Sample records for reactions studied include

  1. Quality of life in children with adverse drug reactions: a narrative and systematic review.

    PubMed

    Del Pozzo-Magaña, Blanca R; Rieder, Michael J; Lazo-Langner, Alejandro

    2015-10-01

    Adverse drug reactions are a common problem affecting adults and children. The economic impact of the adverse drug reactions has been widely evaluated; however, studies of the impact on the quality of life of children with adverse drug reactions are scarce. The aim was to evaluate studies assessing the health-related quality of life of children with adverse drug reactions. We conducted a systematic review that included the following electronic databases: MEDLINE, EMBASE and the Cochrane Library (including the Cochrane Database of Systematic Reviews, the Database of Abstracts of Reviews of Effects, the Cochrane Controlled Trials Register and the Health Technology Assessment Databases). Nine studies were included. Four of the studies were conducted in children with epilepsy; the rest of them involved children with chronic viral hepatitis, Crohn's disease, paediatric cancer and multiple adverse drug reactions compared with healthy children. Based on their findings, authors of all studies concluded that adverse drug reactions had a negative impact on the quality of life of children. No meta-analysis was conducted given the heterogeneous nature of the studies. To date, there is no specific instrument that measures quality of life of children with adverse drug reactions, and the information available is poor and variable. In general, adverse drug reactions have a negative impact on the quality of life of affected children. For those interested in this area, more work needs to be done to improve tools that help to evaluate efficiently the health-related quality of life of children with adverse drug reactions and chronic diseases. © 2014 The British Pharmacological Society.

  2. Quality of life in children with adverse drug reactions: a narrative and systematic review

    PubMed Central

    Del Pozzo-Magaña, Blanca R; Rieder, Michael J; Lazo-Langner, Alejandro

    2015-01-01

    Aims Adverse drug reactions are a common problem affecting adults and children. The economic impact of the adverse drug reactions has been widely evaluated; however, studies of the impact on the quality of life of children with adverse drug reactions are scarce. The aim was to evaluate studies assessing the health-related quality of life of children with adverse drug reactions. Methods We conducted a systematic review that included the following electronic databases: MEDLINE, EMBASE and the Cochrane Library (including the Cochrane Database of Systematic Reviews, the Database of Abstracts of Reviews of Effects, the Cochrane Controlled Trials Register and the Health Technology Assessment Databases). Results Nine studies were included. Four of the studies were conducted in children with epilepsy; the rest of them involved children with chronic viral hepatitis, Crohn’s disease, paediatric cancer and multiple adverse drug reactions compared with healthy children. Based on their findings, authors of all studies concluded that adverse drug reactions had a negative impact on the quality of life of children. No meta-analysis was conducted given the heterogeneous nature of the studies. Conclusions To date, there is no specific instrument that measures quality of life of children with adverse drug reactions, and the information available is poor and variable. In general, adverse drug reactions have a negative impact on the quality of life of affected children. For those interested in this area, more work needs to be done to improve tools that help to evaluate efficiently the health-related quality of life of children with adverse drug reactions and chronic diseases. PMID:24833305

  3. 75 FR 67669 - Disclosure of Cochineal Extract and Carmine in the Labeling of Wines, Distilled Spirits, and Malt...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-03

    ... well as reports of severe allergic reaction, including anaphylaxis, to cochineal extract and carmine... proposal was issued in response to reports of severe allergic reactions, including anaphylaxis, to... describes, in detail, several instances and studies in which allergic reactions occurred. One of the...

  4. CO oxidation reaction on Pt(111) studied by the dynamic Monte Carlo method including lateral interactions of adsorbates.

    PubMed

    Nagasaka, Masanari; Kondoh, Hiroshi; Nakai, Ikuyo; Ohta, Toshiaki

    2007-01-28

    The dynamics of adsorbate structures during CO oxidation on Pt(111) surfaces and its effects on the reaction were studied by the dynamic Monte Carlo method including lateral interactions of adsorbates. The lateral interaction energies between adsorbed species were calculated by the density functional theory method. Dynamic Monte Carlo simulations were performed for the oxidation reaction over a mesoscopic scale, where the experimentally determined activation energies of elementary paths were altered by the calculated lateral interaction energies. The simulated results reproduced the characteristics of the microscopic and mesoscopic scale adsorbate structures formed during the reaction, and revealed that the complicated reaction kinetics is comprehensively explained by a single reaction path affected by the surrounding adsorbates. We also propose from the simulations that weakly adsorbed CO molecules at domain boundaries promote the island-periphery specific reaction.

  5. A Unified Approach to the Study of Chemical Reactions in Freshman Chemistry.

    ERIC Educational Resources Information Center

    Cassen, T.; DuBois, Thomas D.

    1982-01-01

    Provides rationale and objectives for presenting chemical reactions in a unified, logical six-stage approach rather than a piecemeal approach. Stages discussed include: introduction, stable electronic configurations and stable oxidation states, reactions between two free elements, ion transfer/proton transfer reactions, double displacement…

  6. Using Group-Inquiry to Study Differing Reaction Conditions in the E2 Elimination of Cyclohexyl Halides

    ERIC Educational Resources Information Center

    Long, Robert D.

    2012-01-01

    In this experiment, students individually conduct one of several variations of an E2 dehydrohalogenation reaction on a cyclohexyl halide substrate for 30 min, which is sufficient only for a partial reaction to occur. The variations examine reaction conditions including different leaving groups, decreased reaction temperature, or reduced base…

  7. NASTRAN buckling study of a linear induction motor reaction rail

    NASA Technical Reports Server (NTRS)

    Williams, J. G.

    1973-01-01

    NASTRAN was used to study problems associated with the installation of a linear induction motor reaction rail test track. Specific problems studied include determination of the critical axial compressive buckling stress and establishment of the lateral stiffness of the reaction rail under combined loads. NASTRAN results were compared with experimentally obtained values and satisfactory agreement was obtained. The reaction rail was found to buckle at an axial compressive stress of 11,400 pounds per square inch. The results of this investigation were used to select procedures for installation of the reaction rail.

  8. A multi-purpose reaction cell for the investigation of reactions under solvothermal conditions

    NASA Astrophysics Data System (ADS)

    Heidenreich, N.; Rütt, U.; Köppen, M.; Inge, A. Ken; Beier, S.; Dippel, A.-C.; Suren, R.; Stock, N.

    2017-10-01

    A new versatile and easy-to-use remote-controlled reactor setup aimed at the analysis of chemical reactions under solvothermal conditions has been constructed. The reactor includes a heating system that can precisely control the temperature inside the reaction vessels in a range between ambient temperature and 180 °C. As reaction vessels, two sizes of commercially available borosilicate vessels (Vmax = 5 and 11 ml) can be used. The setup furthermore includes the option of stirring and injecting of up to two liquid additives or one solid during the reaction to initiate very fast reactions, quench reactions, or alter chemical parameters. In addition to a detailed description of the general setup and its functionality, three examples of studies conducted using this setup are presented.

  9. Diet Coke and Mentos: What is really behind this physical reaction?

    NASA Astrophysics Data System (ADS)

    Coffey, Tonya Shea

    2008-06-01

    The Diet Coke and Mentos reaction is a fun demonstration in chemistry and physics classes of many important concepts in thermodynamics, fluid dynamics, surface science, and the physics of explosions. The reaction has been performed numerous times on television and the Internet, but has not been systematically studied. We report on an experimental study of the Diet Coke and Mentos reaction, and consider many aspects of the reaction, including the ingredients in the candy and soda, the roughness of the candy, the temperature of the soda, and the duration of the reaction.

  10. A high-temperature, ambient-pressure ultra-dry operando reactor cell for Fourier-transform infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Köck, Eva-Maria; Kogler, Michaela; Pramsoler, Reinhold; Klötzer, Bernhard; Penner, Simon

    2014-08-01

    The construction of a newly designed high-temperature, high-pressure FT-IR reaction cell for ultra-dry in situ and operando operation is reported. The reaction cell itself as well as the sample holder is fully made of quartz glass, with no hot metal or ceramic parts in the vicinity of the high-temperature zone. Special emphasis was put on chemically absolute water-free and inert experimental conditions, which includes reaction cell and gas-feeding lines. Operation and spectroscopy up to 1273 K is possible, as well as pressures up to ambient conditions. The reaction cell exhibits a very easy and variable construction and can be adjusted to any available FT-IR spectrometer. Its particular strength lies in its possibility to access and study samples under very demanding experimental conditions. This includes studies at very high temperatures, e.g., for solid-oxide fuel cell research or studies where the water content of the reaction mixtures must be exactly adjusted. The latter includes all adsorption studies on oxide surfaces, where the hydroxylation degree is of paramount importance. The capability of the reaction cell will be demonstrated for two selected examples where information and in due course a correlation to other methods can only be achieved using the presented setup.

  11. A high-temperature, ambient-pressure ultra-dry operando reactor cell for Fourier-transform infrared spectroscopy.

    PubMed

    Köck, Eva-Maria; Kogler, Michaela; Pramsoler, Reinhold; Klötzer, Bernhard; Penner, Simon

    2014-08-01

    The construction of a newly designed high-temperature, high-pressure FT-IR reaction cell for ultra-dry in situ and operando operation is reported. The reaction cell itself as well as the sample holder is fully made of quartz glass, with no hot metal or ceramic parts in the vicinity of the high-temperature zone. Special emphasis was put on chemically absolute water-free and inert experimental conditions, which includes reaction cell and gas-feeding lines. Operation and spectroscopy up to 1273 K is possible, as well as pressures up to ambient conditions. The reaction cell exhibits a very easy and variable construction and can be adjusted to any available FT-IR spectrometer. Its particular strength lies in its possibility to access and study samples under very demanding experimental conditions. This includes studies at very high temperatures, e.g., for solid-oxide fuel cell research or studies where the water content of the reaction mixtures must be exactly adjusted. The latter includes all adsorption studies on oxide surfaces, where the hydroxylation degree is of paramount importance. The capability of the reaction cell will be demonstrated for two selected examples where information and in due course a correlation to other methods can only be achieved using the presented setup.

  12. Comparison of Sprint Reaction and Visual Reaction Times of Athletes in Different Branches

    ERIC Educational Resources Information Center

    Akyüz, Murat; Uzaldi, Basar Basri; Akyüz, Öznur; Dogru, Yeliz

    2017-01-01

    The aims of this study are to analyse sprint reaction and visual reaction times of female athletes of different branches competing in Professional leagues and to show the differences between them. 42 voluntary female athletes from various branches of Professional leagues of Istanbul (volleyball, basketball, handball) were included in the…

  13. Infliximab-Related Infusion Reactions: Systematic Review

    PubMed Central

    Ron, Yulia; Kivity, Shmuel; Ben-Horin, Shomron; Israeli, Eran; Fraser, Gerald M.; Dotan, Iris; Chowers, Yehuda; Confino-Cohen, Ronit; Weiss, Batia

    2015-01-01

    Objective: Administration of infliximab is associated with a well-recognised risk of infusion reactions. Lack of a mechanism-based rationale for their prevention, and absence of adequate and well-controlled studies, has led to the use of diverse empirical administration protocols. The aim of this study is to perform a systematic review of the evidence behind the strategies for preventing infusion reactions to infliximab, and for controlling the reactions once they occur. Methods: We conducted extensive search of electronic databases of MEDLINE [PubMed] for reports that communicate various aspects of infusion reactions to infliximab in IBD patients. Results: We examined full texts of 105 potentially eligible articles. No randomised controlled trials that pre-defined infusion reaction as a primary outcome were found. Three RCTs evaluated infusion reactions as a secondary outcome; another four RCTs included infusion reactions in the safety evaluation analysis; and 62 additional studies focused on various aspects of mechanism/s, risk, primary and secondary preventive measures, and management algorithms. Seven studies were added by a manual search of reference lists of the relevant articles. A total of 76 original studies were included in quantitative analysis of the existing strategies. Conclusions: There is still paucity of systematic and controlled data on the risk, prevention, and management of infusion reactions to infliximab. We present working algorithms based on systematic and extensive review of the available data. More randomised controlled trials are needed in order to investigate the efficacy of the proposed preventive and management algorithms. PMID:26092578

  14. Electromagnetic effects on explosive reaction and plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tasker, Douglas G; Whitley, Von H; Mace, Jonathan L

    2010-01-01

    A number of studies have reported that electric fields can have quantifiable effects on the initiation and growth of detonation, yet the mechanisms of these effects are not clear. Candidates include Joule heating of the reaction zone, perturbations to the activation energy for chemical reaction, reduction of the Peierls energy barrier that facilitates dislocation motion, and acceleration of plasma projected from the reaction zone. In this study the possible role of plasma in the initiation and growth of explosive reaction is investigated. The effects of magnetic and electric field effects on reaction growth will be reviewed and recent experiments reported.

  15. Ab initio Quantum Chemical and Experimental Reaction Kinetics Studies in the Combustion of Bipropellants

    DTIC Science & Technology

    2017-03-24

    NUMBER (Include area code) 24 March 2017 Briefing Charts 01 March 2017 - 31 March 2017 Ab initio Quantum Chemical and Experimental Reaction Kinetics...Laboratory AFRL/RQRS 1 Ara Road Edwards AFB, CA 93524 *Email: ghanshyam.vaghjiani@us.af.mil Ab initio Quantum Chemical and Experimental Reaction ...Clearance 17161 Zador et al., Prog. Energ. Combust. Sci., 37 371 (2011) Why Quantum Chemical Reaction Kinetics Studies? DISTRIBUTION A: Approved for

  16. Novel duplex vapor-electrochemical method for silicon solar cells

    NASA Technical Reports Server (NTRS)

    Nanis, L.; Sanjurjo, A.; Westphal, S.

    1979-01-01

    Optimization studies were carried out for the SiF4-Na reaction with solid Na feed. The goals of the study were the consistent production of high purity reaction products and the gathering of relevant information needed to scale-up the reactor. Parameters studied include: (1) effect of surface to volume ratio of Na slices on the extent of reaction; (2) effect of Na surface oxidation on the extent of reaction; (3) effect of external heating on the extent of SiF4-Na reaction; (4) effect of Na slice addition rate on extent of the reaction; and (5) SiF4-Na reaction - high pressure experiments. An investigation was also made of the possible role played by NaF as a fluxing agent during the separation of silicon by melting of the reaction product (Si + NaF) mixture. Since silicon can be produced by the thermite reaction between Na2SiF6 and Na, studies were initiated to gather information on parameters which control the efficiency of the thermite reaction.

  17. Plasmonic Imaging of Electrochemical Reactions of Single Nanoparticles.

    PubMed

    Fang, Yimin; Wang, Hui; Yu, Hui; Liu, Xianwei; Wang, Wei; Chen, Hong-Yuan; Tao, N J

    2016-11-15

    Electrochemical reactions are involved in many natural phenomena, and are responsible for various applications, including energy conversion and storage, material processing and protection, and chemical detection and analysis. An electrochemical reaction is accompanied by electron transfer between a chemical species and an electrode. For this reason, it has been studied by measuring current, charge, or related electrical quantities. This approach has led to the development of various electrochemical methods, which have played an essential role in the understanding and applications of electrochemistry. While powerful, most of the traditional methods lack spatial and temporal resolutions desired for studying heterogeneous electrochemical reactions on electrode surfaces and in nanoscale materials. To overcome the limitations, scanning probe microscopes have been invented to map local electrochemical reactions with nanometer resolution. Examples include the scanning electrochemical microscope and scanning electrochemical cell microscope, which directly image local electrochemical reaction current using a scanning electrode or pipet. The use of a scanning probe in these microscopes provides high spatial resolution, but at the expense of temporal resolution and throughput. This Account discusses an alternative approach to study electrochemical reactions. Instead of measuring electron transfer electrically, it detects the accompanying changes in the reactant and product concentrations on the electrode surface optically via surface plasmon resonance (SPR). SPR is highly surface sensitive, and it provides quantitative information on the surface concentrations of reactants and products vs time and electrode potential, from which local reaction kinetics can be analyzed and quantified. The plasmonic approach allows imaging of local electrochemical reactions with high temporal resolution and sensitivity, making it attractive for studying electrochemical reactions in biological systems and nanoscale materials with high throughput. The plasmonic approach has two imaging modes: electrochemical current imaging and interfacial impedance imaging. The former images local electrochemical current associated with electrochemical reactions (faradic current), and the latter maps local interfacial impedance, including nonfaradic contributions (e.g., double layer charging). The plasmonic imaging technique can perform voltammetry (cyclic or square wave) in an analogous manner to the traditional electrochemical methods. It can also be integrated with bright field, dark field, and fluorescence imaging capabilities in one optical setup to provide additional capabilities. To date the plasmonic imaging technique has found various applications, including mapping of heterogeneous surface reactions, analysis of trace substances, detection of catalytic reactions, and measurement of graphene quantum capacitance. The plasmonic and other emerging optical imaging techniques (e.g., dark field and fluorescence microscopy), together with the scanning probe-based electrochemical imaging and single nanoparticle analysis techniques, provide new capabilities for one to study single nanoparticle electrochemistry with unprecedented spatial and temporal resolutions. In this Account, we focus on imaging of electrochemical reactions at single nanoparticles.

  18. Multicentre Double-Blind Placebo-Controlled Food Challenge Study in Children Sensitised to Cashew Nut.

    PubMed

    van der Valk, Johanna P M; Gerth van Wijk, Roy; Dubois, Anthony E J; de Groot, Hans; Reitsma, Marit; Vlieg-Boerstra, Berber; Savelkoul, Huub F J; Wichers, Harry J; de Jong, Nicolette W

    2016-01-01

    Few studies with a limited number of patients have provided indications that cashew-allergic patients may experience severe allergic reactions to minimal amounts of cashew nut. The objectives of this multicentre study were to assess the clinical relevance of cashew nut sensitisation, to study the clinical reaction patterns in double-blind placebo-controlled food challenge tests and to establish the amount of cashew nuts that can elicit an allergic reaction. A total of 179 children were included (median age 9.0 years; range 2-17 years) with cashew nut sensitisation and a clinical history of reactions to cashew nuts or unknown exposure. Sensitised children who could tolerate cashew nuts were excluded. The study included three clinical visits and a telephone consultation. During the first visit, the medical history was evaluated, physical examinations were conducted, blood samples were drawn and skin prick tests were performed. The children underwent a double-blind placebo-controlled food challenge test with cashew nut during the second and third visits. The study showed that 137 (76.5%) of the sensitised children suspected of allergy to cashew nut had a positive double-blind placebo-controlled food challenge test, with 46% (63) manifesting subjective symptoms to the lowest dose of 1 mg cashew nut protein and 11% (15) developing objective symptoms to the lowest dose. Children most frequently had gastro-intestinal symptoms, followed by oral allergy and skin symptoms. A total of 36% (49/137) of the children experienced an anaphylactic reaction and 6% (8/137) of the children were treated with epinephrine. This prospective study demonstrated a strikingly high percentage of clinical reactions to cashew nut in this third line population. Severe allergic reactions, including anaphylaxis requiring epinephrine, were observed. These reactions were to minimal amounts of cashew nut, demonstrated the high potency of this allergens. www.ncbi.nlm.nih.gov/pubmed NTR3572.

  19. Multicentre Double-Blind Placebo-Controlled Food Challenge Study in Children Sensitised to Cashew Nut

    PubMed Central

    van der Valk, Johanna P. M.; Gerth van Wijk, Roy; Dubois, Anthony E. J.; de Groot, Hans; Reitsma, Marit; Vlieg-Boerstra, Berber; Savelkoul, Huub F. J.; Wichers, Harry J.; de Jong, Nicolette W.

    2016-01-01

    Background Few studies with a limited number of patients have provided indications that cashew-allergic patients may experience severe allergic reactions to minimal amounts of cashew nut. The objectives of this multicentre study were to assess the clinical relevance of cashew nut sensitisation, to study the clinical reaction patterns in double-blind placebo-controlled food challenge tests and to establish the amount of cashew nuts that can elicit an allergic reaction. Methods and Findings A total of 179 children were included (median age 9.0 years; range 2–17 years) with cashew nut sensitisation and a clinical history of reactions to cashew nuts or unknown exposure. Sensitised children who could tolerate cashew nuts were excluded. The study included three clinical visits and a telephone consultation. During the first visit, the medical history was evaluated, physical examinations were conducted, blood samples were drawn and skin prick tests were performed. The children underwent a double-blind placebo-controlled food challenge test with cashew nut during the second and third visits. The study showed that 137 (76.5%) of the sensitised children suspected of allergy to cashew nut had a positive double-blind placebo-controlled food challenge test, with 46% (63) manifesting subjective symptoms to the lowest dose of 1 mg cashew nut protein and 11% (15) developing objective symptoms to the lowest dose. Children most frequently had gastro-intestinal symptoms, followed by oral allergy and skin symptoms. A total of 36% (49/137) of the children experienced an anaphylactic reaction and 6% (8/137) of the children were treated with epinephrine. Conclusion This prospective study demonstrated a strikingly high percentage of clinical reactions to cashew nut in this third line population. Severe allergic reactions, including anaphylaxis requiring epinephrine, were observed. These reactions were to minimal amounts of cashew nut, demonstrated the high potency of this allergens. Trial Registration www.ncbi.nlm.nih.gov/pubmed NTR3572 PMID:26967158

  20. ABO blood groups, Rhesus factor, and anaphylactic reactions due to Hymenoptera stings.

    PubMed

    Pałgan, Krzysztof; Bartuzi, Zbigniew; Chrzaniecka, Elżbieta

    2017-09-21

    Numerous publications indicate that the prevalence of some infectious, neoplastic and immunological diseases are associated with ABO blood groups. The aim of this study was to verify whether ABO and Rh blood groups are associated with severe anaphylactic reactions after Hymenoptera stings. A study was undertaken of 71,441 Caucasian subjects living in the same geographic area. The study group included 353 patients with diagnosed systemic anaphylaxis to Hymenoptera venom. Control group included 71,088 healthy blood donors. Frequencies of ABO and Rhesus groups in the study and control groups were compared using univariate and multivariate analyses. No statistically significant interactions were observed between the ABO blood group and anaphylactic reactions to Hymenoptera.

  1. Kinetics and Product Channels in Combustion Chemistry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hershberger, John F.

    We report study of the chemical kinetics and/or photochemistry of several chemical reactions of potential interest in understanding the gas phase combustion chemistry of nitrogen-containing molecules. Studies completed during the final grant period include determination of quantum yields of the photolysis of HCNO, fulminic acid, a kinetics and product channel study of the reaction of CN radicals with methyl bromide, and study of the products of the reaction of hydroxymethyl radical with nitric oxide.

  2. High-level direct-dynamics variational transition state theory calculations including multidimensional tunneling of the thermal rate constants, branching ratios, and kinetic isotope effects of the hydrogen abstraction reactions from methanol by atomic hydrogen.

    PubMed

    Meana-Pañeda, Rubén; Truhlar, Donald G; Fernández-Ramos, Antonio

    2011-03-07

    We report a detailed theoretical study of the hydrogen abstraction reaction from methanol by atomic hydrogen. The study includes the analysis of thermal rate constants, branching ratios, and kinetic isotope effects. Specifically, we have performed high-level computations at the MC3BB level together with direct dynamics calculations by canonical variational transition state theory (CVT) with the microcanonically optimized multidimensional tunneling (μOMT) transmission coefficient (CVT/μOMT) to study both the CH(3)OH+H→CH(2)OH+H(2) (R1) reaction and the CH(3)OH+H→CH(3)O+H(2) (R2) reaction. The CVT/μOMT calculations show that reaction R1 dominates in the whole range 298≤T (K)≤2500 and that anharmonic effects on the torsional mode about the C-O bond are important, mainly at high temperatures. The activation energy for the total reaction sum of R1 and R2 reactions changes substantially with temperature and, therefore, the use of straight-line Arrhenius plots is not valid. We recommend the use of new expressions for the total R1 + R2 reaction and for the R1 and R2 individual reactions. © 2011 American Institute of Physics.

  3. Comparative safety of intravenous Ferumoxytol versus Ferric Carboxymaltose for the Treatment of Iron Deficiency Anemia: rationale and study design of a randomized double-blind study with a focus on acute hypersensitivity reactions.

    PubMed

    Adkinson, N Franklin; Strauss, William E; Bernard, Kristine; Kaper, Robert F; Macdougall, Iain C; Krop, Julie S

    2017-01-01

    Intravenous (IV) iron is often used to treat iron deficiency anemia in patients who are unable to tolerate or are inadequately managed with oral iron. However, IV iron treatment has been associated with acute hypersensitivity reactions. The comparative risk of adverse events (AEs) with IV iron preparations has been assessed by a few randomized controlled trials, which are most often limited by small patient numbers, which lack statistical power to identify differences in low-frequency AE such as hypersensitivity reactions. Ferumoxytol versus Ferric Carboxymaltose for the Treatment of Iron Deficiency Anemia (FIRM) is a randomized, double-blind, international, multicenter, Phase III study designed to compare the safety of ferumoxytol and ferric carboxymaltose (FCM). The study includes adults with hemoglobin <12.0 g/dL (females) or <14.0 g/dL (males), transferrin saturation ≤20% or ferritin ≤100 ng/mL within 60 days of dosing, and a history of unsatisfactory or nontolerated oral iron therapy or in whom oral iron therapy is inappropriate. Patients are randomized (1:1) to ferumoxytol 510 mg or FCM 750 mg, each given intravenously on days 1 and 8. Primary end points are the incidence of moderate-to-severe hypersensitivity reactions, including anaphylaxis, and moderate-to-severe hypotension. All potential hypersensitivity and hypotensive reactions will be adjudicated by a blinded, independent Clinical Events Committee. A secondary safety end point is the composite frequency of moderate-to-severe hypersensitivity reactions, including anaphylaxis, serious cardiovascular events, and death. Secondary efficacy end points include mean change in hemoglobin and mean change in hemoglobin per milligram of iron administered from baseline to week 5. Urinary excretion of phosphorus and the occurrence of hypophosphatemia after IV iron administration will be examined as well as the mechanisms of such hypophosphatemia in a substudy. FIRM will provide data on the comparative safety of ferumoxytol and FCM, two IV iron preparations with similar dosing schedules, focusing on moderate-to-severe hypersensitivity reactions, including anaphylaxis, and moderate-to-severe hypotension. The study plans to enroll 2000 patients and is expected to complete in 2017.

  4. A Spectrophotometric Study of the Permanganate-Oxalate Reaction: An Analytical Laboratory Experiment

    ERIC Educational Resources Information Center

    Kalbus, Gene E.; Lieu, Van T.; Kalbus, Lee H.

    2004-01-01

    The spectrophotometric method assists in the study of potassium permanganate-oxalate reaction. Basic analytical techniques and rules are implemented in the experiment, which can also include the examination of other compounds oxidized by permanganate.

  5. [Prevalence of reactions secundary to mosquito bites Aedes aegypti at en el Regional Center of Allergy and Clinical Immunology, University Hospital, de Monterrey, Nuevo Leon].

    PubMed

    González Diaz, Sandra Nora; Cruz, Alfredo Arias; Sedó Mejía, Giovanni A; Rojas Lozano, Antonio A; Valenzuela, Enrique Avitia; Vidaurri Ojeda, Alma C

    2010-01-01

    although systemic reactions resulting from hymenoptera stings have been studied extensively, the prevalence of allergic reactions to mosquitoes is unknown. to investigate the prevalence of allergic reactions to Aedes aegypti bites in patients seeking treatment at the Allergy and Clinical Immunology Regional Center of Jose E Gonzalez University Hospital in Monterrey, Mexico. we carried out a cross-sectional, descriptive study that included patients receiving skin tests for aeroallergens; skin sensitivity to mosquito bites was also tested. A questionnaire was used to obtain information about previous allergic reactions to mosquito bites. a total of 482 patients between 2 and 60 years of age were included; 53% were female, 407 (84.4%) had a history of local reactions to mosquito bites. Twelve patients (2.4%) stated a history of large local reaction; three (0.6%) of them with a positive skin prick test, one (0.2%) of those had systemic reaction history to mosquito. Eighty five (17.6%) patients had a positive mosquito skin test and 307 (63.6%) had a positive skin test for at least one aeroallergen. Seventy-eight (91.7%) of the 85 patients with a positive mosquito skin test had a history of local skin reactions to mosquito bite (odds ratio: 2.303 [confidence interval (CI) 1.037-5.10]. There was no statistically significance association between allergic diseases and mosquito allergy. adverse reactions and allergic reactions to mosquito bites occur frequently. However mosquito allergy is low. Further studies are required to determine the prevalence of mosquito allergy in the general population.

  6. Explicit inclusion of nonlocality in ( d , p ) transfer reactions

    DOE PAGES

    Titus, L. J.; Nunes, F. M.; Potel, G.

    2016-01-06

    Traditionally, nucleon-nucleus optical potentials are made local for convenience. In recent work we studied the effects of including nonlocal interactions explicitly in the final state for (d,p) reactions, within the distorted wave Born approximation. Our goal in this work is to develop an improved formalism for nonlocal interactions that includes deuteron breakup and to use it to study the effects of including nonlocal interactions in transfer (d,p) reactions, in both the deuteron and the proton channel. We extend the finite-range adiabatic distorted wave approximation to include nonlocal nucleon optical potentials. We apply our method to (d,p) reactions on 16O, 40Ca,more » 48Ca, 126Sn, 132Sn, and 208Pb at 10, 20 and 50 MeV. Here, we find that nonlocality in the deuteron scattering state reduces the amplitude of the wave function in the nuclear interior, and shifts the wave function outward. In many cases, this has the effect of increasing the transfer cross section at the first peak of the angular distributions. This increase was most significant for heavy targets and for reactions at high energies. Lastly, our systematic study shows that, if only local optical potentials are used in the analysis of experimental (d, p) transfer cross sections, the extracted spectroscopic factors may be incorrect by up to 40% due to the local approximation.« less

  7. Kinetic study of the reaction of the hydroxyl radical (OH) with methyl ethyl ketone (2-butanone) and its deuterated isotopomers at low pressure

    NASA Astrophysics Data System (ADS)

    Liljegren, J. A.; Stevens, P. S.

    2012-12-01

    Methyl ethyl ketone (2-butanone) in the atmosphere comes from a variety of sources. It is produced commercially as an industrial ketone. It can be formed as a result of the OH or Cl-initiated oxidation of C4-C6 alkanes, primarily n-butane, or from the reaction of some alkenes with OH or O3. Biogenic sources include direct emissions from certain plants as well as emissions from decaying plant matter. Methyl ethyl ketone is removed from the atmosphere primarily by its reaction with OH. A product of this reaction includes acetaldehyde, which is a hazardous air pollutant, can further react to produce peroxy acetyl nitrate (PAN), and can be a significant source of free radicals to the atmosphere. The absolute rate constant for the reaction of OH with methyl ethyl ketone has been measured as a function of temperature at low pressure using discharge-flow techniques coupled with laser induced fluorescence (LIF) detection of OH. In addition, measurements of the rate constants for the reactions of OH with two deuterated isotopomers of methyl ethyl ketone, including CD3C(O)CH2CH3 and CH3C(O)CD2CD3, will be presented to gain a better understanding of the mechanism for this reaction. Theoretical studies of the potential energy surface for this reaction suggest that the reaction proceeds through the formation of a hydrogen-bonded pre-reactive complex, similar to that of several other atmospherically relevant oxygenated VOCs such as acetone, acetic acid, and hydroxyacetone.

  8. α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions

    NASA Astrophysics Data System (ADS)

    Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.

    1980-09-01

    Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.

  9. Hydrolysis of Nerve Agents by Model Nucleophiles: A Computational Study

    PubMed Central

    Beck, Jeremy M.

    2008-01-01

    Density functional theory calculations were employed to study the reaction of five nerve agents with model nucleophiles, including EtX− and EtXH (X = O, S, Se) for serine, cysteine and selenocysteine, respectively. Calculations at the B3LYP/6-311++G(2d,p) level of theory predict an exothermic reaction between ethoxide and all of the nerve agents studied. As compared to EtO− as a nucleophile, these reactions become ~30 kcal/mol more endothermic for EtS−, and by ~40 kcal/mol for EtSe−. The equivalent reactions with the neutral nucleophiles (EtXH) were more endothermic. The effect of solvation on the reaction thermochemistry was determined using a polarizable continuum model simulating the dielectric constant of chloroform. While there was a large exothermic shift for reactions involving charged nucleophiles with solvation modeling, the corresponding shift was minimal for the reaction with neutral nucleophiles. PMID:18538754

  10. Nonenzymatic Reactions above Phospholipid Surfaces of Biological Membranes: Reactivity of Phospholipids and Their Oxidation Derivatives

    PubMed Central

    Solís-Calero, Christian; Ortega-Castro, Joaquín; Frau, Juan; Muñoz, Francisco

    2015-01-01

    Phospholipids play multiple and essential roles in cells, as components of biological membranes. Although phospholipid bilayers provide the supporting matrix and surface for many enzymatic reactions, their inherent reactivity and possible catalytic role have not been highlighted. As other biomolecules, phospholipids are frequent targets of nonenzymatic modifications by reactive substances including oxidants and glycating agents which conduct to the formation of advanced lipoxidation end products (ALEs) and advanced glycation end products (AGEs). There are some theoretical studies about the mechanisms of reactions related to these processes on phosphatidylethanolamine surfaces, which hypothesize that cell membrane phospholipids surface environment could enhance some reactions through a catalyst effect. On the other hand, the phospholipid bilayers are susceptible to oxidative damage by oxidant agents as reactive oxygen species (ROS). Molecular dynamics simulations performed on phospholipid bilayers models, which include modified phospholipids by these reactions and subsequent reactions that conduct to formation of ALEs and AGEs, have revealed changes in the molecular interactions and biophysical properties of these bilayers as consequence of these reactions. Then, more studies are desirable which could correlate the biophysics of modified phospholipids with metabolism in processes such as aging and diseases such as diabetes, atherosclerosis, and Alzheimer's disease. PMID:25977746

  11. Radiation reaction in fusion plasmas.

    PubMed

    Hazeltine, R D; Mahajan, S M

    2004-10-01

    The effects of a radiation reaction on thermal electrons in a magnetically confined plasma, with parameters typical of planned burning plasma experiments, are studied. A fully relativistic kinetic equation that includes the radiation reaction is derived. The associated rate of phase-space contraction is computed and the relative importance of the radiation reaction in phase space is estimated. A consideration of the moments of the radiation reaction force show that its effects are typically small in reactor-grade confined plasmas, but not necessarily insignificant.

  12. Overview of Light Hydrogen-Based Low Energy Nuclear Reactions

    NASA Astrophysics Data System (ADS)

    Miley, George H.; Shrestha, Prajakti J.

    This paper reviews light water and hydrogen-based low-energy nuclear reactions (LENRs) including the different methodologies used to study these reactions and the results obtained. Reports of excess heat production, transmutation reactions, and nuclear radiation emission are cited. An aim of this review is to present a summary of the present status of light water LENR research and provide some insight into where this research is heading.

  13. Genetic variants associated with phenytoin-related severe cutaneous adverse reactions.

    PubMed

    Chung, Wen-Hung; Chang, Wan-Chun; Lee, Yun-Shien; Wu, Ying-Ying; Yang, Chih-Hsun; Ho, Hsin-Chun; Chen, Ming-Jing; Lin, Jing-Yi; Hui, Rosaline Chung-Yee; Ho, Ji-Chen; Wu, Wei-Ming; Chen, Ting-Jui; Wu, Tony; Wu, Yih-Ru; Hsih, Mo-Song; Tu, Po-Hsun; Chang, Chen-Nen; Hsu, Chien-Ning; Wu, Tsu-Lan; Choon, Siew-Eng; Hsu, Chao-Kai; Chen, Der-Yuan; Liu, Chin-San; Lin, Ching-Yuang; Kaniwa, Nahoko; Saito, Yoshiro; Takahashi, Yukitoshi; Nakamura, Ryosuke; Azukizawa, Hiroaki; Shi, Yongyong; Wang, Tzu-Hao; Chuang, Shiow-Shuh; Tsai, Shih-Feng; Chang, Chee-Jen; Chang, Yu-Sun; Hung, Shuen-Iu

    2014-08-06

    The antiepileptic drug phenytoin can cause cutaneous adverse reactions, ranging from maculopapular exanthema to severe cutaneous adverse reactions, which include drug reactions with eosinophilia and systemic symptoms, Stevens-Johnson syndrome, and toxic epidermal necrolysis. The pharmacogenomic basis of phenytoin-related severe cutaneous adverse reactions remains unknown. To investigate the genetic factors associated with phenytoin-related severe cutaneous adverse reactions. Case-control study conducted in 2002-2014 among 105 cases with phenytoin-related severe cutaneous adverse reactions (n=61 Stevens-Johnson syndrome/toxic epidermal necrolysis and n=44 drug reactions with eosinophilia and systemic symptoms), 78 cases with maculopapular exanthema, 130 phenytoin-tolerant control participants, and 3655 population controls from Taiwan, Japan, and Malaysia. A genome-wide association study (GWAS), direct sequencing of the associated loci, and replication analysis were conducted using the samples from Taiwan. The initial GWAS included samples of 60 cases with phenytoin-related severe cutaneous adverse reactions and 412 population controls from Taiwan. The results were validated in (1) 30 cases with severe cutaneous adverse reactions and 130 phenytoin-tolerant controls from Taiwan, (2) 9 patients with Stevens-Johnson syndrome/toxic epidermal necrolysis and 2869 population controls from Japan, and (3) 6 cases and 374 population controls from Malaysia. Specific genetic factors associated with phenytoin-related severe cutaneous adverse reactions. The GWAS discovered a cluster of 16 single-nucleotide polymorphisms in CYP2C genes at 10q23.33 that reached genome-wide significance. Direct sequencing of CYP2C identified missense variant rs1057910 (CYP2C9*3) that showed significant association with phenytoin-related severe cutaneous adverse reactions (odds ratio, 12; 95% CI, 6.6-20; P=1.1 × 10(-17)). The statistically significant association between CYP2C9*3 and phenytoin-related severe cutaneous adverse reactions was observed in additional samples from Taiwan, Japan, and Malaysia. A meta-analysis using the data from the 3 populations showed an overall odds ratio of 11 (95% CI, 6.2-18; z=8.58; P < .00001) for CYP2C9*3 association with phenytoin-related severe cutaneous adverse reactions. Delayed clearance of plasma phenytoin was detected in patients with severe cutaneous adverse reactions, especially CYP2C9*3 carriers, providing a functional link of the associated variants to the disease. This study identified CYP2C variants, including CYP2C9*3, known to reduce drug clearance, as important genetic factors associated with phenytoin-related severe cutaneous adverse reactions.

  14. Cycloaddition Reactions of Cobalt-Complexed Macrocyclic Alkynes: The Transannular Pauson-Khand Reaction.

    PubMed

    Karabiyikoglu, Sedef; Boon, Byron A; Merlic, Craig A

    2017-08-04

    The Pauson-Khand reaction is a powerful tool for the synthesis of cyclopentenones through the efficient [2 + 2 + 1] cycloaddition of dicobalt alkyne complexes with alkenes. While intermolecular and intramolecular variants are widely known, transannular versions of this reaction are unknown and the basis of this study. Macrocyclic enyne and dienyne complexes were readily synthesized by palladium(II)-catalyzed oxidative macrocyclizations of bis(vinyl boronate esters) or ring-closing metathesis reactions followed by complexation with dicobalt octacarbonyl. Several reaction modalities of these macrocyclic complexes were uncovered. In addition to the first successful transannular Pauson-Khand reactions, other intermolecular and transannular cycloaddition reactions included intermolecular Pauson-Khand reactions, transannular [4 + 2] cycloaddition reactions, intermolecular [2 + 2 + 2] cycloaddition reactions, and intermolecular [2 + 2 + 1 + 1] cycloaddition reactions. The structural and reaction requirements for each process are presented.

  15. In situ insights into shock-driven reactive flow

    NASA Astrophysics Data System (ADS)

    Dattelbaum, Dana

    2017-06-01

    Shock-driven reactions are commonplace. Examples include the detonation of high explosives, shock-driven dissociation of polymers, and transformation of carbon from graphite to diamond phases. The study of shock-driven chemical reactions is important for understanding reaction thresholds, their mechanisms and rates, and associated state sensitivities under the extreme conditions generated by shock compression. Reactions are distinguished by their thermicity - e.g. the volume and enthalpy changes along the reaction coordinate. A survey of the hallmarks of shock-driven reactivity for a variety of simple molecules and polymers will be presented, including benzene, acetylenes and nitriles, and formic acid. Many of the examples will illustrate the nature of the reactive flow through particle velocity wave profiles measured by in situ electromagnetic gauging in gas gun-driven plate impact experiments. General trends will be presented linking molecular moieties, shock temperatures, and reaction state sensitivities. Progress in applying bond-specific diagnostics will also be presented, including time-resolved Raman spectroscopy, and recent results of in situ x-ray diffraction of carbon at the Linac Coherent Light Souce (LCLS) free electron laser.

  16. The effect of patient death on medical students in the emergency department.

    PubMed

    Batley, Nicholas J; Bakhti, Rinad; Chami, Ali; Jabbour, Elsy; Bachir, Rana; El Khuri, Christopher; Mufarrij, Afif J

    2017-07-10

    The emotional consequences of patient deaths on physicians have been studied in a variety of medical settings. Reactions to patient death include distress, guilt, and grief. Comparatively, there are few studies on the effects of patient death on physicians and residents in the Emergency Department (ED). The ED setting is considered unique for having more sudden deaths that likely include the young and previously healthy and expectations for the clinician to return to a dynamic work environment. To date, no studies have looked at the effects of patient deaths on the more vulnerable population of medical students in the ED. This study examined aspects of patient deaths in the ED that most strongly influence students' reactions while comparing it to those of an inpatient setting. Semi-structured qualitative interviews were carried out with a total of 16 medical students from the American University of Beirut, Medical Center in Lebanon who had recently encountered a patient death in the ED. Questions included their reaction to the death, interaction with patients and their family members, the response of the medical team, and coping mechanisms adopted. The analysis revealed the following as determinant factors of student reaction to patient death: context of death; including age of patient, expectation of death, first death experience, relating patient death to personal deaths, and extent of interaction with patient and family members. Importantly, deaths in an inpatient setting were judged as more impactful than ED deaths. ED deaths, however, were especially powerful when a trauma case was deemed physically disturbing and cases in which family reactions were emotionally moving. The study demonstrates that students' emotional reactions differ as a function of the setting (surprise and shock in the ED versus sadness and grief in an inpatient setting). Debriefing and counseling sessions on ED deaths may benefit from this distinction.

  17. Cross-Domain Effects of Achievement Goals: Social Costs and Benefits

    ERIC Educational Resources Information Center

    Barrera, Andrea Eugenia; Schuster, Beate

    2018-01-01

    In this research, we examined cross-domain effects of achievement goals. In two experimental studies, we manipulated achievement goals and assessed social reactions towards a hypothetical (study 1) and a real (study 2) target. Measurement of social reactions included prosocial behaviours such as helping, sharing and cooperating with others.…

  18. Reactions of Solvated Ions Final Report

    DOE R&D Accomplishments Database

    Taube, H.

    1962-09-24

    Brief summaries are presented on isotopic dilution studies on salts dissolved in CH{sub 3}OH, studies on metal and metal salts in solvents of the amine type, and studies on phosphato complexes of the pentammine Co(III) series. A list of papers published on reactions of solvated ions is included. (N.W.R.)

  19. A laser flash photolysis kinetics study of the reaction OH + H2O2 yields HO2 + H2O

    NASA Technical Reports Server (NTRS)

    Wine, P. H.; Semmes, D. H.; Ravishankara, A. R.

    1981-01-01

    Absolute rate constants for the reaction are reported as a function of temperature over the range 273-410 K. OH radicals are produced by 266 nm laser photolysis of H2O2 and detected by resonance fluorescence. H2O2 concentrations are determined in situ in the slow flow system by UV photometry. The results confirm the findings of two recent discharge flow-resonance fluorescence studies that the title reaction is considerably faster, particularly at temperatures below 300 K, than all earlier studies had indicated. A table giving kinetic data from the reaction is included.

  20. Acute hypersensitivity reactions associated with administration of crotalidae polyvalent immune Fab antivenom.

    PubMed

    Cannon, Robert; Ruha, Anne-Michelle; Kashani, John

    2008-04-01

    Acute hypersensitivity reactions are well known to occur with the administration of the Antivenin (Crotalidae) Polyvalent (Wyeth Laboratories, Marietta, PA). Crotalidae polyvalent immune Fab (ovine) (CroFab; FabAV, Protherics, Inc., Brentwood, TN) was introduced in 2001, and early studies reported a hypersensitivity reaction rate up to 19%. We describe the incidence of acute hypersensitivity reactions to FabAV in patients bitten by rattlesnakes. This was a nonconcurrent observational cohort study, with data obtained by chart review of all patients admitted to our service for rattlesnake bites from July 2000 to June 2004. The study was conducted at an urban Level I trauma center and urban children's hospital. All patients treated with FabAV were included. Those who received no antivenom or who were treated with Antivenin (Crotalidae) Polyvalent were excluded. The main outcome variable was whether an acute hypersensitivity reaction developed. Ninety-three patients were included in the review (72 male and 21 female patients). The mean age was 34.5 years (range 16 months to 91 years), and the mean dose of antivenom was 12 vials (range 4 to 32 vials). The incidence of acute hypersensitivity reactions was 5 of 93, or 5.4%. Four patients developed a mild reaction that was easily treated and were able to finish the full course of antivenom. Only 1 patient developed a reaction that prevented further antivenom administration. FabAV appears to be associated with a lower incidence of acute hypersensitivity than initially reported. Most reactions are mild and easily treated and do not preclude further dosing of antivenom.

  1. An algorithm for treatment of patients with hypersensitivity reactions after vaccines.

    PubMed

    Wood, Robert A; Berger, Melvin; Dreskin, Stephen C; Setse, Rosanna; Engler, Renata J M; Dekker, Cornelia L; Halsey, Neal A

    2008-09-01

    Concerns about possible allergic reactions to immunizations are raised frequently by both patients/parents and primary care providers. Estimates of true allergic, or immediate hypersensitivity, reactions to routine vaccines range from 1 per 50000 doses for diphtheria-tetanus-pertussis to approximately 1 per 500000 to 1000000 doses for most other vaccines. In a large study from New Zealand, data were collected during a 5-year period on 15 marketed vaccines and revealed an estimated rate of 1 immediate hypersensitivity reaction per 450000 doses of vaccine administered. Another large study, conducted within the Vaccine Safety Datalink, described a range of reaction rates to >7.5 million doses. Depending on the study design and the time after the immunization event, reaction rates varied from 0.65 cases per million doses to 1.53 cases per million doses when additional allergy codes were included. For some vaccines, particularly when allergens such as gelatin are part of the formulation (eg, Japanese encephalitis), higher rates of serious allergic reactions may occur. Although these per-dose estimates suggest that true hypersensitivity reactions are quite rare, the large number of doses that are administered, especially for the commonly used vaccines, makes this a relatively common clinical problem. In this review, we present background information on vaccine hypersensitivity, followed by a detailed algorithm that provides a rational and organized approach for the evaluation and treatment of patients with suspected hypersensitivity. We then include 3 cases of suspected allergic reactions to vaccines that have been referred to the Clinical Immunization Safety Assessment network to demonstrate the practical application of the algorithm.

  2. Reactor cell assembly for use in spectroscopy and microscopy applications

    DOEpatents

    Grindstaff, Quirinus; Stowe, Ashley Clinton; Smyrl, Norm; Powell, Louis; McLane, Sam

    2015-08-04

    The present disclosure provides a reactor cell assembly that utilizes a novel design and that is wholly or partially manufactured from Aluminum, such that reactions involving Hydrogen, for example, including solid-gas reactions and thermal decomposition reactions, are not affected by any degree of Hydrogen outgassing. This reactor cell assembly can be utilized in a wide range of optical and laser spectroscopy applications, as well as optical microscopy applications, including high-temperature and high-pressure applications. The result is that the elucidation of the role of Hydrogen in the reactions studied can be achieved. Various window assemblies can be utilized, such that high temperatures and high pressures can be accommodated and the signals obtained can be optimized.

  3. Emotional Reactions of Students in Field Education: An Exploratory Study

    ERIC Educational Resources Information Center

    Litvack, Andrea; Mishna, Faye; Bogo, Marion

    2010-01-01

    An exploratory study using qualitative methodology was undertaken with recent MSW graduates (N=12) from 2 graduate social work programs to identify and describe the students' emotional reactions to experiences in field education. Significant and interrelated themes emerged including the subjective and unique definitions of emotionally charged…

  4. Impact of supersonic and subsonic aircraft on ozone: Including heterogeneous chemical reaction mechanisms

    NASA Technical Reports Server (NTRS)

    Kinnison, Douglas E.; Wuebbles, Donald J.

    1994-01-01

    Preliminary calculations suggest that heterogeneous reactions are important in calculating the impact on ozone from emissions of trace gases from aircraft fleets. In this study, three heterogeneous chemical processes that occur on background sulfuric acid aerosols are included and their effects on O3, NO(x), Cl(x), HCl, N2O5, ClONO2 are calculated.

  5. Calibration of Complex Subsurface Reaction Models Using a Surrogate-Model Approach

    EPA Science Inventory

    Application of model assessment techniques to complex subsurface reaction models involves numerous difficulties, including non-trivial model selection, parameter non-uniqueness, and excessive computational burden. To overcome these difficulties, this study introduces SAMM (Simult...

  6. Ab Initio Studies of Shock-Induced Chemical Reactions of Inter-Metallics

    NASA Astrophysics Data System (ADS)

    Zaharieva, Roussislava; Hanagud, Sathya

    2009-06-01

    Shock-induced and shock assisted chemical reactions of intermetallic mixtures are studied by many researchers, using both experimental and theoretical techniques. The theoretical studies are primarily at continuum scales. The model frameworks include mixture theories and meso-scale models of grains of porous mixtures. The reaction models vary from equilibrium thermodynamic model to several non-equilibrium thermodynamic models. The shock-effects are primarily studied using appropriate conservation equations and numerical techniques to integrate the equations. All these models require material constants from experiments and estimates of transition states. Thus, the objective of this paper is to present studies based on ab initio techniques. The ab inito studies, to date, use ab inito molecular dynamics. This paper presents a study that uses shock pressures, and associated temperatures as starting variables. Then intermetallic mixtures are modeled as slabs. The required shock stresses are created by straining the lattice. Then, ab initio binding energy calculations are used to examine the stability of the reactions. Binding energies are obtained for different strain components super imposed on uniform compression and finite temperatures. Then, vibrational frequencies and nudge elastic band techniques are used to study reactivity and transition states. Examples include Ni and Al.

  7. Kinetics Analysis of Synthesis Reaction of Struvite With Air-Flow Continous Vertical Reactors

    NASA Astrophysics Data System (ADS)

    Edahwati, L.; Sutiyono, S.; Muryanto, S.; Jamari, J.; Bayuseno, dan A. P.

    2018-01-01

    Kinetics reaction is a knowledge about a rate of chemical reaction. The differential of the reaction rate can be determined from the reactant material or the formed material. The reaction mechanism of a reactor may include a stage of reaction occurring sequentially during the process of converting the reactants into products. In the determination of reaction kinetics, the order of reaction and the rate constant reaction must be recognized. This study was carried out using air as a stirrer as a medium in the vertical reactor for crystallization of struvite. Stirring is one of the important aspects in struvite crystallization process. Struvite crystals or magnesium ammonium phosphate hexahydrates (MgNH4PO4·6H2O) is commonly formed in reversible reactions and can be generated as an orthorhombic crystal. Air is selected as a stirrer on the existing flow pattern in the reactor determining the reaction kinetics of the crystal from the solution. The experimental study was conducted by mixing an equimolar solution of 0.03 M NH4OH, MgCl2 and H3PO4 with a ratio of 1: 1: 1. The crystallization process of the mixed solution was observed in an inside reactor at the flow rate ranges of 16-38 ml/min and the temperature of 30°C was selected in the study. The air inlet rate was kept constant at 0.25 liters/min. The pH solution was adjusted to be 8, 9 and 10 by dropping wisely of 1 N KOH solution. The crystallization kinetics was examined until the steady state of the reaction was reached. The precipitates were filtered and dried at a temperature for subsequent material characterization, including Scanning Electron Microscope (SEM) and XRD (X-Ray diffraction) method. The results show that higher flow rate leads to less mass of struvite.

  8. Ginger for Prevention of Antituberculosis-induced Gastrointestinal Adverse Reactions Including Hepatotoxicity: A Randomized Pilot Clinical Trial.

    PubMed

    Emrani, Zahra; Shojaei, Esphandiar; Khalili, Hossein

    2016-06-01

    In this study, the potential benefits of ginger in preventing antituberculosis drug-induced gastrointestinal adverse reactions including hepatotoxicity have been evaluated in patients with tuberculosis. Patients in the ginger and placebo groups (30 patients in each group) received either 500 mg ginger (Zintoma)(®) or placebo one-half hour before each daily dose of antituberculosis drugs for 4 weeks. Patients' gastrointestinal complaints (nausea, vomiting, dyspepsia, and abdominal pain) and antituberculosis drug-induced hepatotoxicity were recorded during the study period. In this cohort, nausea was the most common antituberculosis drug-induced gastrointestinal adverse reactions. Forty eight (80%) patients experienced nausea. Nausea was more common in the placebo than the ginger group [27 (90%) vs 21 (70%), respectively, p = 0.05]. During the study period, 16 (26.7%) patients experienced antituberculosis drug-induced hepatotoxicity. Patients in the ginger group experienced less, but not statistically significant, antituberculosis drug-induced hepatotoxicity than the placebo group (16.7% vs 36.7%, respectively, p = 0.07). In conclusion, ginger may be a potential option for prevention of antituberculosis drug-induced gastrointestinal adverse reactions including hepatotoxicity. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Time-Resolved and Operando XAS Studies on Heterogeneous Catalysts - From the Gas Phase Towards Reactions in Supercritical Fluids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grunwaldt, Jan-Dierk; Baiker, Alfons

    2007-02-02

    x-ray absorption spectroscopy is a well-suited technique to uncover the structure of heterogeneous catalysts under reaction conditions. Different aspects of in situ cell design suitable for dynamic and catalytic studies are discussed. In addition, criteria are presented that allow estimating the influence external and internal mass transfer. Starting with studies on gas-solid reactions, including structure-activity relationships, this concept is extended to liquid-solid reactions, reactions at high pressure and in supercritical fluids. The following examples are discussed in more detail: partial oxidation of methane over Pt-Rh/Al2O3, reduction of a Cu/ZnO catalyst, alcohol oxidation over Bi-promoted Pd/Al2O3 in liquid phase and overmore » Pd/Al2O3 in supercritical CO2, and batch reactions (e.g. CO2-fixation over zinc-based catalysts)« less

  10. Hypersensitive Reaction to Tattoos: A Growing Menace in Rural India

    PubMed Central

    Shashikumar, B M; Harish, M R; Shwetha, B; Kavya, M; Deepadarshan, K; Phani, H N

    2017-01-01

    Background: Increased enthusiasm toward newer fashion trends among rural India along with the lack of government regulation has led to increased tattoo reactions. Objective: The objective of this study is to describe various clinical manifestations of hypersensitive reactions to tattoo ink reported at a tertiary care hospital in Mandya district. Materials and Methods: An observational study was carried out over a period of 1 year from June 2014 to May 2015 at Mandya Institute of Medical Sciences, Mandya. All the patients reporting with allergic reaction due to tattooing were included in the present study after obtaining informed consent. Transient acute inflammatory reaction, infections, and skin diseases localized on tattooed area were excluded from this study. A detailed history regarding the onset, duration and color used for tattooing were collected. Cutaneous examination and biopsy was to done to know the type of reaction. Results: Fifty cutaneous allergic reactions were diagnosed among 39 patients. Mean age of subjects was 22 years and mean duration before the appearance of lesion was 7 months. Common colors associated with reactions were red (53.9%), black (33.3%), green (5.1%), and multicolor (7.7%). Itching was the predominant symptom. Skin lesions mainly consisted of lichenoid papules and plaques, eczematous lesions, and verrucous lesions. Lichenoid histopathology reaction was the most common tissue allergic reaction. Conclusion: Increasing popularity of tattooing among young people has predisposed to parallel increase in adverse reactions. Red pigment is most common cause of allergic reaction in the present study, and lichenoid reaction is the most common reaction. PMID:28584372

  11. Gas-Phase Formation Rates of Nitric Acid and Its Isomers Under Urban Conditions

    NASA Technical Reports Server (NTRS)

    Okumura, M.; Mollner, A. K.; Fry, J. L.; Feng, L.

    2005-01-01

    Ozone formation in urban smog is controlled by a complex set of reactions which includes radical production from photochemical processes, catalytic cycles which convert NO to NO2, and termination steps that tie up reactive intermediates in long-lived reservoirs. The reaction OH + NO2 + M -4 HONO2 + M (la) is a key termination step because it transforms two short-lived reactive intermediates, OH and NO2, into relatively long-lived nitric acid. Under certain conditions (low VOC/NOx), ozone production in polluted urban airsheds can be highly sensitive to this reaction, but the rate parameters are not well constrained. This report summarizes the results of new laboratory studies of the OH + NO2 + M reaction including direct determination of the overall rate constant and branching ratio for the two reaction channels under atmospherically relevant conditions.

  12. Role of core excitation in (d ,p ) transfer reactions

    NASA Astrophysics Data System (ADS)

    Deltuva, A.; Ross, A.; Norvaišas, E.; Nunes, F. M.

    2016-10-01

    Background: Recent work found that core excitations can be important in extracting structure information from (d ,p ) reactions. Purpose: Our objective is to systematically explore the role of core excitation in (d ,p ) reactions and to understand the origin of the dynamical effects. Method: Based on the particle-rotor model of n +10Be , we generate a number of models with a range of separation energies (Sn=0.1 -5.0 MeV), while maintaining a significant core excited component. We then apply the latest extension of the momentum-space-based Faddeev method, including dynamical core excitation in the reaction mechanism to all orders, to the 10Be(d ,p )11Be -like reactions, and study the excitation effects for beam energies Ed=15 -90 MeV. Results: We study the resulting angular distributions and the differences between the spectroscopic factor that would be extracted from the cross sections, when including dynamical core excitation in the reaction, and that of the original structure model. We also explore how different partial waves affect the final cross section. Conclusions: Our results show a strong beam-energy dependence of the extracted spectroscopic factors that become smaller for intermediate beam energies. This dependence increases for loosely bound systems.

  13. [Hypersensitivity to mosquito bite manifested as Skeeter síndrome].

    PubMed

    Pérez-Vanzzini, Rafael; González-Díaz, Sandra Nora; Arias-Cruz, Alfredo; Palma-Gómez, Samuel; Yong-Rodríguez, Adrián; Gutiérrez-Mujica, José Julio; García-Calderín, Diego; Ibarra, Jesús Arturo

    2015-01-01

    The reactions to mosquito bites are immunological reactions with involvement of IgE, IgG and T cells mediated hypersensitivity. These reactions are common and range from small local reactions, large local reactions to systemic allergic reactions. Skeeter syndrome is defined as a large local induced inflammatory reaction to mosquito bite and sometimes accompanied by systemic symptoms such as fever and vomiting. Diagnosis is based on clinical history and physical examination, supported by the identification of specific IgE by skin testing. Treatment includes prevention, antihistamines and steroids in some cases. Specific immunotherapy still requires further study. This paper reports two cases of patients with hypersensitivity reactions to mosquito bites, which were evaluated in our center presenting positive skin tests.

  14. Typewriting rate as a function of reaction time.

    PubMed

    Hayes, V; Wilson, G D; Schafer, R L

    1977-12-01

    This study was designed to determine the relationship between reaction time and typewriting rate. Subjects were 24 typists ranging in age from 19 to 39 yr. Reaction times (.001 sec) to a light were recorded for each finger and to each alphabetic character and three punctuation marks. Analysis of variance yielded significant differences in reaction time among subjects and fingers. Correlation between typewriting rate and average reaction time to the alphabetic characters and three punctuation marks was --.75. Correlation between typewriting rate and the difference between the reaction time of the hands was --.42. Factors influencing typewriting rate may include reaction time of the fingers, difference between the reaction time of the hands, and reaction time to individual keys on the typewriter. Implications exist for instructional methodology and further research.

  15. Minimum reaction network necessary to describe Ar/CF4 plasma etch

    NASA Astrophysics Data System (ADS)

    Helpert, Sofia; Chopra, Meghali; Bonnecaze, Roger T.

    2018-03-01

    Predicting the etch and deposition profiles created using plasma processes is challenging due to the complexity of plasma discharges and plasma-surface interactions. Volume-averaged global models allow for efficient prediction of important processing parameters and provide a means to quickly determine the effect of a variety of process inputs on the plasma discharge. However, global models are limited based on simplifying assumptions to describe the chemical reaction network. Here a database of 128 reactions is compiled and their corresponding rate constants collected from 24 sources for an Ar/CF4 plasma using the platform RODEo (Recipe Optimization for Deposition and Etching). Six different reaction sets were tested which employed anywhere from 12 to all 128 reactions to evaluate the impact of the reaction database on particle species densities and electron temperature. Because many the reactions used in our database had conflicting rate constants as reported in literature, we also present a method to deal with those uncertainties when constructing the model which includes weighting each reaction rate and filtering outliers. By analyzing the link between a reaction's rate constant and its impact on the predicted plasma densities and electron temperatures, we determine the conditions at which a reaction is deemed necessary to the plasma model. The results of this study provide a foundation for determining which minimal set of reactions must be included in the reaction set of the plasma model.

  16. Prevalence and factors associated to peanut allergy in Mexican school children.

    PubMed

    Bedolla-Barajas, M; Valdez-López, F; Alcalá-Padilla, G; Bedolla-Pulido, T I; Rivera-Mejia, V; Morales-Romero, J

    In our country, the prevalence and the factors associated to peanut allergy are unknown, a health problem that has been emerging worldwide. To establish the prevalence and the factors that are associated to peanut allergy amongst school children. This is a population-based cross-sectional study. We included 756 children aged 6-7 years. The children's parents were questioned about their peanut intake habits. A structured questionnaire was applied, it included questions regarding peanut intake; family and personal history of asthma; rhinitis; and atopic dermatitis. Allergic reactions to peanuts were registered as: probable, convincing and systematic. The statistical analyses included logistical regression models to look for associated factors. Males were 356/756 (47.1%). Peanut allergy prevalence: probable reaction: 14/756 (1.8%), convincing reaction: 8/756 (1.1%) and systemic reaction: 3/756 (0.4%). Through multivariate analysis, the presence of symptoms of allergic rhinitis (OR=4.2 95% CI 1.3-13.2) and atopic dermatitis (OR=5.2; 95% CI 1.4-19.5) during the previous year, showed significant association to probable peanut reaction. The former year, the presence of atopic dermatitis was the only variable that was substantially associated to a convincing reaction (OR=7.5; 95% CI 1.4-38.4) and to a systematic reaction (OR=45.1; 95% CI 4.0-510.0), respectively. The reported prevalence of peanut allergy was consistent with that found in previous studies; symptoms of allergic rhinitis and atopic dermatitis were identified as associated factors to peanut allergy. Copyright © 2016 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

  17. A systematic review of validated methods for identifying hypersensitivity reactions other than anaphylaxis (fever, rash, and lymphadenopathy), using administrative and claims data.

    PubMed

    Schneider, Gary; Kachroo, Sumesh; Jones, Natalie; Crean, Sheila; Rotella, Philip; Avetisyan, Ruzan; Reynolds, Matthew W

    2012-01-01

    The Food and Drug Administration's Mini-Sentinel pilot program aims to conduct active surveillance to refine safety signals that emerge for marketed medical products. A key facet of this surveillance is to develop and understand the validity of algorithms for identifying health outcomes of interest from administrative and claims data. This article summarizes the process and findings of the algorithm review of hypersensitivity reactions. PubMed and Iowa Drug Information Service searches were conducted to identify citations applicable to the hypersensitivity reactions of health outcomes of interest. Level 1 abstract reviews and Level 2 full-text reviews were conducted to find articles using administrative and claims data to identify hypersensitivity reactions and including validation estimates of the coding algorithms. We identified five studies that provided validated hypersensitivity-reaction algorithms. Algorithm positive predictive values (PPVs) for various definitions of hypersensitivity reactions ranged from 3% to 95%. PPVs were high (i.e. 90%-95%) when both exposures and diagnoses were very specific. PPV generally decreased when the definition of hypersensitivity was expanded, except in one study that used data mining methodology for algorithm development. The ability of coding algorithms to identify hypersensitivity reactions varied, with decreasing performance occurring with expanded outcome definitions. This examination of hypersensitivity-reaction coding algorithms provides an example of surveillance bias resulting from outcome definitions that include mild cases. Data mining may provide tools for algorithm development for hypersensitivity and other health outcomes. Research needs to be conducted on designing validation studies to test hypersensitivity-reaction algorithms and estimating their predictive power, sensitivity, and specificity. Copyright © 2012 John Wiley & Sons, Ltd.

  18. Spectroscopic Study of L Hypernuclei with Electron Beams at Jefferson Lab

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Satoshi; Gogami, Toshiyuki; Tang, Liguang

    The missing mass spectroscopy of L hypernuclei with the (e, e'K^+) reaction was started from 2000 at Jefferson Lab. In this fifteen years, various hypernuclei (A = 7 - 52) including hyperon (L, S^0) productions have been studied with newly developed experimental techniques. The (e, e'K^+) reaction spectroscopy of L hypernuclei features its capability of absolute missing mass calibration and production of new species of hypernuclei which are the isospin partners of well studied hypernuclei by (K^-, pi-) and (pi^+, K^+) reactions. In this paper, we will review how we established the (e, e'K^+) spectroscopic study of hypernuclei.

  19. Contributions to the NUCLEI SciDAC-3 Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bogner, Scott; Nazarewicz, Witek

    This is the Final Report for Michigan State University for the NUCLEI SciDAC-3 project. The NUCLEI project, as defined by the scope of work, has developed, implemented and run codes for large-scale computations of many topics in low-energy nuclear physics. Physics studied included the properties of nuclei and nuclear decays, nuclear structure and reactions, and the properties of nuclear matter. The computational techniques used included Configuration Interaction, Coupled Cluster, and Density Functional methods. The research program emphasized areas of high interest to current and possible future DOE nuclear physics facilities, including ATLAS at ANL and FRIB at MSU (nuclear structuremore » and reactions, and nuclear astrophysics), TJNAF (neutron distributions in nuclei, few body systems, and electroweak processes), NIF (thermonuclear reactions), MAJORANA and FNPB (neutrinoless double-beta decay and physics beyond the Standard Model), and LANSCE (fission studies).« less

  20. Nuclear Computational Low Energy Initiative (NUCLEI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reddy, Sanjay K.

    This is the final report for University of Washington for the NUCLEI SciDAC-3. The NUCLEI -project, as defined by the scope of work, will develop, implement and run codes for large-scale computations of many topics in low-energy nuclear physics. Physics to be studied include the properties of nuclei and nuclear decays, nuclear structure and reactions, and the properties of nuclear matter. The computational techniques to be used include Quantum Monte Carlo, Configuration Interaction, Coupled Cluster, and Density Functional methods. The research program will emphasize areas of high interest to current and possible future DOE nuclear physics facilities, including ATLAS andmore » FRIB (nuclear structure and reactions, and nuclear astrophysics), TJNAF (neutron distributions in nuclei, few body systems, and electroweak processes), NIF (thermonuclear reactions), MAJORANA and FNPB (neutrino-less double-beta decay and physics beyond the Standard Model), and LANSCE (fission studies).« less

  1. Common allergies do not influence the prevalence of cutaneous hypersensitivity reactions to antiepileptic drugs.

    PubMed

    Bosak, Magdalena; Porębski, Grzegorz; Słowik, Agnieszka; Turaj, Wojciech

    2017-09-01

    The aim of the study was to establish whether the presence of common allergies increases the risk of drug-related hypersensitivity reactions among patients with epilepsy treated with antiepileptic drugs (AEDs). We studied 753 patients with epilepsy seen in tertiary outpatient epilepsy clinic. We obtained data related to epilepsy type, past and ongoing treatment with AEDs, occurrence of maculopapular exanthema or more serious cutaneous adverse reactions (Stevens-Johnson syndrome - SJS) and their characteristics. We noted an occurrence of allergic reactions unrelated to treatment with AED, including rash unrelated to AED, bronchial asthma, persistent or seasonal allergic rhinitis, atopic dermatitis, rash after specific food and other allergic reactions. There were 61 cases of AED-related cutaneous hypersensitivity reaction (including 3 cases of SJS) noted in association with 2319 exposures to AEDs (2.63%) among 55 out of 753 patients (7.3%). Cutaneous hypersensitivity reaction to AED was most commonly noted after lamotrigine (12.1%), carbamazepine (5.4%) and oxcarbazepine (4.1%). Prevalence of allergic reactions unrelated to AED was similar between patients with and without AED-related cutaneous hypersensitivity reaction (rash unrelated to AED: 16.4% vs. 10.2%; bronchial asthma: 1.8% vs. 0.1%; persistent allergic rhinitis: 7.3% vs. 10.2%; seasonal allergic rhinitis: 7.3% vs. 11.7%; atopic dermatitis: 0 vs. 0.7%; rash after specific food: 5.4% vs. 6.4%; other allergic reactions: 5.4% vs. 5.2%, respectively; P>0.1 for each difference). Presence of common allergies is not a significant risk factor for AED-related cutaneous hypersensitivity reaction among patients with epilepsy. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Hypersensitivity reactions to non-steroidal anti-inflammatory drugs.

    PubMed

    Cornejo-Garcia, José Antonio; Blanca-López, Natalia; Doña, Inmaculada; Andreu, Inmaculada; Agúndez, José A G; Carballo, Miguel; Blanca, Miguel; Canto, María Gabriela

    2009-11-01

    NSAIDs are the most important group of drugs involved in hypersensitivity drug reactions, and include heterogeneous compounds with very different chemical structures. These reactions can be IgE dependent (immediate reactions), T cell-mediated (non-immediate), or induced by a non-specific immunological mechanism related with the blocking of the COX-1 enzyme and the shunting to the lipooxygenase pathway (cross-intolerant reactions). Cutaneous symptoms are the most frequent, with ibuprofen, naproxen and diclofenac being common culprit drugs worldwide, although others can be involved because patterns of consumption and exposure rates vary between countries. A very important proportion of immunological reactions are immediate, with urticaria and anaphylaxis being the typical clinical manifestations. Non-immediate reactions comprise a number of heterogeneous entities ranging from mild exanthema to severe TEN or DRESS syndrome, as well as organ-specific reactions such as hepatitis or pneumonitis. Cross-intolerant reactions appear to non-chemically related drugs, and involve respiratory airways, skin or both. In vivo diagnostic tests are based on the capacity of the skin to respond to the culprit drug, but their sensitivity is in many instances rather low. The approach for in vitro testing consists of either detecting specific IgE antibodies or studying the proliferation of T lymphocytes toward the eliciting drug. No appropriate tests are yet available for the in vitro validation of cross-intolerance reactions, although techniques based on the stimulation of basophils have been proposed. Based on these findings, the diagnostic approach is often based on the controlled administration of the drug to assess tolerance. In this work we review current knowledge on hypersensitivity reactions to NSAIDs, including diagnostic approach and genetic studies.

  3. Complement activation in leprosy: a retrospective study shows elevated circulating terminal complement complex in reactional leprosy.

    PubMed

    Bahia El Idrissi, N; Hakobyan, S; Ramaglia, V; Geluk, A; Morgan, B Paul; Das, P Kumar; Baas, F

    2016-06-01

    Mycobacterium leprae infection gives rise to the immunologically and histopathologically classified spectrum of leprosy. At present, several tools for the stratification of patients are based on acquired immunity markers. However, the role of innate immunity, particularly the complement system, is largely unexplored. The present retrospective study was undertaken to explore whether the systemic levels of complement activation components and regulators can stratify leprosy patients, particularly in reference to the reactional state of the disease. Serum samples from two cohorts were analysed. The cohort from Bangladesh included multi-bacillary (MB) patients with (n = 12) or without (n = 46) reaction (R) at intake and endemic controls (n = 20). The cohort from Ethiopia included pauci-bacillary (PB) (n = 7) and MB (n = 23) patients without reaction and MB (n = 15) patients with reaction. The results showed that the activation products terminal complement complex (TCC) (P ≤ 0·01), C4d (P ≤ 0·05) and iC3b (P ≤ 0·05) were specifically elevated in Bangladeshi patients with reaction at intake compared to endemic controls. In addition, levels of the regulator clusterin (P ≤ 0·001 without R; P < 0·05 with R) were also elevated in MB patients, irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that, irrespective of a reaction, serum TCC levels were increased significantly in patients with reactions compared to patients without reactions (P ≤ 0·05). Our findings suggests that serum TCC levels may prove to be a valuable tool in diagnosing patients at risk of developing reactions. © 2016 British Society for Immunology.

  4. Rapid neutral-neutral reactions at low temperatures: a new network and first results for TMC-1

    NASA Astrophysics Data System (ADS)

    Smith, Ian W. M.; Herbst, Eric; Chang, Qiang

    2004-05-01

    There is now ample evidence from an assortment of experiments, especially those involving the CRESU (Cinétique de Réaction en Ecoulement Supersonique Uniforme) technique, that a variety of neutral-neutral reactions possess no activation energy barrier and are quite rapid at very low temperatures. These reactions include both radical-radical systems and, more surprisingly, systems involving an atom or a radical and one `stable' species. Generalizing from the small but growing number of systems studied in the laboratory, we estimate reaction rate coefficients for a larger number of such reactions and include these estimates in a new network of gas-phase reactions for use in low-temperature interstellar chemistry. Designated osu.2003, the new network is available on the World Wide Web and will be continually updated. A table of new results for molecular abundances in the dark cloud TMC-1 (CP) is provided and compared with results from an older (new standard model; nsm) network.

  5. Effects of operational conditions on sludge degradation and organic acids formation in low-critical wet air oxidation.

    PubMed

    Chung, Jinwook; Lee, Mikyung; Ahn, Jaehwan; Bae, Wookeun; Lee, Yong-Woo; Shim, Hojae

    2009-02-15

    Wet air oxidation processes are to treat highly concentrated organic compounds including refractory materials, sludge, and night soil, and usually operated at supercritical water conditions of high temperature and pressure. In this study, the effects of operational conditions including temperature, pressure, and oxidant dose on sludge degradation and conversion into subsequent intermediates such as organic acids were investigated at low critical wet oxidation conditions. The reaction time and temperature in the wet air oxidation process was shown an important factor affecting the liquefaction of volatile solids, with more significant effect on the thermal hydrolysis reaction rather than the oxidation reaction. The degradation efficiency of sludge and the formation of organic acids were improved with longer reaction time and higher reaction temperature. For the sludge reduction and the organic acids formation under the wet air oxidation, the optimal conditions for reaction temperature, time, pressure, and oxidant dose were shown approximately 240 degrees C, 30min, 60atm, and 2.0L/min, respectively.

  6. How alkyl halide structure affects E2 and SN2 reaction barriers: E2 reactions are as sensitive as SN2 reactions.

    PubMed

    Rablen, Paul R; McLarney, Brett D; Karlow, Brandon J; Schneider, Jean E

    2014-02-07

    High-level electronic structure calculations, including a continuum treatment of solvent, are employed to elucidate and quantify the effects of alkyl halide structure on the barriers of SN2 and E2 reactions. In cases where such comparisons are available, the results of these calculations show close agreement with solution experimental data. Structural factors investigated include α- and β-methylation, adjacency to unsaturated functionality (allyl, benzyl, propargyl, α to carbonyl), ring size, and α-halogenation and cyanation. While the influence of these factors on SN2 reactivity is mostly well-known, the present study attempts to provide a broad comparison of both SN2 and E2 reactivity across many cases using a single methodology, so as to quantify relative reactivity trends. Despite the fact that most organic chemistry textbooks say far more about how structure affects SN2 reactions than about how it affects E2 reactions, the latter are just as sensitive to structural variation as are the former. This sensitivity of E2 reactions to structure is often underappreciated.

  7. [Adverse reactions to mosquito bites in scholars from Monterrey, Nuevo Leon, Mexico].

    PubMed

    Manrique López, María Amelia; González Díaz, Sandra N; Arias Cruz, Alfredo; Sedó Mejía, Giovanni A; Canseco Villarreal, José Ignacio; Gómez Retamoza, Ernesto Antonio; Padrón López, Olga Magdalena; Cruz Moreno, Miguel Angel; Cisneros Salazar, Guillermo Daniel

    2010-01-01

    Allergic reactions to insect bites are a global problem, the true incidence and prevalence of morbidity from adverse reactions to mosquito bites are unknown. To describe the adverse reactions to mosquito bites in school-age children of Monterrey, Nuevo Leon. A cross-sectional descriptive study was made via a randomized application of questionnaires to children from public elementary schools in the metropolitan area of Monterrey, Nuevo Leon. A total of 11 public schools randomly selected were included in the study. One thousand questionnaires were submitted, of which 506 fulfilled the inclusion criteria; 55% were females. Seventy-six percent referred adverse reactions to mosquito bites, itching (75%) and rash (72%) being the most frequent ones, in the last 12 months. Adverse reactions to mosquito bites occur frequently. Early detection is important to establish a prompt treatment.

  8. Development of the (d,n) Proton-transfer Reaction in Inverse Kinematics for Structure Studies

    NASA Astrophysics Data System (ADS)

    Jones, K. L.; Thornsberry, C.; Allen, J.; Atencio, A.; Bardayan, D. W.; Blankstein, D.; Burcher, S.; Carter, A. B.; Chipps, K. A.; Cizewski, J. A.; Cox, I.; Elledge, Z.; Febbraro, M.; Fijałkowska, A.; Grzywacz, R.; Hall, M. R.; King, T. T.; Lepailleur, A.; Madurga, M.; Marley, S. T.; O'Malley, P. D.; Paulauskas, S. V.; Pain, S. D.; Peters, W. A.; Reingold, C.; Smith, K.; Taylor, S.; Tan, W.; Vostinar, M.; Walter, D.

    Transfer reactions have provided exciting opportunities to study the structure of exotic nuclei and are often used to inform studies relating to nucleosynthesis and applications. In order to benefit from these reactions and their application to rare ion beams (RIBs) it is necessary to develop the tools and techniques to perform and analyze the data from reactions performed in inverse kinematics, that is with targets of light nuclei and heavier beams. We are continuing to expand the transfer reaction toolbox in preparation for the next generation of facilities, such as the Facility for Rare Ion Beams (FRIB), which is scheduled for completion in 2022. An important step in this process is to perform the (d,n) reaction in inverse kinematics, with analyses that include Q-value spectra and differential cross sections. In this way, proton-transfer reactions can be placed on the same level as the more commonly used neutron-transfer reactions, such as (d,p), (9Be,8Be), and (13C,12C). Here we present an overview of the techniques used in (d,p) and (d,n), and some recent data from (d,n) reactions in inverse kinematics using stable beams of 12C and 16O.

  9. Quantum chemical studies of a model for peptide bond formation. 3. Role of magnesium cation in formation of amide and water from ammonia and glycine

    NASA Technical Reports Server (NTRS)

    Oie, T.; Loew, G. H.; Burt, S. K.; MacElroy, R. D.

    1984-01-01

    The SN2 reaction between glycine and ammonia molecules with magnesium cation Mg2+ as a catalyst has been studied as a model reaction for Mg(2+)-catalyzed peptide bond formation using the ab initio Hartree-Fock molecular orbital method. As in previous studies of the uncatalyzed and amine-catalyzed reactions between glycine and ammonia, two reaction mechanisms have been examined, i.e., a two-step and a concerted reaction. The stationary points of each reaction including intermediate and transition states have been identified and free energies calculated for all geometry-optimized reaction species to determine the thermodynamics and kinetics of each reaction. Substantial decreases in free energies of activation were found for both reaction mechanisms in the Mg(2+)-catalyzed amide bond formation compared with those in the uncatalyzed and amine-catalyzed amide bond formation. The catalytic effect of the Mg2+ cation is to stabilize both the transition states and intermediate, and it is attributed to the neutralization of the developing negative charge on the electrophile and formation of a conformationally flexible nonplanar five-membered chelate ring structure.

  10. Spontaneously Reported Adverse Reactions for Herbal Medicinal Products and Natural Remedies in Sweden 2007-15: Report from the Medical Products Agency.

    PubMed

    Svedlund, Erika; Larsson, Maria; Hägerkvist, Robert

    2017-06-01

    In relation to the extensive use of herbal medicinal products in self-care, the safety information is limited and there is a need for improvement. This study describes spontaneously reported adverse reactions related to herbal medicinal products and natural remedies in Sweden. To evaluate the characteristics and frequency of adverse events recorded by the Swedish Medical Products Agency, where herbal medicinal products and natural remedies were suspected as causative agents. Adverse drug reactions reported to the Swedish Medical Product Agency during 2007-15 related to approved herbal medicinal products or natural remedies were included and analysed in the retrospective study. Reports had been assessed for causality when they were lodged and only reports that had been assessed as at least possible were included in the study. In total, 116 reports (concerning 259 adverse reactions) related to herbal medicinal products or natural remedies were found in the Swedish national pharmacovigilance database. The active ingredients most frequently suspected during the study period were black cohosh rhizome (15 reports), purple coneflower herb (14 reports) and a combination of extracts of pollen (13 reports). Adverse reactions related to skin and subcutaneous tissue were the most commonly reported reactions. No previously unknown safety problems have been discovered in the present study. This finding could be explained by a thorough pre-approval assessment of medicinal products and the fact that most herbal preparations in medicinal products have been in clinical use for many years (for traditional herbal medicinal products, the requirements are ≥30 years), i.e. adverse reactions are acknowledged and assessed before approval.

  11. Conditions for extinction events in chemical reaction networks with discrete state spaces.

    PubMed

    Johnston, Matthew D; Anderson, David F; Craciun, Gheorghe; Brijder, Robert

    2018-05-01

    We study chemical reaction networks with discrete state spaces and present sufficient conditions on the structure of the network that guarantee the system exhibits an extinction event. The conditions we derive involve creating a modified chemical reaction network called a domination-expanded reaction network and then checking properties of this network. Unlike previous results, our analysis allows algorithmic implementation via systems of equalities and inequalities and suggests sequences of reactions which may lead to extinction events. We apply the results to several networks including an EnvZ-OmpR signaling pathway in Escherichia coli.

  12. Computed potential energy surfaces for chemical reactions

    NASA Technical Reports Server (NTRS)

    Walch, Stephen P.

    1994-01-01

    Quantum mechanical methods have been used to compute potential energy surfaces for chemical reactions. The reactions studied were among those believed to be important to the NASP and HSR programs and included the recombination of two H atoms with several different third bodies; the reactions in the thermal Zeldovich mechanism; the reactions of H atom with O2, N2, and NO; reactions involved in the thermal De-NO(x) process; and the reaction of CH(squared Pi) with N2 (leading to 'prompt NO'). These potential energy surfaces have been used to compute reaction rate constants and rates of unimolecular decomposition. An additional application was the calculation of transport properties of gases using a semiclassical approximation (and in the case of interactions involving hydrogen inclusion of quantum mechanical effects).

  13. Computer-assisted study on the reaction between pyruvate and ylide in the pathway leading to lactyl-ThDP.

    PubMed

    Alvarado, Omar; Jaña, Gonzalo; Delgado, Eduardo J

    2012-08-01

    In this study the formation of the lactyl-thiamin diphosphate intermediate (L-ThDP) is addressed using density functional theory calculations at X3LYP/6-31++G(d,p) level of theory. The study includes potential energy surface scans, transition state search, and intrinsic reaction coordinate calculations. Reactivity is analyzed in terms of Fukui functions. The results allow to conclude that the reaction leading to the formation of L-ThDP occurs via a concerted mechanism, and during the nucleophilic attack on the pyruvate molecule, the ylide is in its AP form. The calculated activation barrier for the reaction is 19.2 kcal/mol, in agreement with the experimental reported value.

  14. Toward High-Level Theoretical Studies of Large Biodiesel Molecules: An ONIOM [QCISD(T)/CBS:DFT] Study of the Reactions between Unsaturated Methyl Esters (C nH2 n-1COOCH3) and Hydrogen Radical.

    PubMed

    Zhang, Lidong; Meng, Qinghui; Chi, Yicheng; Zhang, Peng

    2018-05-31

    A two-layer ONIOM[QCISD(T)/CBS:DFT] method was proposed for the high-level single-point energy calculations of large biodiesel molecules and was validated for the hydrogen abstraction reactions of unsaturated methyl esters that are important components of real biodiesel. The reactions under investigation include all the reactions on the potential energy surface of C n H 2 n-1 COOCH 3 ( n = 2-5, 17) + H, including the hydrogen abstraction, the hydrogen addition, the isomerization (intramolecular hydrogen shift), and the β-scission reactions. By virtue of the introduced concept of chemically active center, a unified specification of chemically active portion for the ONIOM (ONIOM = our own n-layered integrated molecular orbital and molecular mechanics) method was proposed to account for the additional influence of C═C double bond. The predicted energy barriers and heats of reaction by using the ONIOM method are in very good agreement with those obtained by using the widely accepted high-level QCISD(T)/CBS theory, as verified by the computational deviations being less than 0.15 kcal/mol, for almost all the reaction pathways under investigation. The method provides a computationally accurate and affordable approach to combustion chemists for high-level theoretical chemical kinetics of large biodiesel molecules.

  15. Perioperative Anaphylaxis Including Kounis Syndrome due to Selective Cefazolin Allergy.

    PubMed

    Mota, Inês; Gaspar, Ângela; Morais-Almeida, Mário

    2018-06-18

    Perioperative use of cefazolin has been associated with severe allergic reactions, and patients are usually labelled as allergic to penicillin afterwards. The aim of our study was to describe a group of patients with immediate reactions to cefazolin, with proven selective hypersensitivity reactions. Systematic review of all patients followed at our drug centre with cefazolin-related reactions, between January 2012 and December 2016. All patients were investigated according to the European Network for Drug Allergy (ENDA) recommendations through skin testing (major and minor penicillin determinants, penicillin, amoxicillin, cefazolin, cefuroxime and ceftriaxone) and oral challenges tests. We included 7 patients (median age 40 years) with perioperative anaphylactic reactions immediately after cefazolin injection, 4 with hypotension and 1 with Kounis syndrome (KS) type I. The presence of a selective IgE-mediated hypersensitivity through positive skin tests to cefazoline has been proven in all patients. Two patients experienced systemic reactions during skin testing. All patients were successfully challenged with amoxicillin, and they tolerated cefuroxime. Cefazolin can be responsible for immediate severe allergic reactions in perioperative setting, including KS. Allergological workup is essential for an accurate diagnosis and to explore cross-reactivity between cefazolin and other beta-lactams. Our experience confirmed that patients with IgE-mediated hypersensitivity reactions to cefazolin can tolerate other beta-lactams. This selective pattern of clinical reactivity may be explained by its particular chemical structure, whose R1 side-chain is different from other beta-lactams. © 2018 S. Karger AG, Basel.

  16. Extension of a Kinetic-Theory Approach for Computing Chemical-Reaction Rates to Reactions with Charged Particles

    NASA Technical Reports Server (NTRS)

    Liechty, Derek S.; Lewis, Mark J.

    2010-01-01

    Recently introduced molecular-level chemistry models that predict equilibrium and nonequilibrium reaction rates using only kinetic theory and fundamental molecular properties (i.e., no macroscopic reaction rate information) are extended to include reactions involving charged particles and electronic energy levels. The proposed extensions include ionization reactions, exothermic associative ionization reactions, endothermic and exothermic charge exchange reactions, and other exchange reactions involving ionized species. The extensions are shown to agree favorably with the measured Arrhenius rates for near-equilibrium conditions.

  17. Direct catalytic asymmetric aldol-Tishchenko reaction.

    PubMed

    Gnanadesikan, Vijay; Horiuchi, Yoshihiro; Ohshima, Takashi; Shibasaki, Masakatsu

    2004-06-30

    A direct catalytic asymmetric aldol reaction of propionate equivalent was achieved via the aldol-Tishchenko reaction. Coupling an irreversible Tishchenko reaction to a reversible aldol reaction overcame the retro-aldol reaction problem and thereby afforded the products in high enantio and diastereoselectivity using 10 mol % of the asymmetric catalyst. A variety of ketones and aldehydes, including propyl and butyl ketones, were coupled efficiently, yielding the corresponding aldol-Tishchenko products in up to 96% yield and 95% ee. Diastereoselectivity was generally below the detection limit of 1H NMR (>98:2). Preliminary studies performed to clarify the mechanism revealed that the aldol products were racemic with no diastereoselectivity. On the other hand, the Tishchenko products were obtained in a highly enantiocontrolled manner.

  18. On the Possibility of Studying the Reactions of the Thermal Decomposition of Energy Substances by the Methods of High-Resolution Terahertz Spectroscopy

    NASA Astrophysics Data System (ADS)

    Vaks, V. L.; Domracheva, E. G.; Chernyaeva, M. B.; Pripolzin, S. I.; Revin, L. S.; Tretyakov, I. V.; Anfertyev, V. A.; Yablokov, A. A.; Lukyanenko, I. A.; Sheikov, Yu. V.

    2018-02-01

    We show prospects for using the method of high-resolution terahertz spectroscopy for a continuous analysis of the decomposition products of energy substances in the gas phase (including short-lived ones) in a wide temperature range. The experimental setup, which includes a terahertz spectrometer for studying the thermal decomposition reactions, is described. The results of analysis of the gaseous decomposition products of energy substances by the example of ammonium nitrate heated from room temperature to 167°C are presented.

  19. [Evaluation of reporting quality of RCT on nephrotoxicity of Tripterygium wilfordii preparations according to CONSORT HARMs statement].

    PubMed

    Feng, Xue; Fang, Sai-Nan; Gao, Yu-Xin; Liu, Jian-Ping; Chen, Wei

    2018-02-01

    To evaluate the quality of randomized controlled trials(RCT) on nephrotoxicity of Tripterygium wilfordii preparations according to the CONSORT HARMs statement. The report quality of each included study was evaluated according to the CONSORT HARMs statement, and the number of entries that comply with CONSORT HARMs statement was calculated in each study to evaluate the report quality on nephrotoxicity-related adverse reactions of T. wilfordii preparations and summarize the problems in domestic studies on nephrotoxicity-related adverse reactions. A total of 16 RCTs were included, with an average of 7 entries complying with CONSORT HARMs statement per study. The report of the nephrotoxic-associated RCT of T. wilfordii preparations was of poor quality and the most non-repeating entries included the following ones: using validated tools to report adverse effects, standards for coding of the adverse reactions, describing how and when to collect data on adverse reactions in Method, describing how adverse reactions are attributed to T. wilfordii, clearly stating who has reported the adverse reactions, describing the analysis method of adverse reactions, describing the method of collecting recurrent adverse reaction data, describing any subgroup analysis and exploratory analysis associated with the hazard. We suggest that the studies on adverse reactions of traditional Chinese medicine should strictly report the entries according to the CONSORT HARMs statement, and take the characteristics of traditional Chinese medicine into account to report the details of the Chinese medicine like compositions, dose, taking time, combined medication and the dialectical typology of research objects. Copyright© by the Chinese Pharmaceutical Association.

  20. Inorganic Reaction Mechanisms. Part I

    ERIC Educational Resources Information Center

    Cooke, D. O.

    1976-01-01

    Provides a collection of data on the mechanistic aspects of inorganic chemical reactions. Wherever possible includes procedures for classroom demonstration or student project work. The material covered includes gas phase reactions, reactions in solution, mechanisms of electron transfer, the reaction between iron III and iodine, and hydrolysis. (GS)

  1. Theory and Design Tools For Studies of Reactions to Abrupt Changes in Noise Exposure

    NASA Technical Reports Server (NTRS)

    Fields, James M.; Ehrlich, Gary E.; Zador, Paul; Shepherd, Kevin P. (Technical Monitor)

    2000-01-01

    Study plans, a pre-tested questionnaire, a sample design evaluation tool, a community publicity monitoring plan, and a theoretical framework have been developed to support combined social/acoustical surveys of residents' reactions to an abrupt change in environmental noise, Secondary analyses of more than 20 previous surveys provide estimates of three parameters of a study simulation model; within individual variability, between study wave variability, and between neighborhood variability in response to community noise. The simulation model predicts the precision of the results from social surveys of reactions to noise, including changes in noise. When the study simulation model analyzed the population distribution, noise exposure environments and feasible noise measurement program at a proposed noise change survey site, it was concluded that the site could not yield sufficient precise estimates of human reaction model to justify conducting a survey. Additional secondary analyses determined that noise reactions are affected by the season of the social survey.

  2. The Study of ( n, d) Reaction Cross Sections for New Evaluated Semi-Empirical Formula Using Optical Model

    NASA Astrophysics Data System (ADS)

    Bölükdemir, M. H.; Tel, E.; Okuducu, Ş.; Aydın, A.

    2009-12-01

    Nuclear fusion can be one of the most attractive sources of energy from the viewpoint of safety and minimal environmental impact. The neutron scattering cross sections data have a critical importance on fusion reactor (and in the fusion-fission hybrid) reactors. So, the study of the systematic of ( n, d) etc., reaction cross sections is of great importance in the definition of the excitation function character for reaction taking place on various nuclei at energies up to 20 MeV. In this study, non-elastic cross-sections have been calculated by using optical model for ( n, d) reactions at 14-15 MeV energy. The excitation function character and reaction Q-values depending on the asymmetry term effect for the ( n, d) reaction have been investigated. New coefficients have been obtained and the semi-empirical formulas including optical model non-elastic effects by fitting two parameters for the ( n, d) reaction cross-sections have been suggested. The obtained cross-section formulas with new coefficients have been compared with the available experimental data and discussed.

  3. Ionospheric chemistry. [minor neutrals and ionized constituents of thermosphere

    NASA Technical Reports Server (NTRS)

    Torr, D. G.

    1979-01-01

    This report deals primarily with progress in the chemistry of minor neutrals and ionized constituents of the thermosphere. Significant progress was made over the last few years in quantitative studies of many chemical processes. This success was primarily due to the advent of multiparameter multisatellite programs which permitted accurate simultaneous measurements to be made of many important parameters. In many cases studies of chemical reactions were made with laboratory-like precision. Rate coefficients have been derived as functions of temperature for a number of important reactions. New information has been acquired on nearly every major process which occurs in the thermosphere, including the recombination rates of all major molecular ions, charge transfer reactions, ion atom interchange reactions, and reactions of neutral and ionized metastable atoms and molecules.

  4. Solid rocket exhaust in the stratosphere: Plume diffusion and chemical reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Denison, M.R.; Lamb, J.J.; Bjorndahl, W.D.

    1994-05-01

    A model has been developed to examine, on a local scale, the reactions of rocket exhaust from solid rocket motors with stratospheric ozone. The effects were examined at two different altitudes. Results of the modeling study indicate that afterburning chemistry of reactive exhaust products can cause local but transient (on the order of several minutes) loss of ozone. The modeling study included potential heterogeneous reactions at aluminum oxide surfaces. Results indicate that these potential heterogeneous reactions do not have a major impact on the local plume chemistry. Homogeneous reactions appear to be of more consequence during the early dispersion ofmore » the plume. It has also been found that the rate of plume dispersion has a very significant effect on local ozone loss.« less

  5. Counting the peaks in the excitation function for precompound processes

    NASA Astrophysics Data System (ADS)

    Bonetti, R.; Hussein, M. S.; Mello, P. A.

    1983-08-01

    The "counting of maxima" method of Brink and Stephen, conventionally used for the extraction of the correlation width of statistical (compound nucleus) reactions, is generalized to include precompound processes as well. It is found that this method supplies an important independent check of the results obtained from autocorrelation studies. An application is made to the reaction 25Mg(3He,p). NUCLEAR REACTIONS Statistical multistep compound processes discussed.

  6. Nuclear reactions induced by high-energy alpha particles

    NASA Technical Reports Server (NTRS)

    Shen, B. S. P.

    1974-01-01

    Experimental and theoretical studies of nuclear reactions induced by high energy protons and heavier ions are included. Fundamental data needed in the shielding, dosimetry, and radiobiology of high energy particles produced by accelerators were generated, along with data on cosmic ray interaction with matter. The mechanism of high energy nucleon-nucleus reactions is also examined, especially for light target nuclei of mass number comparable to that of biological tissue.

  7. Dual Visible Light Photoredox and Gold-Catalyzed Arylative Ring Expansion

    PubMed Central

    2015-01-01

    A combination of visible light photocatalysis and gold catalysis is applied to a ring expansion–oxidative arylation reaction. The reaction provides an entry into functionalized cyclic ketones from the coupling reaction of alkenyl and allenyl cycloalkanols with aryl diazonium salts. A mechanism involving generation of an electrophilic gold(III)–aryl intermediate is proposed on the basis of mechanistic studies, including time-resolved FT-IR spectroscopy. PMID:24730447

  8. Role of core excitation in ( d , p ) transfer reactions

    DOE PAGES

    Deltuva, A.; Ross, A.; Norvaišas, E.; ...

    2016-10-24

    In our recent work we found that core excitations can be important in extracting structure information from (d,p) reactions. Our objective is to systematically explore the role of core excitation in (d,p) reactions and to understand the origin of the dynamical effects. Based on the particle-rotor model of n+Be 10, we generate a number of models with a range of separation energies (S n=0.1–5.0 MeV), while maintaining a significant core excited component. We then apply the latest extension of the momentum-space-based Faddeev method, including dynamical core excitation in the reaction mechanism to all orders, to the Be 10(d,p)Be 11-like reactions,more » and study the excitation effects for beam energies E d=15–90 MeV. We study the resulting angular distributions and the differences between the spectroscopic factor that would be extracted from the cross sections, when including dynamical core excitation in the reaction, and that of the original structure model. We also explore how different partial waves affect the final cross section. Our results show a strong beam-energy dependence of the extracted spectroscopic factors that become smaller for intermediate beam energies. Finally, this dependence increases for loosely bound systems.« less

  9. Rock-fluid chemical interactions at reservoir conditions: The influence of brine chemistry and extent of reaction

    NASA Astrophysics Data System (ADS)

    Anabaraonye, B. U.; Crawshaw, J.; Trusler, J. P. M.

    2016-12-01

    Following carbon dioxide injection in deep saline aquifers, CO2 dissolves in the formation brines forming acidic solutions that can subsequently react with host reservoir minerals, altering both porosity and permeability. The direction and rates of these reactions are influenced by several factors including properties that are associated with the brine system. Consequently, understanding and quantifying the impacts of the chemical and physical properties of the reacting fluids on overall reaction kinetics is fundamental to predicting the fate of the injected CO2. In this work, we present a comprehensive experimental study of the kinetics of carbonate-mineral dissolution in different brine systems including sodium chloride, sodium sulphate and sodium bicarbonate of varying ionic strengths. The impacts of the brine chemistry on rock-fluid chemical reactions at different extent of reactions are also investigated. Using a rotating disk technique, we have investigated the chemical interactions between the CO2-saturated brines and carbonate minerals at conditions of pressure (up to 10 MPa) and temperature (up to 373 K) pertinent to carbon storage. The changes in surface textures due to dissolution reaction were studied by means of optical microscopy and vertical scanning interferometry. Experimental results are compared to previously derived models.

  10. Factors that condition the spontaneous reporting of adverse drug reactions among nurses: an integrative review.

    PubMed

    De Angelis, Alessia; Colaceci, Sofia; Giusti, Angela; Vellone, Ercole; Alvaro, Rosaria

    2016-03-01

    To describe and synthesise previous research on factors conditioning the spontaneous reporting of adverse drug reactions among nurses. Spontaneous reports of adverse drug reactions by health-care providers, are a main instrument for the continuous evaluation of the risk-benefit ratio of every drug. Under-reporting of adverse drug reactions by all health-care providers, in particular by nurses, is a major limitation to this system. An integrated review of the literature was conducted using MEDLINE, CINAHL, Embase, Scopus databases and Google Scholar. After evaluation for appropriateness related to inclusion/exclusion criteria, 16 studies were included in the final analysis and synthesis. Two factors emerged from the study: (1) intrinsic factors related to nurses' knowledge and attitudes; (2) extrinsic factors related to nurses' interaction with health-care organisations and to the relationship between nurses and physicians. Nurses' attitudes that hinder reporting include ignorance, insecurity, fear and lethargy. Nurses are not fully aware of their role in adverse drug reaction reporting. Nurses must acquire greater knowledge to implement specific skills into their daily clinical practice. To improve nurses' reporting of adverse drug reactions, it is necessary to develop management approaches that modify both intrinsic and extrinsic factors. © 2015 John Wiley & Sons Ltd.

  11. Computational study of the reactions of methanol with the hydroperoxyl and methyl radicals. 1. Accurate thermochemistry and barrier heights.

    PubMed

    Alecu, I M; Truhlar, Donald G

    2011-04-07

    The reactions of CH(3)OH with the HO(2) and CH(3) radicals are important in the combustion of methanol and are prototypes for reactions of heavier alcohols in biofuels. The reaction energies and barrier heights for these reaction systems are computed with CCSD(T) theory extrapolated to the complete basis set limit using correlation-consistent basis sets, both augmented and unaugmented, and further refined by including a fully coupled treatment of the connected triple excitations, a second-order perturbative treatment of quadruple excitations (by CCSDT(2)(Q)), core-valence corrections, and scalar relativistic effects. It is shown that the M08-HX and M08-SO hybrid meta-GGA density functionals can achieve sub-kcal mol(-1) agreement with the high-level ab initio results, identifying these functionals as important potential candidates for direct dynamics studies on the rates of these and homologous reaction systems.

  12. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique

    NASA Astrophysics Data System (ADS)

    Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing

    2017-05-01

    Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

  13. Lewis acid-Lewis acid heterobimetallic cooperative catalysis: mechanistic studies and application in enantioselective aza-Michael reaction.

    PubMed

    Yamagiwa, Noriyuki; Qin, Hongbo; Matsunaga, Shigeki; Shibasaki, Masakatsu

    2005-09-28

    The full details of a catalytic asymmetric aza-Michael reaction of methoxylamine promoted by rare earth-alkali metal heterobimetallic complexes are described, demonstrating the effectiveness of Lewis acid-Lewis acid cooperative catalysis. First, enones were used as substrates, and the 1,4-adducts were obtained in good yield (57-98%) and high ee (81-96%). Catalyst loading was successfully reduced to 0.3-3 mol % with enones. To broaden the substrate scope of the reaction to carboxylic acid derivatives, alpha,beta-unsaturated N-acylpyrroles were used as monodentate, carboxylic acid derivatives. With beta-alkyl-substituted N-acylpyrroles, the reaction proceeded smoothly and the products were obtained in high yield and good ee. Transformation of the 1,4-adducts from enones and alpha,beta-unsaturated N-acylpyrroles afforded corresponding chiral aziridines and beta-amino acids. Detailed mechanistic studies, including kinetics, NMR analysis, nonlinear effects, and rare earth metal effects, are also described. The Lewis acid-Lewis acid cooperative mechanism, including the substrate coordination mode, is discussed in detail.

  14. Cross-reactions between alpha-streptococci and Omniserum, a polyvalent pneumococcal serum, demonstrated by direct immunofluorescence, immunoelectroosmophoresis, and latex agglutination.

    PubMed Central

    Holmberg, H; Danielsson, D; Hardie, J; Krook, A; Whiley, R

    1985-01-01

    In recent years several groups have used serological methods to demonstrate pneumococcal capsular antigens in sputum. In the present study 123 strains of alpha-hemolytic streptococci (including 97 strains from sputum or pharyngeal specimens) were tested for cross-reactions with a polyvalent antipneumococcal serum (Omniserum). Representatives of the following species were included: Streptococcus bovis, S. equinus, S. intermedius, S. lactis, S. milleri, S. mitis, S. mutans, S. sobrinus, S. salivarius, S. sanguis, S. suis, and Aerococcus viridans. Serological reactions were detected by direct immunofluorescence, immunoelectroosmophoresis, and latex agglutination. Fifteen (12%) of the strains gave positive reactions by all three methods. Positive reactions were also observed with another 32 strains (26%) with two of the methods, whereas 37 strains (30%) gave positive reactions by just one technique. Altogether 84 (68%) strains gave positive reactions with one or more of the methods. Latex agglutination gave positive reactions with 26 (21%) strains compared with 57 (46%) in immunofluorescence and 63 (51%) in immunoelectroosmophoresis. Absorption of the antiserum with one alpha-hemolytic strain reduced but did not entirely eliminate the cross-reactions with five tested strains. These findings indicate a potential risk of cross-reactions with polyvalent antipneumococcal serum in tests carried out on sputa or other specimens which may be contaminated with alpha-hemolytic streptococci. PMID:3889046

  15. Computed potential energy surfaces for chemical reactions

    NASA Technical Reports Server (NTRS)

    Walch, Stephen P.; Levin, Eugene

    1993-01-01

    A new global potential energy surface (PES) is being generated for O(P-3) + H2 yields OH + H. This surface is being fit using the rotated Morse oscillator method, which was used to fit the previous POL-CI surface. The new surface is expected to be more accurate and also includes a much more complete sampling of bent geometries. A new study has been undertaken of the reaction N + O2 yields NO + O. The new studies have focused on the region of the surface near a possible minimum corresponding to the peroxy form of NOO. A large portion of the PES for this second reaction has been mapped out. Since state to state cross sections for the reaction are important in the chemistry of high temperature air, these studies will probably be extended to permit generation of a new global potential for reaction.

  16. Theory of the reaction dynamics of small molecules on metal surfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jackson, Bret

    The objective of this project has been to develop realistic theoretical models for gas-surface interactions, with a focus on processes important in heterogeneous catalysis. The dissociative chemisorption of a molecule on a metal is a key step in many catalyzed reactions, and is often the rate-limiting step. We have explored the dissociative chemisorption of H 2, H 2O and CH 4 on a variety of metal surfaces. Most recently, our extensive studies of methane dissociation on Ni and Pt surfaces have fully elucidated its dependence on translational energy, vibrational state and surface temperature, providing the first accurate comparisons with experimentalmore » data. We have explored Eley-Rideal and hot atom reactions of H atoms with H- and C-covered metal surfaces. H atom interactions with graphite have also been explored, including both sticking and Eley-Rideal recombination processes. Again, our methods made it possible to explain several experiments studying these reactions. The sticking of atoms on metal surfaces has also been studied. To help elucidate the experiments that study these processes, we examine how the reaction dynamics depend upon the nature of the molecule-metal interaction, as well as experimental variables such as substrate temperature, beam energy, angle of impact, and the internal states of the molecules. Electronic structure methods based on Density Functional Theory are used to compute each molecule-metal potential energy surface. Both time-dependent quantum scattering techniques and quasi-classical methods are used to examine the reaction or scattering dynamics. Much of our effort has been directed towards developing improved quantum methods that can accurately describe reactions, as well as include the effects of substrate temperature (lattice vibration).« less

  17. Improved QM Methods and Their Application in QM/MM Studies of Enzymatic Reactions

    NASA Astrophysics Data System (ADS)

    Jorgensen, William L.

    2007-03-01

    Quantum mechanics (QM) and Monte Carlo statistical mechanics (MC) simulations have been used by us since the early 1980s to study reaction mechanisms and the origin of solvent effects on reaction rates. A goal was always to perform the QM and MC/MM calculations simultaneously in order to obtain free-energy surfaces in solution with no geometrical restrictions. This was achieved by 2002 and complete free-energy profiles and surfaces with full sampling of solute and solvent coordinates can now be obtained through one job submission using BOSS [JCC 2005, 26, 1689]. Speed and accuracy demands also led to development of the improved semiempirical QM method, PDDG-PM3 [JCC 1601 (2002); JCTC 817 (2005)]. The combined PDDG-PM3/MC/FEP methodology has provided excellent results for free energies of activation for many reactions in numerous solvents. Recent examples include Cope, Kemp and E1cb eliminations [JACS 8829 (2005), 6141 (2006); JOC 4896 (2006)], as well as enzymatic reactions catalyzed by the putative Diels-Alderase, macrophomate synthase, and fatty-acid amide hydrolase [JACS 3577 (2005); JACS (2006)]. The presentation will focus on the accuracy that is currently achievable in such QM/MM studies and the accuracy of the underlying QM methodology including extensive comparisons of results from PDDG-PM3 and ab initio DFT methods.

  18. Zr-92(d,p)Zr-93 and Zr-92(d,t)Zr-91

    NASA Technical Reports Server (NTRS)

    Baron, N.; Fink, C. L.; Christensen, P. R.; Nickels, J.; Torsteinsen, T.

    1972-01-01

    The structures of Zr-93 and Zr-91 were studied by the stripping reaction Zr-92(d,p)Zr-93 and the pick-up reaction Zr-92(d,t)Zr-91 using 13 MeV incident deuterons. The reaction product particles were detected by counter telescope. Typical spectra from the reactions were analyzed by a nonlinear least squares peak fitting program which included a background search. Spin and parity assignments to observed excited levels were made by comparing experimental angular distributions with distorted wave Born approximation calculations.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nash, Connor P.; Farberow, Carrie A.; Hensley, Jesse E.

    Temperature programmed reaction (TPRxn) is a simple yet powerful tool for screening solid catalyst performance at a variety of conditions. A TPRxn system includes a reactor, furnace, gas and vapor sources, flow control, instrumentation to quantify reaction products (e.g., gas chromatograph), and instrumentation to monitor the reaction in real time (e.g., mass spectrometer). Here, we apply the TPRxn methodology to study molybdenum carbide catalysts for the deoxygenation of acetic acid, an important reaction among many in the upgrading/stabilization of biomass pyrolysis vapors. TPRxn is used to evaluate catalyst activity and selectivity and to test hypothetical reaction pathways (e.g., decarbonylation, ketonization,more » and hydrogenation). Furthermore, the results of the TPRxn study of acetic acid deoxygenation show that molybdenum carbide is an active catalyst for this reaction at temperatures above ca. 300 °C and that the reaction favors deoxygenation (i.e., C-O bond-breaking) products at temperatures below ca. 400 °C and decarbonylation (i.e., C-C bond-breaking) products at temperatures above ca. 400 °C.« less

  20. Evolution of Instrumentation for the Study of Gas-Phase Ion/Ion Chemistry via Mass Spectrometry

    PubMed Central

    Xia, Yu; McLuckey, Scott A.

    2008-01-01

    The scope of gas phase ion/ion chemistry accessible to mass spectrometry is largely defined by the available tools. Due to the development of novel instrumentation, a wide range of reaction phenomenologies have been noted, many of which have been studied extensively and exploited for analytical applications. This perspective presents the development of mass spectrometry-based instrumentation for the study of the gas phase ion/ion chemistry in which at least one of the reactants is multiply-charged. The instrument evolution is presented within the context of three essential elements required for any ion/ion reaction study: the ionization source(s), the reaction vessel or environment, and the mass analyzer. Ionization source arrangements have included source combinations that allow for reactions between multiply charged ions of one polarity and singly charged ions of opposite polarity, arrangements that enable the study of reactions of multiply charged ions of opposite polarity, and most recently, arrangements that allow for ion formation from more than two ion sources. Gas phase ion/ion reaction studies have been performed at near atmospheric pressure in flow reactor designs and within electrodynamic ion traps operated in the mTorr range. With ion trap as a reaction vessel, ionization and reaction processes can be independently optimized and ion/ion reactions can be implemented within the context of MSn experiments. Spatial separation of the reaction vessel from the mass analyzer allows for the use of any form of mass analysis in conjunction with ion/ion reactions. Time-of-flight mass analysis, for example, has provided significant improvements in mass analysis figures of merit relative to mass filters and ion traps. PMID:18083527

  1. Studying Fast Reactions: Construction and Use of a Low-Cost Continuous-Flow Instrument

    ERIC Educational Resources Information Center

    Bisson, Patrick J.; Whitten, James E.

    2006-01-01

    The construction and use of a low-cost continuous-flow instrument for measuring the kinetics of fast reaction which include the use of an light emitting diode light source, a photodiode-on-a-chip detector, and a position sensor is demonstrated. The instrument is suitable for the physical chemistry laboratory and could be used to study the kinetics…

  2. Mesoscopic Modeling of Blood Clotting: Coagulation Cascade and Platelets Adhesion

    NASA Astrophysics Data System (ADS)

    Yazdani, Alireza; Li, Zhen; Karniadakis, George

    2015-11-01

    The process of clot formation and growth at a site on a blood vessel wall involve a number of multi-scale simultaneous processes including: multiple chemical reactions in the coagulation cascade, species transport and flow. To model these processes we have incorporated advection-diffusion-reaction (ADR) of multiple species into an extended version of Dissipative Particle Dynamics (DPD) method which is considered as a coarse-grained Molecular Dynamics method. At the continuum level this is equivalent to the Navier-Stokes equation plus one advection-diffusion equation for each specie. The chemistry of clot formation is now understood to be determined by mechanisms involving reactions among many species in dilute solution, where reaction rate constants and species diffusion coefficients in plasma are known. The role of blood particulates, i.e. red cells and platelets, in the clotting process is studied by including them separately and together in the simulations. An agonist-induced platelet activation mechanism is presented, while platelets adhesive dynamics based on a stochastic bond formation/dissociation process is included in the model.

  3. Iterated reaction graphs: simulating complex Maillard reaction pathways.

    PubMed

    Patel, S; Rabone, J; Russell, S; Tissen, J; Klaffke, W

    2001-01-01

    This study investigates a new method of simulating a complex chemical system including feedback loops and parallel reactions. The practical purpose of this approach is to model the actual reactions that take place in the Maillard process, a set of food browning reactions, in sufficient detail to be able to predict the volatile composition of the Maillard products. The developed framework, called iterated reaction graphs, consists of two main elements: a soup of molecules and a reaction base of Maillard reactions. An iterative process loops through the reaction base, taking reactants from and feeding products back to the soup. This produces a reaction graph, with molecules as nodes and reactions as arcs. The iterated reaction graph is updated and validated by comparing output with the main products found by classical gas-chromatographic/mass spectrometric analysis. To ensure a realistic output and convergence to desired volatiles only, the approach contains a number of novel elements: rate kinetics are treated as reaction probabilities; only a subset of the true chemistry is modeled; and the reactions are blocked into groups.

  4. Immunological aspects of nonimmediate reactions to beta-lactam antibiotics.

    PubMed

    Rodilla, Esther Morena; González, Ignacio Dávila; Yges, Elena Laffond; Bellido, Francisco Javier Múñoz; Bara, María Teresa Gracia; Toledano, Félix Lorente

    2010-09-01

    beta-lactam antibiotics are the agents most frequently implied in immune drug adverse reactions. These can be classified as immediate or nonimmediate according to the time interval between the last drug administration and their onset. Mechanisms of immediate IgE-mediated reactions are widely studied and are therefore better understood. Nonimmediate reactions include a broad number of clinical entities like mild maculopapular exanthemas, the most common, and other less frequent but more severe reactions such as Stevens-Johnson syndrome, toxic epidermal necrolysis, acute exanthematic pustulosis or cytopenias. These nonimmediate reactions are mainly mediated by T cells but the precise underlying mechanisms are not well elucidated. This fact complicates the allergological evaluation of patients with this type of reaction and available tests have demonstrated poor sensitivity and specificity.

  5. Association Between Inflammatory Diet Pattern and Risk of Colorectal Carcinoma Subtypes Classified by Immune Responses to Tumor.

    PubMed

    Liu, Li; Nishihara, Reiko; Qian, Zhi Rong; Tabung, Fred K; Nevo, Daniel; Zhang, Xuehong; Song, Mingyang; Cao, Yin; Mima, Kosuke; Masugi, Yohei; Shi, Yan; da Silva, Annacarolina; Twombly, Tyler; Gu, Mancang; Li, Wanwan; Hamada, Tsuyoshi; Kosumi, Keisuke; Inamura, Kentaro; Nowak, Jonathan A; Drew, David A; Lochhead, Paul; Nosho, Katsuhiko; Wu, Kana; Wang, Molin; Garrett, Wendy S; Chan, Andrew T; Fuchs, Charles S; Giovannucci, Edward L; Ogino, Shuji

    2017-12-01

    Dietary patterns affect systemic and local intestinal inflammation, which have been linked to colorectal carcinogenesis. Chronic inflammation can interfere with the adaptive immune response. We investigated whether the association of a diet that promotes intestinal inflammation with risk of colorectal carcinoma was stronger for tumors with lower lymphocytic reactions than tumors with higher lymphocytic reactions. We collected data from the molecular pathological epidemiology databases of 2 prospective cohort studies: the Nurses' Health Study (since 1976) and the Health Professionals Follow-Up Study (since 1986). We used duplication-method time-varying Cox proportional cause-specific hazards regression to assess the association of empirical dietary inflammatory pattern (EDIP) score (derived from food frequency questionnaire data) with colorectal carcinoma subtype. Foods that contribute to high EDIP scores include red and processed meats, refined grains, carbonated beverages, and some vegetables; foods that contribute to low EDIP scores include beer, wine, coffee, tea, yellow and leafy vegetables, and fruit juice. Colorectal tissue samples were analyzed histologically for patterns of lymphocytic reactions (Crohn's-like lymphoid reaction, peritumoral lymphocytic reaction, intratumoral periglandular reaction, and tumor-infiltrating lymphocytes). During follow-up of 124,433 participants, we documented 1311 incident colon and rectal cancer cases with available tissue data. The association between the EDIP and colorectal cancer risk was significant (P trend  = .02), and varied with degree of peritumoral lymphocytic reaction (P heterogeneity < .001). Higher EDIP scores were associated with increased risk of colorectal cancer with an absent or low peritumoral lymphocytic reaction (highest vs lowest EDIP score quintile hazard ratio, 2.60; 95% confidence interval, 1.60-4.23; P trend < .001), but not risk of tumors with intermediate or high peritumoral lymphocytic reaction (P trend > .80). In 2 prospective cohort studies, we associated inflammatory diets with a higher risk of colorectal cancer subtype that contains little or no peritumoral lymphocytic reaction. These findings suggest that diet-related inflammation might contribute to development of colorectal cancer, by suppressing the adaptive anti-tumor immune response. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  6. In situ alkali-silica reaction observed by x-ray microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurtis, K.E.; Monteiro, P.J.M.; Brown, J.T.

    1997-04-01

    In concrete, alkali metal ions and hydroxyl ions contributed by the cement and reactive silicates present in aggregate can participate in a destructive alkali-silica reaction (ASR). This reaction of the alkalis with the silicates produces a gel that tends to imbibe water found in the concrete pores, leading to swelling of the gel and eventual cracking of the affected concrete member. Over 104 cases of alkali-aggregate reaction in dams and spillways have been reported around the world. At present, no method exists to arrest the expansive chemical reaction which generates significant distress in the affected structures. Most existing techniques availablemore » for the examination of concrete microstructure, including ASR products, demand that samples be dried and exposed to high pressure during the observation period. These sample preparation requirements present a major disadvantage for the study of alkali-silica reaction. Given the nature of the reaction and the affect of water on its products, it is likely that the removal of water will affect the morphology, creating artifacts in the sample. The purpose of this research is to observe and characterize the alkali-silica reaction, including each of the specific reactions identified previously, in situ without introducing sample artifacts. For observation of unconditioned samples, x-ray microscopy offers an opportunity for such an examination of the alkali-silica reaction. Currently, this investigation is focusing on the effect of calcium ions on the alkali-silica reaction.« less

  7. Mean-field hierarchical equations for some A+BC catalytic reaction models

    NASA Astrophysics Data System (ADS)

    Cortés, Joaquín; Puschmann, Heinrich; Valencia, Eliana

    1998-10-01

    A mean-field study of the (A+BC→AC+1/2B2) system is developed from hierarchical equations, considering mechanisms that include dissociation, reaction with finite rates, desorption, and diffusion of the adsorbed species. The phase diagrams are compared to Monte Carlo simulations.

  8. The time course of corticospinal excitability during a simple reaction time task.

    PubMed

    Kennefick, Michael; Maslovat, Dana; Carlsen, Anthony N

    2014-01-01

    The production of movement in a simple reaction time task can be separated into two time periods: the foreperiod, which is thought to include preparatory processes, and the reaction time interval, which includes initiation processes. To better understand these processes, transcranial magnetic stimulation has been used to probe corticospinal excitability at various time points during response preparation and initiation. Previous research has shown that excitability decreases prior to the "go" stimulus and increases following the "go"; however these two time frames have been examined independently. The purpose of this study was to measure changes in CE during both the foreperiod and reaction time interval in a single experiment, relative to a resting baseline level. Participants performed a button press movement in a simple reaction time task and excitability was measured during rest, the foreperiod, and the reaction time interval. Results indicated that during the foreperiod, excitability levels quickly increased from baseline with the presentation of the warning signal, followed by a period of stable excitability leading up to the "go" signal, and finally a rapid increase in excitability during the reaction time interval. This excitability time course is consistent with neural activation models that describe movement preparation and response initiation.

  9. Chemical kinetic analysis of hydrogen-air ignition and reaction times

    NASA Technical Reports Server (NTRS)

    Rogers, R. C.; Schexnayder, C. J., Jr.

    1981-01-01

    An anaytical study of hydrogen air kinetics was performed. Calculations were made over a range of pressure from 0.2 to 4.0 atm, temperatures from 850 to 2000 K, and mixture equivalence ratios from 0.2 to 2.0. The finite rate chemistry model included 60 reactions in 20 species of the H2-O2-N2 system. The calculations also included an assessment of how small amounts of the chemicals H2O, NOx, H2O2, and O3 in the initial mixture affect ignition and reaction times, and how the variation of the third body efficiency of H2O relative of N2 in certain key reactions may affect reaction time. The results indicate that for mixture equivalence ratios between 0.5 and 1.7, ignition times are nearly constant; however, the presence of H2O and NO can have significant effects on ignition times, depending on the mixture temperature. Reaction time is dominantly influenced by pressure but is nearly independent of initial temperature, equivalence ratio, and the addition of chemicals. Effects of kinetics on reaction at supersonic combustor conditions are discussed.

  10. In Situ Environmental TEM in Imaging Gas and Liquid Phase Chemical Reactions for Materials Research.

    PubMed

    Wu, Jianbo; Shan, Hao; Chen, Wenlong; Gu, Xin; Tao, Peng; Song, Chengyi; Shang, Wen; Deng, Tao

    2016-11-01

    Gas and liquid phase chemical reactions cover a broad range of research areas in materials science and engineering, including the synthesis of nanomaterials and application of nanomaterials, for example, in the areas of sensing, energy storage and conversion, catalysis, and bio-related applications. Environmental transmission electron microscopy (ETEM) provides a unique opportunity for monitoring gas and liquid phase reactions because it enables the observation of those reactions at the ultra-high spatial resolution, which is not achievable through other techniques. Here, the fundamental science and technology developments of gas and liquid phase TEM that facilitate the mechanistic study of the gas and liquid phase chemical reactions are discussed. Combined with other characterization tools integrated in TEM, unprecedented material behaviors and reaction mechanisms are observed through the use of the in situ gas and liquid phase TEM. These observations and also the recent applications in this emerging area are described. The current challenges in the imaging process are also discussed, including the imaging speed, imaging resolution, and data management. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Tuberculin skin testing: Spectrum of adverse reactions.

    PubMed

    Praveen, Ramar; Bahuguna, Amit; Dhadwal, Bhumesh Singh

    2015-01-01

    Tuberculin skin testing (TST) is one of the primary diagnostic modalities recommended by the World Health Organization (WHO) and the National Institute for Health and Care Excellence (NICE) study conducted in the United Kingdom (UK) for diagnosing tuberculosis (TB). Even after acceptance as a diagnostic modality and stern standardization, TST has its own flaws that include a spectrum of adverse reactions. We report a series of cases with a spectrum of adverse reactions occurring with a higher frequency than present in the available evidence. The study has some demerits such as being a retrospective one with interobserver variation and lack of histopathological confirmation. The observation is presented to accentuate the fact that adverse reactions are not a rarity and that further studies are required to establish the cause and exact incidence of the same.

  12. Reaction mechanism of dimethyl ether carbonylation to methyl acetate over mordenite – a combined DFT/experimental study

    DOE PAGES

    Rasmussen, D. B.; Christensen, J. M.; Temel, B.; ...

    2017-01-23

    The reaction mechanism of dimethyl ether carbonylation to methyl acetate over mordenite was studied theoretically with periodic density functional theory calculations including dispersion forces and experimentally in a fixed bed flow reactor at pressures between 10 and 100 bar, dimethyl ether concentrations in CO between 0.2 and 2.0%, and at a temperature of 438 K. The theoretical study showed that the reaction of CO with surface methyl groups, the rate-limiting step, is faster in the eight-membered side pockets than in the twelve-membered main channel of the zeolite; the subsequent reaction of dimethyl ether with surface acetyl to form methyl acetatemore » was demonstrated to occur with low energy barriers in both the side pockets and in the main channel. Here, the present analysis has thus identified a path, where the entire reaction occurs favourably on a single site within the side pocket, in good agreement with previous experimental studies. The experimental study of the reaction kinetics was consistent with the theoretically derived mechanism and in addition revealed that the methyl acetate product inhibits the reaction – possibly by sterically hindering the attack of CO on the methyl groups in the side pockets.« less

  13. Safety of benzathine penicillin for preventing congenital syphilis: a systematic review.

    PubMed

    Galvao, Tais F; Silva, Marcus T; Serruya, Suzanne J; Newman, Lori M; Klausner, Jeffrey D; Pereira, Mauricio G; Fescina, Ricardo

    2013-01-01

    To estimate the risk of serious adverse reactions to benzathine penicillin in pregnant women for preventing congenital syphilis. We searched for clinical trials or cohorts that assessed the incidence of serious adverse reactions to benzathine penicillin in pregnant women and the general population (indirect evidence). MEDLINE, EMBASE, Scopus and other databases were searched up to December 2012. The GRADE approach was used to assess quality of evidence. Absolute risks of each study were calculated along with their 95% confidence intervals (95% CI). We employed the DerSimonian and Laird random effects model in the meta-analyses. From 2,765 retrieved studies we included 13, representing 3,466,780 patients. The studies that included pregnant women were conducted to demonstrate the effectiveness of benzathine penicillin: no serious adverse reactions were reported among the 1,244 pregnant women included. In the general population, among 2,028,982 patients treated, 4 died from an adverse reaction. The pooled risk of death was virtually zero. Fifty-four cases of anaphylaxis were reported (pooled absolute risk = 0.002%; 95% CI: 0%-0.003% I(2) = 12%). From that estimate, penicillin treatment would be expected to result in an incidence of 0 to 3 cases of anaphylaxis per 100,000 treated. Any adverse reactions were reported in 6,377 patients among 3,465,322 treated with penicillin (pooled absolute risk = 0.169%; 95% CI: 0.073%-0.265% I(2) = 97%). The quality of evidence was very low. Studies that assessed the risk of serious adverse events due to benzathine penicillin treatment in pregnant women were scarce, but no reports of adverse reactions were found. The incidence of severe adverse outcomes was very low in the general population. The risk of treating pregnant women with benzathine penicillin to prevent congenital syphilis appears very low and does not outweigh its benefits. Further research is needed to improve the quality of evidence.

  14. Characterization of hypersensitivity reactions reported among Andrographis paniculata users in Thailand using Health Product Vigilance Center (HPVC) database.

    PubMed

    Suwankesawong, Wimon; Saokaew, Surasak; Permsuwan, Unchalee; Chaiyakunapruk, Nathorn

    2014-12-24

    Andrographis paniculata (andrographis) is one of the herbal products that are widely used for various indications. Hypersensitivity reactions have been reported among subjects receiving Andrographis paniculata in Thailand. Understanding of characteristics of patients, adverse events, and clinical outcomes is essential for ensuring population safety.This study aimed to describe the characteristics of hypersensitivity reactions reported in patients receiving andrographis containing products in Thailand using national pharmacovigilance database. Thai Vigibase data from February 2001 to December 2012 involving andrographis products were used. This database includes the reports submitted through the spontaneous reporting system and intensive monitoring programmes. The database contained patient characteristic, adverse events associated with andrographis products, and details on seriousness, causality, and clinical outcomes. Case reports were included for final analysis if they met the inclusion criteria; 1) reports with andrographis being the only suspected cause, 2) reports with terms consistent with the constellation of hypersensitivity reactions, and 3) reports with terms considered critical terms according to WHO criteria. Descriptive statistics were used. A total of 248 case reports of andrographis-associated adverse events were identified. Only 106 case reports specified andrographis herbal product as the only suspected drug and reported at least one term consistent with constellation of hypersensitivity reactions. Most case reports (89%) came from spontaneous reporting system with no previously documented history of drug allergy (88%). Of these, 18 case reports were classified as serious with 16 cases requiring hospitalization. For final assessment, the case reports with terms consistent with constellation of hypersensitivity reactions and critical terms were included. Thirteen case reports met such criteria including anaphylactic shock (n = 5), anaphylactic reaction (n = 4) and angioedema (n = 4). Time to development of symptoms ranged from 5 minutes to 1 day. The doses of andrographis used varied from 352 mg to 1,750 mg. Causality assessment of 13 case reports were certain (n = 3), probable (n = 8) and possible (n = 2). Our findings suggested that hypersensitivity reactions have been reported among patients receiving Andrographis paniculata. Healthcare professionals should be aware of this potential risk. Further investigation of the causal relationship is needed; meanwhile including hypersensitivity reactions for andrographis product labeling should be considered.

  15. Using naturalistic driving study data to investigate the impact of driver distraction on driver's brake reaction time in freeway rear-end events in car-following situation.

    PubMed

    Gao, Jingru; Davis, Gary A

    2017-12-01

    The rear-end crash is one of the most common freeway crash types, and driver distraction is often cited as a leading cause of rear-end crashes. Previous research indicates that driver distraction could have negative effects on driving performance, but the specific association between driver distraction and crash risk is still not fully revealed. This study sought to understand the mechanism by which driver distraction, defined as secondary task distraction, could influence crash risk, as indicated by a driver's reaction time, in freeway car-following situations. A statistical analysis, exploring the causal model structure regarding drivers' distraction impacts on reaction times, was conducted. Distraction duration, distraction scenario, and secondary task type were chosen as distraction-related factors. Besides, exogenous factors including weather, visual obstruction, lighting condition, traffic density, and intersection presence and endogenous factors including driver age and gender were considered. There was an association between driver distraction and reaction time in the sample freeway rear-end events from SHRP 2 NDS database. Distraction duration, the distracted status when a leader braked, and secondary task type were related to reaction time, while all other factors showed no significant effect on reaction time. The analysis showed that driver distraction duration is the primary direct cause of the increase in reaction time, with other factors having indirect effects mediated by distraction duration. Longer distraction duration, the distracted status when a leader braked, and engaging in auditory-visual-manual secondary task tended to result in longer reaction times. Given drivers will be distracted occasionally, countermeasures which shorten distraction duration or avoid distraction presence while a leader vehicle brakes are worth considering. This study helps better understand the mechanism of freeway rear-end events in car-following situations, and provides a methodology that can be adopted to study the association between driver behavior and driving features. Copyright © 2017 National Safety Council and Elsevier Ltd. All rights reserved.

  16. Allergic Reactions to Dental Materials-A Systematic Review

    PubMed Central

    Chopra, Radhika; Sachdev, Vinod

    2015-01-01

    Introduction Utility of various dental materials ranging from diagnosis to rehabilitation for the management of oral diseases are not devoid of posing a potential risk of inducing allergic reactions to the patient, technician and dentist. This review aims to develop a systematic approach for the selection and monitoring of dental materials available in the market thereby giving an insight to predict their risk of inducing allergic reactions. Materials and Methods Our data included 71 relevant articles which included 60 case reports, 8 prospective studies and 3 retrospective studies. The source of these articles was Pub Med search done with the following terms: allergies to impression materials, sodium hypochlorite, Ledermix paste, zinc oxide eugenol, formaldehyde, Latex gloves, Methyl methacrylate, fissure sealant, composites, mercury, Nickel-chromium, Titanium, polishing paste and local anaesthesia. All the relevant articles and their references were analysed. The clinical manifestations of allergy to different dental materials based on different case reports were reviewed. Results After reviewing the literature, we found that the dental material reported to cause most adverse reactions in patients is amalgam and the incidence of oral lichenoid reactions adjacent to amalgam restorations occur more often than other dental materials. Conclusion The most common allergic reactions in dental staff are allergies to latex, acrylates and formaldehyde. While polymethylmethacrylates and latex trigger delayed hypersensitivity reactions, sodium metabisulphite and nickel cause immediate reactions. Over the last few years, due to the rise in number of patients with allergies from different materials, the practicing dentists should have knowledge about documented allergies to known materials and thus avoid such allergic manifestations in the dental clinic. PMID:26557634

  17. The Impact of Teachers' Aggressive Management Techniques on Students' Attitudes to Schoolwork

    ERIC Educational Resources Information Center

    Romi, Shlomo; Lewis, Ramon; Roache, Joel; Riley, Philip

    2011-01-01

    Previous studies have shown that teachers' aggressive classroom management impacts negatively on students. The authors compared student reaction to teachers' use of aggressive management techniques in Australia, China, and Israel. Reactions included distraction negativity toward teachers and perceptions that teachers' responses were unjustified,…

  18. Proposed Junior College Administrative Action and Reaction to the Student Activist.

    ERIC Educational Resources Information Center

    Anders, Don F.

    This study examined student activists and their characteristics, demands, and goals. Student politics no longer retain only their traditional liberalism, but include many philosophies--idealism, revolution, conservatism, reaction, etc. Four traits shared by the activists were a desire to master frustration rather than conform, a will to change…

  19. Contact reactions to fragrances.

    PubMed

    Katsarou, A; Armenaka, M; Kalogeromitros, D; Koufou, V; Georgala, S

    1999-05-01

    The most common reaction to fragrances is contact dermatitis, a delayed hypersensitivity reaction; however, other reactions include immediate contact reactions (contact urticaria) and photo-allergic reactions. Fragrance mix (FM) and balsam of Peru (BP) are used to screen for fragrance allergy. To study the different types of allergic skin reactions to fragrance compounds. Delayed hypersensitivity reactions to FM and BP were studied in 4,975 patients with suspected contact dermatitis by routine patch testing interpreted at 48 and 96 hours. In 664 of the patients, patch tests were read at 30 minutes to evaluate for immediate (wheal-and-flare) contact reactions and again at 48 and 96 hours. Photopatch tests to FM were performed in 111 patients with suspected photo-allergic dermatitis. Delayed contact reactions to FM occurred in 6.6% of females and 5.4% of males and to BP in 3.9% of females and 4.1% of males. Analysis of data over time (12 study years) showed an increased trend for reactions to fragrances, particularly in males. Sensitivity to other contact allergens (polysensitivity) was found in 62% of patients and polysensitivity presented more often with generalized contact dermatitis. The most sensitizing components of the fragrance mix that were tested in 38 patients were cinnamic alcohol, oak moss, and cinnamic aldehyde. There were 112 immediate patch test reactions to FM and 113 to BP in 664 patients. Immediate contact reactions were followed by delayed contact reactions in 13.4% of patients for FM and 8.8% for BP, representing a significant increase in the frequency of delayed contact reactions. Patients with immediate contact reactions to fragrances did not have a higher incidence of atopy (25.9%). No cases of positive photopatch test reactions to FM were seen. Fragrances commonly cause both delayed and immediate patch test reactions and patients with immediate contact reactions have an increase in delayed contact reactions to the same allergen.

  20. Particle-based modeling of heterogeneous chemical kinetics including mass transfer.

    PubMed

    Sengar, A; Kuipers, J A M; van Santen, Rutger A; Padding, J T

    2017-08-01

    Connecting the macroscopic world of continuous fields to the microscopic world of discrete molecular events is important for understanding several phenomena occurring at physical boundaries of systems. An important example is heterogeneous catalysis, where reactions take place at active surfaces, but the effective reaction rates are determined by transport limitations in the bulk fluid and reaction limitations on the catalyst surface. In this work we study the macro-micro connection in a model heterogeneous catalytic reactor by means of stochastic rotation dynamics. The model is able to resolve the convective and diffusive interplay between participating species, while including adsorption, desorption, and reaction processes on the catalytic surface. Here we apply the simulation methodology to a simple straight microchannel with a catalytic strip. Dimensionless Damkohler numbers are used to comment on the spatial concentration profiles of reactants and products near the catalyst strip and in the bulk. We end the discussion with an outlook on more complicated geometries and increasingly complex reactions.

  1. Particle-based modeling of heterogeneous chemical kinetics including mass transfer

    NASA Astrophysics Data System (ADS)

    Sengar, A.; Kuipers, J. A. M.; van Santen, Rutger A.; Padding, J. T.

    2017-08-01

    Connecting the macroscopic world of continuous fields to the microscopic world of discrete molecular events is important for understanding several phenomena occurring at physical boundaries of systems. An important example is heterogeneous catalysis, where reactions take place at active surfaces, but the effective reaction rates are determined by transport limitations in the bulk fluid and reaction limitations on the catalyst surface. In this work we study the macro-micro connection in a model heterogeneous catalytic reactor by means of stochastic rotation dynamics. The model is able to resolve the convective and diffusive interplay between participating species, while including adsorption, desorption, and reaction processes on the catalytic surface. Here we apply the simulation methodology to a simple straight microchannel with a catalytic strip. Dimensionless Damkohler numbers are used to comment on the spatial concentration profiles of reactants and products near the catalyst strip and in the bulk. We end the discussion with an outlook on more complicated geometries and increasingly complex reactions.

  2. Modular radiochemistry synthesis system

    DOEpatents

    Satyamurthy, Nagichettiar; Barrio, Jorge R.; Amarasekera, Bernard; Van Dam, Michael R.; Olma, Sebastian; Williams, Dirk; Eddings, Mark; Shen, Clifton Kwang-Fu

    2016-11-01

    A modular chemical production system includes multiple modules for performing a chemical reaction, particularly of radiochemical compounds, from a remote location. One embodiment comprises a reaction vessel including a moveable heat source with the position thereof relative to the reaction vessel being controllable from a remote position. Alternatively the heat source may be fixed in location and the reaction vial is moveable into and out of the heat source. The reaction vessel has one or more sealing plugs, the positioning of which in relationship to the reaction vessel is controllable from a remote position. Also the one or more reaction vessel sealing plugs can include one or more conduits there through for delivery of reactants, gases at atmospheric or an elevated pressure, inert gases, drawing a vacuum and removal of reaction end products to and from the reaction vial, the reaction vial with sealing plug in position being operable at elevated pressures. The modular chemical production system is assembled from modules which can each include operating condition sensors and controllers configured for monitoring and controlling the individual modules and the assembled system from a remote position. Other modules include, but are not limited to a Reagent Storage and Delivery Module, a Cartridge Purification Module, a Microwave Reaction Module, an External QC/Analysis/Purification Interface Module, an Aliquotting Module, an F-18 Drying Module, a Concentration Module, a Radiation Counting Module, and a Capillary Reactor Module.

  3. Modular radiochemistry synthesis system

    DOEpatents

    Satyamurthy, Nagichettiar; Barrio, Jorge R.; Amarasekera, Bernard; Van Dam, R. Michael; Olma, Sebastian; Williams, Dirk; Eddings, Mark; Shen, Clifton Kwang-Fu

    2015-12-15

    A modular chemical production system includes multiple modules for performing a chemical reaction, particularly of radiochemical compounds, from a remote location. One embodiment comprises a reaction vessel including a moveable heat source with the position thereof relative to the reaction vessel being controllable from a remote position. Alternatively the heat source may be fixed in location and the reaction vial is moveable into and out of the heat source. The reaction vessel has one or more sealing plugs, the positioning of which in relationship to the reaction vessel is controllable from a remote position. Also the one or more reaction vessel sealing plugs can include one or more conduits there through for delivery of reactants, gases at atmospheric or an elevated pressure, inert gases, drawing a vacuum and removal of reaction end products to and from the reaction vial, the reaction vial with sealing plug in position being operable at elevated pressures. The modular chemical production system is assembled from modules which can each include operating condition sensors and controllers configured for monitoring and controlling the individual modules and the assembled system from a remote position. Other modules include, but are not limited to a Reagent Storage and Delivery Module, a Cartridge Purification Module, a Microwave Reaction Module, an External QC/Analysis/Purification Interface Module, an Aliquotting Module, an F-18 Drying Module, a Concentration Module, a Radiation Counting Module, and a Capillary Reactor Module.

  4. Modular radiochemistry synthesis system

    DOEpatents

    Satyamurthy, Nagichettiar; Barrio, Jorge R; Amarasekera, Bernard; Van Dam, R. Michael; Olma, Sebastian; Williams, Dirk; Eddings, Mark A; Shen, Clifton Kwang-Fu

    2015-02-10

    A modular chemical production system includes multiple modules for performing a chemical reaction, particularly of radiochemical compounds, from a remote location. One embodiment comprises a reaction vessel including a moveable heat source with the position thereof relative to the reaction vessel being controllable from a remote position. Alternatively the heat source may be fixed in location and the reaction vial is moveable into and out of the heat source. The reaction vessel has one or more sealing plugs, the positioning of which in relationship to the reaction vessel is controllable from a remote position. Also the one or more reaction vessel sealing plugs can include one or more conduits there through for delivery of reactants, gases at atmospheric or an elevated pressure, inert gases, drawing a vacuum and removal of reaction end products to and from the reaction vial, the reaction vial with sealing plug in position being operable at elevated pressures. The modular chemical production system is assembled from modules which can each include operating condition sensors and controllers configured for monitoring and controlling the individual modules and the assembled system from a remote position. Other modules include, but are not limited to a Reagent Storage and Delivery Module, a Cartridge Purification Module, a Microwave Reaction Module, an External QC/Analysis/Purification Interface Module, an Aliquotting Module, an F-18 Drying Module, a Concentration Module, a Radiation Counting Module, and a Capillary Reactor Module.

  5. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  6. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  7. Severe Cutaneous Adverse Drug Reactions: A Clinicoepidemiological Study

    PubMed Central

    Sasidharanpillai, Sarita; Riyaz, Najeeba; Khader, Anza; Rajan, Uma; Binitha, Manikoth P; Sureshan, Deepthi N

    2015-01-01

    Background: Drug eruptions range from transient erythema to the life threatening severe cutaneous adverse reactions (SCAR) that encompass Stevens–Johnson syndrome (SJS), toxic epidermal necrolysis (TEN), acute generalized exanthematous pustulosis (AGEP) and drug reaction with eosinophilia and systemic symptoms complex (DRESS). Aims and Objectives: To study the clinical and epidemiological aspects of cutaneous adverse drug reactions (CADR). Materials and Methods: Ethical clearance was obtained from the institutional ethics committee. All patients admitted in the Dermatology ward of our tertiary care hospital with CADR (those who fit in the category of probable or possible drug reaction as per WHO casuality assessment) from first September 2011 to 31st August 2012 were included in this cross sectional study after obtaining written informed consent. The drug reaction patterns observed in the study population were determined and the common offending drugs were identified. Results: In the study, population of males outnumbered females and the majority were between 46 and 60 years of age. The commonest reaction pattern observed was SJS- TEN spectrum of illness and aromatic anticonvulsants were the common offending drugs. Prompt withdrawal of the culprit drug and administration of systemic steroids with or without I/V Ig reverted the adverse reaction in all except one. Conclusion: Severe drug reactions predominated as the study population was comprised of inpatients of a tertiary referral centre. Though; previous authors had reported a mortality rate of up to 20% in DRESS, all our patients with this reaction pattern, responded well to treatment. The mortality rate among TEN cases was much lower than the previous reports. Early diagnosis, prompt withdrawal of the suspected drug, careful monitoring for development of complications and immediate intervention can improve the prognosis of CADR. PMID:25657416

  8. A systematic review of validated methods for identifying transfusion-related ABO incompatibility reactions using administrative and claims data.

    PubMed

    Carnahan, Ryan M; Kee, Vicki R

    2012-01-01

    This paper aimed to systematically review algorithms to identify transfusion-related ABO incompatibility reactions in administrative data, with a focus on studies that have examined the validity of the algorithms. A literature search was conducted using PubMed, Iowa Drug Information Service database, and Embase. A Google Scholar search was also conducted because of the difficulty identifying relevant studies. Reviews were conducted by two investigators to identify studies using data sources from the USA or Canada because these data sources were most likely to reflect the coding practices of Mini-Sentinel data sources. One study was found that validated International Classification of Diseases (ICD-9-CM) codes representing transfusion reactions. None of these cases were ABO incompatibility reactions. Several studies consistently used ICD-9-CM code 999.6, which represents ABO incompatibility reactions, and a technical report identified the ICD-10 code for these reactions. One study included the E-code E8760 for mismatched blood in transfusion in the algorithm. Another study reported finding no ABO incompatibility reaction codes in the Healthcare Cost and Utilization Project Nationwide Inpatient Sample database, which contains data of 2.23 million patients who received transfusions, raising questions about the sensitivity of administrative data for identifying such reactions. Two studies reported perfect specificity, with sensitivity ranging from 21% to 83%, for the code identifying allogeneic red blood cell transfusions in hospitalized patients. There is no information to assess the validity of algorithms to identify transfusion-related ABO incompatibility reactions. Further information on the validity of algorithms to identify transfusions would also be useful. Copyright © 2012 John Wiley & Sons, Ltd.

  9. Substrate specificity and subcellular localization of the aldehyde-alcohol redox-coupling reaction in carp cones.

    PubMed

    Sato, Shinya; Fukagawa, Takashi; Tachibanaki, Shuji; Yamano, Yumiko; Wada, Akimori; Kawamura, Satoru

    2013-12-20

    Our previous study suggested the presence of a novel cone-specific redox reaction that generates 11-cis-retinal from 11-cis-retinol in the carp retina. This reaction is unique in that 1) both 11-cis-retinol and all-trans-retinal were required to produce 11-cis-retinal; 2) together with 11-cis-retinal, all-trans-retinol was produced at a 1:1 ratio; and 3) the addition of enzyme cofactors such as NADP(H) was not necessary. This reaction is probably part of the reactions in a cone-specific retinoid cycle required for cone visual pigment regeneration with the use of 11-cis-retinol supplied from Müller cells. In this study, using purified carp cone membrane preparations, we first confirmed that the reaction is a redox-coupling reaction between retinals and retinols. We further examined the substrate specificity, reaction mechanism, and subcellular localization of this reaction. Oxidation was specific for 11-cis-retinol and 9-cis-retinol. In contrast, reduction showed low specificity: many aldehydes, including all-trans-, 9-cis-, 11-cis-, and 13-cis-retinals and even benzaldehyde, supported the reaction. On the basis of kinetic studies of this reaction (aldehyde-alcohol redox-coupling reaction), we found that formation of a ternary complex of a retinol, an aldehyde, and a postulated enzyme seemed to be necessary, which suggested the presence of both the retinol- and aldehyde-binding sites in this enzyme. A subcellular fractionation study showed that the activity is present almost exclusively in the cone inner segment. These results suggest the presence of an effective production mechanism of 11-cis-retinal in the cone inner segment to regenerate visual pigment.

  10. Self-vapor cooled targets for production of I-123 at high current accelerators. [using Xe-123 production

    NASA Technical Reports Server (NTRS)

    Blue, J. W.; Scholz, K. L.; Sodd, V. J.

    1974-01-01

    The basic elements of the vapor cooled target system are shown. This system can be operated as a heat pipe or as a conventional condenser. The choice of target fluid is based on the specific nuclear reaction chosen to produce Xe-123. The reaction using I-127 was studied and shown to have a significant yield for bombarding energies from 47 to 63 MeV. The Cs-133 reaction is also included. Xenon-123 is applied to I-123 production in a purer form for thyroid studies.

  11. Design, Sustainable Synthesis, and Programmed Reactions of Templated N-Heteroaryl-Fused Vinyl Sultams.

    PubMed

    Laha, Joydev K; Sharma, Shubhra; Kirar, Seema; Banerjee, Uttam C

    2017-09-15

    A de novo design and synthesis of N-heteroaryl-fused vinyl sultams as templates for programming chemical reactions on vinyl sultam periphery or (hetero)aryl ring is described. The key features include rational designing and sustainable synthesis of the template, customized reactions of vinyl sultams at C═C bond or involving N-S bond cleavage, and reactions on the periphery of the heteroaryl ring for late-stage diversification. The simple, easy access to the template coupled with opportunities for the synthesis of diversely functionalized heterocyles from a single template constitutes a rare study in contemporary organic synthesis.

  12. Taking the plunge: chemical reaction dynamics in liquids.

    PubMed

    Orr-Ewing, Andrew J

    2017-12-11

    The dynamics of chemical reactions in liquid solutions are now amenable to direct study using ultrafast laser spectroscopy techniques and advances in computer simulation methods. The surrounding solvent affects the chemical reaction dynamics in numerous ways, which include: (i) formation of complexes between reactants and solvent molecules; (ii) modifications to transition state energies and structures relative to the reactants and products; (iii) coupling between the motions of the reacting molecules and the solvent modes, and exchange of energy; (iv) solvent caging of reactants and products; and (v) structural changes to the solvation shells in response to the changing chemical identity of the solutes, on timescales which may be slower than the reactive events. This article reviews progress in the study of bimolecular chemical reaction dynamics in solution, concentrating on reactions which occur on ground electronic states. It illustrates this progress with reference to recent experimental and computational studies, and considers how the various ways in which a solvent affects the chemical reaction dynamics can be unravelled. Implications are considered for research in fields such as mechanistic synthetic chemistry.

  13. Reactions of the selected ion flow tube mass spectrometry reagent ions H3O(+) and NO(+) with a series of volatile aldehydes of biogenic significance.

    PubMed

    Smith, David; Chippendale, Thomas W E; Španěl, Patrik

    2014-09-15

    It has been shown that aldehydes are often present in biogenic media. For their analysis by selected ion flow tube mass spectrometry (SIFT-MS), the rate coefficients and the product ion distributions for the reactions of the analyte ions H3O(+) and NO(+) with volatile aldehydes in the presence of water vapour are required. The reactions of H3O(+) and NO(+) ions have been studied with a series of n-aldehydes ranging from acetaldehyde (designated as C2), through undecanal (C11) under the conditions used for SIFT-MS analyses (1 Torr He, 0.1 Torr air sample, 300 K) and over a range of sample gas absolute humidity from 1% to 7%. For comparison, the C5 pentanal isomer 3-methyl butanal, the unsaturated trans-2-pentenal and trans-2-octenal and the aromatic benzaldehyde were also included in the study. The H3O(+) reactions led to the formation of protonated molecules MH(+) and their hydrates MH(+)(H2O)0,1,2,3 , and (MH(+)-H2O). The NO(+) reactions resulted in the production of NO(+)M adduct ions and of [M-H](+) fragment ions. The percentages of the different product ions for each aldehyde are seen to be dependent on the air sample humidity. Kinetic modelling was used to quantitatively explain these observations and to obtain rate coefficients for the association reactions producing NO(+) M adduct ions. This detailed study has provided the kinetics data, in particular the product ion distributions, for the reactions of a number of volatile aldehydes, which allows their analyses by SIFT-MS in humid air, including exhaled breath, food emanations and other biogenic media. Copyright © 2014 John Wiley & Sons, Ltd.

  14. [Delayed adverse reactions to blood donation: From haemovigilance data to specific studies].

    PubMed

    Py, J-Y; Durieux, S; Barnoux, M; Sapey, T

    2016-11-01

    Delayed adverse reactions to blood donation occur after the donor left donation site. Their intrinsic gravity and possible complications can be increased by the fact the donor is alone. This can also increase bad memories, leading to a donation giving up. Blood transfusion centre is only aware in case of donor feedback, hence an event underrating. We choose to compare our data upon delayed adverse donor reactions with those we could find in past studies. A first data level comes from French haemovigilance data while serious adverse reactions declaration is mandatory. But a second level can be reached using blood transfusion centre computerized data because all the donation reactions are saved whatever the gravity is. In both cases, delayed reactions are only those reported by donors. We try to make an exhaustive search of specific studies upon the real delayed reactions incidence so as to compare with our data. There were 1957 serious adverse reactions declared in our regional haemovigilance database between 2011 and 2015: 49 % occurring during donation, 40 % after it but before donor departure, and 11 % delayed events. There were 16,050 adverse reactions recorded during the first trimester of 2016 in mainland France, with 2.7 % delayed ones. Proportion of delayed events rises when gravity rises, until 27.6 % for the most serious ones. It varies between 2.2 % and 2.7 % for vasovagal reactions, haematomas, and other local reactions, and reaches 16.2 % for other general reactions. Data found in other studies with a spontaneous donor notification are of the same kind. But four studies soliciting specifically donor notification give a dramatically higher delayed reactions incidence, with an understatement greater than three out of four. Moreover, these studies found a majority of delayed reactions, which are not included in haemovigilance like fatigue or bruising. Occurrence of a delayed donor reaction is clearly underrated in standard haemovigilance. It remains to be seen whether it have the same impact on donor return as immediate reactions. Considering that delayed reactions are much larger, it might be interesting to take them into account in the evaluation of strategies dedicated to lower immediate reactions. Copyright © 2016. Published by Elsevier SAS.

  15. Frequency and risk factors for donor reactions in an anonymous blood donor survey.

    PubMed

    Goldman, Mindy; Osmond, Lori; Yi, Qi-Long; Cameron-Choi, Keltie; O'Brien, Sheila F

    2013-09-01

    Adverse donor reactions can result in injury and decrease the likelihood of donor return. Reaction reports captured in the blood center's database provide an incomplete picture of reaction rates and risk factors. We performed an anonymous survey, mailed to 40,000 donors in 2008, including questions about symptoms, height, weight, sex, and donation status. Reaction rates were compared to those recorded in our database. Possible risk factors were assessed for various reactions. The response rate was 45.5%. A total of 32% of first-time and 14% of repeat donors reported having any adverse symptom, most frequently bruising (84.9 per 1000 donors) or feeling faint or weak (66.2 per 1000). Faint reactions were two to eight times higher than reported in our database, although direct comparison was difficult. Younger age, female sex, and first-time donation status were risk factors for systemic and arm symptoms. In females, low estimated blood volume (EBV) was a risk factor for systemic symptoms. Only 51% of donors who consulted an outside physician also called Canadian Blood Services. A total of 10% of first-time donors with reactions found adverse effects information inadequate. This study allowed us to collect more information about adverse reactions, including minor symptoms and delayed reactions. Based on our findings of the risk factors and frequency of adverse reactions, we are implementing more stringent EBV criteria for younger donors and providing more detailed information to donors about possible adverse effects and their management. © 2012 American Association of Blood Banks.

  16. Benzalkonium chloride neutralizes the irritant effect of sodium dodecyl sulfate.

    PubMed

    McFadden, J P; Holloway, D B; Whittle, E G; Basketter, D A

    2000-11-01

    When benzalkonium chloride (BKC), a cationic surfactant, is added to sodium dodecyl sulfate (SDS), an anionic surfactant, and used in patch testing, on the basis of their known physicochemical interaction, it is possible to predict that there will be a tendency towards a reduction in the expected irritant response when compared to SDS alone. The aim of this study was to investigate whether BKC could reduce the irritant response to SDS when applied after the SDS exposure. 54 non-atopic adult volunteers were recruited for the study. 20% SDS was applied for 2 h under occlusion. 1% BKC was then applied to the same site. Various controls, including SDS application followed by water for 2 h, were included. The irritant reaction was assessed at 24 h and 48 h. 40 of the 54 subjects had some reaction when SDS was applied for 2 h followed by either benzalkonium chloride or water control under occlusion. In comparison to water control, where BKC was applied after SDS, 20 of the 40 responders had a weaker reaction but only 4 had a stronger response. This study shows that BKC applied to skin exposed to SDS attenuates the resulting irritant reaction.

  17. Intra-individual reaction time variability and all-cause mortality over 17 years: a community-based cohort study.

    PubMed

    Batterham, Philip J; Bunce, David; Mackinnon, Andrew J; Christensen, Helen

    2014-01-01

    very few studies have examined the association between intra-individual reaction time variability and subsequent mortality. Furthermore, the ability of simple measures of variability to predict mortality has not been compared with more complex measures. a prospective cohort study of 896 community-based Australian adults aged 70+ were interviewed up to four times from 1990 to 2002, with vital status assessed until June 2007. From this cohort, 770-790 participants were included in Cox proportional hazards regression models of survival. Vital status and time in study were used to conduct survival analyses. The mean reaction time and three measures of intra-individual reaction time variability were calculated separately across 20 trials of simple and choice reaction time tasks. Models were adjusted for a range of demographic, physical health and mental health measures. greater intra-individual simple reaction time variability, as assessed by the raw standard deviation (raw SD), coefficient of variation (CV) or the intra-individual standard deviation (ISD), was strongly associated with an increased hazard of all-cause mortality in adjusted Cox regression models. The mean reaction time had no significant association with mortality. intra-individual variability in simple reaction time appears to have a robust association with mortality over 17 years. Health professionals such as neuropsychologists may benefit in their detection of neuropathology by supplementing neuropsychiatric testing with the straightforward process of testing simple reaction time and calculating raw SD or CV.

  18. Assessing medication effects in the MTA study using neuropsychological outcomes.

    PubMed

    Epstein, Jeffery N; Conners, C Keith; Hervey, Aaron S; Tonev, Simon T; Arnold, L Eugene; Abikoff, Howard B; Elliott, Glen; Greenhill, Laurence L; Hechtman, Lily; Hoagwood, Kimberly; Hinshaw, Stephen P; Hoza, Betsy; Jensen, Peter S; March, John S; Newcorn, Jeffrey H; Pelham, William E; Severe, Joanne B; Swanson, James M; Wells, Karen; Vitiello, Benedetto; Wigal, Timothy

    2006-05-01

    While studies have increasingly investigated deficits in reaction time (RT) and RT variability in children with attention deficit/hyperactivity disorder (ADHD), few studies have examined the effects of stimulant medication on these important neuropsychological outcome measures. 316 children who participated in the Multimodal Treatment Study of Children with ADHD (MTA) completed the Conners' Continuous Performance Test (CPT) at the 24-month assessment point. Outcome measures included standard CPT outcomes (e.g., errors of commission, mean hit reaction time (RT)) and RT indicators derived from an Ex-Gaussian distributional model (i.e., mu, sigma, and tau). Analyses revealed significant effects of medication across all neuropsychological outcome measures. Results on the Ex-Gaussian outcome measures revealed that stimulant medication slows RT and reduces RT variability. This demonstrates the importance of including analytic strategies that can accurately model the actual distributional pattern, including the positive skew. Further, the results of the study relate to several theoretical models of ADHD.

  19. Kinetic phase evolution of spinel cobalt oxide during lithiation

    DOE PAGES

    Li, Jing; He, Kai; Meng, Qingping; ...

    2016-09-15

    Spinel cobalt oxide has been proposed to undergo a multiple-step reaction during the electrochemical lithiation process. Understanding the kinetics of the lithiation process in this compound is crucial to optimize its performance and cyclability. In this work, we have utilized a low-angle annular dark-field scanning transmission electron microscopy method to visualize the dynamic reaction process in real time and study the reaction kinetics at different rates. We show that the particles undergo a two-step reaction at the single-particle level, which includes an initial intercalation reaction followed by a conversion reaction. At low rates, the conversion reaction starts after the intercalationmore » reaction has fully finished, consistent with the prediction of density functional theoretical calculations. At high rates, the intercalation reaction is overwhelmed by the subsequently nucleated conversion reaction, and the reaction speeds of both the intercalation and conversion reactions are increased. Phase-field simulations show the crucial role of surface diffusion rates of lithium ions in controlling this process. Furthermore, this work provides microscopic insights into the reaction dynamics in non-equilibrium conditions and highlights the effect of lithium diffusion rates on the overall reaction homogeneity as well as the performance.« less

  20. Kinetic phase evolution of spinel cobalt oxide during lithiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jing; He, Kai; Meng, Qingping

    Spinel cobalt oxide has been proposed to undergo a multiple-step reaction during the electrochemical lithiation process. Understanding the kinetics of the lithiation process in this compound is crucial to optimize its performance and cyclability. In this work, we have utilized a low-angle annular dark-field scanning transmission electron microscopy method to visualize the dynamic reaction process in real time and study the reaction kinetics at different rates. We show that the particles undergo a two-step reaction at the single-particle level, which includes an initial intercalation reaction followed by a conversion reaction. At low rates, the conversion reaction starts after the intercalationmore » reaction has fully finished, consistent with the prediction of density functional theoretical calculations. At high rates, the intercalation reaction is overwhelmed by the subsequently nucleated conversion reaction, and the reaction speeds of both the intercalation and conversion reactions are increased. Phase-field simulations show the crucial role of surface diffusion rates of lithium ions in controlling this process. Furthermore, this work provides microscopic insights into the reaction dynamics in non-equilibrium conditions and highlights the effect of lithium diffusion rates on the overall reaction homogeneity as well as the performance.« less

  1. 7Li(d,p)8Li transfer reaction in the NCSM/RGM approach

    NASA Astrophysics Data System (ADS)

    Raimondi, F.; Hupin, G.; Navrátil, P.; Quaglioni, S.

    2018-03-01

    Recently, we applied an ab initio method, the no-core shell model combined with the resonating group method, to the transfer reactions with light p-shell nuclei as targets and deuteron as the projectile. In particular, we studied the elastic scattering of deuterium on 7Li and the 7Li(d,p)8Li transfer reaction starting from a realistic two-nucleon interaction. In this contribution, we review of our main results on the 7Li(d,p)8Li transfer reaction, and we extend the study of the relevant reaction channels, by showing the dominant resonant phase shifts of the scattering matrix. We assess also the impact of the polarization effects of the deuteron below the breakup on the positive-parity resonant states in the reaction. For this purpose, we perform an analysis of the convergence trend of the phase and eigenphase shifts, with respect to the number of deuteron pseudostates included in the model space.

  2. Soft-tissue reactions following irradiation of primary brain and pituitary tumors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baglan, R.J.; Marks, J.E.

    1981-04-01

    One hundred and ninety-nine patients who received radiation therapy for a primary brain or pituitary tumor were studied for radiation-induced soft-tissue reactions of the cranium, scalp, ears and jaw. The frequency of these reactions was studied as a function of: the radiation dose 5 mm below the skin surface, dose distribution, field size and fraction size. Forty percent of patients had complete and permanent epilation, while 21% had some other soft-tissue complication, including: scalp swelling-6%, external otitis-6%, otitis media-5%, ear swelling-4%, etc. The frequency of soft-tissue reactions correlates directly with the radiation dose at 5 mm below the skin surface.more » Patients treated with small portals (<70 cm/sup 2/) had few soft-tissue reactions. The dose to superficial tissues, and hence the frequency of soft-tissue reactions can be reduced by: (1) using high-energy megavoltage beams; (2) using equal loading of beams; and (3) possibly avoiding the use of electron beams.« less

  3. Computational Study of the Reactions of Methanol with the Hydroperoxyl and Methyl Radicals. Part I: Accurate Thermochemistry and Barrier Heights

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alecu, I. M.; Truhlar, D. G.

    2011-04-07

    The reactions of CH 3OH with the HO 2 and CH 3 radicals are important in the combustion of methanol and are prototypes for reactions of heavier alcohols in biofuels. The reaction energies and barrier heights for these reaction systems are computed with CCSD(T) theory extrapolated to the complete basis set limit using correlation-consistent basis sets, both augmented and unaugmented, and further refined by including a fully coupled treatment of the connected triple excitations, a second-order perturbative treatment of quadruple excitations (by CCSDT(2) Q), core–valence corrections, and scalar relativistic effects. It is shown that the M08-HX and M08-SO hybrid meta-GGAmore » density functionals can achieve sub-kcal mol -1 agreement with the high-level ab initio results, identifying these functionals as important potential candidates for direct dynamics studies on the rates of these and homologous reaction systems.« less

  4. The mechanism of hydroaminoalkylation catalyzed by group 5 metal binaphtholate complexes.

    PubMed

    Reznichenko, Alexander L; Hultzsch, Kai C

    2012-02-15

    The intermolecular hydroaminoalkylation of unactivated alkenes and vinyl arenes with secondary amines occurs readily in the presence of tantalum and niobium binaphtholate catalysts with high regio- and enantioselectivity (up to 98% ee). Mechanistic studies have been conducted in order to determine the kinetic order of the reaction in all reagents and elucidate the rate- and stereodetermining steps. The effects of substrate steric and electronic properties on the overall reaction rate have been evaluated. The reaction is first order in amine and the catalyst, while exhibiting saturation in alkene at high alkene concentration. Unproductive reaction events including reversible amine binding and arene C-H activation have been observed. The formation of the metallaaziridine is a fast reversible nondissociative process and the overall reaction rate is limited either by amide exchange or alkene insertion, as supported by reaction kinetics, kinetic isotope effects, and isotopic labeling studies. These results suggest that the catalytic activity can be enhanced by employing a more electron-deficient ligand backbone.

  5. High performance addition-type thermoplastics (ATTs) - Evidence for the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated material and a bismaleimide

    NASA Technical Reports Server (NTRS)

    Pater, R. H.; Soucek, M. D.; Chang, A. C.; Partos, R. D.

    1991-01-01

    Recently, the concept and demonstration of a new versatile synthetic reaction for making a large number of high-performance addition-type thermoplastics (ATTs) were reported. The synthesis shows promise for providing polymers having an attractive combination of easy processability, good toughness, respectable high temperature mechanical performance, and excellent thermo-oxidative stability. The new chemistry involves the reaction of an acetylene-terminated material with a bismaleimide or benzoquinone. In order to clarify the reaction mechanism, model compound studies were undertaken in solutions as well as in the solid state. The reaction products were purified by flash chromatography and characterized by conventional analytical techniques including NMR, FT-IR, UV-visible, mass spectroscopy, and high pressure liquid chromatography. The results are presented of the model compound studies which strongly support the formation of a Diels-Alder adduct in the reaction of an acetylene-terminated compound and a bismaleimide or benzoquinone.

  6. Comprehensive analysis of ß-lactam antibiotics including penicillins, cephalosporins, and carbapenems in poultry muscle using liquid chromatography coupled to tandem mass spectrometry.

    PubMed

    Berendsen, Bjorn J A; Gerritsen, Henk W; Wegh, Robin S; Lameris, Steven; van Sebille, Ralph; Stolker, Alida A M; Nielen, Michel W F

    2013-09-01

    A comprehensive method for the quantitative residue analysis of trace levels of 22 ß-lactam antibiotics, including penicillins, cephalosporins, and carbapenems, in poultry muscle by liquid chromatography in combination with tandem mass spectrometric detection is reported. The samples analyzed for ß-lactam residues are hydrolyzed using piperidine in order to improve compound stability and to include the total residue content of the cephalosporin ceftifour. The reaction procedure was optimized using a full experimental design. Following detailed isotope labeling, tandem mass spectrometry studies and exact mass measurements using high-resolution mass spectrometry reaction schemes could be proposed for all ß-lactams studied. The main reaction occurring is the hydrolysis of the ß-lactam ring under formation of the piperidine substituted amide. For some ß-lactams, multiple isobaric hydrolysis reaction products are obtained, in accordance with expectations, but this did not hamper quantitative analysis. The final method was fully validated as a quantitative confirmatory residue analysis method according to Commission Decision 2002/657/EC and showed satisfactory quantitative performance for all compounds with trueness between 80 and 110% and within-laboratory reproducibility below 22% at target level, except for biapenem. For biapenem, the method proved to be suitable for qualitative analysis only.

  7. Effect of slow energy releasing on divergent detonation of Insensitive High Explosives

    NASA Astrophysics Data System (ADS)

    Hu, Xiaomian; Pan, Hao; Huang, Yong; Wu, Zihui

    2014-03-01

    There exists a slow energy releasing (SER) process in the slow reaction zone located behind the detonation wave due to the carbon cluster in the detonation products of Insensitive High Explosives (IHEs), and the process will affect the divergent detonation wave's propagation and the driving process of the explosives. To study the potential effect, a new artificial burn model including the SER process based on the programmed burn model is proposed in the paper. Quasi-steady analysis of the new model indicates that the nonlinearity of the detonation speed as a function of front curvature owes to the significant change of the reaction rate and the reaction zone length at the sonic state. What's more, in simulating the detonation of IHE JB-9014, the new model including the slow reaction can predict a slower jump-off velocity, in good agreement with the result of the test.

  8. Patient knowledge on reporting adverse drug reactions in Poland

    PubMed Central

    Staniszewska, Anna; Dąbrowska-Bender, Marta; Olejniczak, Dominik; Duda-Zalewska, Aneta; Bujalska-Zadrożny, Magdalena

    2017-01-01

    Aim The aim of the study was to assess patient knowledge on reporting of adverse drug reactions. Materials and methods A prospective study was conducted among 200 patients. The study was based on an original survey composed of 15 single- and multiple-choice questions. The study involved individuals who have experienced adverse reactions as well as individuals who have never experienced any adverse reactions; people over the age of 18; literate; residing in Mazowieckie Voivodeship, who have not been diagnosed with any disease that could compromise their logical thinking skills. Results The respondents who lived in the city had a greater knowledge compared to the respondents who lived in the countryside (Pearson’s χ2=47.70, P=0.0013). The respondents who lived in the city were also more statistically likely to provide a correct answer to the question about the type of adverse reactions to be reported (Pearson’s χ2=50.66, P=0.012). Statistically significant associations were found between the place of residence of the respondents and the correct answer to the question about the data that must be included in the report on adverse reactions (Pearson’s χ2=11.7, P<0.0001). PMID:28096661

  9. Student Reactions to Public Safety Reports of Hate Crimes

    ERIC Educational Resources Information Center

    Kahl, Jessica E.; Koenig, Anne; Smith, Ramon

    2013-01-01

    This study investigated participant's reactions to hate crime versus nonbiased crime incident reports that included more or less detail about the crime using a 2 (victim race: African American, unstated) × 2 (amount of information: vague, detailed) between-subjects factorial design. We hypothesized that participants would be more sympathetic,…

  10. Laboratory Investigation of Organic Aerosol Formation from Aromatic Hydrocarbons

    DOE R&D Accomplishments Database

    Molina, Luisa T.; Molina, Mario J.; Zhang, Renyi

    2006-08-23

    Our work for this DOE funded project includes: (1) measurements of the kinetics and mechanism of the gas-phase oxidation reactions of the aromatic hydrocarbons initiated by OH; (2) measurements of aerosol formation from the aromatic hydrocarbons; and (3) theoretical studies to elucidate the OH-toluene reaction mechanism using quantum-chemical and rate theories.

  11. Trauma in People with Intellectual and Developmental Disabilities: Reactions of Parents and Caregivers to Research Participation

    ERIC Educational Resources Information Center

    Scotti, Joseph R.; Stevens, Sarah B.; Jacoby, Vanessa M.; Bracken, Magdalene R.; Freed, Rachel; Schmidt, Elizabeth

    2012-01-01

    Generally, studies have revealed that only a minority of people are bothered by participation in research on traumatic stress. Severity of traumatic events and subsequent responses are typically unrelated to negative reactions. We included 386 family members and caregivers (respondents) of people with intellectual and developmental disabilities…

  12. Quantum scattering studies of spin-orbit effects in the Cl({sup 2}P) + HCl {yields} ClH + Cl({sup 2}P) reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schatz, G.C.; McCabe, P.; Connor, J.N.L.

    1998-07-01

    The authors present quantum scattering calculations for the Cl + HCl {yields} ClH + Cl reaction in which they include the three electronic states that correlate asymptotically to the ground state of Cl({sup 2}P) + HCl(X{sup 1}{Sigma}{sup +}). The potential surfaces and couplings are taken from the recent work of C.S. Maierle, G.C. Schatz, M.S. Gordon, P. McCabe and J.N.L. Connor, J. Chem. Soc. Farad. Trans. (1997). They are based on extensive ab initio calculations for geometries in the vicinity of the lowest energy saddle point, and on an electrostatic expansion (plus empirical dispersion and repulsion) for long range geometriesmore » including the van der Waals wells. Spin-orbit coupling has been included using a spin-orbit coupling parameter {lambda} that is assumed to be independent of nuclear geometry, and Coriolis interactions are incorporated accurately. The scattering calculations use a hyperspherical coordinate coupled channel method in full dimensionality. AJ-shifting approximation is employed to convert cumulative reaction probabilities for total angular momentum quantum number J = 1/2 into state selected and thermal rate coefficients. Two issues have been studied: (a) the influence of the magnitude of {lambda} on the fine-structure resolved cumulative probabilities and rate coefficients (the authors consider {lambda}`s that vary from 0 to {+-}100% of the true Cl value), and (b) the transition state resonance spectrum, and its variation with {lambda} and with other parameters in the calculations. Cl + HCl is a simple hydrogen transfer reaction which serves as a canonical model both for heavy-light-heavy atom reactions, and for the reactions of halogen atoms with closed shell molecules.« less

  13. Scaffolding Students' Online Critiquing of Expert- and Peer-generated Molecular Models of Chemical Reactions

    NASA Astrophysics Data System (ADS)

    Chang, Hsin-Yi; Chang, Hsiang-Chi

    2013-08-01

    In this study, we developed online critiquing activities using an open-source computer learning environment. We investigated how well the activities scaffolded students to critique molecular models of chemical reactions made by scientists, peers, and a fictitious peer, and whether the activities enhanced the students' understanding of science models and chemical reactions. The activities were implemented in an eighth-grade class with 28 students in a public junior high school in southern Taiwan. The study employed mixed research methods. Data collected included pre- and post-instructional assessments, post-instructional interviews, and students' electronic written responses and oral discussions during the critiquing activities. The results indicated that these activities guided the students to produce overall quality critiques. Also, the students developed a more sophisticated understanding of chemical reactions and scientific models as a result of the intervention. Design considerations for effective model critiquing activities are discussed based on observational results, including the use of peer-generated artefacts for critiquing to promote motivation and collaboration, coupled with critiques of scientific models to enhance students' epistemological understanding of model purpose and communication.

  14. Optical reaction cell and light source for ›18F! fluoride radiotracer synthesis

    DOEpatents

    Ferrieri, Richard A.; Schlyer, David; Becker, Richard J.

    1998-09-15

    Apparatus for performing organic synthetic reactions, particularly no-carrier-added nucleophilic radiofluorination reactions for PET radiotracer production. The apparatus includes an optical reaction cell and a source of broadband infrared radiant energy, which permits direct coupling of the emitted radiant energy with the reaction medium to heat the reaction medium. Preferably, the apparatus includes means for focusing the emitted radiant energy into the reaction cell, and the reaction cell itself is preferably configured to reflect transmitted radiant energy back into the reaction medium to further improve the efficiency of the apparatus. The apparatus is well suited to the production of high-yield syntheses of 2-›.sup.18 F!fluoro-2-deoxy-D-glucose. Also provided is a method for performing organic synthetic reactions, including the manufacture of ›.sup.18 F!-labeled compounds useful as PET radiotracers, and particularly for the preparation of 2-›.sup.18 F!fluoro-2-deoxy-D-glucose in higher yields than previously possible.

  15. Optical reaction cell and light source for [18F] fluoride radiotracer synthesis

    DOEpatents

    Ferrieri, R.A.; Schlyer, D.; Becker, R.J.

    1998-09-15

    An apparatus is disclosed for performing organic synthetic reactions, particularly no-carrier-added nucleophilic radiofluorination reactions for PET radiotracer production. The apparatus includes an optical reaction cell and a source of broadband infrared radiant energy, which permits direct coupling of the emitted radiant energy with the reaction medium to heat the reaction medium. Preferably, the apparatus includes means for focusing the emitted radiant energy into the reaction cell, and the reaction cell itself is preferably configured to reflect transmitted radiant energy back into the reaction medium to further improve the efficiency of the apparatus. The apparatus is well suited to the production of high-yield syntheses of 2-[{sup 18}F]fluoro-2-deoxy-Dglucose. Also provided is a method for performing organic synthetic reactions, including the manufacture of [{sup 18}F]-labeled compounds useful as PET radiotracers, and particularly for the preparation of 2-[{sup 18}F]fluoro-2-deoxy-D-glucose in higher yields than previously possible. 4 figs.

  16. Computational analysis of the roles of biochemical reactions in anomalous diffusion dynamics

    NASA Astrophysics Data System (ADS)

    Naruemon, Rueangkham; Charin, Modchang

    2016-04-01

    Most biochemical processes in cells are usually modeled by reaction-diffusion (RD) equations. In these RD models, the diffusive process is assumed to be Gaussian. However, a growing number of studies have noted that intracellular diffusion is anomalous at some or all times, which may result from a crowded environment and chemical kinetics. This work aims to computationally study the effects of chemical reactions on the diffusive dynamics of RD systems by using both stochastic and deterministic algorithms. Numerical method to estimate the mean-square displacement (MSD) from a deterministic algorithm is also investigated. Our computational results show that anomalous diffusion can be solely due to chemical reactions. The chemical reactions alone can cause anomalous sub-diffusion in the RD system at some or all times. The time-dependent anomalous diffusion exponent is found to depend on many parameters, including chemical reaction rates, reaction orders, and chemical concentrations. Project supported by the Thailand Research Fund and Mahidol University (Grant No. TRG5880157), the Thailand Center of Excellence in Physics (ThEP), CHE, Thailand, and the Development Promotion of Science and Technology.

  17. Temperature-programmed deoxygenation of acetic acid on molybdenum carbide catalysts

    DOE PAGES

    Nash, Connor P.; Farberow, Carrie A.; Hensley, Jesse E.

    2017-02-07

    Temperature programmed reaction (TPRxn) is a simple yet powerful tool for screening solid catalyst performance at a variety of conditions. A TPRxn system includes a reactor, furnace, gas and vapor sources, flow control, instrumentation to quantify reaction products (e.g., gas chromatograph), and instrumentation to monitor the reaction in real time (e.g., mass spectrometer). Here, we apply the TPRxn methodology to study molybdenum carbide catalysts for the deoxygenation of acetic acid, an important reaction among many in the upgrading/stabilization of biomass pyrolysis vapors. TPRxn is used to evaluate catalyst activity and selectivity and to test hypothetical reaction pathways (e.g., decarbonylation, ketonization,more » and hydrogenation). Furthermore, the results of the TPRxn study of acetic acid deoxygenation show that molybdenum carbide is an active catalyst for this reaction at temperatures above ca. 300 °C and that the reaction favors deoxygenation (i.e., C-O bond-breaking) products at temperatures below ca. 400 °C and decarbonylation (i.e., C-C bond-breaking) products at temperatures above ca. 400 °C.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krasnokutski, Serge A.; Huisken, Friedrich; Jäger, Cornelia

    A very high abundance of atomic carbon in the interstellar medium (ISM), and the high reactivity of these species toward different hydrocarbon molecules including benzene, raise questions regarding the stability of polycyclic aromatic hydrocarbon (PAH) molecules in space. To test the efficiency of destruction of PAH molecules via reactions with atomic carbon, we performed a set of laboratory and computational studies of the reactions of naphthalene, anthracene, and coronene molecules with carbon atoms in the ground state. The reactions were investigated in liquid helium droplets at T = 0.37 K and by quantum chemical computations. Our studies suggest that allmore » small and all large catacondensed PAHs react barrierlessly with atomic carbon, and therefore should be efficiently destroyed by such reactions in a broad temperature range. At the same time, large compact pericondensed PAHs should be more inert toward such a reaction. In addition, taking into account their higher photostability, much higher abundances of pericondensed PAHs should be expected in various astrophysical environments. The barrierless reactions between carbon atoms and small PAHs also suggest that, in the ISM, these reactions could lead to the bottom-up formation of PAH molecules.« less

  19. The investigation of degradation reaction of various saccharides in high temperature and high pressure water

    NASA Astrophysics Data System (ADS)

    Saito, T.; Noguchi, S.; Matsumoto, T.; Sasaki, M.; Goto, M.

    2008-07-01

    Recently, conversions of polysaccharides included in biomass resources have been studied in order to recover valuable chemicals. Degradation of polysaccharides has been attracted by many researchers, whereas by-products from secondary reactions of the materials have not been studied very well. For the purpose of understanding reaction behavior of various monosaccharides in high-temperature and high-pressure water regions, we investigated reaction pathway and kinetics through reaction experiments of degradation of saccharides in subcritical water. The experiment was conducted by using continuous flow-type micro-reactors. Glucose was used as the starting material. From the experimental results, the conversion of glucose increased with increasing the residence time. The yields of fructose and 1, 6-anhydro-β-D-glucose decreased with increasing the residence time. The yields of organic acids and some aldehydes increased with increasing the residence time.

  20. Diagnostic patch testing following tuberculosis-associated cutaneous adverse drug reactions induces systemic reactions in HIV-infected persons.

    PubMed

    Lehloenya, R J; Todd, G; Wallace, J; Ngwanya, M R; Muloiwa, R; Dheda, K

    2016-07-01

    The incidence of cutaneous adverse drug reactions (CADRs) to first-line antituberculosis drugs (FLTDs) is higher in HIV-tuberculosis coinfection. However, the utility of patch testing to identify the offending drug in this patient subgroup has been poorly studied. To identify drugs causing adverse drug reactions in patients with HIV-tuberculosis coinfection. Fourteen consecutive patients underwent diagnostic work-up (patch testing followed by a skin prick test and an oral rechallenge) to pinpoint the offending drug after developing FLTD-associated CADR, which included drug rash with eosinophilia and systemic symptoms (n = 12), Stevens-Johnson syndrome (SJS, n = 1) and toxic epidermal necrolysis/SJS overlap (n = 1). A positive reaction to any of the three diagnostic modalities eliminated that drug from the regimen. Once patients were clinically stable postreaction, sequential and additive rechallenge with FLTDs was initiated. Eleven of the 14 participants with FLTD-associated CADR were HIV infected (median CD4 count 149 cells mm(-3) ). In this subgroup, patch testing resulted in generalized systemic reactions in 10 of 11 patients (91%). These included rash in 10 of 13 reactions (77%), eosinophilia in eight (62%), transaminitis in seven (54%) and fever in five (38%). Isoniazid caused six of 13 (46%) generalized systemic reactions, rifampicin four (31%), ethambutol two (15%) and pyrazinamide one reaction. Using the Common Terminology Criteria for Adverse Events, five of 13 reactions were mild, six were moderate and two were severe. There were no life-threatening or fatal reactions. In HIV-infected persons with tuberculosis-associated CADR, although patch-testing reactions to FLTD are common and tend to be associated with systemic features, they are not life threatening or fatal. These data inform clinical practice in HIV-endemic settings. © 2016 British Association of Dermatologists.

  1. THE DYNAMICS OF HYDROGEN ATOM ABSTRACTION FROM POLYATOMIC MOLECULES.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    LIU,X.; SUITS,A.G.

    2002-11-21

    The hydrogen atom abstraction reaction is an important fundamental process that is extensively involved in atmospheric and combustion chemistry. The practical significance of this type of reaction with polyatomic hydrocarbons is manifest, which has led to many kinetics studies. The detailed understanding of these reactions requires corresponding dynamics studies. However, in comparison to the A + HX {radical} AH + X reactions, the study of the dynamics of A + HR {yields} AH + R reactions is much more difficult, both experimentally and theoretically (here and in the following, A stands for an atom, X stands for a halogen atom,more » and R stands for a polyatomic hydrocarbon radical). The complication stems from the structured R, in contrast to the structureless X. First of all, there are many internal degrees of freedom in R that can participate in the reaction. In addition, there are different carbon sites from which an H atom can be abstracted, and the dynamics are correspondingly different; there are also multiple identical carbon sites in HR and in the picture of a local reaction, there exist competitions between neighboring H atoms, and so on. Despite this complexity, there have been continuing efforts to obtain insight into the dynamics of these reactions. In this chapter, some examples are presented, including the reactions of ground state H, Cl, and O atoms, with particular focus on our recent work using imaging to obtain the differential cross sections for these reactions.« less

  2. Single-Plex Quantitative Assays for the Detection and Quantification of Most Pneumococcal Serotypes

    PubMed Central

    Chochua, Sopio; Satzke, Catherine; Dunne, Eileen M.; Mulholland, Kim; Klugman, Keith P.

    2015-01-01

    Streptococcus pneumoniae globally kills more children than any other infectious disease every year. A prerequisite for pneumococcal disease and transmission is colonization of the nasopharynx. While the introduction of pneumococcal conjugate vaccines has reduced the burden of pneumococcal disease, understanding the impact of vaccination on nasopharyngeal colonization has been hampered by the lack of sensitive quantitative methods for the detection of >90 known S. pneumoniae serotypes. In this work, we developed 27 new quantitative (q)PCR reactions and optimized 26 for a total of 53 qPCR reactions targeting pneumococcal serotypes or serogroups, including all vaccine types. Reactions proved to be target-specific with a limit of detection of 2 genome equivalents per reaction. Given the number of probes required for these assays and their unknown shelf-life, the stability of cryopreserved reagents was evaluated. Our studies demonstrate that two-year cryopreserved probes had similar limit of detection as freshly-diluted probes. Moreover, efficiency and limit of detection of 1-month cryopreserved, ready-to-use, qPCR reaction mixtures were similar to those of freshly prepared mixtures. Using these reactions, our proof-of-concept studies utilizing nasopharyngeal samples (N=30) collected from young children detected samples containing ≥2 serotypes/serogroups. Samples colonized by multiple serotypes/serogroups always had a serotype that contributes at least 50% of the pneumococcal load. In addition, a molecular approach called S6-q(PCR)2 was developed and proven to individually detect and quantify epidemiologically-important serogroup 6 strains including 6A, 6B, 6C and 6D. This technology will be useful for epidemiological studies, diagnostic platforms and to study the pneumobiome. PMID:25798884

  3. Low Energy Nuclear Reactions: 2007 Update

    NASA Astrophysics Data System (ADS)

    Krivit, Steven B.

    2007-03-01

    This paper presents an overview of low energy nuclear reactions, a subset of the field of condensed matter nuclear science. Condensed matter nuclear science studies nuclear effects in and/or on condensed matter, including low energy nuclear reactions, an entirely new branch of science that gained widespread attention and notoriety beginning in 1989 with the announcement of a previously unrecognized source of energy by Martin Fleischmann and Stanley Pons that came to be known as cold fusion. Two branches of LENR are recognized. The first includes a set of reactions like those observed by Fleischmann and Pons that use palladium and deuterium and yield excess heat and helium-4. Numerous mechanisms have been proposed to explain these reactions, however there is no consensus for, or general acceptance of, any of the theories. The claim of fusion is still considered speculative and, as such, is not an ideal term for this work. The other branch is a wide assortment of nuclear reactions that may occur with either hydrogen or deuterium. Anomalous nuclear transmutations are reported that involve light as well as heavy elements. The significant questions that face this field of research are: 1) Are LENRs a genuine nuclear reaction? 2) If so, is there a release of excess energy? 3) If there is, is the energy release cost-effective?

  4. Sulfate radical oxidation of aromatic contaminants: a detailed assessment of density functional theory and high-level quantum chemical methods.

    PubMed

    Pari, Sangavi; Wang, Inger A; Liu, Haizhou; Wong, Bryan M

    2017-03-22

    Advanced oxidation processes that utilize highly oxidative radicals are widely used in water reuse treatment. In recent years, the application of sulfate radical (SO 4 ˙ - ) as a promising oxidant for water treatment has gained increasing attention. To understand the efficiency of SO 4 ˙ - in the degradation of organic contaminants in wastewater effluent, it is important to be able to predict the reaction kinetics of various SO 4 ˙ - -driven oxidation reactions. In this study, we utilize density functional theory (DFT) and high-level wavefunction-based methods (including computationally-intensive coupled cluster methods), to explore the activation energies of SO 4 ˙ - -driven oxidation reactions on a series of benzene-derived contaminants. These high-level calculations encompass a wide set of reactions including 110 forward/reverse reactions and 5 different computational methods in total. Based on the high-level coupled-cluster quantum calculations, we find that the popular M06-2X DFT functional is significantly more accurate for OH - additions than for SO 4 ˙ - reactions. Most importantly, we highlight some of the limitations and deficiencies of other computational methods, and we recommend the use of high-level quantum calculations to spot-check environmental chemistry reactions that may lie outside the training set of the M06-2X functional, particularly for water oxidation reactions that involve SO 4 ˙ - and other inorganic species.

  5. Reaction time for processing visual stimulus in a computer-assisted rehabilitation environment.

    PubMed

    Sanchez, Yerly; Pinzon, David; Zheng, Bin

    2017-10-01

    To examine the reaction time when human subjects process information presented in the visual channel under both a direct vision and a virtual rehabilitation environment when walking was performed. Visual stimulus included eight math problems displayed on the peripheral vision to seven healthy human subjects in a virtual rehabilitation training (computer-assisted rehabilitation environment (CAREN)) and a direct vision environment. Subjects were required to verbally report the results of these math calculations in a short period of time. Reaction time measured by Tobii Eye tracker and calculation accuracy were recorded and compared between the direct vision and virtual rehabilitation environment. Performance outcomes measured for both groups included reaction time, reading time, answering time and the verbal answer score. A significant difference between the groups was only found for the reaction time (p = .004). Participants had more difficulty recognizing the first equation of the virtual environment. Participants reaction time was faster in the direct vision environment. This reaction time delay should be kept in mind when designing skill training scenarios in virtual environments. This was a pilot project to a series of studies assessing cognition ability of stroke patients who are undertaking a rehabilitation program with a virtual training environment. Implications for rehabilitation Eye tracking is a reliable tool that can be employed in rehabilitation virtual environments. Reaction time changes between direct vision and virtual environment.

  6. Ophthalmic adverse drug reactions to systemic drugs: a systematic review.

    PubMed

    Miguel, Ana; Henriques, Filipe; Azevedo, Luís Filipe; Pereira, Altamiro Costa

    2014-03-01

    To perform a comprehensive and systematic review regarding ophthalmic adverse drug reactions (ADRs) to systemic drugs to: (i) systematically summarize existing evidence, (ii) identify areas, ophthalmic ADRs or drugs that lacked systematization or assessment (namely drugs with original studies characterizing specific ophthalmic ADRs but without causality assessment nor without meta-analysis). Systematic review of several electronic databases (last search 1/7/2012): Medline, SCOPUS, ISI web of knowledge, ISI Conference Proceedings, International Pharmaceutical Abstracts and Google scholar. Search query included: eye, ocular, ophthalmic, ophthalmology, adverse and reaction. Inclusion criteria were: (i) Primary purpose was to assess an ophthalmic ADR to a systemic medication; (ii) Patient evaluation performed by an ophthalmologist; (iii) Studies that specified diagnostic criteria for an ocular ADR. Different types of studies were included and analyzed separately. Two independent reviewers assessed eligibility criteria, extracted data and evaluated risk of bias. From 562 studies found, 32 were included (1 systematic review to sildenafil, 11 narrative reviews, 1 trial, 1 prospective study, 6 transversal studies, 6 spontaneous reports and 6 case series). Drugs frequently involved included amiodarone, sildenafil, hydroxychloroquine and biphosphonates. Frequent ophthalmic ADRs included: keratopathy, dry eye and retinopathy. To increase evidence about ophthalmic ADRs, there is a need for performing specific systematic reviews, applying strictly the World Health Organization's (WHO) definition of ADR and WHO causality assessment of ADRs. Some ophthalmic ADRs may be frequent, but require ophthalmological examination; therefore, ophthalmologists' education and protocols of collaboration between other specialties whenever they prescribe high-risk drugs are suggestions for the future. Copyright © 2014 John Wiley & Sons, Ltd.

  7. Experimental measurements of low temperature rate coefficients for neutral-neutral reactions of interest for atmospheric chemistry of Titan, Pluto and Triton: reactions of the CN radical.

    PubMed

    Morales, Sébastien B; Le Picard, Sébastien D; Canosa, André; Sims, Ian R

    2010-01-01

    The kinetics of the reactions of cyano radical, CN (X2sigma+) with three hydrocarbons, propane (CH3CH2CH3), propene (CH3CH=CH2) and 1-butyne (CH[triple band]CCH2CH3) have been studied over the temperature range of 23-298 K using a CRESU (Cinétique de Réaction en Ecoulement Supersonique Uniforme or Reaction Kinetics in Uniform Supersonic Flow) apparatus combined with the pulsed laser photolysis-laser induced fluorescence technique. These reactions are of interest for the cold atmospheres of Titan, Pluto and Triton, as they might participate in the formation of nitrogen and carbon bearing molecules, including nitriles, that are thought to play an important role in the formation of hazes and biological molecules. All three reactions are rapid with rate coefficients in excess of 10(-10) cm3 molecule(-1) s(-1) at the lowest temperatures of this study and show behaviour characteristic of barrierless reactions. Temperature dependences, different for each reaction, are compared to those used in the most recent photochemical models of Titan's atmosphere.

  8. Adverse reactions to skin prick testing in children - prevalence and possible risk factors.

    PubMed

    Norrman, Gunilla; Fälth-Magnusson, Karin

    2009-05-01

    Skin prick test (SPT) is usually considered to be a safe procedure, but recently there have been occasional case reports of generalized allergic reactions. This study was performed to delineate the prevalence of, and evaluate possible risk factors for, adverse reactions to SPT in a prospective study. Altogether 5,908 patients aged < or =18 yr from 11 different pediatric settings were included. The adverse reactions were classified into two groups: (1) Generalized allergic reactions (GAR), (2) Vasovagal reactions (VVR). Adverse reactions were observed in 14 out of 5,908 children examined with SPT. Seven of the adverse reactions were GARs and required medication, yielding a 0.12% risk for GAR. Seven of 14 were VVRs, giving the same risk, 0.12%. Identified risk factors for GAR were low age (<1 yr) (RR 6.28) and active eczema (RR 16.98). For VVR, the risk factors were female sex (RR 7.32) and multiple skin pricks performed on a single patient (p < 0.05). We conclude that GARs do occur, albeit rarely, so the need for proper emergency handling should always be acknowledged. The risk factors suggested may help to identify patients who need extra attention.

  9. Fission Activities of the Nuclear Reactions Group in Uppsala

    NASA Astrophysics Data System (ADS)

    Al-Adili, A.; Alhassan, E.; Gustavsson, C.; Helgesson, P.; Jansson, K.; Koning, A.; Lantz, M.; Mattera, A.; Prokofiev, A. V.; Rakopoulos, V.; Sjöstrand, H.; Solders, A.; Tarrío, D.; Österlund, M.; Pomp, S.

    This paper highlights some of the main activities related to fission of the nuclear reactions group at Uppsala University. The group is involved for instance in fission yield experiments at the IGISOL facility, cross-section measurements at the NFS facility, as well as fission dynamics studies at the IRMM JRC-EC. Moreover, work is ongoing on the Total Monte Carlo (TMC) methodology and on including the GEF fission code into the TALYS nuclear reaction code. Selected results from these projects are discussed.

  10. A Critical Evaluation of Studies Employing Alkenyl Halide ’Mechanistic Probe’ as Indicators of Single Electron Transfer Processes.

    DTIC Science & Technology

    1987-07-07

    College Station, TX 77843 Pittsburgh, PA 15260 Introduction: Chemical reactions come about through the reorganization of valence electrons. The notion...Contmnue on reverie of necessary and odentify 0)’ Wooc ,7umor r) Recently it has been suggested that many reaction traditionally classed in polar terms may...evaluates the utility of these alkenyl halide probes as mechanistic probes for SET. Reactions which interfere with the standard analysis ~ include the

  11. Spectral Dependence of Chlorophyll Biosynthesis Pathways in Plant Leaves.

    PubMed

    Belyaeva, O B; Litvin, F F

    2015-12-01

    This review covers studies on the dependence of chlorophyll photobiosynthesis reactions from protochlorophyllide on the spectral composition of actinic light. A general scheme of the reaction sequence for the photochemical stage in chlorophyll biosynthesis for etiolated plant leaves is presented. Comparative analysis of the data shows that the use of light with varied wavelengths for etiolated plant illumination reveals parallel transformation pathways of different protochlorophyllide forms into chlorophyllide, including a pathway for early photosystem II reaction center P-680 pigment formation.

  12. Making a molecular gas in the quantum regime

    NASA Astrophysics Data System (ADS)

    Ni, Kang-Kuen

    2017-04-01

    Ultracold molecules are exciting systems for a large range of scientific explorations including studies of novel phases of matter and precision measurement. In this talk, I will present a brief story of the first quantum gas of molecules, KRb, created under my PhD advisor, Deborah Jin, in 2008. A complete surprise was finding ultracold chemistry in such a system through measurements of reactant losses. In particular, long-range physics that determines KRb reactant collision rates, including van der Waals interactions, quantum statistics, and dipolar interactions, were studied extensively. However, the short-range behavior of these chemical reactions remains unknown. A legacy of her work is carried out in my lab at Harvard, where we are integrating physical chemistry tools with cold atom techniques to study ultracold chemistry with KRb molecules. In particular, we aim to elucidate the four-center reaction 2 KRb ->K2 + Rb2 by detecting the reaction products through ionization - both identify the product species and mapping out their complete quantum states.

  13. Bereavement

    MedlinePlus

    ... as a mental, physical, social or emotional reaction. Mental reactions can include anger, guilt, anxiety, sadness and despair. Physical reactions can include sleeping problems, changes in appetite, physical problems or illness. How long bereavement lasts can depend on how ...

  14. Finite element modeling of contaminant transport in soils including the effect of chemical reactions.

    PubMed

    Javadi, A A; Al-Najjar, M M

    2007-05-17

    The movement of chemicals through soils to the groundwater is a major cause of degradation of water resources. In many cases, serious human and stock health implications are associated with this form of pollution. Recent studies have shown that the current models and methods are not able to adequately describe the leaching of nutrients through soils, often underestimating the risk of groundwater contamination by surface-applied chemicals, and overestimating the concentration of resident solutes. Furthermore, the effect of chemical reactions on the fate and transport of contaminants is not included in many of the existing numerical models for contaminant transport. In this paper a numerical model is presented for simulation of the flow of water and air and contaminant transport through unsaturated soils with the main focus being on the effects of chemical reactions. The governing equations of miscible contaminant transport including advection, dispersion-diffusion and adsorption effects together with the effect of chemical reactions are presented. The mathematical framework and the numerical implementation of the model are described in detail. The model is validated by application to a number of test cases from the literature and is then applied to the simulation of a physical model test involving transport of contaminants in a block of soil with particular reference to the effects of chemical reactions. Comparison of the results of the numerical model with the experimental results shows that the model is capable of predicting the effects of chemical reactions with very high accuracy. The importance of consideration of the effects of chemical reactions is highlighted.

  15. Time course of anger and other emotions in women with borderline personality disorder: a preliminary study.

    PubMed

    Jacob, Gitta A; Guenzler, Cindy; Zimmermann, Sabine; Scheel, Corinna N; Rüsch, Nicolas; Leonhart, Rainer; Nerb, Josef; Lieb, Klaus

    2008-09-01

    Borderline personality disorder (BPD) is characterized by emotional dysregulation including strong emotional reactions to emotional stimuli and a slow return to baseline emotions. Difficulties controlling anger are particularly prominent in BPD. To experimentally test emotional dysregulation with a special focus on anger, we investigated whether a standardized anger induction by a short story caused stronger and prolonged anger reactions in women with BPD (n=27) as compared to female healthy controls (n=26) and whether other emotions were affected by the anger induction. Although the anger reaction was not stronger in the BPD group, it was significantly prolonged. The BPD group showed also stronger negative emotions over the whole experiment. The study is the first to demonstrate prolonged anger reactions in BPD patients in an experimental setting.

  16. Electronic and Vibrational Coherence in Charge-Transfer Reactions

    NASA Astrophysics Data System (ADS)

    Scherer, Norbert

    1996-03-01

    The ultrafast dynamics associated with optically-induced intervalence charge-transfer reactions in solution and protein environments are reported. These studies include the Fe^(II)-Fe^(III) MMCT complex Prussian blue and the mixed valence dimer (CN)_5Ru^(II)CNRuRu^(III)(NH_3)_5. The protein systems include blue copper proteins and the bacterial photosynthetic reaction center. The experimental approaches include photon echo, wavelength-resolved pump-probe and anisotropy measurements performed with 12-16fs duration optical pulses. Complicated time-domain waveforms reflect the several different p[rocesses and time scales for relaxation of coherences (both electronic and vibrational) and populations within these systems. The photon echo and anisotropy results probe electronic coherence and dephasing prior to back electron transfer. Wavelength-resolved pump-probe results reveal vibrational modes coupled to the CT-coordinate as well as formation of new product states or vibrational cooling in the ground state following back electron transfer.

  17. Homogeneous processes of atmospheric interest

    NASA Technical Reports Server (NTRS)

    Rossi, M. J.; Barker, J. R.; Golden, D. M.

    1983-01-01

    Upper atmospheric research programs in the department of chemical kinetics are reported. Topics discussed include: (1) third-order rate constants of atmospheric importance; (2) a computational study of the HO2 + HO2 and DO2 + DO2 reactions; (3) measurement and estimation of rate constants for modeling reactive systems; (4) kinetics and thermodynamics of ion-molecule association reactions; (5) entropy barriers in ion-molecule reactions; (6) reaction rate constant for OH + HOONO2 yields products over the temperature range 246 to 324 K; (7) very low-pressure photolysis of tert-bytyl nitrite at 248 nm; (8) summary of preliminary data for the photolysis of C1ONO2 and N2O5 at 285 nm; and (9) heterogeneous reaction of N2O5 and H2O.

  18. Reaction front dynamics under shear flow for arbitrary Damköhler numbers

    NASA Astrophysics Data System (ADS)

    Bandopadhyay, Aditya; Méheust, Yves; Le Borgne, Tanguy

    2016-04-01

    Reaction fronts where two reactive fluids displace one another play an important role in a range of applications, including contaminant plume transport and reaction, soil and aquifer remediation, CO2 sequestration, geothermal dipoles and the development of hotspots of reaction in mixing zones. The background flow induces enhanced mixing, and therefore reaction, through interfacial shear. Hence the coupling of fluid flow with chemical reactions is pivotal in understanding and quantifying effective reaction kinetics in reaction fronts. While this problem has been addressed in the limit of fast reactions (e.g. de Simoni 2005, Le Borgne 2014), in natural systems reactions can span a large range of Damköhler numbers since their characteristic reaction times vary over a large range of typical values. Here the coupling of shear flow and reversible chemical reactions is studied for a reaction front with initially separated reactants at arbitrary Damköhler numbers. Approximate analytical expressions for the global production rate are derived based on a reactive lamella approach. We observe three distinct regimes, each of them characterized by different scalings of the global production rate and width of the reactive zone. We describe the dependency of these scalings and the associated characteristic transition times as a function of Damköhler and Péclet numbers. These results are validated against 2D numerical simulations. The study is expected to shed light on the inherently complex cases of reactive mixing with varying reaction rates under the influence of an imposed flow. de Simoni et al. (2005) Water Resour. Res., 41, W11410 Le Borgne et al. (2014) GRL, 41(22), 7898

  19. The effect of pre-tectonic reaction and annealing extent on behaviour during subsequent deformation: Insights from paired shear zones in the lower crust of Fiordland, New Zealand

    NASA Astrophysics Data System (ADS)

    Piazolo, Sandra; Daczko, Nathan R.; Smith, James R.; Evans, Lynn

    2015-04-01

    The effect of pre-tectonic reaction and annealing extent on the rheology of lower crustal rocks during a subsequent deformation event was studied using field and detailed microstructural analyses combined with numerical simulations to examine. In the studied rocks (Pembroke granulite, South Island, New Zealand) granulite facies two-pyroxene-pargasite orthogneiss partially to completely reacted to garnet bearing granulite either side of felsic dykes. The metamorphic reaction not only changed the abundance of phases but also their shape and grain size distribution. The reaction is most advanced close to the dykes, whereas further away the reaction is incomplete. As a consequence, grain size and the abundance of the rheologically hard phase garnet decreases away from the felsic dykes. Aspect ratios of mafic clusters which may include garnet decrease from high in the host, to near equidimensional close to the dyke. Post-reaction deformation localized in those areas that experienced minor to moderate reaction extent producing two spaced "paired" shear zones within the garnet-bearing reaction zone at either side of the felsic dykes. Our study shows how rock flow properties are governed by the pre-deformation history of a rock in terms of reaction and coupled annealing extent. If the grain size is sufficiently reduced by metamorphic reaction, deformation localizes in the partially finer grained rock domains, where deformation dominantly occurs by grain size sensitive deformation flow. Even if the reaction produces a nominally stronger phase (e.g. garnet) than the reactants, a local switch in dominant deformation behaviour from a grain size insensitive to a grain size sensitive in reaction induced fine-grained portions of the rock may occur and result in significant strain localization.

  20. Patients with breakthrough reactions to iodinated contrast media have low incidence of positive skin tests.

    PubMed

    Berti, A; Della-Torre, E; Yacoub, Mr; Tombetti, E; Canti, V; Sabbadini, M G; Colombo, G

    2016-07-01

    The term "breakthrough reactions" designates repeated hypersensitivity reactions to iodinated contrast media (ICM) despite premedication with glucocorticoids and antihistamines. We aimed to retrospectively evaluate the rate of positive skin test (STs) in our cohort of patients with previous breakthrough reactions to different ICMs. A series of 35 patients, who experienced at least one breakthrough reaction to ICM and who underwent STs within 6 months from the reaction were studied, and results were compared to a control group of patients with a first hypersensitivity reaction occurred without premedication. Skin prick tests (SPT), intradermal tests (IDT) and patch tests (PT) at different dilutions, with a set of three to four ICM were performed. Of the 35 patients with prior breakthrough reactions, 57% had an immediate reaction (IR) and 43% had a non-immediate reaction (NIR). Patients who experienced the first hypersensitivity IR or NIR, later had one or more breakthrough IR or NIR, respectively. Overall, 29% (10/35) of patients with prior breakthrough reactions resulted positive to STs compared to 57% (16/28) of the control group (p < 0.05). No significant difference in allergy history, age, sex, other clinical / demographic features nor chronic use of ACE-inhibitor, beta-blockers or NSAIDs was observed. This preliminary finding suggests that patients with prior breakthrough reactions have significantly lower immunologically proven ICM reactions (positive STs) if compared to non-breakthrough patients. According to that, a considerable number of breakthrough reactions seems to be non-allergic hypersensitivity reactions or reactions which could be mostly prevented by a proper, well-timed skin testing. Larger prospective studies are needed to confirm these results, with a more careful analysis of patients' risk factors, a laboratory assessment that includes an in vitro allergy diagnostics, and hopefully a drug provocation test for selected cases.

  1. Final technical report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loveland, Walter David

    2016-08-27

    This report describes the research carried out under this grant for the period from 1997 to 2014. This work has been previously described in annual progress reports and renewal applications. As a result of this project, ~100 papers were published in open refereed journals and 107 invited talks were given by the PI. The research subjects covered by this project included the synthesis and characterization of super-heavy nuclei, the critical study of the reaction mechanisms used in these synthesis reactions, the mechanism(s) of intermediate energy and relativistic nuclear collisions, the study of reactions induced by radioactive nuclear beams, and generalmore » properties of the heaviest elements.« less

  2. Rigorous results for the minimal speed of Kolmogorov-Petrovskii-Piscounov monotonic fronts with a cutoffa)

    NASA Astrophysics Data System (ADS)

    Benguria, Rafael D.; Depassier, M. Cristina; Loss, Michael

    2012-12-01

    We study the effect of a cutoff on the speed of pulled fronts of the one-dimensional reaction diffusion equation. To accomplish this, we first use variational techniques to prove the existence of a heteroclinic orbit in phase space for traveling wave solutions of the corresponding reaction diffusion equation under conditions that include discontinuous reaction profiles. This existence result allows us to prove rigorous upper and lower bounds on the minimal speed of monotonic fronts in terms of the cut-off parameter ɛ. From these bounds we estimate the range of validity of the Brunet-Derrida formula for a general class of reaction terms.

  3. Isomerization of glucose into fructose by environmentally friendly Fe/β zeolite catalysts.

    PubMed

    Xu, Siquan; Zhang, Lei; Xiao, Kehao; Xia, Haian

    2017-06-29

    Herein, the environmentally friendly Fe/β zeolite for glucose isomerization to fructose in aqueous media was reported for the first time. The effects of various reaction conditions including reaction temperature, reaction time, catalyst dosage, etc. on the isomerization reaction over Fe/β zeolite were studied in detail. Under the optimized conditions, yield of fructose higher than 20% were obtained. Moreover, the Fe/β zeolite catalysts were stable and remained constant catalytic activity after five consecutive runs. The possible active Fe species for isomerization of glucose in Fe/β zeolite is also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. New mechanistic insights in the NH 3-SCR reactions at low temperature

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruggeri, Maria Pia; Selleri, Tomasso; Nova, Isabella

    2016-05-06

    The present study is focused on the investigation of the low temperature Standard SCR reaction mechanism over Fe- and Cu-promoted zeolites. Different techniques are employed, including in situ DRIFTS, transient reaction analysis and chemical trapping techniques. The results present strong evidence of nitrite formation in the oxidative activation of NO and of their role in SCR reactions. These elements lead to a deeper understanding of the standard SCR chemistry at low temperature and can potentially improve the consistency of mechanistic mathematical models. Furthermore, comprehension of the mechanism on a fundamental level can contribute to the development of improved SCR catalysts.

  5. Model-based analysis of coupled equilibrium-kinetic processes: indirect kinetic studies of thermodynamic parameters using the dynamic data.

    PubMed

    Emami, Fereshteh; Maeder, Marcel; Abdollahi, Hamid

    2015-05-07

    Thermodynamic studies of equilibrium chemical reactions linked with kinetic procedures are mostly impossible by traditional approaches. In this work, the new concept of generalized kinetic study of thermodynamic parameters is introduced for dynamic data. The examples of equilibria intertwined with kinetic chemical mechanisms include molecular charge transfer complex formation reactions, pH-dependent degradation of chemical compounds and tautomerization kinetics in micellar solutions. Model-based global analysis with the possibility of calculating and embedding the equilibrium and kinetic parameters into the fitting algorithm has allowed the complete analysis of the complex reaction mechanisms. After the fitting process, the optimal equilibrium and kinetic parameters together with an estimate of their standard deviations have been obtained. This work opens up a promising new avenue for obtaining equilibrium constants through the kinetic data analysis for the kinetic reactions that involve equilibrium processes.

  6. Students' Ideas about How and Why Chemical Reactions Happen: Mapping the conceptual landscape

    NASA Astrophysics Data System (ADS)

    Yan, Fan; Talanquer, Vicente

    2015-12-01

    Research in science education has revealed that many students struggle to understand chemical reactions. Improving teaching and learning about chemical processes demands that we develop a clearer understanding of student reasoning in this area and of how this reasoning evolves with training in the domain. Thus, we have carried out a qualitative study to explore students reasoning about chemical causality and mechanism. Study participants included individuals at different educational levels, from college to graduate school. We identified diverse conceptual modes expressed by students when engaged in the analysis of different types of reactions. Main findings indicate that student reasoning about chemical reactions is influenced by the nature of the process. More advanced students tended to express conceptual modes that were more normative and had more explanatory power, but major conceptual difficulties persisted in their reasoning. The results of our study are relevant to educators interested in conceptual development, learning progressions, and assessment.

  7. Reconstruction of Tissue-Specific Metabolic Networks Using CORDA

    PubMed Central

    Schultz, André; Qutub, Amina A.

    2016-01-01

    Human metabolism involves thousands of reactions and metabolites. To interpret this complexity, computational modeling becomes an essential experimental tool. One of the most popular techniques to study human metabolism as a whole is genome scale modeling. A key challenge to applying genome scale modeling is identifying critical metabolic reactions across diverse human tissues. Here we introduce a novel algorithm called Cost Optimization Reaction Dependency Assessment (CORDA) to build genome scale models in a tissue-specific manner. CORDA performs more efficiently computationally, shows better agreement to experimental data, and displays better model functionality and capacity when compared to previous algorithms. CORDA also returns reaction associations that can greatly assist in any manual curation to be performed following the automated reconstruction process. Using CORDA, we developed a library of 76 healthy and 20 cancer tissue-specific reconstructions. These reconstructions identified which metabolic pathways are shared across diverse human tissues. Moreover, we identified changes in reactions and pathways that are differentially included and present different capacity profiles in cancer compared to healthy tissues, including up-regulation of folate metabolism, the down-regulation of thiamine metabolism, and tight regulation of oxidative phosphorylation. PMID:26942765

  8. Melamine-modified urea formaldehyde resin for bonding particleboards

    Treesearch

    Chung-Yun Hse; Feng Fu; Hui Pan

    2008-01-01

    For the development of a cost-effective melamine-modified urea formaldehyde resin (MUF), the study evaluated the effects of reaction pH and melamine content on resin properties and bond performance of the MUF resin adhesive systems. Eight resins, each with three replicates, were prepared in a factorial experiment that included two formulation variables: two reaction...

  9. Theoretical Studies of Chemical Reactions following Electronic Excitation

    NASA Technical Reports Server (NTRS)

    Chaban, Galina M.

    2003-01-01

    The use of multi-configurational wave functions is demonstrated for several processes: tautomerization reactions in the ground and excited states of the DNA base adenine, dissociation of glycine molecule after electronic excitation, and decomposition/deformation of novel rare gas molecules HRgF. These processes involve bond brealung/formation and require multi-configurational approaches that include dynamic correlation.

  10. The interaction of small particles and thin films of metals with gases. I - A brief review of the early stages of oxide formation

    NASA Technical Reports Server (NTRS)

    Poppa, H.

    1976-01-01

    Existing work on gas-solid reactions making use of thin film technologies is reviewed. The discussion concentrates on two major areas of gas-metal interactions: chemisorption and the early stages of oxidation of metals (characterized by a non-volatile reaction product) and catalytic surface reactions (featuring volatile reaction products). A brief survey of oxide formation on metals is presented. Here it is of importance to distinguish between reactions on continuous thin film substrates and reactions on particulate deposits. Small particle-gas interactions also affect the nucleation, growth and sintering processes of thin films. It is shown that various combinations of UHV and high resolution electron microscopy techniques, which include in situ experimentation, can provide the appropriate tools for studying angstrom particle chemistry.

  11. A study of various synthetic routes to produce a halogen-labeled traction fluid

    NASA Technical Reports Server (NTRS)

    Jones, W. R., Jr.; Zimmer, H.

    1978-01-01

    Several synthetic routes were studied for the synthesis of the compound 1, 1, 3-trimethyl-1, 3-dicyclohexyl-2 chloropropane. This halogen-labeled fluid would be of use in the study of high traction lubricants under elastohydrodynamic lubrication conditions using infrared emission spectroscopy. The synthetic routes included: dimerization of alpha-methylstyrene, methanol addition to alpha-methylstyrene, a Wittig reaction, and an organometallic approach. Because of steric hindrance and competing reactions, none of these routes were successful.

  12. Ethylene Decomposition Initiated by Ultraviolet Radiation from Low Pressure Mercury Lamps: Kinetics Model Prediction and Experimental Verification.

    NASA Astrophysics Data System (ADS)

    Jozwiak, Zbigniew Boguslaw

    1995-01-01

    Ethylene is an important auto-catalytic plant growth hormone. Removal of ethylene from the atmosphere surrounding ethylene-sensitive horticultural products may be very beneficial, allowing an extended period of storage and preventing or delaying the induction of disorders. Various ethylene removal techniques have been studied and put into practice. One technique is based on using low pressure mercury ultraviolet lamps as a source of photochemical energy to initiate chemical reactions that destroy ethylene. Although previous research showed that ethylene disappeared in experiments with mercury ultraviolet lamps, the reactions were not described and the actual cause of ethylene disappearance remained unknown. Proposed causes for this disappearance were the direct action of ultraviolet rays on ethylene, reaction of ethylene with ozone (which is formed when air or gas containing molecular oxygen is exposed to radiation emitted by this type of lamp), or reactions with atomic oxygen leading to formation of ozone. The objective of the present study was to determine the set of physical and chemical actions leading to the disappearance of ethylene from artificial storage atmosphere under conditions of ultraviolet irradiation. The goal was achieved by developing a static chemical model based on the physical properties of a commercially available ultraviolet lamp, the photochemistry of gases, and the kinetics of chemical reactions. The model was used to perform computer simulations predicting time dependent concentrations of chemical species included in the model. Development of the model was accompanied by the design of a reaction chamber used for experimental verification. The model provided a good prediction of the general behavior of the species involved in the chemistry under consideration; however the model predicted lower than measured rate of ethylene disappearance. Some reasons for the model -experiment disagreement are radiation intensity averaging, the experimental technique, mass transfer in the chamber, and incompleteness of the set of chemical reactions included in the model. The work is concluded with guidelines for development of a more complex mathematical model that includes elements of mass transfer inside the reaction chamber, and uses a three dimensional approach to distribute radiation from the low pressure mercury ultraviolet tube.

  13. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  14. Theoretical study on the identity ion pair SN2 reactions of LiX with CH3SX (X=Cl, Br, and I): structure, mechanism, and potential energy surface.

    PubMed

    Ren, Yi; Gai, Jing-Gang; Xiong, Yan; Lee, Kuo-Hsing; Chu, San-Yan

    2007-07-26

    Three archetypal ion pair nucleophilic substitution reactions at the methylsulfenyl sulfur atom LiX+CH3SX-->XSCH3+LiX (X=Cl, Br, and I) are investigated by the modified Gaussian-2 theory. Including lithium cation in the anionic models makes the ion pair reactions proceed along an SN2 mechanism, contrary to the addition-elimination pathway occurring in the corresponding anionic nucleophilic substitution reactions X-+CH3SX-->XSCH3+X-. Two reaction pathways for the ion pair SN2 reactions at sulfur, inversion and retention, are proposed. Results indicate the inversion pathway is favorable for all the halogens. Comparison of the transition structures and energetics for the ion pair SN2 at sulfur with the potential competition ion pair SN2 reactions at carbon LiX+CH3SX-->XCH3+LiXS shows that the SN2 reactions at carbon are not favorable from the viewpoints of kinetics and thermodynamics.

  15. Ascertainment of risk of serious adverse reactions associated with chemoprophylactic antimalarial drugs.

    PubMed Central

    Phillips-Howard, P. A.; Bjorkman, A. B.

    1990-01-01

    Serious adverse reactions during malaria chemoprophylaxis are reviewed. Three drugs considered to have caused serious reactions in recent years are pyrimethamine/sulfadoxine (Fansidar), pyrimethamine/dapsone (Maloprim) and amodiaquine. These reactions are principally independent of dose and cannot be determined during screening for optimal doses. However, host factors may precipitate dose-dependent reactions, some of which could be avoided with improvements in drug licensing. Since serious and life-threatening reactions are relatively rare (between 1:1000 and 1:20,000), Phase I to III trials cannot identify them. Reliance must therefore be placed on Phase IV post-marketing studies, including ongoing reviews of national registers, and specially tailored studies to identify the risk using prescription-event monitoring in high-risk populations. Occasionally, medical-record linkage, case-control and cohort studies may provide supportive data. Although large numbers of travellers must, of necessity, be exposed to a drug before relatively rare reactions are identified, the ascertainment of risk using post-marketing surveillance was prevented by the following five deficiencies: lack of awareness of early alerts, inadequate use of national registers, poor attention to epidemiological and statistical rigour, inadequate verification of denominators, and inadequacy of data records. Recommendations are given for minimizing such errors in the future. PMID:2208562

  16. HIV Status Disclosure in the Workplace: Positive and Stigmatizing Experiences of Health Care Workers Living with HIV.

    PubMed

    Stutterheim, Sarah E; Brands, Ronald; Baas, Ineke; Lechner, Lilian; Kok, Gerjo; Bos, Arjan E R

    We explored workplace experiences of 10 health care providers with HIV in the Netherlands. We used semi-structured interviews to discuss motivations for disclosure and concealment, reactions to disclosures, the impact of reactions, and coping with negative reactions. Reasons for disclosure were wanting to share the secret, expecting positive responses, observing positive reactions to others, wanting to prevent negative reactions, and being advised to disclose. Reasons for concealment included fearing negative reactions, observing negative reactions, previous negative experiences, having been advised to conceal, and considering disclosure unnecessary. Positive reactions included seeing HIV as a nonissue; showing interest, support, and empathy; and maintaining confidentiality. Negative reactions included management wanting to inform employees, work restrictions, hiring difficulties, gossip, and hurtful comments, resulting in participants being upset, taken aback, angry, depressed, or feeling resignation. Participants coped by providing information, standing above the experience, attributing reactions to ignorance, seeking social support, or leaving their jobs. Copyright © 2017 Association of Nurses in AIDS Care. Published by Elsevier Inc. All rights reserved.

  17. Evaluation of Sexual Communication Message Strategies

    PubMed Central

    2011-01-01

    Parent-child communication about sex is an important proximal reproductive health outcome. But while campaigns to promote it such as the Parents Speak Up National Campaign (PSUNC) have been effective, little is known about how messages influence parental cognitions and behavior. This study examines which message features explain responses to sexual communication messages. We content analyzed 4 PSUNC ads to identify specific, measurable message and advertising execution features. We then develop quantitative measures of those features, including message strategies, marketing strategies, and voice and other stylistic features, and merged the resulting data into a dataset drawn from a national media tracking survey of the campaign. Finally, we conducted multivariable logistic regression models to identify relationships between message content and ad reactions/receptivity, and between ad reactions/receptivity and parents' cognitions related to sexual communication included in the campaign's conceptual model. We found that overall parents were highly receptive to the PSUNC ads. We did not find significant associations between message content and ad reactions/receptivity. However, we found that reactions/receptivity to specific PSUNC ads were associated with increased norms, self-efficacy, short- and long-term expectations about parent-child sexual communication, as theorized in the conceptual model. This study extends previous research and methods to analyze message content and reactions/receptivity. The results confirm and extend previous PSUNC campaign evaluation and provide further evidence for the conceptual model. Future research should examine additional message content features and the effects of reactions/receptivity. PMID:21599875

  18. Youth’s Reactions to Disasters and the Factors That Influence Their Response

    PubMed Central

    Pfefferbaum, Betty; Houston, J. Brian; North, Carol S.; Regens, James L.

    2009-01-01

    Youth’s reactions to disasters include stress reactions, posttraumatic stress disorder (PTSD), and comorbid conditions. A number of factors contribute to outcome including characteristics of the event; the nature of the youth’s exposure; and individual, family, and social predictors. Demographic features may be less important than exposure and other individual variables like preexisting conditions and exposure to other trauma. While youth’s disaster reactions reflect their developmental status and thus may differ from those of adults, their reactions generally parallel those of their parents in degree. Family factors that appear to influence youth’s reactions include parental reactions and the quality of interactions within the family. Social factors have not been well examined. We describe these outcomes and predictors to prepare professionals who may work with youth in post-disaster situations. PMID:19953191

  19. Anomalous dielectric relaxation with linear reaction dynamics in space-dependent force fields.

    PubMed

    Hong, Tao; Tang, Zhengming; Zhu, Huacheng

    2016-12-28

    The anomalous dielectric relaxation of disordered reaction with linear reaction dynamics is studied via the continuous time random walk model in the presence of space-dependent electric field. Two kinds of modified reaction-subdiffusion equations are derived for different linear reaction processes by the master equation, including the instantaneous annihilation reaction and the noninstantaneous annihilation reaction. If a constant proportion of walkers is added or removed instantaneously at the end of each step, there will be a modified reaction-subdiffusion equation with a fractional order temporal derivative operating on both the standard diffusion term and a linear reaction kinetics term. If the walkers are added or removed at a constant per capita rate during the waiting time between steps, there will be a standard linear reaction kinetics term but a fractional order temporal derivative operating on an anomalous diffusion term. The dielectric polarization is analyzed based on the Legendre polynomials and the dielectric properties of both reactions can be expressed by the effective rotational diffusion function and component concentration function, which is similar to the standard reaction-diffusion process. The results show that the effective permittivity can be used to describe the dielectric properties in these reactions if the chemical reaction time is much longer than the relaxation time.

  20. Experimental and Theoretical Studies on the Nazarov Cyclization/Wagner-Meerwein Rearrangement Sequence

    PubMed Central

    Lebœuf, David; Ciesielski, Jennifer

    2012-01-01

    Highly functionalized cyclopentenones can be generated stereospecifically by a chemoselective copper(II)-mediated Nazarov/Wagner-Meerwein rearrangement sequence of divinyl ketones. A detailed investigation of this sequence is described including a study of substrate scope and limitations. After the initial 4π electrocyclization, this reaction proceeds via two different sequential [1,2]-shifts, with selectivity that depends upon either migratory ability or the steric bulkiness of the substituents at C1 and C5. This methodology allows the creation of vicinal stereogenic centers, including adjacent quaternary centers. This sequence can also be achieved by using a catalytic amount of copper(II) in combination with NaBAr4f, a weak Lewis acid. During the study of the scope of the reaction, a partial or complete E / Z isomerization of the enone moiety was observed in some cases prior to the cyclization, which resulted in a mixture of diastereomeric products. Use of a Cu(II)-bisoxazoline complex prevented the isomerization, allowing high diastereoselectivity to be obtained in all substrate types. In addition, the reaction sequence was studied by DFT computations at the UB3LYP/6-31G(d,p) level, which are consistent with the proposed sequences observed, including E / Z isomerizations and chemoselective Wagner-Meerwein shifts. PMID:22471833

  1. 40 CFR 761.185 - Certification program and retention of records by importers and persons generating PCBs in...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., if no processes or imports require reports at the time, within 90 days of having processes or imports... information: (i) Theoretical analysis. Manufacturers records must include: the reaction or reactions believed... records must include: the reaction or reactions believed to be generating PCBs and the levels of PCBs...

  2. 40 CFR 761.185 - Certification program and retention of records by importers and persons generating PCBs in...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., if no processes or imports require reports at the time, within 90 days of having processes or imports... information: (i) Theoretical analysis. Manufacturers records must include: the reaction or reactions believed... records must include: the reaction or reactions believed to be generating PCBs and the levels of PCBs...

  3. 40 CFR 761.185 - Certification program and retention of records by importers and persons generating PCBs in...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., if no processes or imports require reports at the time, within 90 days of having processes or imports... information: (i) Theoretical analysis. Manufacturers records must include: the reaction or reactions believed... records must include: the reaction or reactions believed to be generating PCBs and the levels of PCBs...

  4. 40 CFR 761.185 - Certification program and retention of records by importers and persons generating PCBs in...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., if no processes or imports require reports at the time, within 90 days of having processes or imports... information: (i) Theoretical analysis. Manufacturers records must include: the reaction or reactions believed... records must include: the reaction or reactions believed to be generating PCBs and the levels of PCBs...

  5. Simultaneous Transformation of Commingled Trichloroethylene, Tetrachloroethylene, and 1,4-Dioxane by a Microbially Driven Fenton Reaction in Batch Liquid Cultures.

    PubMed

    Sekar, Ramanan; Taillefert, Martial; DiChristina, Thomas J

    2016-11-01

    Improper disposal of 1,4-dioxane and the chlorinated organic solvents trichloroethylene (TCE) and tetrachloroethylene (also known as perchloroethylene [PCE]) has resulted in widespread contamination of soil and groundwater. In the present study, a previously designed microbially driven Fenton reaction system was reconfigured to generate hydroxyl (HO˙) radicals for simultaneous transformation of source zone levels of single, binary, and ternary mixtures of TCE, PCE, and 1,4-dioxane. The reconfigured Fenton reaction system was driven by fed batch cultures of the Fe(III)-reducing facultative anaerobe Shewanella oneidensis amended with lactate, Fe(III), and contaminants and exposed to alternating anaerobic and aerobic conditions. To avoid contaminant loss due to volatility, the Fe(II)-generating, hydrogen peroxide-generating, and contaminant transformation phases of the microbially driven Fenton reaction system were separated. The reconfigured Fenton reaction system transformed TCE, PCE, and 1,4-dioxane either as single contaminants or as binary and ternary mixtures. In the presence of equimolar concentrations of PCE and TCE, the ratio of the experimentally derived rates of PCE and TCE transformation was nearly identical to the ratio of the corresponding HO˙ radical reaction rate constants. The reconfigured Fenton reaction system may be applied as an ex situ platform for simultaneous degradation of commingled TCE, PCE, and 1,4-dioxane and provides valuable information for future development of in situ remediation technologies. A microbially driven Fenton reaction system [driven by the Fe(III)-reducing facultative anaerobe S. oneidensis] was reconfigured to transform source zone levels of TCE, PCE, and 1,4-dioxane as single contaminants or as binary and ternary mixtures. The microbially driven Fenton reaction may thus be applied as an ex situ platform for simultaneous degradation of at least three (and potentially more) commingled contaminants. Additional targets for ex situ and in situ degradation by the microbially driven Fenton reaction developed in the present study include multiple combinations of environmental contaminants susceptible to attack by Fenton reaction-generated HO˙ radicals, including commingled plumes of 1,4-dioxane, pentachlorophenol (PCP), PCE, TCE, 1,1,2-trichloroethane (TCA), and perfluoroalkylated substances (PFAS). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Simultaneous Transformation of Commingled Trichloroethylene, Tetrachloroethylene, and 1,4-Dioxane by a Microbially Driven Fenton Reaction in Batch Liquid Cultures

    PubMed Central

    Sekar, Ramanan; Taillefert, Martial

    2016-01-01

    ABSTRACT Improper disposal of 1,4-dioxane and the chlorinated organic solvents trichloroethylene (TCE) and tetrachloroethylene (also known as perchloroethylene [PCE]) has resulted in widespread contamination of soil and groundwater. In the present study, a previously designed microbially driven Fenton reaction system was reconfigured to generate hydroxyl (HO˙) radicals for simultaneous transformation of source zone levels of single, binary, and ternary mixtures of TCE, PCE, and 1,4-dioxane. The reconfigured Fenton reaction system was driven by fed batch cultures of the Fe(III)-reducing facultative anaerobe Shewanella oneidensis amended with lactate, Fe(III), and contaminants and exposed to alternating anaerobic and aerobic conditions. To avoid contaminant loss due to volatility, the Fe(II)-generating, hydrogen peroxide-generating, and contaminant transformation phases of the microbially driven Fenton reaction system were separated. The reconfigured Fenton reaction system transformed TCE, PCE, and 1,4-dioxane either as single contaminants or as binary and ternary mixtures. In the presence of equimolar concentrations of PCE and TCE, the ratio of the experimentally derived rates of PCE and TCE transformation was nearly identical to the ratio of the corresponding HO˙ radical reaction rate constants. The reconfigured Fenton reaction system may be applied as an ex situ platform for simultaneous degradation of commingled TCE, PCE, and 1,4-dioxane and provides valuable information for future development of in situ remediation technologies. IMPORTANCE A microbially driven Fenton reaction system [driven by the Fe(III)-reducing facultative anaerobe S. oneidensis] was reconfigured to transform source zone levels of TCE, PCE, and 1,4-dioxane as single contaminants or as binary and ternary mixtures. The microbially driven Fenton reaction may thus be applied as an ex situ platform for simultaneous degradation of at least three (and potentially more) commingled contaminants. Additional targets for ex situ and in situ degradation by the microbially driven Fenton reaction developed in the present study include multiple combinations of environmental contaminants susceptible to attack by Fenton reaction-generated HO˙ radicals, including commingled plumes of 1,4-dioxane, pentachlorophenol (PCP), PCE, TCE, 1,1,2-trichloroethane (TCA), and perfluoroalkylated substances (PFAS). PMID:27542932

  7. Safety of meropenem in patients reporting penicillin allergy: lack of allergic cross reactions.

    PubMed

    Cunha, B A; Hamid, N S; Krol, V; Eisenstein, L

    2008-04-01

    Over the years, meropenem has become the mainstay of empiric therapy for serious systemic infections in critically ill patients. Although we have had extensive clinical experience since 1996 using meropenem safely in treating hundreds of patients with reported allergic reactions to penicillin without any adverse events, we have not published our experience. This study was conducted to document our clinical practice experience. Accordingly, over a 12-month period we prospectively monitored 110 patients treated with meropenem reporting penicillin allergic reactions for that 12-month period. Since early empiric therapy in such patients is essential, there is often no time for penicillin skin testing. Penicillin skin testing was not done in this "real world" clinical study. Patients were divided into two groups, depending on the nature of their penicillin allergic reactions. During a 12-month period, 110 patients with non-anaphylactic (59) and anaphylactic (51) penicillin allergic reactions tolerated prolonged meropenem therapy (1-4 weeks) safely without any allergic reactions. Based on these data and our previous clinical experience, there appears to be little/no potential cross reactivity between meropenem and penicillins even in patients with a definite history of anaphylactic reactions to penicillins. To the best of our knowledge, this is the first prospective clinical study demonstrating that meropenem may be safely given to patients with known/unknown allergic reactions to penicillin, including those with anaphylactic reactions, without penicillin skin testing. We conclude that meropenem may be given safely to patients reporting a history of non-anaphylactic or anaphylactic allergic reactions to penicillins without penicillin skin testing.

  8. Nuclear Data Sheets page at the NNDC

    Science.gov Websites

    for ENDF. 2014 - ND2013 Conference Proceedings. Topics include the opening and plenary talks, ENDF-6 Conference Proceedings. Topics include neutron induced reactions, gamma and charged particle induced . Topics include mass evaluations, nuclear structure, antineutrino studies, medical physics, education, and

  9. Mild Palladium Catalyzed ortho C-H Bond Functionalizations of Aniline Derivatives.

    PubMed

    Tischler, Ms Orsolya; Tóth, Mr Balázs; Novák, Zoltán

    2017-02-01

    This account collects the developments and transformations which avoid the utilization of harsh reaction conditions in the field of palladium catalyzed, ortho-directed C-H activation of aniline derivatives from the first attempts to up-to-date results, including the results of our research laboratory. The discussed functionalizations performed under mild conditions include acylation, olefination, arylation, alkylation, alkoxylation reactions. Beside the optimization studies and the synthetic applications mechanistic investigations are also presented. © 2017 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Glycoconjugate Oxime Formation Catalyzed at Neutral pH: Mechanistic Insights and Applications of 1,4-Diaminobenzene as a Superior Catalyst for Complex Carbohydrates.

    PubMed

    Østergaard, Mads; Christensen, Niels Johan; Hjuler, Christian T; Jensen, Knud J; Thygesen, Mikkel B

    2018-04-18

    The reaction of unprotected carbohydrates with aminooxy reagents to provide oximes is a key method for the construction of glycoconjugates. Aniline and derivatives serve as organocatalysts for the formation of oximes from simple aldehydes, and we have previously reported that aniline also catalyzes the formation of oximes from the more complex aldehydes, carbohydrates. Here, we present a comprehensive study of the effect of aniline analogues on the formation of carbohydrate oximes and related glycoconjugates depending on organocatalyst structure, pH, nucleophile, and carbohydrate, covering more than 150 different reaction conditions. The observed superiority of the 1,4-diaminobenzene (PDA) catalyst at neutral pH is rationalized by NMR analyses and DFT studies of reaction intermediates. Carbohydrate oxime formation at pH 7 is demonstrated by the formation of a bioactive glycoconjugate from a labile, decorated octasaccharide originating from exopolysaccharides of the soil bacterium Mesorhizobium loti. This study of glycoconjugate formation includes the first direct comparison of aniline-catalyzed reaction rates and equilibrium constants for different classes of nucleophiles, including primary oxyamines, secondary N-alkyl oxyamines, as well as aryl and arylsulfonyl hydrazides. We identified 1,4-diaminobenzene as a superior catalyst for the construction of oxime-linked glycoconjugates under mild conditions.

  11. Reactions to Participating in Intimate Partner Violence and Minority Stress Research: A Mixed Methodological Study of Self-Identified Lesbian and Gay Emerging Adults.

    PubMed

    Edwards, Katie M; Sylaska, Kateryna M

    2016-01-01

    The purpose of this study was to examine lesbian and gay (LG) young adults' reactions to participating in intimate partner violence (IPV) and minority stress research using a mixed methodological design. Participants were 277 U.S. college students currently involved in same-sex relationships and self-identified cisgender LG who completed an online questionnaire that included closed- and open-ended questions. Results suggested that IPV research was well tolerated by the vast majority of participants; close to one in 10 participants reported being upset by the study questions, yet 75% of upset individuals reported some level of personal benefit. Reasons for upset as identified in the open-ended responses included thinking about personal experiences with IPV, as the perpetrator or friend of a victim, as well as thinking about the uncertainty of their future with their current partner. The correlates of emotional reactions and personal benefits to research participation were also examined, and these varied among gay men and lesbian women. Implications of these findings underscore the importance of accurate reflection of risk and benefits in informed consent documents as well as systematic evaluation of sexual minority participants' reactions to research participation in an effort to conduct ethically sound sexual science research.

  12. Chemical Reactions in Supercritical Carbon Dioxide

    NASA Astrophysics Data System (ADS)

    Wai, Chien M.; Hunt, Fred; Ji, Min; Chen, Xiaoyuan

    1998-12-01

    Utilizing supercritical fluids as environmentally benign solvents for chemical synthesis is one of the new approaches in the "greening" of chemistry. Carbon dioxide is the most widely used gas for supercritical fluid studies because of its moderate critical constants, nontoxic nature, and availability in pure form. One unique property of supercritical carbon dioxide (sc-CO2) is its high solubility for fluorinated compounds. Thus sc-CO2 can be used to replace Freons that are conventionally used as solvents for synthesis of perfluoro-polymers. Another property of sc-CO2 is its miscibility with gases such as H2. Heterogeneous reactions involving these gases may become homogeneous reactions in sc-CO2. Reactions in sc-CO2 may offer several advantages including controlling phase behavior and products, increasing speed of reactions, and obtaining specific reaction channels. This paper describes the following nine types of chemical reactions reported in the literature utilizing sc-CO2 as a solvent to illustrate the unique properties of the supercritical fluid reaction systems: (i) hydrogenation and hydroformylation, (ii) synthesis of organometallic compounds, (iii) metal chelation and extraction, (iv) preparation of inorganic nanoparticles, (v) stereo-selectivity of lipase-catalyzed reactions, (vi) asymmetric catalytic hydrogenation, (vii) polymerization, (viii) Diels-Alder reaction, and (ix) free radical reactions.

  13. Studies of the quenching phenomenon in delayed contact hypersensitivity reactions.

    PubMed

    Basketter, D A; Allenby, C F

    1991-09-01

    Studies in guinea pig and man have shown that eugenol can quench non-specifically contact urticarial responses, whereas limonene seems largely ineffective. In a comprehensive series of studies, there was little evidence of quenching of delayed contact hypersensitivity reactions to cinnamic aldehyde or citral, including in 'pre-quenched' material supplied by a perfume/flavour company, and in a similar mixture prepared in this laboratory, in the guinea pig model. In addition, there was no evidence of the quenching by eugenol of allergic reactions to cinnamic aldehyde in a panel of human subjects with a proven history of cinnamic-aldehyde-induced allergic contact dermatitis. Overall, the results lend little credibility to earlier literature reports of quenching phenomena in delayed contact hypersensitivity responses.

  14. Method and apparatus for conversion of carbonaceous materials to liquid fuel

    DOEpatents

    Lux, Kenneth W.; Namazian, Mehdi; Kelly, John T.

    2015-12-01

    Embodiments of the invention relates to conversion of hydrocarbon material including but not limited to coal and biomass to a synthetic liquid transportation fuel. The invention includes the integration of a non-catalytic first reaction scheme, which converts carbonaceous materials into a solid product that includes char and ash and a gaseous product; a non-catalytic second reaction scheme, which converts a portion of the gaseous product from the first reaction scheme to light olefins and liquid byproducts; a traditional gas-cleanup operations; and the third reaction scheme to combine the olefins from the second reaction scheme to produce a targeted fuel like liquid transportation fuels.

  15. Amphiphilic phase-transforming catalysts for transesterification of triglycerides

    NASA Astrophysics Data System (ADS)

    Nawaratna, Gayan Ivantha

    Heterogeneous catalytic reactions that involve immiscible liquid-phase reactants are challenging to conduct due to limitations associated with mass transport. Nevertheless, there are numerous reactions such as esterification, transesterification, etherification, and hydrolysis where two immiscible liquid reactants (such as polar and non-polar liquids) need to be brought into contact with a catalyst. With the intention of alleviating mass transport issues associated with such systems but affording the ability to separate the catalyst once the reaction is complete, the overall goal of this study is geared toward developing a catalyst that has emulsification properties as well as the ability to phase-transfer (from liquid-phase to solid-phase) while the reaction is ongoing and evaluating the effectiveness of such a catalytic process in a practical reaction. To elucidate this concept, the transesterification reaction was selected. Metal-alkoxides that possess acidic and basic properties (to catalyze the reaction), amphiphilic properties (to stabilize the alcohol/oil emulsion) and that can undergo condensation polymerization when heated (to separate as a solid subsequent to the completion of the reaction) were used to test the concept. Studies included elucidating the effect of metal sites and alkoxide sites and their concentration effects on transesterification reaction, effect of various metal alkoxide groups on the phase stability of the reactant system, and kinetic effects of the reaction system. The studies revealed that several transition-metal alkoxides, especially, titanium and yttrium based, responded positively to this reaction system. These alkoxides were able to be added to the reaction medium in liquid phase and were able to stabilize the alcohol/oil system. The alkoxides were selective to the transesterification reaction giving a range of ester yields (depending on the catalyst used). It was also observed that transition-metal alkoxides were able to be recovered in the form of their polymerized counterparts as a result of condensation polymerization subsequent to completion of the transesterification reaction.

  16. Quantum chemical study on gas phase pyrolysis of p-isopropenylphenol.

    PubMed

    Mohan Verma, Anand; Kawale, Harshal D; Agrawal, Kushagra; Kishore, Nanda

    2018-05-01

    In the pyrolysis of Sphagnum moss species, p-isopropenylphenol (p-IPP) is a major product which has been considered in this density functional theory based computational study for its conversion to various products such as benzene, phenol, 4-propenylphenol, indan-5-ol, 4-propylcyclohexanone, 4-cyclopropylphenol, etc. In order to achieve these products, eight different reaction schemes are performed using B3LYP/6-311 + g (d,p) level of theory. Further, thermodynamic properties such as reaction free energies and reaction enthalpies associated with these eight reaction schemes are developed in the temperature range of 298-898 K. The reaction schemes that include partial hydrogenation of the aromatic carbon followed by elimination of functional groups are found to demand low activation energy. The production of benzene from p-IPP with isopropenylbenzene as an intermediate product requiring only 19.83 kcal/mol of activation energy is the rate limiting reaction step. Indan-5-ol produced from p-IPP is validated with the literature results and found excellent agreement between two results. Furthermore, the temperature is found to have phenomenal effect in each reaction scheme. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Measurement of 235U(n,n'γ) and 235U(n,2nγ) reaction cross sections

    NASA Astrophysics Data System (ADS)

    Kerveno, M.; Thiry, J. C.; Bacquias, A.; Borcea, C.; Dessagne, P.; Drohé, J. C.; Goriely, S.; Hilaire, S.; Jericha, E.; Karam, H.; Negret, A.; Pavlik, A.; Plompen, A. J. M.; Romain, P.; Rouki, C.; Rudolf, G.; Stanoiu, M.

    2013-02-01

    The design of generation IV nuclear reactors and the studies of new fuel cycles require knowledge of the cross sections of various nuclear reactions. Our research is focused on (n,xnγ) reactions occurring in these new reactors. The aim is to measure unknown cross sections and to reduce the uncertainty on present data for reactions and isotopes of interest for transmutation or advanced reactors. The present work studies the 235U(n,n'γ) and 235U(n,2nγ) reactions in the fast neutron energy domain (up to 20 MeV). The experiments were performed with the Geel electron linear accelerator GELINA, which delivers a pulsed white neutron beam. The time characteristics enable measuring neutron energies with the time-of-flight (TOF) technique. The neutron induced reactions [in this case inelastic scattering and (n,2n) reactions] are identified by on-line prompt γ spectroscopy with an experimental setup including four high-purity germanium (HPGe) detectors. A fission ionization chamber is used to monitor the incident neutron flux. The experimental setup and analysis methods are presented and the model calculations performed with the TALYS-1.2 code are discussed.

  18. Use of photo-Fenton's reaction by 400-nm LED light for endodontic disinfection: A preliminary in vitro study on Enterococcus faecalis.

    PubMed

    Lagori, Giuseppe; Fornaini, Carlo; Rocca, Jean-Paul; Merigo, Elisabetta

    2017-06-01

    One of the biggest challenges in endodontics is the complete disinfection of root canals. In addition to mechanical preparation, the technique traditionally also involves channel disinfection with other agents such as sodium hypochlorite, hydrogen peroxide, chlorhexidine, or a combination of these. Some bacterial species are particularly resistant to eradication. Using Enterococcus faecalis in this preliminary study, we tested the bactericidal effectiveness of the Fenton reaction and the photo-Fenton reaction using an LED light with a 400-nm wavelength. Discs of hydroxyapatite were incubated in brain-heart broth contaminated with Enterococcus faecalis. After 4days, they were decontaminated with different bactericidal agents, including some with proven and well-known efficacy (5% sodium hypochlorite and 3% hydrogen peroxide) and other treatments using solutions of 1.5% hydrogen peroxide and 0.15% iron gluconate (Fenton reaction) plus LED light at a Fluence of 4.0J/cm 2 (photo-Fenton reaction). The photo-Fenton reaction demonstrated comparable performance to that of sodium hypochlorite in eliminating Enterococcus faecalis. Copyright © 2017. Published by Elsevier B.V.

  19. Immediate Reactions to More Than 1 NSAID Must Not Be Considered Cross-Hypersensitivity Unless Tolerance to ASA Is Verified.

    PubMed

    Pérez-Alzate, D; Cornejo-García, J A; Pérez-Sánchez, N; Andreu, I; García-Moral, A; Agúndez, J A; Bartra, J; Doña, I; Torres, M J; Blanca, M; Blanca-López, N; Canto, G

    Individuals who develop drug hypersensitivity reactions (DHRs) to chemically unrelated nonsteroidal anti-inflammatory drugs (NSAIDs) are considered cross-hypersensitive. The hallmark for this classification is that the patient presents a reaction after intake of or challenge with acetylsalicylic acid (ASA). Whether patients react to 2 or more NSAIDs while tolerating ASA remains to be studied (selective reactions, SRs). Objective: To identify patients with SRs to 2 or more NSAIDs including strong COX-1 inhibitors. Patients who attended the Allergy Service of Hospital Infanta Leonor, Madrid, Spain with DHRs to NSAIDs between January 2011 and December 2014 were evaluated. Those with 2 or more immediate reactions occurring in less than 1 hour after intake were included. After confirming tolerance to ASA, the selectivity of the response to 2 or more NSAIDs was demonstrated by in vivo and/or in vitro testing or by controlled administration. From a total of 203 patients with immediate DHRs to NSAIDs, 16 (7.9%) met the inclusion criteria. The patients presented a total of 68 anaphylactic or cutaneous reactions (mean [SD], 4.2 [2.1]). Most reactions were to ibuprofen and other arylpropionic acid derivatives and to metamizole. Two different NSAIDs were involved in 11 patients and 3 in 5 patients. Patients with NSAID-induced anaphylaxis or urticaria/angioedema should not be considered cross-hypersensitive unless tolerance to ASA is verified.

  20. Contact allergy to oxidized geraniol among Swedish dermatitis patients-A multicentre study by the Swedish Contact Dermatitis Research Group.

    PubMed

    Hagvall, Lina; Bruze, Magnus; Engfeldt, Malin; Isaksson, Marléne; Lindberg, Magnus; Ryberg, Kristina; Stenberg, Berndt; Svedman, Cecilia; Karlberg, Ann-Therese; Bråred Christensson, Johanna

    2018-06-21

    Geraniol is a widely used fragrance terpene, and is included in fragrance mix I. Geraniol is prone to autoxidation, forming the skin sensitizers geranial, neral, and geraniol-7-hydroperoxide. Oxidized geraniol has previously been patch tested in 1 clinic, giving 1% to 4.6% positive reactions in consecutive patients when tested at 2% to 11%. To compare test reactions to pure and oxidized geraniol, to compare 2 different test concentrations of oxidized geraniol and to investigate the pattern of concomitant reactions to fragrance markers of the baseline series in a multicentre setting. One thousand four hundred and seventy-six consecutive patients referred for patch testing were patch tested with geraniol 6% pet. and oxidized geraniol 6% and 11% pet. Pure geraniol 6% pet., oxidized geraniol 6% pet. and oxidized geraniol 11% pet. gave 1%, 3% and 8% positive patch test reactions and 0.7%, 3% and 5% doubtful reactions, respectively. Approximately 50% of the patients with doubtful reactions to oxidized geraniol 6% pet. had positive reactions to oxidized geraniol 11% pet. Oxidized geraniol 11% pet. provides better detection than oxidized geraniol 6% pet. As most patients reacted only to oxidized geraniol, it is important to explore further whether oxidized geraniol should be included in a baseline patch test series. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Food allergy to gelatin in children with systemic immediate-type reactions, including anaphylaxis, to vaccines.

    PubMed

    Sakaguchi, M; Nakayama, T; Inouye, S

    1996-12-01

    Anaphylaxis to measles-mumps-rubella vaccines has been reported. We have suspected that most such reactions are caused by gelatin contained in the vaccines. To confirm the relation between systemic allergic reactions to vaccines and the presence of anti-gelatin IgE, we measured anti-gelatin IgE in children who demonstrated allergy to gelatin-containing vaccines. Furthermore, to clarify the relation between allergic reactions to gelatin in vaccines and foods, we surveyed the occurrence of allergic reactions to gelatin-containing foods in the same children. Serum samples were taken from 26 children who had systemic immediate-type reactions, including anaphylactic shock, to vaccines and the same number of children without allergic reactions. Specific IgE to gelatin in these samples was measured. We then surveyed whether these children had allergic reactions to gelatin-containing foods before and after vaccination. Twenty-four of the 26 children with allergic reactions to vaccines had anti-gelatin IgE ranging from 1.2 to 250 Ua/ml. Seven had allergic reactions on ingestion of gelatin-containing foods. Of these, two had reactions before vaccination, and five had reactions after vaccination. All the control children without allergic reactions to vaccines had no anti-gelatin IgE. We reconfirmed a strong relationship between systemic immediate-type allergic reactions, including anaphylaxis, to vaccines and the presence of specific IgE to gelatin. Moreover, some of the children also had allergic reactions to food gelatin before or after vaccination.

  2. Elementary school children's responses 3 months after the September 11 terrorist attacks: a study in Washington, DC.

    PubMed

    Phillips, Deborah; Prince, Shantay; Schiebelhut, Laura

    2004-10-01

    This study examined the responses of elementary school children in Washington, DC, to the September 11 terrorist attacks. Parents (primarily mothers) of children in kindergarten through Grade 6 and children in Grades 4 to 6, including 47 matched parent-child pairs, completed questionnaires regarding exposure, stress reactions, and constructive actions taken 3 months after the attacks. Parent reports and, to an even greater extent, children's self-reports revealed high levels of negative reactions to the attacks on behalf of the children. These reactions were best understood in the context of their exposure to the attacks, primarily through television news, and the reactions of and coping assistance provided by their parents. Implications for school personnel, health care professionals, and intervention efforts are discussed. ((c) 2004 APA, all rights reserved).

  3. The potential of model studies for the understanding of catalyst poisoning and temperature effects in polymer electrolyte fuel cell reactions

    NASA Astrophysics Data System (ADS)

    Behm, R. J.; Jusys, Z.

    In this contribution we demonstrate the potential of model studies for the understanding of electrocatalytic reactions in low-temperature polymer electrolyte fuel cells (PEFCs) operated by H 2-rich anode feed gas, in particular of the role of temperature effects and catalyst poisoning. Reviewing previous work from our laboratory and, for better comparison, focussing on carbon-supported Pt catalysts, the important role of using fuel cell relevant reaction and mass transport conditions will be outlined. The latter conditions include continuous reaction, elevated temperatures, realistic supported catalyst materials and controlled mass transport. The data show the importance of combining electrochemical techniques such as rotating disc electrode (RDE), wall-jet and flow cell measurements, and on-line differential electrochemical mass spectrometry (DEMS) under controlled mass transport conditions.

  4. In situ TEM study of the Li-Au reaction in an electrochemical liquid cell.

    PubMed

    Zeng, Zhiyuan; Liang, Wen-I; Chu, Ying-Hao; Zheng, Haimei

    2014-01-01

    We study the lithiation of a Au electrode in an electrochemical liquid cell using transmission electron microscopy (TEM). The commercial liquid electrolyte for lithium ion batteries (1 M lithium hexafluorophosphate LiPF6 dissolved in 1 : 1 (v/v) ethylene carbonate (EC) and diethyl carbonate (DEC)) was used. Three distinct types of morphology change during the reaction, including gradual dissolution, explosive reaction and local expansion/shrinkage, are observed. It is expected that significant stress is generated from lattice expansion during lithium-gold alloy formation. There is vigorous bubble formation from electrolyte decomposition, likely due to the catalytic effect of Au, while the bubble generation is less severe with titanium electrodes. There is an increase of current in response to electron beam irradiation, and electron beam effects on the observed electrochemical reaction are discussed.

  5. Schiff and pseudo-Schiff reagents: the reactions and reagents of Hugo Schiff, including a classification of various kinds of histochemical reagents used to detect aldehydes.

    PubMed

    Dapson, R W

    2016-11-01

    During the 1860's, Hugo Schiff studied many reactions between amines and aldehydes, some of which have been used in histochemistry, at times without credit to Schiff. Much controversy has surrounded the chemical structures and reaction mechanisms of the compounds involved, but modern analytical techniques have clarified the picture. I review these reactions here. I used molecular modeling software to investigate dyes that contain primary amines representing eight chemical families. All dyes were known to perform satisfactorily for detecting aldehydes in tissue sections. The models verified the correct chemical structures at various points in their reactions and also determined how decolorization occurred in those with "leuco" forms. Decolorization in the presence of sulfurous acid can occur by either adduction or reduction depending on the dye. The final condensation product with aldehyde was determined to be either a C-sulfonic acid adduct on the carbonyl carbon atom or an aminal at the same atom. Based on the various outcomes, I have placed the dyes and their reactions into five categories. Because Hugo Schiff studied the reactions between aldehydes and amines with and without various acids or alcohol, it is only proper to call each of them Schiff reactions that used various types of Schiff reagents.

  6. Mechanism of heterogeneous catalytic oxidation of organic compounds to carboxylic acids

    NASA Astrophysics Data System (ADS)

    Andrushkevich, T. V.; Chesalov, Yu A.

    2018-06-01

    The results of studies on the mechanism of heterogeneous catalytic oxidation of organic compounds of different chemical structure to carboxylic acids are analyzed and generalized. The concept developed by Academician G.K.Boreskov, according to which the direction of the reaction is governed by the structure and bond energy of surface intermediates, was confirmed taking the title processes as examples. Quantitative criteria of the bond energies of surface compounds of oxidizable reactants, reaction products and oxygen that determine the selective course of the reaction are presented. The bibliography includes 195 references.

  7. Alkylsilyl Peroxides as Alkylating Agents in the Copper-Catalyzed Selective Mono-N-Alkylation of Primary Amides and Arylamines.

    PubMed

    Sakamoto, Ryu; Sakurai, Shunya; Maruoka, Keiji

    2017-07-06

    The copper-catalyzed selective mono-N-alkylation of primary amides or arylamines using alkylsilyl peroxides as alkylating agents is reported. The reaction proceeds under mild reaction conditions and exhibits a broad substrate scope with respect to the alkylsilyl peroxides, as well as to the primary amides and arylamines. Mechanistic studies suggest that the present reaction should proceed through a free-radical process that includes alkyl radicals generated from the alkylsilyl peroxides. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Convicted Driving-While-Impaired Offenders’ Views on Effectiveness of Sanctions and Treatment

    PubMed Central

    Lapham, Sandra; England-Kennedy, Elizabeth

    2011-01-01

    In this article we analyze qualitative data from a multiple methods, longitudinal study drawn from 15-year follow-up interviews with a subsample of 82 individuals arrested for driving while intoxicated in a southwestern state (1989–1995). We explore reactions to the arrest and court-mandated sanctions, including legal punishments, mandated interventions, and/or participation in programs aimed at reducing recidivism. Key findings include experiencing certain negative emotional reactions to the arrest, reactions to being jailed, experiencing other court-related sanctions as deterring driving while intoxicated behavior, and generally negative opinions regarding court-mandated interventions. We discuss interviewees’ complex perspectives on treatment and program participation and their effects on lessening recidivism, and we offer suggestions for reducing recidivism based on our findings. PMID:21490294

  9. Activated persulfate for organic chemical degradation: A review.

    PubMed

    Matzek, Laura W; Carter, Kimberly E

    2016-05-01

    Activated persulfate reactions have widespread application for groundwater and environmental remediation, as many of these reactions involve destruction of environmental contaminants. Within the last five years, knowledge of activated persulfate degradation reactions has grown to include novel means of activating persulfate for enhanced removal of organic species. These current studies cover a long list of organic analytes, including pharmaceuticals, pesticides, halogenated compounds and dyes. An extensive review of recently published experimental parameters and results for the destruction of organic compounds via activated persulfate is presented. Focus is placed on emerging methodologies and manipulation of traditional activation techniques. Knowledge gaps are identified and discussed, as despite the number of publications on this subject, more broad-reaching guidelines are needed for optimizing applications of activated persulfate in water treatment. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Pulse radiolysis studies of the reaction of nitrogen dioxide with the vitamin B₁₂ complexes Cob(II)alamin and nitrocobalamin

    DOE PAGES

    Brasch, Nicola E.; Cabelli, Diane E.; Dassanayake, Rohan S.

    2014-10-06

    Although now recognized to be an important reactive nitrogen species in biological systems that modifies the structures of proteins, DNA and lipids, there few studies on the reactivity of ˙NO2, including the reactions between ˙NO2 and transition metal complexes. We report kinetic studies on the reaction of ˙NO2 with two forms of vitamin B12 – cob(II)alamin and nitrocobalamin. UV-vis spectroscopy and HPLC analysis of the product solution show that ˙NO2 cleanly oxidizes the metal center of cob(II)alamin to form nitrocobalamin, with a second-order rate constant of (3.5 ± 0.3) × 10⁸ M⁻¹ s ⁻¹ (pH 7.0 and 9.0, RT, Imore » = 0.20 M). The stoichiometry of the reaction is 1:1. No reaction is detected by UV-vis spectroscopy and by HPLC analysis of the product solution when nitrocobalamin is exposed to up to 2.0 mol equiv.˙NO2.« less

  11. Pulse radiolysis studies of the reaction of nitrogen dioxide with the vitamin B₁₂ complexes Cob(II)alamin and nitrocobalamin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brasch, Nicola E.; Cabelli, Diane E.; Dassanayake, Rohan S.

    Although now recognized to be an important reactive nitrogen species in biological systems that modifies the structures of proteins, DNA and lipids, there few studies on the reactivity of ˙NO2, including the reactions between ˙NO2 and transition metal complexes. We report kinetic studies on the reaction of ˙NO2 with two forms of vitamin B12 – cob(II)alamin and nitrocobalamin. UV-vis spectroscopy and HPLC analysis of the product solution show that ˙NO2 cleanly oxidizes the metal center of cob(II)alamin to form nitrocobalamin, with a second-order rate constant of (3.5 ± 0.3) × 10⁸ M⁻¹ s ⁻¹ (pH 7.0 and 9.0, RT, Imore » = 0.20 M). The stoichiometry of the reaction is 1:1. No reaction is detected by UV-vis spectroscopy and by HPLC analysis of the product solution when nitrocobalamin is exposed to up to 2.0 mol equiv.˙NO2.« less

  12. Effects of Erotic Films of Sexual Behavior of Married Couples. Sex-guilt and Reactions to Pornographic Films. Exposure to Pornography, Character, and Sexual Deviance: A Retrospective Survey.

    ERIC Educational Resources Information Center

    Mann, Jay; And Others

    This paper reviews some of the findings from two studies of the reactions of single college students and married couples who viewed one of two pornographic films. Findings from the first study included: (1) women were aroused as much as men upon viewing the film showing intercourse; they were less aroused and the men were more aroused after the…

  13. I + (H2O)2 → HI + (H2O)OH Forward and Reverse Reactions. CCSD(T) Studies Including Spin-Orbit Coupling.

    PubMed

    Wang, Hui; Li, Guoliang; Li, Qian-Shu; Xie, Yaoming; Schaefer, Henry F

    2016-03-03

    The potential energy profile for the atomic iodine plus water dimer reaction I + (H2O)2 → HI + (H2O)OH has been explored using the "Gold Standard" CCSD(T) method with quadruple-ζ correlation-consistent basis sets. The corresponding information for the reverse reaction HI + (H2O)OH → I + (H2O)2 is also derived. Both zero-point vibrational energies (ZPVEs) and spin-orbit (SO) coupling are considered, and these notably alter the classical energetics. On the basis of the CCSD(T)/cc-pVQZ-PP results, including ZPVE and SO coupling, the forward reaction is found to be endothermic by 47.4 kcal/mol, implying a significant exothermicity for the reverse reaction. The entrance complex I···(H2O)2 is bound by 1.8 kcal/mol, and this dissociation energy is significantly affected by SO coupling. The reaction barrier lies 45.1 kcal/mol higher than the reactants. The exit complex HI···(H2O)OH is bound by 3.0 kcal/mol relative to the asymptotic limit. At every level of theory, the reverse reaction HI + (H2O)OH → I + (H2O)2 proceeds without a barrier. Compared with the analogous water monomer reaction I + H2O → HI + OH, the additional water molecule reduces the relative energies of the entrance stationary point, transition state, and exit complex by 3-5 kcal/mol. The I + (H2O)2 reaction is related to the valence isoelectronic bromine and chlorine reactions but is distinctly different from the F + (H2O)2 system.

  14. Using Different Conceptual Change Methods Embedded within 5E Model: A Sample Teaching of Endothermic-Exothermic Reactions

    ERIC Educational Resources Information Center

    Turk, Fatma; Calik, Muammer

    2008-01-01

    Since Widodo, Duit and Muller (2002) addressed that there is a gap between teacher's theoretical knowledge and their practical classroom constructivist behavior, we presented a sample teaching activity about Endothermic-Exothermic Reactions for teacher usage. Therein, the aim of this study is to design a 5E model to include students' alternative…

  15. A Death in the Family: Death as a Zen Concept

    ERIC Educational Resources Information Center

    Black, Helen K.; Rubinstein, Robert L.

    2013-01-01

    This study is based on original research that explored family reaction to the death of an elderly husband and father. We interviewed 34 families (a family included a widow and two adult biological children) approximately 6 to 10 months after the death. In one-on-one interviews, we discussed family members' initial reaction to the death, how the…

  16. Changes Found on Run-In and Scuffed Surfaces of Steel Chrome Plate, and Cast Iron

    NASA Technical Reports Server (NTRS)

    Good, J. N.; Godfrey, Douglas

    1947-01-01

    A study was made of run-in and scuffed steel, chrome-plate, and cast-iron surfaces. X-ray and electron diffraction techniques, micro-hardness determinations, and microscopy were used. Surface changes varied and were found to include three classes: chemical reaction, hardening, and crystallite-size alteration. The principal chemical reactions were oxidation and carburization.

  17. Formal Developmental Relationships: A Survey of Organizational Practices. [and] Invited Reaction: Setting the Stage for Further Study of Developmental Relationships.

    ERIC Educational Resources Information Center

    Douglas, Christina A.; McCauley, Cynthia D.; Bierema, Laura L.

    1999-01-01

    Douglas and McCauley report on a survey of 246 managers about the management-development strategies used in their organizations. Results show that initiatives include mentoring, apprenticeships, coaching, and action learning. Bierema's reaction concurs in the need to widen the definition of relationships but suggests that methodological issues…

  18. Neutron-Induced Charged Particle Studies at LANSCE

    NASA Astrophysics Data System (ADS)

    Lee, Hye Young; Haight, Robert C.

    2014-09-01

    Direct measurements on neutron-induced charged particle reactions are of interest for nuclear astrophysics and applied nuclear energy. LANSCE (Los Alamos Neutron Science Center) produces neutrons in energy of thermal to several hundreds MeV. There has been an effort at LANSCE to upgrade neutron-induced charged particle detection technique, which follows on (n,z) measurements made previously here and will have improved capabilities including larger solid angles, higher efficiency, and better signal to background ratios. For studying cross sections of low-energy neutron induced alpha reactions, Frisch-gridded ionization chamber is designed with segmented anodes for improving signal-to-noise ratio near reaction thresholds. Since double-differential cross sections on (n,p) and (n,a) reactions up to tens of MeV provide important information on deducing nuclear level density, the ionization chamber will be coupled with silicon strip detectors (DSSD) in order to stop energetic charged particles. In this paper, we will present the status of this development including the progress on detector design, calibrations and Monte Carlo simulations. This work is funded by the US Department of Energy - Los Alamos National Security, LLC under Contract DE-AC52-06NA25396.

  19. Nuclear Reactions and the ν p-Process

    NASA Astrophysics Data System (ADS)

    Fröhlich, Carla; Hatcher, Daniel; Perdikakis, Georgios; Nikas, Stylianos

    In understanding the origin of the heavy elements, the "light heavy elements" pose a particular challenge: The two neutron-capture processes, r- and s-process, cannot explain the abundances patterns seen in very old galactic halo stars. A proposed solution to this problem is the ν p-process, which takes place in the strong neutrino-driven winds of core-collapse supernovae. In the ν p-process, a sequence of (n, p) and (p, γ ) reactions allows for the synthesis of elements with atomic numbers A > 64, which includes Sr, Y, Zr, and others possibly up to Sn. The relevant reaction rates are all based on statistical model predictions and carry some uncertainty. Here, the sensitivity of the final ν p-process abundance pattern on modifications of (n, p), (p, γ ), and (n, γ ) reactions are characterized. Only few reactions affect the final abundance pattern and hence warrant a more detailed study of the reaction rate.

  20. Re-evaluating reaction rates relevant to nova nucleosynthesis from a nuclear structure perspective

    NASA Astrophysics Data System (ADS)

    Jenkins, D. G.; Lister, C. J.; Janssens, R. V. F.; Khoo, T. L.; Moore, E. F.; Rehm, K. E.; Seweryniak, D.; Wuosmaa, A. H.; Davinson, T.; Woods, P. J.; Jokinen, A.; Penttila, H.; Martınez-Pinedo, G.; Jose, J.

    2006-03-01

    Conventionally, reaction rates relevant to nova nucleosynthesis are determined by performing the relevant proton capture reactions directly for stable species, or as has become possible more recently in inverse kinematics using short-lived accelerated radioactive beams with recoil separators. A secondary approach is to compile information on the properties of levels in the Gamow window using transfer reactions. We present a complementary technique where the states of interest are populated in a heavy-ion fusion reaction and their gamma decay studied with a state-of-the-art array of high-purity germanium detectors. The advantages of this approach, including the ability to determine resonance energies with high precision and the possibility of determining spins and parities from gamma-ray angular distributions are discussed. Two specific examples related to the 22Na(p,γ) and 30P(p,γ) reactions are presented.

  1. Birnessite catalysis of the Maillard Reaction: Its significance in natural humification

    NASA Astrophysics Data System (ADS)

    Jokic, A.; Frenkel, A. I.; Vairavamurthy, M. A.; Huang, P. M.

    Although mineral colloids are known to play a significant role in transforming organic matter in soils and sediments, there still are many gaps in our understanding of the mechanisms of organic-mineral interactions. In this study, we investigated the role of a major oxide-mineral birnessite (a form of Mn(IV) oxide) in catalyzing the condensation reaction between sugars and amino acids, the Maillard reaction, for forming humic substances. The Maillard reaction is perceived to be a major pathway in natural humification. Using a suite of spectroscopic methods (including ESR, XANES, EXAFS and 13C NMR), our results show that Mn(IV) oxide markedly accelerates the Maillard reaction between glucose and glycine at ranges of temperatures and pH typical of natural environments. These results demonstrate the importance of manganese oxide catalysis in the Maillard reaction, and its significance in the natural abiotic formation of humic substances.

  2. Wave Phenomena in Reaction-Diffusion Systems

    NASA Astrophysics Data System (ADS)

    Steinbock, Oliver; Engel, Harald

    2013-12-01

    Pattern formation in excitable and oscillatory reaction-diffusion systems provides intriguing examples for the emergence of macroscopic order from molecular reaction events and Brownian motion. Here we review recent results on several aspects of excitation waves including anomalous dispersion, vortex pinning, and three-dimensional scroll waves. Anomalies in the speed-wavelength dependence of pulse trains include nonmonotonic behavior, bistability, and velocity gaps. We further report on the hysteresis effects during the pinning-depinning transition of twodimensional spiral waves. The pinning of three-dimensional scroll waves shows even richer dynamic complexity, partly due to the possibility of geometric and topological mismatches between the unexcitable, pinning heterogeneities and the one-dimensional rotation backbone of the vortex. As examples we present results on the pinning of scroll rings to spherical, C-shaped, and genus-2-type heterogeneities. We also review the main results of several experimental studies employing the Belousov-Zhabotinsky reaction and briefly discuss the biomedical relevance of this research especially in the context of cardiology.

  3. Accelerated hydrolysis of substituted cellulose for potential biofuel production: kinetic study and modeling.

    PubMed

    Mu, Bingnan; Xu, Helan; Yang, Yiqi

    2015-11-01

    In this work, kinetics of substitution accelerated cellulose hydrolysis with multiple reaction stages was investigated to lay foundation for mechanism study and molecular design of substituting compounds. High-efficiency hydrolysis of cellulose is critical for cellulose-based bioethanol production. It is known that, substitution could substantially decrease activation energy and increase reaction rate of acidic hydrolysis of glycosidic bonds in cellulose. However, reaction kinetics and mechanism of the accelerated hydrolysis were not fully revealed. In this research, it was proved that substitution therefore accelerated hydrolysis only occurred in amorphous regions of cellulose fibers, and was a process with multiple reaction stages. With molar ratio of substitution less than 1%, the overall hydrolysis rate could be increased for around 10 times. We also quantified the relationship between the hydrolysis rate of individual reaction stage and its major influences, including molar ratio of substitution, activation energy of acidic hydrolysis, pH and temperature. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Quantum Tunneling Affects Engine Performance.

    PubMed

    Som, Sibendu; Liu, Wei; Zhou, Dingyu D Y; Magnotti, Gina M; Sivaramakrishnan, Raghu; Longman, Douglas E; Skodje, Rex T; Davis, Michael J

    2013-06-20

    We study the role of individual reaction rates on engine performance, with an emphasis on the contribution of quantum tunneling. It is demonstrated that the effect of quantum tunneling corrections for the reaction HO2 + HO2 = H2O2 + O2 can have a noticeable impact on the performance of a high-fidelity model of a compression-ignition (e.g., diesel) engine, and that an accurate prediction of ignition delay time for the engine model requires an accurate estimation of the tunneling correction for this reaction. The three-dimensional model includes detailed descriptions of the chemistry of a surrogate for a biodiesel fuel, as well as all the features of the engine, such as the liquid fuel spray and turbulence. This study is part of a larger investigation of how the features of the dynamics and potential energy surfaces of key reactions, as well as their reaction rate uncertainties, affect engine performance, and results in these directions are also presented here.

  5. Kinetic and Mechanistic Study of the pH-Dependent Activation (Epoxidation) of Prodrug Treosulfan Including the Reaction Inhibition in a Borate Buffer.

    PubMed

    Romański, Michał; Ratajczak, Whitney; Główka, Franciszek

    2017-07-01

    A prodrug treosulfan (T) undergoes a pH-dependent activation to epoxide derivatives. The process seems to involve an intramolecular Williamson reaction (IWR) but clear kinetic evidence is lacking. Moreover, a cis-diol system present in the T structure is expected to promote complexation with boric acid. As a result, the prodrug epoxidation would be inhibited; however, this phenomenon has not been investigated. In this article, the effect of pH on the kinetics of T conversion to its monoepoxide was studied from a mechanistic point of view. Also, the influence of boric acid on the reaction kinetics was examined. The rate constants observed for the activation of T (k obs ) in acetate, phosphate, and carbonate buffers satisfied the equation logk obs  = -7.48 + 0.96 pH. The reaction was inhibited in the excess of boric acid over T, and the k obs decreased with increasing borate buffer concentration. The experimental results were consistent with the inhibition model that included the formation of a tetrahedral, anionic T-boric acid monoester. To conclude, in nonborate buffers, the T activation to (2S,3S)-1,2-epoxybutane-3,4-diol 4-methanesulfonate follows IWR mechanism. A borate buffer changes the reaction kinetics and complicates kinetic analysis. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  6. Reactor vessel using metal oxide ceramic membranes

    DOEpatents

    Anderson, Marc A.; Zeltner, Walter A.

    1992-08-11

    A reaction vessel for use in photoelectrochemical reactions includes as its reactive surface a metal oxide porous ceramic membrane of a catalytic metal such as titanium. The reaction vessel includes a light source and a counter electrode. A provision for applying an electrical bias between the membrane and the counter electrode permits the Fermi levels of potential reaction to be favored so that certain reactions may be favored in the vessel. The electrical biasing is also useful for the cleaning of the catalytic membrane.

  7. Surface- and Tip-Enhanced Raman Spectroscopy in Catalysis

    PubMed Central

    2016-01-01

    Surface- and tip-enhanced Raman spectroscopy (SERS and TERS) techniques exhibit highly localized chemical sensitivity, making them ideal for studying chemical reactions, including processes at catalytic surfaces. Catalyst structures, adsorbates, and reaction intermediates can be observed in low quantities at hot spots where electromagnetic fields are the strongest, providing ample opportunities to elucidate reaction mechanisms. Moreover, under ideal measurement conditions, it can even be used to trigger chemical reactions. However, factors such as substrate instability and insufficient signal enhancement still limit the applicability of SERS and TERS in the field of catalysis. By the use of sophisticated colloidal synthesis methods and advanced techniques, such as shell-isolated nanoparticle-enhanced Raman spectroscopy, these challenges could be overcome. PMID:27075515

  8. Oxygen evolution reaction catalysis

    DOEpatents

    Haber, Joel A.; Jin, Jian; Xiang, Chengxiang; Gregoire, John M.; Jones, Ryan J.; Guevarra, Dan W.; Shinde, Aniketa A.

    2016-09-06

    An Oxygen Evolution Reaction (OER) catalyst includes a metal oxide that includes oxygen, cerium, and one or more second metals. In some instances, the cerium is 10 to 80 molar % of the metals in the metal oxide and/or the catalyst includes two or more second metals. The OER catalyst can be included in or on an electrode. The electrode can be arranged in an oxygen evolution system such that the Oxygen Evolution Reaction occurs at the electrode.

  9. In Silico Knockout Screening of Plasmodium falciparum Reactions and Prediction of Novel Essential Reactions by Analysing the Metabolic Network

    PubMed Central

    Isewon, Itunuoluwa; Aromolaran, Olufemi; Oladipupo, Olufunke

    2018-01-01

    Malaria is an infectious disease that affects close to half a million individuals every year and Plasmodium falciparum is a major cause of malaria. The treatment of this disease could be done effectively if the essential enzymes of this parasite are specifically targeted. Nevertheless, the development of the parasite in resisting existing drugs now makes discovering new drugs a core responsibility. In this study, a novel computational model that makes the prediction of new and validated antimalarial drug target cheaper, easier, and faster has been developed. We have identified new essential reactions as potential targets for drugs in the metabolic network of the parasite. Among the top seven (7) predicted essential reactions, four (4) have been previously identified in earlier studies with biological evidence and one (1) has been with computational evidence. The results from our study were compared with an extensive list of seventy-seven (77) essential reactions with biological evidence from a previous study. We present a list of thirty-one (31) potential candidates for drug targets in Plasmodium falciparum which includes twenty-four (24) new potential candidates for drug targets. PMID:29789805

  10. The Domestication of ortho-Quinone Methides

    PubMed Central

    2015-01-01

    Conspectus An ortho-quinone methide (o-QM) is a highly reactive chemical motif harnessed by nature for a variety of purposes. Given its extraordinary reactivity and biological importance, it is surprising how few applications within organic synthesis exist. We speculate that their widespread use has been slowed by the complications that surround the preparation of their precursors, the harsh generation methods, and the omission of this stratagem from computer databases due to its ephemeral nature. About a decade ago, we discovered a mild anionic triggering procedure to generate transitory o-QMs at low temperature from readily available salicylaldehydes, particularly OBoc derivatives. This novel reaction cascade included both the o-QM formation and the subsequent consumption reaction. The overall transformation was initiated by the addition of the organometallic reagent, usually a Grignard reagent, which resulted in the formation of a benzyloxy alkoxide. Boc migration from the neighboring phenol produced a magnesium phenoxide that we supposed underwent β-elimination of the transferred Boc residue to form an o-QM for immediate further reactions. Moreover, the cascade proved controllable through careful manipulation of metallic and temperature levers so that it could be paused, stopped, or restarted at various intermediates and stages. This new level of domestication enabled us to deploy o-QMs for the first time in a range of applications including diastereocontrolled reactions. This sequence ultimately could be performed in either multipot or single pot processes. The subsequent reaction of the fleeting o-QM intermediates included the 1,4-conjugate additions that led to unbranched or branched ortho-alkyl substituted phenols and Diels–Alder reactions that provided 4-unsubstituted or 4-substituted benzopyrans and chroman ketals. The latter cycloadducts were obtained for the first time with outstanding diastereocontrol. In addition, the steric effects of the newly created stereocenters in subsequent reactions of chroman ketals and acetals were studied and proved predictable. Through the use of a chiral auxiliary, Diels–Alder products were deployed in numerous enantioselective reactions including several complex natural products syntheses. In this Account, we summarize our efforts, which we hope have contributed to the synthetic renaissance for this venerable species. PMID:25469551

  11. Reaction time as an indicator of insufficient effort: Development and validation of an embedded performance validity parameter.

    PubMed

    Stevens, Andreas; Bahlo, Simone; Licha, Christina; Liske, Benjamin; Vossler-Thies, Elisabeth

    2016-11-30

    Subnormal performance in attention tasks may result from various sources including lack of effort. In this report, the derivation and validation of a performance validity parameter for reaction time is described, using a set of malingering-indices ("Slick-criteria"), and 3 independent samples of participants (total n =893). The Slick-criteria yield an estimate of the probability of malingering based on the presence of an external incentive, evidence from neuropsychological testing, from self-report and clinical data. In study (1) a validity parameter is derived using reaction time data of a sample, composed of inpatients with recent severe brain lesions not involved in litigation and of litigants with and without brain lesion. In study (2) the validity parameter is tested in an independent sample of litigants. In study (3) the parameter is applied to an independent sample comprising cooperative and non-cooperative testees. Logistic regression analysis led to a derived validity parameter based on median reaction time and standard deviation. It performed satisfactorily in studies (2) and (3) (study 2 sensitivity=0.94, specificity=1.00; study 3 sensitivity=0.79, specificity=0.87). The findings suggest that median reaction time and standard deviation may be used as indicators of negative response bias. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Microscopic heavy-ion theory. Final Report. February 2014-June 2015

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ernst, David J.; Oberacker, Volker E.; Umar, A. Sait

    The Vanderbilt nuclear theory group conducts research in the areas of low-energy nuclear reactions and in neutrino oscillations. Specically, we study dynamics of nuclear reactions microscopically, in particular for neutron-rich nuclei which will be accessible with current and future radioactive ion beam facilities. The neutrino work concentrates on constructing computational tools for analyzing neutrino oscillation data. The most important of these is the analysis of the Super K atmospheric data. Our research concentrates on the following topics which are part of the DOE Long-Range Plan: STUDIES OF LOW-ENERGY REACTIONS OF EXOTIC NUCLEI (Professors Umar and Oberacker), including sub-barrier fusion crossmore » sections, capture cross sections for superheavy element production, and nuclear astrophysics applications. Our theory project is strongly connected to experiments at RIB facilities around the world, including NSCL-FRIB (MSU) and ATLAS-CARIBU (Argonne). PHENOMENOLOGY OF NEUTRINO OSCILLATIONS (Prof. Ernst), extracting information from existing neutrino oscillation experiments and proposing possible future experiments in order to better understand the oscillation phenomenon.« less

  13. General chemical kinetics computer program for static and flow reactions, with application to combustion and shock-tube kinetics

    NASA Technical Reports Server (NTRS)

    Bittker, D. A.; Scullin, V. J.

    1972-01-01

    A general chemical kinetics program is described for complex, homogeneous ideal-gas reactions in any chemical system. Its main features are flexibility and convenience in treating many different reaction conditions. The program solves numerically the differential equations describing complex reaction in either a static system or one-dimensional inviscid flow. Applications include ignition and combustion, shock wave reactions, and general reactions in a flowing or static system. An implicit numerical solution method is used which works efficiently for the extreme conditions of a very slow or a very fast reaction. The theory is described, and the computer program and users' manual are included.

  14. Interactions of Water Vapor with Oxides at Elevated Temperatures

    NASA Technical Reports Server (NTRS)

    Jacobson, Nathan; Opila, Elizabeth; Copland, Evan; Myers, Dwight

    2003-01-01

    Many volatile metal hydroxides form by reaction of the corresponding metal oxide with water vapor. These reactions are important in a number of high temperature corrosion processes. Experimental methods for studying the thermodynamics of metal hydroxides include: gas leak Knudsen cell mass spectrometry, free jet sampling mass spectrometry, transpiration and hydrogen-oxygen flame studies. The available experimental information is reviewed and the most stable metal hydroxide species are correlated with position in the periodic table. Current studies in our laboratory on the Si-O-H system are discussed.

  15. Prediction of emergence agitation using withdrawal reaction following rocuronium injection in preschool-aged patients undergoing inguinal herniorrhaphy: a preliminary exploratory observational trial.

    PubMed

    Kim, Dae Hee; Roh, Go Un; Lee, Young Bok; Choi, Chang Ik; Lee, Jae Moon; Chae, Yun Jeong

    2018-01-01

    The development of emergence agitation (EA) is associated with several factors including age, preoperative anxiety, postoperative pain, anesthesia method, and surgery type. No studies have investigated whether the withdrawal reaction following rocuronium injection can predict the occurrence of EA. Therefore, we investigated this relationship in preschool-aged children undergoing inguinal herniorrhaphy, and which grade of withdrawal reaction is appropriate for identifying patients at risk of experiencing EA. A total of 40 patients were enrolled in this study. During anesthesia induction, the withdrawal reaction after loss of consciousness following rocuronium injection was assessed using a 4-point scale. After surgery, EA was assessed using the Watcha scale. There was a correlation between withdrawal reaction and EA on admission to the postanesthesia care unit (PACU). Patients with a severe withdrawal reaction (grade 3) showed a significantly higher incidence of severe EA requiring medication on admission to the PACU. The findings of this preliminary exploratory observational study suggest that it is possible for withdrawal movement following rocuronium injection during anesthesia induction to reflect pain sensitivity of pediatric patients, which in turn may be useful in identifying those at risk of severe EA on admission to the PACU among preschool children undergoing inguinal herniorrhaphy. Further studies with a larger sample size are required to validate these findings. The exact correlation between pain reaction following rocuronium injection and postoperative pain or pain-related phenomenon should be elucidated.

  16. Neuropsychological deficits in preschool as predictors of ADHD symptoms and academic achievement in late adolescence

    PubMed Central

    Sjöwall, Douglas; Bohlin, Gunilla; Rydell, Ann-Margret; Thorell, Lisa B

    2017-01-01

    High levels of ADHD symptoms are related to severe negative outcomes, which underscore the importance of identifying early markers of these behavior problems. The main aim of the present study was therefore to investigate whether neuropsychological deficits in preschool are related to later ADHD symptoms and academic achievement, over and above the influence of early ADHD symptom levels. The present study is unique because it includes a broader range of predictors compared to previous studies and the participants are followed over time for as long as 13 years (i.e., ages 5–18 years). Preschool data included measures of executive functioning and reaction time variability as well as emotional reactivity and emotion regulation of both positive and negative emotions. When controlling for early ADHD symptom levels, working memory, reaction time variability, and regulation of happiness/exuberance were significantly related to inattention whereas regulation of happiness/exuberance and anger reactivity were significantly related to hyperactivity/impulsivity. Furthermore, working memory and reaction time variability in preschool were significantly related to academic achievement in late adolescence beyond the influence of early ADHD symptoms. These findings could suggest that it is possible to screen for early neuropsychological deficits and thereby identify children who are at risk of negative outcomes. Furthermore, our results suggest that interventions need to look beyond executive functioning deficits in ADHD and also target the role of emotional functioning and reaction time variability. The importance of including both the positive and negative aspects of emotional functioning and distinguishing between emotion regulation and emotional reactivity was also demonstrated. PMID:26212755

  17. Connecting localized DNA strand displacement reactions

    NASA Astrophysics Data System (ADS)

    Mullor Ruiz, Ismael; Arbona, Jean-Michel; Lad, Amitkumar; Mendoza, Oscar; Aimé, Jean-Pierre; Elezgaray, Juan

    2015-07-01

    Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions.Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions. Electronic supplementary information (ESI) available. See DOI: 10.1039/C5NR02434J

  18. Severe Cutaneous Adverse Drug Reactions in Pediatric Patients: A Multicenter Study.

    PubMed

    Dibek Misirlioglu, Emine; Guvenir, Hakan; Bahceci, Semiha; Haktanir Abul, Mehtap; Can, Demet; Usta Guc, Belgin Emine; Erkocoğlu, Mustafa; Toyran, Muge; Nacaroglu, Hikmet Tekin; Civelek, Ersoy; Buyuktiryaki, Betul; Ginis, Tayfur; Orhan, Fazil; Kocabas, Can Naci

    The severe cutaneous adverse drug reactions (SCARs) are rare but could be life-threatening. These include drug reaction with eosinophilia and systemic symptoms (DRESS), Stevens-Johnson syndrome, toxic epidermal necrolysis (TEN), and acute generalized exanthematous pustulosis. The purpose of this study was the evaluation of the clinical characteristics of patients with the diagnosis of SCARs. Patients who were diagnosed with SCARs between January 2011 and May 2016 by pediatric allergy clinics in the provinces of Ankara, Trabzon, Izmir, Adana, and Bolu were included in this multicenter study. Clinical and laboratory findings, the time between suspected drug intake and development of clinical findings, treatments they have received, and length of recovery time were recorded. Fifty-eight patients with SCARs were included in this study. The median age of the patients was 8.2 years (interquartile range, 5.25-13 years) and 50% (n = 29) were males. Diagnosis was Stevens-Johnson syndrome/TEN in 60.4% (n = 35), DRESS in 27.6% (n = 16), and acute generalized exanthematous pustulosis in 12% (n = 7) of the patients. In 93.1% of the patients, drugs were the cause of the reactions. Antibiotics ranked first among the drugs (51.7%) and antiepileptic drugs were the second (31%) most common. A patient who was diagnosed with TEN developed lagophthalmos and a patient who was diagnosed with DRESS developed secondary diabetes mellitus. Only 1 patient with the diagnosis of TEN died. SCARs in children are not common but potentially serious. Early diagnosis and appropriate treatment of SCARs will reduce the incidence of morbidity and mortality. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  19. Infrared matrix-isolation and theoretical studies of the reactions of ferrocene with ozone.

    PubMed

    Kugel, Roger W; Pinelo, Laura F; Ault, Bruce S

    2015-03-19

    The reactions between ferrocene (Cp2Fe) (2a) and ozone (O3) were studied using low-temperature matrix-isolation techniques coupled with theoretical density functional theory (DFT) calculations. Co-deposition of Ar/Cp2Fe and Ar/O3 gas mixtures onto a cryogenically cooled CsI window produced a dark-green charge-transfer complex, Cp2Fe-O3, that photodecomposed upon red (λ ≥ 600 nm) and infrared (λ ≥ 1000 nm) irradiation but was stable to green or blue irradiation. Products of photodecomposition were characterized by FT-IR, oxygen-18 labeling, and DFT calculations using the B3LYP functionals and the 6-311G++(d,2p) basis set. Likely, photochemical products included four structures having the molecular formula C10H10FeO, identified by DFT calculations based on their calculated infrared spectra and (18)O isotope shifts. Each of these calculated molecules had one intact and fully coordinated η(5)-C5H5 cyclopentadienyl (Cp) ring and (1) an η(5)-C5H5O cyclic ether (pyran ring) (2b), (2) an η(4)-C5H5O linear aldehyde (2c), (3) a bidentate cyclic aldehyde with a seven-membered ring including the iron atom (2d), or (4) an Fe-O bond and an η(2)-C5H5 (Cp) ring (2e). No conclusive evidence for a gas-phase thermal reaction between ferrocene and ozone was observed under the conditions of these experiments. However, strong evidence for a surface-catalyzed thermal reaction was observed in merged-jet experiments wherein the gases were premixed before deposition. Surface-catalyzed ferrocene-ozone reaction products included a thin film of Fe2O3 observed on the walls of the merged tube as well as cyclopentadiene (C5H6), cyclopentadienone (C5H4O), and further oxidation products observed in the matrix. Possible mechanisms for both the photochemical and the thermal reactions are discussed.

  20. Usefulness of In Vivo and In Vitro Diagnostic Tests in the Diagnosis of Hypersensitivity Reactions to Quinolones and in the Evaluation of Cross-Reactivity: A Comprehensive Study Including the Latest Quinolone Gemifloxacin

    PubMed Central

    Gelincik, Asli; Akdeniz, Nilgun; Aktas-Cetin, Esin; Olgac, Muge; Unal, Derya; Ertek, Belkis; Coskun, Raif; Colakoğlu, Bahattin; Deniz, Gunnur; Buyukozturk, Suna

    2017-01-01

    Purpose Reports evaluating diagnosis and cross reactivity of quinolone hypersensitivity have revealed contradictory results. Furthermore, there are no reports investigating the cross-reactivity between gemifloxacin (GFX) and the others. We aimed to detect the usefulness of diagnostic tests of hypersensitivity reactions to quinolones and to evaluate the cross reactivity between different quinolones including the latest quinolone GFX. Methods We studied 54 patients (mean age 42.31±10.39 years; 47 female) with 57 hypersensitivity reactions due to different quinolones and 10 nonatopic quinolone tolerable control subjects. A detailed clinical history, skin test (ST), and single-blind placebo-controlled drug provocation test (SBPCDPT), as well as basophil activation test (BAT) and lymphocyte transformation test (LTT) were performed with the culprit and alternative quinolones including ciprofloxacin (CFX), moxifloxacin (MFX), levofloxacin (LFX), ofloxacin (OFX), and GFX. Results The majority (75.9%) of the patients reported immediate type reactions to various quinolones. The most common culprit drug was CFX (52.6%) and the most common reaction type was urticaria (26.3%). A quarter of the patients (24.1%) reacted to SBPCDPTs, although their STs were negative; while false ST positivity was 3.5% and ST/SBPCDPTs concordance was only 1.8%. Both BAT and LTT were not found useful in quinolone hypersensitivity. Cross-reactivity was primarily observed between LFX and OFX (50.0%), whereas it was the least between MFX and the others, and in GFX hypersensitive patients the degree of cross-reactivity to the other quinolones was 16.7%. Conclusions These results suggest that STs, BAT, and LTT are not supportive in the diagnosis of a hypersensitivity reaction to quinolone as well as in the prediction of cross-reactivity. Drug provocation tests (DPTs) are necessary to identify both culprit and alternative quinolones. PMID:28497922

  1. Thermal Studies of Ammonium Cyanide Reactions: A Model for Thermal Alteration of Prebiotic Compounds in Meteorite Parent Bodies

    NASA Technical Reports Server (NTRS)

    Hammer, P. G.; Locke, D. R.; Burton, A. S.; Callahan, M. P.

    2017-01-01

    Organic compounds in carbonaceous chondrites were likely transformed by a variety of parent body processes including thermal and aqueous processing. Here, we analyzed ammonium cyanide reactions that were heated at different temperatures and times by multiple analytical techniques. The goal of this study is to better understand the effect of hydrothermal alteration on cyanide chemistry, which is believed to be responsible for the abiotic synthesis of purine nucleobases and their structural analogs detected in carbonaceous chondrites.

  2. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

    2015-07-15

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

  3. Acute Adverse Reactions to Nonionic Iodinated Contrast Media for CT: Prospective Randomized Evaluation of the Effects of Dehydration, Oral Rehydration, and Patient Risk Factors.

    PubMed

    Motosugi, Utaroh; Ichikawa, Tomoaki; Sano, Katsuhiro; Onishi, Hiroshi

    2016-11-01

    The objective of our study was to determine the effects of dehydration and oral rehydration on the incidence of acute adverse reactions to iodinated contrast media administered during abdominal and pelvic CT in outpatients. For our prospective randomized study performed at a single institution, adult outpatients undergoing contrast-enhanced abdominal CT were randomly divided into a rehydration group (n = 2244 patients [1379 men and 865 women]; mean age, 65.2 years; age range, 18-90 years) and a control group (n = 3715 [2112 male patients and 1603 female patients]; mean age, 65.8 years; age range, 17-96 years), which included an age- and sex-matched subgroup (adjusted control group, n = 2244). The rehydration group received an oral rehydration solution (500 mL of liquid in which osmotic pressure is adjusted to enhance gastrointestinal absorption) before abdominal and pelvic CT. Patients were also divided into subclinically dehydrated (n = 997) and hydrated (n = 4962) groups according to their answers to a questionnaire that they completed before the CT examination. The patients were interviewed about contrast-induced adverse reactions before they left the CT room, and the reactions were categorized as allergiclike or physiologic. The incidence of reactions was compared between the rehydration and control groups and between the subclinical dehydration and hydrated groups. The rehydration and control groups were compared with an unpaired t test or a chi-square or Fisher test. The overall incidence of an acute adverse reaction was 4.3% (254/5959); the acute adverse reactions included 136 allergiclike and 118 physiologic reactions. Fourteen allergiclike and nine physiologic reactions were moderate grade, and none was severe. There was no significant difference between the rehydration group and adjusted control group in the overall incidence of adverse reactions (99/2244 [4.4%] vs 100/2244 [4.5%], respectively; p = 0.9422) or between the subclinically dehydrated group and hydrated group in the incidence of allergiclike reactions (25/997 [2.5%] vs 111/4962 [2.2%], p = 0.6062) and physiologic reactions (22/997 [2.2%] vs 96/4962 [1.9%], p = 0.5793). Younger age was a risk factor for both allergiclike and physiologic reactions (p ≤ 0.0019). Dehydration and oral rehydration did not affect the incidence of acute adverse reactions to iodinated contrast material for abdominal and pelvic CT in our randomized prospective trial.

  4. Azithromycin is more allergenic than clarithromycin in children with suspected hypersensitivity reaction to macrolides.

    PubMed

    Barni, S; Butti, D; Mori, F; Pucci, N; Rossi, M E; Cianferoni, A; Novembre, E

    2015-01-01

    Macrolides are considered safe antibiotics with reduced allergenic activity. However, studies on the safety of macrolides are scarce, particularly in children. The aim of this study was to assess the frequency of hypersensitivity reactions to clarithromycin and azithromycin in a group of children referred to our allergy unit for suspected macrolide allergy. We retrospectively reviewed the charts of 90 children aged 1-17 years with symptoms suggestive of hypersensitivity reaction to clarithromycin or azithromycin between December 31, 2008 and December 31, 2013. The allergy workup included skin tests (ie, skin prick tests and/or intradermal tests), determination of serum specific IgE (sIgE) to clarithromycin and azithromycin, and, if necessary to reach a diagnosis, oral provocation tests. Seventy-seven children completed the allergy workup. A reaction to clarithromycin was recorded in 58 children (75.3%): 21 (36.2%) had a history of immediate reactions, and 37 (63.8%) had a history of nonimmediate reactions. A reaction to azithromycin was recorded in 19 children (24.6%): 6 (31.5%) had a history of immediate reaction, and 13 (68.42%) had a history of nonimmediate reaction. Positive results in skin tests and oral provocation tests with the suspect drug confirmed the diagnosis in 15.5% of reactions to clarithromycin (9 of 58) and in 47.3% of reactions to azithromycin (9 of 19) (P = .004). A complete allergy workup enabled us to confirm a diagnosis of clarithromycin and azithromycin allergy in 15.5% and 47.3% of cases, respectively. Azithromycin was more allergenic than clarithromycin in children.

  5. Oxidation Dynamics of Methionine with Singlet Oxygen: Effects of Methionine Ionization and Microsolvation.

    PubMed

    Liu, Fangwei; Liu, Jianbo

    2015-06-25

    We report an in-depth study on the gas-phase reactions of singlet O2[a(1)Δg] with methionine (Met) at different ionization and hydration states (including deprotonated [Met - H](-), hydrated deprotonated [Met - H](-)(H2O)1,2, and hydrated protonated MetH(+)(H2O)1,2), using guided-ion-beam scattering mass spectrometry. The measurements include the effects of collision energy (Ecol) on reaction cross sections over a center-of-mass Ecol range from 0.05 to 1.0 eV. The aim of this study is to probe the influences of Met ionization and hydration on its oxidation mechanism and dynamics. Density functional theory calculations, Rice-Ramsperger-Kassel-Marcus modeling, and quasi-classical, direct dynamics trajectory simulations were performed to examine the properties of various complexes and transition states that might be important along reaction coordinates, probe reaction potential energy surfaces, and to establish the atomic-level mechanism for the Met oxidation process. No oxidation products were observed for the reaction of [Met - H](-) with (1)O2 due to the high-energy barriers located in the product channels for this system. However, this nonreactive property was altered by the microsolvation of [Met - H](-); as a result, hydroperoxides were captured as the oxidation products for [Met - H](-)(H2O)1,2 + (1)O2. For the reaction of MetH(+)(H2O)1,2 + (1)O2, besides formation of hydroperoxides, an H2O2 elimination channel was observed. The latter channel is similar to what was found in the reaction of dehydrated MetH(+) with (1)O2 (J. Phys. Chem. B 2011, 115, 2671). The reactions of hydrated protonated and deprotonated Met are all inhibited by Ecol, becoming negligible at Ecol ≥ 0.5 eV. The kinetic and dynamical consequences of microsolvation on Met oxidation and their biological implications are discussed.

  6. Recent results on reactions with radioactive beams at RIBRAS (Radioactive Ion Beams in Brazil)

    NASA Astrophysics Data System (ADS)

    Lépine-Szily, A.; Lichtenthäler, R.; Guimarães, V.; Arazi, A.; Barioni, A.; Benjamim, E. A.; de Faria, P. N.; Descouvemont, P.; Gasques, L. R.; E; Leistenschneider; Mendes, D. R., Jr.; Morais, M. C.; Morcelle, V.; Moro, A. M.; Pampa Condori, R.; Pires, K. C. C.; Rodriguez-Gallardo, M.; Scarduelli, V.; Shorto, J. M. B.; Zamora, J. C.

    2015-04-01

    We present a quick description of RIBRAS (Radioactive Ion beams in Brazil), which is a superconducting double solenoid system, installed at the Pelletron Laboratory of the University of São Paulo and extends the capabilities of the original Pelletron Tandem Accelerator of 8MV terminal voltage (8UD) by producing secondary beams of unstable nuclei. The experimental program of the RIBRAS covers the study of elastic and inelastic scattering with the objective to study the interaction potential and the reaction mechanisms between weakly bound (RIB) and halo (6He and 8B) projectiles on light, medium and heavy mass targets. With highly purified beams, the study of resonant elastic scattering and resonant transfer reactions, using inverse kinematics and thick targets, have also been included in our recent experimental program.

  7. The reaction of iodobenzene-p-sulphonyl chloride (pipsyl chloride) with certain amino acids and peptides, and with insulin

    PubMed Central

    Fletcher, J. C.

    1967-01-01

    1. A system of separation using buffered Celite columns is described that enables the pipsyl derivatives of most of the common amino acids to be separated. 2. The reaction of pipsyl chloride with several amino acids not included in previous studies has been investigated. In particular, knowledge of the acid-soluble pipsyl derivatives of arginine, histidine, lysine, tyrosine and cysteic acid has been extended. 3. Reproducible factors have been obtained that enable corrections to be applied for the breakdown of pipsylamino acids on acid hydrolysis. 4. The reaction of pipsyl chloride with peptides has been studied under various conditions. 5. The extent of the reaction between pipsyl chloride and insulin depends on the nature of the solvent–buffer system, and under the best conditions so far found is about 75% complete. 6. In an Appendix, the separation of pipsylamino acids by thin-layer chromatography is described. PMID:16742498

  8. Catalytic reduction of dinitrogen to ammonia at a single molybdenum center

    PubMed Central

    Weare, Walter W.; Dai, Xuliang; Byrnes, Matthew J.; Chin, Jia Min; Schrock, Richard R.; Müller, Peter

    2006-01-01

    Since our discovery of the catalytic reduction of dinitrogen to ammonia at a single molybdenum center, we have embarked on a variety of studies designed to further understand this complex reaction cycle. These include studies of both individual reaction steps and of ligand variations. An important step in the reaction sequence is exchange of ammonia for dinitrogen in neutral molybdenum(III) compounds. We have found that this exchange reaction is first order in dinitrogen and relatively fast (complete in <1 h) at 1 atm of dinitrogen. Variations of the terphenyl substituents in the triamidoamine ligand demonstrate that the original ligand is not unique in its ability to yield successful catalysts. However, complexes that contain sterically less demanding ligands fail to catalyze formation of ammonia from dinitrogen; it is proposed as a consequence of a base-catalyzed decomposition of a diazenido (MoNNH) intermediate. PMID:17085586

  9. The scavenging reactions of nitrogen dioxide radical and carbonate radical by tea polyphenol derivatives: a pulse radiolysis study

    NASA Astrophysics Data System (ADS)

    Miao, Jin-Ling; Wang, Wen-Feng; Pan, Jing-Xi; Lu, Chang-Yuan; Li, Rong-Qun; Yao, Si-De

    2001-02-01

    The reactions of tea polyphenol derivatives, including epicatechin (EC) and epigallocatechin gallate (EGCG), with nitrogen dioxide radical (NO 2rad ) and carbonate radical (CO 3rad - ) have been studied in detail using time-resolved pulse radiolysis technique. In all the cases, the corresponding phenoxyl radical was formed through electron transfer reaction. From the build-up kinetics of the phenoxyl radicals and the decay kinetics of CO 3rad - radical, the reaction rate constants of EC, EGCG with NO 2rad and CO 3rad - were determined to be 9.0×10 7, 1.2×10 8 and 5.6×10 8, 6.6×10 8 dm 3 mol -1 s -1, respectively. Therefore, tea polyphenol derivatives proved to be efficient scavengers of NO 2rad and CO 3rad - radicals.

  10. Probing fast ribozyme reactions under biological conditions with rapid quench-flow kinetics.

    PubMed

    Bingaman, Jamie L; Messina, Kyle J; Bevilacqua, Philip C

    2017-05-01

    Reaction kinetics on the millisecond timescale pervade the protein and RNA fields. To study such reactions, investigators often perturb the system with abiological solution conditions or substrates in order to slow the rate to timescales accessible by hand mixing; however, such perturbations can change the rate-limiting step and obscure key folding and chemical steps that are found under biological conditions. Mechanical methods for collecting data on the millisecond timescale, which allow these perturbations to be avoided, have been developed over the last few decades. These methods are relatively simple and can be conducted on affordable and commercially available instruments. Here, we focus on using the rapid quench-flow technique to study the fast reaction kinetics of RNA enzymes, or ribozymes, which often react on the millisecond timescale under biological conditions. Rapid quench of ribozymes is completely parallel to the familiar hand-mixing approach, including the use of radiolabeled RNAs and fractionation of reactions on polyacrylamide gels. We provide tips on addressing and preventing common problems that can arise with the rapid-quench technique. Guidance is also offered on ensuring the ribozyme is properly folded and fast-reacting. We hope that this article will facilitate the broader use of rapid-quench instrumentation to study fast-reacting ribozymes under biological reaction conditions. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Probing fast ribozyme reactions under biological conditions with rapid quench-flow kinetics

    PubMed Central

    Bingaman, Jamie L.; Messina, Kyle J.; Bevilacqua, Philip C.

    2017-01-01

    Reaction kinetics on the millisecond timescale pervade the protein and RNA fields. To study such reactions, investigators often perturb the system with abiological solution conditions or substrates in order to slow the rate to timescales accessible by hand-mixing; however, such perturbations can change the rate-limiting step and obscure key folding and chemical steps that are found under biological conditions. Mechanical methods for collecting data on the millisecond timescale, which allow these perturbations to be avoided, have been developed over the last few decades. These methods are relatively simple and can be conducted on affordable and commercially available instruments. Here, we focus on using the rapid quench-flow technique to study the fast reaction kinetics of RNA enzymes, or ribozymes, which often react on the millisecond timescale under biological conditions. Rapid quench of ribozymes is completely parallel to the familiar hand-mixing approach, including the use of radiolabeled RNAs and fractionation of reactions on polyacrylamide gels. We provide tips on addressing and preventing common problems that can arise with the rapid-quench technique. Guidance is also offered on ensuring the ribozyme is properly folded and fast-reacting. We hope that this article will facilitate the broader use of rapid-quench instrumentation to study fast-reacting ribozymes under biological reaction conditions. PMID:28315484

  12. Ranitidine-induced anaphylaxis: clinical features, cross-reactivity, and skin testing.

    PubMed

    Park, K H; Pai, J; Song, D-G; Sim, D W; Park, H J; Lee, J-H; Jeong, K Y; Pan, C-H; Shin, I; Park, J-W

    2016-04-01

    Histamine H2 receptor antagonists are commonly prescribed medications and are known to be well tolerated. However, 99 cases of ranitidine-induced anaphylaxis occurred in Korea from 2007 to 2014. The purpose of this study was to determine the incidence, clinical features, and diagnostic methods for ranitidine-induced anaphylaxis. Ranitidine-related pharmacovigilance data from 2007 to 2014 were reviewed. Adverse drug reactions with causal relationships were selected, and clinical manifestations, outcomes, and drug-related information were assessed. For further investigation, 8 years of pharmacovigilance data were collected at a single centre. Twenty-three patients participated in in vivo and in vitro studies. Skin tests, oral provocation tests, and laboratory tests were performed, including tests using other kinds of histamine H2 receptor antagonists. Over 7 years, 584 patients suffered adverse reactions to ranitidine. The most common manifestation was cutaneous symptoms. Among them, 99 patients (17.0%) experienced anaphylaxis. In a single-centre study, skin prick tests were positive in 91.7% of ranitidine-induced anaphylaxis patients (11/12); the optimal concentration was 20 mg/mL. Detection of ranitidine-specific immunoglobulin E failed. Cimetidine and proton pump inhibitors showed no cross-reactivity with ranitidine based on the skin prick test, oral provocation test, or clinical determination. Surprisingly, 82.6% of patients reintroduced ranitidine and re-experienced the same adverse reactions because ranitidine was not considered the culprit drug. Although ranitidine is known as a safe drug, it can also cause diverse adverse reactions, including anaphylaxis. This study demonstrates the need to pay attention to adverse reactions to ranitidine and consider ranitidine as a cause of anaphylaxis. © 2016 John Wiley & Sons Ltd.

  13. Food Processing: The Influence of the Maillard Reaction on Immunogenicity and Allergenicity of Food Proteins

    PubMed Central

    Teodorowicz, Malgorzata; van Neerven, Joost

    2017-01-01

    The majority of foods that are consumed in our developed society have been processed. Processing promotes a non-enzymatic reaction between proteins and sugars, the Maillard reaction (MR). Maillard reaction products (MRPs) contribute to the taste, smell and color of many food products, and thus influence consumers’ choices. However, in recent years, MRPs have been linked to the increasing prevalence of diet- and inflammation-related non-communicable diseases including food allergy. Although during the last years a better understanding of immunogenicity of MRPs has been achieved, still only little is known about the structural/chemical characteristics predisposing MRPs to interact with antigen presenting cells (APCs). This report provides a comprehensive review of recent studies on the influence of the Maillard reaction on the immunogenicity and allergenicity of food proteins. PMID:28777346

  14. Fabrication Method Study of ZnO Nanocoated Cellulose Film and Its Piezoelectric Property

    PubMed Central

    Ko, Hyun-U; Kim, Hyun Chan; Kim, Jung Woong; Zhai, Lindong; Kim, Jaehwan

    2017-01-01

    Recently, a cellulose-based composite material with a thin ZnO nanolayer—namely, ZnO nanocoated cellulose film (ZONCE)—was fabricated to increase its piezoelectric charge constant. However, the fabrication method has limitations to its application in mass production. In this paper, a hydrothermal synthesis method suitable for the mass production of ZONCE (HZONCE) is proposed. A simple hydrothermal synthesis which includes a hydrothermal reaction is used for the production, and the reaction time is controlled. To improve the piezoelectric charge constant, the hydrothermal reaction is conducted twice. HZONCE fabricated by twice-hydrothermal reaction shows approximately 1.6-times improved piezoelectric charge constant compared to HZONCE fabricated by single hydrothermal reaction. Since the fabricated HZONCE has high transparency, dielectric constant, and piezoelectric constant, the proposed method can be applied for continuous mass production. PMID:28772971

  15. Application of solid-acid catalyst and marine macro-algae Gracilaria verrucosa to production of fermentable sugars.

    PubMed

    Jeong, Gwi-Taek; Kim, Sung-Koo; Park, Don-Hee

    2015-04-01

    In this study, the hydrolysis of marine macro-algae Gracilaria verrucosa with a solid-acid catalyst was investigated. To optimize the hydrolysis, four reaction factors, including liquid-to-solid ratio, catalyst loading, reaction temperature, and reaction time, were investigated. In the results, the highest total reducing sugar (TRS) yield, 61 g/L (51.9%), was obtained under the following conditions: 1:7.5 solid-to-liquid ratio, 15% (w/v) catalyst loading, 140 °C reaction temperature, and 150 min reaction time. Under these conditions, 10.7 g/L of 5-HMF and 2.5 g/L of levulinic acid (LA) were generated. The application of solid-acid catalyst and marine macro-algae resources shows a very high potential for production of fermentable sugars. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Food Processing: The Influence of the Maillard Reaction on Immunogenicity and Allergenicity of Food Proteins.

    PubMed

    Teodorowicz, Malgorzata; van Neerven, Joost; Savelkoul, Huub

    2017-08-04

    The majority of foods that are consumed in our developed society have been processed. Processing promotes a non-enzymatic reaction between proteins and sugars, the Maillard reaction (MR). Maillard reaction products (MRPs) contribute to the taste, smell and color of many food products, and thus influence consumers' choices. However, in recent years, MRPs have been linked to the increasing prevalence of diet- and inflammation-related non-communicable diseases including food allergy. Although during the last years a better understanding of immunogenicity of MRPs has been achieved, still only little is known about the structural/chemical characteristics predisposing MRPs to interact with antigen presenting cells (APCs). This report provides a comprehensive review of recent studies on the influence of the Maillard reaction on the immunogenicity and allergenicity of food proteins.

  17. Chemical reaction and dust formation studies in laboratory hydrocarbon plasmas.

    NASA Astrophysics Data System (ADS)

    Hippler, Rainer; Majumdar, Abhijit; Thejaswini, H. C.

    Plasma chemical reaction studies with relevance to, e.g., Titan's atmosphere have been per-formed in various laboratory plasmas [1,2]. Chemical reactions in a dielectric barrier discharge at medium pressure of 250-300 mbar have been studied in CH4 /N2 and CH4 /Ar gas mixtures by means of mass spectrometry. The main reaction scheme is production of H2 by fragmenta-tion of CH4 , but also production of larger hydrocarbons like Cn Hm with n up to 10 including formation of different functional CN groups is observed. [1] A. Majumdar and R. Hippler, Development of dielectric barrier discharge plasma processing apparatus for mass spectrometry and thin film deposition, Rev. Sci. Instrum. 78, 075103 (2007) [2] H.T. Do, G. Thieme, M. Frühlich, H. Kersten, and R. Hippler, Ion Molecule and Dust Particle Formation in Ar/CH4 , Ar/C2 H2 and Ar/C3 H6 Radio-frequency Plasmas, Contrib. Plasma Phys. 45, No. 5-6, 378-384 (2005)

  18. Thermal reactive hazards of HMX with contaminants.

    PubMed

    Peng, Deng-Jr; Chang, Cheng-Ming; Chiu, Miin

    2004-10-18

    In the past, many unexpected runaway accidents occurred in manufacturing processes, involving volatile chemical and explosive storage and transportation. Incompatible product reactions of high explosives must be carefully considered using loss prevention strategies for thermal hazards risk analysis. High explosive reactions vary via environmental changes, contact materials, or process situations, such as onset temperature and shifts in reaction type when high explosives are in contact with contaminants. Therefore, the manufacture and handling of high explosives require the utmost in safety and loss prevention. HMX (cyclotetramethyene tetranitramine) is one kind of high explosive widely used around the world which is stable with high detonation strength properties. In this study, the influences of contaminants on HMX are investigated. The studied contaminants include ferrous chloride tetrahydrate, ferric chloride hexahydrate, acetone solution, acetic acid, and nitric acid. DSC thermal curves and incompatible reaction kinetic evaluations were preformed using iron, chlorine and acid. Organic acetone solution has lesser effects on HMX. Hopefully, this study will lead to improved thermal hazards risk analysis and reduce accidents.

  19. Reaction Kernel Structure of a Slot Jet Diffusion Flame in Microgravity

    NASA Technical Reports Server (NTRS)

    Takahashi, F.; Katta, V. R.

    2001-01-01

    Diffusion flame stabilization in normal earth gravity (1 g) has long been a fundamental research subject in combustion. Local flame-flow phenomena, including heat and species transport and chemical reactions, around the flame base in the vicinity of condensed surfaces control flame stabilization and fire spreading processes. Therefore, gravity plays an important role in the subject topic because buoyancy induces flow in the flame zone, thus increasing the convective (and diffusive) oxygen transport into the flame zone and, in turn, reaction rates. Recent computations show that a peak reactivity (heat-release or oxygen-consumption rate) spot, or reaction kernel, is formed in the flame base by back-diffusion and reactions of radical species in the incoming oxygen-abundant flow at relatively low temperatures (about 1550 K). Quasi-linear correlations were found between the peak heat-release or oxygen-consumption rate and the velocity at the reaction kernel for cases including both jet and flat-plate diffusion flames in airflow. The reaction kernel provides a stationary ignition source to incoming reactants, sustains combustion, and thus stabilizes the trailing diffusion flame. In a quiescent microgravity environment, no buoyancy-induced flow exits and thus purely diffusive transport controls the reaction rates. Flame stabilization mechanisms in such purely diffusion-controlled regime remain largely unstudied. Therefore, it will be a rigorous test for the reaction kernel correlation if it can be extended toward zero velocity conditions in the purely diffusion-controlled regime. The objectives of this study are to reveal the structure of the flame-stabilizing region of a two-dimensional (2D) laminar jet diffusion flame in microgravity and develop a unified diffusion flame stabilization mechanism. This paper reports the recent progress in the computation and experiment performed in microgravity.

  20. [Cutaneous adverse drug reaction: prospective study of 118 cases].

    PubMed

    Chaabane, Hend; Masmoudi, Abderrahmen; Amouri, Meriem; Ghorbel, Sonda; Boudaya, Sonia; Hammami, Serriya; Zghal, Khaled; Turki, Hamida

    2013-01-01

    Few prospective studies are available on the incidence and analysis of the characteristics of adverse cutaneous drug reactions. To describe the adverse cutaneous reactions, their epidemiologic characteristics as well as the different causative drugs through a prospective hospital study. A 12-month prospective study was managed in our department of dermatology of the teaching hospital Hedi Chaker of Sfax. Requested information included patient characteristics (associated disorders), drug intake (list and chronology of the drug intake during the 3 weeks preceding the adverse reaction) and characteristics of the skin reaction (type, course). The diagnosis was based on a beam of clinical and anamnestic arguments. The drug imputability was evaluated according to the Begaud's French method. One hundred eighteen cases were collected. A prevalence of 1.08/100 among patients consulting in dermatology department was estimated. The macular and papular exanthema represented the most frequent clinical aspects (42 cases) followed by acute urticaria (23 cases), photosensitivity (19 cases) and fixed drug eruption (15 cases). Principal imputable drugs were antibiotics, mainly penicillins followed by analgesics and non-steroidal anti-inflammatory. Although it was monocentric, this study revealed a high frequency of drug-induced dermatitis with different clinical presentation. The high incidence of drug-induced dermatitis induced by antibiotics, analgesics and anti-inflammatory is due to their widespread use, often in self-medication.

  1. Turing patterns and a stochastic individual-based model for predator-prey systems

    NASA Astrophysics Data System (ADS)

    Nagano, Seido

    2012-02-01

    Reaction-diffusion theory has played a very important role in the study of pattern formations in biology. However, a group of individuals is described by a single state variable representing population density in reaction-diffusion models and interaction between individuals can be included only phenomenologically. Recently, we have seamlessly combined individual-based models with elements of reaction-diffusion theory. To include animal migration in the scheme, we have adopted a relationship between the diffusion and the random numbers generated according to a two-dimensional bivariate normal distribution. Thus, we have observed the transition of population patterns from an extinction mode, a stable mode, or an oscillatory mode to the chaotic mode as the population growth rate increases. We show our phase diagram of predator-prey systems and discuss the microscopic mechanism for the stable lattice formation in detail.

  2. Kinetics and thermochemistry of polyatomic free radicals: New results and new understandings

    NASA Technical Reports Server (NTRS)

    Gutman, David; Slagle, Irene R.

    1990-01-01

    An experimental facility for the study of the chemical kinetics of polyatomic free radicals is described which consists of a heatable tubular reactor coupled to a photoionization mass spectrometer. Its use in different kinds of chemical kinetic studies is also discussed. Examples presented include studies of the C2H3 + O2, C2H3 + HC1, CH3 + O, and CH3 + CH3 reactions. The heat of formation of C2H3 was obtained from the results of the study of the C2H3 + HC1 reaction.

  3. Photochemical transformations of diazocarbonyl compounds: expected and novel reactions

    NASA Astrophysics Data System (ADS)

    Galkina, O. S.; Rodina, L. L.

    2016-05-01

    Photochemical reactions of diazocarbonyl compounds are well positioned in synthetic practice as an efficient method for ring contraction and homologation of carboxylic acids and as a carbene generation method. However, interpretation of the observed transformations of diazo compounds in electronically excited states is incomplete and requires a careful study of the fine mechanisms of these processes specific to different excited states of diazo compounds resorting to modern methods of investigation, including laser technology. The review is devoted to analysis of new data in the chemistry of excited states of diazocarbonyl compounds. The bibliography includes 155 references.

  4. Multi-channel gas-delivery system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rozenzon, Yan; Trujillo, Robert T.; Beese, Steven C.

    One embodiment of the present invention provides a gas-delivery system for delivering reaction gas to a reactor chamber. The gas-delivery system includes a main gas-inlet port for receiving reaction gases and a gas-delivery plate that includes a plurality of gas channels. A gas channel includes a plurality of gas holes for allowing the reaction gases to enter the reactor chamber from the gas channel. The gas-delivery system further includes a plurality of sub-gas lines coupling together the main gas-inlet port and the gas-delivery plate, and a respective sub-gas line is configured to deliver a portion of the received reaction gasesmore » to a corresponding gas channel.« less

  5. Leflunomide in active rheumatoid arthritis: a prospective study in daily practice.

    PubMed

    Van Roon, E N; Jansen, T L Th A; Mourad, L; Houtman, P M; Bruyn, G A W; Griep, E N; Wilffert, B; Tobi, H; Brouwers, J R B J

    2004-06-01

    We prospectively studied the efficacy, incidence of adverse drug reactions and withdrawal from leflunomide in an outpatient population with rheumatoid arthritis in a setting of care-as-usual. In this prospective case series study, from outpatient medical records a standard dataset was collected including patient and disease characteristics, data on leflunomide use and adverse drug reactions. During the study period 136 rheumatoid arthritis patients started leflunomide. Median (range) follow-up duration was 317 (11-911) days. Sixty-five percent of patients experienced at least one adverse drug reaction related to leflunomide. During follow-up 76 patients (56%) withdrew from leflunomide treatment, mainly because of adverse drug reactions (29%) or lack of efficacy (13%). The overall incidence density for withdrawal from leflunomide was 56.2 per 100 patient-years. Complete data for calculating efficacy using a validated disease activity score on 28 joints (DAS(28)) was available for 48, 36, and 35% of patients at 2, 6, and 12 months follow-up, respectively. Within a 12-month period after start of leflunomide treatment 76% of the evaluable patients were classified as moderate or good responders according to the DAS(28) response criteria. In the setting of care-as-usual, rheumatoid arthritis patients starting leflunomide frequently experienced adverse drug reactions. More than half of the patients withdrew from leflunomide treatment within a year after start of leflunomide treatment, mainly because of adverse drug reactions.

  6. Leflunomide in active rheumatoid arthritis: a prospective study in daily practice.

    PubMed

    Van Roon, E N; Jansen, T L Th A; Mourad, L; Houtman, P M; Bruyn, G A W; Griep, E N; Wilffert, B; Tobi, H; Brouwers, J R B J

    2004-08-01

    We prospectively studied the efficacy, incidence of adverse drug reactions and withdrawal from leflunomide in an outpatient population with rheumatoid arthritis in a setting of care-as-usual. In this prospective case series study, a standard dataset was collected from outpatient medical records, including patient and disease characteristics, data on leflunomide use and adverse drug reactions. During the study period 136 rheumatoid arthritis patients started leflunomide. Median (range) follow-up duration was 317 (11-911) days. Sixty-five percent of patients experienced at least one adverse drug reaction related to leflunomide. During follow-up 76 patients (56%) withdrew from leflunomide treatment, mainly because of adverse drug reactions (29%) or lack of efficacy (13%). The overall incidence density for withdrawal from leflunomide was 56.2 per 100 patient years. Complete data for calculating efficacy using a validated disease activity score on 28 joints (DAS(28)) was available for 48, 36, and 35% of patients at 2, 6, and 12 months follow-up, respectively. Within a 12-month period after start of leflunomide treatment 76% of the evaluable patients were classified as moderate or good responders according to the DAS(28) response criteria. In the setting of care-as-usual rheumatoid arthritis patients starting leflunomide frequently experienced adverse drug reactions. More than half of the patients withdrew from leflunomide treatment within 1 year of starting leflunomide treatment, mainly because of adverse drug reactions.

  7. Evaluation of synthesized cross linked polyvinyl alcohol as potential disintegrant.

    PubMed

    Patel, Ashok R; Vavia, Pradeep R

    2010-01-01

    The present study deals with evaluation of crosslinked poly vinyl alcohol (PVA) as a potential disintegrant. Crosslinking of PVA was carried out using glutaraldehyde as a crosslinker, in presence of acidic conditions. The crosslinking reaction was optimized for a) polymer: crosslinker ratio; b) temperature requirement and c) reaction duration. Certain physical parameters of the disintegrant (including sedimentation volume, hydration capacity, specific surface area and bulk and tap density) were determined and compared to the known disintegrants. Characterization was carried out using FT-IR, DSC, XRD, SEM and Photo microscopy studies. The developed excipient was also studied for acute toxicity in rats and found to be safe for oral use. Disintegration property of formed product was compared to known disintegrant (Ac-Di-Sol) and it was found to give better results. The disintegration mechanism of developed disintegrant was postulated based on results obtained from various physical evaluations including: Study of effect of disintegrant concentration, fillers, and hardness, mode of incorporation and method of granulation on disintegration activity. By changing the condition parameters of well known crosslinking reaction of PVA, we obtained a crosslinked product which had excellent disintegration activity, good flow and optimal tableting properties.

  8. A molecular dynamics study of intramolecular proton transfer reaction of malonaldehyde in solutions based upon mixed quantum-classical approximation. I. Proton transfer reaction in water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamada, Atsushi; Kojima, Hidekazu; Okazaki, Susumu, E-mail: okazaki@apchem.nagoya-u.ac.jp

    2014-08-28

    In order to investigate proton transfer reaction in solution, mixed quantum-classical molecular dynamics calculations have been carried out based on our previously proposed quantum equation of motion for the reacting system [A. Yamada and S. Okazaki, J. Chem. Phys. 128, 044507 (2008)]. Surface hopping method was applied to describe forces acting on the solvent classical degrees of freedom. In a series of our studies, quantum and solvent effects on the reaction dynamics in solutions have been analysed in detail. Here, we report our mixed quantum-classical molecular dynamics calculations for intramolecular proton transfer of malonaldehyde in water. Thermally activated proton transfermore » process, i.e., vibrational excitation in the reactant state followed by transition to the product state and vibrational relaxation in the product state, as well as tunneling reaction can be described by solving the equation of motion. Zero point energy is, of course, included, too. The quantum simulation in water has been compared with the fully classical one and the wave packet calculation in vacuum. The calculated quantum reaction rate in water was 0.70 ps{sup −1}, which is about 2.5 times faster than that in vacuum, 0.27 ps{sup −1}. This indicates that the solvent water accelerates the reaction. Further, the quantum calculation resulted in the reaction rate about 2 times faster than the fully classical calculation, which indicates that quantum effect enhances the reaction rate, too. Contribution from three reaction mechanisms, i.e., tunneling, thermal activation, and barrier vanishing reactions, is 33:46:21 in the mixed quantum-classical calculations. This clearly shows that the tunneling effect is important in the reaction.« less

  9. Experimental study of decomposition of aqueous nitrosyl thiocyanate.

    PubMed

    Rayson, Mark S; Mackie, John C; Kennedy, Eric M; Dlugogorski, Bogdan Z

    2011-08-15

    This study has examined the kinetics of the decomposition of nitrosyl thiocyanate (ONSCN) by stopped flow UV-vis spectrophotometry, with the reaction products identified and quantified by infrared spectroscopy, membrane inlet mass spectrometry, ion chromatography, and CN(-) ion selective electrode. The reaction results in the formation of nitric oxide and thiocyanogen, the latter decomposing to sulfate and hydrogen cyanide in aqueous solution. The rate of consumption of ONSCN depends strongly on the concentration of SCN(-) ions and is inhibited by nitric oxide. We have developed a reaction mechanism that comprises three parallel pathways for the decomposition of ONSCN. At high thiocyanate concentrations, two reaction pathways operate including a second order reaction to generate NO and (SCN)(2) and a reversible reaction between ONSCN and SCN(-) producing NO and (SCN)(2)(-), with the rate limiting step corresponding to the consumption of (SCN)(2)(-) by reaction with ONSCN. The third reaction pathway, which becomes significant at low thiocyanate concentrations, involves formation of a previously unreported species, ONOSCN, via a reaction between ONSCN and HOSCN, the latter constituting an intermediate in the hydrolysis of (SCN)(2). ONOSCN contributes to the formation of NO via homolysis of the O-NO bond and subsequent dimerization and hydrolysis of OSCN. Fitting the chemical reactions of the model to the experimental measurements, which covered a wide range of reactant concentrations, afforded estimation of all relevant kinetic parameters and provided an excellent match. The reaction mechanism developed in this contribution may be applied to predict the rates of NO formation from ONSCN during the synthesis of azo dyes, the gassing of explosive emulsions, or nitrosation reactions occurring in the human body. © 2011 American Chemical Society

  10. Nuclear physics research operation. Monthly report, November 1958

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Faulkner, J.E.

    1958-12-10

    This report is a summary of projects worked on in support of the production reactors at Hanford. The projects include criticality studies, from tasks associated with fuel element reprocessing to shipments of slightly enriched uranium. They include studies of neutron cross sections for different reactions and neutron flux measurements in different reactor locations, as well as design studies for future reactor projects.

  11. The Hydrolysis of Carbonyl Sulfide at Low Temperature: A Review

    PubMed Central

    Zhao, Shunzheng; Yi, Honghong; Tang, Xiaolong; Jiang, Shanxue; Gao, Fengyu; Zhang, Bowen; Zuo, Yanran; Wang, Zhixiang

    2013-01-01

    Catalytic hydrolysis technology of carbonyl sulfide (COS) at low temperature was reviewed, including the development of catalysts, reaction kinetics, and reaction mechanism of COS hydrolysis. It was indicated that the catalysts are mainly involved metal oxide and activated carbon. The active ingredients which can load on COS hydrolysis catalyst include alkali metal, alkaline earth metal, transition metal oxides, rare earth metal oxides, mixed metal oxides, and nanometal oxides. The catalytic hydrolysis of COS is a first-order reaction with respect to carbonyl sulfide, while the reaction order of water changes as the reaction conditions change. The controlling steps are also different because the reaction conditions such as concentration of carbonyl sulfide, reaction temperature, water-air ratio, and reaction atmosphere are different. The hydrolysis of carbonyl sulfide is base-catalyzed reaction, and the force of the base site has an important effect on the hydrolysis of carbonyl sulfide. PMID:23956697

  12. [Characterization of adverse drug reactions in adults over 44 years of age in Bogota, January-December, 2012].

    PubMed

    Chaves, Marlén

    2015-01-01

    In Colombia, aging of the population is a reality and elders consume more drugs than the young do. Consequently, they are more exposed to adverse drug reactions. To characterize suspected adverse drug reactions in adults over 44 years of age in Bogota in 2012. We conducted a pharmacological surveillance study that included 470 reports of adverse drug events and associated problems with the use of drugs in adults over 44 years old included in the database of Bogotá´s pharmacosurveillance program. We evaluated 470 reports of adverse drug events and associated problems with the use of drugs in adults over 44 years of age. From these, 432 reports (91.9%) were classified as suspected adverse drug reactions and 28 (6%), as associated problems with the use of drugs. The incidence rate for adverse drug events reported in Bogotá was 22.5 for every 100,000 elders, which increased in direct proportion to patients´ age. The most frequently reported drug was antibacterials with 94 notifications (20%). The organ system with the highest number of alterations was the skin and annexes with 21.2% of cases. Regarding severity assessment, 69.5% of adverse drug reactions were moderate, and as for causality, most adverse drug reactions were classified as possible, with 45.8% of the reports. The characterization of adverse drug reactions in older adults in Bogotá is similar to that reported in the literature for this population age group.

  13. Methods of producing adsorption media including a metal oxide

    DOEpatents

    Mann, Nicholas R; Tranter, Troy J

    2014-03-04

    Methods of producing a metal oxide are disclosed. The method comprises dissolving a metal salt in a reaction solvent to form a metal salt/reaction solvent solution. The metal salt is converted to a metal oxide and a caustic solution is added to the metal oxide/reaction solvent solution to adjust the pH of the metal oxide/reaction solvent solution to less than approximately 7.0. The metal oxide is precipitated and recovered. A method of producing adsorption media including the metal oxide is also disclosed, as is a precursor of an active component including particles of a metal oxide.

  14. Catalytic effects of histidine enantiomers and glycine on the formation of dileucine and dimethionine in the salt-induced peptide formation reaction.

    PubMed

    Li, Feng; Fitz, Daniel; Fraser, Donald G; Rode, Bernd M

    2010-01-01

    The salt-induced peptide formation (SIPF) reaction takes place readily under mild reaction conditions and proceeds via a copper complex. Its ease of reaction and the universality for prebiotic scenarios add weights to the arguments in favour of the importance of peptide and proteins in the tug of war with the RNA world hypothesis. In addition, the SIPF reaction has a preference for L-form amino acids in dipeptide formation, casting light on the puzzle of biohomochirality, especially for the amino acids with aliphatic side chains. A detailed investigation on the behaviour of aliphatic leucine in the SIPF reaction is presented in this paper, including the catalytic effects of glycine, L- and D-histidine as well as the stereoselectivity under all the reaction conditions above. The results show a relatively low reactivity and stereoselectivity of leucine in the SIPF reaction, while both glycine and histidine enantiomers remarkably increase the yields of dileucine by factors up to 40. Moreover, a comparative study of the effectiveness of L- and D-histidine in catalysing the formation of dimethionine was also carried out and extends the scope of mutual catalysis by amino acid enantiomers in the SIPF reaction.

  15. A 12-Day Course of Imiquimod 5% for the Treatment of Actinic Keratosis: Effectiveness and Local Reactions.

    PubMed

    Serra-Guillén, C; Nagore, E; Llombart, B; Sanmartín, O; Requena, C; Calomarde, L; Guillén, C

    2018-04-01

    Imiquimod is an excellent option for patients with actinic keratosis, although its use may be limited by the long course of treatment required (4 weeks) and the likelihood of local skin reactions. The objectives of the present study were to demonstrate the effectiveness of a 12-day course of imiquimod 5% for the treatment of actinic keratosis and to examine the association between treatment effectiveness and severity of local reactions. We included patients with at least 8 actinic keratoses treated with imiquimod 5% cream for 12 consecutive days. Local reactions were classified as mild, moderate, or severe. The statistical analysis of the association between local reactions and clinical response was based on the Pearson χ 2 test and the Spearman rank correlation test. Sixty-five patients completed the study. Complete response was recorded in 52.3% and partial response in 75.4%. We found a statistically significant association between severity of the local reaction and response to treatment in both the Pearson χ 2 test and the Spearman rank correlation test. A 12-day course of imiquimod 5% proved effective for the treatment of actinic keratosis. Severity of local reactions during treatment was correlated with clinical response. Copyright © 2017 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

  16. Family structure and posttraumatic stress reactions: a longitudinal study using multilevel analyses

    PubMed Central

    2011-01-01

    Background There is limited research on the relevance of family structures to the development and maintenance of posttraumatic stress following disasters. We longitudinally studied the effects of marital and parental statuses on posttraumatic stress reactions after the 2004 Southeast Asian tsunami and whether persons in the same households had more shared stress reactions than others. Method The study included a tourist population of 641 Norwegian adult citizens, many of them from families with children. We measured posttraumatic stress symptoms with the Impact of Event Scale-Revised at 6 months and 2 years post-disaster. Analyses included multilevel methods with mixed effects models. Results Results showed that neither marital nor parental status was significantly related to posttraumatic stress. At both assessments, adults living in the same household reported levels of posttraumatic stress that were more similar to one another than adults who were not living together. Between households, disaster experiences were closely related to the variance in posttraumatic stress symptom levels at both assessments. Within households, however, disaster experiences were less related to the variance in symptom level at 2 years than at 6 months. Conclusions These results indicate that adult household members may influence one another's posttraumatic stress reactions as well as their interpretations of the disaster experiences over time. Our findings suggest that multilevel methods may provide important information about family processes after disasters. PMID:22171549

  17. Different Modes of Feedback and Peak Vertical Ground Reaction Force During Jump Landing: A Systematic Review

    PubMed Central

    Ericksen, Hayley M.; Gribble, Phillip A.; Pfile, Kate R.; Pietrosimone, Brian G.

    2013-01-01

    Context: Excessive ground reaction force when landing from a jump may result in lower extremity injuries. It is important to better understand how feedback can influence ground reaction force (GRF) and potentially reduce injury risk. Objective: To determine the effect of expert-provided (EP), self-analysis (SA), and combination EP and SA (combo) feedback on reducing peak vertical GRF during a jump-landing task. Data Sources: We searched the Web of Science database on July 1, 2011; using the search terms ground reaction force, landing biomechanics, and feedback elicited 731 initial hits. Study Selection: Of the 731 initial hits, our final analysis included 7 studies that incorporated 32 separate data comparisons. Data Extraction: Standardized effect sizes and 95% confidence intervals (CIs) were calculated between pretest and posttest scores for each feedback condition. Data Synthesis: We found a homogeneous beneficial effect for combo feedback, indicating a reduction in GRF with no CIs crossing zero. We also found a homogeneous beneficial effect for EP feedback, but the CIs from 4 of the 10 data comparisons crossed zero. The SA feedback showed strong, definitive effects when the intervention included a videotape SA, with no CIs crossing zero. Conclusions: Of the 7 studies reviewed, combo feedback seemed to produce the greatest decrease in peak vertical GRF during a jump-landing task. PMID:24067153

  18. Double differential cross section calculations for 16O and 90Zr elements

    NASA Astrophysics Data System (ADS)

    Demirkol, İ.

    2018-04-01

    Double differential cross sections in proton induced reactions on 90Zr and O2 (inert matrix fuel) is calculated at the bombarding energies between 29 and 300 MeV. The proton-induced nuclear reaction cross section data can be used in technical applications such as the isotope production alternatives, spallation reactions for production of neutrons in spallation neutron source, etc. In this study, the cascade excition model including the effect of preequilibrium is used to calculate the differential cross section. Then, the obtained results are discussed and compared with available experimental data.

  19. Anionic Four Electron Donor-Based Palladacycles as Catalysts for Addition Reactions of Arylboronic Acids with α,β-Unsaturated Ketones, Aldehydes and α-Ketoesters

    PubMed Central

    He, Ping; Lu, Yong; Dong, Cheng-Guo; Hu, Qiao-Sheng

    2008-01-01

    Anionic four electron donor-based palladacycle-catalyzed 1,4-additions of arylboronic acids with α,β-unsaturated ketones and 1,2-additions of arylboronic acids with aldehydes and α-ketoesters are described. Our study demonstrated that palladacycles were highly efficient, practical catalysts for these addition reactions. The work described here not only opened a new paradigm for the application of palladacycles, but may also pave the road for other metalacycles as practically useful catalysts for such addition reactions including asymmetric ones. PMID:17217300

  20. Adverse reactions of trivalent influenza vaccine in HIV-infected individuals.

    PubMed

    Hajiabdolbaghi, Mahboube; Jam, Sara; SeyedAlinaghi, SeyedAhmad; Jafari, Sirous; Badie, Banafshe Moradmand; Sabzvari, Duman

    2010-01-01

    In this study, we assessed the adverse reactions to influenza vaccination in HIV-infected individuals. From November 2006 to January 2007, a total of 203 HIV-infected persons were recruited. Demographic data were collected. Subjects were evaluated 48 h and 15 days after vaccination for symptoms and significant health events as possible side effects. Participants were instructed to measure their temperature in the morning and evening for 2 days post-immunization and to assess injection site and systemic adverse reactions. 80.3% of the subjects were male. The mean age of the subjects was 36.9 +/- 7.9 years. Local and systemic reactions were reported by 61 (30%) and 62 (30.5%) persons, respectively. The most common adverse reactions to the influenza vaccine included skin redness (37 cases), induration (32 cases), and pain (55 cases) as local reactions, and fever (22 cases), myalgia (46 cases), headache (12 cases) and weakness (35 cases) as general reactions. 1.4 % of the subjects had fever over 38.5 degrees C. There were significant associations between myalgia and flushing with CD4 counts (P<0.05). We found no relationship between adverse reactions and sex, history of smoking, allergy, alcohol, and drug usage, stage of HIV infection, anti-retroviral therapies, anti-TB medication and previous vaccination. We concluded that inactivated influenza vaccine administered in HIV-infected adults did not result in potential adverse events in this study population.

  1. On the mechanism of the palladium catalyzed intramolecular Pauson-Khand-type reaction.

    PubMed

    Lan, Yu; Deng, Lujiang; Liu, Jing; Wang, Can; Wiest, Olaf; Yang, Zhen; Wu, Yun-Dong

    2009-07-17

    Density functional theory calculations and experimental studies have been carried out on the intramolecular Pauson-Khand-Type reaction mediated by a PdCl(2)-thiourea catalyst, which proceeds under mild reaction conditions and provides a useful alternative to traditional Pauson-Khand reactions. The classical mechanism of the Pauson-Khand reaction involving the alkyne/alkene C-C bond formation as the key step has been found to be energetically unfavorable and is not in line with the experimental observations. A novel reaction mechanism has been proposed for the reaction. The first step involves the cis-halometalation of the alkyne, followed by sequential alkene and carbonyl insertion. The rate-determining fourth step is an intramolecular C-Cl oxidative addition, leading to a Pd(IV) intermediate. A C-C bond formation by reductive elimination completes the reaction. The mechanism is in agreement with the key experimental observations including (1) the need of a chloride for catalytic activity and the absence of catalysis with Pd(OAc)(2) alone; (2) the rate acceleration by the addition of LiCl; both with PdCl(2) and Pd(OAc)(2) catalysts; and (3) the preferred formation of the trans diastereomer in substituted cases. The cis halometalation and the formation and stability of the Pd(IV) intermediate is studied in detail and provides general insights into these novel steps.

  2. Multi-chamber nucleic acid amplification and detection device

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dugan, Lawrence

    A nucleic acid amplification and detection device includes an amplification cartridge with a plurality of reaction chambers for containing an amplification reagent and a visual detection reagent, and a plurality of optically transparent view ports for viewing inside the reaction chambers. The cartridge also includes a sample receiving port which is adapted to receive a fluid sample and fluidically connected to distribute the fluid sample to the reaction chamber, and in one embodiment, a plunger is carried by the cartridge for occluding fluidic communication to the reaction chambers. The device also includes a heating apparatus having a heating element whichmore » is activated by controller to generate heat when a trigger event is detected. The heating apparatus includes a cartridge-mounting section which positioned a cartridge in thermal communication with the heating element so that visual changes to the contents of the reaction chambers are viewable through the view ports.« less

  3. Effects of directional uncertainty on visually-guided joystick pointing.

    PubMed

    Berryhill, Marian; Kveraga, Kestutis; Hughes, Howard C

    2005-02-01

    Reaction times generally follow the predictions of Hick's law as stimulus-response uncertainty increases, although notable exceptions include the oculomotor system. Saccadic and smooth pursuit eye movement reaction times are independent of stimulus-response uncertainty. Previous research showed that joystick pointing to targets, a motor analog of saccadic eye movements, is only modestly affected by increased stimulus-response uncertainty; however, a no-uncertainty condition (simple reaction time to 1 possible target) was not included. Here, we re-evaluate manual joystick pointing including a no-uncertainty condition. Analysis indicated simple joystick pointing reaction times were significantly faster than choice reaction times. Choice reaction times (2, 4, or 8 possible target locations) only slightly increased as the number of possible targets increased. These data suggest that, as with joystick tracking (a motor analog of smooth pursuit eye movements), joystick pointing is more closely approximated by a simple/choice step function than the log function predicted by Hick's law.

  4. The reaction of NH2 with NO2

    NASA Technical Reports Server (NTRS)

    Jayanty, R. K. M.; Simonaitis, R.; Heicklen, J.

    1976-01-01

    Ammonia (NH3) was photolyzed at 213.9 nm in the presence of NO2 at 25 C in order to study the reactions of NH2 with NO2. The products included NO, with a quantum yield of 1.0. The other measured products of the reaction were N2 and N2O with respective quantum yields of 0.94 plus or minus 0.10 and 0.3 in the presence of small amounts of He and 0.65 plus or minus 0.15 and 0.13 in the presence of a large excess of He. The quantum yield for NO2 consumption was 6.0 plus or minus 2.0 in the absence of He. These results are explained in terms of various reactions.

  5. Quantum mechanical calculations of vibrational population inversion in chemical reactions - Numerically exact L-squared-amplitude-density study of the H2Br reactive system

    NASA Technical Reports Server (NTRS)

    Zhang, Y. C.; Zhang, J. Z. H.; Kouri, D. J.; Haug, K.; Schwenke, D. W.

    1988-01-01

    Numerically exact, fully three-dimensional quantum mechanicl reactive scattering calculations are reported for the H2Br system. Both the exchange (H + H-prime Br to H-prime + HBr) and abstraction (H + HBR to H2 + Br) reaction channels are included in the calculations. The present results are the first completely converged three-dimensional quantum calculations for a system involving a highly exoergic reaction channel (the abstraction process). It is found that the production of vibrationally hot H2 in the abstraction reaction, and hence the extent of population inversion in the products, is a sensitive function of initial HBr rotational state and collision energy.

  6. [A new method for the preparation of potassium ferrate and spectroscopic characterization].

    PubMed

    Zheng, Huai-li; Deng, Lin-li; Ji, Fang-ying; Jiang, Shao-jie; Zhang, Peng

    2010-10-01

    Calcium hypochlorite was used as the raw material for preparation of the high purity potassium ferrate. The study includes the effects of reaction temperature, recrystallization temperature, reaction time, Ca(ClO)2 dosage, and the amount of calcium hypochlorite on the yield. It was determined that when the reaction temperature was 25 degrees C, recrystallization temperature 0 degree C and reaction time 40 min, the yield was more than 75%. The purity was detected by direct spectrophotometric method to be more than 92%. The product was characterized by infrated spectrum(IR), X-ray diffraction (XRD) and ultraviolet spectrum (UV) methods and proved to be potassium ferrate that was prepared by calcium hypochlorite as the raw material.

  7. Detailed mechanism of the NO + CO reaction on Rh(1 0 0) and Rh(1 1 1): A first-principles study

    NASA Astrophysics Data System (ADS)

    Tan, Lu; Huang, Liangliang; Liu, Yingchun; Wang, Qi

    2018-06-01

    Through DFT calculations, the detailed mechanism of the catalytic NO + CO reaction, a prototypical system with great practical applications especially in the automobile-exhaust aftertreatment, was determined on Rh(1 0 0) and Rh(1 1 1). The elementary steps and their energy evolution were revealed. These steps include NO dissociation, N2 formation through N recombination, CO2 formation, and N2O formation, transformation, and dissociation. The reaction steps of NO2 formation and direct reaction between NO and CO were also studied, and were verified to be relatively insignificant in this reaction system. Results shed light on the atomic-level origin why Rh(1 0 0) is more active for this reaction system and more selective for the production of N2 versus N2O compared with Rh(1 1 1). Meanwhile, the preference between the two routes for N2 production, i.e., N atoms recombination and N2O as intermediate, was found to be dependent on the distribution of surface species and the interaction among them intricately. This work provides a basis for further kinetic modeling to investigate the catalytic properties on a realistic scale.

  8. Brief report: adolescents under missile attacks: sense of coherence as a mediator between exposure and stress-related reactions.

    PubMed

    Braun-Lewensohn, Orna; Sagy, Shifra; Roth, Guy

    2011-02-01

    Employing the salutogenic approach (Antonovsky, 1987), this pilot study aimed at exploring the mediation effect of Sense of Coherence (SOC) on the relationships between exposure to missile attacks and stress-related reactions among adolescents. A strong SOC means a tendency to see the world as more comprehensible, manageable and meaningful. Data were gathered during August 2006 (Second Lebanon War) from 230 Israeli adolescents, 12-18 years old. Adolescents filled out self-reported questionnaires, including demographics, level of physical exposure, SOC, Scale of Psychological Distress (SPD), State Anxiety and State Anger. Exposure to missile attacks was found to be significantly positively linked to stress reactions; exposure was negatively linked to SOC which was also negatively linked to stress reactions. The mediation hypothesis was supported, with SOC mediating the effect of exposure to missile attacks on stress reactions. It seems that SOC may have a protective effect against stress reactions among adolescents exposed to political violence. This should be further studied in a longitudinal research. Copyright © 2010 The Association for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  9. Adverse drug reactions in hospitalized Colombian children.

    PubMed

    de Las Salas, Roxana; Díaz-Agudelo, Daniela; Burgos-Flórez, Francisco Javier; Vaca, Claudia; Serrano-Meriño, Dolores Vanessa

    2016-09-30

    The occurrence of adverse drug reactions is an important issue due to the lack of drug safety data in children. To describe the Adverse Drug Reactions in inpatient children under 6 years of age in two general pediatrics wards located in Barranquilla, Colombia. A prospective cohort study based on intensive pharmacovigilance was conducted during six months in order to monitor the emergence of Adverse Drug Reactions in inpatients children under 6 years of age with at least one medication prescribed. The study was conducted in two pediatric wards of two hospitals located in Barranquilla, Colombia. Naranjo´s Algorithm was used to evaluate imputability, the modified Hartwig and Siegel assessment scale to establish severity and the Schumock and Thornton criteria to determine preventability. Of a total of 772 monitored patients, 156 Adverse Drug Reactions were detected on 147 children. The cumulative incidence of Adverse Drug Reactions was 19.0% (147/772); the incidence density was 37.6 Adverse Drug Reactions per 1,000 patients-days (147/3,913). The frequency was higher in children under 2 years of age (12.7%). Emergence of Adverse Drug Reactions was higher in male patients (RR= 1.66; 95% CI= 1.22-2.22, p = 0.001) and in those who used systemic antibiotics (RR= 1.82; 95% CI= 1.17-2.82, p = 0.005). Adverse Drug Reactions are common among hospitalized children and represent an additional burden of morbidity and risk, particularly in those who used several medicines, including antibiotics.

  10. Computational Study of the Thermodynamics of Atmospheric Nitration of PAHs via OH-Radical-Initiated Reaction

    NASA Astrophysics Data System (ADS)

    Jariyasopit, N.; Cheong, P.; Simonich, S. L.

    2011-12-01

    Nitrated polycyclic aromatic hydrocarbons (NPAHs) are an important class of PAH derivatives that are more toxic than their parent PAHs (1) and are emitted from direct emission and secondary emission to the atmosphere. The secondary emissions, particularly the OH-radical initiated and NO3-radical-initiated reactions, have been shown to influence the NPAH concentrations in the atmosphere. Gas-phase reactions are thought to be the major sources of NPAHs containing four or fewer rings (2). Besides NPAHs, PAHs lead to a number of other products including oxygenated, hydroxy substituted and ring-opened PAH derivatives (3). For some PAHs, the OH-initiated and NO3-initiated reactions result in the formation of different NPAH isomers, allowing the ratio of these isomers to be used in the determination of direct or secondary emission sources. Previous studies have shown that the PAH gas-phase reactions with OH radical is initiated by the addition of OH radical to the aromatic ring to form hydroxycyclohexadienyl radicals (4). In the presence of NO2, these reactive intermediates readily nitrate with the elimination of water (4). The hydroxycyclohexadienyl-type radical intermediates are also prone to react with other species in the atmosphere or revert back to the original compound (3). The objective of this study was to investigate the thermodynamics of PAH nitration through day-time OH-radical-initiated reactions. The theoretical investigation were carried out using Density Functioanl Theory (B3LYP) and the 6-31G(d) basis set, as implemented in Gaussian03. A number of different PAHs were studied including fluoranthene, pyrene, as well as the molecular weight 302 PAHs such as dibenzo[a,l]pyrene. Computations were also used to predict unknown NPAHs formed by OH-radical-initiated reaction. All intermediates for the OH-radical addition and the following nitration were computed. We have discovered that the thermodynamic stability of the intermediates involved in the PAH oxygenation and nitration pathways are critical in explaining the atmospheric abundances of NPAHs. Specifically, we have found that the experimentally most abundant species had the most stable intermediates. Interestingly, the overall free energy of reaction was not a factor in determining the relative abundances of NPAHs.

  11. Turning Cucurbit[8]uril into a Supramolecular Nanoreactor for Asymmetric Catalysis

    PubMed Central

    Zheng, Lifei; Sonzini, Silvia; Ambarwati, Masyitha; Rosta, Edina

    2015-01-01

    Abstract Chiral macromolecules have been widely used as synthetic pockets to mimic natural enzymes and promote asymmetric reactions. An achiral host, cucurbit[8]uril (CB[8]), was used for an asymmetric Lewis acid catalyzed Diels–Alder reaction. We achieved a remarkable increase in enantioselectivity and a large rate acceleration in the presence of the nanoreactor by using an amino acid as the chiral source. Mechanistic and computational studies revealed that both the amino acid–Cu2+ complex and the dienophile substrate are included inside the macrocyclic host cavity, suggesting that contiguity and conformational constraints are fundamental to the catalytic process and rate enhancement. These results pave the way towards new studies on asymmetric reactions catalyzed in confined achiral cavities. PMID:27478269

  12. Turning Cucurbit[8]uril into a Supramolecular Nanoreactor for Asymmetric Catalysis

    PubMed Central

    Zheng, Lifei; Sonzini, Silvia; Ambarwati, Masyitha; Rosta, Edina; Scherman, Oren A; Herrmann, Andreas

    2015-01-01

    Chiral macromolecules have been widely used as synthetic pockets to mimic natural enzymes and promote asymmetric reactions. An achiral host, cucurbit[8]uril (CB[8]), was used for an asymmetric Lewis acid catalyzed Diels–Alder reaction. We achieved a remarkable increase in enantioselectivity and a large rate acceleration in the presence of the nanoreactor by using an amino acid as the chiral source. Mechanistic and computational studies revealed that both the amino acid–Cu2+ complex and the dienophile substrate are included inside the macrocyclic host cavity, suggesting that contiguity and conformational constraints are fundamental to the catalytic process and rate enhancement. These results pave the way towards new studies on asymmetric reactions catalyzed in confined achiral cavities. PMID:26383272

  13. The Effects of Intrinsic Noise on an Inhomogeneous Lattice of Chemical Oscillators

    NASA Astrophysics Data System (ADS)

    Giver, Michael; Jabeen, Zahera; Chakraborty, Bulbul

    2012-02-01

    Intrinsic or demographic noise has been shown to play an important role in the dynamics of a variety of systems including biochemical reactions within cells, predator-prey populations, and oscillatory chemical reaction systems, and is known to give rise to oscillations and pattern formation well outside the parameter range predicted by standard mean-field analysis. Motivated by an experimental model of cells and tissues where the cells are represented by chemical reagents isolated in emulsion droplets, we study the stochastic Brusselator, a simple activator-inhibitor chemical reaction model. Our work extends the results of recent studies on the zero and one dimensional system to the case of a non-uniform one dimensional lattice using a combination of analytical techniques and Monte Carlo simulations.

  14. Ab initio study of the chlorine nitrate protonation reaction - Implications for loss of ClONO2 in the stratosphere

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.; Rice, Julia E.

    1993-01-01

    Ab initio quantum mechanical methods, including coupled-cluster theory, are used to determine the equilibrium geometries, dipole moments, and harmonic vibrational frequencies of ClONO2, NO2(+), and four isomers of protonated ClONO2. It was found that, for the equilibrium structures and harmonic frequencies of ClONO2, HOCl, and NO2(+), the highest-level theoretical predictions are consistent with the available experimental information concerning the reactions of ClONO2 and HOCl with HCl on the surface of polar stratospheric clouds (PSCs). The study supports a recent hypothesis that the reaction of ClONO2 on the surface of PSCs is proton catalyzed, although the mechanism is different.

  15. Anomalous dimension in a two-species reaction-diffusion system

    NASA Astrophysics Data System (ADS)

    Vollmayr-Lee, Benjamin; Hanson, Jack; McIsaac, R. Scott; Hellerick, Joshua D.

    2018-01-01

    We study a two-species reaction-diffusion system with the reactions A+A\\to (0, A) and A+B\\to A , with general diffusion constants D A and D B . Previous studies showed that for dimensions d≤slant 2 the B particle density decays with a nontrivial, universal exponent that includes an anomalous dimension resulting from field renormalization. We demonstrate via renormalization group methods that the scaled B particle correlation function has a distinct anomalous dimension resulting in the asymptotic scaling \\tilde CBB(r, t) ˜ tφf(r/\\sqrt{t}) , where the exponent ϕ results from the renormalization of the square of the field associated with the B particles. We compute this exponent to first order in \

  16. TOXICOLOGY OF PESTICIDES

    EPA Science Inventory

    This report includes the results of five toxicological studies of pesticide compounds conducted by the Institute for Medical Research and Occupational Health, Zagreb, Yugoslavia. In the first study, the reactions of two groups of esterases (cholinesterases and arylesterases) with...

  17. Experimental Demonstrations in Teaching Chemical Reactions.

    ERIC Educational Resources Information Center

    Hugerat, Muhamad; Basheer, Sobhi

    2001-01-01

    Presents demonstrations of chemical reactions by employing different features of various compounds that can be altered after a chemical change occurs. Experimental activities include para- and dia-magnetism in chemical reactions, aluminum reaction with base, reaction of acid with carbonates, use of electrochemical cells for demonstrating chemical…

  18. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  19. A multi-species reactive transport model to estimate biogeochemical rates based on single-well push-pull test data

    NASA Astrophysics Data System (ADS)

    Phanikumar, Mantha S.; McGuire, Jennifer T.

    2010-08-01

    Push-pull tests are a popular technique to investigate various aquifer properties and microbial reaction kinetics in situ. Most previous studies have interpreted push-pull test data using approximate analytical solutions to estimate (generally first-order) reaction rate coefficients. Though useful, these analytical solutions may not be able to describe important complexities in rate data. This paper reports the development of a multi-species, radial coordinate numerical model (PPTEST) that includes the effects of sorption, reaction lag time and arbitrary reaction order kinetics to estimate rates in the presence of mixing interfaces such as those created between injected "push" water and native aquifer water. The model has the ability to describe an arbitrary number of species and user-defined reaction rate expressions including Monod/Michelis-Menten kinetics. The FORTRAN code uses a finite-difference numerical model based on the advection-dispersion-reaction equation and was developed to describe the radial flow and transport during a push-pull test. The accuracy of the numerical solutions was assessed by comparing numerical results with analytical solutions and field data available in the literature. The model described the observed breakthrough data for tracers (chloride and iodide-131) and reactive components (sulfate and strontium-85) well and was found to be useful for testing hypotheses related to the complex set of processes operating near mixing interfaces.

  20. Expertise and responsibility effects on pilots' reactions to flight deck alerts in a simulator.

    PubMed

    Zheng, Yiyuan; Lu, Yanyu; Yang, Zheng; Fu, Shan

    2014-11-01

    Flight deck alerts provide system malfunction information designed to lead corresponding pilot reactions aimed at guaranteeing flight safety. This study examined the roles of expertise and flight responsibility and their relationship to pilots' reactions to flight deck alerts. There were 17 pilots composing 12 flight crews that were assigned into pairs according to flight hours and responsibilities. The experiment included 9 flight scenarios and was carried out in a CRJ-200 flight simulator. Pilot performance was recorded by a wide angle video camera, and four kinds of reactions to alerts were defined for analysis. Pilots tended to have immediate reactions to uninterrupted cautions, with a turning off rate as high as 75%. However, this rate decreased sharply when pilots encountered interrupted cautions and warnings; they also exhibited many wrong reactions to warnings. Pilots with more expertise had more reactions to uninterrupted cautions than those with less expertise, both as pilot flying and pilot monitoring. Meanwhile, the pilot monitoring, regardless of level of expertise, exhibited more reactions than the pilot flying. In addition, more experienced pilots were more likely to have wrong reactions to warnings while acting as the monitoring pilot. These results suggest that both expertise and flight responsibility influence pilots' reactions to alerts. Considering crew pairing strategy, when a pilot flying is a less experienced pilot, a more experience pilot is suggested to be the monitoring pilot. The results of this study have implications for understanding pilots' behaviors to flight deck alerts, calling for specialized training and design of approach alarms on the flight deck.

  1. Influence of a reaction medium on the oxidation of aromatic nitrogen-containing compounds by peroxyacids

    NASA Astrophysics Data System (ADS)

    Dutka, V. S.; Matsyuk, N. V.; Dutka, Yu. V.

    2011-01-01

    The influence of different solvents on the oxidation reaction rate of pyridine (Py), quinoline (QN), acridine (AN), α-oxyquinoline (OQN) and α-picolinic acid (APA) by peroxydecanoic acid (PDA) was studied. It was found that the oxidation rate grows in the series Py < QN < AN, and the rate of the oxidation reaction of compounds containing a substituent in the α position from a reactive center is significantly lower than for unsubstituted analogues. The effective energies of activation of the oxidation reaction were found. It was shown that in the first stage, the reaction mechanism includes the rapid formation of an intermediate complex nitrogen-containing compound, peroxyacid, which forms products upon decomposing in the second stage. A kinetic equation that describes the studied process is offered. The constants of equilibrium of the intermediate complex formation ( K eq) and its decomposition constant ( k 2) in acetone and benzene were calculated. It was shown that the nature of the solvent influences the numerical values of both K p and k 2. It was established that introduction of acetic acid (which is able to form compounds with Py) into the reaction medium slows the rate of the oxidation process drastically. Correlation equations linking the polarity, polarizability, electrophilicity, and basicity of solvents with the constant of the PDA oxidation reaction rate for Py were found. It was concluded that the basicity and polarity of the solvent have a decisive influence on the oxidation reaction rate, while the polarizability and electrophilicity of the reaction medium do not influence the oxidation reaction rate.

  2. High-Energy-Density LCA-Coupled Structural Energetic Materials for Counter WMD Applications

    DTIC Science & Technology

    2014-04-01

    reactive ( thermite ) fillers as high-energy-density structural energetic materials. The specific objectives include performing fundamental studies to...a) investigate mechanics of dynamic densification and reaction initiation in Ta+Fe2O3 and Ta+Bi2O3 thermite powder mixtures and to (b) design and...initiation in the thermite filler and allow controlled fragmentation. Linear Cellular A; counter WMDs; shock-compression and impact-initiated reactions

  3. The affects on Titan atmospheric modeling by variable molecular reaction rates

    NASA Astrophysics Data System (ADS)

    Hamel, Mark D.

    The main effort of this thesis is to study the production and loss of molecular ions in the ionosphere of Saturn's largest moon Titan. Titan's atmosphere is subject to complex photochemical processes that can lead to the production of higher order hydrocarbons and nitriles. Ion-molecule chemistry plays an important role in this process but remains poorly understood. In particular, current models that simulate the photochemistry of Titan's atmosphere overpredict the abundance of the ionosphere's main ions suggesting a flaw in the modeling process. The objective of this thesis is to determine which reactions are most important for production and loss of the two primary ions, C2H5+ and HCNH+, and what is the impact of uncertainty in the reaction rates on the production and loss of these ions. In reviewing the literature, there is a contention about what reactions are really necessary to illuminate what is occurring in the atmosphere. Approximately seven hundred reactions are included in the model used in this discussion (INT16). This paper studies what reactions are fundamental to the atmospheric processes in Titan's upper atmosphere, and also to the reactions that occur in the lower bounds of the ionosphere which are used to set a baseline molecular density for all species, and reflects what is expected at those altitudes on Titan. This research was conducted through evaluating reaction rates and cross sections available in the scientific literature and through conducting model simulations of the photochemistry in Titan's atmosphere under a range of conditions constrained by the literature source. The objective of this study is to determine the dependence of ion densities of C2H5+ and HCNH+ on the uncertainty in the reaction rates that involve these two ions in Titan's atmosphere.

  4. Kinetics of DNA-mediated docking reactions between vesicles tethered to supported lipid bilayers

    PubMed Central

    Chan, Yee-Hung M.; Lenz, Peter; Boxer, Steven G.

    2007-01-01

    Membrane–membrane recognition and binding are crucial in many biological processes. We report an approach to studying the dynamics of such reactions by using DNA-tethered vesicles as a general scaffold for displaying membrane components. This system was used to characterize the docking reaction between two populations of tethered vesicles that display complementary DNA. Deposition of vesicles onto a supported lipid bilayer was performed by using a microfluidic device to prevent mixing of the vesicles in bulk during sample preparation. Once tethered onto the surface, vesicles mixed via two-dimensional diffusion. DNA-mediated docking of two reacting vesicles results in their colocalization after collision and their subsequent tandem motion. Individual docking events and population kinetics were observed via epifluorescence microscopy. A lattice-diffusion simulation was implemented to extract from experimental data the probability, Pdock, that a collision leads to docking. For individual vesicles displaying small numbers of docking DNA, Pdock shows a first-order relationship with copy number as well as a strong dependence on the DNA sequence. Both trends are explained by a model that includes both tethered vesicle diffusion on the supported bilayer and docking DNA diffusion over each vesicle's surface. These results provide the basis for the application of tethered vesicles to study other membrane reactions including protein-mediated docking and fusion. PMID:18025472

  5. Investigating the Relationship Between Posttraumatic Stress Symptoms and Posttraumatic Growth Following Community Violence: The Role of Anger.

    PubMed

    Strasshofer, David R; Peterson, Zoë D; Beagley, Marin C; Galovski, Tara E

    2017-10-05

    Past research has revealed that posttraumatic stress disorder (PTSD) is characterized by disturbances in emotional reactivity, including anger reactions. In turn, posttraumatic stress symptoms (PTSS) and anger reactions have been shown to be independently associated with posttraumatic growth (PTG). As such, anger reactions may serve as a pathway of influence through which PTSS lead to PTG in trauma-exposed adults. The current study examined cross-sectional relationships among PTSS, anger reactions, and PTG in 318 participants who were exposed to the violent political protests in Ferguson, Missouri after the officer-involved shooting of Michael Brown. Specifically, anger reactions were examined as a pathway of influence through which PTSS contribute to PTG. PTSS positively predicted anger reactions and PTG. Further anger reactions were associated with PTG. Anger reactions were found to partially account for the relationship between PTSS and PTG; thus, PTSS affect PTG, in part, through anger reactions to traumatic events. These results indicate a more direct role of anger reactions in facilitating growth after the associated distress of community violence. On the basis of these findings, anger may be useful in galvanizing individuals to make positive change after traumatic events. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  6. Safety and effectiveness of tofogliflozin in elderly Japanese patients with type 2 diabetes mellitus: A post-marketing study (J-STEP/EL Study).

    PubMed

    Utsunomiya, Kazunori; Shimmoto, Naoki; Senda, Masayuki; Kurihara, Yuji; Gunji, Ryoji; Fujii, Shoko; Kakiuchi, Seigo; Fujiwara, Hisataka; Kameda, Hiroyuki; Tamura, Masahiro; Kaku, Kohei

    2017-11-01

    Although sodium-glucose cotransporter 2 inhibitors are a promising treatment for type 2 diabetes mellitus, they are associated with concerns about specific adverse drug reactions. We carried out a 1-year post-marketing study of tofogliflozin, a novel agent in this class, in Japanese elderly patients with type 2 diabetes mellitus. This was a prospective, observational and multicenter post-marketing study carried out in the context of routine clinical practice. The study included all type 2 diabetes patients aged ≥65 years who started treatment with tofogliflozin during the first 3 months after its launch on 23 May 2014. Of 1,535 patients registered, 1,507 patients whose electronic case report forms were collected and who had at least one follow-up visit were included in the safety analysis. A total of 270 of 1,507 patients (17.92%) had at least one adverse drug reaction to tofogliflozin. The incidences of adverse drug reactions of special interest, namely, polyuria/pollakiuria, volume depletion-related events, urinary tract infection, genital infection, hypoglycemia and skin disorders were 2.92, 3.85, 2.06, 1.33, 1.06 and 2.39%, respectively. Among those patients evaluable for clinical effectiveness, the mean change in glycated hemoglobin and bodyweight from baseline to last visit was -0.46% (P < 0.0001) and -2.71 kg (P < 0.0001), respectively. The present study showed that the incidence of adverse drug reactions to tofogliflozin in this study of elderly patients aged ≥65 years differed little from the incidence in the preapproval clinical trials. It was shown that tofogliflozin significantly decreased glycated hemoglobin levels. © 2017 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  7. Chemistry Notes

    ERIC Educational Resources Information Center

    Pinkney, J. N.; And Others

    1976-01-01

    Describes eleven laboratory experiments, including the catalytic effect of copper in zinc-acid reaction; a study of the rate of polymerization of some aldehydes; and a demonstration automatic potentiometric titrator. (MLH)

  8. Linking Nuclear Reactions and Nuclear Structure on the Way to the Drip Line

    NASA Astrophysics Data System (ADS)

    Dickhoff, Willem

    2012-10-01

    The present understanding of the role of short- and long-range physics in determining proton properties near the Fermi energy for stable closed-shell nuclei has relied on data from the (e,e'p) reaction. Hadronic tools to extract such spectroscopic information have been hampered by the lack of a consistent reaction description that provides unambiguous and undisputed results. The dispersive optical model (DOM), originally conceived by Claude Mahaux, provides a unified description of both elastic nucleon scattering and structure information related to single-particle properties below the Fermi energy. The DOM provides the starting point to provide a framework in which nuclear reactions and structure data can be analyzed consistently to provide unambiguous spectroscopic information including its asymmetry dependence. Recent extensions of this approach include the treatment of non-locality to describe experimental data like the nuclear charge density based on information of the spectral density below the Fermi energy, the application of the DOM ingredients to the description of transfer reactions, a comparison of the microscopic content of the nucleon self-energy based on Faddeev-RPA calculations emphasizing long-range correlations with DOM potentials, and a study of the relation between a self-energy which includes the effect of short-range correlations with DOM potentials. The most recent Dom implementation currently in progress abandons the constraint of local potentials completely to allow an accurate description of various properties of the nuclear ground state.

  9. LC-MS/MS analysis of uncommon paracetamol metabolites derived through in vitro polymerization and nitration reactions in liquid nitrogen.

    PubMed

    Trettin, Arne; Jordan, Jens; Tsikas, Dimitrios

    2014-09-01

    Paracetamol (acetaminophen, APAP) is a commonly used analgesic drug. Known paracetamol metabolites include the glucuronide, sulfate and mercapturate. N-Acetyl-benzoquinonimine (NAPQI) is considered the toxic intermediate metabolite of paracetamol. In vitro and in vivo studies indicate that paracetamol is also metabolized to additional poorly characterized metabolites. For example, metabolomic studies in urine samples of APAP-treated mice revealed metabolites such as APAP-sulfate-APAP and APAP-S-S-APAP in addition to the classical phase II metabolites. Here, we report on the development and application of LC-MS and LC-MS/MS approaches to study reactions of unlabelled and (2)H-labelled APAP with unlabelled and (15)N-labelled nitrite in aqueous phosphate buffers (pH 7.4) upon their immersion into liquid nitrogen (-196°C). In mechanistic studies, these reactions were also studied in aqueous buffer prepared in (18)O-labelled water. LC-MS and LC-MS/MS analyses were performed on a reverse-phase material (C18) using gradient elution (2mM ammonium acetate/acetonitrile), in positive and negative electrospray mode. We identified a series of APAP metabolites including di-, tri- and tetra-APAP, mono- and di-nitro-APAP and nitric ester of di-APAP. Our study indicates that nitrite induces oxidation, i.e., polymerization and nitration of APAP, when buffered APAP/nitrite solutions are immersed into liquid nitrogen. These reactions are specific for nitrite with respect to nitrate and do not proceed via intermediate formation of NAPQI. Potassium ions and physiological saline but not thiols inhibit nitrite- and shock-freeze-induced reactions of paracetamol. The underlying mechanism likely involves in situ formation of NO2 radicals from nitrite secondary to profound pH reduction (down to pH 1) and disproportionation. Polymeric paracetamol species can be analyzed as pentafluorobenzyl derivatives by LC-MS but not by GC-MS. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Geochemical Reaction Mechanism Discovery from Molecular Simulation

    DOE PAGES

    Stack, Andrew G.; Kent, Paul R. C.

    2014-11-10

    Methods to explore reactions using computer simulation are becoming increasingly quantitative, versatile, and robust. In this review, a rationale for how molecular simulation can help build better geochemical kinetics models is first given. We summarize some common methods that geochemists use to simulate reaction mechanisms, specifically classical molecular dynamics and quantum chemical methods and discuss their strengths and weaknesses. Useful tools such as umbrella sampling and metadynamics that enable one to explore reactions are discussed. Several case studies wherein geochemists have used these tools to understand reaction mechanisms are presented, including water exchange and sorption on aqueous species and mineralmore » surfaces, surface charging, crystal growth and dissolution, and electron transfer. The impact that molecular simulation has had on our understanding of geochemical reactivity are highlighted in each case. In the future, it is anticipated that molecular simulation of geochemical reaction mechanisms will become more commonplace as a tool to validate and interpret experimental data, and provide a check on the plausibility of geochemical kinetic models.« less

  11. Molecular Origin of Color Variation in Firefly (Beetle) Bioluminescence: A Chemical Basis for Biological Imaging.

    PubMed

    Hirano, Takashi

    2016-01-01

    Firefly shows bioluminescence by "luciferin-luciferase" (L-L) reaction using luciferin, luciferase, ATP and O2. The chemical photon generation by an enzymatic reaction is widely utilized for analytical methods including biological imaging in the life science fields. To expand photondetecting analyses with firefly bioluminescence, it is important for users to understand the chemical basis of the L-L reaction. In particular, the emission color variation of the L-L reaction is one of the distinguishing characteristics for multicolor luciferase assay and in vivo imaging. From the viewpoint of fundamental chemistry, this review explains the recent progress in the studies on the molecular mechanism of emission color variation after showing the outline of the reaction mechanism of the whole L-L reaction. On the basis of the mechanism, the progresses in organic synthesis of luciferin analogs modulating their emission colors are also presented to support further developments of red/near infrared in vivo biological imaging utility of firefly bioluminescence.

  12. Hydroxyacetone production from C 3 Criegee intermediates

    DOE PAGES

    Taatjes, Craig A.; Liu, Fang; Rotavera, Brandon; ...

    2016-12-21

    Hydroxyacetone (CH 3C(O)CH 2OH) is observed as a stable end product from reactions of the (CH 3) 2COO Criegee intermediate, acetone oxide, in a flow tube coupled with multiplexed photoionization mass spectrometer detection. In the experiment, the isomers at m/z = 74 are distinguished by their different photoionization spectra and reaction times. Hydroxyacetone is observed as a persistent signal at longer reaction times at a higher photoionization threshold of ca. 9.7 eV than Criegee intermediate and definitively identified by comparison with the known photoionization spectrum. Complementary electronic structure calculations reveal multiple possible reaction pathways for hydroxyacetone formation, including unimolecular isomerizationmore » via hydrogen atom transfer and –OH group migration as well as self-reaction of Criegee intermediates. Varying the concentration of Criegee intermediates suggests contributions from both unimolecular and self-reaction pathways to hydroxyacetone. As a result, the hydroxyacetone end product can provide an effective, stable marker for the production of transient Criegee intermediates in future studies of alkene ozonolysis.« less

  13. Effect of prosthetic alignment changes on socket reaction moment impulse during walking in transtibial amputees

    PubMed Central

    Kobayashi, Toshiki; Orendurff, Michael S.; Arabian, Adam K.; Rosenbaum-Chou, Teri G.; Boone, David A.

    2014-01-01

    The alignment of a lower limb prosthesis affects the way load is transferred to the residual limb through the socket, and this load is critically important for the comfort and function of the prosthesis. Both magnitude and duration of the moment are important factors that may affect the residual limb health. Moment impulse is a well-accepted measurement that incorporates both factors via moment–time integrals. The aim of this study was to investigate the effect of alignment changes on the socket reaction moment impulse in transtibial prostheses. Ten amputees with transtibial prostheses participated in this study. The socket reaction moment impulse was measured at a self-selected walking speed using a Smart Pyramid™ in 25 alignment conditions, including a nominal alignment (clinically aligned by a prosthetist), as well as angle malalignments of 2°, 4° and 6° (abduction, adduction, extension and flexion) and translation malalignments of 5 mm, 10 mm and 15 mm (lateral, medial, anterior and posterior). The socket reaction moment impulse of the nominal alignment was compared for each condition. The relationship between the alignment and the socket reaction moment impulse was clearly observed in the coronal angle, coronal translation and sagittal translation alignment changes. However, this relationship was not evident in the sagittal angle alignment changes. The results of this study suggested that the socket reaction moment impulse could potentially serve as a valuable parameter to assist the alignment tuning process for transtibial prostheses. Further study is needed to investigate the influence of the socket reaction moment impulse on the residual limb health. PMID:24612718

  14. Self-organization in precipitation reactions far from the equilibrium

    PubMed Central

    Nakouzi, Elias; Steinbock, Oliver

    2016-01-01

    Far from the thermodynamic equilibrium, many precipitation reactions create complex product structures with fascinating features caused by their unusual origins. Unlike the dissipative patterns in other self-organizing reactions, these features can be permanent, suggesting potential applications in materials science and engineering. We review four distinct classes of precipitation reactions, describe similarities and differences, and discuss related challenges for theoretical studies. These classes are hollow micro- and macrotubes in chemical gardens, polycrystalline silica carbonate aggregates (biomorphs), Liesegang bands, and propagating precipitation-dissolution fronts. In many cases, these systems show intricate structural hierarchies that span from the nanometer scale into the macroscopic world. We summarize recent experimental progress that often involves growth under tightly regulated conditions by means of wet stamping, holographic heating, and controlled electric, magnetic, or pH perturbations. In this research field, progress requires mechanistic insights that cannot be derived from experiments alone. We discuss how mesoscopic aspects of the product structures can be modeled by reaction-transport equations and suggest important targets for future studies that should also include materials features at the nanoscale. PMID:27551688

  15. Kerosene combustion at pressures up to 40 atm: Experimental study and detailed chemical kinetic modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dagaut, P.; Reuillon, M.; Boettner, J.C.

    1994-12-31

    The oxidation of TR0 kerosene (jet A1 aviation fuel) was studied in a jet-stirred reactor (JSR) at pressures extending from 10 to 40 atm, in the temperature range 750--1,150 K. A large number of reaction intermediates were identified, and their concentrations were followed for reaction yields ranging from low conversion to the formation of the final products. A reference hydrocarbon, n-decane, studied under the same experimental conditions gave very similar experimental concentration profiles for the main oxidation products. Because of the strong analogy between n-decane and kerosene oxidation kinetics, a detailed chemical kinetic reaction mechanisms describing the oxidation of n-decanemore » was built to reproduce the present experimental results. This mechanisms includes 573 elementary reactions, most of them being reversible, among 90 chemical species. A reasonably good prediction of the concentrations of major species was obtained by computation, covering the whole range of temperature, pressures, and equivalence ratios of the experiments. A kinetic analysis performed to identify the dominant reaction steps of the mechanism shows that, under the conditions of the present study (intermediate temperature and high pressure), HO{sub 2} radicals are important chain carriers leading to the formation of the branching agent H{sub 2}O{sub 2}.« less

  16. Biogeochemical metabolic modeling of methanogenesis by Methanosarcina barkeri

    NASA Astrophysics Data System (ADS)

    Jensvold, Z. D.; Jin, Q.

    2015-12-01

    Methanogenesis, the biological process of methane production, is the final step of natural organic matter degradation. In studying natural methanogenesis, important questions include how fast methanogenesis proceeds and how methanogens adapt to the environment. To address these questions, we propose a new approach - biogeochemical reaction modeling - by simulating the metabolic networks of methanogens. Biogeochemical reaction modeling combines geochemical reaction modeling and genome-scale metabolic modeling. Geochemical reaction modeling focuses on the speciation of electron donors and acceptors in the environment, and therefore the energy available to methanogens. Genome-scale metabolic modeling predicts microbial rates and metabolic strategies. Specifically, this approach describes methanogenesis using an enzyme network model, and computes enzyme rates by accounting for both the kinetics and thermodynamics. The network model is simulated numerically to predict enzyme abundances and rates of methanogen metabolism. We applied this new approach to Methanosarcina barkeri strain fusaro, a model methanogen that makes methane by reducing carbon dioxide and oxidizing dihydrogen. The simulation results match well with the results of previous laboratory experiments, including the magnitude of proton motive force and the kinetic parameters of Methanosarcina barkeri. The results also predict that in natural environments, the configuration of methanogenesis network, including the concentrations of enzymes and metabolites, differs significantly from that under laboratory settings.

  17. Simulation of dual carbon-bromine stable isotope fractionation during 1,2-dibromoethane degradation.

    PubMed

    Jin, Biao; Nijenhuis, Ivonne; Rolle, Massimo

    2018-06-01

    We performed a model-based investigation to simultaneously predict the evolution of concentration, as well as stable carbon and bromine isotope fractionation during 1,2-dibromoethane (EDB, ethylene dibromide) transformation in a closed system. The modelling approach considers bond-cleavage mechanisms during different reactions and allows evaluating dual carbon-bromine isotopic signals for chemical and biotic reactions, including aerobic and anaerobic biological transformation, dibromoelimination by Zn(0) and alkaline hydrolysis. The proposed model allowed us to accurately simulate the evolution of concentrations and isotope data observed in a previous laboratory study and to successfully identify different reaction pathways. Furthermore, we illustrated the model capabilities in degradation scenarios involving complex reaction systems. Specifically, we examined (i) the case of sequential multistep transformation of EDB and the isotopic evolution of the parent compound, the intermediate and the reaction product and (ii) the case of parallel competing abiotic pathways of EDB transformation in alkaline solution.

  18. Multiple dimensions of attitudes about homosexuality: development of a multifaceted scale measuring attitudes toward homosexuality.

    PubMed

    Adolfsen, Anna; Iedema, Jurjen; Keuzenkamp, Saskia

    2010-01-01

    Attitudes toward homosexuality are complex. To get a comprehensive view on the attitudes of people, different dimensions need to be included in research. Based on a review of the literature, we distinguish five dimensions: acceptance of homosexuality in a general sense; attitude toward equal rights; reactions to homosexuality "at close quarters"; reactions to homosexuality in public; and so-called modern homonegativity. In a study on a representative sample of Dutch Defence personnel (N = 1,607) we tested this model. Structural equation modeling of several items measuring the attitude toward homosexuality offers a six factor solution. These six factors are more or less comparable to the five dimensions we distinguished. The dimension "reactions to homosexuality at close quarters" is, however, empirically split in a dimension on affective reactions to homosexuality and homosexual persons in general and a dimension on affective reaction to homosexual friends or acquaintances.

  19. Development of a system for treatment of coconut industry wastewater using electrochemical processes followed by Fenton reaction.

    PubMed

    Gomes, Lúcio de Moura; Duarte, José Leandro da Silva; Pereira, Nathalia Marcelino; Martínez-Huitle, Carlos A; Tonholo, Josealdo; Zanta, Carmen Lúcia de Paiva E Silva

    2014-01-01

    The coconut processing industry generates a significant amount of liquid waste. New technologies targeting the treatment of industrial effluents have emerged, including advanced oxidation processes, the Fenton reaction, and electrochemical processes, which produce strong oxidizing species to remove organic matter. In this study we combined the Fenton reaction and electrochemical process to treat wastewater generated by the coconut industry. We prepared a synthetic wastewater consisting of a mixture of coconut milk and water and assessed how the Fenton reagents' concentration, the cathode material, the current density, and the implementation of associated technologies affect its treatment. Electrochemical treatment followed by the Fenton reaction diminished turbidity and chemical oxygen demand (COD) by 85 and 95%, respectively. The Fenton reaction followed by the electrochemical process reduced turbidity and COD by 93 and 85%, respectively. Therefore, a combination of the Fenton and electrochemical technologies can effectively treat the effluent from the coconut processing industry.

  20. General theory of multistage geminate reactions of isolated pairs of reactants. I. Kinetic equations.

    PubMed

    Doktorov, Alexander B; Kipriyanov, Alexey A

    2014-05-14

    General matrix approach to the consideration of multistage geminate reactions of isolated pairs of reactants depending on reactant mobility is formulated on the basis of the concept of "effective" particles. Various elementary reactions (stages of multistage reaction including physicochemical processes of internal quantum state changes) proceeding with the participation of isolated pairs of reactants (or isolated reactants) are taken into account. Investigation has been made in terms of kinetic approach implying the derivation of general (matrix) kinetic equations for local and mean probabilities of finding any of the reaction species in the sample under study (or for local and mean concentrations). The recipes for the calculation of kinetic coefficients of the equations for mean quantities in terms of relative coordinates of reactants have been formulated in the general case of inhomogeneous reacting systems. Important specific case of homogeneous reacting systems is considered.

  1. Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

    NASA Astrophysics Data System (ADS)

    Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

    2018-01-01

    ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

  2. Systemic allergic reactions to gelatin included in vaccines as a stabilizer.

    PubMed

    Sakaguchi, M; Inouye, S

    2000-10-01

    Most of the children who showed systemic immediate-type reactions, including anaphylactic shock, to measles, mumps, rubella, and varicella vaccines had IgE antibodies to gelatin; thus we suspected that the allergic symptoms are caused by gelatin antigen, which is usually included in these live-virus vaccines as a stabilizer. We hypothesized that the anti-gelatin IgE is elicited by immunization with DTaP (diphtheria-tetanus-acellular pertussis) vaccines, which contained a small amount of gelatin as a spillover protein after purification of pertussis toxin. To test this hypothesis, we conducted a case-control study to determine whether children with anti-gelatin IgE had received gelatin-containing DTaP vaccines, and it was indeed found that all such children in the study had immunization histories that included the gelatin-containing DTaP vaccines. Based on these findings, the vaccine manufacturers had removed gelatin from all the DTaP and live-virus vaccines produced in Japan by 2000.

  3. Multicenter Patch Testing With a Resol Resin Based on Phenol and Formaldehyde Within the International Contact Dermatitis Research Group.

    PubMed

    Isaksson, Marléne; Ale, Iris; Andersen, Klaus; Diepgen, Thomas; Elsner, Peter; Goossens, An; Goh, Chee-Leok; Jerajani, Hemangi; Maibach, Howard; Matsunaga, Kayoko; McFadden, John; Nixon, Rosemary; Sasseville, Denis; Bruze, Magnus

    2015-01-01

    Contact allergy to phenol-formaldehyde resins (PFRs) based on phenol and formaldehyde is not detected by a p-tertiary-butylphenol-formaldehyde resin included in most baseline patch test series. The aims of this study were to investigate the contact allergy rate to PFR-2 in an international population and to investigate associated simultaneous allergic reactions. Thirteen centers representing the International Contact Dermatitis Research Group included PFR-2 into their patch test baseline series during a period of 6 months in 2012. Of 2259 patients tested, 28 (1.2%) reacted to PFR-2. Of those 28 individuals, one had a positive reaction to formaldehyde and 2 to p-tertiary-butylphenol-formaldehyde resin. Simultaneous allergic reactions were noted to colophonium in 3, to Myroxylon pereirae in 5, and to fragrance mix I in 8. The contact allergy frequency in the tested population (1.2%) merits its inclusion into the international baseline series and possibly also into other baseline series after appropriate investigations. Significantly, overrepresented simultaneous allergic reactions were noted for M. pereirae and fragrance mix I.

  4. 30S(α , p) Thermonuclear Reaction Rate from Experimental Level Structure of 34Ar

    NASA Astrophysics Data System (ADS)

    Kahl, D.; Chen, A. A.; Kubono, S.; Yamaguchi, H.; Binh, D. N.; Chen, J.; Cherubini, S.; Duy, N. N.; Hashimoto, T.; Hayakawa, S.; Iwasa, N.; Jung, H. S.; Kato, S.; Kwon, Y. K.; Nishimura, S.; Ota, S.; Setoodehnia, K.; Teranishi, T.; Tokieda, H.; Yamada, T.; Yun, C. C.; Zhang, L. Y.

    Type I X-ray bursts are the most frequent thermonuclear explosions in the galaxy. Owing to their recurrence from known astronomical objects, burst morphology is extensively documented, and they are modeled very successfully as neutron-deficient, thermonuclear runaway on the surface of accreting neutron stars. While reaction networks include hundreds of isotopes and thousands of nuclear processes, only a small subset appear to play a pivotal role. One such reaction is the 30S(α , p) reaction, which is believed to be a crucial link in the explosive helium burning which is responsible for the large energy flux. However, very little experimental information is available concerning the cross section itself, nor the 34Ar compound nucleus at the relevant energies. We performed the first study of the entrance channel via 30S alpha resonant elastic scattering using a state-of-the-art, low-energy, 30S radioactive ion beam. The measurement was performed in inverse kinematics using a newly-developed active target. An R-matrix analysis of the excitation function reveals previously unknown resonances, including their quantum properties of spin, parity, width, and energy.

  5. A Lewis acid β-diiminato-zinc-complex as all-rounder for co- and terpolymerisation of various epoxides with carbon dioxide.

    PubMed

    Reiter, M; Vagin, S; Kronast, A; Jandl, C; Rieger, B

    2017-03-01

    A β-diiminato-zinc-N(SiMe 3 ) 2 complex ( 1 ) was synthesised and fully characterised, including an X-ray diffraction study. The activity of catalyst 1 towards the coupling reaction of CO 2 and various epoxides, including propylene oxide (PO), cyclohexene oxide (CHO), styrene oxide (SO), limonene oxide (LO), octene oxide (OO) and epichlorohydrin (ECH), was investigated. Terpolymerisation of CO 2 , PO and LO, as well as CO 2 , CHO and PO, was successfully realised, resulting in polymers with adjustable glass transition temperatures and transparencies. Reaction conditions such as temperature, pressure and catalyst concentration were varied to find the optimal reaction values, especially regarding LO/CO 2 . In situ IR experiments hinted that at 60 °C and a critical LO concentration, polymerisation and depolymerisation are in an equilibrium (ceiling effect). Pressurising catalyst 1 with carbon dioxide resulted in a dimeric catalyst ( 2 ) with a OSiMe 3 group as a new initiator. Homopolymerisation of different epoxides was carried out in order to explain the reactivity concerning copolymerisation reaction of CO 2 and epoxides.

  6. Food Allergy

    MedlinePlus

    ... trigger allergic reactions include fish, shellfish, peanuts, and tree nuts, such as walnuts. Problem foods for children can include eggs, milk, peanuts, tree nuts, soy, and wheat. The allergic reaction may ...

  7. Tandem reactions initiated by copper-catalyzed cross-coupling: a new strategy towards heterocycle synthesis.

    PubMed

    Liu, Yunyun; Wan, Jie-Ping

    2011-10-21

    Copper-catalyzed cross-coupling reactions which lead to the formation of C-N, C-O, C-S and C-C bonds have been recognized as one of the most useful strategies in synthetic organic chemistry. During past decades, important breakthroughs in the study of Cu-catalyzed coupling processes demonstrated that Cu-catalyzed reactions are broadly applicable to a variety of research fields related to organic synthesis. Representatively, employing these coupling transformations as key steps, a large number of tandem reactions have been developed for the construction of various heterocyclic compounds. These tactics share the advantages of high atom economics of tandem reactions as well as the broad tolerance of Cu-catalyst systems. Therefore, Cu-catalyzed C-X (X = N, O, S, C) coupling transformation-initiated tandem reactions were quickly recognized as a strategy with great potential for synthesizing heterocyclic compounds and gained worldwide attention. In this review, recent research progress in heterocycle syntheses using tandem reactions initiated by copper-catalyzed coupling transformations, including C-N, C-O, C-S as well as C-C coupling processes are summarized.

  8. [Similarity of Clinically Significant Neuropsychiatric Adverse Reactions Listed in Package Inserts between the Anti-influenza Drugs Oseltamivir and Amantadine (Possibility Attributable to Common Pharmacological Effects)].

    PubMed

    Ono, Hideki; Okamura, Maya; Fukushima, Akihiro

    2018-06-20

      The anti-influenza virus drug oseltamivir has been reported to have several pharmacological actions including blocking of nicotinic acetylcholine receptor channels and activation of the dopaminergic system. These pharmacological actions highly overlap those of amantadine, another anti-influenza virus drug authorized in Japan, and ester-type local anesthetics. Moreover, oseltamivir and amantadine can clinically induce similar adverse neuropsychiatric reactions. In the present study, from the database of the Pharmaceuticals and Medical Devices Agency (PMDA), we surveyed 2,576 drugs for which neuropsychiatric side effects similar to those of oseltamivir, amantadine and local anesthetics (abnormal behavior, confusion, consciousness disturbance, convulsion, delirium, delusion, hallucination, myoclonus, tremor) are listed as "clinically significant adverse reactions", and found 327 that had at least one of these adverse reactions. Other neuraminidase inhibitors (laninamivir, peramivir and zanamivir) did not elicit such adverse reactions. By discussing the pharmacological effects of drugs that elicit these adverse reactions, we propose that the similarity of adverse neuropsychiatric reactions between oseltamivir and amantadine is possibly attributable to their common pharmacological effects.

  9. Weathering crusts on peridotite

    NASA Astrophysics Data System (ADS)

    Bucher, Kurt; Stober, Ingrid; Müller-Sigmund, Hiltrud

    2015-05-01

    Chemical weathering of dark-green massive peridotite, including partly serpentinized peridotite, produces a distinct and remarkable brown weathering rind when exposed to the atmosphere long enough. The structure and mineral composition of crusts on rocks from the Ronda peridotite, Spain, have been studied in some detail. The generic overall weathering reaction serpentinized peridotite + rainwater = weathering rind + runoff water describes the crust-forming process. This hydration reaction depends on water supply from the outcrop surface to the reaction front separating green peridotite from the brown crust. The reaction pauses after drying and resumes at the front after wetting. The overall net reaction transforms olivine to serpentine in a volume-conserving replacement reaction. The crust formation can be viewed as secondary serpentinization of peridotite that has been strongly altered by primary hydrothermal serpentinization. The reaction stoichiometry of the crust-related serpentinization is preserved and reflected by the composition of runoff waters in the peridotite massif. The brown color of the rind is caused by amorphous Fe(III) hydroxide, a side product from the oxidation of Fe(II) released by the dissolution of fayalite component in olivine.

  10. Physicochemical application of capillary chromatography

    NASA Astrophysics Data System (ADS)

    Vasil'ev, A. V.; Aleksandrov, E. N.

    1992-04-01

    The application of capillary gas chromatography in the determination of the free energy, enthalpy, and entropy of sorption, the saturated vapour pressure and activity coefficients, the assessment of the lipophilicity of volatile compounds, and the study of the properties of polymers and liquid crystals is described. The use of reaction cappillary chromatography in kinetic studies of conformational conversions, thermal degradation, and photochemical reactions is examined. Studies on the use of capillary columns for determination of the second virial coefficients and viscosity of gases and the diffusion coefficients in gases, liquids, supercritical fluids, and polymers are analysed. The bibliography includes 114 references.

  11. The ratio method: A new tool to study one-neutron halo nuclei

    DOE PAGES

    Capel, Pierre; Johnson, R. C.; Nunes, F. M.

    2013-10-02

    Recently a new observable to study halo nuclei was introduced, based on the ratio between breakup and elastic angular cross sections. This new observable is shown by the analysis of specific reactions to be independent of the reaction mechanism and to provide nuclear-structure information of the projectile. Here we explore the details of this ratio method, including the sensitivity to binding energy and angular momentum of the projectile. We also study the reliability of the method with breakup energy. Lastly, we provide guidelines and specific examples for experimentalists who wish to apply this method.

  12. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  13. Mechanistic Study of Nitric Oxide Reduction by Hydrogen on Pt(100) (I): A DFT Analysis of the Reaction Network

    DOE PAGES

    Bai, Yunhai; Mavrikakis, Manos

    2017-05-08

    Periodic, self-consistent density functional theory (DFT-GGA, PW91) calculations are used to study the reaction mechanism for nitric oxide (NO) reduction by hydrogen (H 2) on Pt(100). Energetics of various N–O activation paths, including both direct and hydrogen-assisted N–O bond-breaking paths, and the formation of three different N-containing products (N 2, N 2O, and NH3), are systematically studied. On the basis of our analysis, NO* dissociation has a lower barrier than NO* hydrogenation to HNO* or NOH*, and therefore, the direct NO dissociation path is predicted to dominate N–O activation on clean Pt(100). The reaction of atomic N* with N* andmore » NO* is proposed as the mechanism for N 2 and N 2O formation, respectively. NH 3 formation from N* via three successive hydrogenation steps is also studied and is found to be kinetically more difficult than N 2 and N 2O formation from N*. Finally, NO adsorption phase diagrams on Pt(100) are constructed, and these phase diagrams suggest that, at low temperatures (e.g., 400 K), the Pt(100) surface may be covered by half a monolayer of NO. We propose that high NO coverage might affect the NO + H 2 reaction mechanism, and therefore, one should explicitly take the NO coverage into consideration in first-principles studies to determine the reaction mechanism on catalyst surfaces under reaction conditions. In conclusion, a detailed analysis of high NO coverage effects on the reaction mechanism will be presented in a separate contribution.« less

  14. Mechanistic Study of Nitric Oxide Reduction by Hydrogen on Pt(100) (I): A DFT Analysis of the Reaction Network

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bai, Yunhai; Mavrikakis, Manos

    Periodic, self-consistent density functional theory (DFT-GGA, PW91) calculations are used to study the reaction mechanism for nitric oxide (NO) reduction by hydrogen (H 2) on Pt(100). Energetics of various N–O activation paths, including both direct and hydrogen-assisted N–O bond-breaking paths, and the formation of three different N-containing products (N 2, N 2O, and NH3), are systematically studied. On the basis of our analysis, NO* dissociation has a lower barrier than NO* hydrogenation to HNO* or NOH*, and therefore, the direct NO dissociation path is predicted to dominate N–O activation on clean Pt(100). The reaction of atomic N* with N* andmore » NO* is proposed as the mechanism for N 2 and N 2O formation, respectively. NH 3 formation from N* via three successive hydrogenation steps is also studied and is found to be kinetically more difficult than N 2 and N 2O formation from N*. Finally, NO adsorption phase diagrams on Pt(100) are constructed, and these phase diagrams suggest that, at low temperatures (e.g., 400 K), the Pt(100) surface may be covered by half a monolayer of NO. We propose that high NO coverage might affect the NO + H 2 reaction mechanism, and therefore, one should explicitly take the NO coverage into consideration in first-principles studies to determine the reaction mechanism on catalyst surfaces under reaction conditions. In conclusion, a detailed analysis of high NO coverage effects on the reaction mechanism will be presented in a separate contribution.« less

  15. A SIFT study of the reactions of H2ONO+ ions with several types of organic molecules

    NASA Astrophysics Data System (ADS)

    Smith, David; Wang, Tianshu; Spanel, Patrik

    2003-11-01

    A selected ion flow tube (SIFT) study has been carried out of the reactions of hydrated nitrosonium ions, NO+H2O, which theory has equated to protonated nitrous acid ions, H2ONO+. One objective of this study was to investigate if this ion exhibits the properties of both a cluster ion and a protonated acid in their reactions with a variety of organic molecules. The chosen reactant molecules comprise two each of the following types--amines, terpenes, aromatic hydrocarbons, esters, carboxylic acids, ketones, aldehydes and alcohols. The reactant H2ONO+ (NO+H2O) ions are formed in a discharge ion source and injected into helium carrier gas where they are partially vibrationally excited and partially dissociated to NO+ ions. Hence, the reactions of the H2ONO+ ions had to be studies simultaneously with NO+ ions, the reactions of the latter ions readily being studied by selectively injecting NO+ ions into the carrier gas. The results of this study indicate that the H2ONO+ ions undergo a wide variety of reaction processes that depend on the properties of the reactant molecules such as their ionisation energies and proton affinities. These processes include charge transfer with compounds, M, that have low ionisation energies (producing M+), proton transfer with compounds possessing large proton affinities (MH+), hydride ion transfer (M---H+), alkyl radical (M---R+), alkoxide radical transfer (M---OR+), ion-molecule association (NO+H2OM) and ligand switching (NO+M), producing the ions given in parentheses.

  16. Coming Out and the Potential for Growth in Sexual Minorities: The Role of Social Reactions and Internalized Homonegativity.

    PubMed

    Solomon, David; McAbee, James; Åsberg, Kia; McGee, Ashley

    2015-01-01

    Coming out is a significant and sometimes difficult process in the lives of sexual minorities, but disclosure can also affect wellbeing in positive ways, including reduced distress and greater relationship satisfaction. This study investigates the possibility of stress-related growth and depreciation following coming out. To obtain a diverse sample with varying coming-out experiences, data were collected from undergraduate students as well as from online sources, including lesbian, gay, and bisexual support groups and Pride groups. Regression analyses indicated that negative social reactions to coming out predicted both growth and depreciation, although they more strongly predicted depreciation. Positive social reactions were positively related to stress-related growth, while internalized homonegativity was inversely associated with growth. Although the two sample sources (online and campus) differed in some ways, sample source was not a significant predictor in the regressions, nor was it indicated as a moderator in exploratory ANOVA analyses.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takanabe, Kazuhiro; Khan, Abdulaziz M.; Tang, Yu

    Sodium-based catalysts (such as Na 2 WO 4) were proposed to selectively catalyze OH radical formation from H 2O and O 2 at high temperatures. This reaction may proceed on molten salt state surfaces owing to the lower melting point of the used Na salts compared to the reaction temperature. This study provides direct evidence of the molten salt state of Na 2WO 4, which can form OH radicals, using in situ techniques including X-ray diffraction (XRD), scanning transmission electron microscopy (STEM), laser induced fluorescence (LIF) spectrometry, and ambient-pressure X-ray photoelectron spectroscopy (AP-XPS). As a result, Na 2O 2 species,more » which were hypothesized to be responsible for the formation of OH radicals, have been identified on the outer surfaces at temperatures of ≥800°C, and these species are useful for various gasphase hydrocarbon reactions, including the selective transformation of methane to ethane.« less

  18. Reactions to prick and intradermal skin tests.

    PubMed

    Bagg, Andrew; Chacko, Thomas; Lockey, Richard

    2009-05-01

    Allergy skin testing is a common procedure for the diagnosis of atopic diseases with a small risk of systemic reactions. To determine the 12-month incidence of systemic reactions (SRs) to skin prick testing (SPT) and intradermal skin testing (ST) and the symptoms and response to immediate treatment with epinephrine intramuscularly. A prospective study was conducted to evaluate SRs from ST in 1,456 patients. A standard form was used to record symptoms, signs, and treatment. The SRs are defined as any sign or symptom other than a local reaction thought to be secondary to ST. No vasovagal reactions were included. Nurses, as instructed by attending physicians, administered epinephrine (0.2 mL of a 1:1,000 dilution) intramuscularly in the deltoid as soon as any remote signs or symptoms occurred. Fifty-two patients (3.6%) had SRs (6 SPT and 46 intradermal): 43 (83%) were female, and 17 (33%) had asthma. Systemic symptoms included (SPT/intradermal) pruritic eyes, nose, or pharynx (0%/46%); worsening cough (50%/26%); sensation of difficulty swallowing (0%/20%); worsening nasal congestion (17%/15%); rhinorrhea (17%/13%); chest tightness or shortness of breath (33%/11%); generalized pruritus (17%/11%); sneezing (33%/9%); wheeze (0%/4%); and urticaria (17%/2%). No severe asthma, shock, hypotension, unconsciousness, or biphasic reactions occurred. All 52 patients received epinephrine intramuscularly, 48 (92%) oral prednisone, 9 (17%) oral prednisone to take 6 to 8 hours after a reaction, 50 (96%) oral antihistamine, and 6 (12%) nebulized beta-agonist. Of patients who underwent ST, SRs occurred in 3.6% (0.4% for SPT and 3.2% for intradermal ST), all of whom readily responded to epinephrine intramuscularly in the deltoid. This immediate administration of epinephrine seems to prevent more serious and biphasic reactions.

  19. Adverse reactions in a population of Sydney pet rabbits vaccinated against rabbit calicivirus.

    PubMed

    Tung, T; Phalen, D; Toribio, J-Alml

    2015-11-01

    To determine the general clinical presentation and incidence of adverse reactions to Cylap® RCD vaccinations, of a nature serious enough for veterinary attention, in a Sydney population of pet rabbits. A retrospective survey using hospital databases. Nine veterinary hospitals in Sydney participated in a database search for the number of rabbits vaccinated within a 2-year period. The hospitals involved had an identified interest in rabbit medicine and included general, specialist and teaching hospitals. Details of the rabbit, vaccination event and any possible reaction were collected and analysed. Of 933 events recorded in 705 rabbits, 17 (1.8%) adverse reactions were observed. Of the adverse events, local injection site reactions (alopecia, abrasions and scabbing) were most common. Other reactions, including systemic signs of gastrointestinal tract stasis, lethargy and forelimb lameness, were also documented. Overall, rabbits presented for vaccination were mostly male (57.7%) and desexed (71.3%), with an average age of 28.1 months (median 19.0, range 1.4-149.8 months) and an average weight at first vaccination of 2.12 kg (median 2.08 kg, range 0.18-5.6 kg). A significant association between increasing age and decreased incidence of adverse events was demonstrated (P value, 0.038). The benefits of vaccination against RCV outweigh the risks of an adverse reaction occurring. Data from this study show that adverse reactions occur infrequently, are generally mild and self-resolving, and decrease in incidence with increasing age. These results are similar to previous field research on wild rabbit colonies and reports from government and industry. © 2015 Australian Veterinary Association.

  20. Enzyme localization, crowding, and buffers collectively modulate diffusion-influenced signal transduction: Insights from continuum diffusion modeling

    PubMed Central

    Kekenes-Huskey, Peter M.; Eun, Changsun; McCammon, J. A.

    2015-01-01

    Biochemical reaction networks consisting of coupled enzymes connect substrate signaling events with biological function. Substrates involved in these reactions can be strongly influenced by diffusion “barriers” arising from impenetrable cellular structures and macromolecules, as well as interactions with biomolecules, especially within crowded environments. For diffusion-influenced reactions, the spatial organization of diffusion barriers arising from intracellular structures, non-specific crowders, and specific-binders (buffers) strongly controls the temporal and spatial reaction kinetics. In this study, we use two prototypical biochemical reactions, a Goodwin oscillator, and a reaction with a periodic source/sink term to examine how a diffusion barrier that partitions substrates controls reaction behavior. Namely, we examine how conditions representative of a densely packed cytosol, including reduced accessible volume fraction, non-specific interactions, and buffers, impede diffusion over nanometer length-scales. We find that diffusion barriers can modulate the frequencies and amplitudes of coupled diffusion-influenced reaction networks, as well as give rise to “compartments” of decoupled reactant populations. These effects appear to be intensified in the presence of buffers localized to the diffusion barrier. These findings have strong implications for the role of the cellular environment in tuning the dynamics of signaling pathways. PMID:26342355

  1. Experiments Developed to Study Microgravity Smoldering Combustion

    NASA Technical Reports Server (NTRS)

    Vergilii, Franklin

    2001-01-01

    The overall objective of the Microgravity Smoldering Combustion (MSC) research program is to understand and predict smoldering combustion under normal and microgravity (near-zero-gravity) conditions to help prevent and control smolder-originated fires, in both environments. Smoldering is defined as a nonflaming, self-sustaining, propagating, exothermic surface reaction. If a material is sufficiently permeable, smoldering is not confined to its outer surface, but can propagate as a reaction wave through the interior of the material. The MSC program will accomplish its goals by conducting smolder experiments on the ground and in a space-based laboratory, and developing theoretical models of the process. Space-based experiments are necessary because smoldering is a very slow process and, consequently, its study in a microgravity environment requires extended periods of time that can only be achieved in space. Smoldering can occur in a variety of processes ranging from the smolder of porous insulating materials to underground coal combustion. Many materials can sustain smoldering, including wood, cloth, foams, tobacco, other dry organic materials, and charcoal. The ignition, propagation, transition to flaming, and extinction of the smolder reaction are controlled by complex, thermochemical mechanisms that are not well understood. As with many forms of combustion, gravity affects the availability of the oxidizer and the transport of heat, and therefore, the rate of combustion. The smoldering combustion of porous materials has been studied both experimentally and theoretically, usually in the context of fire safety. Smoldering encompasses a number of fundamental processes, including heat and mass transfer in a porous media; endothermic pyrolysis of combustible material; ignition, propagation, and extinction of heterogeneous exothermic reactions at the solid-gas pore interface; and the onset of gas phase reactions (flaming) from existing surface reactions. Smoldering presents a serious fire risk because the combustion can propagate slowly in a material's interior and go undetected for long periods of time. It typically yields a substantially higher conversion of fuel to toxic compounds than does flaming (though more slowly), and may undergo a sudden transition to flaming.

  2. Photon Energy Threshold in Direct Photocatalysis with Metal Nanoparticles: Key Evidence from the Action Spectrum of the Reaction.

    PubMed

    Sarina, Sarina; Jaatinen, Esa; Xiao, Qi; Huang, Yi Ming; Christopher, Philip; Zhao, Jin Cai; Zhu, Huai Yong

    2017-06-01

    By investigating the action spectra (the relationship between the irradiation wavelength and apparent quantum efficiency of reactions under constant irradiance) of a number of reactions catalyzed by nanoparticles including plasmonic metals, nonplasmonic metals, and their alloys at near-ambient temperatures, we found that a photon energy threshold exists in each photocatalytic reaction; only photons with sufficient energy (e.g., higher than the energy level of the lowest unoccupied molecular orbitals) can initiate the reactions. This energy alignment (and the photon energy threshold) is determined by various factors, including the wavelength and intensity of irradiation, molecule structure, reaction temperature, and so forth. Hence, distinct action spectra were observed in the same type of reaction catalyzed by the same catalyst due to a different substituent group, a slightly changed reaction temperature. These results indicate that photon-electron excitations, instead of the photothermal effect, play a dominant role in direct photocatalysis of metal nanoparticles for many reactions.

  3. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marinov, N.M.; Westbrook, C.K.; Cloutman, L.D.

    Work being carried out at LLNL has concentrated on studies of the role of chemical kinetics in a variety of problems related to hydrogen combustion in practical combustion systems, with an emphasis on vehicle propulsion. Use of hydrogen offers significant advantages over fossil fuels, and computer modeling provides advantages when used in concert with experimental studies. Many numerical {open_quotes}experiments{close_quotes} can be carried out quickly and efficiently, reducing the cost and time of system development, and many new and speculative concepts can be screened to identify those with sufficient promise to pursue experimentally. This project uses chemical kinetic and fluid dynamicmore » computational modeling to examine the combustion characteristics of systems burning hydrogen, either as the only fuel or mixed with natural gas. Oxidation kinetics are combined with pollutant formation kinetics, including formation of oxides of nitrogen but also including air toxics in natural gas combustion. We have refined many of the elementary kinetic reaction steps in the detailed reaction mechanism for hydrogen oxidation. To extend the model to pressures characteristic of internal combustion engines, it was necessary to apply theoretical pressure falloff formalisms for several key steps in the reaction mechanism. We have continued development of simplified reaction mechanisms for hydrogen oxidation, we have implemented those mechanisms into multidimensional computational fluid dynamics models, and we have used models of chemistry and fluid dynamics to address selected application problems. At the present time, we are using computed high pressure flame, and auto-ignition data to further refine the simplified kinetics models that are then to be used in multidimensional fluid mechanics models. Detailed kinetics studies have investigated hydrogen flames and ignition of hydrogen behind shock waves, intended to refine the detailed reactions mechanisms.« less

  5. The underlying toxicological mechanism of chemical mixtures: A case study on mixture toxicity of cyanogenic toxicants and aldehydes to Photobacterium phosphoreum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tian, Dayong; Department of Chemical and Environmental Engineering, Anyang Institute of Technology, Anyang 455000; Lin, Zhifen, E-mail: lzhifen@tongji.edu.cn

    Intracellular chemical reaction of chemical mixtures is one of the main reasons that cause synergistic or antagonistic effects. However, it still remains unclear what the influencing factors on the intracellular chemical reaction are, and how they influence on the toxicological mechanism of chemical mixtures. To reveal this underlying toxicological mechanism of chemical mixtures, a case study on mixture toxicity of cyanogenic toxicants and aldehydes to Photobacterium phosphoreum was employed, and both their joint effects and mixture toxicity were observed. Then series of two-step linear regressions were performed to describe the relationships between joint effects, the expected additive toxicities and descriptorsmore » of individual chemicals (including concentrations, binding affinity to receptors, octanol/water partition coefficients). Based on the quantitative relationships, the underlying joint toxicological mechanisms were revealed. The result shows that, for mixtures with their joint effects resulting from intracellular chemical reaction, their underlying toxicological mechanism depends on not only their interaction with target proteins, but also their transmembrane actions and their concentrations. In addition, two generic points of toxicological mechanism were proposed including the influencing factors on intracellular chemical reaction and the difference of the toxicological mechanism between single reactive chemicals and their mixtures. This study provided an insight into the understanding of the underlying toxicological mechanism for chemical mixtures with intracellular chemical reaction. - Highlights: • Joint effects of nitriles and aldehydes at non-equitoxic ratios were determined. • A novel descriptor, ligand–receptor interaction energy (E{sub binding}), was employed. • Quantitative relationships for mixtures were developed based on a novel descriptor. • The underlying toxic mechanism was revealed based on quantitative relationships. • Two generic points of toxicological mechanism were elucidated.« less

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Franke, J.-H.; Kosov, D. S.

    We study the adsorption and ring-opening of lactide on the naturally chiral metal surface Pt(321){sup S}. Lactide is a precursor for polylactic acid ring-opening polymerization, and Pt is a well known catalyst surface. We study, here, the energetics of the ring-opening of lactide on a surface that has a high density of kink atoms. These sites are expected to be present on a realistic Pt surface and show enhanced catalytic activity. The use of a naturally chiral surface also enables us to study potential chiral selectivity effects of the reaction at the same time. Using density functional theory with amore » functional that includes the van der Waals forces in a first-principles manner, we find modest adsorption energies of around 1.4 eV for the pristine molecule and different ring-opened states. The energy barrier to be overcome in the ring-opening reaction is found to be very small at 0.32 eV and 0.30 eV for LL- and its chiral partner DD-lactide, respectively. These energies are much smaller than the activation energy for a dehydrogenation reaction of 0.78 eV. Our results thus indicate that (a) ring-opening reactions of lactide on Pt(321) can be expected already at very low temperatures, and Pt might be a very effective catalyst for this reaction; (b) the ring-opening reaction rate shows noticeable enantioselectivity.« less

  7. Catatonic variants, hyperthermic extrapyramidal reactions, and subtypes of neuroleptic malignant syndrome.

    PubMed

    Lee, Joseph W Y

    2007-01-01

    This case series study examines the hypothesis that neuroleptic malignant syndrome (NMS) is a heterogeneous condition including catatonic variants and non-catatonic pathological reactions to antipsychotics. Fourteen episodes of NMS were prospectively identified. Patients were examined for catatonia during the course of NMS. Close monitoring of catatonia episodes and suspected cases of evolving NMS for possible NMS development provided data on the pre-NMS clinical course. All NMS episodes received benzodiazepines. Episodes with catatonia diagnosed were compared with those without catatonia, noting their presentation, clinical course and responses to treatment. Concurrent catatonia was diagnosed in 9 episodes. In 6 of them antecedent catatonia progressed to NMS following antipsychotic exposure (NMS of antipsychotic-converted catatonia). In 3 episodes, a parkinsonian-catatonic syndrome with fever and autonomic abnormality developed in reaction to antipsychotics (NMS of antipsychotic-induced catatonia). Catatonia was not diagnosed in 5 during the longitudinal course of NMS. A severe extrapyramidal reaction to antipsychotics with associated delirium preceded all 5 episodes. Seven of the 9 NMS episodes with catatonia and none of the 5 without catatonia showed significant responses to benzodiazepines. The preliminary findings support the hypothesis that NMS is a heterogeneous condition including catatonic variants and non-catatonic hyperthermic extrapyramidal reactions to antipsychotics, differing in presentation, clinical course, and treatment responses.

  8. Studies in useful hard x-ray induced chemistry

    NASA Astrophysics Data System (ADS)

    Pravica, Michael; Bai, Ligang; Sneed, Daniel; Park, Changyong

    2013-06-01

    The observed rapid decomposition of potassium chlorate (via 2KClO3 + h ν --> 2KCl +3O2) via synchrotron hard x-ray irradiation (>10 keV) has enabled experiments that are developing novel and useful hard x-ray chemistry. We have observed a number of radiation-induced in situ decomposition reactions in various substances which release O2, H2, N2, NH3, and H2O in a diamond anvil cell (DAC) at ambient and high pressures. These novel acatalytic and isothermal reactions represent a highly controllable, penetrating, and focused method to initiate chemistry (including x-ray induced combustion) in sealed and/or isolated chambers which maintain matter under extreme conditions. During our studies, we have typically observed a slowing of decomposition with pressure including phase dependent decomposition of KClO3. Energy dependent studies have observed an apparent resonance near 15 keV at which the decomposition rate is maximized. This may enable use of much lower flux and portable x-ray sources (e.g. x-ray tubes) in larger scale experiments. These developments support novel means to load DACs and control chemical reactions providing novel routes of synthesis of novel materials under extreme conditions.

  9. Adsorption and ring-opening of lactide on the chiral metal surface Pt(321)S studied by density functional theory

    NASA Astrophysics Data System (ADS)

    Franke, J.-H.; Kosov, D. S.

    2015-01-01

    We study the adsorption and ring-opening of lactide on the naturally chiral metal surface Pt(321)S. Lactide is a precursor for polylactic acid ring-opening polymerization, and Pt is a well known catalyst surface. We study, here, the energetics of the ring-opening of lactide on a surface that has a high density of kink atoms. These sites are expected to be present on a realistic Pt surface and show enhanced catalytic activity. The use of a naturally chiral surface also enables us to study potential chiral selectivity effects of the reaction at the same time. Using density functional theory with a functional that includes the van der Waals forces in a first-principles manner, we find modest adsorption energies of around 1.4 eV for the pristine molecule and different ring-opened states. The energy barrier to be overcome in the ring-opening reaction is found to be very small at 0.32 eV and 0.30 eV for LL- and its chiral partner DD-lactide, respectively. These energies are much smaller than the activation energy for a dehydrogenation reaction of 0.78 eV. Our results thus indicate that (a) ring-opening reactions of lactide on Pt(321) can be expected already at very low temperatures, and Pt might be a very effective catalyst for this reaction; (b) the ring-opening reaction rate shows noticeable enantioselectivity.

  10. A study of the rate-controlled constrained-equilibrium dimension reduction method and its different implementations

    NASA Astrophysics Data System (ADS)

    Hiremath, Varun; Pope, Stephen B.

    2013-04-01

    The Rate-Controlled Constrained-Equilibrium (RCCE) method is a thermodynamic based dimension reduction method which enables representation of chemistry involving n s species in terms of fewer n r constraints. Here we focus on the application of the RCCE method to Lagrangian particle probability density function based computations. In these computations, at every reaction fractional step, given the initial particle composition (represented using RCCE), we need to compute the reaction mapping, i.e. the particle composition at the end of the time step. In this work we study three different implementations of RCCE for computing this reaction mapping, and compare their relative accuracy and efficiency. These implementations include: (1) RCCE/TIFS (Trajectory In Full Space): this involves solving a system of n s rate-equations for all the species in the full composition space to obtain the reaction mapping. The other two implementations obtain the reaction mapping by solving a reduced system of n r rate-equations obtained by projecting the n s rate-equations for species evaluated in the full space onto the constrained subspace. These implementations include (2) RCCE: this is the classical implementation of RCCE which uses a direct projection of the rate-equations for species onto the constrained subspace; and (3) RCCE/RAMP (Reaction-mixing Attracting Manifold Projector): this is a new implementation introduced here which uses an alternative projector obtained using the RAMP approach. We test these three implementations of RCCE for methane/air premixed combustion in the partially-stirred reactor with chemistry represented using the n s=31 species GRI-Mech 1.2 mechanism with n r=13 to 19 constraints. We show that: (a) the classical RCCE implementation involves an inaccurate projector which yields large errors (over 50%) in the reaction mapping; (b) both RCCE/RAMP and RCCE/TIFS approaches yield significantly lower errors (less than 2%); and (c) overall the RCCE/TIFS approach is the most accurate, efficient (by orders of magnitude) and robust implementation.

  11. Advances in quantum and molecular mechanical (QM/MM) simulations for organic and enzymatic reactions.

    PubMed

    Acevedo, Orlando; Jorgensen, William L

    2010-01-19

    Application of combined quantum and molecular mechanical (QM/MM) methods focuses on predicting activation barriers and the structures of stationary points for organic and enzymatic reactions. Characterization of the factors that stabilize transition structures in solution and in enzyme active sites provides a basis for design and optimization of catalysts. Continued technological advances allowed for expansion from prototypical cases to mechanistic studies featuring detailed enzyme and condensed-phase environments with full integration of the QM calculations and configurational sampling. This required improved algorithms featuring fast QM methods, advances in computing changes in free energies including free-energy perturbation (FEP) calculations, and enhanced configurational sampling. In particular, the present Account highlights development of the PDDG/PM3 semi-empirical QM method, computation of multi-dimensional potentials of mean force (PMF), incorporation of on-the-fly QM in Monte Carlo (MC) simulations, and a polynomial quadrature method for efficient modeling of proton-transfer reactions. The utility of this QM/MM/MC/FEP methodology is illustrated for a variety of organic reactions including substitution, decarboxylation, elimination, and pericyclic reactions. A comparison to experimental kinetic results on medium effects has verified the accuracy of the QM/MM approach in the full range of solvents from hydrocarbons to water to ionic liquids. Corresponding results from ab initio and density functional theory (DFT) methods with continuum-based treatments of solvation reveal deficiencies, particularly for protic solvents. Also summarized in this Account are three specific QM/MM applications to biomolecular systems: (1) a recent study that clarified the mechanism for the reaction of 2-pyrone derivatives catalyzed by macrophomate synthase as a tandem Michael-aldol sequence rather than a Diels-Alder reaction, (2) elucidation of the mechanism of action of fatty acid amide hydrolase (FAAH), an unusual Ser-Ser-Lys proteolytic enzyme, and (3) the construction of enzymes for Kemp elimination of 5-nitrobenzisoxazole that highlights the utility of QM/MM in the design of artificial enzymes.

  12. First-principles quantum-mechanical investigations: The role of water in catalytic conversion of furfural on Pd(111)

    NASA Astrophysics Data System (ADS)

    Xue, Wenhua; Borja, Miguel Gonzalez; Resasco, Daniel E.; Wang, Sanwu

    2015-03-01

    In the study of catalytic reactions of biomass, furfural conversion over metal catalysts with the presence of water has attracted wide attention. Recent experiments showed that the proportion of alcohol product from catalytic reactions of furfural conversion with palladium in the presence of water is significantly increased, when compared with other solvent including dioxane, decalin, and ethanol. We investigated the microscopic mechanism of the reactions based on first-principles quantum-mechanical calculations. We particularly identified the important role of water and the liquid/solid interface in furfural conversion. Our results provide atomic-scale details for the catalytic reactions. Supported by DOE (DE-SC0004600). This research used the supercomputer resources at NERSC, of XSEDE, at TACC, and at the Tandy Supercomputing Center.

  13. The use of hydrazine as an alternate source of energy

    NASA Technical Reports Server (NTRS)

    Carvalho, J. A., Jr.; Bressan, C.; Ferreira, J. L.

    1984-01-01

    The potentials of using hydrazine as an alternative source of energy was studied. Three chemical reactions are considered: oxidation with air, oxidation with hydrogen peroxide, and thermocatalytic decomposition. Performance data of gasoline, ethylic alcohol, and propane are compared. An item about the NO(x) emissions by the various investigated reactions is included. Promising results are shown, mainly those regarding the available energy per unit volume of unburned gases (vaporized fuel and oxidizer).

  14. Inadequate safety reporting in pre-eclampsia trials: a systematic evaluation.

    PubMed

    Duffy, Jmn; Hirsch, M; Pealing, L; Showell, M; Khan, K S; Ziebland, S; McManus, R J

    2018-06-01

    Randomised trials and their syntheses in meta-analyses offer a unique opportunity to assess the frequency and severity of adverse reactions. To assess safety reporting in pre-eclampsia trials. Systematic search using bibliographic databases, including Cochrane Central Register of Controlled Trials, Embase, and MEDLINE, from inception to August 2017. Randomised trials evaluating anticonvulsant or antihypertensive medication for pre-eclampsia. Descriptive statistics appraising the adequacy of adverse reaction and toxicity reporting. We included 60 randomised trials. Six trials (10%) were registered with the International Clinical Trials Registry Platform, two registry records referred to adverse reactions, stating 'safety and toleration' and 'possible side effects' would be collected. Twenty-six trials (43%) stated the frequency of withdrawals within each study arm, and five trials (8%) adequately reported these withdrawals. Adverse reactions were inconsistently reported across eligible trials: 24 (40%) reported no serious adverse reactions and 36 (60%) reported no mild adverse reactions. The methods of definition or measurement of adverse reactions were infrequently reported within published trial reports. Pre-eclampsia trials regularly omit critical information related to safety. Despite the paucity of reporting, randomised trials collect an enormous amount of safety data. Developing and implementing a minimum data set could help to improve safety reporting, permitting a more balanced assessment of interventions by considering the trade-off between the benefits and harms. National Institute for Health Research (DRF-2014-07-051), UK; Maternity Forum, Royal Society of Medicine, UK. Developing @coreoutcomes could help to improve safety reporting in #preeclampsia trials. @NIHR_DC. © 2017 Royal College of Obstetricians and Gynaecologists.

  15. Severe Adverse Reactions Following Ketoconazole, Fluconazole, and Environmental Exposures: A Case Report.

    PubMed

    Lieberman, Allan; Curtis, Luke

    2018-04-18

    In this case report, we describe a 66-year-old man who developed multiple adverse reactions beginning at age 56 after exposure to several azole antifungal drugs including ketoconazole and fluconazole. He also had a history of more than 40 years exposure to chemicals including pesticides, wood preservatives, fertilizers, and welding chemicals. His reactions involved dehydration (requiring several liters of intravenous fluids in less than an hour to alleviate this condition), angioedema, nausea, tinnitus, hypotension, and difficulty breathing. His acute adverse reactions were triggered by a wide range of chemicals including gasoline, diesel fuel, pesticides, chlorine, topical isopropyl alcohol, and paper mill emissions. His acute reactions were also triggered by a wide range of foods such as bananas, apples, milk, white potatoes, and processed sweets. A number of mechanisms could be responsible for his increased sensitivity to chemicals following exposure to fluconazole/ketoconazole, including inhibition of P450 and other detoxification enzymes, acetaldehyde buildup, and neurogenic sensitization.

  16. Histopathology and immune histochemistry of red tattoo reactions. Interface dermatitis is the lead pathology, with increase in T-lymphocytes and Langerhans cells suggesting an allergic pathomechanism.

    PubMed

    Høgsberg, T; Thomsen, B M; Serup, J

    2015-11-01

    The majority of tattoo reactions are affiliated to red pigmented areas and often suspected to be allergic in nature. A sizeable series of biopsies of such reactions has not previously been performed. The aim of this study was to type and grade epidermal and dermal changes in tattoo reactions to red/red nuances by microscopy and immunochemistry relevant for the assessment of a possible allergic pathomechanism. Skin biopsies were taken from red tattoo reactions, graded by conventional microscopy and stained for T and B-lymphocytes, Langerhans cells, macrophages and tumour necrosis factor (TNF)-α. The study included 19 biopsies from 19 patients. The culprit colours were red/pink (n = 15) and purple/bordeaux (n = 4). Interface dermatitis was clearly the lead pathology found in 78% of samples, overlapped with granulomatous (in 32%) and pseudolymphomatous reaction patterns (in 32%). Epidermal hyperkeratosis (in 89%) was common as was leakage of red pigment across the dermo-epidermal junction, with transepidermal elimination (in 28%). The dermal cellular infiltration was dominated by T-lymphocytes (in 100%), Langerhans cells (in 95%) and macrophages (in 100%). TNF-α was common. The predominant histological pattern of chronic tattoo reactions in red/red nuances is interface dermatitis. T-lymphocytes and Langerhans cells are increased suggesting an allergic pathomechanism. TNF-α may contribute to reactions. In many cases, overlapping reactive patterns were identified. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Thermolysis of phenethyl phenyl ether: A model of ether linkages in low rank coal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Britt, P.F.; Buchanan, A.C. III; Malcolm, E.A.

    Currently, an area of interest and frustration for coal chemists has been the direct liquefaction of low rank coal. Although low rank coals are more reactive than bituminous coals, they are more difficult to liquefy and offer lower liquefaction yields under conditions optimized for bituminous coals. Solomon, Serio, and co-workers have shown that: in the pyrolysis and liquefaction of low rank coals, a low temperature cross-linking reaction associated with oxygen functional groups occurs before tar evolution. A variety of pretreatments (demineralization, alkylation, and ion-exchange) have been shown to reduce these retrogressive reactions and increase tar yields, but the actual chemicalmore » reactions responsible for these processes have not been defined. In order to gain insight into the thermochemical reactions leading to cross-linking in low rank coal, we have undertaken a study of the pyrolysis of oxygen containing coal model compounds. Solid state NMR studies suggest that the alkyl aryl ether linkage may be present in modest amounts in low rank coal. Therefore, in this paper, we will investigate the thermolysis of phenethyl phenyl ether (PPE) as a model of 0-aryl ether linkages found in low rank coal, lignites, and lignin, an evolutionary precursor of coal. Our results have uncovered a new reaction channel that can account for 25% of the products formed. The impact of reaction conditions, including restricted mass transport, on this new reaction pathway and the role of oxygen functional groups in cross-linking reactions will be investigated.« less

  18. NASA Data Evaluation (2015): Chemical Kinetics and Photochemical Data for Use in Atmospheric Studies

    NASA Astrophysics Data System (ADS)

    Burkholder, J. B.; Sander, S. P.; Abbatt, J.; Barker, J. R.; Huie, R. E.; Kolb, C. E., Jr.; Kurylo, M. J., III; Orkin, V. L.; Wilmouth, D. M.; Wine, P. H.

    2015-12-01

    Atmospheric chemistry models must include a large number of processes to accurately describe the temporal and spatial behavior of atmospheric composition. They require a wide range of chemical and physical data (parameters) that describe elementary gas-phase and heterogeneous processes. The review and evaluation of chemical and physical data has, therefore, played an important role in the development of chemical models and in their use in environmental assessment activities. The NASA data panel evaluation has a broad atmospheric focus that includes Ox, O(1D), singlet O2, HOx, NOx, Organic, FOx, ClOx, BrOx, IOx, SOx, and Na reactions, three-body reactions, equilibrium constants, photochemistry, Henry's Law coefficients, aqueous chemistry, heterogeneous chemistry and processes, and thermodynamic parameters. The 2015 evaluation includes critical coverage of ~700 bimolecular reactions, 86 three-body reactions, 33 equilibrium constants, ~220 photochemical species, ~360 aqueous and heterogeneous processes, and thermodynamic parameters for ~800 species with over 5000 literature citations reviewed. Each evaluation includes (1) recommended values (e.g. rate coefficients, absorption cross sections, solubilities, and uptake coefficients) with estimated uncertainty factors and (2) a note describing the available experimental and theoretical data and an explanation for the recommendation. This presentation highlights some of the recent additions to the evaluation that include: (1) expansion of thermochemical parameters, including Hg species, (2) CH2OO (Criegee) chemistry, (3) Isoprene and its major degradation product chemistry, (4) halocarbon chemistry, (5) Henry's law solubility data, and (6) uptake coefficients. In addition, a listing of complete references with the evaluation notes has been implemented. Users of the data evaluation are encouraged to suggest potential improvements and ways that the evaluation can better serve the atmospheric chemistry community.

  19. Risk Factors for Oxaliplatin-Induced Hypersensitivity Reactions in Japanese Patients with Advanced Colorectal Cancer

    PubMed Central

    Seki, Kyoko; Senzaki, Kenzou; Tsuduki, Yasuo; Ioroi, Takeshi; Fujii, Michiko; Yamauchi, Hiroko; Shiraishi, Yukinari; Nakata, Izumi; Nishiguchi, Kohshi; Matsubayashi, Teruhisa; Takakubo, Yoshihide; Okamura, Noboru; Yamamori, Motohiro; Tamura, Takao; Sakaeda, Toshiyuki

    2011-01-01

    Objective: Previously, we suggested that oxaliplatin (L-OHP)-related grade 3/4 hypersensitivity reactions occurred immediately after the initiation, but grade 1/2 reactions did not. This study was conducted to clarify the risk factors for L-OHP-related hypersensitivity reactions. Methods: Clinical data from 108 Japanese patients with colorectal cancer were analyzed, who were treated with L-OHP-containing regimens, FOLFOX4 and/or mFOLFOX6. The risk factors examined included demographic data, preexisting allergies, laboratory test data, treatment regimen, treatment line of therapy, pretreatment with steroids, total number of cycles and cumulative amount of L-OHP. Results: The incidence of grade 1/2 and grade 3/4 hypersensitivity reactions were found at 13.0% (14/108) and 9.3% (10/108), respectively. Female (P=0.037), preexisting allergies (P=0.004) and lower level of lactate dehydrogenase (P=0.003) were risk factors for grade 1/2 hypersensitivity reactions, and higher neutrophil count (P=0.043) and lower monocyte count (P=0.007) were for grade 3/4 reactions. Total number of cycles were larger in the patients with grade 3/4 reactions than those without reactions (P=0.049). Conclusions: Further extensive examination with a large number of patients is needed to establish a patient management strategy. PMID:21448307

  20. [Reaction time of drivers who caused road traffic accidents].

    PubMed

    Durić, Predrag; Filipović, Danka

    2009-01-01

    Human factor is the single cause of road traffic injuries in 57%, and together with other factors in more than 90% of all road traffic accidents. Human factor includes many aspects, where reaction time is very important. Thirty healthy drivers 28-40 y.o. with 50-500 km passed per week, having caused at least one road traffic accident in the last ten years were selected, provided they were not under the influence of alcohol and drugs during traffic accident. The same number of control were selected. Both cases and controls were tested to reaction time. We found statistically significant difference between car drivers who caused car accidents and those who did not in both simple and choice reaction times. Car drivers who caused road traffic accidents have longer reaction time (both simple and choice reaction time), but as the tasks were more complex, that difference was less visible. Since drivers involved in this study had introductory phase before measuring their reaction times, they faced with unpleasant sound when they made mistake, which forced them to be aware not to make a mistake in further tasks, so they showed longer reaction times. Measuring of reaction time seems to be important, and as we have showed they are different in drivers who have caused road traffic accidents and those who have do not.

  1. Chemical methods and techniques to monitor early Maillard reaction in milk products; A review.

    PubMed

    Aalaei, Kataneh; Rayner, Marilyn; Sjöholm, Ingegerd

    2018-01-23

    Maillard reaction is an extensively studied, yet unresolved chemical reaction that occurs as a result of application of the heat and during the storage of foods. The formation of advanced glycation end products (AGEs) has been the focus of several investigations recently. These molecules which are formed at the advanced stage of the Maillard reaction, are suspected to be involved in autoimmune diseases in humans. Therefore, understanding to which extent this reaction occurs in foods, is of vital significance. Because of their composition, milk products are ideal media for this reaction, especially when application of heat and prolonged storage are considered. Thus, in this work several chemical approaches to monitor this reaction in an early stage are reviewed. This is mostly done regarding available lysine blockage which takes place in the very beginning of the reaction. The most popular methods and their applications to various products are reviewed. The methods including their modifications are described in detail and their findings are discussed. The present paper provides an insight into the history of the most frequently-used methods and provides an overview on the indicators of the Maillard reaction in the early stage with its focus on milk products and especially milk powders.

  2. An observational assessment of the influence of mesoscale and submesoscale heterogeneity on ocean biogeochemical reactions

    NASA Astrophysics Data System (ADS)

    Martin, Adrian P.; Lévy, Marina; van Gennip, Simon; Pardo, Silvia; Srokosz, Meric; Allen, John; Painter, Stuart C.; Pidcock, Roz

    2015-09-01

    Numerous observations demonstrate that considerable spatial variability exists in components of the marine planktonic ecosystem at the mesoscale and submesoscale (100 km-1 km). The causes and consequences of physical processes at these scales ("eddy advection") influencing biogeochemistry have received much attention. Less studied, the nonlinear nature of most ecological and biogeochemical interactions means that such spatial variability has consequences for regional estimates of processes including primary production and grazing, independent of the physical processes. This effect has been termed "eddy reactions." Models remain our most powerful tools for extrapolating hypotheses for biogeochemistry to global scales and to permit future projections. The spatial resolution of most climate and global biogeochemical models means that processes at the mesoscale and submesoscale are poorly resolved. Modeling work has previously suggested that the neglected eddy reactions may be almost as large as the mean field estimates in some cases. This study seeks to quantify the relative size of eddy and mean reactions observationally, using in situ and satellite data. For primary production, grazing, and zooplankton mortality the eddy reactions are between 7% and 15% of the mean reactions. These should be regarded as preliminary estimates to encourage further observational estimates and not taken as a justification for ignoring eddy reactions. Compared to modeling estimates, there are inconsistencies in the relative magnitude of eddy reactions and in correlations which are a major control on their magnitude. One possibility is that models exhibit much stronger spatial correlations than are found in reality, effectively amplifying the magnitude of eddy reactions.

  3. Electron and Ion Reactions in Molecular Solids: from water ice to DNA

    NASA Astrophysics Data System (ADS)

    Huels, Michael A.

    2002-05-01

    Wherever ionizing radiation interacts with matter, it initiates reaction cascades involving non-thermal ions, radicals, and ballistic secondary electrons, which in turn may lead to substantial physical and chemical modifications of a medium. The detailed study of the fundamental reaction mechanisms which occur on a molecular level aids our general understanding of radiation induced processes in a variety of contexts, ranging from radiobiology to astrochemistry. Here I present measurements of electron (1 - 80 eV) and some ion (1 - 8 eV) mediated reactions in molecular films that resemble biological model systems. These consist of cryogenic films (pure or mixed) of rare gases, oxygen, water, methane, or aromatic hydrocarbons of increasing complexity, including bases, sugars, single and double stranded DNA. Although the basic nature of the electron or ion reaction mechanisms are found to be similar to those in the gas phase, they are often modulated by the physico-chemical characteristics of the medium. Depending on the latter, some reaction channels may be strongly enhanced, some may be quenched, and new reaction pathways, unavailable in the gas phase, may open. Thus, a given reaction cascade may lead to different end-points even in the same target. Although the goal of these studies is to unravel some of the nascent secondary-electron and reactive-ion induced events that contribute to radiation damage in living tissue, the basic observed reactions relate to other areas of application which will be briefly discussed. This research is supported by the Canadian Institutes of Health Research (CIHR), the National Cancer Institutes of Canada, the Natural Science and Engineering Research Council, and NATO.

  4. Predictors of severe systemic anaphylactic reactions in patients with Hymenoptera venom allergy: importance of baseline serum tryptase-a study of the European Academy of Allergology and Clinical Immunology Interest Group on Insect Venom Hypersensitivity.

    PubMed

    Ruëff, Franziska; Przybilla, Bernhard; Biló, Maria Beatrice; Müller, Ulrich; Scheipl, Fabian; Aberer, Werner; Birnbaum, Joëlle; Bodzenta-Lukaszyk, Anna; Bonifazi, Floriano; Bucher, Christoph; Campi, Paolo; Darsow, Ulf; Egger, Cornelia; Haeberli, Gabrielle; Hawranek, Thomas; Körner, Michael; Kucharewicz, Iwona; Küchenhoff, Helmut; Lang, Roland; Quercia, Oliviero; Reider, Norbert; Severino, Maurizio; Sticherling, Michael; Sturm, Gunter Johannes; Wüthrich, Brunello

    2009-11-01

    Severe anaphylaxis to honeybee or vespid stings is associated with a variety of risk factors, which are poorly defined. Our aim was to evaluate the association of baseline serum tryptase concentrations and other variables routinely recorded during patient evaluation with the frequency of past severe anaphylaxis after a field sting. In this observational multicenter study, we enrolled 962 patients with established bee or vespid venom allergy who had a systemic reaction after a field sting. Data were collected on tryptase concentration, age, sex, culprit insect, cardiovascular medication, and the number of preceding minor systemic reactions before the index field sting. A severe reaction was defined as anaphylactic shock, loss of consciousness, or cardiopulmonary arrest. The index sting was defined as the hitherto first, most severe systemic field-sting reaction. Relative rates were calculated with generalized additive models. Two hundred six (21.4%) patients had a severe anaphylactic reaction after a field sting. The frequency of this event increased significantly with higher tryptase concentrations (nonlinear association). Other factors significantly associated with severe reactions after a field sting were vespid venom allergy, older age, male sex, angiotensin-converting enzyme inhibitor medication, and 1 or more preceding field stings with a less severe systemic reaction. In patients with honeybee or vespid venom allergy, baseline serum tryptase concentrations are associated with the risk for severe anaphylactic reactions. Preventive measures should include substitution of angiotensin-converting enzyme inhibitors.

  5. Some issues for blast from a structural reactive material solid

    NASA Astrophysics Data System (ADS)

    Zhang, F.

    2018-07-01

    Structural reactive material (SRM) is consolidated from a mixture of micro- or nanometric reactive metals and metal compounds to the mixture theoretical maximum density. An SRM can thus possess a higher energy density, relying on various exothermic reactions, and higher mechanical strength and heat resistance than that of conventional CHNO explosives. Progress in SRM solid studies is reviewed specifically as an energy source for air blast through the reaction of fine SRM fragments under explosive loading. This includes a baseline SRM solid explosion characterization, material properties of an SRM solid, and its dynamic fine fragmentation mechanisms and fragment reaction mechanisms. The overview is portrayed mainly from the author's own experimental studies combined with theoretical and numerical explanation. These advances have laid down some fundamentals for the next stage of developments.

  6. Some issues for blast from a structural reactive material solid

    NASA Astrophysics Data System (ADS)

    Zhang, F.

    2018-03-01

    Structural reactive material (SRM) is consolidated from a mixture of micro- or nanometric reactive metals and metal compounds to the mixture theoretical maximum density. An SRM can thus possess a higher energy density, relying on various exothermic reactions, and higher mechanical strength and heat resistance than that of conventional CHNO explosives. Progress in SRM solid studies is reviewed specifically as an energy source for air blast through the reaction of fine SRM fragments under explosive loading. This includes a baseline SRM solid explosion characterization, material properties of an SRM solid, and its dynamic fine fragmentation mechanisms and fragment reaction mechanisms. The overview is portrayed mainly from the author's own experimental studies combined with theoretical and numerical explanation. These advances have laid down some fundamentals for the next stage of developments.

  7. Effects of space environment on structural materials - A preliminary study and development of materials characterization protocols

    NASA Technical Reports Server (NTRS)

    Miglionico, C.; Stein, C.; Murr, L. E.

    1991-01-01

    A preliminary study of materials exposed in space in LEO for nearly six years in the NASA Long-Duration Exposure Facility is presented. It is demonstrated that it will be necessary to isolate surface debris and reaction products from materials exposed in space. Replication techniques originally designed for electron microscopy examination of surfaces can be applied to lift off and isolate such surface features. Debris and reaction products were examined through a variety of analytical techniques, including the surface morphology by SEM, and internal microstructures by STEM and TEM, EDS, and SAD. The results illustrate the role that atomic oxygen and micrometeorites play in surface alteration and reaction in LEO space environments, as well as the role of debris created from other proximate materials.

  8. Effect of Water Chemistry and Hydrodynamics on Nitrogen Transformation Activity and Microbial Community Functional Potential in Hyporheic Zone Sediment Columns

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yuanyuan; Liu, Chongxuan; Nelson, William C.

    Nitrogen (N) transformation in hyporheic zone (HZ) is an important component in N-cycling in ecosystems. A column study was conducted to investigate N transformation in a HZ sediment with a focus on how characteristic HZ properties including water chemistry, fluid residence time, and dynamic groundwater and surface water exchange affect on N transformation. Metagenomic and quantitative polymerase chain reaction (qPCR) analyses were performed to evaluate the dynamic changes in microbial community structure and its function in response to N transformation. The results indicated that N transformation in the HZ sediment was collectively controlled by microbial community functions including: denitrification, dissimilatorymore » nitrate reduction to ammonium (DNRA), nitrification, and anaerobic ammonium oxidation (anammox). However, the spatial distribution of the microbial community functions and associated biogeochemical reaction rates and products changed quickly in response to experimental perturbation, and was influenced by various factors including water chemistry (dissolved O2 and N species), desorption of sediment associated organic carbon, ion exchange reactions of NH4+, and fluid residence time. The results of this study implied that the microbial community in the HZ would exhibit strong function zonation along N and O gradients, which in turn would control the rates and products of N transformation.« less

  9. Reactions of aromatic diazonium salts with unsaturated compounds in the presence of nucleophiles

    NASA Astrophysics Data System (ADS)

    Grishchuk, B. D.; Gorbovoi, P. M.; Ganushchak, N. I.; Dombrovskii, A. V.

    1994-03-01

    The review surveys the reactions of aromatic diazonium salts with diene and monounsaturated compounds in the presence of nucleophiles. Certain further reactions of the reaction products and their application are considered. The bibliography includes 63 references.

  10. Ozone impacts of gas-aerosol uptake in global chemistry transport models

    NASA Astrophysics Data System (ADS)

    Stadtler, Scarlet; Simpson, David; Schröder, Sabine; Taraborrelli, Domenico; Bott, Andreas; Schultz, Martin

    2018-03-01

    The impact of six heterogeneous gas-aerosol uptake reactions on tropospheric ozone and nitrogen species was studied using two chemical transport models, the Meteorological Synthesizing Centre-West of the European Monitoring and Evaluation Programme (EMEP MSC-W) and the European Centre Hamburg general circulation model combined with versions of the Hamburg Aerosol Model and Model for Ozone and Related chemical Tracers (ECHAM-HAMMOZ). Species undergoing heterogeneous reactions in both models include N2O5, NO3, NO2, O3, HNO3, and HO2. Since heterogeneous reactions take place at the aerosol surface area, the modelled surface area density (Sa) of both models was compared to a satellite product retrieving the surface area. This comparison shows a good agreement in global pattern and especially the capability of both models to capture the extreme aerosol loadings in east Asia. The impact of the heterogeneous reactions was evaluated by the simulation of a reference run containing all heterogeneous reactions and several sensitivity runs. One reaction was turned off in each sensitivity run to compare it with the reference run. The analysis of the sensitivity runs confirms that the globally most important heterogeneous reaction is the one of N2O5. Nevertheless, NO2, HNO3, and HO2 heterogeneous reactions gain relevance particularly in east Asia due to the presence of high NOx concentrations and high Sa in the same region. The heterogeneous reaction of O3 itself on dust is of minor relevance compared to the other heterogeneous reactions. The impacts of the N2O5 reactions show strong seasonal variations, with the biggest impacts on O3 in springtime when photochemical reactions are active and N2O5 levels still high. Evaluation of the models with northern hemispheric ozone surface observations yields a better agreement of the models with observations in terms of concentration levels, variability, and temporal correlations at most sites when the heterogeneous reactions are incorporated. Our results are loosely consistent with results from earlier studies, although the magnitude of changes induced by N2O5 reaction is at the low end of estimates, which seems to fit a trend, whereby the more recent the study the lower the impacts of these reactions.

  11. ATLAS of Biochemistry: A Repository of All Possible Biochemical Reactions for Synthetic Biology and Metabolic Engineering Studies.

    PubMed

    Hadadi, Noushin; Hafner, Jasmin; Shajkofci, Adrian; Zisaki, Aikaterini; Hatzimanikatis, Vassily

    2016-10-21

    Because the complexity of metabolism cannot be intuitively understood or analyzed, computational methods are indispensable for studying biochemistry and deepening our understanding of cellular metabolism to promote new discoveries. We used the computational framework BNICE.ch along with cheminformatic tools to assemble the whole theoretical reactome from the known metabolome through expansion of the known biochemistry presented in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. We constructed the ATLAS of Biochemistry, a database of all theoretical biochemical reactions based on known biochemical principles and compounds. ATLAS includes more than 130 000 hypothetical enzymatic reactions that connect two or more KEGG metabolites through novel enzymatic reactions that have never been reported to occur in living organisms. Moreover, ATLAS reactions integrate 42% of KEGG metabolites that are not currently present in any KEGG reaction into one or more novel enzymatic reactions. The generated repository of information is organized in a Web-based database ( http://lcsb-databases.epfl.ch/atlas/ ) that allows the user to search for all possible routes from any substrate compound to any product. The resulting pathways involve known and novel enzymatic steps that may indicate unidentified enzymatic activities and provide potential targets for protein engineering. Our approach of introducing novel biochemistry into pathway design and associated databases will be important for synthetic biology and metabolic engineering.

  12. Things fall apart: Fragmentation reactions in the oxidative aging of organic species

    NASA Astrophysics Data System (ADS)

    Kroll, J. H.; Isaacman-VanWertz, G. A.; Wilson, K. R.; Daumit, K. E.; Kessler, S. H.; Lim, C. Y.; Worsnop, D. R.

    2016-12-01

    The atmospheric oxidation of organic compounds involves a wide array of chemical transformations, including functionalization reactions (addition of polar functional groups to the carbon skeleton), fragmentation reactions (formation of lower carbon-number products via C-C bond scission), and accretion reactions (increases in molecular weight by the combination of two chemical species). Each of these reaction classes can lead to large changes in volatility, and hence can have major implications for atmospheric organic aerosol (OA). For example, the formation of OA is predominantly driven by functionalization and accretion reactions, which generally lead to decreases in volatility. Here we describe a series of laboratory studies of the subsequent organic "aging", the multiday oxidation processes that occur after the initial OA formation and growth. In these studies, the multigenerational oxidation of organic compounds in various phases (the gas phase, the condensed OA phase, and the aqueous phase) is carried out within either an environmental chamber or a flow reactor, and monitored using various high-resolution mass spectrometric techniques. In all cases it is found that fragmentation reactions play a major role in the observed aging chemistry, dominated by the formation of small, volatile oxidation products. These results suggest that multi-day oxidative aging processes do not lead to sustained aerosol growth, but rather may serve as a chemical sink for atmospheric OA.

  13. Multiscale Informatics for Low-Temperature Propane Oxidation: Further Complexities in Studies of Complex Reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burke, Michael P.; Goldsmith, C. Franklin; Klippenstein, Stephen J.

    2015-07-16

    We have developed a multi-scale approach (Burke, M. P.; Klippenstein, S. J.; Harding, L. B. Proc. Combust. Inst. 2013, 34, 547–555.) to kinetic model formulation that directly incorporates elementary kinetic theories as a means to provide reliable, physics-based extrapolation to unexplored conditions. Here, we extend and generalize the multi-scale modeling strategy to treat systems of considerable complexity – involving multi-well reactions, potentially missing reactions, non-statistical product branching ratios, and non-Boltzmann (i.e. non-thermal) reactant distributions. The methodology is demonstrated here for a subsystem of low-temperature propane oxidation, as a representative system for low-temperature fuel oxidation. A multi-scale model is assembled andmore » informed by a wide variety of targets that include ab initio calculations of molecular properties, rate constant measurements of isolated reactions, and complex systems measurements. Active model parameters are chosen to accommodate both “parametric” and “structural” uncertainties. Theoretical parameters (e.g. barrier heights) are included as active model parameters to account for parametric uncertainties in the theoretical treatment; experimental parameters (e.g. initial temperatures) are included to account for parametric uncertainties in the physical models of the experiments. RMG software is used to assess potential structural uncertainties due to missing reactions. Additionally, branching ratios among product channels are included as active model parameters to account for structural uncertainties related to difficulties in modeling sequences of multiple chemically activated steps. The approach is demonstrated here for interpreting time-resolved measurements of OH, HO2, n-propyl, i-propyl, propene, oxetane, and methyloxirane from photolysis-initiated low-temperature oxidation of propane at pressures from 4 to 60 Torr and temperatures from 300 to 700 K. In particular, the multi-scale informed model provides a consistent quantitative explanation of both ab initio calculations and time-resolved species measurements. The present results show that interpretations of OH measurements are significantly more complicated than previously thought – in addition to barrier heights for key transition states considered previously, OH profiles also depend on additional theoretical parameters for R + O2 reactions, secondary reactions, QOOH + O2 reactions, and treatment of non-Boltzmann reaction sequences. Extraction of physically rigorous information from those measurements may require more sophisticated treatment of all of those model aspects, as well as additional experimental data under more conditions, to discriminate among possible interpretations and ensure model reliability. Keywords: Optimization, Uncertainty quantification, Chemical mechanism, Low-Temperature Oxidation, Non-Boltzmann« less

  14. Sorption and redox reactions of As(III) and As(V) within secondary mineral coatings on aquifer sediment grains.

    PubMed

    Singer, David M; Fox, Patricia M; Guo, Hua; Marcus, Matthew A; Davis, James A

    2013-10-15

    Important reactive phenomena that affect the transport and fate of many elements occur at the mineral-water interface (MWI), including sorption and redox reactions. Fundamental knowledge of these phenomena are often based on observations of ideal mineral-water systems, for example, studies of molecular scale reactions on single crystal faces or the surfaces of pure mineral powders. Much less is understood about MWI in natural environments, which typically have nanometer to micrometer scale secondary mineral coatings on the surfaces of primary mineral grains. We examined sediment grain coatings from a well-characterized field site to determine the causes of rate limitations for arsenic (As) sorption and redox processes within the coatings. Sediments were obtained from the USGS field research site on Cape Cod, MA, and exposed to synthetic contaminated groundwater solutions. Uptake of As(III) and As(V) into the coatings was studied with a combination of electron microscopy and synchrotron techniques to assess concentration gradients and reactive processes, including electron transfer reactions. Transmission electron microscopy (TEM) and X-ray microprobe (XMP) analyses indicated that As was primarily associated with micrometer- to submicrometer aggregates of Mn-bearing nanoparticulate goethite. As(III) oxidation by this phase was observed but limited by the extent of exposed surface area of the goethite grains to the exterior of the mineral coatings. Secondary mineral coatings are potentially both sinks and sources of contaminants depending on the history of a contaminated site, and may need to be included explicitly in reactive transport models.

  15. Venom immunotherapy for preventing allergic reactions to insect stings.

    PubMed

    Boyle, Robert J; Elremeli, Mariam; Hockenhull, Juliet; Cherry, Mary Gemma; Bulsara, Max K; Daniels, Michael; Oude Elberink, J N G

    2012-10-17

    Venom immunotherapy (VIT) is commonly used for preventing further allergic reactions to insect stings in people who have had a sting reaction. The efficacy and safety of this treatment has not previously been assessed by a high-quality systematic review. To assess the effects of immunotherapy using extracted insect venom for preventing further allergic reactions to insect stings in people who have had an allergic reaction to a sting. We searched the following databases up to February 2012: the Cochrane Skin Group Specialised Register, CENTRAL in The Cochrane Library, MEDLINE (from 1946), EMBASE (from 1974), PsycINFO (from 1806), AMED (from 1985), LILACS (from 1982), the Armed Forces Pest Management Board Literature Retrieval System, and OpenGrey. There were no language or publication status restrictions to our searches. We searched trials databases, abstracts from recent European and North American allergy meetings, and the references of identified review articles in order to identify further relevant trials. Randomised controlled trials of venom immunotherapy using standardised venom extract in insect sting allergy. Two authors independently undertook study selection, data extraction, and assessment of risk of bias. We identified adverse events from included controlled trials and from a separate analysis of observational studies identified as part of a National Institute for Health and Clinical Excellence Health Technology Assessment. We identified 6 randomised controlled trials and 1 quasi-randomised controlled trial for inclusion in the review; the total number of participants was 392. The trials had some risk of bias because five of the trials did not blind outcome assessors to treatment allocation. The interventions included ant, bee, and wasp immunotherapy in children or adults with previous systemic or large local reactions to a sting, using sublingual (one trial) or subcutaneous (six trials) VIT. We found that VIT is effective for preventing systemic allergic reaction to an insect sting, which was our primary outcome measure. This applies whether the sting occurs accidentally or is given intentionally as part of a trial procedure.In the trials, 3/113 (2.7%) participants treated with VIT had a subsequent systemic allergic reaction to a sting, compared with 37/93 (39.8%) untreated participants (risk ratio [RR] 0.10, 95% confidence interval [CI] 0.03 to 0.28). The efficacy of VIT was similar across studies; we were unable to identify a patient group or mode of treatment with different efficacy, although these analyses were limited by small numbers. We were unable to confirm whether VIT prevents fatal reactions to insect stings, because of the rarity of this outcome.Venom immunotherapy was also effective for preventing large local reactions to a sting (5 studies; 112 follow-up stings; RR 0.41, 95% CI 0.24 to 0.69) and for improving quality of life (mean difference [MD] in favour of VIT 1.21 points on a 7-point scale, 95% CI 0.75 to 1.67).We found a significant risk of systemic adverse reaction to VIT treatment: 6 trials reported this outcome, in which 14 of 150 (9.3%) participants treated with VIT and 1 of 135 (0.7%) participants treated with placebo or no treatment suffered a systemic reaction to treatment (RR 8.16, 95% CI 1.53 to 43.46; 2 studies contributed to the effect estimate). Our analysis of 11 observational studies found systemic adverse reactions occurred in 131/921 (14.2%) participants treated with bee venom VIT and 8/289 (2.8%) treated with wasp venom VIT. We found venom immunotherapy using extracted insect venom to be an effective therapy for preventing further allergic reactions to insect stings, which can improve quality of life. The treatment carries a small but significant risk of systemic adverse reaction.

  16. Discovery of a Significant Acetone•Hydroperoxy Adduct Chaperone Effect and Its Impact on the Determination of Room Temperature Rate Constants for Acetonylperoxy/Hydroperoxy Self-Reactions and Cross Reaction Via Infrared Kinetic Spectroscopy.

    NASA Astrophysics Data System (ADS)

    Grieman, F. J.; Hui, A. O.; Okumura, M.; Sander, S. P.

    2017-12-01

    In order to model the upper troposphere/lower stratosphere in regions containing acetone properly, the kinetics of the acetonylperoxy/hydroperoxy self-reactions and cross reaction have been studied over a wide temperature range using Infrared Kinetic Spectroscopy. We report here the determination of different rate constants for the acetonylperoxy chemistry that we obtained at 298 K compared to currently accepted values. A considerable increase in the observed HO2 self-reaction rate constant due to rate enhancement via the chaperone effect from the reaction between HO2 and the (CH3)2CO•HO2 hydrogen-bonded adduct, even at room temperature, was discovered that was previously ignored. Correct determination of the acetonylperoxy and hydroperoxy kinetics must include this dependence of the HO2 self-reaction rate on acetone concentration. Via excimer laser flash photolysis to create the radical reactants, HO2 absorption was monitored in the infrared by diode laser wavelength modulation detection simultaneously with CH3C(O)CH2O2absorption monitored in the ultraviolet at 300 nm as a function of time. Resulting decay curves were fit concurrently first over a short time scale to obtain the rate constants minimizing subsequent product reactions. Modeling/fitting with a complete reaction scheme was then performed to refine the rate constants and test their veracity. Experiments were carried out over a variety of concentrations of acetone and methanol. Although no effect due to methanol concentration was found at room temperature, the rate constant for the hydroperoxy self-reaction was found to increase linearly with acetone concentration which is interpreted as the adduct being formed and resulting in a chaperone mechanism that enhances the self-reaction rate: (CH3)2CO·HO2 + HO2 → H2O2 + O2 + (CH3)2CO Including this effect, the resulting room temperature rate constants for the cross reaction and the acetonylperoxy self-reaction were found to be 2-3 times smaller than previously reported. This complex formation/chaperone mechanism is similar to that found for methanol, but different in that it occurs at room temperature. No precursor concentration dependence was found for the acetonylperoxy radical reactions. The equilibrium constant for the complex formation will also be presented.

  17. Self-reported adverse food reactions and anaphylaxis in the SchoolNuts study: A population-based study of adolescents.

    PubMed

    McWilliam, Vicki L; Koplin, Jennifer J; Field, Michael J; Sasaki, Mari; Dharmage, Shyamali C; Tang, Mimi L K; Sawyer, Susan M; Peters, Rachel L; Allen, Katrina J

    2018-03-01

    Adolescents are at the highest risk of death from anaphylaxis, yet few population-based studies have described the frequencies and risk factors for allergic reactions caused by accidental allergen ingestion in this group. We describe the prevalence, frequency, and associated risk factors for recent adverse food reactions in 10- to 14-year-olds in Melbourne, Australia, recruited from a stratified, random, population-based sample of schools (SchoolNuts, n = 9663; 48% response rate). Self-reported food allergy and adverse reaction details, including anaphylaxis, were identified by using a student questionnaire over the past year. Of 547 students with possible IgE-mediated food allergy, 243 (44.4%; 95% CI, 40.3% to 48.7%) reported a reaction to a food. Fifty-three (9.7%; 95% CI, 7.2% to 12.2%) students reported 93 anaphylaxis episodes. Peanut and tree nuts were the most common food triggers. Among students with current IgE-mediated food allergy, those with resolved or current asthma (adjusted odds ratio [aOR], 1.9 [95% CI, 1.1-1.3] and 1.7 [95% CI, 1.1-2.6]) and those with more than 2 food allergies (aOR, 1.9 [95% CI, 1.1-3.1]) were at greatest risk of any adverse food reaction, and those with nut allergy were most at risk of severe reactions (aOR, 2.9 [95% CI, 1.1-4.4]). Resolved or current asthma was not associated with increased risk of severe reactions (aOR, 0.8 [95% CI, 0.3-2.2] and 1.6 [95% CI, 0.7-3.7]). Adolescents with food allergy are frequently exposed to food allergens. Those with asthma and more than 2 food allergies were at the greatest risk for adverse food reactions. Those with nut allergies were most at risk of severe reactions. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  18. Kinetic Study of the Aroxyl-Radical-Scavenging Activity of Five Fatty Acid Esters and Six Carotenoids in Toluene Solution: Structure-Activity Relationship for the Hydrogen Abstraction Reaction.

    PubMed

    Mukai, Kazuo; Yoshimoto, Maya; Ishikura, Masaharu; Nagaoka, Shin-Ichi

    2017-08-17

    A kinetic study of the reaction between an aroxyl radical (ArO • ) and fatty acid esters (LHs 1-5, ethyl stearate 1, ethyl oleate 2, ethyl linoleate 3, ethyl linolenate 4, and ethyl arachidonate 5) has been undertaken. The second-order rate constants (k s ) for the reaction of ArO • with LHs 1-5 in toluene at 25.0 °C have been determined spectrophotometrically. The k s values obtained increased in the order of LH 1 < 2 < 3 < 4 < 5, that is, with increasing the number of double bonds included in LHs 1-5. The k s value for LH 5 was 2.93 × 10 -3 M -1 s -1 . From the result, it has been clarified that the reaction of ArO • with LHs 1-5 was explained by an allylic hydrogen abstraction reaction. A similar kinetic study was performed for the reaction of ArO • with six carotenoids (Car-Hs 1-6, astaxanthin 1, β-carotene 2, lycopene 3, capsanthin 4, zeaxanthin 5, and lutein 6). The k s values obtained increased in the order of Car-H 1 < 2 < 3 < 4 < 5 < 6. The k s value for Car-H 6 was 8.4 × 10 -4 M -1 s -1 . The k s values obtained for Car-Hs 1-6 are in the same order as that of the values for LHs 1-5. The results of detailed analyses of the k s values for the above reaction indicated that the reaction was also explained by an allylic hydrogen abstraction reaction. Furthermore, the structure-activity relationship for the reaction was discussed by taking the result of density functional theory calculation reported by Martinez and Barbosa into account.

  19. Differences in posttraumatic growth and grief reactions among adolescents by relationship with the deceased.

    PubMed

    Hirooka, Kayo; Fukahori, Hiroki; Ozawa, Miwa; Akita, Yumi

    2017-04-01

    The aim of this study was to examine three hypotheses: (1) adolescents who had experienced the death of a parent would report higher grief reactions than those who had lost a grandparent; (2) adolescents who experienced the death of a parent would report higher posttraumatic growth than those who had lost a grandparent; and (3) posttraumatic growth and grief reactions are positively associated. To date, no study has investigated adolescents' posttraumatic growth by their relationship with the deceased. Cross-sectional web-based survey. Participants were adolescents who had experienced the death of a parent or grandparent in the last 5 years. Participants completed the Japanese version of the Posttraumatic Growth Inventory and grief reaction items. We conducted a web-based survey during January 2014. We used Pearson product-moment correlations to examine the association between each Posttraumatic Growth Inventory domain and each grief reaction item. Differences in the relationship with the deceased for each Posttraumatic Growth Inventory and grief reaction item were compared with an independent-sample t-test. Participants (n = 124) reported grief reactions including 'I began to get frustrated at the little things' (43·5%), 'It was difficult to go to school' (41·1%) and 'I was not able to sleep at night' (33·9%). The independent t-test indicated that parentally bereaved adolescents reported higher posttraumatic growth and grief reactions than those who had lost a grandparent. Pearson's bivariate analysis showed an association between grief reactions and posttraumatic growth. Parentally bereaved adolescents reported higher posttraumatic growth and grief reactions. Nurses should ensure bereaved adolescents receive appropriate support. © 2016 John Wiley & Sons Ltd.

  20. Reaction norm model to describe environmental sensitivity across first lactation in dairy cattle under tropical conditions.

    PubMed

    Bignardi, Annaiza Braga; El Faro, Lenira; Pereira, Rodrigo Junqueira; Ayres, Denise Rocha; Machado, Paulo Fernando; de Albuquerque, Lucia Galvão; Santana, Mário Luiz

    2015-10-01

    Reaction norm models have been widely used to study genotype by environment interaction (G × E) in animal breeding. The objective of this study was to describe environmental sensitivity across first lactation in Brazilian Holstein cows using a reaction norm approach. A total of 50,168 individual monthly test day (TD) milk yields (10 test days) from 7476 complete first lactations of Holstein cattle were analyzed. The statistical models for all traits (10 TDs and for 305-day milk yield) included the fixed effects of contemporary group, age of cow (linear and quadratic effects), and days in milk (linear effect), except for 305-day milk yield. A hierarchical reaction norm model (HRNM) based on the unknown covariate was used. The present study showed the presence of G × E in milk yield across first lactation of Holstein cows. The variation in the heritability estimates implies differences in the response to selection depending on the environment where the animals of this population are evaluated. In the average environment, the heritabilities for all traits were rather similar, in range from 0.02 to 0.63. The scaling effect of G × E predominated throughout most of lactation. Particularly during the first 2 months of lactation, G × E caused reranking of breeding values. It is therefore important to include the environmental sensitivity of animals according to the phase of lactation in the genetic evaluations of Holstein cattle in tropical environments.

  1. The dissociative chemisorption of methane on Ni(100) and Ni(111): Classical and quantum studies based on the reaction path Hamiltonian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mastromatteo, Michael; Jackson, Bret, E-mail: jackson@chem.umass.edu

    Electronic structure methods based on density functional theory are used to construct a reaction path Hamiltonian for CH{sub 4} dissociation on the Ni(100) and Ni(111) surfaces. Both quantum and quasi-classical trajectory approaches are used to compute dissociative sticking probabilities, including all molecular degrees of freedom and the effects of lattice motion. Both approaches show a large enhancement in sticking when the incident molecule is vibrationally excited, and both can reproduce the mode specificity observed in experiments. However, the quasi-classical calculations significantly overestimate the ground state dissociative sticking at all energies, and the magnitude of the enhancement in sticking with vibrationalmore » excitation is much smaller than that computed using the quantum approach or observed in the experiments. The origin of this behavior is an unphysical flow of zero point energy from the nine normal vibrational modes into the reaction coordinate, giving large values for reaction at energies below the activation energy. Perturbative assumptions made in the quantum studies are shown to be accurate at all energies studied.« less

  2. Shape-dependence of the thermal and photochemical reactions of methanol on nanocrystalline anatase TiO2

    NASA Astrophysics Data System (ADS)

    Bennett, David A.; Cargnello, Matteo; Diroll, Benjamin T.; Murray, Christopher B.; Vohs, John M.

    2016-12-01

    Structure-activity relationships and the influence of particle size and shape on the partial- and photo-oxidation of methanol on nanocrystalline anatase TiO2 were investigated using temperature-programmed desorption. The study employed two distinct nanoparticle morphologies: truncated bipyramids exposing primarily {101} facets, and flatter platelets exposing primarily {001} surfaces, whose nominal sizes ranged from 10 to 25 nm. The platelets were found to be more active for thermally-driven reactions, such as coupling of methoxide groups to produce dimethyl ether, and deoxygenation to produce methane. A dependence of the reactivity of {001} facets for the coupling of methoxide groups to produce dimethyl ether on facet size was also observed. In contrast to the thermally-driven reactions, the bipyramidal nanoparticles were observed to be more active for a range of photochemical reactions, including oxidation and coupling to produce methyl formate, and photo-decomposition of surface methoxide species. This study also shows how well-defined nanocrystals can be used to help bridge the materials gap between studies of single crystal model catalysts and their high surface area industrial analogs.

  3. Emotional Reactions Mediate the Effect of Music Listening on Creative Thinking: Perspective of the Arousal-and-Mood Hypothesis.

    PubMed

    He, Wu-Jing; Wong, Wan-Chi; Hui, Anna N-N

    2017-01-01

    This study examined the effect of music listening on creative thinking through the lens of the arousal-and-mood hypothesis, which posits that emotional reactions (i.e., arousal and valence) mediate the effect of music listening on cognitive functioning. Participants were randomly assigned to three groups: a positive music group ( n = 198), a negative music group ( n = 195), and a control group ( n = 191). Creative thinking and emotional reactions were assessed with the Test for Creative Thinking-Drawing Production and the Affect Grid, respectively. The results showed that both positively and negatively arousing music enhanced creative thinking. The results further revealed that arousal, regardless of valence, significantly mediated the music-creativity relationship. This study enriches the research on the arousal-and-mood hypothesis by (1) providing direct empirical testing on the mediating roles of emotional reactions; (2) including both positively and negatively arousing music in the study design; and (3) identifying that only arousal, and not valence, was a significant mediator in the music-creativity link.

  4. Emotional Reactions Mediate the Effect of Music Listening on Creative Thinking: Perspective of the Arousal-and-Mood Hypothesis

    PubMed Central

    He, Wu-Jing; Wong, Wan-Chi; Hui, Anna N.-N.

    2017-01-01

    This study examined the effect of music listening on creative thinking through the lens of the arousal-and-mood hypothesis, which posits that emotional reactions (i.e., arousal and valence) mediate the effect of music listening on cognitive functioning. Participants were randomly assigned to three groups: a positive music group (n = 198), a negative music group (n = 195), and a control group (n = 191). Creative thinking and emotional reactions were assessed with the Test for Creative Thinking-Drawing Production and the Affect Grid, respectively. The results showed that both positively and negatively arousing music enhanced creative thinking. The results further revealed that arousal, regardless of valence, significantly mediated the music-creativity relationship. This study enriches the research on the arousal-and-mood hypothesis by (1) providing direct empirical testing on the mediating roles of emotional reactions; (2) including both positively and negatively arousing music in the study design; and (3) identifying that only arousal, and not valence, was a significant mediator in the music-creativity link. PMID:29018395

  5. Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

    PubMed

    Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

    2017-04-01

    The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

  6. Kinetic Model for the Radical Degradation of Tri-Halonitromethane Disinfection Byproducts in Water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stephen P. Mezyk; Bruce J. Mincher; William J. Cooper

    The halonitromethanes (HNMs) are byproducts of the ozonation and chlorine/chloramine treatment of drinking waters. Although typically occurring at low concentrations HNMs have high cytotoxicity and mutagenicity, and may therefore represent a significant human health hazard. In this study, we have investigated the radical based mineralization of fully-halogenated HNMs in water using the congeners bromodichloronitromethane and chlorodibromonitromethane. We have combined absolute reaction rate constants for their reactions with the hydroxyl radical and the hydrated electron as measured by electron pulse radiolysis and analytical measurements of stable product concentrations obtained by 60Co steady-state radiolysis with a kinetic computer model that includes watermore » radiolysis reactions and halide/nitrogen oxide radical chemistry to fully elucidate the reaction pathways of these HNMs. These results are compared to our previous similar study of the fully chlorinated HNM chloropicrin. The full optimized computer model, suitable for predicting the behavior of this class of compounds in irradiated drinking water is provided.« less

  7. Reactivity of amino acid anions with nitrogen and oxygen atoms.

    PubMed

    Wang, Zhe-Chen; Li, Ya-Ke; He, Sheng-Gui; Bierbaum, Veronica M

    2018-02-14

    For many decades, astronomers have searched for biological molecules, including amino acids, in the interstellar medium; this endeavor is important for investigating the hypothesis of the origin of life from space. The space environment is complex and atomic species, such as nitrogen and oxygen atoms, are widely distributed. In this work, the reactions of eight typical deprotonated amino acids (glycine, alanine, cysteine, proline, aspartic acid, histidine, tyrosine, and tryptophan) with ground state nitrogen and oxygen atoms are studied by experiment and theory. These amino acid anions do not react with nitrogen atoms. However, the reactions of these ions with oxygen atoms show an intriguing variety of ionic products and the reaction rate constants are of the order of 10 -10 cm 3 s -1 . Density functional calculations provide detailed mechanisms of the reactions, and demonstrate that spin conversion is essential for some processes. Our study provides important data and insights for understanding the kinetic and dynamic behavior of amino acids in space environments.

  8. Spallation reaction study for the long-lived fission product 107Pd

    NASA Astrophysics Data System (ADS)

    Wang, He; Otsu, Hideaki; Sakurai, Hiroyoshi; Ahn, DeukSoon; Aikawa, Masayuki; Ando, Takashi; Araki, Shouhei; Chen, Sidong; Nobuyuki, Chiga; Doornenbal, Pieter; Fukuda, Naoki; Isobe, Tadaaki; Kawakami, Shunsuke; Kawase, Shoichiro; Kin, Tadahiro; Kondo, Yosuke; Koyama, Shunpei; Kubono, Shigeru; Maeda, Yukie; Makinaga, Ayano; Matsushita, Masafumi; Matsuzaki, Teiichiro; Michimasa, Shin'ichiro; Momiyama, Satoru; Nagamine, Shunsuke; Nakamura, Takashi; Nakano, Keita; Niikura, Megumi; Ozaki, Tomoyuki; Saito, Atsumi; Saito, Takeshi; Shiga, Yoshiaki; Shikata, Mizuki; Shimizu, Yohei; Shimoura, Susumu; Sumikama, Toshiyuki; Söderström, Pär-Anders; Suzuki, Hiroshi; Takeda, Hiroyuki; Takeuchi, Satoshi; Taniuchi, Ryo; Togano, Yasuhiro; Tsubota, Junichi; Uesaka, Meiko; Watanabe, Yasushi; Watanabe, Yukinobu; Wimmer, Kathrin; Yamamoto, Tatsuya; Yoshida, Koichi

    2017-02-01

    Spallation reactions for the long-lived fission product 107Pd have been studied for the purpose of nuclear waste transmutation. The cross sections on the proton- and deuteron-induced spallation were obtained at 196 and 118 MeV/nucleon in inverse kinematics at the RIKEN Radioactive Isotope Beam Factory. Both the target and energy dependences of cross sections have been investigated systematically. It was found that the proton-induced cross sections at 196 MeV/nucleon are close to those for deuteron obtained at 118 MeV/nucleon for the light-mass products. The experimental data are compared with the SPACS semi-empirical parameterization and the PHITS calculations including both the intranuclear cascade and evaporation processes. Our data give a design goal of proton/deuteron flux for the transmutation of 107Pd using the spallation reaction. In addition, it is found that the spallation reaction at 118 MeV/nucleon may have an advantage over the 107Pd transmutation because of the low production of other long-lived radioactive isotopes.

  9. Oxidation of aniline aerofloat in flotation wastewater by sodium hypochlorite solution.

    PubMed

    Lin, Weixiong; Tian, Jing; Ren, Jie; Xu, Pingting; Dai, Yongkang; Sun, Shuiyu; Wu, Chun

    2016-01-01

    Aniline aerofloat (dianilinodithiophosphoric acid (C6H5NH)2PSSH) is a widely used phosphorodithioic organic flotation collector that contains aniline groups and dithiophosphate groups. In the present study, sodium hypochlorite solution was used to oxidize aniline aerofloat. The effect of operational parameters and optimum oxidation conditions on aniline aerofloat was studied, and the oxidation pathway of aniline aerofloat was proposed by analyzing its main oxidation intermediates. The results showed that NaOCl concentration had a significant influence on aniline aerofloat oxidation and at 100 mg/L aniline aerofloat, 84.54% was removed under the following optimal conditions: NaOCl concentration = 1.25 g/L, pH = 4, and reaction time = 60 min. The main reaction of aniline aerofloat by NaOCl included N-P bond cleavage, aniline group oxidation, aniline group chlorination, and dithiophosphate group oxidation. The initial reaction was the N-P bond cleavage and the anilines and dithiophosphate was further oxidized to other intermediates by five parallel reaction pathways.

  10. Challenges in modelling homogeneous catalysis: new answers from ab initio molecular dynamics to the controversy over the Wacker process.

    PubMed

    Stirling, András; Nair, Nisanth N; Lledós, Agustí; Ujaque, Gregori

    2014-07-21

    We present here a review of the mechanistic studies of the Wacker process stressing the long controversy about the key reaction steps. We give an overview of the previous experimental and theoretical studies on the topic. Then we describe the importance of the most recent Ab Initio Molecular Dynamics (AIMD) calculations in modelling organometallic reactivity in water. As a prototypical example of homogeneous catalytic reactions, the Wacker process poses serious challenges to modelling. The adequate description of the multiple role of the water solvent is very difficult by using static quantum chemical approaches including cluster and continuum solvent models. In contrast, such reaction systems are suitable for AIMD, and by combining with rare event sampling techniques, the method provides reaction mechanisms and the corresponding free energy profiles. The review also highlights how AIMD has helped to obtain a novel understanding of the mechanism and kinetics of the Wacker process.

  11. Patterns and Oscillations in Reaction-Diffusion Systems with Intrinsic Fluctuations

    NASA Astrophysics Data System (ADS)

    Giver, Michael; Goldstein, Daniel; Chakraborty, Bulbul

    2013-03-01

    Intrinsic or demographic noise has been shown to play an important role in the dynamics of a variety of systems including predator-prey populations, biochemical reactions within cells, and oscillatory chemical reaction systems, and is known to give rise to oscillations and pattern formation well outside the parameter range predicted by standard mean-field analysis. Initially motivated by an experimental model of cells and tissues where the cells are represented by chemical reagents isolated in emulsion droplets, we study the stochastic Brusselator, a simple activator-inhibitor chemical reaction model. Our work extends the results of recent studies on the zero and one dimensional systems with the ultimate goals of understanding the role of noise in spatially structured systems and engineering novel patterns and attractors induced by fluctuations. In the zero dimensional system, we observe a noise induced switching between small and large amplitude oscillations when a separation of time scales is present, while the spatially extended system displays a similar switching between a stationary Turing pattern and uniform oscillations.

  12. Stereospecific nickel-catalyzed cross-coupling reactions of benzylic ethers and esters.

    PubMed

    Tollefson, Emily J; Hanna, Luke E; Jarvo, Elizabeth R

    2015-08-18

    This Account presents the development of a suite of stereospecific alkyl-alkyl cross-coupling reactions employing nickel catalysts. Our reactions complement related nickel-catalyzed stereoconvergent cross-coupling reactions from a stereochemical and mechanistic perspective. Most reactions of alkyl electrophiles with low-valent nickel complexes proceed through alkyl radicals and thus are stereoablative; the correct enantioselective catalyst can favor the formation of one enantiomer. Our reactions, in contrast, are stereospecific. Enantioenriched ethers and esters are cleanly converted to cross-coupled products with high stereochemical fidelity. While mechanistic details are still to be refined, our results are consistent with a polar, two-electron oxidative addition that avoids the formation of radical intermediates. This reactivity is unusual for a first-row transition metal. The cross-coupling reactions engage a range of benzylic ethers and esters, including methyl ethers, tetrahydropyrans, tetrahydrofurans, esters, and lactones. Coordination of the arene substituent to the nickel catalyst accelerates the reactions. Arenes with low aromatic stabilization energies, such as naphthalene, benzothiophene, and furan, serve as the best ligands and provide the highest reactivity. Traceless directing groups that accelerate reactions of sluggish substrates are described, providing partial compensation for arene coordination. Kumada, Negishi, and Suzuki reactions provide incorporation of a broad range of transmetalating agents. In Kumada coupling reactions, a full complement of Grigard reagents, including methyl, n-alkyl, and aryl Grignard reagents, are employed. In reactions employing methylmagnesium iodide, ligation of the nickel catalyst by rac-BINAP or DPEphos provides the highest yield and stereospecificity. For all other Grignard reagents, Ni(dppe)Cl2 has emerged as the best catalyst. Negishi cross-coupling reactions employing dimethylzinc are reported as a strategy to increase the functional group tolerance of the reaction. We also describe Suzuki reactions using arylboronic esters. These reactions provided the first example in the series of a switch in stereochemical outcome. The reactions maintain stereospecificity, but reactions employing different achiral ligands provide opposite enantiomers of the product. Use of an N-heterocyclic carbene ligand, SIMes, provides inversion, consistent with our prior work in Kumada and Negishi coupling reactions. Use of the electron-rich phosphine PCy3, however, provides retention with stereospecificity, signaling a change in the mechanistic details. Potential applications of the reported cross-coupling reactions include the synthesis of medicinal agents containing the 2-arylalkane and 1,1-diarylalkane moieties, which are pharmacophores in medicinal chemistry. These moieties are found in compounds with activity against a broad range of indications, including cancer, heart disease, diabetes, osteoporosis, smallpox, tuberculosis, and insomnia. We highlight representative examples of bioactive compounds that we have prepared with high enantioselectivity employing our methods, as well as the discovery of a new anti-cancer agent.

  13. Experience with Subgam, a Subcutaneously Administered Human Normal Immunoglobulin (ClinicalTrials.gov--NCT02247141).

    PubMed

    Dash, Clive; Gascoigne, Ernie; Gillanders, Kate; Gooi, Hock

    2015-01-01

    A multi-centre, non-comparative study examining the efficacy and safety of Subgam, a normal immunoglobulin (IgG) given weekly as a rapid subcutaneous infusion to patients with primary immune deficiency (PID), is reported. Also included is a summary of adverse drug reactions associated with the use of marketed Subgam in the UK. 50 patients with stable PID on IgG therapy were enrolled: Stage 1 included three infusions with prior IgG product followed by 6 months with Subgam, Stage 2 involved long-term Subgam therapy up to 4 years. Stage 1, 85% of the subjects aged >12 years and 93% of the subjects aged <12 years achieved IgG levels ≥6 and ≥4 g/L, respectively at all observations. There were 3.62 infections/patient/year during Subgam treatment. The most common product-related events were infusion site reactions (50% of patients). Recent post-hoc pharmacokinetics analysis of the post-infusion serum total IgG concentration indicated that the mean dose-normalised incremental IgG AUCτ following intravenous dosing (120.5 g.day/L) was 1.64-fold that of the dose-normalised mean incremental IgG AUCτ following subcutaneous dosing (73.6 g.day/L), corresponding to an estimated IgG bioavailability for subcutaneous dosing of 61%. Only 34 post-licensing adverse reactions have been received in 30 patients over a period of 10 years; fourteen were classed as serious as defined by the ICH guidelines on good clinical practice. The most common post-licensing adverse reaction was infusion site reaction (7 reports). There were 7 reports of flu-like symptoms (pyrexia/shivering/rigors/feeling hot or cold), 2 other reports of combined flu-like symptoms and infusion site reactions, 5 reports of generalised skin reactions, and 3 reports of combined infusion site and skin reactions. There were also reports of anaphylaxis (2 reports) and 8 other adverse events (including headache). In conclusion, Subgam is effective and well tolerated in the treatment of PID. ClinicalTrials.gov NCT02247141.

  14. Comprehensive Genetic Analysis of Early Host Body Reactions to the Bioactive and Bio-Inert Porous Scaffolds

    PubMed Central

    Ehashi, Tomo; Takemura, Taro; Hanagata, Nobutaka; Minowa, Takashi; Kobayashi, Hisatoshi; Ishihara, Kazuhiko; Yamaoka, Tetsuji

    2014-01-01

    To design scaffolds for tissue regeneration, details of the host body reaction to the scaffolds must be studied. Host body reactions have been investigated mainly by immunohistological observations for a long time. Despite of recent dramatic development in genetic analysis technologies, genetically comprehensive changes in host body reactions are hardly studied. There is no information about host body reactions that can predict successful tissue regeneration in the future. In the present study, porous polyethylene scaffolds were coated with bioactive collagen or bio-inert poly(2-methacryloyloxyethyl phosphorylcholine-co-n-butyl methacrylate) (PMB) and were implanted subcutaneously and compared the host body reaction to those substrates by normalizing the result using control non-coat polyethylene scaffold. The comprehensive analyses of early host body reactions to the scaffolds were carried out using a DNA microarray assay. Within numerous genes which were expressed differently among these scaffolds, particular genes related to inflammation, wound healing, and angiogenesis were focused upon. Interleukin (IL)-1β and IL-10 are important cytokines in tissue responses to biomaterials because IL-1β promotes both inflammation and wound healing and IL-10 suppresses both of them. IL-1β was up-regulated in the collagen-coated scaffold. Collagen-specifically up-regulated genes contained both M1- and M2-macrophage-related genes. Marked vessel formation in the collagen-coated scaffold was occurred in accordance with the up-regulation of many angiogenesis-inducible factors. The DNA microarray assay provided global information regarding the host body reaction. Interestingly, several up-regulated genes were detected even on the very bio-inert PMB-coated surfaces and those genes include inflammation-suppressive and wound healing-suppressive IL-10, suggesting that not only active tissue response but also the inert response may relates to these genetic regulations. PMID:24454803

  15. Reaction Kinetics of Hydrogen Atom Abstraction from C4-C6 Alkenes by the Hydrogen Atom and Methyl Radical.

    PubMed

    Wang, Quan-De; Liu, Zi-Wu

    2018-06-14

    Alkenes are important ingredients of realistic fuels and are also critical intermediates during the combustion of a series of other fuels including alkanes, cycloalkanes, and biofuels. To provide insights into the combustion behavior of alkenes, detailed quantum chemical studies for crucial reactions are desired. Hydrogen abstractions of alkenes play a very important role in determining the reactivity of fuel molecules. This work is motivated by previous experimental and modeling evidence that current literature rate coefficients for the abstraction reactions of alkenes are still in need of refinement and/or redetermination. In light of this, this work reports a theoretical and kinetic study of hydrogen atom abstraction reactions from C4-C6 alkenes by the hydrogen (H) atom and methyl (CH 3 ) radical. A series of C4-C6 alkene molecules with enough structural diversity are taken into consideration. Geometry and vibrational properties are determined at the B3LYP/6-31G(2df,p) level implemented in the Gaussian-4 (G4) composite method. The G4 level of theory is used to calculate the electronic single point energies for all species to determine the energy barriers. Conventional transition state theory with Eckart tunneling corrections is used to determine the high-pressure-limit rate constants for 47 elementary reaction rate coefficients. To faciliate their applications in kinetic modeling, the obtained rate constants are given in the Arrhenius expression and rate coefficients for typical reaction classes are recommended. The overall rate coefficients for the reaction of H atom and CH 3 radical with all the studied alkenes are also compared. Branching ratios of these reaction channels for certain alkenes have also been analyzed.

  16. Accurate Quantum Wave Packet Study of the Deep Well D+ + HD Reaction: Product Ro-vibrational State-Resolved Integral and Differential Cross Sections.

    PubMed

    He, Haixiang; Zhu, Weimin; Su, Wenli; Dong, Lihui; Li, Bin

    2018-03-08

    The H + + H 2 reaction and its isotopic variants as the simplest triatomic ion-molecule reactive system have been attracting much interests, however there are few studies on the titled reaction at state-to-state level until recent years. In this work, accurate state-to-state quantum dynamics studies of the titled reaction have been carried out by a reactant Jacobi coordinate-based time-dependent wave packet approach on diabatic potential energy surfaces constructed by Kamisaka et al. Product ro-vibrational state-resolved information has been calculated for collision energies up to 0.2 eV with maximal total angular momentum J = 40. The necessity of including all K-component for accounting the Coriolis coupling for the reaction has been illuminated. Competitions between the two product channels, (D + + HD' → D' + + HD and D + + HD' → H + + DD') were investigated. Total integral cross sections suggest that resonances enhance the reactivity of channel D + + HD'→ H + + DD', however, resonances depress the reactivity of the another channel D + + HD' → D' + + HD. The structures of the differential cross sections are complicated and depend strongly on collision energies of the two channels and also on the product rotational states. All of the product ro-vibrational state-resolved differential cross sections for this reaction do not exhibit rigorous backward-forward symmetry which may indicate that the lifetimes of the intermediate resonance complexes should not be that long. The dynamical observables of this deuterated isotopic reaction are quite different from the reaction of H + + H 2 → H 2 + H + reported previously.

  17. An Evaluation System for the Online Training Programs in Meteorology and Hydrology

    ERIC Educational Resources Information Center

    Wang, Yong; Zhi, Xiefei

    2009-01-01

    This paper studies the current evaluation system for the online training program in meteorology and hydrology. CIPP model that includes context evaluation, input evaluation, process evaluation and product evaluation differs from Kirkpatrick model including reactions evaluation, learning evaluation, transfer evaluation and results evaluation in…

  18. Lessons Learned from Our Elders: How to Study Polypharmacy in Populations with Intellectual and Developmental Disabilities

    ERIC Educational Resources Information Center

    Stortz, Jessica N.; Lake, Johanna K.; Cobigo, Virginie; Ouellette-Kuntz, Hélène M. J.; Lunsky, Yona

    2014-01-01

    "Polypharmacy" is the concurrent use of multiple medications, including both psychotropic and non-psychotropic drugs. Although it may sometimes be clinically indicated, polypharmacy can have a number of negative consequences, including medication nonadherence, adverse drug reactions, and undesirable drug--drug interactions. The objective…

  19. Mass Transfer with Chemical Reaction.

    ERIC Educational Resources Information Center

    DeCoursey, W. J.

    1987-01-01

    Describes the organization of a graduate course dealing with mass transfer, particularly as it relates to chemical reactions. Discusses the course outline, including mathematics models of mass transfer, enhancement of mass transfer rates by homogeneous chemical reaction, and gas-liquid systems with chemical reaction. (TW)

  20. Infrared Emission from Gas-Aerosol Reactions

    DTIC Science & Technology

    1982-09-01

    Gaseous Amonia Infrared (IR) "Gas-aerosol Reactions Sulfuric Acid- amonia IR Luminescence Exothermic Reactions Octanoic Acid- amonia IR Laser Acid-base...of radiation observed from the reactions of chloro- sulfuric acid aerosol with gaseous amonia and water. Other systems which were screened including

  1. Violent oxidation of lithium-containing aluminum alloys in liquid oxygen

    NASA Astrophysics Data System (ADS)

    Dalins, Ilmars; Karimi, Majid; Ila, Daryush

    1991-06-01

    A strong exothermic and quite well known thermite reaction involving aluminum, oxygen and transition metals (Fe, Cr, Ni, etc.) has apparently been initiated during impact testing of Alcoa aluminum alloy #2090 in liquid oxygen at NASA-MSFC. In some instances, this reaction, essentially an oxidation process, has been so intense that the Inconel 718 cup containing the aluminum alloy disk and associated impacter has melted raising certain safety concerns in the use of this alloy. Reaction products as well as the test specimen surfaces have been studied with surface science techniques like XPS/ESCA, SIMS and AES. Typically, in order to initiate the thermite reaction a temperature of approximately 1000°C is necessary. The mechanism responsible for this oxidation is of great interest. The analysis of the reaction products together with a theoretical analysis, including digital modeling has been pursued. There is strong evidence that the large relaxation energy of the aluminum oxide coating, formed during the aluminum alloy cleaning process, is causing a highly localized energy release during fracture or lattice deformation which is enhancing the oxidation process to a runaway condition. The presence of alkali atoms (Li) enhances the likelihood and intensity of the oxidation reaction. The details of the surface studies will be discussed.

  2. Mechanistic Studies of the Solvolyses of Carbamoyl Chlorides and Related Reactions

    PubMed Central

    D’Souza, Malcolm J.; Kevill, Dennis N.

    2016-01-01

    Carbamoyl chlorides are important intermediates, both in the research laboratory and in industrial scale syntheses. The most studied and used are the disubstituted derivatives, incorporating either aryl or alkyl groups (Ar2NCOCl or R2NCOCl). Sometimes, the groups are tied back to give a ring and piperidino- and morpholino-derivatives are commonly encountered. Some studies have been made with two different groups attached. Solvolyses tend to occur at the carbonyl carbon, with replacement of the chloride ion. Studies of both rate and products are reviewed and the solvolysis reactions are usually SN1, although addition of an amine leads to a superimposable bimolecular component. Many of the studies under solvolytic conditions include the application of the extended Grunwald–Winstein equation. The monosubstituted derivatives (ArNHCOCl or RNHCOCl) are less studied. They are readily prepared by the addition of HCl to an isocyanate. In acetonitrile, they decompose to set up and reach equilibrium with the isocyanate (ArNCO or RNCO) and HCl. Considering that the structurally related formyl chloride (HOCOCl) is highly unstable (with formation of HCl + CO2), the unsubstituted carbamoyl chloride (H2NCOCl) is remarkably stable. Recommended synthetic procedures require it to survive reaction temperatures in the 300–400 °C range. There has been very little study of its reactions. PMID:26784185

  3. Mechanistic Studies of the Solvolyses of Carbamoyl Chlorides and Related Reactions.

    PubMed

    D'Souza, Malcolm J; Kevill, Dennis N

    2016-01-15

    Carbamoyl chlorides are important intermediates, both in the research laboratory and in industrial scale syntheses. The most studied and used are the disubstituted derivatives, incorporating either aryl or alkyl groups (Ar2NCOCl or R2NCOCl). Sometimes, the groups are tied back to give a ring and piperidino- and morpholino-derivatives are commonly encountered. Some studies have been made with two different groups attached. Solvolyses tend to occur at the carbonyl carbon, with replacement of the chloride ion. Studies of both rate and products are reviewed and the solvolysis reactions are usually SN1, although addition of an amine leads to a superimposable bimolecular component. Many of the studies under solvolytic conditions include the application of the extended Grunwald-Winstein equation. The monosubstituted derivatives (ArNHCOCl or RNHCOCl) are less studied. They are readily prepared by the addition of HCl to an isocyanate. In acetonitrile, they decompose to set up and reach equilibrium with the isocyanate (ArNCO or RNCO) and HCl. Considering that the structurally related formyl chloride (HOCOCl) is highly unstable (with formation of HCl + CO2), the unsubstituted carbamoyl chloride (H2NCOCl) is remarkably stable. Recommended synthetic procedures require it to survive reaction temperatures in the 300-400 °C range. There has been very little study of its reactions.

  4. Vasovagal Rates in Flouroscopically Guided Interventional Procedures: A Study of Over 8,000 Injections

    PubMed Central

    Kennedy, David J.; Schneider, Byron; Casey, Ellen; Rittenberg, Joshua; Conrad, Bryan; Smuck, Matthew; Plastaras, Christopher T.

    2014-01-01

    Objective To determine the rate of vasovagal (vv) complications in fluoroscopically guided interventional procedures. Design Retrospective case series analysis of prospectively collected data from March 8, 2004 to January 30, 2009. Setting A single academic medical center. Subjects Four thousand one hundred eighty-three subjects undergoing 8,010 consecutive injections. Outcome Measures Pearson's chi-square test was used to determine the relationship between categorical variables. Results A total of 8,010 injections, including epidural steroid injections, radiofrequency nerve ablations, medial branch blocks, hip injections, knee injections, and glenohumeral injections were performed. Overall vv reaction rate was 2.6%, with 0.8% of procedures resulting in early terminated due to vv reaction. Peripheral joint injections had a vv rate of 0.2%, all occurring in hip injections. Transforaminal epidural steroid injections had a vv rate of 3.5%. Diagnostic blocks of the medial branches had the highest rate of vv (5.1%). Other predictors of vv reactions were identified including preprocedure pain score visual analog scale <5 (P = 0.004), male gender (P < 0.001), and age less than 65 years old (P < 0.001). Conclusions vv reactions have an overall low occurrence rate (2.6%) in interventional procedures ranging from 0% in peripheral knee and shoulder injections to 5.1% in medial branch blocks. Conservative treatment of vv reaction and willingness to terminate procedures resulted in no serious adverse events related to vv reaction in 8,010 procedures. PMID:24118835

  5. A multi-step reaction model for ignition of fully-dense Al-CuO nanocomposite powders

    NASA Astrophysics Data System (ADS)

    Stamatis, D.; Ermoline, A.; Dreizin, E. L.

    2012-12-01

    A multi-step reaction model is developed to describe heterogeneous processes occurring upon heating of an Al-CuO nanocomposite material prepared by arrested reactive milling. The reaction model couples a previously derived Cabrera-Mott oxidation mechanism describing initial, low temperature processes and an aluminium oxidation model including formation of different alumina polymorphs at increased film thicknesses and higher temperatures. The reaction model is tuned using traces measured by differential scanning calorimetry. Ignition is studied for thin powder layers and individual particles using respectively the heated filament (heating rates of 103-104 K s-1) and laser ignition (heating rate ∼106 K s-1) experiments. The developed heterogeneous reaction model predicts a sharp temperature increase, which can be associated with ignition when the laser power approaches the experimental ignition threshold. In experiments, particles ignited by the laser beam are observed to explode, indicating a substantial gas release accompanying ignition. For the heated filament experiments, the model predicts exothermic reactions at the temperatures, at which ignition is observed experimentally; however, strong thermal contact between the metal filament and powder prevents the model from predicting the thermal runaway. It is suggested that oxygen gas release from decomposing CuO, as observed from particles exploding upon ignition in the laser beam, disrupts the thermal contact of the powder and filament; this phenomenon must be included in the filament ignition model to enable prediction of the temperature runaway.

  6. Understanding the interplay of weak forces in [3,3]-sigmatropic rearrangement for stereospecific synthesis of diamines.

    PubMed

    So, Soon Mog; Mui, Leo; Kim, Hyunwoo; Chin, Jik

    2012-08-21

    Chiral diamines are important building blocks for constructing stereoselective catalysts, including transition metal based catalysts and organocatalysts that facilitate oxidation, reduction, hydrolysis, and C-C bond forming reactions. These molecules are also critical components in the synthesis of drugs, including antiviral agents such as Tamiflu and Relenza and anticancer agents such as oxaliplatin and nutlin-3. The diaza-Cope rearrangement reaction provides one of the most versatile methods for rapidly generating a wide variety of chiral diamines stereospecifically and under mild conditions. Weak forces such as hydrogen bonding, electronic, steric, oxyanionic, and conjugation effects can drive this equilibrium process to completion. In this Account, we examine the effect of these individual weak forces on the value of the equilibrium constant for the diaza-Cope rearrangement reaction using both computational and experimental methods. The availability of a wide variety of aldehydes and diamines allows for the facile synthesis of the diimines needed to study the weak forces. Furthermore, because the reaction generally takes place cleanly at ambient temperature, we can easily measure equilibrium constants for rearrangement of the diimines. We use the Hammett equation to further examine the electronic and oxyanionic effects. In addition, computations and experiments provide us with new insights into the origin and extent of stereospecificity for this rearrangement reaction. The diaza-Cope rearrangement, with its unusual interplay between weak forces and the equilibrium constant of the reaction, provides a rare opportunity to study the effects of the fundamental weak forces on a chemical reaction. Among these many weak forces that affect the diaza-Cope rearrangement, the anion effect is the strongest (10.9 kcal/mol) followed by the resonance-assisted hydrogen-bond effect (7.1 kcal/mol), the steric effect (5.7 kcal/mol), the conjugation effect (5.5 kcal/mol), and the electronic effect (3.2 kcal/mol). Based on both computation and experimental data, the effects of these weak forces are additive. Understanding the interplay of the weak forces in the [3,3]-sigmatropic reaction is interesting in its own right and also provides valuable insights for the synthesis of chiral diamine based drugs and catalysts in excellent yield and enantiopurity.

  7. A new compilation of experimental nuclear data for total reaction cross sections

    NASA Astrophysics Data System (ADS)

    Lantz, Mattias; Sihver, L.

    The nucleon-nucleus and nucleus-nucleus total reaction cross sections are of importance in many different fields, both for a better theoretical understanding as well as for a number of applications, including space radiation dosimetry. We have performed a comprehensive literature study in order to find all available experimental data on total reaction cross sections, σR , and interaction cross sections, σI , for neutrons, protons, and all stable and exotic heavy ions. Excluded from the data base are measurements where the cross sections have been derived through model-dependent calculations from other kinds of measurements. The objective of the study is to identify where more measurements are needed in view of different applications, and to make the data easily available for model developers and experimentalists. We will present some examples from the study, which is in the stage of quality control of all the gathered data.

  8. Theoretical research program to study chemical reactions in AOTV bow shock tubes

    NASA Technical Reports Server (NTRS)

    Taylor, Peter

    1992-01-01

    Effort continued through this period to refine and expand the SIRIUS/ABACUS program package for CASSCF and RASSCF second derivatives. A new approach to computing the Gaussian integral derivatives that require much of the time in gradient and Hessian calculations was devised. Several different studies were undertaken in the area of application calculations. These include a study of proton transfer in the HF trimer, which provides an analog of rearrangement reactions, and the extension of our previous work on Be and Mg clusters to Ca clusters. In addition, a very accurate investigation of the lowest-lying potential curves of the O2 molecule was completed. These curves are essential for evaluating different models of the terrestrial atmosphere nightglow. The most effort this year was devoted to a large scale investigation of stationary points on the C4H4 surface, and the thermochemistry of acetylene/acetylene reaction.

  9. Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in Werner Syndrome Cells.

    PubMed

    Bagley, Mark C; Baashen, Mohammed; Chuckowree, Irina; Dwyer, Jessica E; Kipling, David; Davis, Terence

    2015-06-03

    Microwave-assisted Suzuki-Miyaura cross-coupling reactions have been employed towards the synthesis of three different MAPKAPK2 (MK2) inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a 3-pyridinylboronic acid, the coupling of an aryl bromide with an indolylboronic acid and the reaction of a 3-amino-4-bromopyrazole with 4-carbamoylphenylboronic acid. In all of these processes, the Suzuki-Miyaura reaction was fast and relatively efficient using a palladium catalyst under microwave irradiation. The process was incorporated into a rapid 3-step microwave-assisted method for the synthesis of a MK2 inhibitor involving 3-aminopyrazole formation, pyrazole C-4 bromination using N-bromosuccinimide (NBS), and Suzuki-Miyaura cross-coupling of the pyrazolyl bromide with 4-carbamoylphenylboronic acid to give the target 4-arylpyrazole in 35% overall yield, suitable for study in WS cells.

  10. The Origins and Evolution of Molecules in Icy Solids

    NASA Technical Reports Server (NTRS)

    Hudson, Reggie L.; Moore, Marla H.

    2010-01-01

    Astronomical observations of the past few decades have revealed the existence of a variety of molecules in extraterrestrial ices. These molecules include H2O, CO, and CO2, and organics such as CH4, CH30H, and C2H6. Some ices are dominated by polar molecules, while non-polar species appear to dominate others. Observations, mainly in the radio and IR regions, have allowed the inference of other solid-phase molecules whose formation remains difficult to explain by gas-phase chemistry alone. Several laboratory research groups have reported on extensive experiments on the solid-phase reaction chemistry of icy materials, generally as initiated by either ionizing radiation or vacuum-UV photons. These experiments not only permit molecular identifications to be made from astronomical observations, but also allow predictions of yet unidentified molecules. This laboratory approach has evolved over more than 30 years with much of the earliest work focusing on complex mixtures thought to represent either cometary or interstellar ices. Although those early experiments documented a rich solid-state photo- and radiation chemistry, they revealed few details of reactions for particular molecules, partly due to the multi-component nature of the samples. Since then, model systems have been examined that allow the chemistry of individual species and specific reactions to be probed. Reactions involving most of the smaller astronomical molecules have now been studied and specific processes identified. Current laboratory work suggests that a variety of reactions occur in extraterrestrial ices, including acid-base processes, radical dimerizations, proton transfers, oxidations, reductions, and isomerizations. This workshop presentation will focus on chemical reactions relevant to solar system and interstellar ices. While most of the work will be drawn from that to which the speaker has contributed, results from other laboratories also will be included. Suggestions for future studies will be made, with an emphasis on some present deficiencies. The speaker's work has been generously supported by these NASA research programs: Cassini Data Analysis, Exobiology, Mars Fundamental Research, Outer Planets Research, Planetary Atmospheres, Planetary Geology and Geophysics, and the NASA Astrobiology Institute.

  11. High-dose chlorogenic acid induces inflammation reactions and oxidative stress injury in rats without implication of mast cell degranulation.

    PubMed

    Du, Wen-Yuan; Chang, Cheng; Zhang, Yu; Liu, Yu-Ying; Sun, Kai; Wang, Chuan-She; Wang, Ming-Xia; Liu, Yuan; Wang, Fu; Fan, Jing-Yu; Li, Peng-Tao; Han, Jing-Yan

    2013-05-02

    Chlorogenic acid (CA) exits widely in those Chinese herbal injections that have antibacterial and antiphlogistic effects and belongs to the ethnopharmacological family of medicines. Chinese herbal injections containing high levels of CA have been reported to increase the adverse drug reactions, but the mechanism for which is still unclear. In this study, we investigated the mechanism of the CA derived adverse drug reactions. The present study was to explore the potential role of CA in initiating inflammatory reaction and the underlying mechanism. Male Wistar rats were treated with different dosages of CA for different time period. The variables examined included microcirculation by intravital microscopy, histology of ileum tissue, expression of adhesion molecules CD11b and CD18 on leukocytes by flow cytometry, myeloperoxidase activity and maleic dialdehyde content in ileum tissue by spectrophotometry, activity of superoxide dismutase and catalase in serum by ELISA, and expression of NADPH oxidase subunits by PCR and Western blot. High-dose CA increased the number of adherent leukocytes, generation of peroxides in the venular walls and induced albumin leakage from mesentery venules. High-dose CA induced changes also included an increase in maleic dialdehyde, myeloperoxidase, inflammatory cytokines and NADPH oxidase activities, and a decline in activity of superoxide dismutase and catalase. High-dose, but not Low-dose CA induced inflammation reaction, and in this process an imbalance between oxidant and antioxidant mechanism may be involved, providing more information for better understanding the rationale behind the adverse effects of CA. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. “How Did You Feel?”: Increasing Child Sexual Abuse Witnesses’ Production of Evaluative Information

    PubMed Central

    Lyon, Thomas D.; Scurich, Nicholas; Choi, Karen; Handmaker, Sally; Blank, Rebecca

    2014-01-01

    In child sexual abuse cases, the victim’s testimony is essential, because the victim and the perpetrator tend to be the only eyewitnesses to the crime. A potentially important component of an abuse report is the child’s subjective reactions to the abuse. Attorneys may ask suggestive questions or avoid questioning children about their reactions, assuming that children, given their immaturity and reluctance, are incapable of articulation. We hypothesized that How questions referencing reactions to abuse (e.g., “how did you feel”) would increase the productivity of children’s descriptions of abuse reactions. Two studies compared the extent to which children provided evaluative content, defined as descriptions of emotional, cognitive, and physical reactions, in response to different question-types, including How questions, Wh-questions, Option-posing questions (yes–no or forced-choice), and Suggestive questions. The first study examined children’s testimony (ages 5–18) in 80 felony child sexual abuse cases. How questions were more productive yet the least prevalent, and Option-posing and Suggestive questions were less productive but the most common. The second study examined interview transcripts of 61 children (ages 6 –12) suspected of being abused, in which children were systematically asked How questions regarding their reactions to abuse, thus controlling for the possibility that in the first study, attorneys selectively asked How questions of more articulate children. Again, How questions were most productive in eliciting evaluative content. The results suggest that interviewers and attorneys interested in eliciting evaluative reactions should ask children “how did you feel?” rather than more direct or suggestive questions. PMID:22309936

  13. Effect of prosthetic alignment changes on socket reaction moment impulse during walking in transtibial amputees.

    PubMed

    Kobayashi, Toshiki; Orendurff, Michael S; Arabian, Adam K; Rosenbaum-Chou, Teri G; Boone, David A

    2014-04-11

    The alignment of a lower limb prosthesis affects the way load is transferred to the residual limb through the socket, and this load is critically important for the comfort and function of the prosthesis. Both magnitude and duration of the moment are important factors that may affect the residual limb health. Moment impulse is a well-accepted measurement that incorporates both factors via moment-time integrals. The aim of this study was to investigate the effect of alignment changes on the socket reaction moment impulse in transtibial prostheses. Ten amputees with transtibial prostheses participated in this study. The socket reaction moment impulse was measured at a self-selected walking speed using a Smart Pyramid in 25 alignment conditions, including a nominal alignment (clinically aligned by a prosthetist), as well as angle malalignments of 2°, 4° and 6° (abduction, adduction, extension and flexion) and translation malalignments of 5 mm, 10 mm and 15 mm (lateral, medial, anterior and posterior). The socket reaction moment impulse of the nominal alignment was compared for each condition. The relationship between the alignment and the socket reaction moment impulse was clearly observed in the coronal angle, coronal translation and sagittal translation alignment changes. However, this relationship was not evident in the sagittal angle alignment changes. The results of this study suggested that the socket reaction moment impulse could potentially serve as a valuable parameter to assist the alignment tuning process for transtibial prostheses. Further study is needed to investigate the influence of the socket reaction moment impulse on the residual limb health. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Thermophysicochemical Reaction of ZrCo-Hydrogen-Helium System

    NASA Astrophysics Data System (ADS)

    Jung, Kwangjin; Kang, Hee-Seok; Yun, Sei-Hun; Chung, Hongsuk

    2017-11-01

    Nuclear fusion energy, which is clean and infinite, has been studied for more than half a century. Efforts are in progress worldwide for the demonstration and validation of nuclear fusion energy. Korea has been developing hydrogen isotope storage and delivery system (SDS) technologies including a basic scientific study on a hydrogen storage medium. An SDS bed, which is a key component of the SDS, is used for storing hydrogen isotopes in a metal hydride form and supplying them to a tokamak. Thermophysicochemical properties of the ZrCo-H2-He system are investigated for the practical utilization of a hydriding alloy system. The hydriding reaction, in which ZrCoHx is composed as ZrCo absorbing hydrogen, is exothermic. The dehydriding reaction, in which ZrCoHx decomposes into ZrCo and hydrogen, is endothermic. The heat generated through the hydriding reaction interrupts the hydriding progress. The heat loss by a dehydriding reaction impedes the dehydriding progress. The tritium decay product, helium-3, covers the ZrCo and keeps the hydrogen from contact with ZrCo in the SDS bed. In this study, we designed and fabricated a ZrCo bed and its performance test rig. The helium blanketing effect on a ZrCo hydrogen reaction with 0 % to 20 % helium content in a gaseous phase and a helium blanket removal method were studied experimentally. In addition, the volumetric flow rates and temperature at the beginning of a ZrCo hydrogen reaction in a hydrogen or helium atmosphere, and the cooling of the SDS bed by radiation only and by both radiation and natural convection related to the reuse cycle, were obtained.

  15. Theoretical Studies in Chemical Kinetics - Annual Report, 1970.

    DOE R&D Accomplishments Database

    Karplus, Martin

    1970-10-01

    The research performed includes (a) Alkali-Halide, Alkali-Halide (MX, M?X?) Exchange Reactions; (b) Inversion Problem; (c) Quantum Mechanics of Scattering Processes, (d) Transition State Analysis of Classical Trajectories, (e) Differential Cross Sections from Classical Trajectories; and (f) Other Studies.

  16. Synthesis of alkyl- and aryl-amino-substituted anthraquinone derivatives by microwave-assisted copper(0)-catalyzed Ullmann coupling reactions.

    PubMed

    Baqi, Younis; Müller, Christa E

    2010-05-01

    This protocol describes the efficient, generally applicable Ullmann coupling reaction of bromaminic acid with alkyl- or aryl-amines in phosphate buffer under microwave irradiation using elemental copper as a catalyst. The reaction leads to a number of biologically active compounds. As a prototypical example, the synthesis of a new, potent antagonist of human platelet P2Y(12) receptors, which has potential as an antithrombotic drug, is described in detail. The optimized protocol includes a description of an appropriate reaction setup, thin layer chromatography for monitoring the reaction and a procedure for the isolation, purification and characterization of the anticipated product. The reaction is performed without the use of a glove box and there is no requirement for an inert atmosphere. The reaction typically proceeds within 2-30 min, the protocol, including workup, generally takes 1-3 h to complete.

  17. Operando MAS NMR Reaction Studies at High Temperatures and Pressures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walter, Eric D.; Qi, Long; Chamas, Ali

    Operando MAS-NMR studies provide unique insights into the details of chemical reactions; comprehensive information about temperature- and time-dependent changes in chemical species is accompanied by similarly rich information about changes in phase and chemical environment. Here we describe a new MAS-NMR rotor (the WHiMS rotor) capable of achieving internal pressures up to 400 bar at 20 °C or 225 bar at 250 °C, a range which includes many reactions of interest. The MAS-NMR spectroscopy enabled by these rotors is ideal for studying the behavior of mixed-phase systems, such as reactions involving solid catalysts and volatile liquids, with the potential tomore » add gases at high pressure. The versatile operation of the new rotors is demonstrated by collecting operando 1H and 13C spectra during the hydrogenolysis of benzyl phenyl ether, catalyzed by Ni/-Al2O3 at ca. 250 ºC, both with and without H2 (g) supplied to the rotor. The 2-propanol solvent, which exists in the supercritical phase under these reaction conditions, serves as an internal source of H2. The NMR spectra provide detailed kinetic profiles for the formation of the primary products toluene and phenol, as well as secondary hydrogenation and etherification products.« less

  18. Development of a simple analytical methodology for determination of glucosamine release from modified release matrix tablets.

    PubMed

    Wu, Yunqi; Hussain, Munir; Fassihi, Reza

    2005-06-15

    A simple spectrophotometric method for determination of glucosamine release from sustained release (SR) hydrophilic matrix tablet based on reaction with ninhydrin is developed, optimized and validated. The purple color (Ruhemann purple) resulted from the reaction was stabilized and measured at 570 nm. The method optimization was essential as many procedural parameters influenced the accuracy of determination including the ninhydrin concentration, reaction time, pH, reaction temperature, purple color stability period, and glucosamine/ninhydrin ratio. Glucosamine tablets (600 mg) with different hydrophilic polymers were formulated and manufactured on a rotary press. Dissolution studies were conducted (USP 26) using deionized water at 37+/-0.2 degrees C with paddle rotation of 50 rpm, and samples were removed manually at appropriate time intervals. Under given optimized reaction conditions that appeared to be critical, glucosamine was quantitatively analyzed and the calibration curve in the range of 0.202-2.020 mg (r=0.9999) was constructed. The recovery rate of the developed method was 97.8-101.7% (n=6). Reproducible dissolution profiles were achieved from the dissolution studies performed on different glucosamine tablets. The developed method is easy to use, accurate and highly cost-effective for routine studies relative to HPLC and other techniques.

  19. Ozone reaction with clothing and its initiated VOC emissions in an environmental chamber.

    PubMed

    Rai, A C; Guo, B; Lin, C-H; Zhang, J; Pei, J; Chen, Q

    2014-02-01

    Human health is adversely affected by ozone and the volatile organic compounds (VOCs) produced from its reactions in the indoor environment. Hence, it is important to characterize the ozone-initiated reactive chemistry under indoor conditions and study the influence of different factors on these reactions. This investigation studied the ozone reactions with clothing through a series of experiments conducted in an environmental chamber under various conditions. The study found that the ozone reactions with a soiled (human-worn) T-shirt consumed ozone and generated VOCs. The ozone removal rate and deposition velocity for the T-shirt increased with the increasing soiling level and air change rate, decreased at high ozone concentrations, and were relatively unaffected by the humidity. The deposition velocity for the soiled T-shirt ranged from 0.15 to 0.29 cm/s. The ozone-initiated VOC emissions included C6-C10 straight-chain saturated aldehydes, acetone, and 4-OPA (4-oxopentanal). The VOC emissions were generally higher at higher ozone, humidity, soiling of T-shirt, and air change rate. The total molar yield was approximately 0.5 in most cases, which means that for every two moles of ozone removed by the T-shirt surface, one mole of VOCs was produced. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Mapping students' ideas about chemical reactions at different educational levels

    NASA Astrophysics Data System (ADS)

    Yan, Fan

    Understanding chemical reactions is crucial in learning chemistry at all educational levels. Nevertheless, research in science education has revealed that many students struggle to understand chemical processes. Improving teaching and learning about chemical reactions demands that we develop a clearer understanding of student reasoning in this area and of how this reasoning evolves with training in the discipline. Thus, we have carried out a qualitative study using semi-structured interviews as the main data collection tool to explore students reasoning about reaction mechanism and causality. The participants of this study included students at different levels of training in chemistry: general chemistry students (n=22), organic chemistry students (n=16), first year graduate students (n=13) and Ph.D. candidates (n=14). We identified major conceptual modes along critical dimensions of analysis, and illustrated common ways of reasoning using typical cases. Main findings indicate that although significant progress is observed in student reasoning in some areas, major conceptual difficulties seem to persist even at the more advanced educational levels. In addition, our findings suggest that students struggle to integrate important concepts when thinking about mechanism and causality in chemical reactions. The results of our study are relevant to chemistry educators interested in learning progressions, assessment, and conceptual development.

  1. A systematic review of the clinical effectiveness and cost-effectiveness of Pharmalgen® for the treatment of bee and wasp venom allergy.

    PubMed

    Hockenhull, J; Elremeli, M; Cherry, M G; Mahon, J; Lai, M; Darroch, J; Oyee, J; Boland, A; Dickson, R; Dundar, Y; Boyle, R

    2012-01-01

    Each year in the UK, there are between two and nine deaths from anaphylaxis caused by bee and wasp venom. Anaphylactic reactions can occur rapidly following a sting and can progress to a life-threatening condition within minutes. To avoid further reactions in people with a history of anaphylaxis to bee and wasp venom, the use of desensitisation, through a process known as venom immunotherapy (VIT), has been investigated and is in use in the UK. VIT consists of subcutaneous injections of increasing amounts of purified bee and/or wasp venom extract. Pharmalgen® products (ALK Abelló) have had UK marketing authorisation for VIT (as well as diagnosis) of allergy to bee venom (using Pharmalgen Bee Venom) and wasp venom (using Pharmalgen Wasp Venom) since March 1995. This review assessed the clinical effectiveness and cost-effectiveness of Pharmalgen in providing immunotherapy to individuals with a history of type 1 [immunoglobulin E (IgE)-mediated] systemic allergic reaction to bee and wasp venom. A comprehensive search strategy using a combination of index terms (e.g. Pharmalgen) and free-text words (e.g. allerg$) was developed and used to interrogate the following electronic databases: EMBASE, MEDLINE, The Cochrane Library. Papers were included if they studied venom immunotherapy using Pharmalgen (PhVIT) in patients who had previously experienced a systemic reaction to a bee and/or a wasp sting. Comparators were any alternative treatment options available in the NHS without VIT. Included outcomes were systemic reactions, local reactions, mortality, anxiety related to the possibility of future allergic reactions, health-related quality of life (QoL) and adverse reactions (ARs) to treatment. Cost-effectiveness outcomes included cost per quality-adjusted life-years (QALYs) gained. Because of the small number of published randomised controlled trials (RCTs), no meta-analyses were conducted. A de novo economic model was developed to assess the cost-effectiveness of PhVIT plus high-dose antihistamine (HDA) plus adrenaline auto-injector (AAI) plus avoidance advice in relation to two comparators. A total of 1065 citations were identified, of which 266 full-text papers were obtained. No studies were identified that compared PhVIT with any of the outlined comparators. When these criteria were widened to include different protocols and types of PhVIT administration, four RCTs and five quasi-experimental studies were identified for inclusion. The quality of included studies was poor, and none was conducted in the UK. Eight studies reported re-sting data (systemic reactions ranged from 0.0% to 36.4%) and ARs (systemic reactions ranged from 0.0% to 38.1% and none was fatal). No included studies reported quality of life. No published economic evidence relevant to the decision problem was identified. The manufacturer of PhVIT did not submit any clinical effectiveness or cost-effectiveness evidence to the National Institute for Health and Clinical Excellence in support of PhVIT. The results of the Assessment Group's (AG) base-case analysis show that the comparison of PhVIT + HDA + AAI versus AAI + HDA yields an incremental cost-effectiveness ratio (ICER) of £18,065,527 per QALY gained; PhVIT + HDA + AAI versus avoidance advice only yields an ICER of £7,627,835 per QALY gained. The results of the sensitivity analyses and scenario analyses showed that the results of the base-case economic evaluation were robust for every plausible change in parameter made. The results of the 'High Risk of Sting Patients' subgroup analysis show that PhVIT + HDA + AAI dominates both AAI + HDA and avoidance advice only (i.e. is less expensive and more effective). The 'VIT Anxiety QoL Improvement' subgroup analysis shows that PhVIT + HDA + AAI versus HDA + AAI has an ICER of £23,868 per QALY gained, and PhVIT + HDA + AAI versus avoidance advice only yields an ICER of £25,661 per QALY gained. This review is limited to the use of Pharmalgen in the treatment of hymenoptera venom allergy and therefore does not assess the effectiveness of VIT in general. The current use of PhVIT in clinical practice in the NHS appears to be based on limited and poor-quality clinical effectiveness research. Available evidence indicates that sting reactions following the use of PhVIT are low and that the ARs related to treatment are minor and easily treatable. The results of the AG's de novo economic evaluation demonstrate that PhVIT + AAI + HDA compared with AAI + HDA and with avoidance advice only yields ICERs in the range of £8-20M per QALY gained. Two subgroups ('High Risk of Sting Patients' and 'VIT Anxiety QoL Improvement') were considered in the economic evaluation and the AG concludes that the use of PhVIT + AAI + HDA may be cost-effective in both groups. Future research should focus on clearly identifying groups of patients most likely to benefit from treatment and ensure that clinical practice is focussed on these groups. Furthermore, given the paucity of UK data in this area it would be informative if data could be collected routinely when VIT is administered in the NHS (e.g. rates of systemic adverse reactions to VIT, rates of systemic reactions to bee/wasp stings). The National Institute for Health Research Health Technology Assessment programme.

  2. Metal-air flow batteries using oxygen enriched electrolyte

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Jian-ping; Andrei, Petru; Shellikeri, Annadanesh

    A metal air flow battery includes an electrochemical reaction unit and an oxygen exchange unit. The electrochemical reaction unit includes an anode electrode, a cathode electrode, and an ionic conductive membrane between the anode and the cathode, an anode electrolyte, and a cathode electrolyte. The oxygen exchange unit contacts the cathode electrolyte with oxygen separate from the electrochemical reaction unit. At least one pump is provided for pumping cathode electrolyte between the electrochemical reaction unit and the oxygen exchange unit. A method for producing an electrical current is also disclosed.

  3. NEUTRONIC REACTION SYSTEM

    DOEpatents

    Wigner, E.P.

    1963-09-01

    A nuclear reactor system is described for breeding fissionable material, including a heat-exchange tank, a high- and a low-pressure chamber therein, heat- exchange tubes connecting these chambers, a solution of U/sup 233/ in heavy water in a reaction container within the tank, a slurry of thorium dioxide in heavy water in a second container surrounding the first container, an inlet conduit including a pump connecting the low pressure chamber to the reaction container, an outlet conduit connecting the high pressure chamber to the reaction container, and means of removing gaseous fission products released in both chambers. (AEC)

  4. Metal-air flow batteries using oxygen enriched electrolyte

    DOEpatents

    Zheng, Jian-ping; Andrei, Petru; Shellikeri, Annadanesh; Chen, Xujie

    2017-08-01

    A metal air flow battery includes an electrochemical reaction unit and an oxygen exchange unit. The electrochemical reaction unit includes an anode electrode, a cathode electrode, and an ionic conductive membrane between the anode and the cathode, an anode electrolyte, and a cathode electrolyte. The oxygen exchange unit contacts the cathode electrolyte with oxygen separate from the electrochemical reaction unit. At least one pump is provided for pumping cathode electrolyte between the electrochemical reaction unit and the oxygen exchange unit. A method for producing an electrical current is also disclosed.

  5. Contrasting effect of prepulse signals on performance of Toxoplasma-infected and Toxoplasma-free subjects in an acoustic reaction times test.

    PubMed

    Příplatová, Lenka; Sebánková, Blanka; Flegr, Jaroslav

    2014-01-01

    About 30% of people on Earth have latent toxoplasmosis. Infected subjects do not express any clinical symptoms, however, they carry dormant stages of parasite Toxoplasma for the rest of their life. This form of toxoplasmosis is mostly considered harmless, however, recent studies showed its specific effects on physiology, behaviour and its associations with various diseases, including psychiatric disorders such as schizophrenia. Individuals who suffer from schizophrenia have about 2.7 times higher prevalence of Toxoplasma-seropositivity than controls, which suggests that some traits characteristic of schizophrenic patients, including the sex difference in schizophrenia onset, decrease of grey matter density in specific brain areas and modification of prepulse inhibition of startle reaction could in fact be caused by toxoplasmosis for those patients who are Toxoplasma-seropositive. We measured the effect of prepulse inhibition/facilitation of the startle reaction on reaction times. The students, 170 women and 66 men, were asked to react as quickly as possible to a startling acoustic signal by pressing a computer mouse button. Some of the startling signals were without the prepulse, some were 20 msec. preceded by a short (20 msec.) prepulse signal of lower intensity. Toxoplasma-seropositive subjects had longer reaction times than the controls. Acoustic prepulse shorted the reaction times in all subjects. This effect of prepulse on reaction times was stronger in male subjects and increased with the duration of infection, suggesting that it represented a cumulative effect of latent toxoplasmosis, rather than a fading out after effect of past acute toxoplasmosis. Different sensitivity of Toxoplasma-seropositive and Toxoplasma-seronegative subjects on effect of prepulses on reaction times (the toxoplasmosis-prepulse interaction) suggested, but of course did not prove, that the alternations of prepulse inhibition of startle reaction observed in schizophrenia patients probably joined the list of schizophrenia symptoms that are in fact caused by latent toxoplasmosis.

  6. Adverse reactions to sulfites

    PubMed Central

    Yang, William H.; Purchase, Emerson C.R.

    1985-01-01

    Sulfites are widely used as preservatives in the food and pharmaceutical industries. In the United States more than 250 cases of sulfite-related adverse reactions, including anaphylactic shock, asthmatic attacks, urticaria and angioedema, nausea, abdominal pain and diarrhea, seizures and death, have been reported, including 6 deaths allegedly associated with restaurant food containing sulfites. In Canada 10 sulfite-related adverse reactions have been documented, and 1 death suspected to be sulfite-related has occurred. The exact mechanism of sulfite-induced reactions is unknown. Practising physicians should be aware of the clinical manifestations of sulfite-related adverse reactions as well as which foods and pharmaceuticals contain sulfites. Cases should be reported to health officials and proper advice given to the victims to prevent further exposure to sulfites. The food industry, including beer and wine manufacturers, and the pharmaceutical industry should consider using alternative preservatives. In the interim, they should list any sulfites in their products. PMID:4052897

  7. Anomalous diffusion with linear reaction dynamics: from continuous time random walks to fractional reaction-diffusion equations.

    PubMed

    Henry, B I; Langlands, T A M; Wearne, S L

    2006-09-01

    We have revisited the problem of anomalously diffusing species, modeled at the mesoscopic level using continuous time random walks, to include linear reaction dynamics. If a constant proportion of walkers are added or removed instantaneously at the start of each step then the long time asymptotic limit yields a fractional reaction-diffusion equation with a fractional order temporal derivative operating on both the standard diffusion term and a linear reaction kinetics term. If the walkers are added or removed at a constant per capita rate during the waiting time between steps then the long time asymptotic limit has a standard linear reaction kinetics term but a fractional order temporal derivative operating on a nonstandard diffusion term. Results from the above two models are compared with a phenomenological model with standard linear reaction kinetics and a fractional order temporal derivative operating on a standard diffusion term. We have also developed further extensions of the CTRW model to include more general reaction dynamics.

  8. Anaphylactoid reactions to the nonvascular administration of water-soluble iodinated contrast media.

    PubMed

    Davis, Peter L

    2015-06-01

    Anaphylactoidlike reactions occur during the nonvascular administration of iodinated contrast media. Many of these reactions have been severe. These reactions have occurred with many procedures, including gastrointestinal imaging, cystography, sialography, and hysterosalpingography. This article reviews reports of these reactions. It also reviews what the literature recommends concerning how to deal with individuals undergoing these procedures who are at a higher risk for anaphylactoidlike reactions.

  9. Supercritical water oxidation of products of human metabolism

    NASA Technical Reports Server (NTRS)

    Tester, Jefferson W.; Orge A. achelling, Richard K. ADTHOMASSON; Orge A. achelling, Richard K. ADTHOMASSON

    1986-01-01

    Although the efficient destruction of organic material was demonstrated in the supercritical water oxidation process, the reaction kinetics and mechanisms are unknown. The kinetics and mechanisms of carbon monoxide and ammonia oxidation in and reaction with supercritical water were studied experimentally. Experimental oxidation of urine and feces in a microprocessor controlled system was performed. A minaturized supercritical water oxidation process for space applications was design, including preliminary mass and energy balances, power, space and weight requirements.

  10. Combined Excitatory and Inhibitory Coupling in a 1-D Array of Belousov-Zhabotinsky Droplets

    DTIC Science & Technology

    2014-01-01

    with numerical chemical models of the BZ reaction in which components that participate in the excitatory (bromine dioxide and bromous acid) and...verify the transport through the fluorinated oil of chlorine dioxide and several weak acids, including malonic acid. 1. Introduction Recent studies1...finite element model (COMSOLs) of the reaction - diffusion equation in 1-D, 2-D and 3-D, where each drop is modeled as a point, disk or sphere

  11. A Mechanism-Based Model for the Prediction of the Metabolic Sites of Steroids Mediated by Cytochrome P450 3A4.

    PubMed

    Dai, Zi-Ru; Ai, Chun-Zhi; Ge, Guang-Bo; He, Yu-Qi; Wu, Jing-Jing; Wang, Jia-Yue; Man, Hui-Zi; Jia, Yan; Yang, Ling

    2015-06-30

    Early prediction of xenobiotic metabolism is essential for drug discovery and development. As the most important human drug-metabolizing enzyme, cytochrome P450 3A4 has a large active cavity and metabolizes a broad spectrum of substrates. The poor substrate specificity of CYP3A4 makes it a huge challenge to predict the metabolic site(s) on its substrates. This study aimed to develop a mechanism-based prediction model based on two key parameters, including the binding conformation and the reaction activity of ligands, which could reveal the process of real metabolic reaction(s) and the site(s) of modification. The newly established model was applied to predict the metabolic site(s) of steroids; a class of CYP3A4-preferred substrates. 38 steroids and 12 non-steroids were randomly divided into training and test sets. Two major metabolic reactions, including aliphatic hydroxylation and N-dealkylation, were involved in this study. At least one of the top three predicted metabolic sites was validated by the experimental data. The overall accuracy for the training and test were 82.14% and 86.36%, respectively. In summary, a mechanism-based prediction model was established for the first time, which could be used to predict the metabolic site(s) of CYP3A4 on steroids with high predictive accuracy.

  12. Faradaic reactions in capacitive deionization (CDI) - problems and possibilities: A review.

    PubMed

    Zhang, Changyong; He, Di; Ma, Jinxing; Tang, Wangwang; Waite, T David

    2018-01-01

    Capacitive deionization (CDI) is considered to be one of the most promising technologies for the desalination of brackish water with low to medium salinity. In practical applications, Faradaic redox reactions occurring in CDI may have both negative and positive effects on CDI performance. In this review, we present an overview of the types and mechanisms of Faradaic reactions in CDI systems including anodic oxidation of carbon electrodes, cathodic reduction of oxygen and Faradaic ion storage and identify their apparent negative and positive effects on water desalination. A variety of strategies including development of novel electrode materials and use of alternative configurations and/or operational modes are proposed for the purpose of mitigation or elimination of the deterioration of electrodes and the formation of byproducts caused by undesired side Faradaic reactions. It is also recognized that Faradaic reactions facilitate a variety of exciting new applications including i) the incorporation of intercalation electrodes to enhance water desalination or to selectively separate certain ions through reversible Faradaic reactions and ii) the use of particular anodic oxidation and cathodic reduction reactions to realize functions such as water disinfection and contaminant removal. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Reactor process using metal oxide ceramic membranes

    DOEpatents

    Anderson, Marc A.

    1994-01-01

    A reaction vessel for use in photoelectrochemical reactions includes as its reactive surface a metal oxide porous ceramic membrane of a catalytic metal such as titanium. The reaction vessel includes a light source and a counter electrode. A provision for applying an electrical bias between the membrane and the counter electrode permits the Fermi levels of potential reaction to be favored so that certain reactions may be favored in the vessel. The electrical biasing is also useful for the cleaning of the catalytic membrane. Also disclosed is a method regenerating a porous metal oxide ceramic membrane used in a photoelectrochemical catalytic process by periodically removing the reactants and regenerating the membrane using a variety of chemical, thermal, and electrical techniques.

  14. Seventh BES (Basic Energy Sciences) catalysis and surface chemistry research conference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1990-03-01

    Research programs on catalysis and surface chemistry are presented. A total of fifty-seven topics are included. Areas of research include heterogeneous catalysis; catalysis in hydrogenation, desulfurization, gasification, and redox reactions; studies of surface properties and surface active sites; catalyst supports; chemical activation, deactivation; selectivity, chemical preparation; molecular structure studies; sorption and dissociation. Individual projects are processed separately for the data bases. (CBS)

  15. Systematic Evaluation of Bioorthogonal Reactions in Live Cells with Clickable HaloTag Ligands: Implications for Intracellular Imaging

    PubMed Central

    2015-01-01

    Bioorthogonal reactions, including the strain-promoted azide–alkyne cycloaddition (SPAAC) and inverse electron demand Diels–Alder (iEDDA) reactions, have become increasingly popular for live-cell imaging applications. However, the stability and reactivity of reagents has never been systematically explored in the context of a living cell. Here we report a universal, organelle-targetable system based on HaloTag protein technology for directly comparing bioorthogonal reagent reactivity, specificity, and stability using clickable HaloTag ligands in various subcellular compartments. This system enabled a detailed comparison of the bioorthogonal reactions in live cells and informed the selection of optimal reagents and conditions for live-cell imaging studies. We found that the reaction of sTCO with monosubstituted tetrazines is the fastest reaction in cells; however, both reagents have stability issues. To address this, we introduced a new variant of sTCO, Ag-sTCO, which has much improved stability and can be used directly in cells for rapid bioorthogonal reactions with tetrazines. Utilization of Ag complexes of conformationally strained trans-cyclooctenes should greatly expand their usefulness especially when paired with less reactive, more stable tetrazines. PMID:26270632

  16. Systematic Evaluation of Bioorthogonal Reactions in Live Cells with Clickable HaloTag Ligands: Implications for Intracellular Imaging.

    PubMed

    Murrey, Heather E; Judkins, Joshua C; Am Ende, Christopher W; Ballard, T Eric; Fang, Yinzhi; Riccardi, Keith; Di, Li; Guilmette, Edward R; Schwartz, Joel W; Fox, Joseph M; Johnson, Douglas S

    2015-09-09

    Bioorthogonal reactions, including the strain-promoted azide-alkyne cycloaddition (SPAAC) and inverse electron demand Diels-Alder (iEDDA) reactions, have become increasingly popular for live-cell imaging applications. However, the stability and reactivity of reagents has never been systematically explored in the context of a living cell. Here we report a universal, organelle-targetable system based on HaloTag protein technology for directly comparing bioorthogonal reagent reactivity, specificity, and stability using clickable HaloTag ligands in various subcellular compartments. This system enabled a detailed comparison of the bioorthogonal reactions in live cells and informed the selection of optimal reagents and conditions for live-cell imaging studies. We found that the reaction of sTCO with monosubstituted tetrazines is the fastest reaction in cells; however, both reagents have stability issues. To address this, we introduced a new variant of sTCO, Ag-sTCO, which has much improved stability and can be used directly in cells for rapid bioorthogonal reactions with tetrazines. Utilization of Ag complexes of conformationally strained trans-cyclooctenes should greatly expand their usefulness especially when paired with less reactive, more stable tetrazines.

  17. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  18. Tropospheric Trace Gas Interactions with Aerosols

    NASA Technical Reports Server (NTRS)

    Penner, Joyce E.; Maddrea, George L., Jr. (Technical Monitor)

    2002-01-01

    Tropospheric aerosols are of considerable environmental importance. They modify the radiative budget of Earth by scattering and absorbing radiation, and by providing nuclei for cloud formation. Additionally, they provide surfaces for heterogeneous and multiphase reactions that affect tropospheric chemistry. For example, Dentener and Crutzen (1993) showed that reactions of N2O5 and NO3 with sulfate aerosols may significantly alter the tropospheric concentrations of NO(x), O3, and OH by converting NOx to HNO3 which is rapidly removed by precipitation. Zhang et al. (1994) assumed these same reactions would occur on dust aerosols and showed that dust outbreaks may reduce NO(x) levels by up to 50%. Dentener et al. (1996) studied the possible effect of reactions on dust on sulfate, nitrate, and O3 concentration. Heterogeneous and multiphase reactions on aerosols may also perturb the sulfur cycle the chlorine cycle and the bromine cycle. Because these reactions can release free chlorine and free bromine they might lead to the destruction of ozone in the marine boundary layer that may be important to include in models of tropospheric chemistry. The goal of our proposed work is to examine the role of heterogeneous and multiphase reactions in the tropospheric cycles of reactive nitrogen and sulfur.

  19. Metallic Sn spheres and SnO2@C core-shells by anaerobic and aerobic catalytic ethanol and CO oxidation reactions over SnO2 nanoparticles

    PubMed Central

    Kim, Won Joo; Lee, Sung Woo; Sohn, Youngku

    2015-01-01

    SnO2 has been studied intensely for applications to sensors, Li-ion batteries and solar cells. Despite this, comparatively little attention has been paid to the changes in morphology and crystal phase that occur on the metal oxide surface during chemical reactions. This paper reports anaerobic and aerobic ethanol and CO oxidation reactions over SnO2 nanoparticles (NPs), as well as the subsequent changes in the nature of the NPs. Uniform SnO2@C core-shells (10 nm) were formed by an aerobic ethanol oxidation reaction over SnO2 NPs. On the other hand, metallic Sn spheres were produced by an anaerobic ethanol oxidation reaction at 450 °C, which is significantly lower than that (1200 °C) used in industrial Sn production. Anaerobic and aerobic CO oxidation reactions were also examined. The novelty of the methods for the production of metallic Sn and SnO2@C core-shells including other anaerobic and aerobic reactions will contribute significantly to Sn and SnO2-based applications. PMID:26300041

  20. Drug metabolism and hypersensitivity reactions to drugs.

    PubMed

    Agúndez, José A G; Mayorga, Cristobalina; García-Martin, Elena

    2015-08-01

    The aim of the present review was to discuss recent advances supporting a role of drug metabolism, and particularly of the generation of reactive metabolites, in hypersensitivity reactions to drugs. The development of novel mass-spectrometry procedures has allowed the identification of reactive metabolites from drugs known to be involved in hypersensitivity reactions, including amoxicillin and nonsteroidal antiinflammatory drugs such as aspirin, diclofenac or metamizole. Recent studies demonstrated that reactive metabolites may efficiently bind plasma proteins, thus suggesting that drug metabolites, rather than - or in addition to - parent drugs, may elicit an immune response. As drug metabolic profiles are often determined by variability in the genes coding for drug-metabolizing enzymes, it is conceivable that an altered drug metabolism may predispose to the generation of reactive drug metabolites and hence to hypersensitivity reactions. These findings support the potential for the use of pharmacogenomics tests in hypersensitivity (type B) adverse reactions, in addition to the well known utility of these tests in type A adverse reactions. Growing evidence supports a link between genetically determined drug metabolism, altered metabolic profiles, generation of highly reactive metabolites and haptenization. Additional research is required to developing robust biomarkers for drug-induced hypersensitivity reactions.

  1. Food-induced anaphylaxis.

    PubMed

    Järvinen, Kirsi M

    2011-06-01

    Food-induced anaphylaxis is the leading single cause of anaphylaxis treated in emergency departments and increasing in prevalence. Food allergy is an increasing problem in westernized countries around the world, with a cumulative prevalence of 3-6%. Peanut, tree nuts, and shellfish are the most commonly implicated foods in anaphylaxis, although milk is a common trigger in children. Asthmatics, adolescents, and those with a prior reaction are at increased risk for more severe reactions. Most first reactions and reactions in children most commonly occur at home, whereas most subsequent reactions and reactions in adults occur outside home. Studies on schools have identified inadequate management plans and symptom recognition whereas those on restaurants report lack of prior notification by allergic individuals and lack in staff education. Epinephrine, although underutilized is the drug of choice with multiple doses needed in up to one-fifth of reactions. Diagnosis is currently based on convincing history and allergy testing supported by elevated serum tryptase, if available. Long-term management includes strict avoidance and emergency action plan. With a growing population of food-allergic children and adults, markers to predict which individuals are at increased risk for anaphylaxis as well as new therapies are vigorously sought.

  2. Time-dependent wave-packet quantum dynamics study of the Ne + D2(+) (v0 = 0-2, j0 = 0) → NeD(+) + D reaction: including the coriolis coupling.

    PubMed

    Yao, Cui-Xia; Zhang, Pei-Yu

    2014-07-10

    The dynamics of the Ne + D2(+) (v0 = 0-2, j0 = 0) → NeD(+) + D reaction has been investigated in detail by using an accurate time-dependent wave-packet method on the ground 1(2)A' potential energy surface. Comparisons between the Coriolis coupling results and the centrifugal-sudden ones reveal that Coriolis coupling effect can influence reaction dynamics of the NeD2(+) system. Integral cross sections have been evaluated for the Ne + D2(+) reaction and its isotopic variant Ne + H2(+), and a considerable intermolecular isotopic effect has been found. Also obvious is the great enhancement of the reactivity due to the reagent vibrational excitation. Besides, a comparison with previous theoretical results is also presented and discussed.

  3. Global and Local Partitioning of the Charge Transferred in the Parr-Pearson Model.

    PubMed

    Orozco-Valencia, Angel Ulises; Gázquez, José L; Vela, Alberto

    2017-05-25

    Through a simple proposal, the charge transfer obtained from the cornerstone theory of Parr and Pearson is partitioned, for each reactant, in two channels: an electrophilic, through which the species accepts electrons, and the other, a nucleophilic, where the species donates electrons. It is shown that this global model allows us to determine unambiguously the charge-transfer mechanism prevailing in a given reaction. The partitioning is extended to include local effects through the Fukui functions of the reactants. This local model is applied to several emblematic reactions in organic and inorganic chemistry, and we show that besides improving the correlations obtained with the global model it provides valuable information concerning the atoms in the reactants playing the most important roles in the reaction and thus improving our understanding of the reaction under study.

  4. Rate Coefficient Measurements of the Reaction CH3+O2+CH3O+O

    NASA Technical Reports Server (NTRS)

    Hwang, S. M.; Ryu, Si-Ok; DeWitt, K. J.; Rabinowitz, M. J.

    1999-01-01

    Rate coefficients for the reaction CH3 + O2 = CH3O + O were measured behind reflected shock waves in a series of lean CH4-O2-Ar mixtures using hydroxyl and methyl radical diagnostics. The rate coefficients are well represented by an Arrhenius expression given as k = (1.60(sup +0.67, -0.47)) X 10(exp 13) exp(- 15813 +/- 587 K/T)cc/mol s. This expression, which is valid in the temperature range 1575-1822 K, supports the downward trend in the rate coefficients that has been reported in recent determinations. All measurements to date, including the present study, have been to some extent affected by secondary reactions. The complications due to secondary reactions, choice of thermochemical data, and shock-boundary layer interactions that affect the determination of the rate coefficients are examined.

  5. Reactions of protective service workers towards people who stutter.

    PubMed

    Li, Jian; Arnold, Hayley S; Beste-Guldborg, Ann

    2016-12-01

    This study sought to assess whether protective service workers differ from people in non-protective services occupations in their intended reactions towards people who stutter (PWS). Analyses were based on questionnaire responses regarding intended reactions toward PWS from 171 protective services workers and 2595 non-protective services workers in the United States. A propensity score matching procedure was used to identify a comparison group of non-protective services workers for the protective services workers. The matching covariate variables included age, gender, years of education, familiarity with PWS, and beliefs about PWS. Findings indicated that protective services workers had less helpful intended behavioral reactions and more negative affective reactions towards PWS than the matched non-protective services workers. Examination of the matching covariate variables in the larger sample also indicated that protective services workers had less accurate beliefs about PWS compared to respondents not in protective services professions. Less favorable intended reactions of protective services workers toward PWS indicate a need for protective services workers to receive training in best practices when interacting with PWS. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Adverse reactions of Methylphenidate in children with attention deficit-hyperactivity disorder: Report from a referral center

    PubMed Central

    Khajehpiri, Zahra; Mahmoudi-Gharaei, Javad; Faghihi, Toktam; Karimzadeh, Iman; Khalili, Hossein; Mohammadi, Mostafa

    2014-01-01

    Objective: The aim of the current study was to determine various aspects of methylphenidate adverse reactions in children with attention deficit-hyperactivity disorder (ADHD) in Iran. Methods: During the 6 months period, all children under methylphenidate treatment alone or along with other agents attending a university-affiliated psychology clinic were screened regarding all subjective and objective adverse drug reactions (ADRs) of methylphenidate. Causality and seriousness of detected ADRs were assessed by relevant World Health Organization definitions. The Schumock and Thornton questionnaire was used to determine preventability of ADRs. Findings: Seventy-one patients including 25 girls and 46 boys with ADHD under methylphenidate treatment were enrolled within the study period. All (100%) ADHD children under methylphenidate treatment developed at least one ADR. Anorexia (74.3%), irritability (57.1%), and insomnia (47.2%) were the most frequent methylphenidate-related adverse reactions. Except for one, all other detected ADRs were determined to be mild. In addition, no ADR was considered to be preventable and serious. Conclusion: Our data suggested that although methylphenidate related adverse reactions were common in children with ADHD, but they were mainly mild and nonserious. PMID:25535621

  7. More experiences with the Tzanck smear test: cytologic findings in cutaneous granulomatous disorders.

    PubMed

    Durdu, Murat; Baba, Mete; Seçkin, Deniz

    2009-09-01

    Granulomatous dermatitis is a distinctive histopathologic cutaneous reaction pattern against various infectious and noninfectious agents. Cytologically, granulomatous dermatitis shows granulomas and multinucleated giant cells. Various etiologic agents of granulomatous diseases can also be identified. We aimed to investigate Tzanck smear findings in granulomatous skin diseases. Patients who had granulomas and/or multinucleated giant cells of Langhans, foreign body- and/or Touton type in Tzanck smear tests were included in the study. In these patients, Tzanck preparations were then further evaluated for additional cytologic findings. Samples stained with May-Grünwald-Giemsa stain were evaluated by the same dermatologist throughout the study. In some patients, methylene blue, Gram and/or Erlich-Ziehl-Nielsen stains were also performed. In all of the study cases, the final diagnosis was established after the evaluation of clinical and laboratory findings (including, when appropriate, potassium hydroxide examination; bacterial, leishmanial, and fungal cultures; histopathology; tuberculosis and leishmania polymerase chain reaction). We also calculated the sensitivity and specificity of the Leishman-Donovan body for cutaneous leishmaniasis. Over a 2-year period, 94 of 950 patients (9.9%) in whom Tzanck smear tests were performed had cytologic findings consistent with a granulomatous reaction. In 74 (78.7%) and 20 (21.3%) patients, the granulomatous reaction was due to infectious and noninfectious causes, respectively. Infectious causes included cutaneous leishmaniasis in 65 patients (87.8%), candidal granuloma in two patients, botyromycosis in two patients, and aspergillosis, blastomycosis, mucormycosis, leprosy, and cutaneous tuberculosis in one patient each. In 58 of 74 patients (78.4%) with infectious granulomatous dermatitis, the causes of the granulomas were identified. Noninfectious granulomatous reactions were due to granuloma annulare in 7 patients, sarcoidosis in 5 patients, a foreign body in 4 patients, necrobiosis lipoidica in 2 patients, and juvenile xanthogranuloma in 2 patients. In 17 of 20 patients (85%) with noninfectious granulomatous reactions, the cytologic findings were characteristic of the final diagnoses. The sensitivity and specificity of Leishman-Donovan bodies for cutaneous leishmaniasis were 76.9% and 100%, respectively. All of the samples were evaluated by the same dermatologist throughout the study; therefore no comment could be made regarding the reliability of the Tzanck smear test. In addition, the sensitivity and specificity of Tzanck smear test findings for diseases other than cutaneous leishmaniasis could not be calculated because of an insufficient number of patients. The Tzanck smear test may be a useful diagnostic tool for certain granulomatous skin diseases.

  8. Cutaneous Side Effects of Antiosteoporosis Treatments

    PubMed Central

    Musette, Philippe; Kaufman, Jean-Marc; Rizzoli, René; Cacoub, Patrice; Brandi, Maria Louisa; Reginster, Jean-Yves

    2011-01-01

    Cutaneous adverse reactions are reported for many therapeutic agents and, in general, are observed in between 0% and 8% of treated patients depending on the drug. Antiosteoporotic agents are considered to be safe in terms of cutaneous effects, however there have been a number of case reports of cutaneous adverse reactions which warrant consideration. This was the subject of a working group meeting of the European Society for Clinical and Economic Aspects of Osteoporosis and Osteoarthritis in April 2009, which focused on the impact of cutaneous adverse reactions and drug-induced hypersensitivity in the management of postmenopausal osteoporosis. This position paper was drafted following these discussions and includes a flowchart for their recognition. Cutaneous adverse reactions observed with antiosteoporotic agents were reviewed and included information from case reports, regulatory documents and pharmacovigilance. These reactions ranged from benign effects including exanthematous or maculopapular eruption (drug rash), photosensitivity and urticaria, to the severe and potentially life-threatening reactions of angioedema, drug rash with eosinophilia and systemic symptoms (DRESS), Stevens Johnson syndrome and toxic epidermal necrolysis. A review of the available evidence demonstrates that cutaneous adverse reactions occur with all commonly used antiosteoporotic treatments. Notably, there are reports of Stevens Johnson syndrome and toxic epidermal necrolysis for bisphosphonates, and of DRESS and toxic epidermal necrolysis for strontium ranelate. These severe reactions remain very rare (<1 in 10,000 cases). In general, with proper management and early recognition, including immediate and permanent withdrawal of the culprit agent, accompanied by hospitalization, rehydration and systemic corticosteroids if necessary, the prognosis is positive. PMID:22870464

  9. Laboratory Studies of Chemical and Photochemical Processes Relevant to Stratospheric Ozone

    NASA Technical Reports Server (NTRS)

    Zahniser, Mark S.; Nelson, David D.; Worsnop, Douglas R.; Kolb, Charles E.

    1996-01-01

    The purpose of this project is to reduce the uncertainty in several key gas-phase kinetic processes which impact our understanding of stratospheric ozone. The main emphasis of this work is on measuring rate coefficients and product channels for reactions of HOx and NOx species in the temperature range 200 K to 240 K relevant to the lower stratosphere. Other areas of study have included infrared spectroscopic studies of the HO radical, measurements of OH radical reactions with alternative fluorocarbons, and determination of the vapor pressures of nitric acid hydrates under stratospheric conditions. The results of these studies will improve models of stratospheric ozone chemistry and predictions of perturbations due to human influences.

  10. 21 CFR 201.57 - Specific requirements on content and format of labeling for human prescription drug and...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... comparative rates of occurrence cannot be reliably determined (e.g., adverse reactions were observed only in... in vivo study designs or results (e.g., drug interaction studies), may be included in this section if...

  11. 21 CFR 201.57 - Specific requirements on content and format of labeling for human prescription drug and...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... comparative rates of occurrence cannot be reliably determined (e.g., adverse reactions were observed only in... in vivo study designs or results (e.g., drug interaction studies), may be included in this section if...

  12. 21 CFR 201.57 - Specific requirements on content and format of labeling for human prescription drug and...

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... comparative rates of occurrence cannot be reliably determined (e.g., adverse reactions were observed only in... in vivo study designs or results (e.g., drug interaction studies), may be included in this section if...

  13. Catalytic and reactive polypeptides and methods for their preparation and use

    DOEpatents

    Schultz, Peter

    1994-01-01

    Catalytic and reactive polypeptides include a binding site specific for a reactant or reactive intermediate involved in a chemical reaction of interest. The polypeptides further include at least one active functionality proximate the binding site, where the active functionality is capable of catalyzing or chemically participating in the chemical reaction in such a way that the reaction rate is enhanced. Methods for preparing the catalytic peptides include chemical synthesis, site-directed mutagenesis of antibody and enzyme genes, covalent attachment of the functionalities through particular amino acid side chains, and the like.

  14. Outbreak of Adverse Reactions Associated with Contaminated Heparin

    PubMed Central

    Blossom, David B.; Kallen, Alexander J.; Patel, Priti R.; Elward, Alexis; Robinson, Luke; Gao, Ganpan; Langer, Robert; Perkins, Kiran M.; Jaeger, Jennifer L.; Kurkjian, Katie M.; Jones, Marilyn; Schillie, Sarah F.; Shehab, Nadine; Ketterer, Daniel; Venkataraman, Ganesh; Kishimoto, Takashi Kei; Shriver, Zachary; McMahon, Ann W.; Austen, K. Frank; Kozlowski, Steven; Srinivasan, Arjun; Turabelidze, George; Gould, Carolyn V.; Arduino, Matthew J.; Sasisekharan, Ram

    2013-01-01

    BACKGROUND In January 2008, the Centers for Disease Control and Prevention began a nationwide investigation of severe adverse reactions that were first detected in a single hemodialysis facility. Preliminary findings suggested that heparin was a possible cause of the reactions. METHODS Information on clinical manifestations and on exposure was collected for patients who had signs and symptoms that were consistent with an allergic-type reaction after November 1, 2007. Twenty-one dialysis facilities that reported reactions and 23 facilities that reported no reactions were included in a case–control study to identify facility-level risk factors. Unopened heparin vials from facilities that reported reactions were tested for contaminants. RESULTS A total of 152 adverse reactions associated with heparin were identified in 113 patients from 13 states from November 19, 2007, through January 31, 2008. The use of heparin manufactured by Baxter Healthcare was the factor most strongly associated with reactions (present in 100.0% of case facilities vs. 4.3% of control facilities, P<0.001). Vials of heparin manufactured by Baxter from facilities that reported reactions contained a contaminant identified as oversulfated chondroitin sulfate (OSCS). Adverse reactions to the OSCS-contaminated heparin were often characterized by hypotension, nausea, and shortness of breath occurring within 30 minutes after administration. Of 130 reactions for which information on the heparin lot was available, 128 (98.5%) occurred in a facility that had OSCS-contaminated heparin on the premises. Of 54 reactions for which the lot number of administered heparin was known, 52 (96.3%) occurred after the administration of OSCS-contaminated heparin. CONCLUSIONS Heparin contaminated with OSCS was epidemiologically linked to adverse reactions in this nationwide outbreak. The reported clinical features of many of the cases further support the conclusion that contamination of heparin with OSCS was the cause of the outbreak. PMID:19052120

  15. [Adverse reaction caused by rabies vaccine in China: a Meta-analysis].

    PubMed

    Zhang, X R; Wu, Z G; Zhang, W S

    2017-06-10

    Objective: To conduct a Meta-analysis on the rate of adverse reaction related to rabies vaccine, so as to provide reference for rabies vaccine immunization in China. Methods: We electronically searched databases including CNKI, VIP information resource integration service platform, WanFang Data, CBM, PubMed and The Cochrane Library, to collect studies on Chinese people who had received full rabies vaccination and recording all the adverse reactions, from January 2000 to July 2016. Inclusion and exclusion criteria were strictly followed. Meta-analysis for the adverse reaction rate was performed using the R software. Results: A total of 29 related papers had met the inclusion criteria, with no publication bias noticed. A total number of 11 020 cases had adverse reactions, among all the 94 222 respondents, with an incidence of adverse reactions as 1.04 % -47.78 % . The overall incidence rate of adverse reaction was 9.82 % (95 %CI : 7.58 % -12.72 % ). A combined local adverse reaction rate appeared as 12.05 % (95 % CI : 9.26 % -15.69 % ). The systemic adverse reaction rate was 9.06 % (95 %CI : 7.07 % -11.61 % ). The overall adverse reaction rate on aqueous vaccine was 32.39 % (95 %CI : 21.88 % -47.94 % ). Combined adverse reaction rate of freeze dried vaccine appeared as 8.65 % (95 %CI : 4.54 % -16.51 % ). Significant differences were seen between both groups ( P <0.05). Conclusions: The local adverse reaction rate caused by rabies vaccination was higher than the systemic adverse reaction rate. The adverse reaction rate of aqueous rabies vaccine was higher than that of freeze dried rabies vaccine. Our results suggested that the aqueous vaccine should gradually be eliminated.

  16. Is oral immunotherapy the cure for food allergies?

    PubMed

    Nowak-Wegrzyn, Anna; Fiocchi, Alessandro

    2010-06-01

    To review current evidence on food oral immunotherapy (OIT). Desensitized state, defined as the ingestion of a substantial amount of food in the home diet that protects from severe reactions to accidental exposures, can be achieved by approximately 50-75% of the children treated with OIT. The rate of permanent tolerance is unknown; the longer duration of OIT may result in permanent tolerance. Side effects are common both during the initial dose escalation and during home dosing. Most reactions are mild (oral pruritus, abdominal discomfort, and rashes) and decrease in frequency with the longer duration of OIT. Severe reactions treated with epinephrine have been reported during home dosing. Factors associated with increased risk of reactions to previously tolerated doses during home dosing include exercise, viral infection, dosing on empty stomach, menses, and asthma exacerbation. These preliminary data on OIT are encouraging. Additional studies must answer multiple questions including optimal dose, ideal duration of oral/sublingual immunotherapy, degree of protection, efficacy for different ages, severity and type of food allergy responsive to treatment and need for patient protection during home administration. Until these questions are answered in rigorous multicenter randomized and placebo-controlled trials, OIT remains an experimental approach with not sufficiently well established risk-to-benefit ratio.

  17. One-week oral challenge with penicillin in diagnosis of penicillin allergy.

    PubMed

    Hjortlund, Janni; Mortz, Charlotte Gotthard; Skov, Per Stahl; Eller, Esben; Poulsen, Johan Milling; Borch, Jakob Eli; Bindslev-Jensen, Carsten

    2012-05-01

    Many patients experience reactions during penicillin treatment. The diagnosis may be difficult and is mainly based on short-term tests. The European Network for Drug Allergy (ENDA) guidelines proposed for diagnosing penicillin allergy do not include long-term challenge. In this study a total of 405 patients were evaluated. The ENDA guidelines were extended, to include a 7-day oral treatment (p.o.7) with penicillin for all patients who were negative in the ENDA programme. Among the 405 patients; 85 had an immediate reaction to penicillin, and a further 13 reacted during p.o.7. Among the 307 patients with a negative outcome, 88 had a case history of reaction to other β-lactam antibiotics and were subsequently tested with the culprit drug. Thirteen patients had a positive outcome: 3 on single-dose challenge and 10 during p.o.7. The extended penicillin diagnostic work-up was positive in 111 patients, 30.0% showed immediate reactions and 5.7% reacted during p.o.7. Approximately 20% of all patients with positive outcome during penicillin challenge are detected by adding p.o.7 with penicillin to the original ENDA guidelines.

  18. Genetic Encoding of bicyclononynes and trans-cyclooctenes for site-specific protein labeling in vitro and in live mammalian cells via rapid fluorogenic Diels-Alder reactions.

    PubMed

    Lang, Kathrin; Davis, Lloyd; Wallace, Stephen; Mahesh, Mohan; Cox, Daniel J; Blackman, Melissa L; Fox, Joseph M; Chin, Jason W

    2012-06-27

    Rapid, site-specific labeling of proteins with diverse probes remains an outstanding challenge for chemical biologists. Enzyme-mediated labeling approaches may be rapid but use protein or peptide fusions that introduce perturbations into the protein under study and may limit the sites that can be labeled, while many "bioorthogonal" reactions for which a component can be genetically encoded are too slow to effect quantitative site-specific labeling of proteins on a time scale that is useful for studying many biological processes. We report a fluorogenic reaction between bicyclo[6.1.0]non-4-yn-9-ylmethanol (BCN) and tetrazines that is 3-7 orders of magnitude faster than many bioorthogonal reactions. Unlike the reactions of strained alkenes, including trans-cyclooctenes and norbornenes, with tetrazines, the BCN-tetrazine reaction gives a single product of defined stereochemistry. We have discovered aminoacyl-tRNA synthetase/tRNA pairs for the efficient site-specific incorporation of a BCN-containing amino acid, 1, and a trans-cyclooctene-containing amino acid 2 (which also reacts extremely rapidly with tetrazines) into proteins expressed in Escherichia coli and mammalian cells. We demonstrate the rapid fluorogenic labeling of proteins containing 1 and 2 in vitro, in E. coli , and in live mammalian cells. These approaches may be extended to site-specific protein labeling in animals, and we anticipate that they will have a broad impact on labeling and imaging studies.

  19. Adverse reactions following administration of contrast media for diagnostic imaging in anaesthetized dogs and cats: a retrospective study.

    PubMed

    Scarabelli, Stefania; Cripps, Peter; Rioja, Eva; Alderson, Briony

    2016-09-01

    To evaluate incidences of adverse reaction after the administration of contrast media. Retrospective observational study. Animals included 356 dogs and 58 cats receiving non-ionic iodinated contrast agents, and 425 dogs and 49 cats receiving gadolinium-based contrast agents. Anaesthesia records of dogs and cats receiving intravenous (IV) gadobutrol for magnetic resonance imaging (MRI) or IV iohexol for computed tomography (CT) were reviewed. Changes in pulse rate, respiratory rate and mean arterial pressure at 5 minutes after administration of the contrast medium were evaluated. Changes of 10-20% were considered mild, those of >20% moderate, and reactions that required immediate treatment were considered severe. Associations of sex, age and weight with contrast reaction were investigated using logistic regression. Differences in the incidences of reactions to CT and MRI contrast media were examined with chi-squared tests. A p-value of <0.05 was considered to indicate statistical significance. Of cats receiving iohexol, eight (13.8%) had mild and 10 (17.2%) had moderate reactions. Of cats receiving gadobutrol, six (12.2%) had mild and six (12.2%) had moderate reactions. No cats had severe reactions and the risk for reaction was not associated with type of medium, age, weight or sex (p > 0.2). Of dogs receiving iohexol, 64 (18.0%) had mild, 65 (18.3%) had moderate and three (0.8%) had severe reactions. Of dogs receiving gadobutrol, 42 (9.9%) had mild, 87 (20.5%) had moderate and one (0.2%) had a severe reaction. When dogs receiving iohexol were compared with those receiving gadobutrol, the odds ratio of a moderate reaction was 2.0 (95% confidence interval 1.34-3.10; p = 0.001). These estimates did not change substantially after adjustment for age, weight and sex. Severe reactions to iohexol and gadobutrol are rare in dogs and cats; moderate reactions are more likely with iohexol than with gadobutrol. © 2015 Association of Veterinary Anaesthetists and the American College of Veterinary Anesthesia and Analgesia.

  20. Microdialysis Sampling Techniques Applied to Studies of the Foreign Body Reaction

    PubMed Central

    Sides, Cynthia R.; Stenken, Julie A.

    2014-01-01

    Implanted materials including drug delivery devices and chemical sensors undergo what is termed the foreign body reaction (FBR). Depending on the device and its intended application, the FBR can have differing consequences. An extensive scientific research effort has been devoted to elucidating the cellular and molecular mechanisms that drive the FBR. Important, yet relatively unexplored, research includes the localized tissue biochemistry and the chemical signaling events that occur throughout the FBR. This review provides an overview of the mechanisms of the FBR, describes how the FBR affects different implanted devices, and illustrates the role that microdialysis sampling can play in further elucidating the chemical communication processes that drive FBR outcomes. PMID:24269987

  1. Microwave-induced Bismuth Salts-mediated Synthesis of Molecules of Medicinal Interests.

    PubMed

    Bandyopadhyay, Debasish; Chavez, Ashlee; Banik, Bimal K

    2017-01-01

    Bismuth salts-mediated reactions have become a powerful tool for the synthesis of diverse medicinally-significant compounds because of their low-toxicity (non-toxic) and Lewis acidic capacity. In fact, LD50 of bismuth nitrate is lower than table salt. On the other hand, microwave-induced chemical synthesis is considered as a major greener route in modern chemistry. A total of 139 publications (including a few authentic web links) have been reviewed mainly to discuss bismuth salts-induced electrophilic aromatic substitution, protection-deprotection chemistry of carbonyl compounds, enamination, oxidation, carbohydrate chemistry, hydrolysis, addition-elimination route, Paal-Knorr reaction, Clauson-kaas synthesis, Michael addition, aza-Michael addition, Hantzsch reaction, Biginelli reaction, Ferrier rearrangement, Pechmann condensation, Diels-Alder and aza-Diels- Alder reactions, as well as effects of microwave irradiation in a wide range of chemical transformations. Bismuth salts-mediated reactions are developed for the synthesis of diverse organic molecules of medicinal significance. Reactions conducted with bismuth salts are environmentally benign, economical, rapid and high yielding. Microwave irradiation has accelerated these reactions significantly. It is believed that bismuth salts released corresponding acids in the media during the reaction. However, a coordination of bismuth salt to the electronegative atom is also observed in the NMR study. Bismuth has much less control (less attractive forces) over anions (for example, halides, nitrate, sulfate and triflates) compared to alkali metals. Therefore, it forms weak bond with electronegative atoms more readily and facilitates the reactions significantly. Many products obtained via bismuth salts-mediated reactions are medicinally active or intermediate for the synthesis of biologically active molecules including antifungal, anti-parasitic, anticancer and antibacterial agents, as well as agents to prevent Leishmaniosis and Chagas' diseases. Bismuth salts are able to (i) generate mineral acids in the reaction media and (ii) coordinate with electronegative atoms to facilitate the reaction. When the reagents and the catalyst (bismuth salt) are subjected to microwave irradiation, microwave passes through the (glass) walls of the reaction vessel and heat only the reactants avoiding local overheating at the wall of the vessel. Accordingly, the possibility of side reaction and subsequent by-product formation are reduced abruptly which in turn increases the yield of the desired product. The extreme rapidity with excellent yield of the product can be rationalized as a synergistic effect of the bismuth salts and microwave irradiation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Reaction Paths and Chemical Activation Reactions of 2-Methyl-5-Furanyl Radical with 3O2.

    PubMed

    Hudzik, Jason M; Bozzelli, Joseph W

    2017-10-05

    Interest in high-energy substituted furans has been increasing due to their occurrence in biofuel production and their versatility in conversion to other useful products. Methylfurans are the simplest substituted furans and understanding their reaction pathways, thermochemical properties, including intermediate species stability, and chemical kinetics would aid in the study of larger furans. Furan ring C-H bonds have been shown to be extremely strong, approximately 120 kcal mol -1 , due in part to the placement of the oxygen atom and aromatic-like resonance, both within the ring. The thermochemistry and kinetics of the oxidation of 2-methyfuran radical at position 5 of the furan ring, 2-methyl-5-furanyl radical (2MF5j), is analyzed. The resulting chemically activated species, 2MF5OOj radical, has a well depth of 51 kcal mol -1 below the 2MF5j + O 2 reactants; this is 4-5 kcal mol -1 deeper than that of phenyl and vinyl radical plus O 2 , with both of these reactions known to undergo chain branching. Important, low-energy reaction pathways include chain branching dissociations, intramolecular abstractions, group transfers, and radical oxygen additions. Enthalpies of formation, entropies, and heat capacities for the stable molecules, radicals, and transition-state species are analyzed using computational methods. Calculated ΔH ° f 298 values were determined using an isodesmic work reaction from the CBS-QB3 composite method. Elementary rate parameters are from saddle point transition-state structures and compared to variational transition-state analysis for the barrierless reactions. Temperature- and pressure-dependent rate constants which are calculated using QRRK and master equation analysis is used for falloff and stabilization.

  3. Phytosphingosine degradation pathway includes fatty acid α-oxidation reactions in the endoplasmic reticulum.

    PubMed

    Kitamura, Takuya; Seki, Naoya; Kihara, Akio

    2017-03-28

    Although normal fatty acids (FAs) are degraded via β-oxidation, unusual FAs such as 2-hydroxy (2-OH) FAs and 3-methyl-branched FAs are degraded via α-oxidation. Phytosphingosine (PHS) is one of the long-chain bases (the sphingolipid components) and exists in specific tissues, including the epidermis and small intestine in mammals. In the degradation pathway, PHS is converted to 2-OH palmitic acid and then to pentadecanoic acid (C15:0-COOH) via FA α-oxidation. However, the detailed reactions and genes involved in the α-oxidation reactions of the PHS degradation pathway have yet to be determined. In the present study, we reveal the entire PHS degradation pathway: PHS is converted to C15:0-COOH via six reactions [phosphorylation, cleavage, oxidation, CoA addition, cleavage (C1 removal), and oxidation], in which the last three reactions correspond to the α-oxidation. The aldehyde dehydrogenase ALDH3A2 catalyzes both the first and second oxidation reactions (fatty aldehydes to FAs). In Aldh3a2 -deficient cells, the unmetabolized fatty aldehydes are reduced to fatty alcohols and are incorporated into ether-linked glycerolipids. We also identify HACL2 (2-hydroxyacyl-CoA lyase 2) [previous name, ILVBL; ilvB (bacterial acetolactate synthase)-like] as the major 2-OH acyl-CoA lyase involved in the cleavage (C1 removal) reaction in the FA α-oxidation of the PHS degradation pathway. HACL2 is localized in the endoplasmic reticulum. Thus, in addition to the already-known FA α-oxidation in the peroxisomes, we have revealed the existence of FA α-oxidation in the endoplasmic reticulum in mammals.

  4. Use of patch testing for the diagnosis of abacavir-related hypersensitivity reaction in HIV patients.

    PubMed

    Giorgini, S; Martinelli, C; Tognetti, L; Carocci, A; Giuntini, R; Mastronardi, V; Torricelli, F; Leoncini, F; Lotti, T

    2011-01-01

    The use of antiretroviral drug abacavir (ABC) has been often associated with cutaneous hypersensitivity reactions, the majority being severe. The present study discusses the issues of patch testing associated with pharmacogenetic screening in light of the development of abacavir hypersensitivity reactions (HSRs). The present authors classified 100 patients into three groups: 20 patients (group A) had experienced a hypersensitivity reaction when treated with highly active antiretroviral therapy (HAART) including ABC; 60 HIV-positive patients (group B) were receiving HAART scheme including ABC; 20 HIV-negative patients acted as control group (group C). Patients of group A and B were patch tested with ABC as such, then with an ABC extract diluted to 1 and 10% in petrolatum. Group C patients underwent patches with petrolatum only. A biopsy of the lesion was performed in those patients who showed a positive skin reaction. All patients had been tested for HLA-B5701. A correlation between positive ABC-patch testing and HLA-B5701 was found in 50% of patients enrolled in group A, while in group B and C, all patients tested negative for both genetic marker and ABC-patch testing. Histopathology findings confirmed a vigorous CD4+ and CD8+ cellular response that is compatible with HSR. Patch testing is a safe and sensitive method that can be used for to confirm or exclude any correlation between abacavir and hypersensitivity skin reactions in patients who have been previously treated with abacavir during HAART. Correlation between patch test, immunohistochimical, and genetic tests results shows that genetic testing increases the possibility to identify patients with a true reaction. © 2012 Wiley Periodicals, Inc.

  5. Study on US/O3 mechanism in p-chlorophenol decomposition

    PubMed Central

    Xu, Xian-wen; Xu, Xin-hua; Shi, Hui-xiang; Wang, Da-hui

    2005-01-01

    Study on the effects of sonolysis, ozonolysis and US/O3 system on the decomposition of p-chlorophenol in aqueous solutions indicated that in the cases of US/O3 system, individual ozonolysis and sonolysis, the decomposition rate of p-chlorophenol reached 78.78%, 56.20%, 2.79% after a 16-min reaction while its CODcr (chemical oxygen demand) removal rate was 97.02%, 62.17%, 3.67% after a 120-min reaction. The decomposition reaction of p-chlorophenol follows pseudo-first-order kinetics. The enhancement factors of p-chlorophenol and its CODcr under US/O3 system reached 63% and 237% respectively. The main intermediates during the decomposition include catechol, hydroquinone, p-benzoquinone, phenol, fumaric acid, maleic acid, oxalic acid and formic acid. The decomposition mechanism of p-chlorophenol was also discussed. PMID:15909343

  6. Spallation reaction study for fission products in nuclear waste: Cross section measurements for 137Cs and 90Sr on proton and deuteron

    NASA Astrophysics Data System (ADS)

    Wang, H.; Otsu, H.; Sakurai, H.; Ahn, D. S.; Aikawa, M.; Doornenbal, P.; Fukuda, N.; Isobe, T.; Kawakami, S.; Koyama, S.; Kubo, T.; Kubono, S.; Lorusso, G.; Maeda, Y.; Makinaga, A.; Momiyama, S.; Nakano, K.; Niikura, M.; Shiga, Y.; Söderström, P.-A.; Suzuki, H.; Takeda, H.; Takeuchi, S.; Taniuchi, R.; Watanabe, Ya.; Watanabe, Yu.; Yamasaki, H.; Yoshida, K.

    2016-03-01

    We have studied spallation reactions for the fission products 137Cs and 90Sr for the purpose of nuclear waste transmutation. The spallation cross sections on the proton and deuteron were obtained in inverse kinematics for the first time using secondary beams of 137Cs and 90Sr at 185 MeV/nucleon at the RIKEN Radioactive Isotope Beam Factory. The target dependence has been investigated systematically, and the cross-section differences between the proton and deuteron are found to be larger for lighter spallation products. The experimental data are compared with the PHITS calculation, which includes cascade and evaporation processes. Our results suggest that both proton- and deuteron-induced spallation reactions are promising mechanisms for the transmutation of radioactive fission products.

  7. Emotional reactions to crime across cultures.

    PubMed

    Matsumoto, David; Hwang, Hyisung C

    2015-10-01

    Information about the emotions experienced by observers when they witness crimes would have important theoretical and practical implications, but to date no study has broadly assessed such emotional reactions. This study addressed this gap in the literature. Observers in seven countries viewed seven videos portraying actual crimes and rated their emotional reactions to each using 14 emotion scales. Observers reported significantly high levels of negative emotions including anger, contempt, disgust, fear and sadness-related emotions, and anger, contempt and disgust were the most salient emotions experienced by viewers across all countries. Witnesses also reported significantly high levels of positive emotions as well (compared to not feeling the emotion at all), which was unexpected. Country moderated the emotion ratings; post-hoc analyses indicated that masculine-oriented cultures reported less nervousness, surprise, excitement, fear and embarrassment than feminine cultures. © 2014 International Union of Psychological Science.

  8. Nonlinear electromechanical modelling and dynamical behavior analysis of a satellite reaction wheel

    NASA Astrophysics Data System (ADS)

    Aghalari, Alireza; Shahravi, Morteza

    2017-12-01

    The present research addresses the satellite reaction wheel (RW) nonlinear electromechanical coupling dynamics including dynamic eccentricity of brushless dc (BLDC) motor and gyroscopic effects, as well as dry friction of shaft-bearing joints (relative small slip) and bearing friction. In contrast to other studies, the rotational velocity of the flywheel is considered to be controllable, so it is possible to study the reaction wheel dynamical behavior in acceleration stages. The RW is modeled as a three-phases BLDC motor as well as flywheel with unbalances on a rigid shaft and flexible bearings. Improved Lagrangian dynamics for electromechanical systems is used to obtain the mathematical model of the system. The developed model can properly describe electromechanical nonlinear coupled dynamical behavior of the satellite RW. Numerical simulations show the effectiveness of the presented approach.

  9. Rotor assembly and assay method

    DOEpatents

    Burtis, C.A.; Johnson, W.F.; Walker, W.A.

    1993-09-07

    A rotor assembly for carrying out an assay includes a rotor body which is rotatable about an axis of rotation, and has a central chamber and first, second, third, fourth, fifth, and sixth chambers which are in communication with and radiate from the central chamber. The rotor assembly further includes a shuttle which is movable through the central chamber and insertable into any of the chambers, the shuttle including a reaction cup carrying an immobilized antigen or an antibody for transport among the chambers. A method for carrying out an assay using the rotor assembly includes moving the reaction cup among the six chambers by passing the cup through the central chamber between centrifugation steps in order to perform the steps of: separating plasma from blood cells, binding plasma antibody or antigen, washing, drying, binding enzyme conjugate, reacting with enzyme substrate and optically comparing the resulting reaction product with unreacted enzyme substrate solution. The movement of the reaction cup can be provided by attaching a magnet to the reaction cup and supplying a moving magnetic field to the rotor. 34 figures.

  10. Rotor assembly and assay method

    DOEpatents

    Burtis, Carl A.; Johnson, Wayne F.; Walker, William A.

    1993-01-01

    A rotor assembly for carrying out an assay includes a rotor body which is rotatable about an axis of rotation, and has a central chamber and first, second, third, fourth, fifth, and sixth chambers which are in communication with and radiate from the central chamber. The rotor assembly further includes a shuttle which is movable through the central chamber and insertable into any of the chambers, the shuttle including a reaction cup carrying an immobilized antigen or an antibody for transport among the chambers. A method for carrying out an assay using the rotor assembly includes moving the reaction cup among the six chambers by passing the cup through the central chamber between centrifugation steps in order to perform the steps of: separating plasma from blood cells, binding plasma antibody or antigen, washing, drying, binding enzyme conjugate, reacting with enzyme substrate and optically comparing the resulting reaction product with unreacted enzyme substrate solution. The movement of the reaction cup can be provided by attaching a magnet to the reaction cup and supplying a moving magnetic field to the rotor.

  11. High-level theoretical characterization of the vinoxy radical (•CH2CHO) + O2 reaction

    NASA Astrophysics Data System (ADS)

    Weidman, Jared D.; Allen, Ryan T.; Moore, Kevin B.; Schaefer, Henry F.

    2018-05-01

    Numerous processes in atmospheric and combustion chemistry produce the vinoxy radical (•CH2CHO). To understand the fate of this radical and to provide reliable energies needed for kinetic modeling of such processes, we have examined its reaction with O2 using highly reliable theoretical methods. Utilizing the focal point approach, the energetics of this reaction and subsequent reactions were obtained using coupled-cluster theory with single, double, and perturbative triple excitations [CCSD(T)] extrapolated to the complete basis set limit. These extrapolated energies were appended with several corrections including a treatment of full triples and connected quadruple excitations, i.e., CCSDT(Q). In addition, this study models the initial vinoxy radical + O2 reaction for the first time with multireference methods. We predict a barrier for this reaction of approximately 0.4 kcal mol-1. This result agrees with experimental findings but is in disagreement with previous theoretical studies. The vinoxy radical + O2 reaction produces a 2-oxoethylperoxy radical which can undergo a number of unimolecular reactions. Abstraction of a β-hydrogen (a 1,4-hydrogen shift) and dissociation back to reactants are predicted to be competitive to each other due to their similar barriers of 21.2 and 22.3 kcal mol-1, respectively. The minimum-energy β-hydrogen abstraction pathway produces a hydroperoxy radical (QOOH) that eventually decomposes to formaldehyde, CO, and •OH. Two other unimolecular reactions of the peroxy radical are α-hydrogen abstraction (38.7 kcal mol-1 barrier) and HO2• elimination (43.5 kcal mol-1 barrier). These pathways lead to glyoxal + •OH and ketene + HO2• formation, respectively, but they are expected to be uncompetitive due to their high barriers.

  12. Hot spot formation and chemical reaction initiation in shocked HMX crystals with nanovoids: a large-scale reactive molecular dynamics study.

    PubMed

    Zhou, Tingting; Lou, Jianfeng; Zhang, Yangeng; Song, Huajie; Huang, Fenglei

    2016-07-14

    We report million-atom reactive molecular dynamic simulations of shock initiation of β-cyclotetramethylene tetranitramine (β-HMX) single crystals containing nanometer-scale spherical voids. Shock induced void collapse and subsequent hot spot formation as well as chemical reaction initiation are observed which depend on the void size and impact strength. For an impact velocity of 1 km s(-1) and a void radius of 4 nm, the void collapse process includes three stages; the dominant mechanism is the convergence of upstream molecules toward the centerline and the downstream surface of the void forming flowing molecules. Hot spot formation also undergoes three stages, and the principal mechanism is kinetic energy transforming to thermal energy due to the collision of flowing molecules on the downstream surface. The high temperature of the hot spot initiates a local chemical reaction, and the breakage of the N-NO2 bond plays the key role in the initial reaction mechanism. The impact strength and void size have noticeable effects on the shock dynamical process, resulting in a variation of the predominant mechanisms leading to void collapse and hot spot formation. Larger voids or stronger shocks result in more intense hot spots and, thus, more violent chemical reactions, promoting more reaction channels and generating more reaction products in a shorter duration. The reaction products are mainly concentrated in the developed hot spot, indicating that the chemical reactivity of the hmx crystal is greatly enhanced by void collapse. The detailed information derived from this study can aid a thorough understanding of the role of void collapse in hot spot formation and the chemical reaction initiation of explosives.

  13. Ab initio kinetics of gas phase decomposition reactions.

    PubMed

    Sharia, Onise; Kuklja, Maija M

    2010-12-09

    The thermal and kinetic aspects of gas phase decomposition reactions can be extremely complex due to a large number of parameters, a variety of possible intermediates, and an overlap in thermal decomposition traces. The experimental determination of the activation energies is particularly difficult when several possible reaction pathways coexist in the thermal decomposition. Ab initio calculations intended to provide an interpretation of the experiment are often of little help if they produce only the activation barriers and ignore the kinetics of the decomposition process. To overcome this ambiguity, a theoretical study of a complete picture of gas phase thermo-decomposition, including reaction energies, activation barriers, and reaction rates, is illustrated with the example of the β-octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) molecule by means of quantum-chemical calculations. We study three types of major decomposition reactions characteristic of nitramines: the HONO elimination, the NONO rearrangement, and the N-NO(2) homolysis. The reaction rates were determined using the conventional transition state theory for the HONO and NONO decompositions and the variational transition state theory for the N-NO(2) homolysis. Our calculations show that the HMX decomposition process is more complex than it was previously believed to be and is defined by a combination of reactions at any given temperature. At all temperatures, the direct N-NO(2) homolysis prevails with the activation barrier at 38.1 kcal/mol. The nitro-nitrite isomerization and the HONO elimination, with the activation barriers at 46.3 and 39.4 kcal/mol, respectively, are slow reactions at all temperatures. The obtained conclusions provide a consistent interpretation for the reported experimental data.

  14. Correlated uncertainties in Monte Carlo reaction rate calculations

    NASA Astrophysics Data System (ADS)

    Longland, Richard

    2017-07-01

    Context. Monte Carlo methods have enabled nuclear reaction rates from uncertain inputs to be presented in a statistically meaningful manner. However, these uncertainties are currently computed assuming no correlations between the physical quantities that enter those calculations. This is not always an appropriate assumption. Astrophysically important reactions are often dominated by resonances, whose properties are normalized to a well-known reference resonance. This insight provides a basis from which to develop a flexible framework for including correlations in Monte Carlo reaction rate calculations. Aims: The aim of this work is to develop and test a method for including correlations in Monte Carlo reaction rate calculations when the input has been normalized to a common reference. Methods: A mathematical framework is developed for including correlations between input parameters in Monte Carlo reaction rate calculations. The magnitude of those correlations is calculated from the uncertainties typically reported in experimental papers, where full correlation information is not available. The method is applied to four illustrative examples: a fictional 3-resonance reaction, 27Al(p, γ)28Si, 23Na(p, α)20Ne, and 23Na(α, p)26Mg. Results: Reaction rates at low temperatures that are dominated by a few isolated resonances are found to minimally impacted by correlation effects. However, reaction rates determined from many overlapping resonances can be significantly affected. Uncertainties in the 23Na(α, p)26Mg reaction, for example, increase by up to a factor of 5. This highlights the need to take correlation effects into account in reaction rate calculations, and provides insight into which cases are expected to be most affected by them. The impact of correlation effects on nucleosynthesis is also investigated.

  15. 15 CFR 710.1 - Definitions of terms used in the Chemical Weapons Convention Regulations (CWCR).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... chemical means its conversion into another chemical via a chemical reaction. Unreacted material must be... formed through chemical reaction that is subsequently reacted to form another chemical. ITAR. Means the... formation of a chemical through chemical reaction, including biochemical or biologically mediated reaction...

  16. Influences of growth parameters on the reaction pathway during GaN synthesis

    NASA Astrophysics Data System (ADS)

    Zhang, Zhi; Liu, Zhongyi; Fang, Haisheng

    2018-01-01

    Gallium nitride (GaN) film growth is a complicated physical and chemical process including fluid flow, heat transfer, species transport and chemical reaction. Study of the reaction mechanism, i.e., the reaction pathway, is important for optimizing the growth process in the actual manufacture. In the paper, the growth pathway of GaN in a closed-coupled showerhead metal-organic chemical vapor deposition (CCS-MOCVD) reactor is investigated in detail using computational fluid dynamics (CFD). Influences of the process parameters, such as the chamber pressure, the inlet temperature, the susceptor temperature and the pre-exponential factor, on the reaction pathway are examined. The results show that increases of the chamber pressure or the inlet temperature, as well as reductions of the susceptor temperature or the pre-exponential factor lead to the adduct route dominating the growth. The deposition rate contributed by the decomposition route, however, can be enhanced dramatically by increasing the inlet temperature, the susceptor temperature and the pre-exponential factor.

  17. Perspective: chemical dynamics simulations of non-statistical reaction dynamics

    PubMed Central

    Ma, Xinyou; Hase, William L.

    2017-01-01

    Non-statistical chemical dynamics are exemplified by disagreements with the transition state (TS), RRKM and phase space theories of chemical kinetics and dynamics. The intrinsic reaction coordinate (IRC) is often used for the former two theories, and non-statistical dynamics arising from non-IRC dynamics are often important. In this perspective, non-statistical dynamics are discussed for chemical reactions, with results primarily obtained from chemical dynamics simulations and to a lesser extent from experiment. The non-statistical dynamical properties discussed are: post-TS dynamics, including potential energy surface bifurcations, product energy partitioning in unimolecular dissociation and avoiding exit-channel potential energy minima; non-RRKM unimolecular decomposition; non-IRC dynamics; direct mechanisms for bimolecular reactions with pre- and/or post-reaction potential energy minima; non-TS theory barrier recrossings; and roaming dynamics. This article is part of the themed issue ‘Theoretical and computational studies of non-equilibrium and non-statistical dynamics in the gas phase, in the condensed phase and at interfaces’. PMID:28320906

  18. Development of new UV-vis spectroscopic microwave-assisted method for determination of glucose in pharmaceutical samples

    NASA Astrophysics Data System (ADS)

    Mabood, Fazal; Hussain, Z.; Haq, H.; Arian, M. B.; Boqué, R.; Khan, K. M.; Hussain, K.; Jabeen, F.; Hussain, J.; Ahmed, M.; Alharasi, A.; Naureen, Z.; Hussain, H.; Khan, A.; Perveen, S.

    2016-01-01

    A new UV-Visible spectroscopic method assisted with microwave for the determination of glucose in pharmaceutical formulations was developed. In this study glucose solutions were oxidized by ammonium molybdate in the presence of microwave energy and reacted with aniline to produce a colored solution. Optimum conditions of the reaction including wavelength, temperature, and pH of the medium and relative concentration ratio of the reactants were investigated. It was found that the optimal wavelength for the reaction is 610 nm, the optimal reaction time is 80 s, the optimal reaction temperature is 160 °C, the optimal reaction pH is 4, and the optimal concentration ratio aniline/ammonium molybdate solution was found to be 1:1. The limits of detection and quantification of the method are 0.82 and 2.75 ppm for glucose solution, respectively. The use of microwaves improved the speed of the method while the use of aniline improved the sensitivity of the method by shifting the wavelength.

  19. Modeling the suppression of boron transient enhanced diffusion in silicon by substitutional carbon incorporation

    NASA Astrophysics Data System (ADS)

    Ngau, Julie L.; Griffin, Peter B.; Plummer, James D.

    2001-08-01

    Recent work has indicated that the suppression of boron transient enhanced diffusion (TED) in carbon-rich Si is caused by nonequilibrium Si point defect concentrations, specifically the undersaturation of Si self-interstitials, that result from the coupled out-diffusion of carbon interstitials via the kick-out and Frank-Turnbull reactions. This study of boron TED reduction in Si1-x-yGexCy during 750 °C inert anneals has revealed that the use of an additional reaction that further reduces the Si self-interstitial concentration is necessary to describe accurately the time evolved diffusion behavior of boron. In this article, we present a comprehensive model which includes {311} defects, boron-interstitial clusters, a carbon kick-out reaction, a carbon Frank-Turnbull reaction, and a carbon interstitial-carbon substitutional (CiCs) pairing reaction that successfully simulates carbon suppression of boron TED at 750 °C for anneal times ranging from 10 s to 60 min.

  20. Cytochemical Localization of Glycolate Dehydrogenase in Mitochondria of Chlamydomonas1

    PubMed Central

    Beezley, Belinda B.; Gruber, Peter J.; Frederick, Sue Ellen

    1976-01-01

    Mildly disrupted cells of Chlamydomonas reinhardi Dangeard were incubated in a reaction medium containing glycolate, ferricyanide, and cupric ions, and then processed for electron microscopy. As a result of the cytochemical treatment, an electron opaque product was deposited specifically in the outer compartment of mitochondria; other cellular components, including microbodies, did not accumulate stain. Incubation with d-lactate yielded similar results, while treatment with l-lactate produced only a weak reaction. Oxamate, which inhibits glycolate dehydrogenase activity in cell-free extracts, also inhibited the cytochemical reaction. These findings demonstrate in situ that glycolate dehydrogenase is localized in mitochondria, and thus corroborate similar conclusions reached on the basis of enzymic studies of isolated algal organelles. Images PMID:16659670

Top