avenue for the greener synthesis of nanomaterials and provides several desirable features such as shorter reaction times, reduced energy consumption, and better product yields.

A high-throughput detection method for invasive fruit fly (Diptera: Tephritidae) species based on microfluidic dynamic array.

PubMed

Jiang, Fan; Fu, Wei; Clarke, Anthony R; Schutze, Mark Kurt; Susanto, Agus; Zhu, Shuifang; Li, Zhihong

2016-11-01

Invasive species can be detrimental to a nation's ecology, economy and human health. Rapid and accurate diagnostics are critical to limit the establishment and spread of exotic organisms. The increasing rate of biological invasions relative to the taxonomic expertise available generates a demand for high-throughput, DNA-based diagnostics methods for identification. We designed species-specific qPCR primer and probe combinations for 27 economically important tephritidae species in six genera (Anastrepha, Bactrocera, Carpomya, Ceratitis, Dacus and Rhagoletis) based on 935 COI DNA barcode haplotypes from 181 fruit fly species publically available in BOLD, and then tested the specificity for each primer pair and probe through qPCR of 35 of those species. We then developed a standardization reaction system for detecting the 27 target species based on a microfluidic dynamic array and also applied the method to identify unknown immature samples from port interceptions and field monitoring. This method led to a specific and simultaneous detection for all 27 species in 7.5 h, using only 0.2 μL of reaction system in each reaction chamber. The approach successfully discriminated among species within complexes that had genetic similarities of up to 98.48%, while it also identified all immature samples consistent with the subsequent results of morphological examination of adults which were reared from larvae of cohorts from the same samples. We present an accurate, rapid and high-throughput innovative approach for detecting fruit flies of quarantine concern. This is a new method which has broad potential to be one of international standards for plant quarantine and invasive species detection. © 2016 John Wiley & Sons Ltd.

Kinetic and mechanism formation reaction of complex compound Cu with di-n-buthildithiocarbamate (dbdtc) ligand

NASA Astrophysics Data System (ADS)

Haryani, S.; Kurniawan, C.; Kasmui

2018-04-01

Synthesis of complex compound is one field of research which intensively studied. Metal-dithiocarbamate complexes find wide-ranging applications in nanomaterial and metal separation science, and have potential use as chemotherapeutic, pesticides, and as additives to lubricants. However, the information about is reaction kinetic and mechanism are very much lacking. The research and analyzes results show that reaction synthesis ligand DBDTC and complex compounds Cu-DBDTC. Optimum reaction condition of formation of complex compounds Cu with DBDTC at pH=3, [DBDTC] = 4.10-3 M, and the time of reaction 5 minutes. Based the analysis varian reaction of complex compounds at pH 3 and 4, diffrence significance at the other pH: 5; 5,5; 6; 6,5 ; 7; and 8. The various of mole with reactants comosition difference sigbificance, those the time reaction for 5 and 6 minutes diffrence by significance with the other time, it is 3,4,8, and 10 minutes. The great product to at condition pH 6, the time optimum at 5 minutes and molar ratio of logam: ligand = 1:2. The reaction kinetic equation of complex compound Cu with chelathing ligand DBDTC is V=0.917106 [Cu2+]0.87921 [DBDTC]2.03021. Based on the kinetic data, and formed complex compounds estimation, the mechanism explaining by 2 stages. In the first stage formation of [Cu(DBDTC)], and then [Cu(DBDTC)2] with the last structure geomethry planar rectangle. The result of this research will be more useful if an effort is being done in reaction mechanism by chemical computation method for obtain intermediate, and for constant “k” in same stage, k1.k2. and compound complex constanta (β).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Jing; Hu, Jiawei; Yu, Hongwei, E-mail: hwyu@hunnu.edu.cn

We study the spontaneous excitation of a circularly accelerated atom coupled with vacuum Dirac field fluctuations by separately calculating the contribution to the excitation rate of vacuum fluctuations and a cross term which involves both vacuum fluctuations and radiation reaction, and demonstrate that although the spontaneous excitation for the atom in its ground state would occur in vacuum, such atoms in circular motion do not perceive a pure thermal radiation as their counterparts in linear acceleration do since the transition rates of the atom do not contain the Planckian factor characterizing a thermal bath. We also find that the contributionmore » of the cross term that plays the same role as that of radiation reaction in the scalar and electromagnetic fields cases differs for atoms in circular motion from those in linear acceleration. This suggests that the conclusion drawn for atoms coupled with the scalar and electromagnetic fields that the contribution of radiation reaction to the mean rate of change of atomic energy does not vary as the trajectory of the atom changes from linear acceleration to circular motion is not a general trait that applies to the Dirac field where the role of radiation reaction is played by the cross term. - Highlights: • Spontaneous excitation of a circularly accelerated atom is studied. • The atom interacts with the Dirac field through nonlinear coupling. • A cross term involving vacuum fluctuations and radiation reaction contributes. • The atom in circular motion does not perceive pure thermal radiation. • The contribution of the cross term changes as the atomic trajectory varies.« less

Evaluation of a Genome-Scale In Silico Metabolic Model for Geobacter metallireducens Using Proteomic Data from a Field Biostimulation Experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Yilin; Wilkins, Michael J.; Yabusaki, Steven B.

2012-12-12

Biomass and shotgun global proteomics data that reflected relative protein abundances from samples collected during the 2008 experiment at the U.S. Department of Energy Integrated Field-Scale Subsurface Research Challenge site in Rifle, Colorado, provided an unprecedented opportunity to validate a genome-scale metabolic model of Geobacter metallireducens and assess its performance with respect to prediction of metal reduction, biomass yield, and growth rate under dynamic field conditions. Reconstructed from annotated genomic sequence, biochemical, and physiological data, the constraint-based in silico model of G. metallireducens relates an annotated genome sequence to the physiological functions with 697 reactions controlled by 747 enzyme-coding genes.more » Proteomic analysis showed that 180 of the 637 G. metallireducens proteins detected during the 2008 experiment were associated with specific metabolic reactions in the in silico model. When the field-calibrated Fe(III) terminal electron acceptor process reaction in a reactive transport model for the field experiments was replaced with the genome-scale model, the model predicted that the largest metabolic fluxes through the in silico model reactions generally correspond to the highest abundances of proteins that catalyze those reactions. Central metabolism predicted by the model agrees well with protein abundance profiles inferred from proteomic analysis. Model discrepancies with the proteomic data, such as the relatively low fluxes through amino acid transport and metabolism, revealed pathways or flux constraints in the in silico model that could be updated to more accurately predict metabolic processes that occur in the subsurface environment.« less

Mixing effects on apparent reaction rates and isotope fractionation during denitrification in a heterogeneous aquifer

USGS Publications Warehouse

Green, Christopher T.; Böhlke, John Karl; Bekins, Barbara A.; Phillips, Steven P.

2010-01-01

Gradients in contaminant concentrations and isotopic compositions commonly are used to derive reaction parameters for natural attenuation in aquifers. Differences between field‐scale (apparent) estimated reaction rates and isotopic fractionations and local‐scale (intrinsic) effects are poorly understood for complex natural systems. For a heterogeneous alluvial fan aquifer, numerical models and field observations were used to study the effects of physical heterogeneity on reaction parameter estimates. Field measurements included major ions, age tracers, stable isotopes, and dissolved gases. Parameters were estimated for the O2 reduction rate, denitrification rate, O2 threshold for denitrification, and stable N isotope fractionation during denitrification. For multiple geostatistical realizations of the aquifer, inverse modeling was used to establish reactive transport simulations that were consistent with field observations and served as a basis for numerical experiments to compare sample‐based estimates of “apparent” parameters with “true“ (intrinsic) values. For this aquifer, non‐Gaussian dispersion reduced the magnitudes of apparent reaction rates and isotope fractionations to a greater extent than Gaussian mixing alone. Apparent and true rate constants and fractionation parameters can differ by an order of magnitude or more, especially for samples subject to slow transport, long travel times, or rapid reactions. The effect of mixing on apparent N isotope fractionation potentially explains differences between previous laboratory and field estimates. Similarly, predicted effects on apparent O2threshold values for denitrification are consistent with previous reports of higher values in aquifers than in the laboratory. These results show that hydrogeological complexity substantially influences the interpretation and prediction of reactive transport.

Influence of temperature and aging time on HA synthesized by the hydrothermal method.

PubMed

Kothapalli, C R; Wei, M; Legeros, R Z; Shaw, M T

2005-05-01

The influence of temperature and aging time on the morphology and mechanical properties of nano-sized hydroxyapatite (HA) synthesized by a hydrothermal method is reported here. The pre-mixed reactants were poured into a stirred autoclave and reacted at temperatures between 25-250 degrees C for 2-10 h. HA powders thus obtained were examined using X-ray diffraction (XRD), high-resolution field emission scanning electron microscopy (FESEM) and a particle size analyzer. It was found that the aspect ratio of the particles increased with the reaction temperature. The length of the HA particles increased with the reaction temperature below 170 degrees C, but it decreased when the temperature was raised above 170 degrees C. The agglomerates of HA particles were formed during synthesis, and their sizes were strongly dependent on reaction temperatures. As the reaction temperature increased, the agglomerate size decreased (p = 0.008). The density of the discs pressed from these samples reached 85-90% of the theoretical density after sintering at 1200 degrees C for 1 h. No decomposition to other calcium phosphates was detected at this sintering temperature. A correlation existed (p = 0.05) between the agglomerate sizes of HA particles synthesized at various conditions and their sintered densities. With the increase of the agglomerate size, the sintered density of the HA compact decreased. It was found that both the sintered density and flexural strength increased with increasing aging time and reaction temperature. A maximum flexural strength of 78 MPa was observed for the samples synthesized at 170 degrees C for 5 h with the predicted average at these conditions being 65 MPa. These samples attained an average sintered density of 88%.

Sub-millitesla magnetic field effects on the recombination reaction of flavin and ascorbic acid radicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, Emrys W.; Henbest, Kevin B.; Timmel, Christiane R., E-mail: christiane.timmel@chem.ox.ac.uk, E-mail: stuart.mackenzie@chem.ox.ac.uk

Even though the interaction of a <1 mT magnetic field with an electron spin is less than a millionth of the thermal energy at room temperature (k{sub B}T), it still can have a profound effect on the quantum yields of radical pair reactions. We present a study of the effects of sub-millitesla magnetic fields on the photoreaction of flavin mononucleotide with ascorbic acid. Direct control of the reaction pathway is achieved by varying the rate of electron transfer from ascorbic acid to the photo-excited flavin. At pH 7.0, we verify the theoretical prediction that, apart from a sign change, themore » form of the magnetic field effect is independent of the initial spin configuration of the radical pair. The data agree well with model calculations based on a Green’s function approach that allows multinuclear spin systems to be treated including the diffusive motion of the radicals, their spin-selective recombination reactions, and the effects of the inter-radical exchange interaction. The protonation states of the radicals are uniquely determined from the form of the magnetic field-dependence. At pH 3.0, the effects of two chemically distinct radical pair complexes combine to produce a pronounced response to ∼500 μT magnetic fields. These findings are relevant to the magnetic responses of cryptochromes (flavin-containing proteins proposed as magnetoreceptors in birds) and may aid the evaluation of effects of weak magnetic fields on other biologically relevant electron transfer processes.« less

Singular trajectories: space-time domain topology of developing speckle fields

NASA Astrophysics Data System (ADS)

Vasil'ev, Vasiliy; Soskin, Marat S.

2010-02-01

It is shown the space-time dynamics of optical singularities is fully described by singularities trajectories in space-time domain, or evolution of transverse coordinates(x, y) in some fixed plane z0. The dynamics of generic developing speckle fields was realized experimentally by laser induced scattering in LiNbO3:Fe photorefractive crystal. The space-time trajectories of singularities can be divided topologically on two classes with essentially different scenario and duration. Some of them (direct topological reactions) consist from nucleation of singularities pair at some (x, y, z0, t) point, their movement and annihilation. They possess form of closed loops with relatively short time of existence. Another much more probable class of trajectories are chain topological reactions. Each of them consists from sequence of links, i.e. of singularities nucleation in various points (xi yi, ti) and following annihilation of both singularities in other space-time points with alien singularities of opposite topological indices. Their topology and properties are established. Chain topological reactions can stop on the borders of a developing speckle field or go to infinity. Examples of measured both types of topological reactions for optical vortices (polarization C points) in scalar (elliptically polarized) natural developing speckle fields are presented.

Bioactivation of drugs in the skin: relationship to cutaneous adverse drug reactions.

PubMed

Sharma, Amy M; Uetrecht, Jack

2014-02-01

Drug-induced skin rashes are poorly understood idiosyncratic reactions, and current methods cannot predict their occurrence. Most idiosyncratic drug reactions are thought to be caused by chemically reactive metabolites, and the skin is a frequent site of idiosyncratic reactions; however, the skin has a very limited capacity to metabolize drugs. To balance this, the skin represents a protective barrier with a very active immune response against pathogens and other types of skin injury. Therefore its response to reactive metabolites is quite different from that of the liver. The purpose of this review is to integrate emerging findings into proposed mechanisms of drug and carcinogen metabolism in the skin that are likely responsible for rashes and other immune responses of the skin. Current evidence suggests the skin possesses significant sulfotransferase and flavin monooxygenases activities, but very low cytochromes P450 activity. However, there are skin-specific P450s that are not present in the liver. The manner in which the skin responds to neoantigens through local antigen presentation and innate immune sensing is reviewed with a focus on insights gained from the contact hypersensitivity (CHS) field. The roles of keratinocytes and Langerhans cells, and the emerging function of NOD-like receptors, are highlighted.

An analytical derivation of MC-SCF vibrational wave functions for the quantum dynamical simulation of multiple proton transfer reactions: Initial application to protonated water chains

NASA Astrophysics Data System (ADS)

Drukker, Karen; Hammes-Schiffer, Sharon

1997-07-01

This paper presents an analytical derivation of a multiconfigurational self-consistent-field (MC-SCF) solution of the time-independent Schrödinger equation for nuclear motion (i.e. vibrational modes). This variational MC-SCF method is designed for the mixed quantum/classical molecular dynamics simulation of multiple proton transfer reactions, where the transferring protons are treated quantum mechanically while the remaining degrees of freedom are treated classically. This paper presents a proof that the Hellmann-Feynman forces on the classical degrees of freedom are identical to the exact forces (i.e. the Pulay corrections vanish) when this MC-SCF method is used with an appropriate choice of basis functions. This new MC-SCF method is applied to multiple proton transfer in a protonated chain of three hydrogen-bonded water molecules. The ground state and the first three excited state energies and the ground state forces agree well with full configuration interaction calculations. Sample trajectories are obtained using adiabatic molecular dynamics methods, and nonadiabatic effects are found to be insignificant for these sample trajectories. The accuracy of the excited states will enable this MC-SCF method to be used in conjunction with nonadiabatic molecular dynamics methods. This application differs from previous work in that it is a real-time quantum dynamical nonequilibrium simulation of multiple proton transfer in a chain of water molecules.

Malaria PCR Detection in Cambodian Low-Transmission Settings: Dried Blood Spots versus Venous Blood Samples

PubMed Central

Canier, Lydie; Khim, Nimol; Kim, Saorin; Eam, Rotha; Khean, Chanra; Loch, Kaknika; Ken, Malen; Pannus, Pieter; Bosman, Philippe; Stassijns, Jorgen; Nackers, Fabienne; Alipon, SweetC; Char, Meng Chuor; Chea, Nguon; Etienne, William; De Smet, Martin; Kindermans, Jean-Marie; Ménard, Didier

2015-01-01

In the context of malaria elimination, novel strategies for detecting very low malaria parasite densities in asymptomatic individuals are needed. One of the major limitations of the malaria parasite detection methods is the volume of blood samples being analyzed. The objective of the study was to compare the diagnostic accuracy of a malaria polymerase chain reaction assay, from dried blood spots (DBS, 5 μL) and different volumes of venous blood (50 μL, 200 μL, and 1 mL). The limit of detection of the polymerase chain reaction assay, using calibrated Plasmodium falciparum blood dilutions, showed that venous blood samples (50 μL, 200 μL, 1 mL) combined with Qiagen extraction methods gave a similar threshold of 100 parasites/mL, ∼100-fold lower than 5 μL DBS/Instagene method. On a set of 521 field samples, collected in two different transmission areas in northern Cambodia, no significant difference in the proportion of parasite carriers, regardless of the methods used was found. The 5 μL DBS method missed 27% of the samples detected by the 1 mL venous blood method, but most of the missed parasites carriers were infected by Plasmodium vivax (84%). The remaining missed P. falciparum parasite carriers (N = 3) were only detected in high-transmission areas. PMID:25561570

Computational Interpretation of the Relation Between Electric Field and the Applied Current for Cathodic Protection Under Different Conductivity Environments

NASA Astrophysics Data System (ADS)

Kim, Yong-Sang; Ko, Sang-Jin; Lee, Sangkyu; Kim, Jung-Gu

2018-03-01

An interpretation of the relation between the electric field and the applied current for cathodic protection is investigated using a boundary element method simulation. Also, a conductivity-difference environment is set for the interface influence. The variation of the potential distribution is increased with the increase of the applied current and the conductivity difference due to the rejection of the current at the interface. In the case of the electric field, the tendencies of the increasing rate and the applied currents are similar, but the interface influence is different according to the directional component and field type (decrease of E z and increases of E x and E y) due to the directional difference between the electric fields. Also, the change tendencies of the electric fields versus the applied current plots are affected by the polarization curve tendency regarding the polarization type (activation and concentration polarizations in the oxygen-reduction and hydrogen-reduction reactions). This study shows that the underwater electric signature is determined by the polarization behavior of the materials.

Biophysical characterization of influenza virus subpopulations using field flow fractionation and multiangle light scattering: correlation of particle counts, size distribution and infectivity.

PubMed

Wei, Ziping; McEvoy, Matt; Razinkov, Vladimir; Polozova, Alla; Li, Elizabeth; Casas-Finet, Jose; Tous, Guillermo I; Balu, Palani; Pan, Alfred A; Mehta, Harshvardhan; Schenerman, Mark A

2007-09-01

Adequate biophysical characterization of influenza virions is important for vaccine development. The influenza virus vaccines are produced from the allantoic fluid of developing chicken embryos. The process of viral replication produces a heterogeneous mixture of infectious and non-infectious viral particles with varying states of aggregation. The study of the relative distribution and behavior of different subpopulations and their inter-correlation can assist in the development of a robust process for a live virus vaccine. This report describes a field flow fractionation and multiangle light scattering (FFF-MALS) method optimized for the analysis of size distribution and total particle counts. The FFF-MALS method was compared with several other methods such as transmission electron microscopy (TEM), atomic force microscopy (AFM), size exclusion chromatography followed by MALS (SEC-MALS), quantitative reverse transcription polymerase chain reaction (RT Q-PCR), median tissue culture dose (TCID(50)), and the fluorescent focus assay (FFA). The correlation between the various methods for determining total particle counts, infectivity and size distribution is reported. The pros and cons of each of the analytical methods are discussed.

Structural, electrical and optical properties of nanostructured ZrO2 thin film deposited by SILAR method

NASA Astrophysics Data System (ADS)

Salodkar, R. V.; Belkhedkar, M. R.; Nemade, S. D.

2018-05-01

Successive Ionic Layer Adsorption and Reaction (SILAR) method has been employed to deposit nanocrystalline ZrO2 thin film of thickness 91 nm onto glass substrates using ZrOCl2.8H2O and NaOH as cationic and anionic precursors respectively. The structural and surface morphological characterizations have been carried out by means of X-ray diffraction and field emission scanning electron microscopy confirms the nanocrystalline nature of ZrO2 thin film. The direct optical band gap and activation energy of the ZrO2 thin film are found to be 4.74 and 0.80eV respectively.

Hydrothermal synthesis of highly crystalline ZnO nanorod arrays: Dependence of morphology and alignment on growth conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azzez, Shrook A., E-mail: shurouq44@yahoo.com; Hassan, Z.; Alimanesh, M.

Highly oriented zinc oxide nanorod were successfully grown on seeded p-type silicon substrate by hydrothermal methode. The morphology and the crystallinty of ZnO c-axis (002) arrays were systematically studied using field emission scanning electron microscopy (FESEM) and X-ray diffraction (XRD) methods. The effect of seed layer pre-annealing on nanorods properties was explained according to the nucleation site of ZnO nanoparticles on silicon substrate. In addition, the variation of the equal molarity of zinc nitrate hexahydrate and hexamine concentrations in the reaction vessel play a crucial role related to the ZnO nanorods.

Hydrogen production via reforming of biogas over nanostructured Ni/Y catalyst: Effect of ultrasound irradiation and Ni-content on catalyst properties and performance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharifi, Mahdi; Reactor and Catalysis Research Center; Haghighi, Mohammad, E-mail: haghighi@sut.ac.ir

2014-12-15

Highlights: • Synthesis of nanostructured Ni/Y catalyst by sonochemical and impregnation methods. • Enhancement of size distribution and active phase dispersion by employing sonochemical method. • Evaluation of biogas reforming over Ni/Y catalyst with different Ni-loadings. • Preparation of highly active and stable catalyst with low Ni content for biogas reforming. • Getting H{sub 2}/CO very close to equilibrium ratio by employing sonochemical method. - Abstract: The effect of ultrasound irradiation and various Ni-loadings on dispersion of active phase over zeolite Y were evaluated in biogas reforming for hydrogen production. X-ray diffraction, field emission scanning electron microscopy, energy dispersive X-ray,more » Brunauer–Emmett–Teller, Fourier transform infrared analysis and TEM analysis were employed to observe the characteristics of nanostructured catalysts. The characterizations implied that utilization of ultrasound irradiation enhanced catalyst physicochemical properties including high dispersion of Ni on support, smallest particles size and high catalyst surface area. The reforming reactions were carried out at GHSV = 24 l/g.h, P = 1 atm, CH{sub 4}/CO{sub 2} = 1 and temperature range of 550–850 °C. Activity test displayed that ultrasound irradiated Ni(5 wt.%)/Y had the best performance and the activity remained stable during 600 min. Furthermore, the proposed reaction mechanism showed that there are three major reaction channels in biogas reforming.« less

Effects of NN potentials on p Nuclides in the A ˜100-120 region

NASA Astrophysics Data System (ADS)

Lahiri, C.; Biswal, S. K.; Patra, S. K.

2016-02-01

Microscopic optical potentials for low-energy proton reactions have been obtained by folding density dependent M3Y (DDM3Y) interaction derived from nuclear matter calculation with densities from mean field approach to study astrophysically important proton rich nuclei in mass 100-120 region. We compare S factors for low-energy (p,γ) reactions with available experimental data and further calculate astrophysical reaction rates for (p,γ) and (p,n) reactions. Again, we choose some nonlinear R3Y (NR3Y) interactions from relativistic mean field (RMF) calculation and folded them with corresponding RMF densities to reproduce experimental S-factor values in this mass region. Finally, the effect of nonlinearity on our result is discussed.