Science.gov

Sample records for reca-mediated strand invasion

  1. Uncovering the microscopic mechanism of strand exchange during RecA mediated homologous recombination using all-atom molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Shankla, Manish; Yoo, Jejoong; Aksimentiev, Aleksei

    2012-02-01

    Homologous recombination (HR) is a key step during the repair process of double-stranded DNA (dsDNA) breakage. RecA is a protein that mediates HR in bacteria. RecA monomers polymerize on a single-stranded DNA (ssDNA) separated from the broken dsDNA to form a helical filament, thus allowing strand exchange to occur. Recent crystal structures depict each RecA monomer in contact with three contiguous nucleotides called DNA triplets. Surprisingly, the conformation of each triplet is similar to that of a triplet in B-form DNA. However, in the filament the neighboring triplets are separated by loops of the RecA proteins. Single molecule experiments demonstrated that strand exchange propagation occurs in 3 base-pair increments. However, the temporal resolution of the experiments was insufficient to determine the exact molecular mechanism of the triplet propagation. Using all-atom molecular dynamics simulations, we investigated the effect of both the RecA protein and the conformation of the bound ssDNA fragment on the stability of the duplex DNA intermediate formed during the strand-exchange process. Specifically, we report simulations of force-induced unzipping of duplex DNA in the presence and absence of the RecA filament that explored the effect of the triplet ladder conformation.

  2. Strand invasion promoted by recombination protein of coliphage

    NASA Astrophysics Data System (ADS)

    Rybalchenko, Nataliya; Golub, Efim I.; Bi, Baoyuan; Radding, Charles M.

    2004-12-01

    Studies of phage in vivo have indicated that its own recombination enzymes, protein and exonuclease, are capable of catalyzing two dissimilar pathways of homologous recombination that are widely distributed in nature: single-strand annealing and strand invasion. The former is an enzymatic splicing of overlapping ends of broken homologous DNA molecules, whereas the latter is characterized by the formation of a three-stranded synaptic intermediate and subsequent strand exchange. Previous studies in vitro have shown that protein has annealing activity, and that exonuclease, acting on branched substrates, can produce a perfect splice that requires only ligation for completion. The present study shows that protein can initiate strand invasion in vitro, as evidenced both by the formation of displacement loops (D-loops) in superhelical DNA and by strand exchange between colinear single-stranded and double-stranded molecules. Thus, protein can catalyze steps that are central to both strand annealing and strand invasion pathways of recombination. These observations add protein to a set of diverse proteins that appear to promote recognition of homology by a unitary mechanism governed by the intrinsic dynamic properties of base pairs in DNA. genetic recombination | phage λ

  3. Strand displacement and duplex invasion into double-stranded DNA by pyrrolidinyl peptide nucleic acids.

    PubMed

    Bohländer, Peggy R; Vilaivan, Tirayut; Wagenknecht, Hans-Achim

    2015-09-21

    The so-called acpcPNA system bears a peptide backbone consisting of 4'-substituted proline units with (2'R,4'R) configuration in an alternating combination with (2S)-amino-cyclopentane-(1S)-carboxylic acids. acpcPNA forms exceptionally stable hybrids with complementary DNA. We demonstrate herein (i) strand displacements by single-stranded DNA from acpcPNA-DNA hybrids, and by acpcPNA strands from DNA duplexes, and (ii) strand invasions by acpcPNA into double-stranded DNA. These processes were studied in vitro using synthetic oligonucleotides and by means of our concept of wavelength-shifting fluorescent nucleic acid probes, including fluorescence lifetime measurements that allow quantifying energy transfer efficiencies. The strand displacements of preannealed 14mer acpcPNA-7mer DNA hybrids consecutively by 10mer and 14mer DNA strands occur with rather slow kinetics but yield high fluorescence color ratios (blue : yellow or blue : red), fluorescence intensity enhancements, and energy transfer efficiencies. Furthermore, 14mer acpcPNA strands are able to invade into 30mer double-stranded DNA, remarkably with quantitative efficiency in all studied cases. These processes can also be quantified by means of fluorescence. This remarkable behavior corroborates the extraordinary versatile properties of acpcPNA. In contrast to conventional PNA systems which require 3 or more equivalents PNA, only 1.5 equivalents acpcPNA are sufficient to get efficient double duplex invasion. Invasions also take place even in the presence of 250 mM NaCl which represents an ionic strength nearly twice as high as the physiological ion concentration. These remarkable results corroborate the extraordinary properties of acpcPNA, and thus acpcPNA represents an eligible tool for biological analytics and antigene applications.

  4. A strand invasion 3' polymerization intermediate of mammalian homologous recombination.

    PubMed

    Si, Weiduo; Mundia, Maureen M; Magwood, Alissa C; Mark, Adam L; McCulloch, Richard D; Baker, Mark D

    2010-06-01

    Initial events in double-strand break repair by homologous recombination in vivo involve homology searching, 3' strand invasion, and new DNA synthesis. While studies in yeast have contributed much to our knowledge of these processes, in comparison, little is known of the early events in the integrated mammalian system. In this study, a sensitive PCR procedure was developed to detect the new DNA synthesis that accompanies mammalian homologous recombination. The test system exploits a well-characterized gene targeting assay in which the transfected vector bears a gap in the region of homology to the single-copy chromosomal immunoglobulin mu heavy chain gene in mouse hybridoma cells. New DNA synthesis primed by invading 3' vector ends copies chromosomal mu-gene template sequences excluded by the vector-borne double-stranded gap. Following electroporation, specific 3' extension products from each vector end are detected with rapid kinetics: they appear after 0.5 hr, peak at 3-6 hr, and then decline, likely as a result of the combined effects of susceptibility to degradation and cell division. New DNA synthesis from each vector 3' end extends at least approximately 1000 nucleotides into the gapped region, but the efficiency declines markedly within the first approximately 200 nucleotides. Over this short distance, an average frequency of 3' extension for the two invading vector ends is approximately 0.007 events/vector backbone. DNA sequencing reveals precise copying of the cognate chromosomal mu-gene template. In unsynchronized cells, 3' extension is sensitive to aphidicolin supporting involvement of a replicative polymerase. Analysis suggests that the vast majority of 3' extensions reside on linear plasmid molecules.

  5. Quantitative, non-invasive imaging of radiation-induced DNA double strand breaks in vivo

    PubMed Central

    Li, Wenrong; Li, Fang; Huang, Qian; Shen, Jingping; Wolf, Frank; He, Yujun; Liu, Xinjian; Hu, Y. Angela; Bedford, Joel. S.; Li, Chuan-Yuan

    2011-01-01

    DNA double strand breaks is a major form of DNA damage and a key mechanism through which radiotherapy and some chemotherapeutic agents kill cancer cells. Despite its importance, measuring DNA double strand breaks is still a tedious task that is normally carried out by gel electrophoresis or immunofluorescence staining. Here we report a novel approach to image and quantify DNA double strand breaks in live mammalian cells through bi-fragment luciferase reconstitution. N- and C- terminal fragments of firefly luciferase gene were fused with H2AX and MDC1 genes, respectively. Our strategy was based on the established fact that at the sites of DNA double strand breaks, H2AX protein is phosphoryated and physically associates with the MDC1 protein, thus bringing together N- and C- luciferase fragments and reconstituting luciferase activity. Our strategy allowed serial, non-invasive quantification of DNA double strand breaks in cells irradiated with x-rays and 56Fe ions. Furthermore, it allowed for the evaluation of DNA double strand breaks (DSBs) non-invasively in vivo in irradiated tumors over two weeks. Surprisingly, we detected a second wave of DSB induction in irradiated tumor cells days after radiation exposure in addition to the initial rapid induction of DSBs. We conclude that our new split-luciferase based method for imaging γ-H2AX-MDC1 interaction is a powerful new tool to study DNA double strand break repair kinetics in vivo with considerable advantage for experiments requiring observations over an extended period of time. PMID:21527553

  6. Equilibrious Strand Exchange Promoted by DNA Conformational Switching

    NASA Astrophysics Data System (ADS)

    Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang

    2013-01-01

    Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.

  7. Site-Selective Binding of Nanoparticles to Double-Stranded DNA via Peptide Nucleic Acid "Invasion"

    SciTech Connect

    Stadler, A.L.; van der Lelie, D.; Sun, D.; Maye, M. M.; Gang, O.

    2011-04-01

    We demonstrate a novel method for by-design placement of nano-objects along double-stranded (ds) DNA. A molecular intercalator, designed as a peptide nucleic acid (PNA)-DNA chimera, is able to invade dsDNA at the PNA-side due to the hybridization specificity between PNA and one of the duplex strands. At the same time, the single-stranded (ss) DNA tail of the chimera, allows for anchoring of nano-objects that have been functionalized with complementary ssDNA. The developed method is applied for interparticle attachment and for the fabrication of particle clusters using a dsDNA template. This method significantly broadens the molecular toolbox for constructing nanoscale systems by including the most conventional not yet utilized DNA motif, double helix DNA.

  8. Functional Outcomes of Achilles Tendon Minimally Invasive Repair Using 4- and 6-Strand Nonabsorbable Suture: A Cohort Comparison Study

    PubMed Central

    Carmont, Michael R.; Zellers, Jennifer A.; Brorsson, Annelie; Olsson, Nicklas; Nilsson-Helander, Katarina; Karlsson, Jon; Silbernagel, Karin Grävare

    2017-01-01

    Background: The aim of management of Achilles tendon rupture is to reduce tendon lengthening and maximize function while reducing the rerupture rate and minimizing other complications. Purpose: To determine changes in Achilles tendon resting angle (ATRA), heel-rise height, patient-reported outcomes, return to play, and occurrence of complications after minimally invasive repair of Achilles tendon ruptures using nonabsorbable sutures. Study Design: Cohort study; Level of evidence, 3. Methods: Between March 2013 and August 2015, a total of 70 patients (58 males, 12 females) with a mean age of 42 ± 8 years were included and evaluated at 6 weeks and 3, 6, 9, and 12 months after repair of an Achilles tendon rupture. Surgical repair was performed using either 4-strand or 6-strand nonabsorbable sutures. After surgery, patients were mobilized, fully weightbearing using a functional brace. Early active movement was permitted starting at 2 weeks. Results: There were no significant differences in the ATRA, Achilles Tendon Total Rupture Score (ATRS), and Heel-Rise Height Index (HRHI) between the 4- and 6-strand repairs. The mean (SD) relative ATRA was –13.1° (6.6°) (dorsiflexion) following injury; this was reduced to 7.6° (4.8°) (plantar flexion) directly after surgery. During initial rehabilitation at 6 weeks, the relative ATRA was 0.6° (7.4°) (neutral) and –7.0° (5.3°) (dorsiflexion) at 3 months, after which ATRA improved significantly with time to 12 months (P = .005). At 12 months, the median ATRS was 93 (range, 35-100), and the mean (SD) HRHI and Heel-Rise Repetition Index were 81% (0.22%) and 82.9% (0.17%), respectively. The relative ATRA at 3 and 12 months correlated with HRHI (r = 0.617, P < .001 and r = 0.535, P < .001, respectively). Conclusion: Increasing the number of suture strands from 4 to 6 does not alter the ATRA or HRHI after minimally invasive Achilles tendon repair. The use of a nonabsorbable suture during minimally invasive repair when used

  9. Functional Outcomes of Achilles Tendon Minimally Invasive Repair Using 4- and 6-Strand Nonabsorbable Suture: A Cohort Comparison Study.

    PubMed

    Carmont, Michael R; Zellers, Jennifer A; Brorsson, Annelie; Olsson, Nicklas; Nilsson-Helander, Katarina; Karlsson, Jon; Silbernagel, Karin Grävare

    2017-08-01

    The aim of management of Achilles tendon rupture is to reduce tendon lengthening and maximize function while reducing the rerupture rate and minimizing other complications. To determine changes in Achilles tendon resting angle (ATRA), heel-rise height, patient-reported outcomes, return to play, and occurrence of complications after minimally invasive repair of Achilles tendon ruptures using nonabsorbable sutures. Cohort study; Level of evidence, 3. Between March 2013 and August 2015, a total of 70 patients (58 males, 12 females) with a mean age of 42 ± 8 years were included and evaluated at 6 weeks and 3, 6, 9, and 12 months after repair of an Achilles tendon rupture. Surgical repair was performed using either 4-strand or 6-strand nonabsorbable sutures. After surgery, patients were mobilized, fully weightbearing using a functional brace. Early active movement was permitted starting at 2 weeks. There were no significant differences in the ATRA, Achilles Tendon Total Rupture Score (ATRS), and Heel-Rise Height Index (HRHI) between the 4- and 6-strand repairs. The mean (SD) relative ATRA was -13.1° (6.6°) (dorsiflexion) following injury; this was reduced to 7.6° (4.8°) (plantar flexion) directly after surgery. During initial rehabilitation at 6 weeks, the relative ATRA was 0.6° (7.4°) (neutral) and -7.0° (5.3°) (dorsiflexion) at 3 months, after which ATRA improved significantly with time to 12 months (P = .005). At 12 months, the median ATRS was 93 (range, 35-100), and the mean (SD) HRHI and Heel-Rise Repetition Index were 81% (0.22%) and 82.9% (0.17%), respectively. The relative ATRA at 3 and 12 months correlated with HRHI (r = 0.617, P < .001 and r = 0.535, P < .001, respectively). Increasing the number of suture strands from 4 to 6 does not alter the ATRA or HRHI after minimally invasive Achilles tendon repair. The use of a nonabsorbable suture during minimally invasive repair when used together with accelerated rehabilitation did not prevent the

  10. Single-stranded RNA viruses infecting the invasive Argentine ant, Linepithema humile.

    PubMed

    Gruber, Monica A M; Cooling, Meghan; Baty, James W; Buckley, Kevin; Friedlander, Anna; Quinn, Oliver; Russell, Jessica F E J; Sébastien, Alexandra; Lester, Philip J

    2017-06-12

    Social insects host a diversity of viruses. We examined New Zealand populations of the globally widely distributed invasive Argentine ant (Linepithema humile) for RNA viruses. We used metatranscriptomic analysis, which identified six potential novel viruses in the Dicistroviridae family. Of these, three contigs were confirmed by Sanger sequencing as Linepithema humile virus-1 (LHUV-1), a novel strain of Kashmir bee virus (KBV) and Black queen cell virus (BQCV), while the others were chimeric or misassembled sequences. We extended the known sequence of LHUV-1 to confirm its placement in the Dicistroviridae and categorised its relationship to closest relatives, which were all viruses infecting Hymenoptera. We examined further for known viruses by mapping our metatranscriptomic sequences to all viral genomes, and confirmed KBV, BQCV, LHUV-1 and Deformed wing virus (DWV) presence using qRT-PCR. Viral replication was confirmed for DWV, KBV and LHUV-1. Viral titers in ants were higher in the presence of honey bee hives. Argentine ants appear to host a range of' honey bee' pathogens in addition to a virus currently described only from this invasive ant. The role of these viruses in the population dynamics of the ant remain to be determined, but offer potential targets for biocontrol approaches.

  11. Reverse transcription strand invasion based amplification (RT-SIBA): a method for rapid detection of influenza A and B.

    PubMed

    Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark

    2016-06-01

    Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.

  12. Saccharomyces cerevisiae Dmc1 and Rad51 proteins preferentially function with Tid1 and Rad54 proteins, respectively, to promote DNA strand invasion during genetic recombination.

    PubMed

    Nimonkar, Amitabh V; Dombrowski, Christopher C; Siino, Joseph S; Stasiak, Alicja Z; Stasiak, Andrzej; Kowalczykowski, Stephen C

    2012-08-17

    The Saccharomyces cerevisiae Dmc1 and Tid1 proteins are required for the pairing of homologous chromosomes during meiotic recombination. This pairing is the precursor to the formation of crossovers between homologs, an event that is necessary for the accurate segregation of chromosomes. Failure to form crossovers can have serious consequences and may lead to chromosomal imbalance. Dmc1, a meiosis-specific paralog of Rad51, mediates the pairing of homologous chromosomes. Tid1, a Rad54 paralog, although not meiosis-specific, interacts with Dmc1 and promotes crossover formation between homologs. In this study, we show that purified Dmc1 and Tid1 interact physically and functionally. Dmc1 forms stable nucleoprotein filaments that can mediate DNA strand invasion. Tid1 stimulates Dmc1-mediated formation of joint molecules. Under conditions optimal for Dmc1 reactions, Rad51 is specifically stimulated by Rad54, establishing that Dmc1-Tid1 and Rad51-Rad54 function as specific pairs. Physical interaction studies show that specificity in function is not dictated by direct interactions between the proteins. Our data are consistent with the hypothesis that Rad51-Rad54 function together to promote intersister DNA strand exchange, whereas Dmc1-Tid1 tilt the bias toward interhomolog DNA strand exchange.

  13. Restriction Endonucleases from Invasive Neisseria gonorrhoeae Cause Double-Strand Breaks and Distort Mitosis in Epithelial Cells during Infection

    PubMed Central

    Weyler, Linda; Engelbrecht, Mattias; Mata Forsberg, Manuel; Brehwens, Karl; Vare, Daniel; Vielfort, Katarina; Wojcik, Andrzej; Aro, Helena

    2014-01-01

    The host epithelium is both a barrier against, and the target for microbial infections. Maintaining regulated cell growth ensures an intact protective layer towards microbial-induced cellular damage. Neisseria gonorrhoeae infections disrupt host cell cycle regulation machinery and the infection causes DNA double strand breaks that delay progression through the G2/M phase. We show that intracellular gonococci upregulate and release restriction endonucleases that enter the nucleus and damage human chromosomal DNA. Bacterial lysates containing restriction endonucleases were able to fragment genomic DNA as detected by PFGE. Lysates were also microinjected into the cytoplasm of cells in interphase and after 20 h, DNA double strand breaks were identified by 53BP1 staining. In addition, by using live-cell microscopy and NHS-ester stained live gonococci we visualized the subcellular location of the bacteria upon mitosis. Infected cells show dysregulation of the spindle assembly checkpoint proteins MAD1 and MAD2, impaired and prolonged M-phase, nuclear swelling, micronuclei formation and chromosomal instability. These data highlight basic molecular functions of how gonococcal infections affect host cell cycle regulation, cause DNA double strand breaks and predispose cellular malignancies. PMID:25460012

  14. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    PubMed

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  15. Strand Invasion Based Amplification (SIBA®): A Novel Isothermal DNA Amplification Technology Demonstrating High Specificity and Sensitivity for a Single Molecule of Target Analyte

    PubMed Central

    Hoser, Mark J.; Mansukoski, Hannu K.; Morrical, Scott W.; Eboigbodin, Kevin E.

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2′-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella. PMID:25419812

  16. Optimized polymerase chain reaction-based single-strand conformation polymorphism analysis of p53 gene applied to Bulgarian patients with invasive breast cancer.

    PubMed

    Krasteva, M E; Garanina, Z; Georgieva, E I

    2003-11-01

    During the last few decades a substantial amount of evidence has accumulated proving that the abrogation of the normal p53 pathway is a critical step in the initiation and progression of tumors. Decoding the genetic mechanisms involved in carcinogenesis requires screening for consistent genetic tumor alterations, including those concerning the p53 gene. Thus, practical, efficient, and inexpensive techniques for accurate determination of p53 mutational status are needed. Polymerase chain reaction/single-strand conformation polymorphism (PCR-SSCP) analysis is considered to be a useful tool to investigate the role of the p53 gene in the development and progression of human cancers. The sensitivity of the method can be increased considerably by varying the experimental conditions. Here we demonstrate a scheme of PCR-SSCP optimization for detection of p53 gene mutations of patients with various cancers. Optimal conditions for PCRSSCP of p53 exons 4-9 are reported. Such PCR-SSCP optimization could allow an increase in the sensitivity and reproducibility of the technique and facilitates screening of large series of patients to assess the clinical significance of p53 mutations in human cancers. Using the optimized PCR-SSCP analysis we screened Bulgarian patients with invasive breast cancer for p53 gene mutations and registered a 33.33% frequency of mutations. To date, there are no data concerning the p53 status of Bulgarian breast cancer patients. Screening for p53 gene mutations enables an accurate and routine determination of the p53 status of patients with cancer and may be applied in clinical oncology to cancer diagnosis, prediction of prognosis and response to treatment.

  17. Evidence for hydrophobic catalysis of DNA strand exchange.

    PubMed

    Feng, B; Westerlund, F; Nordén, B

    2015-04-30

    The catalytic role of hydrophobic co-solutes in DNA strand exchange is demonstrated by FRET kinetics. Two mechanisms that contribute to this are base stacking destabilisation and nucleation-promoted DNA strand invasion. We propose that hydrophobic catalysis is involved in the strand-exchange activity of recombination enzymes.

  18. Stressed Kevlar strand test

    SciTech Connect

    Golopol, H.; Clarkson, J.; Moore, R.; Hetherington, N.

    1981-09-10

    Kevlar is a polyaramid fiber used in fiber composites. In order to characterize this material, we determined the effect of time, temperature, and chemical environment on the strength retention of stressed Kevlar strands. In this work, we applied a stress load of 20% of the ultimate tensile strength (UTS). Strands were hung with a suitable weight in a closed container. Each container was then provided with its own heater and chemical environment. No significant loss of strength retention was found on these stressed strands. 4 figures, 5 tables.

  19. Classifying Saturn's F Ring Strands

    NASA Astrophysics Data System (ADS)

    Albers, Nicole; Sremcevic, M.; Esposito, L. W.; Colwell, J. E.

    2009-09-01

    The Cassini Ultraviolet Imaging Spectrograph (UVIS) High Speed Photometer (HSP) has recorded more than 113 stellar occultations by Saturn's F ring providing measurements with ring plane resolutions of a few dozen meters and better. Inner and outer F ring strands have been seen throughout the Cassini mission where they revealed themselves as non-continuous, azimuthally and temporally highly variable structures. In the light of a more accurate orbit description of the F ring core we find evidence for a ring that becomes dynamically more active as the system approaches anti-apse alignment with Prometheus. This is consistent with the observed increased strand activity. A recent strand that morphologically resembles the core is the strongest seen to date and points to the intricate relation between core and strands indicating the strands' violent creation. Using more than 150 identifications of various strands, we trace their kinematics and infer dynamical timescales and photometric properties. Implications for the dynamical evolution of the F ring will be discussed. This research was supported by the Cassini Project.

  20. Investigating Invasives

    ERIC Educational Resources Information Center

    Lightbody, Mary

    2008-01-01

    Invasive species, commonly known as "invasives," are nonnative plants, animals, and microbes that completely take over and change an established ecosystem. The consequences of invasives' spread are significant. In fact, many of the species that appear on the Endangered Species list are threatened by invasives. Therefore, the topic of invasive…

  1. Investigating Invasives

    ERIC Educational Resources Information Center

    Lightbody, Mary

    2008-01-01

    Invasive species, commonly known as "invasives," are nonnative plants, animals, and microbes that completely take over and change an established ecosystem. The consequences of invasives' spread are significant. In fact, many of the species that appear on the Endangered Species list are threatened by invasives. Therefore, the topic of invasive…

  2. Cryptography with DNA binary strands.

    PubMed

    Leier, A; Richter, C; Banzhaf, W; Rauhe, H

    2000-06-01

    Biotechnological methods can be used for cryptography. Here two different cryptographic approaches based on DNA binary strands are shown. The first approach shows how DNA binary strands can be used for steganography, a technique of encryption by information hiding, to provide rapid encryption and decryption. It is shown that DNA steganography based on DNA binary strands is secure under the assumption that an interceptor has the same technological capabilities as sender and receiver of encrypted messages. The second approach shown here is based on steganography and a method of graphical subtraction of binary gel-images. It can be used to constitute a molecular checksum and can be combined with the first approach to support encryption. DNA cryptography might become of practical relevance in the context of labelling organic and inorganic materials with DNA 'barcodes'.

  3. Report on marine mammal stranding

    NASA Astrophysics Data System (ADS)

    Kumar, Mohi

    2006-06-01

    The U.S. National Oceanic and Atmospheric Administration (NOAA) released a report on 27 April indicating that U.S. Navy sonar transmissions may have played a role in the stranding of more than 150 melon-headed whales on 3 July 2004 off the coast of Kauai, Hawaii. At the time of the stranding, which resulted in one whale death, the Navy was preparing to conduct sonar activities as part of a military exercise. The report notes that six naval surface vessels transiting to the area on the previous night intermittenly transmitted mid-frequency active sonar. That activity is ``a plausible, if not likely, contributing factor'' to the stranding event. There was no significant weather, natural oceanographic event, or known biological factors that would explain the animals' movement into the bay nor the group's continued presence in the bay, according to report lead author Teri Rowles, NOAA marine mammal veterinarian.

  4. Double stranded nucleic acid biochips

    DOEpatents

    Chernov, Boris; Golova, Julia

    2006-05-23

    This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

  5. Invasive Candidiasis

    MedlinePlus

    ... Invasive candidiasis is an infection caused by a yeast (a type of fungus) called Candida . Unlike Candida ... mouth and throat (also called “thrush”) or vaginal “yeast infections,” invasive candidiasis is a serious infection that ...

  6. Invasive Species

    EPA Pesticide Factsheets

    Invasive species have significantly changed the Great Lakes ecosystem. An invasive species is a plant or animal that is not native to an ecosystem, and whose introduction is likely to cause economic, human health, or environmental damage.

  7. Microwave drying of wood strands

    Treesearch

    Guanben Du; Siqun Wang; Zhiyong Cai

    2005-01-01

    Characteristics of microwave drying of wood strands with different initial moisture contents and geometries were investigated using a commercial small microwave oven under different power inputs. Temperature and moisture changes along with the drying efficiency were examined at different drying scenarios. Extractives were analyzed using gas chromatography=mass...

  8. Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.

    PubMed

    Ward, Jordan D; Muzzini, Diego M; Petalcorin, Mark I R; Martinez-Perez, Enrique; Martin, Julie S; Plevani, Paolo; Cassata, Giuseppe; Marini, Federica; Boulton, Simon J

    2010-01-29

    Homologous recombination (HR) is essential for repair of meiotic DNA double-strand breaks (DSBs). Although the mechanisms of RAD-51-DNA filament assembly and strand exchange are well characterized, the subsequent steps of HR are less well defined. Here, we describe a synthetic lethal interaction between the C. elegans helicase helq-1 and RAD-51 paralog rfs-1, which results in a block to meiotic DSB repair after strand invasion. Whereas RAD-51-ssDNA filaments assemble at meiotic DSBs with normal kinetics in helq-1, rfs-1 double mutants, persistence of RAD-51 foci and genetic interactions with rtel-1 suggest a failure to disassemble RAD-51 from strand invasion intermediates. Indeed, purified HELQ-1 and RFS-1 independently bind to and promote the disassembly of RAD-51 from double-stranded, but not single-stranded, DNA filaments via distinct mechanisms in vitro. These results indicate that two compensating activities are required to promote postsynaptic RAD-51 filament disassembly, which are collectively essential for completion of meiotic DSB repair.

  9. Hyperchromicity and strand separation in bacterial DNA.

    PubMed

    FREIFELDER, D; DAVISON, P F

    1962-05-01

    Studies of the per cent of strand separation of N(14)-N(15) hybrid coli DNA heated to various temperatures in formaldehyde have shown that the process of strand separation is a function of temperature and formaldehyde concentration and is directly related to the measured hyperchromicity. No strands separate until about 75 per cent of full hyperchromicity is obtained, and even at apparently full hyperchromicity a large fraction of the strands may be held together, possibly by guanine-cytosine-rich regions.

  10. Factors that Determine the Efficiency of HIV-1 Strand Transfer Initiated at a Specific Site

    PubMed Central

    Rigby, Sean T.; Van Nostrand, Keith P.; Rose, April E.; Gorelick, Robert J.; Mathews, David H.; Bambara, Robert A.

    2010-01-01

    Summary HIV-1 employs strand transfer for recombination between the two viral genomes. We previously provided evidence that strand transfer proceeds by an invasion-mediated mechanism, in which a DNA segment on the original RNA template is invaded by a second RNA template at a gap site. The initial RNA-DNA hybrid then expands until the DNA is fully transferred. Ribonuclease H (RNase H) cleavages and nucleocapsid protein (NC) were required for long distance propagation of the hybrid. The evaluation was performed on a unique substrate with a short gap serving as a pre-created invasion site (PCIS). In our current work, this substrate provided the opportunity to test what factors influence a specific invasion site to support transfer, and distinguish factors that influence invasion site creation from those that impact later steps. RNase H can act in a polymerization-dependent or -independent mode. Polymerization-dependent and -independent RNase H were found to be important to create efficiently-used invasion sites in the primer-donor complex, with or without NC. Propagation and terminus transfer steps, emanating from a PCIS in the presence of NC, were stimulated by polymerization-dependent but not -independent RNase H. RNase H can carry out primary and secondary cleavages during synthesis. While both modes of cleavage promoted invasion, only primary cleavage promoted propagation in the presence of NC in our system. These observations suggest that once invasion is initiated at a short gap, it can propagate through an adjacent region interrupted only by nicks, with help by NC. We considered the possibility that propagation solely by strand exchange was a significant contributor to transfers. However, it did not promote transfer, even if synthetic progress of the RT was intentionally slowed, which is consistent with strand exchange by random walk in which rate declines precipitously with distance. PMID:19853618

  11. A sensitive method for the quantification of virion-sense and complementary-sense DNA strands of circular single-stranded DNA viruses

    PubMed Central

    Rodríguez-Negrete, Edgar A.; Sánchez-Campos, Sonia; Cañizares, M. Carmen; Navas-Castillo, Jesús; Moriones, Enrique; Bejarano, Eduardo R.; Grande-Pérez, Ana

    2014-01-01

    Circular single-stranded DNA (ssDNA) viruses are the smallest viruses known to infect eukaryotes. High recombination and mutation rates have conferred these viruses with an evolutionary potential that has facilitated their emergence. Their damaging effects on livestock (circoviruses) and crops (geminiviruses and nanoviruses), and the ubiquity of anelloviruses in human populations and other mammalian species, have resulted in increased interest in better understanding their epidemiology and infection mechanisms. Circular ssDNA viral replication involves the synthesis of dsDNA intermediates containing complementary-sense (CS) and virion-sense (VS) strands. Precise quantification of VS and CS accumulation during viral infections can provide insights into the molecular mechanisms underlying viral replication and the host invasion process. Although qPCR protocols for quantifying viral molecules exist, none of them discriminate VS and CS strands. Here, using a two-step qPCR protocol we have quantified VS and CS molecule accumulation during the infection process of Tomato yellow leaf curl virus (TYLCV) and Tomato yellow leaf curl Sardinia virus (TYLCSV) (genus Begomovirus, family Geminiviridae). Our results show that the VS/CS strand ratio and overall dsDNA amounts vary throughout the infection process. Moreover, we show that these values depend on the virus-host combination, and that most CS strands are present as double-stranded molecules. PMID:25241765

  12. A general solution for opening double-stranded DNA for isothermal amplification

    PubMed Central

    Chen, Gangyi; Dong, Juan; Yuan, Yi; Li, Na; Huang, Xin; Cui, Xin; Tang, Zhuo

    2016-01-01

    Nucleic acid amplification is the core technology of molecular biology and genetic engineering. Various isothermal amplification techniques have been developed as alternatives to polymerase chain reaction (PCR). However, most of these methods can only detect single stranded nucleic acid. Herein, we put forward a simple solution for opening double-stranded DNA for isothermal detection methods. The strategy employs recombination protein from E. coli (RecA) to form nucleoprotein complex with single-stranded DNA, which could scan double-stranded template for homologous sites. Then, the nucleoprotein can invade the double-stranded template to form heteroduplex in the presence of ATP, resulting in the strand exchange. The ATP regeneration system could be eliminated by using high concentration of ATP, and the 3′-OH terminal of the invasion strand can be recognized by other DNA modifying enzymes such as DNA polymerase or DNA ligase. Moreover, dATP was found to be a better cofactor for RecA, which make the system more compatible to DNA polymerase. The method described here is a general solution to open dsDNA, serving as a platform to develop more isothermal nucleic acids detection methods for real DNA samples based on it. PMID:27687498

  13. Kinetics of DNA Strand Displacement Systems with Locked Nucleic Acids.

    PubMed

    Olson, Xiaoping; Kotani, Shohei; Yurke, Bernard; Graugnard, Elton; Hughes, William L

    2017-03-30

    Locked nucleic acids (LNAs) are conformationally restricted RNA nucleotides. Their increased thermal stability and selectivity toward their complements make them well-suited for diagnostic and therapeutic applications. Although the structural and thermodynamic properties of LNA-LNA, LNA-RNA, and LNA-DNA hybridizations are known, the kinetic effects of incorporating LNA nucleotides into DNA strand displacement systems are not. Here, we thoroughly studied the strand displacement kinetics as a function of the number and position of LNA nucleotides in DNA oligonucleotides. When compared to that of an all-DNA control, with an identical sequence, the leakage rate constant was reduced more than 50-fold, to an undetectable level, and the invasion rate was preserved for a hybrid DNA/LNA system. The total performance enhancement ratio also increased more than 70-fold when calculating the ratio of the invading rate to the leakage rate constants for a hybrid system. The rational substitution of LNA nucleotides for DNA nucleotides preserves sequence space while improving the signal-to-noise ratio of strand displacement systems. Hybrid DNA/LNA systems offer great potential for high-performance chemical reaction networks that include catalyzed hairpin assemblies, hairpin chain reactions, motors, walkers, and seesaw gates.

  14. Repair of DNA double strand breaks: in vivo biochemistry.

    PubMed

    Sugawara, Neal; Haber, James E

    2006-01-01

    Double strand breaks (DSBs) can cause damage to the genomic integrity of a cell as well as initiate genetic recombination processes. The HO and I-SceI endonucleases from budding yeast have provided a way to study these events by inducing a unique DSB in vivo under the control of a galactose-inducible promoter. The GAL::HO construct has been used extensively to study processes such as nonhomologous end joining, intra- and interchromosomal gene conversion, single strand annealing and break-induced recombination. Synchronously induced DSBs have also been important in the study of the DNA damage checkpoint, adaptation, and recovery pathways of yeast. This chapter describes methods of using GAL::HO to physically monitor the progression of events following a DSB, specifically the events leading to the switching of mating type by gene conversion of MAT using the silent donors at HML and HMR. Southern blot analysis can be used to follow the overall events in this process such as the formation of the DSB and product. Denaturing alkaline gels and slot blot techniques can be employed to follow the 5' to 3' resection of DNA starting at the DSB. After resection, the 3' tail initiates a homology search and then strand invades its homologous sequence at the donor cassette. Polymerase chain reaction is an important means to assay strand invasion and the priming of new DNA synthesis as well as the completion of gene conversion. Methods such as chromatin immunoprecipitation have provided a means to study many proteins that associate with a DSB, including not only recombination proteins, but also proteins involved in nonhomologous end joining, cell cycle arrest, chromatin remodeling, cohesin function, and mismatch repair.

  15. Stranded costs: Is the market paying attention?

    SciTech Connect

    Ros, A.; Domagalski, J.; O`Connor, P.R.

    1996-05-15

    This article is a discussion of the effects of the stranded costs issue on the market and book value of electric utility stocks. Mathematical models were used to determine whether stranded costs, as measured by Moody`s Investor Services and S&P, can explain variability if equity performance as expressed by the market-to-book value ratio. The models adequately explain the variances and show that increased exposure to stranded costs leads to reduced market value.

  16. Hyperchromicity and Strand Separation in Bacterial DNA

    PubMed Central

    Freifelder, David; Davison, Peter F.

    1962-01-01

    Studies of the per cent of strand separation of N14-N15 hybrid coli DNA heated to various temperatures in formaldehyde have shown that the process of strand separation is a function of temperature and formaldehyde concentration and is directly related to the measured hyperchromicity. No strands separate until about 75 per cent of full hyperchromicity is obtained, and even at apparently full hyperchromicity a large fraction of the strands may be held together, possibly by guanine-cytosine-rich regions. PMID:13894962

  17. Thermophoresis of single stranded DNA.

    PubMed

    Reineck, Philipp; Wienken, Christoph J; Braun, Dieter

    2010-01-01

    The manipulation and analysis of biomolecules in native bulk solution is highly desired; however, few methods are available. In thermophoresis, the thermal analog to electrophoresis, molecules are moved along a microscopic temperature gradient. Its theoretical foundation is still under debate, but practical applications for analytics in biology show considerable potential. Here we measured the thermophoresis of highly diluted single stranded DNA using an all-optical capillary approach. Temperature gradients were created locally by an infrared laser. The thermal depletion of oligonucleotides of between 5 and 50 bases in length were investigated by fluorescence at various salt concentrations. To a good approximation, the previously tested capacitor model describes thermophoresis: the Soret coefficient linearly depends on the Debye length and is proportional to the DNA length to the power of 0.35, dictated by the conformation-based size scaling of the diffusion coefficient. The results form the basis for quantitative DNA analytics using thermophoresis.

  18. A Biomechanical Comparison of 4-Strand and 5-Strand Anterior Cruciate Ligament Graft Constructs

    PubMed Central

    Broadhead, Matthew L.; Singla, Animesh A.; Bertollo, Nicky; Broe, David; Walsh, William R.

    2017-01-01

    Hamstring tendon autografts are used for reconstruction of the anterior cruciate ligament. This study tested the hypothesis that a 5-strand hamstring autograft construct is superior in strength to a 4-strand construct. Four-strand and 5-strand tendon grafts constructs were prepared from ovine flexor tendons and then tested in a uniaxial electromechanical load system with suspensory fixation. The 4-strand and 5-strand constructs were pre-conditioned, stress-relaxed and loaded to ultimate failure. Stress-relaxation, stiffness and ultimate load were compared using a one-way ANOVA. There were no statistical differences in stress-relaxation, initial stiffness, secondary stiffness or ultimate load between 4-strand and 5-strand split tendon graft constructs. Inconsistent failure patterns for both 4-strand and 5-strand constructs were observed. The additional strand in the 5-strand construct may be shielded from stress with additional weakness secondary to the use of suspensory fixation. The potential biological benefit of religamentization and bony integration, with more autologous tissue in the intra-articular space and bony tunnels remains unknown. PMID:28286624

  19. Unraveling the strands of Saturn's F ring

    USGS Publications Warehouse

    Murray, C.D.; Gordon, M.K.; Giuliatti, Winter S.M.

    1997-01-01

    Several high-resolution Voyager 2 images of Saturn's F ring show that it is composed of at least four separate, non-intersecting strands extending ~45?? in longitude. Voyager 1 images show that the two brightest strands appear to intersect, giving rise to a "braided" morphology. From a study of all available Voyager images the detectable radial structure is cataloged and reviewed. Previous indications that there is fine material interior to the orbit of the F ring are confirmed. Evidence is presented that a model of four strands with comparable eccentricities and nearly aligned perichrones is consistent with all the Voyager observations. The observed perichrone offset of the two brightest strands suggests a minimum radial separation of ~20 km, which implies intersection of these strands when their finite radial widths are taken into account. The longitude range of such an intersection includes that observed in the Voyager 1 "braid" images. The proximity of these two strands at some longitudes may account for the apparent differences in the ring between the Voyager encounters, as well as provide a source for the short-lived features detected in the Hubble Space Telescope images of the F ring. There is no evidence that the locations of the individual strands are determined by resonant perturbations with known satellites. It is proposed that the radial structure is formed by the localized action of small satellites orbiting within the strand region. ?? 1997 Academic Press.

  20. Modelling Toehold-Mediated RNA Strand Displacement

    PubMed Central

    Šulc, Petr; Ouldridge, Thomas E.; Romano, Flavio; Doye, Jonathan P.K.; Louis, Ard A.

    2015-01-01

    We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperature and make two experimentally testable predictions: that the displacement is faster if the toehold is placed at the 5′ end of the substrate; and that the displacement slows down with increasing temperature for longer toeholds. PMID:25762335

  1. Modelling toehold-mediated RNA strand displacement.

    PubMed

    Šulc, Petr; Ouldridge, Thomas E; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

    2015-03-10

    We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperature and make two experimentally testable predictions: that the displacement is faster if the toehold is placed at the 5' end of the substrate; and that the displacement slows down with increasing temperature for longer toeholds.

  2. DNA strand patterns on aluminium thin films.

    PubMed

    Khatir, Nadia Mahmoudi; Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Majid, Wan Haliza Abd; Rahman, Saadah Abdul; Shahhosseini, Fatemeh

    2011-01-01

    A new patterning method using Deoxyribose Nucleic Acid (DNA) strands capable of producing nanogaps of less than 100 nm is proposed and investigated in this work. DNA strands from Bosenbergia rotunda were used as the fundamental element in patterning DNA on thin films of aluminium (Al) metal without the need for any lithographic techniques. The DNA strands were applied in buffer solutions onto thin films of Al on silicon (Si) and the chemical interactions between the DNA strands and Al creates nanometer scale arbitrary patterning by direct transfer of the DNA strands onto the substrate. This simple and cost-effective method can be utilized in the fabrication of various components in electronic chips for microelectronics and Nano Electronic Mechanical System (NEMS) applications in general.

  3. Invasive Candidiasis.

    PubMed

    McCarty, Todd P; Pappas, Peter G

    2016-03-01

    Invasive candidiasis is a collective term that refers to a group of infectious syndromes caused by a variety of species of Candida, 5 of which cause most cases. Candidemia is the most commonly recognized syndrome associated with invasive candidiasis. Certain conditions may influence the likelihood for one species versus another in a specific clinical scenario, and this can have important implications for selection of antifungal therapy and the duration of treatment. Molecular diagnostic technology plays an ever-increasing role as an adjunct to traditional culture-based diagnostics, offering significant potential toward improvement in patient care.

  4. Repairing a double-strand chromosome break by homologous recombination: revisiting Robin Holliday's model.

    PubMed Central

    Haber, James E; Ira, Gregorz; Malkova, Anna; Sugawara, Neal

    2004-01-01

    Since the pioneering model for homologous recombination proposed by Robin Holliday in 1964, there has been great progress in understanding how recombination occurs at a molecular level. In the budding yeast Saccharomyces cerevisiae, one can follow recombination by physically monitoring DNA after the synchronous induction of a double-strand break (DSB) in both wild-type and mutant cells. A particularly well-studied system has been the switching of yeast mating-type (MAT) genes, where a DSB can be induced synchronously by expression of the site-specific HO endonuclease. Similar studies can be performed in meiotic cells, where DSBs are created by the Spo11 nuclease. There appear to be at least two competing mechanisms of homologous recombination: a synthesis-dependent strand annealing pathway leading to noncrossovers and a two-end strand invasion mechanism leading to formation and resolution of Holliday junctions (HJs), leading to crossovers. The establishment of a modified replication fork during DSB repair links gene conversion to another important repair process, break-induced replication. Despite recent revelations, almost 40 years after Holliday's model was published, the essential ideas he proposed of strand invasion and heteroduplex DNA formation, the formation and resolution of HJs, and mismatch repair, remain the basis of our thinking. PMID:15065659

  5. Repairing a double-strand chromosome break by homologous recombination: revisiting Robin Holliday's model.

    PubMed

    Haber, James E; Ira, Gregorz; Malkova, Anna; Sugawara, Neal

    2004-01-29

    Since the pioneering model for homologous recombination proposed by Robin Holliday in 1964, there has been great progress in understanding how recombination occurs at a molecular level. In the budding yeast Saccharomyces cerevisiae, one can follow recombination by physically monitoring DNA after the synchronous induction of a double-strand break (DSB) in both wild-type and mutant cells. A particularly well-studied system has been the switching of yeast mating-type (MAT) genes, where a DSB can be induced synchronously by expression of the site-specific HO endonuclease. Similar studies can be performed in meiotic cells, where DSBs are created by the Spo11 nuclease. There appear to be at least two competing mechanisms of homologous recombination: a synthesis-dependent strand annealing pathway leading to noncrossovers and a two-end strand invasion mechanism leading to formation and resolution of Holliday junctions (HJs), leading to crossovers. The establishment of a modified replication fork during DSB repair links gene conversion to another important repair process, break-induced replication. Despite recent revelations, almost 40 years after Holliday's model was published, the essential ideas he proposed of strand invasion and heteroduplex DNA formation, the formation and resolution of HJs, and mismatch repair, remain the basis of our thinking.

  6. Marine mammal strandings in the New Caledonia region, Southwest Pacific.

    PubMed

    Borsa, Philippe

    2006-04-01

    Four hundred twenty three marine mammals, in 72 stranding events, were recorded between 1877 and 2005 in New Caledonia, the Loyalty Islands, and Vanuatu in the southwest Pacific. Sixteen species were represented in this count, including: minke whale, Balaenoptera acutorostrata (1 single stranding), sei whale, B. borealis (1 single stranding), blue whale, B. musculus (1 single stranding), humpback whale, Megaptera novaeangliae (2 single strandings), giant sperm whale, Physeter macrocephalus (18 single strandings, 2 pair strandings), pygmy sperm whale, Kogia breviceps (5 single strandings), dwarf sperm whale, K. sima (2 single strandings, 1 triple stranding), Blainville's beaked whale, Mesoplodon densirostris (2 single strandings), short-finned pilot whale, Globicephala macrorhynchus (4 strandings, 56 individuals), melon-headed whale, Peponocephala electra (1 single stranding and 2 mass strandings totalling 231 individuals), common dolphin, Delphinus delphis (1 single stranding), spinner dolphin, Stenella longirostris (1 pair stranding and 2 mass strandings of groups of approximately 30 individuals each), Indian Ocean bottlenose dolphin, Tursiops aduncus (2 single strandings), dugong, Dugong dugon (14 single strandings), and New Zealand fur seal, Arctocephalus forsteri (3 single strandings). A stranded rorqual identified as an Antarctic minke whale (B. bonaerensis), with coloration patterns that did not match known descriptions, was also reported. Sei whale was recorded for the first time in the tropical Southwest Pacific region and Antarctic minke whale, melon-headed whale, and Indian Ocean bottlenose dolphin were recorded for the first time in New Caledonia. Strandings of sperm whales were most frequent in the spring, but also occurred in autumn months, suggesting a seasonal pattern of occurrence possibly related to seasonal migration. One stranded humpback whale bore the scars of a killer whale's attack and one dugong was injured by a shark. Scars left by

  7. DNA strand displacement system running logic programs.

    PubMed

    Rodríguez-Patón, Alfonso; Sainz de Murieta, Iñaki; Sosík, Petr

    2014-01-01

    The paper presents a DNA-based computing model which is enzyme-free and autonomous, not requiring a human intervention during the computation. The model is able to perform iterated resolution steps with logical formulae in conjunctive normal form. The implementation is based on the technique of DNA strand displacement, with each clause encoded in a separate DNA molecule. Propositions are encoded assigning a strand to each proposition p, and its complementary strand to the proposition ¬p; clauses are encoded comprising different propositions in the same strand. The model allows to run logic programs composed of Horn clauses by cascading resolution steps. The potential of the model is demonstrated also by its theoretical capability of solving SAT. The resulting SAT algorithm has a linear time complexity in the number of resolution steps, whereas its spatial complexity is exponential in the number of variables of the formula. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  8. Stranded superconducting cable of improved design

    NASA Technical Reports Server (NTRS)

    Brooks, J.; Laverick, C.; Lobell, G. M.; Purcell, J.

    1970-01-01

    High-current cable developed in liquid helium cooled magnets uses aluminum wire interspersed with the superconductor strands. The aluminum maintains higher electrical conductivity, is light in weight, and has low thermal capacity.

  9. Invasive forest species

    Treesearch

    Barbara L. Illman

    2006-01-01

    Nonnative organisms that cause a major change to native ecosystems-once called foreign species, biological invasions, alien invasives, exotics, or biohazards–are now generally referred to as invasive species or invasives. invasive species of insects, fungi, plants, fish, and other organisms present a rising threat to natural forest ecosystems worldwide. Invasive...

  10. Bubbles in live-stranded dolphins

    PubMed Central

    Dennison, S.; Moore, M. J.; Fahlman, A.; Moore, K.; Sharp, S.; Harry, C. T.; Hoppe, J.; Niemeyer, M.; Lentell, B.; Wells, R. S.

    2012-01-01

    Bubbles in supersaturated tissues and blood occur in beaked whales stranded near sonar exercises, and post-mortem in dolphins bycaught at depth and then hauled to the surface. To evaluate live dolphins for bubbles, liver, kidneys, eyes and blubber–muscle interface of live-stranded and capture-release dolphins were scanned with B-mode ultrasound. Gas was identified in kidneys of 21 of 22 live-stranded dolphins and in the hepatic portal vasculature of 2 of 22. Nine then died or were euthanized and bubble presence corroborated by computer tomography and necropsy, 13 were released of which all but two did not re-strand. Bubbles were not detected in 20 live wild dolphins examined during health assessments in shallow water. Off-gassing of supersaturated blood and tissues was the most probable origin for the gas bubbles. In contrast to marine mammals repeatedly diving in the wild, stranded animals are unable to recompress by diving, and thus may retain bubbles. Since the majority of beached dolphins released did not re-strand it also suggests that minor bubble formation is tolerated and will not lead to clinically significant decompression sickness. PMID:21993505

  11. Bubbles in live-stranded dolphins.

    PubMed

    Dennison, S; Moore, M J; Fahlman, A; Moore, K; Sharp, S; Harry, C T; Hoppe, J; Niemeyer, M; Lentell, B; Wells, R S

    2012-04-07

    Bubbles in supersaturated tissues and blood occur in beaked whales stranded near sonar exercises, and post-mortem in dolphins bycaught at depth and then hauled to the surface. To evaluate live dolphins for bubbles, liver, kidneys, eyes and blubber-muscle interface of live-stranded and capture-release dolphins were scanned with B-mode ultrasound. Gas was identified in kidneys of 21 of 22 live-stranded dolphins and in the hepatic portal vasculature of 2 of 22. Nine then died or were euthanized and bubble presence corroborated by computer tomography and necropsy, 13 were released of which all but two did not re-strand. Bubbles were not detected in 20 live wild dolphins examined during health assessments in shallow water. Off-gassing of supersaturated blood and tissues was the most probable origin for the gas bubbles. In contrast to marine mammals repeatedly diving in the wild, stranded animals are unable to recompress by diving, and thus may retain bubbles. Since the majority of beached dolphins released did not re-strand it also suggests that minor bubble formation is tolerated and will not lead to clinically significant decompression sickness.

  12. Correlation Between Strand Stability and Magnet Performance

    SciTech Connect

    Dietderich, D.R.; Bartlett, S.E.; Caspi, S.; Ferracin, P.; Gourlay, S.A.; Higley, H.C.; Lietzke, A.F.; Mattafirri, S.; McInturff, A.D.; Sabbi, G.L.; Scanlan, R.M.

    2005-06-01

    Magnet programs at BNL, LBNL and FNAL have observed instabilities in high J{sub c} Nb{sub 3}Sn strands and magnets made from these strands. This paper correlates the strand stability determined from a short sample-strand test to the observed magnet performance. It has been observed that strands that carry high currents at high fields (greater than 10 T) cannot sustain these same currents at low fields (1-3 T) when the sample current is fixed and the magnetic field is ramped. This suggests that the present generation of strand is susceptible to flux jumps (FJ). To prevent flux jumps from limiting stand performance, one must accommodate the energy released during a flux jump. To better understand FJ this work has focused on wire with a given sub-element diameter and shows that one can significantly improve stability by increasing the copper conductivity (higher residual resistivity ratio, RRR, of the Cu). This increased stability significantly improves the conductor performance and permits it to carry more current.

  13. Correlation between Strand Stability and Magnet Performance

    SciTech Connect

    Dietderich, Daniel R.; Bartlett, Scott E.; Caspi, Shlomo; Ferracin, Paolo; G ourlay, Stephen A.; Higley, Hugh C.; Lietzke, Alan F.; Mattafirri, Sara; McInturff, Alfred D.; Sabbi, GianLuca L.; Scanlan,Ronald M.

    2005-04-16

    Magnet programs at BNL, LBNL and FNAL have observed instabilities in high J{sub c} Nb{sub 3}Sn strands and magnets made from these strands. This paper correlates the strand stability determined from a short sample-strand test to the observed magnet performance. It has been observed that strands that carry high currents at high fields (greater than 10T) cannot sustain these same currents at low fields (1-3T) when the sample current is fixed and the magnetic field is ramped. This suggests that the present generation of strand is susceptible to flux jumps (FJ). To prevent flux jumps from limiting stand performance, one must accommodate the energy released during a flux jump. To better understand FJ this work has focused on wire with a given sub-element diameter and shows that one can significantly improve stability by increasing the copper conductivity (higher residual resistivity ratio, RRR, of the Cu). This increased stability significantly improves the conductor performance and permits it to carry more current.

  14. Primary invasive extramammary Paget disease on penoscrotum: a clinicopathological analysis of 41 cases.

    PubMed

    Shu, Bo; Shen, Xu-Xia; Chen, Peng; Fang, Xin-Zhi; Guo, Yong-Lian; Kong, Yun-Yi

    2016-01-01

    To investigate the clinicopathological and immunohistochemical features and prognostic factors for invasive extramammary Paget disease (EMPD) on penoscrotum, we described the clinical presentations, histopathology, and follow-up courses of 41 cases. The age of the patients ranged from 42 to 84 years. All the patients were treated with wide surgical excision, and 14 were confirmed to have lymph node metastasis. During follow-up, 18 patients (43.9%) developed local or distant recurrence, and 13 patients (31.7%) died of the disease. Histologically, glandular formation with true lumina within the epidermis was found in 29 cases, and signet ring cells were seen in 11 cases. In invasive components, nodular/micronodular growth pattern, glandular formation, and strands/solid sheets existed in 95.1% (39/41), 43.9% (18/41), and 24.4% (10/41) of the cases, respectively. More than half of the cases had at least 2 different types of invasive growth pattern. CK7 was diffusely positive in all cases, whereas CK20 was focally positive in 8 cases. GCDFP-15 was expressed to a variable degree in 24 cases. Presence of strands/solid sheets, lymphovascular invasion, and perineural invasion in invasive EMPD were found to be correlated with higher lymph node metastatic rate. Univariate analysis revealed that patients with one of the following prognostic factors: delay in diagnosis more than 7.5 years, depth of invasion more than 1 mm, invasive pattern of strands/solid sheets, marked inflammation, lymphovascular invasion, and lymph node metastasis at diagnosis, had significantly shorter cancer-specific survival. We concluded that invasive EMPD is a rare malignant skin neoplasm with morphological diversity. Invasive pattern of strands/solid sheets is significantly associated with both lymph node metastasis and worse prognosis. Delay in diagnosis, depth of invasion, marked inflammation, lymphovascular invasion, and regional lymph node status are important prognostic factors.

  15. 5. CABLE STRAND ALARM: Photocopy of December 1966 photograph showing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. CABLE STRAND ALARM: Photocopy of December 1966 photograph showing cable strand alarm located at Beach and Hyde Streets. A strand in the cable (see CA-12-7) forces the fork forward, alerting the powerhouse to the strand by means of an electrical warning device. This strand alarm operates in essentially the same manner as those first used in the 1880s. - San Francisco Cable Railway, Washington & Mason Streets, San Francisco, San Francisco County, CA

  16. Use of Mature miRNA Strand Selection in miRNAs Families in Cervical Cancer Development.

    PubMed

    Granados-López, Angelica Judith; Ruiz-Carrillo, José Luis; Servín-González, Luis Steven; Martínez-Rodríguez, José Luis; Reyes-Estrada, Claudia Araceli; Gutiérrez-Hernández, Rosalinda; López, Jesús Adrián

    2017-02-14

    Aberrant miRNA expression is well recognized as a cancer hallmark, nevertheless miRNA function and expression does not always correlate in patients tissues and cell lines studies. In addition to this issue, miRNA strand usage conduces to increased cell signaling pathways modulation diversifying cellular processes regulation. In cervical cancer, 20 miRNA families are involved in carcinogenesis induction and development to this moment. These families have 5p and 3p strands with different nucleotide (nt) chain sizes. In general, mature 5p strands are larger: two miRNAs of 24 nt, 24 miRNAs of 23 nt, 35 miRNAs of 22 nt and three miRNAs of 21 nt. On the other hand, the 3p strands lengths observed are: seven miRNAs of 23 nt, 50 miRNAs of 22 nt, six miRNAs of 21 nt and four miRNAs of 20 nt. Based on the analysis of the 20 miRNA families associated with cervical cancer, 67 3p strands and 65 5p strands are selected suggesting selectivity and specificity mechanisms regulating cell processes like proliferation, apoptosis, migration, invasion, metabolism and Warburg effect. The insight reviewed here could be used in the miRNA based therapy, diagnosis and prognosis approaches.

  17. Use of Mature miRNA Strand Selection in miRNAs Families in Cervical Cancer Development

    PubMed Central

    Granados-López, Angelica Judith; Ruiz-Carrillo, José Luis; Servín-González, Luis Steven; Martínez-Rodríguez, José Luis; Reyes-Estrada, Claudia Araceli; Gutiérrez-Hernández, Rosalinda; López, Jesús Adrián

    2017-01-01

    Aberrant miRNA expression is well recognized as a cancer hallmark, nevertheless miRNA function and expression does not always correlate in patients tissues and cell lines studies. In addition to this issue, miRNA strand usage conduces to increased cell signaling pathways modulation diversifying cellular processes regulation. In cervical cancer, 20 miRNA families are involved in carcinogenesis induction and development to this moment. These families have 5p and 3p strands with different nucleotide (nt) chain sizes. In general, mature 5p strands are larger: two miRNAs of 24 nt, 24 miRNAs of 23 nt, 35 miRNAs of 22 nt and three miRNAs of 21 nt. On the other hand, the 3p strands lengths observed are: seven miRNAs of 23 nt, 50 miRNAs of 22 nt, six miRNAs of 21 nt and four miRNAs of 20 nt. Based on the analysis of the 20 miRNA families associated with cervical cancer, 67 3p strands and 65 5p strands are selected suggesting selectivity and specificity mechanisms regulating cell processes like proliferation, apoptosis, migration, invasion, metabolism and Warburg effect. The insight reviewed here could be used in the miRNA based therapy, diagnosis and prognosis approaches. PMID:28216603

  18. Real-time analysis of double-strand DNA break repair by homologous recombination.

    PubMed

    Hicks, Wade M; Yamaguchi, Miyuki; Haber, James E

    2011-02-22

    The ability to induce synchronously a single site-specific double-strand break (DSB) in a budding yeast chromosome has made it possible to monitor the kinetics and genetic requirements of many molecular steps during DSB repair. Special attention has been paid to the switching of mating-type genes in Saccharomyces cerevisiae, a process initiated by the HO endonuclease by cleaving the MAT locus. A DSB in MATa is repaired by homologous recombination--specifically, by gene conversion--using a heterochromatic donor, HMLα. Repair results in the replacement of the a-specific sequences (Ya) by Yα and switching from MATa to MATα. We report that MAT switching requires the DNA replication factor Dpb11, although it does not require the Cdc7-Dbf4 kinase or the Mcm and Cdc45 helicase components. Using Southern blot, PCR, and ChIP analysis of samples collected every 10 min, we extend previous studies of this process to identify the times for the loading of Rad51 recombinase protein onto the DSB ends at MAT, the subsequent strand invasion by the Rad51 nucleoprotein filament into the donor sequences, the initiation of new DNA synthesis, and the removal of the nonhomologous Y sequences. In addition we report evidence for the transient displacement of well-positioned nucleosomes in the HML donor locus during strand invasion.

  19. Real-time analysis of double-strand DNA break repair by homologous recombination

    PubMed Central

    Hicks, Wade M.; Yamaguchi, Miyuki; Haber, James E.

    2011-01-01

    The ability to induce synchronously a single site-specific double-strand break (DSB) in a budding yeast chromosome has made it possible to monitor the kinetics and genetic requirements of many molecular steps during DSB repair. Special attention has been paid to the switching of mating-type genes in Saccharomyces cerevisiae, a process initiated by the HO endonuclease by cleaving the MAT locus. A DSB in MATa is repaired by homologous recombination—specifically, by gene conversion—using a heterochromatic donor, HMLα. Repair results in the replacement of the a-specific sequences (Ya) by Yα and switching from MATa to MATα. We report that MAT switching requires the DNA replication factor Dpb11, although it does not require the Cdc7-Dbf4 kinase or the Mcm and Cdc45 helicase components. Using Southern blot, PCR, and ChIP analysis of samples collected every 10 min, we extend previous studies of this process to identify the times for the loading of Rad51 recombinase protein onto the DSB ends at MAT, the subsequent strand invasion by the Rad51 nucleoprotein filament into the donor sequences, the initiation of new DNA synthesis, and the removal of the nonhomologous Y sequences. In addition we report evidence for the transient displacement of well-positioned nucleosomes in the HML donor locus during strand invasion. PMID:21292986

  20. A homogeneous nucleic acid hybridization assay based on strand displacement.

    PubMed Central

    Vary, C P

    1987-01-01

    A homogeneous nucleic acid hybridization assay which is conducted in solution and requires no separation steps is described. The assay is based on the concept of strand displacement. In the strand displacement assay, an RNA "signal strand" is hybridized within a larger DNA strand termed the "probe strand", which is, in turn, complementary to the target nucleic acid of interest. Hybridization of the target nucleic acid with the probe strand ultimately results in displacement of the RNA signal strand. Strand displacement, therefore, causes conversion of the RNA from double to single-stranded form. The single-strand specificity of polynucleotide phosphorylase (EC 2.7.7.8) allows discrimination between double-helical and single-stranded forms of the RNA signal strand. As displacement proceeds, free RNA signal strands are preferentially phosphorolyzed to component nucleoside diphosphates, including adenosine diphosphate. The latter nucleotide is converted to ATP by pyruvate kinase(EC 2.7.1.40). Luciferase catalyzed bioluminescence is employed to measure the ATP generated as a result of strand displacement. Images PMID:3309890

  1. LRV1 viral particles in Leishmania guyanensis contain double-stranded or single-stranded RNA.

    PubMed Central

    Weeks, R; Aline, R F; Myler, P J; Stuart, K

    1992-01-01

    The 32-nm-diameter spherical viral particles found in the cytoplasm of Leishmania guyanensis CUMC1-1A sediment at 130S and have a buoyant density of approximately 1.4 g/ml in cesium chloride gradients. These particles contain a 5.3-kb double-stranded RNA, while single-stranded RNA that corresponds to the viral positive strand is associated with less-dense particles. These results suggest a conservative and sequential mode of LRV1 viral RNA replication that is exemplified by the ScV L-A virus of yeast. Images PMID:1738198

  2. Neurobrucellosis in Stranded Dolphins, Costa Rica

    PubMed Central

    Hernández-Mora, Gabriela; González-Barrientos, Rocío; Morales, Juan-Alberto; Chaves-Olarte, Esteban; Guzmán-Verri, Caterina; Baquero-Calvo, Elías; De-Miguel, María-Jesús; Marín, Clara-María; Blasco, José-María

    2008-01-01

    Ten striped dolphins, Stenella coeruleoalba, stranded along the Costa Rican Pacific coast, had meningoencephalitis and antibodies against Brucella spp. Brucella ceti was isolated from cerebrospinal fluid of 6 dolphins and 1 fetus. S. coeruleoalba constitutes a highly susceptible host and a potential reservoir for B. ceti transmission. PMID:18760012

  3. Rescue Your Campus from "Stranded" Costs.

    ERIC Educational Resources Information Center

    Kadamus, David A.

    2003-01-01

    Discusses how to deal with the pressures to defer maintenance on campus buildings, including the issue of accelerated cycles of obsolescence, which "stranded" costs to avoid and to accept, and specific strategies to gain control of the physical asset portfolio. (EV)

  4. Untangling the Strands of the Fourteenth Amendment.

    ERIC Educational Resources Information Center

    Lupu, Ira C.

    1979-01-01

    Explores trends in the Court's interpretation of the libertarian and egalitarian dimensions of the Fourteenth Amendment and offers a theory of the two strands. Available from Michigan Law Review, Hutchins Hall, Ann Arbor, MI 48109; single issues $3.50. (Author/IRT)

  5. Esophagectomy - minimally invasive

    MedlinePlus

    Minimally invasive esophagectomy; Robotic esophagectomy; Removal of the esophagus - minimally invasive; Achalasia - esophagectomy; Barrett esophagus - esophagectomy; Esophageal cancer - esophagectomy - laparoscopic; Cancer of the ...

  6. Determination of recovery length in spiral strands

    SciTech Connect

    Raoof, M.; Kraincanic, I.

    1994-12-31

    On the offshore scene, the ever growing demands placed on moorings for conventional semi-submersible platforms, coupled with the requirements for guys to new structural forms such as compliant towers has led to the use of larger and longer ropes and spiral strands. Much emphasis has recently been placed on suitable forms of discard criteria based on the remaining fatigue life (or strength) of the spiral strands and wire ropes. It is now well established that, depending on the type of cable (strand or rope) application, the influence of broken wires on the strength of the cable is not directly equivalent to a loss of area of steel: the number and distribution of wire breaks around a cable cross-section and also along its length are both important. With sufficient friction, a broken wire will be capable of supporting its total share of the load in a relatively short length called the recovery length. The determination of recovery length for any type of steel cable, therefore, is of importance as a first step towards developing realistic guidelines for cable discard criteria. The present paper presents a theoretical model for predicting the recovery length in any layer of an axially preloaded spiral strand. Based on a series of theoretical parametric studies, a straightforward method is proposed for obtaining reasonable estimates of variations in the recovery length in any layer of a strand with changes in the lay angle. In view of the simple nature of the final results, these should prove of interest to practicing engineers. Moreover, the final recommendations should prove of some value in the context of length effects associated with axial fatigue loading of cables under laboratory conditions which has recently attracted much attention: the question here is how to determine a minimum length for test specimens whose axial fatigue life under laboratory conditions may safely be used to represent those of the much longer cables in the field.

  7. RNA-catalysed synthesis of complementary-strand RNA

    NASA Astrophysics Data System (ADS)

    Doudna, Jennifer A.; Szostak, Jack W.

    1989-06-01

    The Tetrahymena ribozyme can splice together multiple oligonucleotides aligned on a template strand to yield a fully complementary product strand. This reaction demonstrates the feasibility of RNA-catalysed RNA replications.

  8. Magnetic instabilities in Nb3Sn strands and cables

    SciTech Connect

    Kashikhim, Vadim V.; Zlobin, Alexander V.; /Fermilab

    2004-11-01

    This paper describes a model for calculation of magnetic instabilities in superconducting wires with transport current and reports results of instability simulations in Nb{sub 3}Sn strands from different manufactures. The effect of magnetic instabilities on the strand and cable performance is presented and a criterion for the maximum effective sub-element size of strands for high field magnets is formulated.

  9. Fish stranding in freshwater systems: sources, consequences, and mitigation.

    PubMed

    Nagrodski, Alexander; Raby, Graham D; Hasler, Caleb T; Taylor, Mark K; Cooke, Steven J

    2012-07-30

    Fish can become stranded when water levels decrease, often rapidly, as a result of anthropogenic (e.g., canal drawdown, hydropeaking, vessel wakes) and natural (e.g., floods, drought, winter ice dynamics) events. We summarize existing research on stranding of fish in freshwater, discuss the sources, consequences, and mitigation options for stranding, and report current knowledge gaps. Our literature review revealed that ∼65.5% of relevant peer-reviewed articles were found to focus on stranding associated with hydropower operations and irrigation projects. In fact, anthropogenic sources of fish stranding represented 81.8% of available literature compared to only 19.9% attributed to natural fish stranding events. While fish mortality as a result of stranding is well documented, our analysis revealed that little is known about the sublethal and long-term consequences of stranding on growth and population dynamics. Furthermore, the contribution of stranding to annual mortality rates is poorly understood as are the potential ecosystem-scale impacts. Mitigation strategies available to deal with stranding include fish salvage, ramping rate limitations, and physical habitat works (e.g., to contour substrate to minimize stranding). However, a greater knowledge of the factors that cause fish stranding would promote the development and refinement of mitigation strategies that are economically and ecologically sustainable.

  10. The Parameter of Preposition Stranding: A View from Child English

    ERIC Educational Resources Information Center

    Sugisaki, Koji; Snyder, William

    2006-01-01

    In this squib we examine the time course of children's acquisition of English to evaluate the basic insights of Kayne's (1981; 1984) proposals on preposition stranding. Kayne argued that the availability of preposition stranding (P-stranding) in English is parametrically linked to the availability of double object datives and the prepositional…

  11. Hole hopping rates in single strand oligonucleotides

    NASA Astrophysics Data System (ADS)

    Borrelli, Raffaele; Capobianco, Amedeo; Peluso, Andrea

    2014-08-01

    The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck-Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck-Condon density of states extends over a wide range of hole site energy difference, 0-1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  12. G-Strands on symmetric spaces

    NASA Astrophysics Data System (ADS)

    Arnaudon, Alexis; Holm, Darryl D.; Ivanov, Rossen I.

    2017-03-01

    We study the G-strand equations that are extensions of the classical chiral model of particle physics in the particular setting of broken symmetries described by symmetric spaces. These equations are simple field theory models whose configuration space is a Lie group, or in this case a symmetric space. In this class of systems, we derive several models that are completely integrable on finite dimensional Lie group G, and we treat in more detail examples with symmetric space SU(2)/S1 and SO(4)/SO(3). The latter model simplifies to an apparently new integrable nine-dimensional system. We also study the G-strands on the infinite dimensional group of diffeomorphisms, which gives, together with the Sobolev norm, systems of 1+2 Camassa-Holm equations. The solutions of these equations on the complementary space related to the Witt algebra decomposition are the odd function solutions.

  13. DNA strand breakage induced by photosensitization

    NASA Astrophysics Data System (ADS)

    Piette, Jacques; van de Vorst, Albert

    More than 110 papers have been reviewed in relation to damages, especially breaks induced in DNA by various photosensitizers. Direct experimental evidence shows that these breaks may either exist as alkali-labile bonds or as true single strand-breaks. 1O ∗2 seems to be unable to break the sugar-phosphate backbone but can oxidize the guanine residues, an alteration which may be converted into breaks after alkaline labilization. In general, true single-strand breaks are due to the direct action of OH radicals or from a reaction between DNA and the excited dye or one of its photoproducts. Although these reactions have been frequently observed in vitro and in vivo, their biological relevance still remains an open question.

  14. DNA Strand-Displacement Timer Circuits.

    PubMed

    Fern, Joshua; Scalise, Dominic; Cangialosi, Angelo; Howie, Dylan; Potters, Leo; Schulman, Rebecca

    2017-02-17

    Chemical circuits can coordinate elaborate sequences of events in cells and tissues, from the self-assembly of biological complexes to the sequence of embryonic development. However, autonomously directing the timing of events in synthetic systems using chemical signals remains challenging. Here we demonstrate that a simple synthetic DNA strand-displacement circuit can release target sequences of DNA into solution at a constant rate after a tunable delay that can range from hours to days. The rates of DNA release can be tuned to the order of 1-100 nM per day. Multiple timer circuits can release different DNA strands at different rates and times in the same solution. This circuit can thus facilitate precise coordination of chemical events in vitro without external stimulation.

  15. Alignment of Homologous Chromosomes and Effective Repair of Programmed DNA Double-Strand Breaks during Mouse Meiosis Require the Minichromosome Maintenance Domain Containing 2 (MCMDC2) Protein.

    PubMed

    Finsterbusch, Friederike; Ravindranathan, Ramya; Dereli, Ihsan; Stanzione, Marcello; Tränkner, Daniel; Tóth, Attila

    2016-10-01

    Orderly chromosome segregation during the first meiotic division requires meiotic recombination to form crossovers between homologous chromosomes (homologues). Members of the minichromosome maintenance (MCM) helicase family have been implicated in meiotic recombination. In addition, they have roles in initiation of DNA replication, DNA mismatch repair and mitotic DNA double-strand break repair. Here, we addressed the function of MCMDC2, an atypical yet conserved MCM protein, whose function in vertebrates has not been reported. While we did not find an important role for MCMDC2 in mitotically dividing cells, our work revealed that MCMDC2 is essential for fertility in both sexes due to a crucial function in meiotic recombination. Meiotic recombination begins with the introduction of DNA double-strand breaks into the genome. DNA ends at break sites are resected. The resultant 3-prime single-stranded DNA overhangs recruit RAD51 and DMC1 recombinases that promote the invasion of homologous duplex DNAs by the resected DNA ends. Multiple strand invasions on each chromosome promote the alignment of homologous chromosomes, which is a prerequisite for inter-homologue crossover formation during meiosis. We found that although DNA ends at break sites were evidently resected, and they recruited RAD51 and DMC1 recombinases, these recombinases were ineffective in promoting alignment of homologous chromosomes in the absence of MCMDC2. Consequently, RAD51 and DMC1 foci, which are thought to mark early recombination intermediates, were abnormally persistent in Mcmdc2-/- meiocytes. Importantly, the strand invasion stabilizing MSH4 protein, which marks more advanced recombination intermediates, did not efficiently form foci in Mcmdc2-/- meiocytes. Thus, our work suggests that MCMDC2 plays an important role in either the formation, or the stabilization, of DNA strand invasion events that promote homologue alignment and provide the basis for inter-homologue crossover formation during

  16. Alignment of Homologous Chromosomes and Effective Repair of Programmed DNA Double-Strand Breaks during Mouse Meiosis Require the Minichromosome Maintenance Domain Containing 2 (MCMDC2) Protein

    PubMed Central

    Ravindranathan, Ramya; Dereli, Ihsan; Stanzione, Marcello; Tóth, Attila

    2016-01-01

    Orderly chromosome segregation during the first meiotic division requires meiotic recombination to form crossovers between homologous chromosomes (homologues). Members of the minichromosome maintenance (MCM) helicase family have been implicated in meiotic recombination. In addition, they have roles in initiation of DNA replication, DNA mismatch repair and mitotic DNA double-strand break repair. Here, we addressed the function of MCMDC2, an atypical yet conserved MCM protein, whose function in vertebrates has not been reported. While we did not find an important role for MCMDC2 in mitotically dividing cells, our work revealed that MCMDC2 is essential for fertility in both sexes due to a crucial function in meiotic recombination. Meiotic recombination begins with the introduction of DNA double-strand breaks into the genome. DNA ends at break sites are resected. The resultant 3-prime single-stranded DNA overhangs recruit RAD51 and DMC1 recombinases that promote the invasion of homologous duplex DNAs by the resected DNA ends. Multiple strand invasions on each chromosome promote the alignment of homologous chromosomes, which is a prerequisite for inter-homologue crossover formation during meiosis. We found that although DNA ends at break sites were evidently resected, and they recruited RAD51 and DMC1 recombinases, these recombinases were ineffective in promoting alignment of homologous chromosomes in the absence of MCMDC2. Consequently, RAD51 and DMC1 foci, which are thought to mark early recombination intermediates, were abnormally persistent in Mcmdc2-/- meiocytes. Importantly, the strand invasion stabilizing MSH4 protein, which marks more advanced recombination intermediates, did not efficiently form foci in Mcmdc2-/- meiocytes. Thus, our work suggests that MCMDC2 plays an important role in either the formation, or the stabilization, of DNA strand invasion events that promote homologue alignment and provide the basis for inter-homologue crossover formation during

  17. Method and apparatus for testing a forward-moving strand

    DOEpatents

    Ducommun, Joel; Vulliens, Philippe

    1980-01-01

    In a method for testing a continuously forward-moving strand a light beam which passes along a plane that extends approximately perpendicularly to the longitudinal axis of the strand is introduced into the strand. The brightness value is measured on a place of the strand exterior which is distal from the light incidence place by means of at least one photoelectronic element disposed directly on the strand exterior and the measured result is evaluated in a gating circuit which is electrically connected to the photoelectronic element.

  18. Double-Stranded RNA Is Detected by Immunofluorescence Analysis in RNA and DNA Virus Infections, Including Those by Negative-Stranded RNA Viruses.

    PubMed

    Son, Kyung-No; Liang, Zhiguo; Lipton, Howard L

    2015-09-01

    Early biochemical studies of viral replication suggested that most viruses produce double-stranded RNA (dsRNA), which is essential for the induction of the host immune response. However, it was reported in 2006 that dsRNA could be detected by immunofluorescence antibody staining in double-stranded DNA and positive-strand RNA virus infections but not in negative-strand RNA virus infections. Other reports in the literature seemed to support these observations. This suggested that negative-strand RNA viruses produce little, if any, dsRNA or that more efficient viral countermeasures to mask dsRNA are mounted. Because of our interest in the use of dsRNA antibodies for virus discovery, particularly in pathological specimens, we wanted to determine how universal immunostaining for dsRNA might be in animal virus infections. We have detected the in situ formation of dsRNA in cells infected with vesicular stomatitis virus, measles virus, influenza A virus, and Nyamanini virus, which represent viruses from different negative-strand RNA virus families. dsRNA was also detected in cells infected with lymphocytic choriomeningitis virus, an ambisense RNA virus, and minute virus of mice (MVM), a single-stranded DNA (ssDNA) parvovirus, but not hepatitis B virus. Although dsRNA staining was primarily observed in the cytoplasm, it was also seen in the nucleus of cells infected with influenza A virus, Nyamanini virus, and MVM. Thus, it is likely that most animal virus infections produce dsRNA species that can be detected by immunofluorescence staining. The apoptosis induced in several uninfected cell lines failed to upregulate dsRNA formation. An effective antiviral host immune response depends on recognition of viral invasion and an intact innate immune system as a first line of defense. Double-stranded RNA (dsRNA) is a viral product essential for the induction of innate immunity, leading to the production of type I interferons (IFNs) and the activation of hundreds of IFN

  19. Replisome mechanics: lagging strand events that influence speed and processivity

    PubMed Central

    Georgescu, Roxana E.; Yao, Nina; Indiani, Chiara; Yurieva, Olga; O'Donnell, Mike E.

    2014-01-01

    The antiparallel structure of DNA requires lagging strand synthesis to proceed in the opposite direction of the replication fork. This imposes unique events that occur only on the lagging strand, such as primase binding to DnaB helicase, RNA synthesis, and SS B antigen (SSB) displacement during Okazaki fragment extension. Single-molecule and ensemble techniques are combined to examine the effect of lagging strand events on the Escherichia coli replisome rate and processivity. We find that primase activity lowers replisome processivity but only when lagging strand extension is inoperative. rNTPs also lower replisome processivity. However, the negative effects of primase and rNTPs on processivity are overcome by the extra grip on DNA provided by the lagging strand polymerases. Visualization of single molecules reveals that SSB accumulates at forks and may wrap extensive amounts of single-strand DNA. Interestingly SSB has an inter-strand positive effect on the rate of the leading strand based in its interaction with the replicase χ-subunit. Further, the lagging strand polymerase is faster than leading strand synthesis, indicating that replisome rate is limited by the helicase. Overall, lagging strand events that impart negative effects on the replisome are counterbalanced by the positive effects of SSB and additional sliding clamps during Okazaki fragment extension. PMID:24829446

  20. Biological consequences of strand breaks in plasmid and viral DNA.

    PubMed Central

    Schulte-Frohlinde, D.

    1987-01-01

    Some biological consequences of strand breakage in biologically active single- and double-stranded plasmid and viral DNA are examined. A double-strand break in DNA produced by restriction-endonucleases in aqueous solution is not a 100% lethal damage. The survival depends strongly on the structure of the end groups. Evidence is presented that survival is the result of a balance between degradation and repair. The enzymatically produced double-strand break (dsb) is a potentially lethal damage similar to the irradiation-produced dsb in cells. Results with double-stranded biologically active DNA treated either with gamma-rays, heat, pancrease nuclease or UV-light in aqueous solution suggest that a single-strand damage is also a potentially lethal damage. Mechanisms for conversion of single-strand damage to lethal events are discussed. PMID:3307866

  1. Cryptic invasions: A review.

    PubMed

    Morais, Pedro; Reichard, Martin

    2017-06-22

    Cryptic invasions are defined as the introduction and spread of non-native lineages within the species' native range (intra-specific cryptic invasion) or the invasion of non-native species that goes unnoticed due to misidentification as a native or another invasive species (inter-specific cryptic invasion). While population-specific attributes are acknowledged to play a critical role in the success and impact of biological invasions in general, our knowledge of the causes and consequences of cryptic invasions is largely neglected. Cryptic invasions are inherently difficult to recognize and, despite being likely widespread, often go undetected. In this review, we analyse the sources, mechanisms, and consequences of cryptic invasions. Using a bibliometric survey, we first quantify the relative proportion of study questions, taxa, and geographic regions. We then highlight the value of comparative information from archived specimens in uncovering the occurrence and timing of cryptic invasions. We examine the mechanisms of cryptic invasions and emphasise the role of anthropogenic environmental changes on the arrival of cryptic invaders. We then discuss the role of interspecific biological interactions in the success of cryptic invasions and the role of hybridization between native and non-native lineages in cryptic invasions. We examine the competitive advantage of some invasive lineages in key physiological, ecological or sexually-selected traits. We argue that cryptic invasions, often undetected, may trigger subsequent rapid range expansions. We suggest that cryptic invasions are much more common than currently acknowledged. We highlight the role of coevolved associations (host-parasite, mutualism, herbivory), inherently population-specific, in the impacts of cryptic invasions on local communities. Finally, we outline a framework to manage intraspecific cryptic invasions. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1991-01-01

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. Probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations.

  3. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  4. The multiple personalities of Watson and Crick strands.

    PubMed

    Cartwright, Reed A; Graur, Dan

    2011-02-08

    In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

  5. The multiple personalities of Watson and Crick strands

    PubMed Central

    2011-01-01

    Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550

  6. National invasive species program

    Treesearch

    Anna Rinick; Hilda Diaz-Soltero

    2007-01-01

    The structure and function of the National Invasive Species Council was presented below. The names and contact information for the USDA Invasive Species coordinators as of February 2006 were presented on the next page.

  7. Method for producing labeled single-stranded nucleic acid probes

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    1999-10-19

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

  8. A strand graph semantics for DNA-based computation.

    PubMed

    Petersen, Rasmus L; Lakin, Matthew R; Phillips, Andrew

    2016-06-13

    DNA nanotechnology is a promising approach for engineering computation at the nanoscale, with potential applications in biofabrication and intelligent nanomedicine. DNA strand displacement is a general strategy for implementing a broad range of nanoscale computations, including any computation that can be expressed as a chemical reaction network. Modelling and analysis of DNA strand displacement systems is an important part of the design process, prior to experimental realisation. As experimental techniques improve, it is important for modelling languages to keep pace with the complexity of structures that can be realised experimentally. In this paper we present a process calculus for modelling DNA strand displacement computations involving rich secondary structures, including DNA branches and loops. We prove that our calculus is also sufficiently expressive to model previous work on non-branching structures, and propose a mapping from our calculus to a canonical strand graph representation, in which vertices represent DNA strands, ordered sites represent domains, and edges between sites represent bonds between domains. We define interactions between strands by means of strand graph rewriting, and prove the correspondence between the process calculus and strand graph behaviours. Finally, we propose a mapping from strand graphs to an efficient implementation, which we use to perform modelling and simulation of DNA strand displacement systems with rich secondary structure.

  9. A strand graph semantics for DNA-based computation

    PubMed Central

    Petersen, Rasmus L.; Lakin, Matthew R.; Phillips, Andrew

    2015-01-01

    DNA nanotechnology is a promising approach for engineering computation at the nanoscale, with potential applications in biofabrication and intelligent nanomedicine. DNA strand displacement is a general strategy for implementing a broad range of nanoscale computations, including any computation that can be expressed as a chemical reaction network. Modelling and analysis of DNA strand displacement systems is an important part of the design process, prior to experimental realisation. As experimental techniques improve, it is important for modelling languages to keep pace with the complexity of structures that can be realised experimentally. In this paper we present a process calculus for modelling DNA strand displacement computations involving rich secondary structures, including DNA branches and loops. We prove that our calculus is also sufficiently expressive to model previous work on non-branching structures, and propose a mapping from our calculus to a canonical strand graph representation, in which vertices represent DNA strands, ordered sites represent domains, and edges between sites represent bonds between domains. We define interactions between strands by means of strand graph rewriting, and prove the correspondence between the process calculus and strand graph behaviours. Finally, we propose a mapping from strand graphs to an efficient implementation, which we use to perform modelling and simulation of DNA strand displacement systems with rich secondary structure. PMID:27293306

  10. Most Retroviral Recombinations Occur during Minus-Strand DNA Synthesis

    PubMed Central

    Zhang, Jiayou; Tang, Ling-Yun; Li, Ting; Ma, Yan; Sapp, Christy M.

    2000-01-01

    Retroviral RNA molecules are plus, or sense in polarity, equivalent to mRNA. During reverse transcription, the first strand of the DNA molecule synthesized is minus-strand DNA. After the minus strand is polymerized, the plus-strand DNA is synthesized using the minus-strand DNA as the template. In this study, a helper cell line that contains two proviruses with two different mutated gfp genes was constructed. Recombination between the two frameshift mutant genes resulted in a functional gfp. If recombination occurs during minus-strand DNA synthesis, the plus-strand DNA will also contain the functional sequence. After the cell divides, all of its offspring will be green. However, if recombination occurs during plus-strand DNA synthesis, then only the plus-strand DNA will contain the wild-type gfp sequence and the minus-strand DNA will still carry the frameshift mutation. The double-stranded DNA containing this mismatch was subsequently integrated into the host chromosomal DNA of D17 cells, which were unable to repair the majority of mismatches within the retroviral double-strand DNA. After the cell divided, one daughter cell contained the wild-type gfp sequence and the other daughter cell contained the frameshift mutation in the gfp sequence. Under fluorescence microscopy, half the cells in the offspring were green and the other half of the cells were colorless or clear. Thus, we demonstrated that more than 98%, if not all, retroviral recombinations occurred during minus-strand DNA synthesis. PMID:10666262

  11. Attacking invasive grasses

    USGS Publications Warehouse

    Keeley, Jon E.

    2015-01-01

    In grasslands fire may play a role in the plant invasion process, both by creating disturbances that potentially favour non-native invasions and as a possible tool for controlling alien invasions. Havill et al. (Applied Vegetation Science, 18, 2015, this issue) determine how native and non-native species respond to different fire regimes as a first step in understanding the potential control of invasive grasses.

  12. Invasive species in agriculture

    USDA-ARS?s Scientific Manuscript database

    Agricultural production of food, feed, fiber or fuel is a local human activity with global ecological impacts, including the potential to foster invasions. Agriculture plays an unusual role in biological invasions, in that it is both a source of non-indigenous invasive species (NIS) and especially s...

  13. Improving strand quality of upland oaks for use in oriented strand board

    Treesearch

    David B. DeValliance; Jody D. Gray; Shawn T. Grushecky

    2013-01-01

    Past research estimates that more than 1 million tons of oak logging residues go unused in West Virginia each year. Much research has been done investigating potential products and markets for this underutilized resource. West Virginia is home to an oriented strand board (OSB) producer that consumes large volumes of small diameter, low quality round wood. However, the...

  14. IS200/IS605 family single-strand transposition: mechanism of IS608 strand transfer

    PubMed Central

    He, Susu; Guynet, Catherine; Siguier, Patricia; Hickman, Alison B.; Dyda, Fred; Chandler, Mick; Ton-Hoang, Bao

    2013-01-01

    Transposase, TnpA, of the IS200/IS605 family member IS608, catalyses single-strand DNA transposition and is dimeric with hybrid catalytic sites composed of an HUH motif from one monomer and a catalytic Y127 present in an α-helix (αD) from the other (trans configuration). αD is attached to the main body by a flexible loop. Although the reactions leading to excision of a transposition intermediate are well characterized, little is known about the dynamic behaviour of the transpososome that drives this process. We provide evidence strongly supporting a strand transfer model involving rotation of both αD helices from the trans to the cis configuration (HUH and Y residues from the same monomer). Studies with TnpA heterodimers suggest that TnpA cleaves DNA in the trans configuration, and that the catalytic tyrosines linked to the 5′-phosphates exchange positions to allow rejoining of the cleaved strands (strand transfer) in the cis configuration. They further imply that, after excision of the transposon junction, TnpA should be reset to a trans configuration before the cleavage required for integration. Analysis also suggests that this mechanism is conserved among members of the IS200/IS605 family. PMID:23345619

  15. Repair of DNA Double-Strand Breaks

    NASA Astrophysics Data System (ADS)

    Falk, Martin; Lukasova, Emilie; Kozubek, Stanislav

    The genetic information of cells continuously undergoes damage induced by intracellular processes including energy metabolism, DNA replication and transcription, and by environmental factors such as mutagenic chemicals and UV and ionizing radiation. This causes numerous DNA lesions, including double strand breaks (DSBs). Since cells cannot escape this damage or normally function with a damaged genome, several DNA repair mechanisms have evolved. Although most "single-stranded" DNA lesions are rapidly removed from DNA without permanent damage, DSBs completely break the DNA molecule, presenting a real challenge for repair mechanisms, with the highest risk among DNA lesions of incorrect repair. Hence, DSBs can have serious consequences for human health. Therefore, in this chapter, we will refer only to this type of DNA damage. In addition to the biochemical aspects of DSB repair, which have been extensively studied over a long period of time, the spatio-temporal organization of DSB induction and repair, the importance of which was recognized only recently, will be considered in terms of current knowledge and remaining questions.

  16. Why double-stranded RNA resists condensation

    PubMed Central

    Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.

    2014-01-01

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663

  17. Why double-stranded RNA resists condensation.

    PubMed

    Tolokh, Igor S; Pabit, Suzette A; Katz, Andrea M; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V

    2014-01-01

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes--internal and external--distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode.

  18. recA protein-catalyzed strand assimilation: stimulation by Escherichia coli single-stranded DNA-binding protein.

    PubMed Central

    McEntee, K; Weinstock, G M; Lehman, I R

    1980-01-01

    The single-stranded DNA-binding protein of Escherichia coli significantly alters the strand assimilation reaction catalyzed by recA protein [McEntee, K., Weinstock, G. M. & Lehman, I. R. (1979) Proc. Natl. Acad. Sci. USA 76, 2615--2619]. The binding protein (i) increases the rate and extent of strand assimilation into homologous duplex DNA, (ii) enhances the formation of a complex between recA protein and duplex DNA in the presence of homologous or heterologous single-stranded DNA, (iii) reduces the rate and extent of ATP hydrolysis catalyzed by recA protein in the presence of single-stranded DNA, (iv) reduces the high concentration of recA protein required for strand assimilation, and (v) permits detection of strand assimilation in the presence of the ATP analog, adenosine 5'-O-(O-thiotriphosphate). Single-stranded DNA-binding protein purified from a binding protein mutant (lexC) is considerably less effective than wild-type binding protein in stimulating strand assimilation, a result which suggests that single-stranded DNA-binding protein participates in general recombination in vivo. PMID:6244589

  19. Hypermutability of Damaged Single-Strand DNA Formed at Double-Strand Breaks and Uncapped Telomeres in Yeast Saccharomyces cerevisiae

    PubMed Central

    Yang, Yong; Sterling, Joan; Storici, Francesca; Resnick, Michael A.; Gordenin, Dmitry A.

    2008-01-01

    The major DNA repair pathways operate on damage in double-strand DNA because they use the intact strand as a template after damage removal. Therefore, lesions in transient single-strand stretches of chromosomal DNA are expected to be especially threatening to genome stability. To test this hypothesis, we designed systems in budding yeast that could generate many kilobases of persistent single-strand DNA next to double-strand breaks or uncapped telomeres. The systems allowed controlled restoration to the double-strand state after applying DNA damage. We found that lesions induced by UV-light and methyl methanesulfonate can be tolerated in long single-strand regions and are hypermutagenic. The hypermutability required PCNA monoubiquitination and was largely attributable to translesion synthesis by the error-prone DNA polymerase ζ. In support of multiple lesions in single-strand DNA being a source of hypermutability, analysis of the UV-induced mutants revealed strong strand-specific bias and unexpectedly high frequency of alleles with widely separated multiple mutations scattered over several kilobases. Hypermutability and multiple mutations associated with lesions in transient stretches of long single-strand DNA may be a source of carcinogenesis and provide selective advantage in adaptive evolution. PMID:19023402

  20. Translocation of double strand DNA into a biological nanopore

    NASA Astrophysics Data System (ADS)

    Chatkaew, Sunita; Mlayeh, Lamia; Leonetti, Marc; Homble, Fabrice

    2009-03-01

    Translocation of double strand DNA across a unique mitochondrial biological nanopore (VDAC) is observed by an electrophysiological method. Characteristics of opened and sub-conductance states of VDAC are studied. When the applied electric potential is beyond ± 20 mV, VDAC transits to a sub-conductance state. Plasmids (circular double strand DNA) with a diameter greater than that of the channel shows the current reduction into the channel during the interaction but the state with zero-current is not observed. On the contrary, the interaction of linear double strand DNA with the channel shows the current reduction along with the zero-current state. These show the passages of linear double strand DNA across the channel and the electrostatic effect due to the surface charges of double strand DNA and channel for circular and linear double strand DNA.

  1. Atomic force microscopy of single- and double-stranded DNA.

    PubMed Central

    Hansma, H G; Sinsheimer, R L; Li, M Q; Hansma, P K

    1992-01-01

    A method has been developed for imaging single-stranded DNA with the atomic force microscope (AFM). phi X174 single-stranded DNA in formaldehyde on mica can be imaged in the AFM under propanol or butanol or in air. Measured lengths of most molecules are on the order of 1 mu, although occasionally more extended molecules with lengths of 1.7 to 1.9 mu are seen. Single-stranded DNA in the AFM generally appears lumpier than double-stranded DNA, even when extended. Images of double-stranded lambda DNA in the AFM show more sharp kinks and bends than are typically observed in the electron microscope. Dense, aggregated fields of double-stranded plasmids can be converted by gentle rinsing with hot water to well spread fields. Images PMID:1386422

  2. Strong gold atom strands formed by incorporation of carbon atoms

    NASA Astrophysics Data System (ADS)

    Oshima, Yoshifumi; Kurui, Yoshihiko; Nguyen, Huy Duy; Ono, Tomoya; Takayanagi, Kunio

    2011-07-01

    Single metal atom strands have attracted significant interest because of their unique properties, such as quantization effects and a high degree of strength. Recently it was suggested that the strength of a gold atom strand can be enhanced by the insertion of an impurity atom, but it has not been experimentally investigated. Using a transmission electron microscope under ultrahigh vacuum conditions, we observed that gold atoms were pulled out one by one from a carbon-contaminated gold (111) surface to form a long atom strand. The strand was so strong that it did not break even upon bending. Supported by first-principles calculations, the strand was found to have two carbon atoms at each gold atom interval. Our observations suggest that the carbon atoms act as a glue to form a long gold atom strand.

  3. DNA Strand Breaks, Neurodegeneration and Aging in the Brain

    PubMed Central

    Katyal, Sachin; McKinnon, Peter J.

    2013-01-01

    Defective responses to DNA single- or double-strand breaks can result in neurological disease, underscoring the critical importance of DNA repair for neural homeostasis. Human DNA repair-deficient syndromes are generally congenital, in which brain pathology reflects the consequences of developmentally incurred DNA damage. Although, it is unclear to what degree DNA strand-break repair defects in mature neural cells contributes to disease pathology. However, DNA single-strand breaks are a relatively common lesion which if not repaired can impact cells via interference with transcription. Thus, this lesion, and probably to a lesser extent DNA double strand breaks, may be particularly relevant to aging in the neural cell population. In this review we will examine the consequences of defective DNA strand break repair towards homeostasis in the brain. Further, we also consider the utility of mouse models as reagents to understand the connection between DNA strand breaks and aging in the brain. PMID:18455751

  4. Establishing a Marine Mammal Stranding Network in the Bahamas

    DTIC Science & Technology

    2008-01-01

    Marine Mammal Stranding Network in the Bahamas Diane Elaine Claridge Bahamas Marine Mammal Research Organisation P.O. Box AB...are to establish a marine mammal stranding network in the Bahamas to better understand the conservation needs of marine mammals in the Bahamas, with...well as the biology of marine mammals . The stranding network will be structured so that it will become self-sufficient and able to continue into

  5. New progress of ITER-PF strand production in WST

    NASA Astrophysics Data System (ADS)

    Li, J. F.; Liu, W. T.; Yan, L. X.; H, J.; Gao, H. X.; Liu, J. W.; Du, S. J.; Liu, X. H.; Feng, Y.; Zhang, P. X.; Liu, S.; Li, H. W.; Niu, E. W.

    2014-05-01

    ITER Poloidal Field (PF) systems consist of 6 independent coils with different dimensions and require NbTi superconductor and copper strands. Western Superconducting Technologies Co.,Ltd.(WST) will supply PF2-5 NbTi strand for ITER, and over 14,000 km of NbTi strands have been produced in the past two years. Main performance of NbTi strands, including critical current, n value, wire diameter, Cu/non-Cu ratio, hysteresis loss and RRR are reported and analysed in this paper.

  6. Regulation of DNA Strand Displacement Using Allosteric DNA Toehold.

    PubMed

    Yang, Xiaolong; Tang, Yanan; Traynor, Sarah M; Li, Feng

    2016-10-05

    Toehold-mediated DNA strand displacement is the fundamental basis for the construction and operation of diverse DNA devices, including circuits, machines, sensors, and reconfigurable structures. Controllable activation and regulation of toeholds are critical to construct devices with multistep, autonomous, and complex behaviors. A handful of unique toehold activation mechanisms, including toehold-exchange, associative toehold, and remote toehold, have been developed and are often combined to achieve desired strand displacement behaviors and functions. Here we report an allosteric DNA toehold (A-toehold) design that allows the flexible regulation of DNA strand displacement by splitting an input strand into an A-toehold and branch migration domain. Because of its simplicity, the A-toehold mechanism can be a useful addition to the current toolbox of DNA strand displacement techniques. We demonstrated that A-toehold enabled a number of interesting functions that were previously shown using more sophisticated DNA strand displacement systems, including 1) continuously tuning the rate of strand displacement, 2) dynamic control of strand displacement reactions, and 3) selective activation of multiple strand displacement reactions. Moreover, by combining A-toehold and toehold-exchange mechanisms, we have successfully constructed a non-covalent DNA catalysis network that resembles an allosteric enzyme.

  7. Acoustical dead zones and the spatial aggregation of whale strandings.

    PubMed

    Sundaram, Bala; Poje, Andrew C; Veit, Richard R; Nganguia, Herve

    2006-02-21

    Cetacean strandings display a marked geographical clustering. We propose a simple, two-dimensional ray-dynamics model of cetacean echolocation to examine the role played by coastline topography in influencing the location and clustering of stranding sites. We find that a number of coastlines known to attract cetacean strandings produce acoustical "Dead Zones" where echolocation signals are severely distorted by purely geometric effects. Using available cetacean stranding data bases from four disparate areas, we show that the geographical clusters in the observations correlate strongly with the regions of distorted echolocation signals as predicted by the model.

  8. A methodology to identify stranded generation facilities and estimate stranded costs for Louisiana's electric utility industry

    NASA Astrophysics Data System (ADS)

    Cope, Robert Frank, III

    1998-12-01

    The electric utility industry in the United States is currently experiencing a new and different type of growing pain. It is the pain of having to restructure itself into a competitive business. Many industry experts are trying to explain how the nation as a whole, as well as individual states, will implement restructuring and handle its numerous "transition problems." One significant transition problem for federal and state regulators rests with determining a utility's stranded costs. Stranded generation facilities are assets which would be uneconomic in a competitive environment or costs for assets whose regulated book value is greater than market value. At issue is the methodology which will be used to estimate stranded costs. The two primary methods are known as "Top-Down" and "Bottom-Up." The "Top-Down" approach simply determines the present value of the losses in revenue as the market price for electricity changes over a period of time into the future. The problem with this approach is that it does not take into account technical issues associated with the generation and wheeling of electricity. The "Bottom-Up" approach computes the present value of specific strandable generation facilities and compares the resulting valuations with their historical costs. It is regarded as a detailed and difficult, but more precise, approach to identifying stranded assets and their associated costs. This dissertation develops a "Bottom-Up" quantitative, optimization-based approach to electric power wheeling within the state of Louisiana. It optimally evaluates all production capabilities and coordinates the movement of bulk power through transmission interconnections of competing companies in and around the state. Sensitivity analysis to this approach is performed by varying seasonal consumer demand, electric power imports, and transmission inter-connection cost parameters. Generation facility economic dispatch and transmission interconnection bulk power transfers, specific

  9. Why double-stranded RNA resists condensation

    SciTech Connect

    Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan A.; Pollack, Lois; Onufriev, Alexey

    2014-09-15

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexes with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.

  10. RecBCD is required to complete chromosomal replication: Implications for double-strand break frequencies and repair mechanisms.

    PubMed

    Courcelle, Justin; Wendel, Brian M; Livingstone, Dena D; Courcelle, Charmain T

    2015-08-01

    Several aspects of the mechanism of homologous double-strand break repair remain unclear. Although intensive efforts have focused on how recombination reactions initiate, far less is known about the molecular events that follow. Based upon biochemical studies, current models propose that RecBCD processes double-strand ends and loads RecA to initiate recombinational repair. However, recent studies have shown that RecBCD plays a critical role in completing replication events on the chromosome through a mechanism that does not involve RecA or recombination. Here, we examine several studies, both early and recent, that suggest RecBCD also operates late in the recombination process - after initiation, strand invasion, and crossover resolution have occurred. Similar to its role in completing replication, we propose a model in which RecBCD is required to resect and resolve the DNA synthesis associated with homologous recombination at the point where the missing sequences on the broken molecule have been restored. We explain how the impaired ability to complete chromosome replication in recBC and recD mutants is likely to account for the loss of viability and genome instability in these mutants, and conclude that spontaneous double-strand breaks and replication fork collapse occur far less frequently than previously speculated.

  11. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA.

    PubMed

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela; Gamba, Cristina; Barnett, Ross; Samaniego, José Alfredo; Madrigal, Jazmín Ramos; Orlando, Ludovic; Gilbert, M Thomas P

    2015-12-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained <3% endogenous DNA, but this enrichment is less pronounced when dsDNA preparations successfully recover short endogenous DNA fragments (mean size < 70 bp). Our findings can help researchers determine when to utilize the time- and resource-intensive ssDNA library preparation method.

  12. 75 FR 4104 - Prestressed Concrete Steel Wire Strand From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-26

    ... COMMISSION Prestressed Concrete Steel Wire Strand From China AGENCY: United States International Trade... concrete steel wire strand, provided for in subheading 7312.10.30 of the Harmonized Tariff Schedule of the... suitable for use in prestressed concrete (both pre-tensioned and post- tensioned) applications. The...

  13. Saliva of Lygus lineolaris digests double stranded ribonucleic acids

    USDA-ARS?s Scientific Manuscript database

    The prospects for development of highly specific pesticides based on double stranded ribonucleic acid have been a recent focus of scientific research. Creative applications have been proposed and demonstrated. However, not all insects are sensitive to double stranded RNA (dsRNA) gene knockdown effec...

  14. The economics of stranded investment - a two-way street

    SciTech Connect

    Cearley, R.; McKinzie, L.

    1995-11-01

    In the transition to deregulation, the risk, costs and benefits of utility assets are transferred from the customer to the investor, creating potential stranded benefits as well as stranded costs. Investors may be better or worse off depending on whether an asset`s cost is below or above market. Regulators can minimize unintended wealth transfers by compensating each potential loser in the transition. The amount of investment stranded - i.e., the portion of plant that is above market value - does seem to be a murky issue. This article sets a framework for evaluating stranded investment and traces the possible welfare effects of different policies to address it. It defines {open_quote}stranded costs,{close_quote} {open_quote}stranded investment,{close_quote} and {open_quote}stranded benefits.{close_quote} It addresses their interrelationship, and shows that the redefinition of property rights during the transition to a competitive market is what leads to stranded investment. The elimination of the utility`s exclusive franchise - i.e., its obligation to serve and customers` obligation to pay - leads to the redefinition of those property rights as they pertain to the costs, benefits and risks associated with existing utility generation. Finally, the authors address the possible welfare implications from this transition.

  15. Second-strand cDNA synthesis: classical method

    SciTech Connect

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S/sub 1/ nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described.

  16. Dynamic DNA nanotechnology using strand-displacement reactions

    NASA Astrophysics Data System (ADS)

    Zhang, David Yu; Seelig, Georg

    2011-02-01

    The specificity and predictability of Watson-Crick base pairing make DNA a powerful and versatile material for engineering at the nanoscale. This has enabled the construction of a diverse and rapidly growing set of DNA nanostructures and nanodevices through the programmed hybridization of complementary strands. Although it had initially focused on the self-assembly of static structures, DNA nanotechnology is now also becoming increasingly attractive for engineering systems with interesting dynamic properties. Various devices, including circuits, catalytic amplifiers, autonomous molecular motors and reconfigurable nanostructures, have recently been rationally designed to use DNA strand-displacement reactions, in which two strands with partial or full complementarity hybridize, displacing in the process one or more pre-hybridized strands. This mechanism allows for the kinetic control of reaction pathways. Here, we review DNA strand-displacement-based devices, and look at how this relatively simple mechanism can lead to a surprising diversity of dynamic behaviour.

  17. Computing in mammalian cells with nucleic acid strand exchange

    PubMed Central

    Pochekailov, Sergii; Kirschman, Jonathan L.; Santangelo, Philip J.; Seelig, Georg

    2015-01-01

    DNA strand displacement has been widely used for the design of molecular circuits, motors, and sensors in cell-free settings. Recently, it has been shown that this technology can also operate in biological environments, but capabilities remain limited. Here, we look to adapt strand displacement and exchange reactions to mammalian cells and report DNA circuitry that can directly interact with a native mRNA. We began by optimizing the cellular performance of fluorescent reporters based on four-way strand exchange reactions and identified robust design principles by systematically varying the molecular structure, chemistry and delivery method. Next, we developed and tested AND and OR logic gates based on four-way strand exchange, demonstrating the feasibility of multi-input logic. Finally, we established that functional siRNA could be activated through strand exchange, and used native mRNA as programmable scaffolds for co-localizing gates and visualizing their operation with subcellular resolution. PMID:26689378

  18. Yeast Pif1 Accelerates Annealing of Complementary DNA Strands

    PubMed Central

    2015-01-01

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406

  19. Stranded investment, prices and privacy factor in FERC rulings

    SciTech Connect

    O`Driscoll, M.

    1993-07-16

    The Federal Energy Regulatory Commission upheld its rejection of United Illuminating Co.`s bid to recover stranded investment costs. Since UI has no wholesale customers, it is a matter best left to state regulators, FERC said. UI`s stranded investment recovery plan was part of the company`s transmission access tariff, which provides for open access transmission service at cost-based rates. FERC ordered UI to delete the stranded investment provisions, saying UI was trying to recover in its wholesale transmission rates the costs of generation facility investments that were incurred to provide service to retail customers that leave its system, reasoning that UI was seeking protection from what may be legitimate retail franchise competition, which is a state matter. UI, however, said deleting the stranded investment provision would preclude it from arguing in an individual rate filling under the transmission tariff that stranded investment costs should be borne by the wheeling customer.

  20. Relationship between marine mammal stranding events and offshore earthquakes

    NASA Astrophysics Data System (ADS)

    Grant, Rachel; Savirina, Anna; Hoppit, Will

    2014-05-01

    The causes of marine mammal stranding events are largely unknown, but may relate to ocean currents, severe weather, anthropogenic noise pollution, and other factors. Large stranding events have been suggested to occur as a result of offshore earthquakes but there is little evidence as yet to support this hypothesis. Stranding events occur in hotspots, which are sometimes areas of high seismic activity, such as Taiwan, and other times, in areas that are removed from seismic zones, such as Cape Cod. We analyse a large and robust dataset of marine mammal stranding data collected off the coast of Washington and Oregon from 1999 to 2010, to look for statistical connections to offshore earthquakes. We looked forward, as well as backward in time from significant seismic events, to ascertain whether stranding occurrences, if connected to earthquakes, are a result of the earthquake preparation period or the earthquake itself. Possible mechanisms are discussed.

  1. Alpha Helices Are More Robust to Mutations than Beta Strands

    PubMed Central

    Abrusán, György

    2016-01-01

    The rapidly increasing amount of data on human genetic variation has resulted in a growing demand to identify pathogenic mutations computationally, as their experimental validation is currently beyond reach. Here we show that alpha helices and beta strands differ significantly in their ability to tolerate mutations: helices can accumulate more mutations than strands without change, due to the higher numbers of inter-residue contacts in helices. This results in two patterns: a) the same number of mutations causes less structural change in helices than in strands; b) helices diverge more rapidly in sequence than strands within the same domains. Additionally, both helices and strands are significantly more robust than coils. Based on this observation we show that human missense mutations that change secondary structure are more likely to be pathogenic than those that do not. Moreover, inclusion of predicted secondary structure changes shows significant utility for improving upon state-of-the-art pathogenicity predictions. PMID:27935949

  2. Computing in mammalian cells with nucleic acid strand exchange

    NASA Astrophysics Data System (ADS)

    Groves, Benjamin; Chen, Yuan-Jyue; Zurla, Chiara; Pochekailov, Sergii; Kirschman, Jonathan L.; Santangelo, Philip J.; Seelig, Georg

    2016-03-01

    DNA strand displacement has been widely used for the design of molecular circuits, motors, and sensors in cell-free settings. Recently, it has been shown that this technology can also operate in biological environments, but capabilities remain limited. Here, we look to adapt strand displacement and exchange reactions to mammalian cells and report DNA circuitry that can directly interact with a native mRNA. We began by optimizing the cellular performance of fluorescent reporters based on four-way strand exchange reactions and identified robust design principles by systematically varying the molecular structure, chemistry and delivery method. Next, we developed and tested AND and OR logic gates based on four-way strand exchange, demonstrating the feasibility of multi-input logic. Finally, we established that functional siRNA could be activated through strand exchange, and used native mRNA as programmable scaffolds for co-localizing gates and visualizing their operation with subcellular resolution.

  3. Yeast Pif1 accelerates annealing of complementary DNA strands.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D

    2014-12-09

    Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.

  4. [Invasive and minimally invasive hemodynamic monitoring].

    PubMed

    Hansen, Matthias

    2016-10-01

    Advanced hemodynamic monitoring is necessary for adequate management of high-risk patients or patients with derangement of circulation. Studies demonstrate a benefit of early goal directed therapy in unstable cardiopulmonary situations. In these days we have different possibilities of minimally invasive or invasive hemodynamic monitoring. Minimally invasive measurements like pulse conture analysis or pulse wave analysis being less accurate under some circumstances, however only an artery catheter is needed for cardiac output monitoring. Pulmonary artery, transpulmonary thermodilution and lithium dilution technology have acceptable accuracy in cardiac output measurement. For therapy of unstable circulation there are additionally parameters to obtain. The pulmonary artery catheter is the device with the largest rate of complications, used by a trained crew and with a correct indication, his use is unchained justified.

  5. Vacuum brazing of carbon nanotube strands

    NASA Astrophysics Data System (ADS)

    Wu, Wei

    Carbon nanotubes (CNTs) discovered at 1991 have attracted great interest for applications in Nano-Electro-Mechanical-Systems (NEMS). However, the search for methods to join CNTs with metallic parts has been a worldwide challenge. Many efforts have been devoted to manipulating individual CNTs and joining them to each other. Joining processes so far attempted are premature and fall short of efficiency for joint quality evaluation. Thus, it has been found necessary to work on macro CNTs strands which are easy to handle via macro joining techniques. In this study, vacuum brazing technology has been developed for joining macro CNTs strands with Ni using a Ti-Ag-Cu alloy. The brazing mechanism has been confirmed as due to TiC formation at the CNTs/Ti-Ag-Cu interface. To evaluate this novel vacuum brazing technique for CNTs joining, the temperature effect on the brazing mechanism, microstructure and stoichiometry at joint interface needed to be understood. Firstly, the influence of temperature (from room temperature to 1000°C) on mechanical behaviour of CNTs was well examined. The ultimate tensile strength (UTS) of CNTs was measured to be a maximum at 900°C. Then, the mechanical performance of the joints was investigated from 850°C to 1000°C, and the fracture modes of the joints were identified. The UTS of joint also achieves maximum at 900°C. Below 900°C, due to little TiC formation, the bonding is weak thus leading to interfacial fracture. Above 900°C, due to much TiC formation, the bonding is strong thus resulting in CNTs fracture. Furthermore, the vacuum brazing technique was applied to join CNTs to Ni contact wires used as a lamp filament. Compared to the filament joined by Ag paste or mechanical connection, the illumination of the brazed CNTs filament was stronger. The current density of the brazed filament was superior to the Ag paste connected filament. This may represent a promising way to produce energy saving lamps.

  6. Strand-Specific Analysis Shows Protein Binding at Replication Forks and PCNA Unloading from Lagging Strands when Forks Stall

    PubMed Central

    Yu, Chuanhe; Gan, Haiyun; Han, Junhong; Zhou, Zhi-Xiong; Jia, Shaodong; Chabes, Andrei; Farrugia, Gianrico; Ordog, Tamas; Zhang, Zhiguo

    2015-01-01

    SUMMARY In eukaryotic cells, DNA replication proceeds with continuous synthesis of leading-strand DNA and discontinuous synthesis of lagging-strand DNA. Here we describe a method, eSPAN (enrichment and sequencing of protein-associated nascent DNA), which reveals the genome-wide association of proteins with leading and lagging strands of DNA replication forks. Using this approach in budding yeast, we confirm the strand specificities of DNA polymerases delta and epsilon and show that the PCNA clamp is enriched at lagging strands compared with leading-strand replication. Surprisingly, at stalled forks, PCNA is unloaded specifically from lagging strands. PCNA unloading depends on the Elg1-containing alternative RFC complex, ubiquitination of PCNA, and the checkpoint kinases Mec1 and Rad53. Cells deficient in PCNA unloading exhibit increased chromosome breaks. Our studies provide a tool for studying replication-related processes and reveal a mechanism whereby checkpoint kinases regulate strand-specific unloading of PCNA from stalled replication forks to maintain genome stability. PMID:25449133

  7. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    DTIC Science & Technology

    2012-09-30

    University of Pennsylvania Philadelphia PA 19104 Kathleen Moore International Fund for Animal Welfare Yarmouth Port MA 02675 Randall Wells...stress in cetaceans . After undertaking a baseline experiment in Steller sea lions, this project will compare and contrast health, body condition, and...presence of bubbles with markers for decompression stress in mass stranded cetaceans , and compare these indices with single stranded individuals

  8. Overlooking the smallest matter: viruses impact biological invasions.

    PubMed

    Faillace, Cara A; Lorusso, Nicholas S; Duffy, Siobain

    2017-04-01

    Parasites and pathogens have recently received considerable attention for their ability to affect biological invasions, however, researchers have largely overlooked the distinct role of viruses afforded by their unique ability to rapidly mutate and adapt to new hosts. With high mutation and genomic substitution rates, RNA and single-stranded DNA (ssDNA) viruses may be important constituents of invaded ecosystems, and could potentially behave quite differently from other pathogens. We review evidence suggesting that rapidly evolving viruses impact invasion dynamics in three key ways: (1) Rapidly evolving viruses may prevent exotic species from establishing self-sustaining populations. (2) Viruses can cause population collapses of exotic species in the introduced range. (3) Viruses can alter the consequences of biological invasions by causing population collapses and extinctions of native species. The ubiquity and frequent host shifting of viruses make their ability to influence invasion events likely. Eludicating the viral ecology of biological invasions will lead to an improved understanding of the causes and consequences of invasions, particularly as regards establishment success and changes to community structure that cannot be explained by direct interspecific interactions among native and exotic species.

  9. Coccidioidomycosis and other systemic mycoses of marine mammals stranding along the central California, USA coast: 1998-2012.

    PubMed

    Huckabone, Sara E; Gulland, Frances M D; Johnson, Suzanne M; Colegrove, Kathleen M; Dodd, Erin M; Pappagianis, Demosthenes; Dunkin, Robin C; Casper, David; Carlson, Erin L; Sykes, Jane E; Meyer, Weiland; Miller, Melissa A

    2015-04-01

    A wide range of systemic mycoses have been reported from captive and wild marine mammals from North America. Examples include regionally endemic pathogens such as Coccidioides and Blastomyces spp., and novel pathogens like Cryptococcus gattii, which appear may have been introduced to North America by humans. Stranding and necropsy data were analyzed from three marine mammal stranding and response facilities on the central California coast to assess the prevalence, host demographics, and lesion distribution of systemic mycoses affecting locally endemic marine mammals. Between 1 January 1998 and 30 June 2012, >7,000 stranded marine mammals were necropsied at the three facilities. Necropsy and histopathology records were reviewed to identify cases of locally invasive or systemic mycoses and determine the nature and distribution of fungal lesions. Forty-one animals (0.6%) exhibited cytological, culture- or histologically confirmed locally invasive or systemic mycoses: 36 had coccidioidomycosis, two had zygomycosis, two had cryptococcosis, and one was systemically infected with Scedosporium apiospermum (an Ascomycota). Infected animals included 18 California sea lions (Zalophus californianus), 20 southern sea otters (Enhydra lutris nereis), two Pacific harbor seals (Phoca vitulina richardsi), one Dall's porpoise (Phocoenoides dalli), and one northern elephant seal (Mirounga angustirostris). Coccidioidomycosis was reported from 15 sea lions, 20 sea otters, and one harbor seal, confirming that Coccidioides spp. is the most common pathogen causing systemic mycosis in marine mammals stranding along the central California coast. We also report the first confirmation of C. gattii infection in a wild marine mammal from California and the first report of coccidioidomycosis in a wild harbor seal. Awareness of these pathogenic fungi during clinical care and postmortem examination is an important part of marine mammal population health surveillance and human health protection

  10. Predictors of mesorectal fascia invasion after gadolinium injection in rectal carcinoma after neoadjuvant therapy.

    PubMed

    Quaia, Emilio; Gennari, Antonio Giulio; De Paoli, Luca; Angileri, Roberta; Ukmar, Maja; Cova, Maria Assunta

    2014-01-01

    To assess spectral presaturation inversion-recovery MRI sequence with gadolinium to identify predictors of mesorectal fascia (MRF) invasion in patients with locally advanced rectal carcinoma after neoadjuvant therapy. Sixty-five patients underwent neoadjuvant concomitant radiation and chemotherapy and surgery. Magnetic resonance images were assessed by two radiologists. Linear (odds ratio, 95% confidence intervals: 19.33, 1.98-188.6) and reticular strands (odds ratio, 95% confidence intervals: 9.75, 1.45-67.77) reaching the MRF are predictors of MRF invasion. Linear or reticular mesorectal strands reaching the MRF detected at contrast-enhanced MRI represent a predictor of MRF invasion. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Recombination in Eukaryotic Single Stranded DNA Viruses

    PubMed Central

    Martin, Darren P.; Biagini, Philippe; Lefeuvre, Pierre; Golden, Michael; Roumagnac, Philippe; Varsani, Arvind

    2011-01-01

    Although single stranded (ss) DNA viruses that infect humans and their domesticated animals do not generally cause major diseases, the arthropod borne ssDNA viruses of plants do, and as a result seriously constrain food production in most temperate regions of the world. Besides the well known plant and animal-infecting ssDNA viruses, it has recently become apparent through metagenomic surveys of ssDNA molecules that there also exist large numbers of other diverse ssDNA viruses within almost all terrestrial and aquatic environments. The host ranges of these viruses probably span the tree of life and they are likely to be important components of global ecosystems. Various lines of evidence suggest that a pivotal evolutionary process during the generation of this global ssDNA virus diversity has probably been genetic recombination. High rates of homologous recombination, non-homologous recombination and genome component reassortment are known to occur within and between various different ssDNA virus species and we look here at the various roles that these different types of recombination may play, both in the day-to-day biology, and in the longer term evolution, of these viruses. We specifically focus on the ecological, biochemical and selective factors underlying patterns of genetic exchange detectable amongst the ssDNA viruses and discuss how these should all be considered when assessing the adaptive value of recombination during ssDNA virus evolution. PMID:21994803

  12. Parasites in stranded cetaceans of Patagonia.

    PubMed

    Berón-Vera, Bárbara; Crespo, Enrique A; Raga, Juan A

    2008-08-01

    There is an increasing interest in parasites of marine mammals of Argentina. Here, we examined several poorly known cetaceans, i.e., 2 spectacled porpoises and 1 Burmeister's porpoise (Phocoenidae), and 1 Gray's beaked whale and 1 Cuvier's beaked whale (Ziphidae); we also updated the parasite information for 1 sperm whale (Physeteridae). These hosts strand only occasionally. We found Anisakis simplex s.l. in 2 spectacled porpoises and the Burmeister's porpoise, and recorded its distribution among the stomach chambers. Anisakis physeteris infected the sperm whale; Corynosoma cetaceum occurred in the duodenal ampulla of the Burmeister's porpoise; Corynosoma australe was found in the posterior-most region of the intestine of 1 spectacled porpoise, while another one had Tetrabothrius sp. in the anal crypts; Corynosoma bullosum and Corynosoma sp. were found in the sperm whale. The only digenean found was Pholeter gastrophilus in the Burmeister's porpoise. Merocercoids of Phyllobothrium delphini were present in the blubber of 1 spectacled porpoise, the sperm whale, and the Gray's beaked whale, while Scolex pleuronectis infected the Gray's beaked whale and 1 spectacled porpoise. No parasites were recovered from the Cuvier's beaked whale. Poor parasite-species assemblages are consistent in marine mammals of Patagonia. Given the conservation status of these hosts, the limited parasitological information gathered is valuable for conservation or management of these hosts in Patagonia.

  13. A double-stranded DNA rotaxane.

    PubMed

    Ackermann, Damian; Schmidt, Thorsten L; Hannam, Jeffrey S; Purohit, Chandra S; Heckel, Alexander; Famulok, Michael

    2010-06-01

    Mechanically interlocked molecules such as rotaxanes and catenanes have potential as components of molecular machinery. Rotaxanes consist of a dumb-bell-shaped molecule encircled by a macrocycle that can move unhindered along the axle, trapped by bulky stoppers. Previously, rotaxanes have been made from a variety of molecules, but not from DNA. Here, we report the design, assembly and characterization of rotaxanes in which both the dumb-bell-shaped molecule and the macrocycle are made of double-stranded DNA, and in which the axle of the dumb-bell is threaded through the macrocycle by base pairing. The assembly involves the formation of pseudorotaxanes, in which the macrocycle and the axle are locked together by hybridization. Ligation of stopper modules to the axle leads to the characteristic dumb-bell topology. When an oligonucleotide is added to release the macrocycle from the axle, the pseudorotaxanes are either converted to mechanically stable rotaxanes, or they disassemble by means of a slippage mechanism to yield a dumb-bell and a free macrocycle. Our DNA rotaxanes allow the fields of mechanically interlocked molecules and DNA nanotechnology to be combined, thus opening new possibilities for research into molecular machines and synthetic biology.

  14. A double-stranded DNA rotaxane

    NASA Astrophysics Data System (ADS)

    Ackermann, Damian; Schmidt, Thorsten L.; Hannam, Jeffrey S.; Purohit, Chandra S.; Heckel, Alexander; Famulok, Michael

    2010-06-01

    Mechanically interlocked molecules such as rotaxanes and catenanes have potential as components of molecular machinery. Rotaxanes consist of a dumb-bell-shaped molecule encircled by a macrocycle that can move unhindered along the axle, trapped by bulky stoppers. Previously, rotaxanes have been made from a variety of molecules, but not from DNA. Here, we report the design, assembly and characterization of rotaxanes in which both the dumb-bell-shaped molecule and the macrocycle are made of double-stranded DNA, and in which the axle of the dumb-bell is threaded through the macrocycle by base pairing. The assembly involves the formation of pseudorotaxanes, in which the macrocycle and the axle are locked together by hybridization. Ligation of stopper modules to the axle leads to the characteristic dumb-bell topology. When an oligonucleotide is added to release the macrocycle from the axle, the pseudorotaxanes are either converted to mechanically stable rotaxanes, or they disassemble by means of a slippage mechanism to yield a dumb-bell and a free macrocycle. Our DNA rotaxanes allow the fields of mechanically interlocked molecules and DNA nanotechnology to be combined, thus opening new possibilities for research into molecular machines and synthetic biology.

  15. Recombination in eukaryotic single stranded DNA viruses.

    PubMed

    Martin, Darren P; Biagini, Philippe; Lefeuvre, Pierre; Golden, Michael; Roumagnac, Philippe; Varsani, Arvind

    2011-09-01

    Although single stranded (ss) DNA viruses that infect humans and their domesticated animals do not generally cause major diseases, the arthropod borne ssDNA viruses of plants do, and as a result seriously constrain food production in most temperate regions of the world. Besides the well known plant and animal-infecting ssDNA viruses, it has recently become apparent through metagenomic surveys of ssDNA molecules that there also exist large numbers of other diverse ssDNA viruses within almost all terrestrial and aquatic environments. The host ranges of these viruses probably span the tree of life and they are likely to be important components of global ecosystems. Various lines of evidence suggest that a pivotal evolutionary process during the generation of this global ssDNA virus diversity has probably been genetic recombination. High rates of homologous recombination, non-homologous recombination and genome component reassortment are known to occur within and between various different ssDNA virus species and we look here at the various roles that these different types of recombination may play, both in the day-to-day biology, and in the longer term evolution, of these viruses. We specifically focus on the ecological, biochemical and selective factors underlying patterns of genetic exchange detectable amongst the ssDNA viruses and discuss how these should all be considered when assessing the adaptive value of recombination during ssDNA virus evolution.

  16. Factors influencing plant invasiveness

    Treesearch

    Yvette Ortega; Dean Pearson

    2009-01-01

    Invasiveness of spotted knapweed and biological control agents. Dean and Yvette are examining the influence of drought on the invasiveness of spotted knapweed (Centaurea maculosa) and its susceptibility to herbivory by biological control agents. In collaboration with the University of Montana and Forest Health Protection, researchers have constructed 150...

  17. Fluid mechanics of DNA double-strand filter elution.

    PubMed

    Rudinger, George; Blazek, Ed Robert

    2002-01-01

    Measurement of infrequent DNA double-strand breaks (DSB) in mammalian cells is essential for the understanding of cell damage by ionizing radiation and many DNA-reactive drugs. One of the most important assays for measuring DSB in cellular DNA is filter elution. This study is an attempt to determine whether standard concepts of fluid mechanics can yield a self-consistent model of this process. Major assumptions of the analysis are reptation through a channel formed by surrounding strands, with only strand ends captured by filter pores. Both viscosity and entanglement with surrounding strands are considered to determine the resistance to this motion. One important result is that the average elution time of a strand depends not only on its length, but also on the size distribution of the surrounding strands. This model is consistent with experimental observations, such as the dependence of elution kinetics upon radiation dose, but independence from the size of the DNA sample up to a critical filter loading, and possible overlap of elution times for strands of different length. It indicates how the dependence of elution time on the flow rate could reveal the relative importance of viscous and entanglement resistance, and also predicts the consequences of using different filters.

  18. Exclusion of RNA strands from a purine motif triple helix.

    PubMed Central

    Semerad, C L; Maher, L J

    1994-01-01

    Research concerning oligonucleotide-directed triple helix formation has mainly focused on the binding of DNA oligonucleotides to duplex DNA. The participation of RNA strands in triple helices is also of interest. For the pyrimidine motif (pyrimidine.purine.pyrimidine triplets), systematic substitution of RNA for DNA in one, two, or all three triplex strands has previously been reported. For the purine motif (purine.purine.pyrimidine triplets), studies have shown only that RNA cannot bind to duplex DNA. To extend this result, we created a DNA triple helix in the purine motif and systematically replaced one, two, or all three strands with RNA. In dramatic contrast to the general accommodation of RNA strands in the pyrimidine triple helix motif, a stable triplex forms in the purine motif only when all three of the substituent strands are DNA. The lack of triplex formation among any of the other seven possible strand combinations involving RNA suggests that: (i) duplex structures containing RNA cannot be targeted by DNA oligonucleotides in the purine motif; (ii) RNA strands cannot be employed to recognize duplex DNA in the purine motif; and (iii) RNA tertiary structures are likely to contain only isolated base triplets in the purine motif. Images PMID:7529405

  19. Fluid mechanics of DNA double-strand filter elution.

    PubMed Central

    Rudinger, George; Blazek, Ed Robert

    2002-01-01

    Measurement of infrequent DNA double-strand breaks (DSB) in mammalian cells is essential for the understanding of cell damage by ionizing radiation and many DNA-reactive drugs. One of the most important assays for measuring DSB in cellular DNA is filter elution. This study is an attempt to determine whether standard concepts of fluid mechanics can yield a self-consistent model of this process. Major assumptions of the analysis are reptation through a channel formed by surrounding strands, with only strand ends captured by filter pores. Both viscosity and entanglement with surrounding strands are considered to determine the resistance to this motion. One important result is that the average elution time of a strand depends not only on its length, but also on the size distribution of the surrounding strands. This model is consistent with experimental observations, such as the dependence of elution kinetics upon radiation dose, but independence from the size of the DNA sample up to a critical filter loading, and possible overlap of elution times for strands of different length. It indicates how the dependence of elution time on the flow rate could reveal the relative importance of viscous and entanglement resistance, and also predicts the consequences of using different filters. PMID:11751292

  20. Dynamics of Leading-strand Lesion Skipping by the Replisome

    PubMed Central

    Yeeles, Joseph T.P.; Marians, Kenneth J.

    2013-01-01

    SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

  1. 75 FR 27294 - Proposed Information Collection; Comment Request; Marine Mammal Stranding Report/Marine Mammal...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-14

    ... Mammal Stranding Report/Marine Mammal Rehabilitation Disposition Report AGENCY: National Oceanic and... mammal stranding report provides information on strandings so that the National Marine Fisheries Service... facilities. This information is submitted primarily by volunteer members of the marine mammal...

  2. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    PubMed Central

    Roux, Simon; Solonenko, Natalie E.; Dang, Vinh T.; Poulos, Bonnie T.; Schwenck, Sarah M.; Goldsmith, Dawn B.; Coleman, Maureen L.; Breitbart, Mya

    2016-01-01

    Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA) viral genomes captured in quantitative viral metagenomes (viromes). This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA) viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation). Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against) and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5%) of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA) viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems. PMID:28003936

  3. Absence of localization in a multi-strand quasiperiodic lattice

    NASA Astrophysics Data System (ADS)

    Mukherjee, Amrita; Chakrabarti, Arunava

    2017-05-01

    Finite strips, composed of a quasi-periodic Fibonacci chain is described by tight binding Hamiltonian and refer to it as a style sample before you begin working on your paper. The system is described by a tight binding Hamiltonian. The eigenvalue spectrum of such a multi-strand quasiperiodic network is found to be sensitive on the mutual values of the intra-strand and inter-strand tunnel hoppings, whose distribution displays a unique three-subband self-similar pattern in a parameter subspace.

  4. Template Role of Double-Stranded RNA in Tombusvirus Replication

    PubMed Central

    Kovalev, Nikolay; Pogany, Judit

    2014-01-01

    ABSTRACT Replication of plus-strand RNA [(+)RNA] viruses of plants is a relatively simple process that involves complementary minus-strand RNA [(−)RNA] synthesis and subsequent (+)RNA synthesis. However, the actual replicative form of the (−)RNA template in the case of plant (+)RNA viruses is not yet established unambiguously. In this paper, using a cell-free replication assay supporting a full cycle of viral replication, we show that replication of Tomato bushy stunt virus (TBSV) leads to the formation of double-stranded RNA (dsRNA). Using RNase digestion, DNAzyme, and RNA mobility shift assays, we demonstrate the absence of naked (−)RNA templates during replication. Time course experiments showed the rapid appearance of dsRNA earlier than the bulk production of new (+)RNAs, suggesting an active role for dsRNA in replication. Radioactive nucleotide chase experiments showed that the mechanism of TBSV replication involves the use of dsRNA templates in strand displacement reactions, where the newly synthesized plus strand replaces the original (+)RNA in the dsRNA. We propose that the use of dsRNA as a template for (+)RNA synthesis by the viral replicase is facilitated by recruited host DEAD box helicases and the viral p33 RNA chaperone protein. Altogether, this replication strategy allows TBSV to separate minus- and plus-strand syntheses in time and regulate asymmetrical RNA replication that leads to abundant (+)RNA progeny. IMPORTANCE Positive-stranded RNA viruses of plants use their RNAs as the templates for replication. First, the minus strand is synthesized by the viral replicase complex (VRC), which then serves as a template for new plus-strand synthesis. To characterize the nature of the (−)RNA in the membrane-bound viral replicase, we performed complete RNA replication of Tomato bushy stunt virus (TBSV) in yeast cell-free extracts and in plant extracts. The experiments demonstrated that the TBSV (−)RNA is present as a double-stranded RNA that serves

  5. Ultrastructural evidence for intramolecular double stranding in iota-carrageenan.

    PubMed

    Abeysekera, R M; Bergström, E T; Goodall, D M; Norton, I T; Robards, A W

    1993-10-04

    Kinetic studies of primary processes of conformational ordering in gel-forming biopolymers have suggested that a change in mechanism from intermolecular to intramolecular multistrand formation occurs on lowering the concentration of biopolymer. We report here ultrastructural observations consistent with intramolecular double stranding in a carbohydrate polymer, iota-carrageenan, by arresting this process of primary conformational ordering by an ultra-rapid freeze fixation technique. High-resolution transmission electron microscopy (TEM) revealed isolated iota-carrageenan chains showing a range of morphologies (linear, circular, and hairpin) consistent with intramolecular stranding. Control experiments in which iota-carrageenan was frozen in the disordered form revealed longer and thinner strands.

  6. Analysis of the impact of the absence of RAD51 strand exchange activity in Arabidopsis meiosis

    PubMed Central

    Singh, Gunjita; Da Ines, Olivier; Gallego, Maria Eugenia

    2017-01-01

    The ploidy of eukaryote gametes must be halved to avoid doubling of numbers of chromosomes with each generation and this is carried out by meiosis, a specialized cell division in which a single chromosomal replication phase is followed by two successive nuclear divisions. With some exceptions, programmed recombination ensures the proper pairing and distribution of homologous pairs of chromosomes in meiosis and recombination defects thus lead to sterility. Two highly related recombinases are required to catalyse the key strand-invasion step of meiotic recombination and it is the meiosis-specific DMC1 which is generally believed to catalyse the essential non-sister chromatid crossing-over, with RAD51 catalysing sister-chromatid and non-cross-over events. Recent work in yeast and plants has however shown that in the absence of RAD51 strand-exchange activity, DMC1 is able to repair all meiotic DNA breaks and surprisingly, that this does not appear to affect numbers of meiotic cross-overs. In this work we confirm and extend this conclusion. Given that more than 95% of meiotic homologous recombination in Arabidopsis does not result in inter-homologue crossovers, Arabidopsis is a particularly sensitive model for testing the relative importance of the two proteins—even minor effects on the non-crossover event population should produce detectable effects on crossing-over. Although the presence of RAD51 protein provides essential support for the action of DMC1, our results show no significant effect of the absence of RAD51 strand-exchange activity on meiotic crossing-over rates or patterns in different chromosomal regions or across the whole genome of Arabidopsis, strongly supporting the argument that DMC1 catalyses repair of all meiotic DNA breaks, not only non-sister cross-overs. PMID:28797117

  7. Human mismatch repair system balances mutation rates between strands by removing more mismatches from the lagging strand.

    PubMed

    Andrianova, Maria A; Bazykin, Georgii A; Nikolaev, Sergey I; Seplyarskiy, Vladimir B

    2017-08-01

    Mismatch repair (MMR) is one of the main systems maintaining fidelity of replication. Differences in correction of errors produced during replication of the leading and the lagging DNA strands were reported in yeast and in human cancers, but the causes of these differences remain unclear. Here, we analyze data on human cancers with somatic mutations in two of the major DNA polymerases, delta and epsilon, that replicate the genome. We show that these cancers demonstrate a substantial asymmetry of the mutations between the leading and the lagging strands. The direction of this asymmetry is the opposite between cancers with mutated polymerases delta and epsilon, consistent with the role of these polymerases in replication of the lagging and the leading strands in human cells, respectively. Moreover, the direction of strand asymmetry observed in cancers with mutated polymerase delta is similar to that observed in MMR-deficient cancers. Together, these data indicate that polymerase delta (possibly together with polymerase alpha) contributes more mismatches during replication than its leading-strand counterpart, polymerase epsilon; that most of these mismatches are repaired by the MMR system; and that MMR repairs about three times more mismatches produced in cells during lagging strand replication compared with the leading strand. © 2017 Andrianova et al.; Published by Cold Spring Harbor Laboratory Press.

  8. 78 FR 54867 - Proposed Information Collection; Comment Request; Marine Mammal Health and Stranding Response...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-06

    ... Mammal Health and Stranding Response Program, Level A Stranding and Rehabilitation Disposition Data Sheet... mammals while in rehabilitation status. The data from the marine mammal rehabilitation disposition report...

  9. Transcriptional effects on double-strand break-induced gene conversion tracts.

    PubMed

    Weng, Y S; Xing, D; Clikeman, J A; Nickoloff, J A

    2000-10-16

    Transcription stimulates spontaneous homologous recombination, but prior studies have not investigated the effects of transcription on double-strand break (DSB)-induced recombination in yeast. We examined products of five ura3 direct repeat substrates in yeast using alleles that were transcribed at low or high levels. In each strain, recombination was stimulated by DSBs created in vivo at an HO site in one copy of ura3. Increasing transcription levels in donor or recipient alleles did not further stimulate DSB-induced recombination, nor did it alter the relative frequencies of conversion and deletion (pop-out) events. This result is consistent with the idea that transcription enhances spontaneous recombination by increasing initiation. Gene conversion tracts were measured using silent restriction fragment length polymorphisms (RFLPs) at approximately 100bp intervals. Transcription did not alter average tract lengths, but increased transcription in donor alleles increased both the frequency of promoter-proximal (5') unidirectional tracts and conversion of 5' markers. Increased transcription in recipient alleles increased the frequency of bidirectional tracts. We demonstrate that these effects are due to transcription per se, and not just transcription factor binding. These results suggest that transcription influences aspects of gene conversion after initiation, such as strand invasion and/or mismatch repair (MMR).

  10. Discovery of a novel circular single-stranded DNA virus from porcine faeces.

    PubMed

    Sikorski, Alyssa; Argüello-Astorga, Gerardo R; Dayaram, Anisha; Dobson, Renwick C J; Varsani, Arvind

    2013-01-01

    A large number of novel single-stranded DNA (ssDNA) viruses have been characterised from various environmental sources in the last 5 years. The bulk of these have been from faecal sources, and faecal sampling is an ideal non-invasive pathogen sampling method. We characterised a novel ssDNA from a porcine faecal sample from Cass Basin of the South Island of New Zealand. The novel viral genome has two large open reading frames (ORFs), which are bidirectionally transcribed and separated by intergenic regions. The largest ORF has some degree of similarity (<30 %) to the putative capsid protein of chimpanzee stool-associated circular ssDNA virus (ChiSCV) and pig stool-associated single-stranded DNA virus (PigSCV), whereas the second-largest ORF has high similarity to the putative replication-associated protein (Rep) of ChiSCV (~50 %) and bovine stool-associated circular DNA virus (BoSCV; ~30 %). Based on genome architecture, location of putative stem-loop like elements, and maximum-likelihood phylogenetic analysis of the gene encoding the Rep protein, the novel isolate belongs to the same family of ssDNA viruses as ChiSCV and BoSCV.

  11. Rad51-mediated double-strand break repair and mismatch correction of divergent substrates

    PubMed Central

    Anand, Ranjith; Beach, Annette; Li, Kevin; Haber, James

    2017-01-01

    The RecA/Rad51 family of recombinases execute the critical step in homologous recombination (HR): the search for homologous DNA to serve as the template during DNA double-strand break (DSB) repair1–7. Although budding yeast Rad51 has been extensively characterized in vitro3,4,6–9, the stringency of its search and sensitivity to mismatched sequences in vivo remain poorly defined. We analyzed Rad51-dependent break-induced replication (BIR) where the invading DSB end and its donor template share 108 bp homology and the donor carries different densities of single-bp mismatches (Fig. 1a). With every 8th bp mismatched, repair was ~14% compared to completely homologous sequences. With every 6th bp mismatched, repair was >5%. Thus completing BIR in vivo overcomes the apparent requirement for at least 6–8 consecutive paired bases inferred from in vitro studies6,8. When recombination occurs without a protruding nonhomologous 3′ tail, mismatch repair protein Msh2 does not discourage homeologous recombination. However, when the DSB end contains a 3′ protruding nonhomologous tail, Msh2 promotes rejection of mismatched substrates. Mismatch correction of strand invasion heteroduplex DNA is strongly polar, favoring correction close to the DSB end. Nearly all mismatch correction depends on the proofreading activity of DNA polymerase δ, although Msh2-Mlh1 and Exo1 influence the extent of correction. PMID:28405019

  12. Rad51-mediated double-strand break repair and mismatch correction of divergent substrates.

    PubMed

    Anand, Ranjith; Beach, Annette; Li, Kevin; Haber, James

    2017-04-20

    The Rad51 (also known as RecA) family of recombinases executes the critical step in homologous recombination: the search for homologous DNA to serve as a template during the repair of DNA double-strand breaks (DSBs). Although budding yeast Rad51 has been extensively characterized in vitro, the stringency of its search and sensitivity to mismatched sequences in vivo remain poorly defined. Here, in Saccharomyces cerevisiae, we analysed Rad51-dependent break-induced replication in which the invading DSB end and its donor template share a 108-base-pair homology region and the donor carries different densities of single-base-pair mismatches. With every eighth base pair mismatched, repair was about 14% of that of completely homologous sequences. With every sixth base pair mismatched, repair was still more than 5%. Thus, completing break-induced replication in vivo overcomes the apparent requirement for at least 6-8 consecutive paired bases that has been inferred from in vitro studies. When recombination occurs without a protruding nonhomologous 3' tail, the mismatch repair protein Msh2 does not discourage homeologous recombination. However, when the DSB end contains a 3' protruding nonhomologous tail, Msh2 promotes the rejection of mismatched substrates. Mismatch correction of strand invasion heteroduplex DNA is strongly polar, favouring correction close to the DSB end. Nearly all mismatch correction depends on the proofreading activity of DNA polymerase-δ, although the repair proteins Msh2, Mlh1 and Exo1 influence the extent of correction.

  13. 215. Dennis Hill, Photographer May 1998 DETAIL VIEW OF STRAND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    215. Dennis Hill, Photographer May 1998 DETAIL VIEW OF STRAND SHOES AND STORM CABLE EYE BARS IN YERBA BUENA ANCHORAGE, FACING EAST. - San Francisco Oakland Bay Bridge, Spanning San Francisco Bay, San Francisco, San Francisco County, CA

  14. 1893 ROPE ROOM189380 TON ROPE MACHINEUPPER STRAND GUIDE John ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1893 ROPE ROOM-1893-80 TON ROPE MACHINE-UPPER STRAND GUIDE - John A. Roebling's Sons Company & American Steel & Wire Company, South Broad, Clark, Elmer, Mott & Hudson Streets, Trenton, Mercer County, NJ

  15. Programmable energy landscapes for kinetic control of DNA strand displacement.

    PubMed

    Machinek, Robert R F; Ouldridge, Thomas E; Haley, Natalie E C; Bath, Jonathan; Turberfield, Andrew J

    2014-11-10

    DNA is used to construct synthetic systems that sense, actuate, move and compute. The operation of many dynamic DNA devices depends on toehold-mediated strand displacement, by which one DNA strand displaces another from a duplex. Kinetic control of strand displacement is particularly important in autonomous molecular machinery and molecular computation, in which non-equilibrium systems are controlled through rates of competing processes. Here, we introduce a new method based on the creation of mismatched base pairs as kinetic barriers to strand displacement. Reaction rate constants can be tuned across three orders of magnitude by altering the position of such a defect without significantly changing the stabilities of reactants or products. By modelling reaction free-energy landscapes, we explore the mechanistic basis of this control mechanism. We also demonstrate that oxDNA, a coarse-grained model of DNA, is capable of accurately predicting and explaining the impact of mismatches on displacement kinetics.

  16. 75 FR 8113 - Prestressed Concrete Steel Wire Strand From China

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-23

    ... From the Federal Register Online via the Government Publishing Office INTERNATIONAL TRADE COMMISSION Prestressed Concrete Steel Wire Strand From China AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject investigations. DATES: Effective Date: February 16,...

  17. Programming colloidal phase transitions with DNA strand displacement

    NASA Astrophysics Data System (ADS)

    Rogers, William; Manoharan, Vinothan

    2014-03-01

    Specific interactions induced by transient bridging of complementary DNA strands grafted to colloidal particles can direct assembly of nanostructured materials. These interactions have been used to `program' the symmetry of novel equilibrium superlattices and could in principle enable self-assembly of prescribed structures. However, the ability to program the transitions between these equilibrium phases is currently limited: DNA-mediated attractions between particles decrease monotonically and steeply with increasing temperature, resulting only in high-temperature fluids and low-temperature solids that are inherently difficult to equilibrate. We show that by introducing free DNA strands that compete to bind with the grafted ones by strand displacement, the temperature dependence of interparticle interactions can be programmed through the base sequences of displacing strands. We use this scheme to create colloids with `designer' phase behavior such as re-entrant melting, arbitrarily wide gas-solid coexistence, and reversible transitions between different binary crystals.

  18. Mass stranding of Odontoceti caused by parasitogenic eighth cranial neuropathy.

    PubMed

    Morimitsu, T; Nagai, T; Ide, M; Kawano, H; Naichuu, A; Koono, M; Ishii, A

    1987-10-01

    Hearing organs of the Odontoceti from two mass strandings in 1983 and 1986 were examined histopathologically. In the 1983 stranding, two of three pilot whales (Globicephala macrorhynchus) were necropsied and numerous Nasitrema sp. were found close to the eighth cranial nerve (nervus vistibulo cochlearis) in both animals. Patchy degeneration of the eighth cranial nerve in and out of the modiolus of the cochlea was observed. In the 1986 stranding, five of 125 false killer whales (Pseudorca crassiclens) were examined and numerous trematodes (Nasitrema gondo) were found in the tympanic cavities. Severe degeneration of the eighth cranial nerve was discovered and there were many trematode eggs in the nervous and surrounding tissues. Parasitogenic eighth neuropathy is proposed again as the cause of mass stranding of the Odontoceti.

  19. DNA nanotechnology. Programming colloidal phase transitions with DNA strand displacement.

    PubMed

    Rogers, W Benjamin; Manoharan, Vinothan N

    2015-02-06

    DNA-grafted nanoparticles have been called "programmable atom-equivalents": Like atoms, they form three-dimensional crystals, but unlike atoms, the particles themselves carry information (the sequences of the grafted strands) that can be used to "program" the equilibrium crystal structures. We show that the programmability of these colloids can be generalized to the full temperature-dependent phase diagram, not just the crystal structures themselves. We add information to the buffer in the form of soluble DNA strands designed to compete with the grafted strands through strand displacement. Using only two displacement reactions, we program phase behavior not found in atomic systems or other DNA-grafted colloids, including arbitrarily wide gas-solid coexistence, reentrant melting, and even reversible transitions between distinct crystal phases. Copyright © 2015, American Association for the Advancement of Science.

  20. 65. Detail view inside Manhattan anchorage of splayed cable strands. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    65. Detail view inside Manhattan anchorage of splayed cable strands. Jet Lowe, photographer, 1982. - Brooklyn Bridge, Spanning East River between Park Row, Manhattan and Sands Street, Brooklyn, New York County, NY

  1. DNA strand exchange and RecA homologs in meiosis.

    PubMed

    Brown, M Scott; Bishop, Douglas K

    2014-12-04

    Homology search and DNA strand-exchange reactions are central to homologous recombination in meiosis. During meiosis, these processes are regulated such that the probability of choosing a homolog chromatid as recombination partner is enhanced relative to that of choosing a sister chromatid. This regulatory process occurs as homologous chromosomes pair in preparation for assembly of the synaptonemal complex. Two strand-exchange proteins, Rad51 and Dmc1, cooperate in regulated homology search and strand exchange in most organisms. Here, we summarize studies on the properties of these two proteins and their accessory factors. In addition, we review current models for the assembly of meiotic strand-exchange complexes and the possible mechanisms through which the interhomolog bias of recombination partner choice is achieved.

  2. Establishing a Marine Mammal Stranding Network in the Bahamas

    DTIC Science & Technology

    2009-09-30

    mammal & turtle anatomy Dr Ruth Ewing, DVM, NOAA Fisheries Sample collection: The Basics Dr Charles Manire, DVM Atlantis Dolphin Cay Rescue...the Bahamas Pedro Baranda Dolphin Experience Sea turtles : species identification, strandings, and legislation Kelly Melillo Dolphin

  3. Single-stranded DNA transposition is coupled to host replication

    PubMed Central

    Hoang, Bao Ton; Pasternak, Cécile; Siguier, Patricia; Guynet, Catherine; Hickman, Alison Burgess; Dyda, Fred; Sommer, Suzanne; Chandler, Michael

    2010-01-01

    DNA transposition has contributed significantly to evolution of eukaryotes and prokaryotes. Insertion sequences (IS) are the simplest prokaryotic transposons and are divided into families based on their organization and transposition mechanism. Here, we describe a link between transposition of IS608 and ISDra2, both members of the IS200/IS605 family which uses obligatory single-stranded (ss) DNA intermediates, and the host replication fork. Replication direction through the IS plays a crucial role in excision: activity is maximal when the “top” IS strand is located on the lagging-strand template. Excision is stimulated upon transient inactivation of replicative helicase function or inhibition of Okazaki fragment synthesis. IS608 insertions also exhibit an orientation preference for the lagging-strand template and insertion can be specifically directed to stalled replication forks. An in silico genomic approach provides evidence that dissemination of other IS200/IS605 family members is also linked to host replication. PMID:20691900

  4. Sensitive, Specific Complementary - Strand Optical Detection of Viral RNA

    DTIC Science & Technology

    1997-06-01

    sensing. 14. SUBJECT TERMS 15. NUMBER OF PAGES RNA, enterovirii, biosensor, evanscent waves, refractometry , 31 phase detection, complementary strand...the investigator(s) adhered to the CDC-NIH Guide for Biosafety in Microbiological and Biomedical Laboratories. (,- u r,’ Dt Table of Contents Overview...Nonetheless, the physical basis of the Georgia Tech signal is T ( u 20 30 40 50 identical to ours. They have also developed a single-stranded,Time (minutes

  5. The impact of environmental factors on marine turtle stranding rates

    PubMed Central

    Flint, Mark; Limpus, Colin J.; Mills, Paul C.

    2017-01-01

    Globally, tropical and subtropical regions have experienced an increased frequency and intensity in extreme weather events, ranging from severe drought to protracted rain depressions and cyclones, these coincided with an increased number of marine turtles subsequently reported stranded. This study investigated the relationship between environmental variables and marine turtle stranding. The environmental variables examined in this study, in descending order of importance, were freshwater discharge, monthly mean maximum and minimum air temperatures, monthly average daily diurnal air temperature difference and rainfall for the latitudinal hotspots (-27°, -25°, -23°, -19°) along the Queensland coast as well as for major embayments within these blocks. This study found that marine turtle strandings can be linked to these environmental variables at different lag times (3–12 months), and that cumulative (months added together for maximum lag) and non-cumulative (single month only) effects cause different responses. Different latitudes also showed different responses of marine turtle strandings, both in response direction and timing.Cumulative effects of freshwater discharge in all latitudes resulted in increased strandings 10–12 months later. For latitudes -27°, -25° and -23° non-cumulative effects for discharge resulted in increased strandings 7–12 months later. Latitude -19° had different results for the non-cumulative bay with strandings reported earlier (3–6 months). Monthly mean maximum and minimum air temperatures, monthly average daily diurnal air temperature difference and rainfall had varying results for each examined latitude. This study will allow first responders and resource managers to be better equipped to deal with increased marine turtle stranding rates following extreme weather events. PMID:28771635

  6. The N-terminal strand modulates immunoglobulin light chain fibrillogenesis

    SciTech Connect

    Pozo-Yauner, Luis del; Wall, Jonathan S.; González Andrade, Martín; Sánchez-López, Rosana; Rodríguez-Ambriz, Sandra L.; Pérez Carreón, Julio I.; and others

    2014-01-10

    Highlights: •We evaluated the impact of mutations in the N-terminal strand of 6aJL2 protein. •Mutations destabilized the protein in a position-dependent manner. •Destabilizing mutations accelerated the fibrillogenesis by shortening the lag time. •The effect on the kinetic of fibril elongation by seeding was of different nature. •The N-terminal strand is buried in the fibrillar state of 6aJL2 protein. -- Abstract: It has been suggested that the N-terminal strand of the light chain variable domain (V{sub L}) protects the molecule from aggregation by hindering spurious intermolecular contacts. We evaluated the impact of mutations in the N-terminal strand on the thermodynamic stability and kinetic of fibrillogenesis of the V{sub L} protein 6aJL2. Mutations in this strand destabilized the protein in a position-dependent manner, accelerating the fibrillogenesis by shortening the lag time; an effect that correlated with the extent of destabilization. In contrast, the effect on the kinetics of fibril elongation, as assessed in seeding experiments was of different nature, as it was not directly dependant on the degree of destabilization. This finding suggests different factors drive the nucleation-dependent and elongation phases of light chain fibrillogenesis. Finally, taking advantage of the dependence of the Trp fluorescence upon environment, four single Trp substitutions were made in the N-terminal strand, and changes in solvent exposure during aggregation were evaluated by acrylamide-quenching. The results suggest that the N-terminal strand is buried in the fibrillar state of 6aJL2 protein. This finding suggest a possible explanation for the modulating effect exerted by the mutations in this strand on the aggregation behavior of 6aJL2 protein.

  7. Mismatch repair balances leading and lagging strand DNA replication fidelity.

    PubMed

    Lujan, Scott A; Williams, Jessica S; Pursell, Zachary F; Abdulovic-Cui, Amy A; Clark, Alan B; Nick McElhinny, Stephanie A; Kunkel, Thomas A

    2012-01-01

    The two DNA strands of the nuclear genome are replicated asymmetrically using three DNA polymerases, α, δ, and ε. Current evidence suggests that DNA polymerase ε (Pol ε) is the primary leading strand replicase, whereas Pols α and δ primarily perform lagging strand replication. The fact that these polymerases differ in fidelity and error specificity is interesting in light of the fact that the stability of the nuclear genome depends in part on the ability of mismatch repair (MMR) to correct different mismatches generated in different contexts during replication. Here we provide the first comparison, to our knowledge, of the efficiency of MMR of leading and lagging strand replication errors. We first use the strand-biased ribonucleotide incorporation propensity of a Pol ε mutator variant to confirm that Pol ε is the primary leading strand replicase in Saccharomyces cerevisiae. We then use polymerase-specific error signatures to show that MMR efficiency in vivo strongly depends on the polymerase, the mismatch composition, and the location of the mismatch. An extreme case of variation by location is a T-T mismatch that is refractory to MMR. This mismatch is flanked by an AT-rich triplet repeat sequence that, when interrupted, restores MMR to > 95% efficiency. Thus this natural DNA sequence suppresses MMR, placing a nearby base pair at high risk of mutation due to leading strand replication infidelity. We find that, overall, MMR most efficiently corrects the most potentially deleterious errors (indels) and then the most common substitution mismatches. In combination with earlier studies, the results suggest that significant differences exist in the generation and repair of Pol α, δ, and ε replication errors, but in a generally complementary manner that results in high-fidelity replication of both DNA strands of the yeast nuclear genome.

  8. Direct Synthesis of Long Single-Walled Carbon Nanotube Strands

    NASA Astrophysics Data System (ADS)

    Zhu, H. W.; Xu, C. L.; Wu, D. H.; Wei, B. Q.; Vajtai, R.; Ajayan, P. M.

    2002-05-01

    In the processes that are used to produce single-walled nanotubes (electric arc, laser ablation, and chemical vapor deposition), the typical lengths of tangled nanotube bundles reach several tens of micrometers. We report that long nanotube strands, up to several centimeters in length, consisting of aligned single-walled nanotubes can be synthesized by the catalytic pyrolysis of n-hexane with an enhanced vertical floating technique. The long strands of nanotubes assemble continuously from arrays of nanotubes, which are intrinsically long.

  9. Protein stabilization by introduction of cross-strand disulfides.

    PubMed

    Chakraborty, Kausik; Thakurela, Sudhir; Prajapati, Ravindra Singh; Indu, S; Ali, P Shaik Syed; Ramakrishnan, C; Varadarajan, Raghavan

    2005-11-08

    Disulfides cross-link residues in a protein that are separated in primary sequence and stabilize the protein through entropic destabilization of the unfolded state. While the removal of naturally occurring disulfides leads to protein destabilization, introduction of engineered disulfides does not always lead to significant stabilization of a protein. We have analyzed naturally occurring disulfides that span adjacent antiparallel strands of beta sheets (cross-strand disulfides). Cross-strand disulfides have recently been implicated as redox-based conformational switches in proteins such as gp120 and CD4. The propensity of these disulfides to act as conformational switches was postulated on the basis of the hypothesis that this class of disulfide is conformationally strained. In the present analysis, there was no evidence to suggest that cross-strand disulfides are more strained compared to other disulfides as assessed by their torsional energy. It was also observed that these disulfides occur solely at non-hydrogen-bonded (NHB) registered pairs of adjacent antiparallel strands and not at hydrogen-bonded (HB) positions as suggested previously. One of the half-cystines involved in cross-strand disulfide formation often occurs at an edge strand. Experimental confirmation of the stabilizing effects of such disulfides was carried out in Escherichia coli thioredoxin. Four pairs of cross-strand cysteines were introduced, two at HB and two at NHB pairs. Disulfides were formed in all four cases. However, as predicted from our analysis, disulfides at NHB positions resulted in an increase in melting temperature of 7-10 degrees C, while at HB positions there was a corresponding decrease of -7 degrees C. The reduced state of all proteins had similar stability.

  10. Analysis of guanine oxidation products in double-stranded DNA and proposed guanine oxidation pathways in single-stranded, double-stranded or quadruplex DNA.

    PubMed

    Morikawa, Masayuki; Kino, Katsuhito; Oyoshi, Takanori; Suzuki, Masayo; Kobayashi, Takanobu; Miyazawa, Hiroshi

    2014-02-10

    Guanine is the most easily oxidized among the four DNA bases, and some guanine-rich sequences can form quadruplex structures. In a previous study using 6-mer DNA d(TGGGGT), which is the shortest oligomer capable of forming quadruplex structures, we demonstrated that guanine oxidation products of quadruplex DNA differ from those of single-stranded DNA. Therefore, the hotooxidation products of double-stranded DNA (dsDNA) may also differ from that of quadruplex or single-stranded DNA, with the difference likely explaining the influence of DNA structures on guanine oxidation pathways. In this study, the guanine oxidation products of the dsDNA d(TGGGGT)/d(ACCCCA) were analyzed using HPLC and electrospray ionization-mass spectrometry (ESI-MS). As a result, the oxidation products in this dsDNA were identified as 2,5-diamino-4H-imidazol-4-one (Iz), 8-oxo-7,8-dihydroguanine (8oxoG), dehydroguanidinohydantoin (Ghox), and guanidinohydantoin (Gh). The major oxidation products in dsDNA were consistent with a combination of each major oxidation product observed in single-stranded and quadruplex DNA. We previously reported that the kinds of the oxidation products in single-stranded or quadruplex DNA depend on the ease of deprotonation of the guanine radical cation (G•+) at the N1 proton. Similarly, this mechanism was also involved in dsDNA. Deprotonation in dsDNA is easier than in quadruplex DNA and more difficult in single-stranded DNA, which can explain the formation of the four oxidation products in dsDNA.

  11. A multilevel homogenised model for superconducting strand thermomechanics

    NASA Astrophysics Data System (ADS)

    Boso, D. P.; Lefik, M.; Schrefler, B. A.

    2005-04-01

    In the present concept of ITER fusion reactor the toroidal field and the central solenoid coils are made of Nb 3Sn based strands with the cable-in-conduit-conductor (CICC) technology. It is well known that the critical parameters of the Nb 3Sn strand material are strain sensitive; experimental investigations on short samples of basic strands and subsize CICC cables already demonstrated significant effects of residual strain on the critical parameters. In this paper a method is proposed to analyse in detail the thermal strain induced by the cool down from the strand reaction temperature to the coil working conditions. The superconducting strand can be regarded as a very good example of a hierarchical structure, since there is a clear distinction between the micro-scale of the Nb 3Sn filaments, the meso-scale of the SC filament groups and the macro-scale of the strand, where it can be regarded as homogeneous. A constitutive relation for the homogenised micro- and meso-components is deduced from the knowledge of the respective internal structures, starting from an accurate description of the single representative cells. This two-scales homogenisation technique is associated with an efficient finite element procedure for computing effective material coefficients to be used with standard orthotropic 3D elements in structural codes. Finally the finite elements routines developed for the unsmearing process provide the real stress and strain values over each single material, which are essential to catch the local features needed for engineering design.

  12. Both DNA strands of antibody genes are hypermutation targets

    PubMed Central

    Milstein, Cesar; Neuberger, Michael S.; Staden, Rodger

    1998-01-01

    During the maturation of the immune response, antibody genes are subjected to localized hypermutation. Mutations are not evenly distributed along the V gene; intrinsic hot spots exist that are correlated with primary sequence motifs. Although the mechanism of hypermutation remains unknown, it has been proposed to exhibit DNA strand polarity because purine residues on the coding strand are more frequently targeted for mutation than pyrimidines. However, this polarity may not be an intrinsic property of the hypermutation mechanism but a consequence of evolutionary-selected peculiarities of V gene sequences. Furthermore, the possibility that both strands are hypermutation targets has received little attention. To discriminate between these possibilities, we have analyzed the average frequency of mutations of each of the three bases of all nucleotide triplets by using large databases taken from both V and non-V mutation targets. We also have reassessed the sequence motifs associated with hot spots. We find that even in non-Ig sequences, A mutates more than T, consistent with a strand-dependent component to targeting. However, the mutation biases of triplets and of their inverted complements are correlated, demonstrating that there is a sequence-specific but strand-independent component to mutational targeting. Thus, there are two aspects of the hypermutation process that are sensitive to local DNA sequences, one that is DNA strand-dependent and the other that is not. PMID:9671757

  13. DNA Origami with Double Stranded DNA as a Unified Scaffold

    PubMed Central

    Yang, Yang; Han, Dongran; Nangreave, Jeanette; Liu, Yan; Yan, Hao

    2013-01-01

    Scaffolded DNA origami is a widely used technology for self-assembling precisely structured nanoscale objects that contain a large number of addressable features. Typical scaffolds are long, single strands of DNA (ssDNA) that are folded into distinct shapes through the action of many, short ssDNA staples that are complementary to several different domains of the scaffold. However, sources of long single stranded DNA are scarce, limiting the size and complexity of structures that can be assembled. Here we demonstrated that dsDNA scaffolds can be directly used to fabricate integrated DNA origami structures that incorporate both of the constituent ssDNA molecules. Two basic principles were employed in the design of scaffold folding paths – folding path asymmetry and periodic convergence of the two ssDNA scaffold strands. Asymmetry in the folding path minimizes unwanted complementarity between staples, and incorporating an offset between the folding paths of each ssDNA scaffold strand reduces the number of times that complementary portions of the strands are brought into close proximity with one another, both of which decrease the likelihood of dsDNA scaffold recovery. Meanwhile, the folding paths of the two ssDNA scaffold strands were designed to periodically converge to promote the assembly of a single, unified structure rather than two individual ones. Our results reveal that this basic strategy can be used to reliably assemble integrated DNA nanostructures from dsDNA scaffolds. PMID:22830653

  14. Application of strand meshes to complex aerodynamic flow fields

    NASA Astrophysics Data System (ADS)

    Katz, Aaron; Wissink, Andrew M.; Sankaran, Venkateswaran; Meakin, Robert L.; Chan, William M.

    2011-07-01

    We explore a new approach for viscous computational fluid dynamics calculations for external aerodynamics around geometrically complex bodies that incorporates nearly automatic mesh generation and efficient flow solution methods. A prismatic-like grid using "strands" is grown a short distance from the body surface to capture the viscous boundary layer, and adaptive Cartesian grids are used throughout the rest of the domain. The approach presents several advantages over established methods: nearly automatic grid generation from triangular or quadrilateral surface tessellations, very low memory overhead, automatic mesh adaptivity for time-dependent problems, and fast and efficient solvers from structured data in both the strand and Cartesian grids.The approach is evaluated for complex geometries and flow fields. We investigate the effects of strand length and strand vector smoothing to understand the effects on computed solutions. Results of three applications using the strand-adaptive Cartesian approach are given, including a NACA wing, isolated V-22 (TRAM) rotor in hover, and the DLR-F6 wing-body transport. The results from these cases show that the strand approach can successfully resolve near-body and off-body features as well as or better than established methods.

  15. Conformations of double stranded DNA: the effect of breathing bubbles

    NASA Astrophysics Data System (ADS)

    Huang, Aiqun; Bhattacharya, Aniket

    2015-03-01

    A double stranded DNA (dsDNA) is a natural semi-flexible biopolymer with persistence length ~ 50 nm, while a single stranded (ss) DNA is very flexible whose persistence length is one order of magnitude smaller (3-5 nm). Depending on the temperature and sequence, the two strands in a dsDNA can locally denature into two single strands and form bubbles along the polymer chain, i.e. dsDNA exists in the form of a combination of double strands and single strands, exhibiting a heterogeneity of bending rigidity. In our study, we adopt a coarse grained model of dsDNA developed by Kim et al. [J. Y. Kim, J. H. Jeon, and W. Sung, J. Chem. Phys. 128, 055101 2008] and further improve it by incorporating excluded volume effect and sequence heterogeneity. In this model, a dsDNA is described as two semi-flexible chains paired with each other by hydrogen bonding, the stacking interaction is designed such that the persistence length of the paired chains interpolates 3 nm and 50 nm depending on the fraction of the melted base pairs. By performing Langevin dynamics simulation we study the bubble statistics as a function of temperature and sequence and how the bubbles affect local bending rigidity and the chain conformations. We compare our results with those from WLC model.

  16. Hearing loss in stranded odontocete dolphins and whales.

    PubMed

    Mann, David; Hill-Cook, Mandy; Manire, Charles; Greenhow, Danielle; Montie, Eric; Powell, Jessica; Wells, Randall; Bauer, Gordon; Cunningham-Smith, Petra; Lingenfelser, Robert; DiGiovanni, Robert; Stone, Abigale; Brodsky, Micah; Stevens, Robert; Kieffer, George; Hoetjes, Paul

    2010-11-03

    The causes of dolphin and whale stranding can often be difficult to determine. Because toothed whales rely on echolocation for orientation and feeding, hearing deficits could lead to stranding. We report on the results of auditory evoked potential measurements from eight species of odontocete cetaceans that were found stranded or severely entangled in fishing gear during the period 2004 through 2009. Approximately 57% of the bottlenose dolphins and 36% of the rough-toothed dolphins had significant hearing deficits with a reduction in sensitivity equivalent to severe (70-90 dB) or profound (>90 dB) hearing loss in humans. The only stranded short-finned pilot whale examined had profound hearing loss. No impairments were detected in seven Risso's dolphins from three different stranding events, two pygmy killer whales, one Atlantic spotted dolphin, one spinner dolphin, or a juvenile Gervais' beaked whale. Hearing impairment could play a significant role in some cetacean stranding events, and the hearing of all cetaceans in rehabilitation should be tested.

  17. Viscoelastic characterization of single-stranded DNA from Escherichia coli.

    PubMed

    Uhlenhopp, E L; Zimm, B H

    1975-03-01

    Single-stranded DNA released from E. coli wild type and mutant cells by alkaline-EDTA-detergent was analyzed using the recently developed biophysical technique of viscoelastometry. Under the lysis conditions used, it was possible to detect single strands of molecular weight approximately 2 times 10-9 daltons. Little difference was detected in the size of single-stranded DNA from log phase vs. stationary phase cultures, or from cells treated with chloramphenicol to allow completion of replicating chromosomes. The largest single strands from ligase overproducing, endonuclease minus, and pol A1 mutants were likewise of approximately the same size as wild type, but were present in smaller yields. The reduction in single-strand molecular weight as a result of heating intact cells was investigated as a function of time and temperature. Heating at 37 degrees C for up to 20 min produced no additional single-strand breaks, but temperatures from 45 to 65 degrees introduced breaks. Solutions maintained at pH 12.5 were not stable indefinitely, and the relative viscosity of such solutions was found to decrease over a period of several hours.

  18. Tissue strands as "bioink" for scale-up organ printing.

    PubMed

    Yu, Yin; Ozbolat, Ibrahim T

    2014-01-01

    Organ printing, takes tissue spheroids as building blocks together with additive manufacturing technique to engineer tissue or organ replacement parts. Although a wide array of cell aggregation techniques has been investigated, and gained noticeable success, the application of tissue spheroids for scale-up tissue fabrication is still worth investigation. In this paper, we introduce a new micro-fabrication technique to create tissue strands at the scale of 500-700μm as a "bioink" for future robotic tissue printing. Printable alginate micro-conduits are used as semi-permeable capsules for tissue strand fabrication. Mouse insulinoma beta TC3 cell tissue strands were formed upon 4 days post fabrication with reasonable mechanical strength, high cell viability close to 90%, and tissue specific markers expression. Fusion was readily observed between strands when placing them together as early as 24h. Also, tissue strands were deposited with human umbilical vein smooth muscle cells (HUVSMCs) vascular conduits together to fabricated miniature pancreatic tissue analog. Our study provided a novel technique using tissue strands as "bioink" for scale-up bioprinting of tissues or organs.

  19. A model capturing novel strand symmetries in bacterial DNA

    SciTech Connect

    Sobottka, Marcelo; Hart, Andrew G.

    2011-07-15

    Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that the frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.

  20. Hearing Loss in Stranded Odontocete Dolphins and Whales

    PubMed Central

    Mann, David; Hill-Cook, Mandy; Manire, Charles; Greenhow, Danielle; Montie, Eric; Powell, Jessica; Wells, Randall; Bauer, Gordon; Cunningham-Smith, Petra; Lingenfelser, Robert; DiGiovanni, Robert; Stone, Abigale; Brodsky, Micah; Stevens, Robert; Kieffer, George; Hoetjes, Paul

    2010-01-01

    The causes of dolphin and whale stranding can often be difficult to determine. Because toothed whales rely on echolocation for orientation and feeding, hearing deficits could lead to stranding. We report on the results of auditory evoked potential measurements from eight species of odontocete cetaceans that were found stranded or severely entangled in fishing gear during the period 2004 through 2009. Approximately 57% of the bottlenose dolphins and 36% of the rough-toothed dolphins had significant hearing deficits with a reduction in sensitivity equivalent to severe (70–90 dB) or profound (>90 dB) hearing loss in humans. The only stranded short-finned pilot whale examined had profound hearing loss. No impairments were detected in seven Risso's dolphins from three different stranding events, two pygmy killer whales, one Atlantic spotted dolphin, one spinner dolphin, or a juvenile Gervais' beaked whale. Hearing impairment could play a significant role in some cetacean stranding events, and the hearing of all cetaceans in rehabilitation should be tested. PMID:21072206

  1. Flap Endonuclease 1 Limits Telomere Fragility on the Leading Strand*

    PubMed Central

    Teasley, Daniel C.; Parajuli, Shankar; Nguyen, Mai; Moore, Hayley R.; Alspach, Elise; Lock, Ying Jie; Honaker, Yuchi; Saharia, Abhishek; Piwnica-Worms, Helen; Stewart, Sheila A.

    2015-01-01

    The existence of redundant replication and repair systems that ensure genome stability underscores the importance of faithful DNA replication. Nowhere is this complexity more evident than in challenging DNA templates, including highly repetitive or transcribed sequences. Here, we demonstrate that flap endonuclease 1 (FEN1), a canonical lagging strand DNA replication protein, is required for normal, complete leading strand replication at telomeres. We find that the loss of FEN1 nuclease activity, but not DNA repair activities, results in leading strand-specific telomere fragility. Furthermore, we show that FEN1 depletion-induced telomere fragility is increased by RNA polymerase II inhibition and is rescued by ectopic RNase H1 expression. These data suggest that FEN1 limits leading strand-specific telomere fragility by processing RNA:DNA hybrid/flap intermediates that arise from co-directional collisions occurring between the replisome and RNA polymerase. Our data reveal the first molecular mechanism for leading strand-specific telomere fragility and the first known role for FEN1 in leading strand DNA replication. Because FEN1 mutations have been identified in human cancers, our findings raise the possibility that unresolved RNA:DNA hybrid structures contribute to the genomic instability associated with cancer. PMID:25922071

  2. Flap Endonuclease 1 Limits Telomere Fragility on the Leading Strand.

    PubMed

    Teasley, Daniel C; Parajuli, Shankar; Nguyen, Mai; Moore, Hayley R; Alspach, Elise; Lock, Ying Jie; Honaker, Yuchi; Saharia, Abhishek; Piwnica-Worms, Helen; Stewart, Sheila A

    2015-06-12

    The existence of redundant replication and repair systems that ensure genome stability underscores the importance of faithful DNA replication. Nowhere is this complexity more evident than in challenging DNA templates, including highly repetitive or transcribed sequences. Here, we demonstrate that flap endonuclease 1 (FEN1), a canonical lagging strand DNA replication protein, is required for normal, complete leading strand replication at telomeres. We find that the loss of FEN1 nuclease activity, but not DNA repair activities, results in leading strand-specific telomere fragility. Furthermore, we show that FEN1 depletion-induced telomere fragility is increased by RNA polymerase II inhibition and is rescued by ectopic RNase H1 expression. These data suggest that FEN1 limits leading strand-specific telomere fragility by processing RNA:DNA hybrid/flap intermediates that arise from co-directional collisions occurring between the replisome and RNA polymerase. Our data reveal the first molecular mechanism for leading strand-specific telomere fragility and the first known role for FEN1 in leading strand DNA replication. Because FEN1 mutations have been identified in human cancers, our findings raise the possibility that unresolved RNA:DNA hybrid structures contribute to the genomic instability associated with cancer. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Protein-free parallel triple-stranded DNA complex formation

    PubMed Central

    Shchyolkina, A. K.; Timofeev, E. N.; Lysov, Yu. P.; Florentiev, V. L.; Jovin, T. M.; Arndt-Jovin, D. J.

    2001-01-01

    A 14 nt DNA sequence 5′-AGAATGTGGCAAAG-3′ from the zinc finger repeat of the human KRAB zinc finger protein gene ZNF91 bearing the intercalator 2-methoxy,6-chloro,9-amino acridine (Acr) attached to the sugar–phosphate backbone in various positions has been shown to form a specific triple helix (triplex) with a 16 bp hairpin (intramolecular) or a two-stranded (intermolecular) duplex having the identical sequence in the same (parallel) orientation. Intramolecular targets with the identical sequence in the antiparallel orientation and a non-specific target sequence were tested as controls. Apparent binding constants for formation of the triplex were determined by quantitating electrophoretic band shifts. Binding of the single-stranded oligonucleotide probe sequence to the target led to an increase in the fluorescence anisotropy of acridine. The parallel orientation of the two identical sequence segments was confirmed by measurement of fluorescence resonance energy transfer between the acridine on the 5′-end of the probe strand as donor and BODIPY-Texas Red on the 3′-amino group of either strand of the target duplex as acceptor. There was full protection from OsO4-bipyridine modification of thymines in the probe strand of the triplex, in accordance with the presumed triplex formation, which excluded displacement of the homologous duplex strand by the probe–intercalator conjugate. The implications of these results for the existence of protein-independent parallel triplexes are discussed. PMID:11160932

  4. The N-terminal strand modulates immunoglobulin light chain fibrillogenesis.

    PubMed

    del Pozo-Yauner, Luis; Wall, Jonathan S; González Andrade, Martín; Sánchez-López, Rosana; Rodríguez-Ambriz, Sandra L; Pérez Carreón, Julio I; Ochoa-Leyva, Adrián; Fernández-Velasco, D Alejandro

    2014-01-10

    It has been suggested that the N-terminal strand of the light chain variable domain (V(L)) protects the molecule from aggregation by hindering spurious intermolecular contacts. We evaluated the impact of mutations in the N-terminal strand on the thermodynamic stability and kinetic of fibrillogenesis of the V(L) protein 6aJL2. Mutations in this strand destabilized the protein in a position-dependent manner, accelerating the fibrillogenesis by shortening the lag time; an effect that correlated with the extent of destabilization. In contrast, the effect on the kinetics of fibril elongation, as assessed in seeding experiments was of different nature, as it was not directly dependant on the degree of destabilization. This finding suggests different factors drive the nucleation-dependent and elongation phases of light chain fibrillogenesis. Finally, taking advantage of the dependence of the Trp fluorescence upon environment, four single Trp substitutions were made in the N-terminal strand, and changes in solvent exposure during aggregation were evaluated by acrylamide-quenching. The results suggest that the N-terminal strand is buried in the fibrillar state of 6aJL2 protein. This finding suggest a possible explanation for the modulating effect exerted by the mutations in this strand on the aggregation behavior of 6aJL2 protein.

  5. G-Strands and Peakon Collisions on Diff(R)

    NASA Astrophysics Data System (ADS)

    Holm, Darryl D.; Ivanov, Rossen I.

    2013-03-01

    A G-strand is a map g: R×R→G for a Lie group G that follows from Hamilton's principle for a certain class of G-invariant Lagrangians. Some G-strands on finite-dimensional groups satisfy 1+1 space-time evolutionary equations that admit soliton solutions as completely integrable Hamiltonian systems. For example, the SO(3)-strand equations may be regarded physically as integrable dynamics for solitons on a continuous spin chain. Previous work has shown that G-strands for diffeomorphisms on the real line possess solutions with singular support (e.g. peakons). This paper studies collisions of such singular solutions of G-strands when G=Diff(R) is the group of diffeomorphisms of the real line R, for which the group product is composition of smooth invertible functions. In the case of peakon-antipeakon collisions, the solution reduces to solving either Laplace's equation! or the wave equation (depending on a sign in the Lagrangian) and is written in terms of their solutions. We also consider the complexified systems of G-strand equations for G=Diff(R) corresponding to a harmonic map g: C→Diff(R) and find explicit expressions for its peakon-antipeakon solutions, as well.

  6. Prostate resection - minimally invasive

    MedlinePlus

    ... invasive - discharge Transurethral resection of the prostate - discharge Review Date 6/29/2015 Updated by: Jennifer Sobol, ... the Michigan Institute of Urology, West Bloomfield, MI. Review provided by VeriMed Healthcare Network. Also reviewed by ...

  7. Invasive Prenatal Testing

    PubMed Central

    Hunter, A.

    1988-01-01

    Invasive prenatal diagnosis is a major diagnostic tool which is used in modern obstetrical care. A synopsis of these techniques is provided to assist the family practitioner in providing this information to his patients. PMID:21253097

  8. Red Tide Strands South African Rock Lobsters

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Although some red tides form a healthy part of phytoplankton production, recurrent harmful or toxic blooms also occur, with results depending upon the type of plankton and on atmospheric and oceanic conditions. At Elands Bay in South Africa's Western Cape province, about 1000 tons of rock lobsters beached themselves during February 2002, when the decay of dense blooms of phytoplankton caused a rapid reduction in the oxygen concentration of nearshore waters. The lobsters (or crayfish, as they are known locally) moved toward the breaking surf in search of oxygen, but were stranded by the retreating tide. The Multi-angle Imaging SpectroRadiometer's nadir camera acquired these red, green, blue composites on February 2 and 18, 2002, during Terra orbits 11315 and 11548. The colors have been accentuated to highlight the bloom, and land and water have been enhanced separately. The two views show the shoreward migration of the algal bloom. Each image represents an area of about 205 kilometers x 330 kilometers. Elands Bay is situated near the mouth of the Doring River, about 75 kilometers northeast of the jutting Cape Columbine. The term 'red tide' is used to refer to a number of different types of phytoplankton blooms of various hues. The wine color of certain parts of this bloom are consistent with the ciliate species Mesodinium rubrum, which has been associated with recurring harmful algal blooms along the Western Cape coast. Under these conditions, the lobsters are not poisoned. During the recent event, government and military staff transported as many of the living lobsters as possible to areas that were less affected by the red tide. At the same time, people came from across South Africa to gather the undersized creatures for food. The effects of the losses on the maritime economy are expected to be felt over the next few years. MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington, DC. The Terra

  9. Red Tide Strands South African Rock Lobsters

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Although some red tides form a healthy part of phytoplankton production, recurrent harmful or toxic blooms also occur, with results depending upon the type of plankton and on atmospheric and oceanic conditions. At Elands Bay in South Africa's Western Cape province, about 1000 tons of rock lobsters beached themselves during February 2002, when the decay of dense blooms of phytoplankton caused a rapid reduction in the oxygen concentration of nearshore waters. The lobsters (or crayfish, as they are known locally) moved toward the breaking surf in search of oxygen, but were stranded by the retreating tide.

    The Multi-angle Imaging SpectroRadiometer's nadir camera acquired these red, green, blue composites on February 2 and 18, 2002, during Terra orbits 11315 and 11548. The colors have been accentuated to highlight the bloom, and land and water have been enhanced separately. The two views show the shoreward migration of the algal bloom. Each image represents an area of about 205 kilometers x 330 kilometers. Elands Bay is situated near the mouth of the Doring River, about 75 kilometers northeast of the jutting Cape Columbine.

    The term 'red tide' is used to refer to a number of different types of phytoplankton blooms of various hues. The wine color of certain parts of this bloom are consistent with the ciliate species Mesodinium rubrum, which has been associated with recurring harmful algal blooms along the Western Cape coast. Under these conditions, the lobsters are not poisoned. During the recent event, government and military staff transported as many of the living lobsters as possible to areas that were less affected by the red tide. At the same time, people came from across South Africa to gather the undersized creatures for food. The effects of the losses on the maritime economy are expected to be felt over the next few years.

    MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington

  10. Red Tide Strands South African Rock Lobsters

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Although some red tides form a healthy part of phytoplankton production, recurrent harmful or toxic blooms also occur, with results depending upon the type of plankton and on atmospheric and oceanic conditions. At Elands Bay in South Africa's Western Cape province, about 1000 tons of rock lobsters beached themselves during February 2002, when the decay of dense blooms of phytoplankton caused a rapid reduction in the oxygen concentration of nearshore waters. The lobsters (or crayfish, as they are known locally) moved toward the breaking surf in search of oxygen, but were stranded by the retreating tide. The Multi-angle Imaging SpectroRadiometer's nadir camera acquired these red, green, blue composites on February 2 and 18, 2002, during Terra orbits 11315 and 11548. The colors have been accentuated to highlight the bloom, and land and water have been enhanced separately. The two views show the shoreward migration of the algal bloom. Each image represents an area of about 205 kilometers x 330 kilometers. Elands Bay is situated near the mouth of the Doring River, about 75 kilometers northeast of the jutting Cape Columbine. The term 'red tide' is used to refer to a number of different types of phytoplankton blooms of various hues. The wine color of certain parts of this bloom are consistent with the ciliate species Mesodinium rubrum, which has been associated with recurring harmful algal blooms along the Western Cape coast. Under these conditions, the lobsters are not poisoned. During the recent event, government and military staff transported as many of the living lobsters as possible to areas that were less affected by the red tide. At the same time, people came from across South Africa to gather the undersized creatures for food. The effects of the losses on the maritime economy are expected to be felt over the next few years. MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington, DC. The Terra

  11. Red Tide Strands South African Rock Lobsters

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Although some red tides form a healthy part of phytoplankton production, recurrent harmful or toxic blooms also occur, with results depending upon the type of plankton and on atmospheric and oceanic conditions. At Elands Bay in South Africa's Western Cape province, about 1000 tons of rock lobsters beached themselves during February 2002, when the decay of dense blooms of phytoplankton caused a rapid reduction in the oxygen concentration of nearshore waters. The lobsters (or crayfish, as they are known locally) moved toward the breaking surf in search of oxygen, but were stranded by the retreating tide.

    The Multi-angle Imaging SpectroRadiometer's nadir camera acquired these red, green, blue composites on February 2 and 18, 2002, during Terra orbits 11315 and 11548. The colors have been accentuated to highlight the bloom, and land and water have been enhanced separately. The two views show the shoreward migration of the algal bloom. Each image represents an area of about 205 kilometers x 330 kilometers. Elands Bay is situated near the mouth of the Doring River, about 75 kilometers northeast of the jutting Cape Columbine.

    The term 'red tide' is used to refer to a number of different types of phytoplankton blooms of various hues. The wine color of certain parts of this bloom are consistent with the ciliate species Mesodinium rubrum, which has been associated with recurring harmful algal blooms along the Western Cape coast. Under these conditions, the lobsters are not poisoned. During the recent event, government and military staff transported as many of the living lobsters as possible to areas that were less affected by the red tide. At the same time, people came from across South Africa to gather the undersized creatures for food. The effects of the losses on the maritime economy are expected to be felt over the next few years.

    MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington

  12. Interferon-α and interleukin-12 are induced, respectively, by double-stranded DNA and single-stranded RNA in human myeloid dendritic cells

    PubMed Central

    Katashiba, Yuichi; Miyamoto, Rie; Hyo, Akira; Shimamoto, Keiko; Murakami, Naoko; Ogata, Makoto; Amakawa, Ryuichi; Inaba, Muneo; Nomura, Shosaku; Fukuhara, Shirou; Ito, Tomoki

    2011-01-01

    Dendritic cells (DCs) are initiators of innate immunity and acquired immunity as cells linking these two bio-defence systems through the production of cytokines such as interferon-α (IFN-α) and interleukin-12 (IL-12). Nucleic acids such as DNA from damaged cells or pathogens are important activators not only for anti-microbial innate immune responses but also in the pathogenesis of IFN-related autoimmune diseases. Plasmacytoid DCs are regarded as the main effectors for the DNA-mediated innate immunity by possessing DNA-sensing toll-like receptor 9 (TLR9). We here found that double-stranded DNA (dsDNA) complexed with lipotransfectants triggered activation of human monocyte-derived DCs (moDCs), leading to the preferential production of IFN-α but not IL-12. This indicates that myeloid DCs also function as supportive effectors against the invasion of pathogenic microbes through the DNA-mediated activation in innate immunity. The dsDNA with lipotransfectants can be taken up by moDCs without co-localization of endosomal LAMP1 staining, and the dsDNA-mediated IFN-α production was not impaired by chloroquine. These findings indicate that moDC activation by dsDNA does not involve the endosomal TLR pathway. In contrast, single-stranded RNA (ssRNA) stimulated moDCs to secrete IL-12 but not IFN-α. This process was inhibited by chloroquine, suggesting an involvement of the TLR pathway in ssRNA-mediated moDC activation. As might be inferred from our findings, myeloid DCs may function as a traffic control between innate immunity via IFN-α production and acquired immunity via IL-12 production, depending on the type of nucleic acids. Our results provide a new insight into the biological action of myeloid DCs underlying the DNA-mediated activation of protective or pathogenic immunity. PMID:20875078

  13. Interferon-α and interleukin-12 are induced, respectively, by double-stranded DNA and single-stranded RNA in human myeloid dendritic cells.

    PubMed

    Katashiba, Yuichi; Miyamoto, Rie; Hyo, Akira; Shimamoto, Keiko; Murakami, Naoko; Ogata, Makoto; Amakawa, Ryuichi; Inaba, Muneo; Nomura, Shosaku; Fukuhara, Shirou; Ito, Tomoki

    2011-02-01

    Dendritic cells (DCs) are initiators of innate immunity and acquired immunity as cells linking these two bio-defence systems through the production of cytokines such as interferon-α (IFN-α) and interleukin-12 (IL-12). Nucleic acids such as DNA from damaged cells or pathogens are important activators not only for anti-microbial innate immune responses but also in the pathogenesis of IFN-related autoimmune diseases. Plasmacytoid DCs are regarded as the main effectors for the DNA-mediated innate immunity by possessing DNA-sensing toll-like receptor 9 (TLR9). We here found that double-stranded DNA (dsDNA) complexed with lipotransfectants triggered activation of human monocyte-derived DCs (moDCs), leading to the preferential production of IFN-α but not IL-12. This indicates that myeloid DCs also function as supportive effectors against the invasion of pathogenic microbes through the DNA-mediated activation in innate immunity. The dsDNA with lipotransfectants can be taken up by moDCs without co-localization of endosomal LAMP1 staining, and the dsDNA-mediated IFN-α production was not impaired by chloroquine. These findings indicate that moDC activation by dsDNA does not involve the endosomal TLR pathway. In contrast, single-stranded RNA (ssRNA) stimulated moDCs to secrete IL-12 but not IFN-α. This process was inhibited by chloroquine, suggesting an involvement of the TLR pathway in ssRNA-mediated moDC activation. As might be inferred from our findings, myeloid DCs may function as a traffic control between innate immunity via IFN-α production and acquired immunity via IL-12 production, depending on the type of nucleic acids. Our results provide a new insight into the biological action of myeloid DCs underlying the DNA-mediated activation of protective or pathogenic immunity.

  14. Minimally invasive stomas.

    PubMed

    Hellinger, Michael D; Al Haddad, Abdullah

    2008-02-01

    Traditionally, stoma creation and end stoma reversal have been performed via a laparotomy incision. However, in many situations, stoma construction may be safely performed in a minimally invasive nature. This may include a trephine, laparoscopic, or combined approach. Furthermore, Hartmann's colostomy reversal, a procedure traditionally associated with substantial morbidity, may also be performed laparoscopically. The authors briefly review patient selection, preparation, and indications, and focus primarily on surgical techniques and results of minimally invasive stoma creation and Hartmann's reversal.

  15. Minimally invasive lumbar foraminotomy.

    PubMed

    Deutsch, Harel

    2013-07-01

    Lumbar radiculopathy is a common problem. Nerve root compression can occur at different places along a nerve root's course including in the foramina. Minimal invasive approaches allow easier exposure of the lateral foramina and decompression of the nerve root in the foramina. This video demonstrates a minimally invasive approach to decompress the lumbar nerve root in the foramina with a lateral to medial decompression. The video can be found here: http://youtu.be/jqa61HSpzIA.

  16. In Vivo Conversion of the Single-Stranded DNA of the Kilham Rat Virus to a Double-Stranded Form

    PubMed Central

    Salzman, Lois Ann; White, Wesley

    1973-01-01

    Kilham rat virus (KRV) contains linear, single-stranded DNA in the virion. The fate of radioactive viral DNA was followed after infection of monolayer cells. Within 60 min after infection of cells, 28 to 42% of the parental viral DNA is converted to a new form. This new DNA form is believed to be double stranded and linear on the basis of its sedimentation in neutral and alkaline sucrose gradients, elution from hydroxyapatite columns, its buoyant density in equilibrium CsCl density gradients, and appearance in the electron microscope. The double-stranded linear KRV DNA may be analogous to the replicative form of certain bacteriophages, including φX174, which contain single-stranded circular genomes. Images PMID:4347430

  17. Parasites and marine invasions

    USGS Publications Warehouse

    Torchin, M.E.; Lafferty, K.D.; Kuris, A.M.

    2002-01-01

    Introduced marine species are a major environmental and economic problem. The rate of these biological invasions has substantially increased in recent years due to the globalization of the world's economies. The damage caused by invasive species is often a result of the higher densities and larger sizes they attain compared to where they are native. A prominent hypothesis explaining the success of introduced species is that they are relatively free of the effects of natural enemies. Most notably, they may encounter fewer parasites in their introduced range compared to their native range. Parasites are ubiquitous and pervasive in marine systems, yet their role in marine invasions is relatively unexplored. Although data on parasites of marine organisms exist, the extent to which parasites can mediate marine invasions, or the extent to which invasive parasites and pathogens are responsible for infecting or potentially decimating native marine species have not been examined. In this review, we present a theoretical framework to model invasion success and examine the evidence for a relationship between parasite presence and the success of introduced marine species. For this, we compare the prevalence and species richness of parasites in several introduced populations of marine species with populations where they are native. We also discuss the potential impacts of introduced marine parasites on native ecosystems.

  18. A unified approach for quantifying invasibility and degree of invasion

    Treesearch

    Qinfeng Guo; Songlin Fei; Jeffrey S. Dukes; Christopher M. Oswalt; Basil V. Iannone III; Kevin M. Potter

    2015-01-01

    Habitat invasibility is a central focus of invasion biology, with implications for basic ecological patterns and processes and for effective invasion management. ‘‘Invasibility’’ is, however, one of the most elusive metrics and misused terms in ecology. Empirical studies and meta-analyses of invasibility have produced inconsistent and even conflicting results. This ...

  19. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    SciTech Connect

    Poeschla, Eric

    2013-06-20

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import.

  20. In vivo occupancy of mitochondrial single-stranded DNA binding protein supports the strand displacement mode of DNA replication.

    PubMed

    Miralles Fusté, Javier; Shi, Yonghong; Wanrooij, Sjoerd; Zhu, Xuefeng; Jemt, Elisabeth; Persson, Örjan; Sabouri, Nasim; Gustafsson, Claes M; Falkenberg, Maria

    2014-12-01

    Mitochondrial DNA (mtDNA) encodes for proteins required for oxidative phosphorylation, and mutations affecting the genome have been linked to a number of diseases as well as the natural ageing process in mammals. Human mtDNA is replicated by a molecular machinery that is distinct from the nuclear replisome, but there is still no consensus on the exact mode of mtDNA replication. We here demonstrate that the mitochondrial single-stranded DNA binding protein (mtSSB) directs origin specific initiation of mtDNA replication. MtSSB covers the parental heavy strand, which is displaced during mtDNA replication. MtSSB blocks primer synthesis on the displaced strand and restricts initiation of light-strand mtDNA synthesis to the specific origin of light-strand DNA synthesis (OriL). The in vivo occupancy profile of mtSSB displays a distinct pattern, with the highest levels of mtSSB close to the mitochondrial control region and with a gradual decline towards OriL. The pattern correlates with the replication products expected for the strand displacement mode of mtDNA synthesis, lending strong in vivo support for this debated model for mitochondrial DNA replication.

  1. C. elegans telomeres contain G-strand and C-strand overhangs that are bound by distinct proteins.

    PubMed

    Raices, Marcela; Verdun, Ramiro E; Compton, Sarah A; Haggblom, Candy I; Griffith, Jack D; Dillin, Andrew; Karlseder, Jan

    2008-03-07

    Single-strand extensions of the G strand of telomeres are known to be critical for chromosome-end protection and length regulation. Here, we report that in C. elegans, chromosome termini possess 3' G-strand overhangs as well as 5' C-strand overhangs. C tails are as abundant as G tails and are generated by a well-regulated process. These two classes of overhangs are bound by two single-stranded DNA binding proteins, CeOB1 and CeOB2, which exhibit specificity for G-rich or C-rich telomeric DNA. Strains of worms deleted for CeOB1 have elongated telomeres as well as extended G tails, whereas CeOB2 deficiency leads to telomere-length heterogeneity. Both CeOB1 and CeOB2 contain OB (oligo-saccharide/oligo-nucleotide binding) folds, which exhibit structural similarity to the second and first OB folds of the mammalian telomere binding protein hPOT1, respectively. Our results suggest that C. elegans telomere homeostasis relies on a novel mechanism that involves 5' and 3' single-stranded termini.

  2. Stranding Events of Kogia Whales along the Brazilian Coast

    PubMed Central

    Moura, Jailson F.; Acevedo-Trejos, Esteban; Tavares, Davi C.; Meirelles, Ana C. O.; Silva, Cristine P. N.; Oliveira, Larissa R.; Santos, Roberta A.; Wickert, Janaína C.; Machado, Rodrigo; Siciliano, Salvatore; Merico, Agostino

    2016-01-01

    The genus Kogia, which comprises only two extant species, Kogia sima and Kogia breviceps, represents one of the least known groups of cetaceans in the global ocean. In some coastal regions, however, stranding events of these species have been relatively common over the last decades. Stranding provides the opportunity to investigate the biology of these cetaceans and to explore the epidemiological aspects associated with the mortality of the organisms found on the beach. A number of disturbances (including pelagic fisheries, chemical pollution, boat strikes, and noise pollution) have been confirmed to pose a particular threat to the Kogia species. However, no study has yet investigated potential relationships between environmental conditions and stranding events. Here we analyse how a collection of environmental, physical, and biological variables, such as wind, sea surface temperature (SST), water depth, and chlorophyll-a, correlate to Kogia stranding events along the Brazilian coast. The results of our statistical analyses suggest that K. sima is more likely found in warm tropical waters, which provide an explanation for the high frequency of stranding in northeastern Brazilian coast. In contrast, K. breviceps appears to have a preference for temperate and productive waters. Wind speed results to be also an important factor for predicting Kogia strandings in Brazilian coast. Additionally, literature information in combination with our own data and analyses of stomach contents confirms that oceanic cephalopods constitute the primary nutritional source of both Kogia species. By using the available information as a qualitative proxy for habitat preference and feeding ecology, our study provides a novel and comprehensive assessment of Kogia stranding data in relation to environmental conditions along the Brazilian coast. PMID:26730951

  3. New Views on Strand Asymmetry in Insect Mitochondrial Genomes

    PubMed Central

    Wei, Shu-Jun; Shi, Min; Chen, Xue-Xin; Sharkey, Michael J.; van Achterberg, Cornelis; Ye, Gong-Yin; He, Jun-Hua

    2010-01-01

    Strand asymmetry in nucleotide composition is a remarkable feature of animal mitochondrial genomes. Understanding the mutation processes that shape strand asymmetry is essential for comprehensive knowledge of genome evolution, demographical population history and accurate phylogenetic inference. Previous studies found that the relative contributions of different substitution types to strand asymmetry are associated with replication alone or both replication and transcription. However, the relative contributions of replication and transcription to strand asymmetry remain unclear. Here we conducted a broad survey of strand asymmetry across 120 insect mitochondrial genomes, with special reference to the correlation between the signs of skew values and replication orientation/gene direction. The results show that the sign of GC skew on entire mitochondrial genomes is reversed in all species of three distantly related families of insects, Philopteridae (Phthiraptera), Aleyrodidae (Hemiptera) and Braconidae (Hymenoptera); the replication-related elements in the A+T-rich regions of these species are inverted, confirming that reversal of strand asymmetry (GC skew) was caused by inversion of replication origin; and finally, the sign of GC skew value is associated with replication orientation but not with gene direction, while that of AT skew value varies with gene direction, replication and codon positions used in analyses. These findings show that deaminations during replication and other mutations contribute more than selection on amino acid sequences to strand compositions of G and C, and that the replication process has a stronger affect on A and T content than does transcription. Our results may contribute to genome-wide studies of replication and transcription mechanisms. PMID:20856815

  4. Role of stranded gas in increasing global gas supplies

    USGS Publications Warehouse

    Attanasi, E.D.; Freeman, P.A.

    2013-01-01

    This report synthesizes the findings of three regional studies in order to evaluate, at the global scale, the contribution that stranded gas resources can make to global natural gas supplies. Stranded gas, as defined for this study, is natural gas in discovered conventional gas and oil fields that is currently not commercially producible for either physical or economic reasons. The regional studies evaluated the cost of bringing the large volumes of undeveloped gas in stranded gas fields to selected markets. In particular, stranded gas fields of selected Atlantic Basin countries, north Africa, Russia, and central Asia are screened to determine whether the volumes are sufficient to meet Europe’s increasing demand for gas imports. Stranded gas fields in Russia, central Asia, Southeast Asia, and Australia are also screened to estimate development, production, and transport costs and corresponding gas volumes that could be supplied to Asian markets in China, India, Japan, and South Korea. The data and cost analysis presented here suggest that for the European market and the markets examined in Asia, the development of stranded gas provides a way to meet projected gas import demands for the 2020-to-2040 period. Although this is a reconnaissance-type appraisal, it is based on volumes of gas that are associated with individual identified fields. Individual field data were carefully examined. Some fields were not evaluated because current technology was insufficient or it appeared the gas was likely to be held off the export market. Most of the evaluated stranded gas can be produced and delivered to markets at costs comparable to historical prices. Moreover, the associated volumes of gas are sufficient to provide an interim supply while additional technologies are developed to unlock gas diffused in shale and hydrates or while countries transition to making a greater use of renewable energy sources.

  5. Translating Ribosomes Inhibit Poliovirus Negative-Strand RNA Synthesis

    PubMed Central

    Barton, David J.; Morasco, B. Joan; Flanegan, James B.

    1999-01-01

    Poliovirus has a single-stranded RNA genome of positive polarity that serves two essential functions at the start of the viral replication cycle in infected cells. First, it is translated to synthesize viral proteins and, second, it is copied by the viral polymerase to synthesize negative-strand RNA. We investigated these two reactions by using HeLa S10 in vitro translation-RNA replication reactions. Preinitiation RNA replication complexes were isolated from these reactions and then used to measure the sequential synthesis of negative- and positive-strand RNAs in the presence of different protein synthesis inhibitors. Puromycin was found to stimulate RNA replication overall. In contrast, RNA replication was inhibited by diphtheria toxin, cycloheximide, anisomycin, and ricin A chain. Dose-response experiments showed that precisely the same concentration of a specific drug was required to inhibit protein synthesis and to either stimulate or inhibit RNA replication. This suggested that the ability of these drugs to affect RNA replication was linked to their ability to alter the normal clearance of translating ribosomes from the input viral RNA. Consistent with this idea was the finding that the protein synthesis inhibitors had no measurable effect on positive-strand synthesis in normal RNA replication complexes. In marked contrast, negative-strand synthesis was stimulated by puromycin and was inhibited by cycloheximide. Puromycin causes polypeptide chain termination and induces the dissociation of polyribosomes from mRNA. Cycloheximide and other inhibitors of polypeptide chain elongation “freeze” ribosomes on mRNA and prevent the normal clearance of ribosomes from viral RNA templates. Therefore, it appears that the poliovirus polymerase was not able to dislodge translating ribosomes from viral RNA templates and mediate the switch from translation to negative-strand synthesis. Instead, the initiation of negative-strand synthesis appears to be coordinately regulated

  6. Multiple sensors ensure guide strand selection in human RNAi pathways.

    PubMed

    Noland, Cameron L; Doudna, Jennifer A

    2013-05-01

    Small RNAs guide RNA-induced silencing complexes (RISCs) to bind to cognate mRNA transcripts and trigger silencing of protein expression during RNA interference (RNAi) in eukaryotes. A fundamental aspect of this process is the asymmetric loading of one strand of a short interfering RNA (siRNA) or microRNA (miRNA) duplex onto RISCs for correct target recognition. Here, we use a reconstituted system to determine the extent to which the core components of the human RNAi machinery contribute to RNA guide strand selection. We show that Argonaute2 (Ago2), the endonuclease that binds directly to siRNAs and miRNAs within RISC, has intrinsic but substrate-dependent RNA strand selection capability. This activity can be enhanced substantially when Ago2 is in complex with the endonuclease Dicer and the double-stranded RNA-binding proteins (dsRBPs)-trans-activation response (TAR) RNA-binding protein (TRBP) or protein activator of PKR (PACT). The extent to which human Dicer/dsRBP complexes contribute to strand selection is dictated by specific duplex parameters such as thermodynamics, 5' nucleotide identity, and structure. Surprisingly, our results also suggest that strand selection for some miRNAs is enhanced by PACT-containing complexes but not by those containing TRBP. Furthermore, overall mRNA targeting by miRNAs is disfavored for complexes containing TRBP but not PACT. These findings demonstrate that multiple proteins collaborate to ensure optimal strand selection in humans and reveal the possibility of delineating RNAi pathways based on the presence of TRBP or PACT.

  7. Stranding Events of Kogia Whales along the Brazilian Coast.

    PubMed

    Moura, Jailson F; Acevedo-Trejos, Esteban; Tavares, Davi C; Meirelles, Ana C O; Silva, Cristine P N; Oliveira, Larissa R; Santos, Roberta A; Wickert, Janaína C; Machado, Rodrigo; Siciliano, Salvatore; Merico, Agostino

    2016-01-01

    The genus Kogia, which comprises only two extant species, Kogia sima and Kogia breviceps, represents one of the least known groups of cetaceans in the global ocean. In some coastal regions, however, stranding events of these species have been relatively common over the last decades. Stranding provides the opportunity to investigate the biology of these cetaceans and to explore the epidemiological aspects associated with the mortality of the organisms found on the beach. A number of disturbances (including pelagic fisheries, chemical pollution, boat strikes, and noise pollution) have been confirmed to pose a particular threat to the Kogia species. However, no study has yet investigated potential relationships between environmental conditions and stranding events. Here we analyse how a collection of environmental, physical, and biological variables, such as wind, sea surface temperature (SST), water depth, and chlorophyll-a, correlate to Kogia stranding events along the Brazilian coast. The results of our statistical analyses suggest that K. sima is more likely found in warm tropical waters, which provide an explanation for the high frequency of stranding in northeastern Brazilian coast. In contrast, K. breviceps appears to have a preference for temperate and productive waters. Wind speed results to be also an important factor for predicting Kogia strandings in Brazilian coast. Additionally, literature information in combination with our own data and analyses of stomach contents confirms that oceanic cephalopods constitute the primary nutritional source of both Kogia species. By using the available information as a qualitative proxy for habitat preference and feeding ecology, our study provides a novel and comprehensive assessment of Kogia stranding data in relation to environmental conditions along the Brazilian coast.

  8. 75 FR 37382 - Notice of Antidumping Duty Order: Prestressed Concrete Steel Wire Strand from the People's...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-29

    ... International Trade Administration Notice of Antidumping Duty Order: Prestressed Concrete Steel Wire Strand from... duty order on prestressed concrete steel wire strand (``PC strand'') from the People's Republic of... material injury to a U.S. industry. See Prestressed Concrete Steel Wire Strand from China...

  9. 75 FR 36678 - Prestressed Concrete Steel Wire Strand From China; Determinations

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-28

    ... COMMISSION Prestressed Concrete Steel Wire Strand From China; Determinations On the basis of the record \\1... of prestressed concrete steel wire strand (PC strand), provided for in subheading 7312.10.30 of the... (June 2010), entitled Prestressed Concrete Steel Wire Strand from China: Investigation Nos....

  10. Tensile and dimensional properties of wood strands made from plantation southern pine lumber

    Treesearch

    Qinglin Wu; Zhiyong Cai; Jong N. Lee

    2005-01-01

    Working stresses and performance of strand composite lumber largely depend upon the properties of each individual strand. Southern pine strands from plantation lumber grown in southern Louisiana were investigated in this study in order to understand strand behaviors. The effects of hot-pressing and resin application on tensile modulus, strength, and dimensional...

  11. The excluded DNA strand is SEW important for hexameric helicase unwinding.

    PubMed

    Carney, Sean M; Trakselis, Michael A

    2016-10-01

    Helicases are proposed to unwind dsDNA primarily by translocating on one strand to sterically exclude and separate the two strands. Hexameric helicases in particular have been shown to encircle one strand while physically excluding the other strand. In this article, we will detail experimental methods used to validate specific interactions with the excluded strand on the exterior surface of hexameric helicases. Both qualitative and quantitative methods are described to identify an excluded strand interaction, determine the exterior interacting residues, and measure the dynamics of binding. The implications of exterior interactions with the nontranslocating strand are discussed and include forward unwinding stabilization, regulation of the unwinding rate, and DNA damage sensing.

  12. Minimally invasive procedures

    PubMed Central

    Baltayiannis, Nikolaos; Michail, Chandrinos; Lazaridis, George; Anagnostopoulos, Dimitrios; Baka, Sofia; Mpoukovinas, Ioannis; Karavasilis, Vasilis; Lampaki, Sofia; Papaiwannou, Antonis; Karavergou, Anastasia; Kioumis, Ioannis; Pitsiou, Georgia; Katsikogiannis, Nikolaos; Tsakiridis, Kosmas; Rapti, Aggeliki; Trakada, Georgia; Zissimopoulos, Athanasios; Zarogoulidis, Konstantinos

    2015-01-01

    Minimally invasive procedures, which include laparoscopic surgery, use state-of-the-art technology to reduce the damage to human tissue when performing surgery. Minimally invasive procedures require small “ports” from which the surgeon inserts thin tubes called trocars. Carbon dioxide gas may be used to inflate the area, creating a space between the internal organs and the skin. Then a miniature camera (usually a laparoscope or endoscope) is placed through one of the trocars so the surgical team can view the procedure as a magnified image on video monitors in the operating room. Specialized equipment is inserted through the trocars based on the type of surgery. There are some advanced minimally invasive surgical procedures that can be performed almost exclusively through a single point of entry—meaning only one small incision, like the “uniport” video-assisted thoracoscopic surgery (VATS). Not only do these procedures usually provide equivalent outcomes to traditional “open” surgery (which sometimes require a large incision), but minimally invasive procedures (using small incisions) may offer significant benefits as well: (I) faster recovery; (II) the patient remains for less days hospitalized; (III) less scarring and (IV) less pain. In our current mini review we will present the minimally invasive procedures for thoracic surgery. PMID:25861610

  13. T7 RNA Polymerase Bypass of Large Gaps on the Template Strand Reveals a Critical Role of the Nontemplate Strand in Elongation

    PubMed Central

    Zhou, Wei; Reines, Daniel

    2012-01-01

    Summary We show that T7 RNA polymerase can efficiently transcribe DNA containing gaps from one to five bases in the template strand. Surprisingly, broken template strands missing up to 24 bases can still be transcribed, although at reduced efficiency. The resulting transcripts contain the full template sequence with the RNA deleted for the gapped region missing on the template strand. These findings indicate that the end of a downstream template strand can be brought into the polymerase and transcribed as if it were a part of an intact polynucleotide chain by utilizing the unpaired nontemplate strand. This, as well as transcription of an intact template strand, relies heavily upon the nontemplate strand, suggesting that a duplex DNA-binding site on the leading edge of RNA polymerase is required for RNA chain elongation on DNA templates. This work contributes substantially to the emerging picture that the nontemplate strand is an important element of the transcription elongation complex. PMID:7664337

  14. Mass stranding of wedge-tailed shearwater chicks in Hawaii

    USGS Publications Warehouse

    Work, Thierry M.; Rameyer, Robert

    1999-01-01

    Unusual numbers of wedge-tailed shearwater (Puffinus pacificus) chicks stranded on Oahu (Hawaii, USA) in 1994. Compared to healthy wedge-tailed shearwater (WTSW) chicks, stranded chicks were underweight, dehydrated, leukopenic, lymphopenic, eosinopenic, and heterophilic; some birds were toxemic and septic. Stranded chicks also were hypoglycemic and had elevated aspartate amino transferase levels. Most chicks apparently died from emaciation, dehydration, or bacteremia. Because many birds with bacteremia also had severe necrosis of the gastrointestinal (GI) mucosa associated with bacteria, we suspect the GI tract to be the source of disseminated bacterial infection. The identity of the bacteria was not confirmed. The daily number of chicks stranded was significantly related to average wind speeds, and the mortality coincided with the fledging period for WTSW. Strong southeasterly winds were a distinguishing meteorologic factor in 1994 and contributed to the distribution of stranded chicks on Oahu. More objective data on WTSW demographics would enhance future efforts to determine predisposing causes of WTSW wrecks and their effects on seabird colonies.

  15. An intercalation-locked parallel-stranded DNA tetraplex

    PubMed Central

    Tripathi, Shailesh; Zhang, Daoning; Paukstelis, Paul J.

    2015-01-01

    DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(ACBrUCGGABrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5′-most A–A base pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H–1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures. PMID:25628357

  16. DNA-directed mutations. Leading and lagging strand specificity

    NASA Technical Reports Server (NTRS)

    Sinden, R. R.; Hashem, V. I.; Rosche, W. A.

    1999-01-01

    The fidelity of replication has evolved to reproduce B-form DNA accurately, while allowing a low frequency of mutation. The fidelity of replication can be compromised, however, by defined order sequence DNA (dosDNA) that can adopt unusual or non B-DNA conformations. These alternative DNA conformations, including hairpins, cruciforms, triplex DNAs, and slipped-strand structures, may affect enzyme-template interactions that potentially lead to mutations. To analyze the effect of dosDNA elements on spontaneous mutagenesis, various mutational inserts containing inverted repeats or direct repeats were cloned in a plasmid containing a unidirectional origin of replication and a selectable marker for the mutation. This system allows for analysis of mutational events that are specific for the leading or lagging strands during DNA replication in Escherichia coli. Deletions between direct repeats, involving misalignment stabilized by DNA secondary structure, occurred preferentially on the lagging strand. Intermolecular strand switch events, correcting quasipalindromes to perfect inverted repeats, occurred preferentially during replication of the leading strand.

  17. An intercalation-locked parallel-stranded DNA tetraplex

    DOE PAGES

    Tripathi, S.; Zhang, D.; Paukstelis, P. J.

    2015-01-27

    DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(ACBrUCGGABrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A base pairs betweenmore » adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H–1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less

  18. An intercalation-locked parallel-stranded DNA tetraplex

    SciTech Connect

    Tripathi, S.; Zhang, D.; Paukstelis, P. J.

    2015-01-27

    DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(ACBrUCGGABrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A base pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H–1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.

  19. DNA-directed mutations. Leading and lagging strand specificity

    NASA Technical Reports Server (NTRS)

    Sinden, R. R.; Hashem, V. I.; Rosche, W. A.

    1999-01-01

    The fidelity of replication has evolved to reproduce B-form DNA accurately, while allowing a low frequency of mutation. The fidelity of replication can be compromised, however, by defined order sequence DNA (dosDNA) that can adopt unusual or non B-DNA conformations. These alternative DNA conformations, including hairpins, cruciforms, triplex DNAs, and slipped-strand structures, may affect enzyme-template interactions that potentially lead to mutations. To analyze the effect of dosDNA elements on spontaneous mutagenesis, various mutational inserts containing inverted repeats or direct repeats were cloned in a plasmid containing a unidirectional origin of replication and a selectable marker for the mutation. This system allows for analysis of mutational events that are specific for the leading or lagging strands during DNA replication in Escherichia coli. Deletions between direct repeats, involving misalignment stabilized by DNA secondary structure, occurred preferentially on the lagging strand. Intermolecular strand switch events, correcting quasipalindromes to perfect inverted repeats, occurred preferentially during replication of the leading strand.

  20. Regulation of DNA strand exchange in homologous recombination.

    PubMed

    Holthausen, J Thomas; Wyman, Claire; Kanaar, Roland

    2010-12-10

    Homologous recombination, the exchange of DNA strands between homologous DNA molecules, is involved in repair of many structural diverse DNA lesions. This versatility stems from multiple ways in which homologous DNA strands can be rearranged. At the core of homologous recombination are recombinase proteins such as RecA and RAD51 that mediate homology recognition and DNA strand exchange through formation of a dynamic nucleoprotein filament. Four stages in the life cycle of nucleoprotein filaments are filament nucleation, filament growth, homologous DNA pairing and strand exchange, and filament dissociation. Progression through this cycle requires a sequence of recombinase-DNA and recombinase protein-protein interactions coupled to ATP binding and hydrolysis. The function of recombinases is controlled by accessory proteins that allow coordination of strand exchange with other steps of homologous recombination and that tailor to the needs of specific aberrant DNA structures undergoing recombination. Accessory proteins are also able to reverse filament formation thereby guarding against inappropriate DNA rearrangements. The dynamic instability of the recombinase-DNA interactions allows both positive and negative action of accessory proteins thereby ensuring that genome maintenance by homologous recombination is not only flexible and versatile, but also accurate. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Mass stranding of wedge-tailed shearwater chicks in Hawaii.

    PubMed

    Work, T M; Rameyer, R A

    1999-07-01

    Unusual numbers of wedge-tailed shearwater (Puffinus pacificus) chicks stranded on Oahu (Hawaii, USA) in 1994. Compared to healthy wedge-tailed shearwater (WTSW) chicks, stranded chicks were underweight, dehydrated, leukopenic, lymphopenic, eosinopenic, and heterophilic; some birds were toxemic and septic. Stranded chicks also were hypoglycemic and had elevated aspartate amino transferase levels. Most chicks apparently died from emaciation, dehydration, or bacteremia. Because many birds with bacteremia also had severe necrosis of the gastrointestinal (GI) mucosa associated with bacteria, we suspect the GI tract to be the source of disseminated bacterial infection. The identity of the bacteria was not confirmed. The daily number of chicks stranded was significantly related to average wind speeds, and the mortality coincided with the fledging period for WTSW. Strong southeasterly winds were a distinguishing meteorologic factor in 1994 and contributed to the distribution of stranded chicks on Oahu. More objective data on WTSW demographics would enhance future efforts to determine predisposing causes of WTSW wrecks and their effects on seabird colonies.

  2. Proceedings of a Workshop on Antarctic Meteorite Stranding Surfaces

    SciTech Connect

    Cassidy, W.A.; Whillans, I.M.

    1990-08-01

    The discovery of large numbers of meteorites on the Antarctic Ice Sheet is one of the most exciting developments in polar science in recent years. The meteorites are found on areas of ice called stranding surfaces. Because of the sudden availability of hundreds, and then thousands, of new meteorite specimens at these sites, the significance of the discovery of meteorite stranding surfaces in Antarctica had an immediate and profound impact on planetary science, but there is also in this discovery an enormous, largely unrealized potential to glaciology for records of climatic and ice sheet changes. The glaciological interest derives from the antiquity of the ice in meteorite stranding surfaces. This exposed ice covers a range of ages, probably between zero and more than 500,000 years. The Workshop on Antarctic Meteorite Stranding Surfaces was convened to explore this potential and to devise a course of action that could be recommended to granting agencies. The workshop recognized three prime functions of meteorite stranding surfaces. They provide: (1) A proxy record of climatic change (i.e., a long record of climatic change is probably preserved in the exposed ice stratigraphy); (2) A proxy record of ice volume change; and (3) A source of unique nonterrestrial material.

  3. Heavy ion induced double strand breaks in bacteria and bacteriophages

    NASA Astrophysics Data System (ADS)

    Micke, U.; Schäfer, M.; Anton, A.; Horneck, G.; Bücker, H.

    DNA damage induced by heavy ions in bacterial cells and bacteriophages such as Bacillus subtilis, E. coli and Bacteriophage Tl were investigated by analyzing the double strand breaks in the chromosomal DNA. This kind of lesion is considered as one of the main reasons for lethal events. To analyze double strand breaks in long molecules of DNA - up to some Mbp in length - the technique of pulse field agarose gel electrophoresis has been used. This allows the detection of one double strand break per genome. Cell lysis and DNA isolation were performed in small agarose blocks directly. This procedure secured minimum DNA destruction by shearing forces. After running a gel, the DNA was stained with ethidium bromide. The light intensity of ethidium bromide fluorescence for both the outcoming (running) DNA and the remaining intact DNA were measured by scanning. The mean number of double strand breaks was calculated by determining the quotient of these intensities. Strand break induction after heavy ion and X-ray irradiation was compared.

  4. The Effect of Basepair Mismatch on DNA Strand Displacement.

    PubMed

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality.

  5. Hydration of single-stranded phosphodiester and phosphorothioate oligodeoxyribonucleotides.

    PubMed Central

    White, A P; Reeves, K K; Snyder, E; Farrell, J; Powell, J W; Mohan, V; Griffey, R H

    1996-01-01

    Infrared spectroscopy was used to identify hydration-sensitive structural differences between single- stranded phosphorothioate (PS) and phosphodiester (PO) oligodeoxyribonucleotides. Spectra were recorded in the mid-infrared region, 500-1800 cm-1, at relative humidities between 0 and 98%; the PS and PO spectra are substantially different. The hydration effects on spectral bands in these single-stranded oligodeoxyribonucleotides is markedly different from such behavior in double- and triple-stranded oligodeoxyribonucleotides. A strong absorption occurs at 656 cm-1 in the phosphorothioate sample which is completely absent from the PO spectra. Gravimetric measurements were carried out on one PS and one PO sample to monitor and confirm hydration. The calculated BET adsorption constants [Brunauer, S., Emmett, RH. and Teller, E. (1938) J. Am. Chem. Soc., 60, 309-319] are 1.2 and 1.4 water molecules per nucleotide in the first hydration layer of PS and PO respectively. While the gravimetric data indicate that the single-stranded oligodeoxyribonucleotides hydrate very similarly to duplex DNA, the mid-infrared conformational marker bands are strikingly different from those observed for duplex DNA. In particular, the Vas of the phosphate group (PO2) at 1222 cm-1 in the single-stranded PO spectra is independent of relative humidity. PMID:8774910

  6. Mass stranding of wedge-tailed shearwater chicks in Hawaii

    USGS Publications Warehouse

    Work, T.M.; Rameyer, R.A.

    1999-01-01

    Unusual numbers of wedge-tailed shearwater (Puffinus pacificus) chicks stranded on Oahu (Hawaii, USA) in 1994. Compared to healthy wedge-tailed shearwater (WTSW) chicks, stranded chicks were underweight, dehydrated, leukopenic, lymphopenic, eosinopenic, and heterophilic; some birds were toxemic and septic. Stranded chicks also were hypoglycemic and had elevated aspartate amino transferase levels. Most chicks apparently died from emaciation, dehydration, or bacteremia. Because many birds with bacteremia also had severe necrosis of the gastrointestinal (GI) mucosa associated with bacteria, we suspect the GI tract to be the source of disseminated bacterial infection. The identity of the bacteria was not confirmed. The daily number of chicks stranded was significantly related to average wind speeds, and the mortality coincided with the fledging period for WTSW. Strong southeasterly winds were a distinguishing meteorologic factor in 1994 and contributed to the distribution of stranded chicks on Oahu. More objective data on WTSW demographics would enhance future efforts to determine predisposing causes of WTSW wrecks and their effects on seabird colonies.

  7. Oligoarginine Peptides Slow Strand Annealing and Assist Nonenzymatic RNA Replication

    PubMed Central

    Jia, Tony Z.; Fahrenbach, Albert C.; Kamat, Neha P.; Adamala, Katarzyna P.; Szostak, Jack W.

    2016-01-01

    The nonenzymatic replication of RNA is thought to have been a critical process required for the origin of life. One unsolved difficulty with nonenzymatic RNA replication is that template-directed copying of RNA results in a double-stranded product; following strand separation, rapid strand reannealing outcompetes slow nonenzymatic template copying, rendering multiple rounds of RNA replication impossible. Here we show that oligoarginine peptides slow the annealing of complementary oligoribonucleotides by up to several thousand-fold; however, short primers and activated monomers can still bind to template strands, and template-directed primer extension can still occur within a phase-separated condensed state, or coacervate. Furthermore, we show that within this phase, partial template copying occurs even in the presence of full-length complementary strands. This method for enabling further rounds of replication suggests one mechanism by which short, non-coded peptides could have enhanced early cellular fitness, potentially explaining how longer, coded peptides, i.e. proteins, came to prominence in modern biology. PMID:27657866

  8. Strand displacement synthesis by yeast DNA polymerase ε

    PubMed Central

    Ganai, Rais A.; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik

    2016-01-01

    DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3′–5′ exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo. We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3′–5′ exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5′ end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. PMID:27325747

  9. Proceedings of a Workshop on Antarctic Meteorite Stranding Surfaces

    NASA Technical Reports Server (NTRS)

    Cassidy, W. A. (Editor); Whillans, I. M. (Editor)

    1990-01-01

    The discovery of large numbers of meteorites on the Antarctic Ice Sheet is one of the most exciting developments in polar science in recent years. The meteorites are found on areas of ice called stranding surfaces. Because of the sudden availability of hundreds, and then thousands, of new meteorite specimens at these sites, the significance of the discovery of meteorite stranding surfaces in Antarctica had an immediate and profound impact on planetary science, but there is also in this discovery an enormous, largely unrealized potential to glaciology for records of climatic and ice sheet changes. The glaciological interest derives from the antiquity of the ice in meteorite stranding surfaces. This exposed ice covers a range of ages, probably between zero and more than 500,000 years. The Workshop on Antarctic Meteorite Stranding Surfaces was convened to explore this potential and to devise a course of action that could be recommended to granting agencies. The workshop recognized three prime functions of meteorite stranding surfaces. They provide: (1) A proxy record of climatic change (i.e., a long record of climatic change is probably preserved in the exposed ice stratigraphy); (2) A proxy record of ice volume change; and (3) A source of unique nonterrestrial material.

  10. Dna2 is involved in CA strand resection and nascent lagging strand completion at native yeast telomeres.

    PubMed

    Budd, Martin E; Campbell, Judith L

    2013-10-11

    Post-replicational telomere end processing involves both extension by telomerase and resection to produce 3'-GT-overhangs that extend beyond the complementary 5'-CA-rich strand. Resection must be carefully controlled to maintain telomere length. At short de novo telomeres generated artificially by HO endonuclease in the G2 phase, we show that dna2-defective strains are impaired in both telomere elongation and sequential 5'-CA resection. At native telomeres in dna2 mutants, GT-overhangs do clearly elongate during late S phase but are shorter than in wild type, suggesting a role for Dna2 in 5'-CA resection but also indicating significant redundancy with other nucleases. Surprisingly, elimination of Mre11 nuclease or Exo1, which are complementary to Dna2 in resection of internal double strand breaks, does not lead to further shortening of GT-overhangs in dna2 mutants. A second step in end processing involves filling in of the CA-strand to maintain appropriate telomere length. We show that Dna2 is required for normal telomeric CA-strand fill-in. Yeast dna2 mutants, like mutants in DNA ligase 1 (cdc9), accumulate low molecular weight, nascent lagging strand DNA replication intermediates at telomeres. Based on this and other results, we propose that FEN1 is not sufficient and that either Dna2 or Exo1 is required to supplement FEN1 in maturing lagging strands at telomeres. Telomeres may be among the subset of genomic locations where Dna2 helicase/nuclease is essential for the two-nuclease pathway of primer processing on lagging strands.

  11. Invasive Bordetella holmesii infections.

    PubMed

    Fishbain, Joel T; Riederer, Kathleen; Sawaf, Hadi; Mody, Rupal

    2015-02-01

    Bordetella holmesii is a rare cause of invasive human disease. The fastidious and unusual nature of this organism makes routine isolation and identification challenging. We report two cases of B. holmesii bacteremia that were rapidly identified by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS) when standard techniques failed to provide speciation. There are no current standards for susceptibility testing or treatment recommendations. The rare occurrence and challenges in identifying this pathogen led us to perform a comprehensive review of the epidemiology, clinical presentations, and treatment options for this potentially invasive pathogen.

  12. Intracellular Parasite Invasion Strategies

    NASA Astrophysics Data System (ADS)

    Sibley, L. D.

    2004-04-01

    Intracellular parasites use various strategies to invade cells and to subvert cellular signaling pathways and, thus, to gain a foothold against host defenses. Efficient cell entry, ability to exploit intracellular niches, and persistence make these parasites treacherous pathogens. Most intracellular parasites gain entry via host-mediated processes, but apicomplexans use a system of adhesion-based motility called ``gliding'' to actively penetrate host cells. Actin polymerization-dependent motility facilitates parasite migration across cellular barriers, enables dissemination within tissues, and powers invasion of host cells. Efficient invasion has brought widespread success to this group, which includes Toxoplasma, Plasmodium, and Cryptosporidium.

  13. Polymerase chain reaction-single strand conformation polymorphism analyses of nuclear and chloroplast DNA provide evidence for recombination, multiple introductions and nascent speciation in the Caulerpa taxifolia complex.

    PubMed

    Meusnier, I; Valero, M; Destombe, C; Godé, C; Desmarais, E; Bonhomme, F; Stam, W T; Olsen, J L

    2002-11-01

    Independent lines of evidence support an Australian origin for the Mediterranean populations of the tropical alga Caulerpa taxifolia. To complement previous biogeographical studies based on nuclear rDNA internal transcribed spacer (ITS), a new chloroplast marker was developed--the cp 16S rDNA intron-2. Sequence variability for both nuclear and chloroplast markers were assessed in 110 individuals using single strand conformation polymorphism. Comparison of intrapopulation genetic diversity between invasive Mediterranean and 'native' Australian populations revealed the occurrence of two divergent and widespread clades. The first clade grouped nontropical invasive populations with inshore-mainland populations from Australia, while the second clustered all offshore-island populations studied so far. Despite our finding of nine distinct nuclear and five distinct chloroplast profiles, a single nucleocytoplasmic combination was characteristic of the invasive populations and sexual reproduction was found to be very rare. C. taxifolia is clearly a complex of genetically and ecologically differentiated sibling species or subspecies.

  14. Over-invasion by functionally equivalent invasive species.

    PubMed

    Russell, James C; Sataruddin, Nurul S; Heard, Allison D

    2014-08-01

    Multiple invasive species have now established at most locations around the world, and the rate of new species invasions and records of new invasive species continue to grow. Multiple invasive species interact in complex and unpredictable ways, altering their invasion success and impacts on biodiversity. Incumbent invasive species can be replaced by functionally similar invading species through competitive processes; however the generalized circumstances leading to such competitive displacement have not been well investigated. The likelihood of competitive displacement is a function of the incumbent advantage of the resident invasive species and the propagule pressure of the colonizing invasive species. We modeled interactions between populations of two functionally similar invasive species and indicated the circumstances under which dominance can be through propagule pressure and incumbent advantage. Under certain circumstances, a normally subordinate species can be incumbent and reject a colonizing dominant species, or successfully colonize in competition with a dominant species during simultaneous invasion. Our theoretical results are supported by empirical studies of the invasion of islands by three invasive Rattus species. Competitive displacement is prominent in invasive rats and explains the replacement of R. exulans on islands subsequently invaded by European populations of R. rattus and R. norvegicus. These competition outcomes between invasive species can be found in a broad range of taxa and biomes, and are likely to become more common. Conservation management must consider that removing an incumbent invasive species may facilitate invasion by another invasive species. Under very restricted circumstances of dominant competitive ability but lesser impact, competitive displacement may provide a novel method of biological control.

  15. Invasion triangle: an organizational framework for species invasion

    PubMed Central

    Perkins, Lora B; Leger, Elizabeth A; Nowak, Robert S

    2011-01-01

    Species invasion is a complex, multifactor process. To encapsulate this complexity into an intuitively appealing, simple, and straightforward manner, we present an organizational framework in the form of an invasion triangle. The invasion triangle is an adaptation of the disease triangle used by plant pathologists to help envision and evaluate interactions among a host, a pathogen, and an environment. Our modification of this framework for invasive species incorporates the major processes that result in invasion as the three sides of the triangle: (1) attributes of the potential invader; (2) biotic characteristics of a potentially invaded site; and (3) environmental conditions of the site. The invasion triangle also includes the impact of external influences on each side of the triangle, such as climate and land use change. This paper introduces the invasion triangle, discusses how accepted invasion hypotheses are integrated in this framework, describes how the invasion triangle can be used to focus research and management, and provides examples of application. The framework provided by the invasion triangle is easy to use by both researchers and managers and also applicable at any level of data intensity, from expert opinion to highly controlled experiments. The organizational framework provided by the invasion triangle is beneficial for understanding and predicting why species are invasive in specific environments, for identifying knowledge gaps, for facilitating communication, and for directing management in regard to invasive species. PMID:22393528

  16. PROPERTIES OF DOUBLE-STRANDED DNA AS A POLYELECTROLYTE.

    PubMed

    OHNISHI, T

    1963-11-01

    The stability of the structure of double-stranded DNA in the salt-free solution is discussed on the basis of the polyelectrolyte theory. Assuming that DNA is an infinitely long rod, and the formation of double strands is divided into combining process and folding process, the free energy changes required in these processes are calculated by the use of the exact solutions of two-dimensional Poisson-Boltzmann equation for the one rod and the two rod systems.By strong depression of electrostatic interaction due to counter-ion condensation phenomena, the free energy change is remarkably decreased so that the double-stranded structure of DNA can be stabilized by energy of hydrogen bonds between base pairs. The increase of the activity coefficient of a counterion upon heat denaturation of DNA is also explained.

  17. Availability: A Metric for Nucleic Acid Strand Displacement Systems

    PubMed Central

    2016-01-01

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks. PMID:26875531

  18. Persistence and breakdown of strand symmetry in the human genome.

    PubMed

    Zhang, Shang-Hong

    2015-04-07

    Afreixo, V., Bastos, C.A.C., Garcia, S.P., Rodrigues, J.M.O.S., Pinho, A.J., Ferreira, P.J.S.G., 2013. The breakdown of the word symmetry in the human genome. J. Theor. Biol. 335, 153-159 analyzed the word symmetry (strand symmetry or the second parity rule) in the human genome. They concluded that strand symmetry holds for oligonucleotides up to 6 nt and is no longer statistically significant for oligonucleotides of higher orders. However, although they provided some new results for the issue, their interpretation would not be fully justified. Also, their conclusion needs to be further evaluated. Further analysis of their results, especially those of equivalence tests and word symmetry distance, shows that strand symmetry would persist for higher-order oligonucleotides up to 9 nt in the human genome, at least for its overall frequency framework (oligonucleotide frequency pattern). Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Availability: A Metric for Nucleic Acid Strand Displacement Systems.

    PubMed

    Olson, Xiaoping; Kotani, Shohei; Padilla, Jennifer E; Hallstrom, Natalya; Goltry, Sara; Lee, Jeunghoon; Yurke, Bernard; Hughes, William L; Graugnard, Elton

    2017-01-20

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks.

  20. Factors that affect electric-utility stranded commitments

    SciTech Connect

    Hirst, E.; Hadley, S.; Baxter, L.

    1996-07-01

    Estimates of stranded commitments for U.S. investor-owned utilities range widely, with many falling in the range of $100 to $200 billion. These potential losses exist because some utility-owned power plants, long-term power-purchase contracts and fuel-supply contracts, regulatory assets, and expenses for public-policy programs have book values that exceed their expected market values under full competition. This report quantifies the sensitivity of stranded- commitment estimates to the various factors that lead to these above- market-value estimates. The purpose of these sensitivity analyses is to improve understanding on the part of state and federal regulators, utilities, customers, and other electric-industry participants about the relative importance of the factors that affect stranded- commitment amounts.

  1. Mammalian Ino80 mediates double-strand break repair through its role in DNA end strand resection.

    PubMed

    Gospodinov, Anastas; Vaissiere, Thomas; Krastev, Dragomir B; Legube, Gaëlle; Anachkova, Boyka; Herceg, Zdenko

    2011-12-01

    Chromatin modifications/remodeling are important mechanisms by which cells regulate various functions through providing accessibility to chromatin DNA. Recent studies implicated INO80, a conserved chromatin-remodeling complex, in the process of DNA repair. However, the precise underlying mechanism by which this complex mediates repair in mammalian cells remains enigmatic. Here, we studied the effect of silencing of the Ino80 subunit of the complex on double-strand break repair in mammalian cells. Comet assay and homologous recombination repair reporter system analyses indicated that Ino80 is required for efficient double-strand break repair. Ino80 association with chromatin surrounding double-strand breaks suggested the direct involvement of INO80 in the repair process. Ino80 depletion impaired focal recruitment of 53BP1 but did not impede Rad51 focus formation, suggesting that Ino80 is required for the early steps of repair. Further analysis by using bromodeoxyuridine (BrdU)-labeled single-stranded DNA and replication protein A (RPA) immunofluorescent staining showed that INO80 mediates 5'-3' resection of double-strand break ends.

  2. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase

    PubMed Central

    Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.

    2014-01-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618

  3. Simultaneous binding to the tracking strand, displaced strand and the duplex of a DNA fork enhances unwinding by Dda helicase.

    PubMed

    Aarattuthodiyil, Suja; Byrd, Alicia K; Raney, Kevin D

    2014-10-01

    Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding.

  4. Retroviral nucleocapsid proteins possess potent nucleic acid strand renaturation activity.

    PubMed Central

    Dib-Hajj, F.; Khan, R.; Giedroc, D. P.

    1993-01-01

    The nucleocapsid protein (NC) is the major genomic RNA binding protein that plays integral roles in the structure and replication of all animal retroviruses. In this report, select biochemical properties of recombinant Mason-Pfizer monkey virus (MPMV) and HIV-1 NCs are compared. Evidence is presented that two types of saturated Zn2 NC-polynucleotide complexes can be formed under conditions of low [NaCl] that differ in apparent site-size (n = 8 vs. n = 14). The formation of one or the other complex appears dependent on the molar ratio of NC to RNA nucleotide with the putative low site-size mode apparently predominating under conditions of protein excess. Both MPMV and HIV-1 NCs kinetically facilitate the renaturation of two complementary DNA strands, suggesting that this is a general property of retroviral NCs. NC proteins increase the second-order rate constant for renaturation of a 149-bp DNA fragment by more than four orders of magnitude over that obtained in the absence of protein at 37 degrees C. The protein-assisted rate is 100-200-fold faster than that obtained at 68 degrees C, 1 M NaCl, solution conditions considered to be optimal for strand renaturation. Provided that sufficient NC is present to coat all strands, the presence of 400-1,000-fold excess nonhomologous DNA does not greatly affect the reaction rate. The HIV-1 NC-mediated renaturation reaction functions stoichiometrically, requiring a saturated strand of DNA nucleotide:NC ratio of about 7-8, rather than 14. Under conditions of less protein, the rate acceleration is not realized. The finding of significant nucleic acid strand renaturation activity may have important implications for various events of reverse transcription particularly in initiation and cDNA strand transfer. PMID:8443601

  5. Electrodeless dielectrophoresis of single- and double-stranded DNA.

    PubMed Central

    Chou, Chia-Fu; Tegenfeldt, Jonas O; Bakajin, Olgica; Chan, Shirley S; Cox, Edward C; Darnton, Nicholas; Duke, Thomas; Austin, Robert H

    2002-01-01

    Dielectrophoretic trapping of molecules is typically carried out using metal electrodes to provide high field gradients. In this paper we demonstrate dielectrophoretic trapping using insulating constrictions at far lower frequencies than are feasible with metallic trapping structures because of water electrolysis. We demonstrate that electrodeless dielectrophoresis (EDEP) can be used for concentration and patterning of both single-strand and double-strand DNA. A possible mechanism for DNA polarization in ionic solution is discussed based on the frequency, viscosity, and field dependence of the observed trapping force. PMID:12324434

  6. Negative-strand RNA viruses: applications to biotechnology.

    PubMed

    García-Sastre, A

    1998-05-01

    The establishment of reverse-genetics techniques to manipulate the genome of negative-strand RNA viruses has contributed enormously to a better understanding of the replication mechanisms and pathogenicity of this group of viruses. The generation of recombinant viruses bearing specific mutations in the coding and noncoding regions of their genomic RNAs now allows the functions in the replicative cycle of specific RNA regions and protein domains of these viruses to be studied. In addition, recombinant negative-strand RNA viruses can now be designed to have specific properties that make them attractive biotechnological tools.

  7. Crystal structure of four-stranded Oxytricha telomeric DNA

    NASA Technical Reports Server (NTRS)

    Kang, C.; Zhang, X.; Ratliff, R.; Moyzis, R.; Rich, A.

    1992-01-01

    The sequence d(GGGGTTTTGGGG) from the 3' overhang of the Oxytricha telomere has been crystallized and its three-dimensional structure solved to 2.5 A resolution. The oligonucleotide forms hairpins, two of which join to make a four-stranded helical structure with the loops containing four thymine residues at either end. The guanine residues are held together by cyclic hydrogen bonding and an ion is located in the centre. The four guanine residues in each segment have a glycosyl conformation that alternates between anti and syn. There are two four-stranded molecules in the asymmetric unit showing that the structure has some intrinsic flexibility.

  8. Partners and pathwaysrepairing a double-strand break.

    PubMed

    Haber, J E

    2000-06-01

    Double-strand chromosome breaks can arise in a number of ways, by ionizing radiation, by spontaneous chromosome breaks during DNA replication, or by the programmed action of endonucleases, such as in meiosis. Broken chromosomes can be repaired either by one of several homologous recombination mechanisms, or by a number of nonhomologous repair processes. Many of these pathways compete actively for the repair of a double-strand break. Which of these repair pathways is used appears to be regulated developmentally, genetically and during the cell cycle.

  9. Three dimensional FEM quench simulations of superconducting strands

    SciTech Connect

    Yamada, Ryuji; Wake, Masayoshi; /KEK, Tsukuba

    2005-09-01

    The detailed phenomena in quench starting of Nb{sub 3}Sn strands are simulated in 3-D and in time using ANSYS and FEMLAB programs. The current sharing between the superconductor and copper stabilizer in strands at the beginning of a quench was studied and displayed in time. The differences in copper configuration and RRR value of copper were found to have large effect to the stability and quench propagation velocity. The MPZ theory was found to be effective for 3D multifilament situation.

  10. Method for fabricating multi-strand superconducting cable

    DOEpatents

    Borden, A.R.

    1985-04-01

    Multi-strand superconducting cables adapted to be used, for example, to wind a magnet are fabricated by directing wire strands inwardly from spools disposed on the perimeter of a rotating disk and wrapping them diagonally around a tapered mandrel with a flattened cross-sectional shape with a core having a wedge-shaped channel. As the cable is pulled axially, flexibly coupled wedge-shaped pieces are continuously passed through the channel in the mandrel and inserted into the cable as an internal support therefor.

  11. Apparatus and method for fabricating multi-strand superconducting cable

    DOEpatents

    Borden, Albert R.

    1986-01-01

    Multi-strand superconducting cables adapted to be used, for example, to wind a magnet is fabricated by directing wire strands inwardly from spools disposed on the perimeter of a rotating disk and wrapping them diagonally around a tapered mandrel with a flattened cross-sectional shape with a core having a wedge-shaped channel. As the cable is pulled axially, flexibly coupled wedge-shaped pieces are continuously passed through the channel in the mandrel and inserted into the cable as an internal support therefor.

  12. Interaction of DAPI with double-stranded ribonucleic acids.

    PubMed Central

    Manzini, G; Xodo, L; Barcellona, M L; Quadrifoglio, F

    1985-01-01

    The interaction of DAPI with natural and synthetic double-stranded polyribonucleotides was studied with different optical and calorimetric methods. The results were similar to those obtained previously with double-stranded polydeoxynucleotides, i.e. two interaction modes, the first of which shows high affinity for AU clusters and consequent strong fluorescence enhancement. The results suggest caution in the use of DAPI as selective fluorescent staining agent for DNA in the presence of RNA. A narrow groove binding model with hydrogen bonds between DAPI and AU pairs is proposed. An intercalation mechanism can be excluded because of the non planarity of DAPI molecule. PMID:4080554

  13. DNA double-strand break repair in a cellular context.

    PubMed

    Shibata, A; Jeggo, P A

    2014-05-01

    Substantial insight into the mechanisms responding to DNA double-strand breaks has been gained from molecular, biochemical and structural approaches. Attention is now focusing on understanding the interplay between the pathways, how they interface through the cell cycle and the communication with other DNA transactions, such as replication and transcription. Understanding these aspects will facilitate an assessment of how cancer cells have modified these processes to achieve unlimited proliferative capacity and adaptability, and pave the way to identify targets suitable for therapy. Here, we briefly overview the processes responding to double-strand breaks and discuss our current understanding of their interplay in a cellular context.

  14. Industry participation workshop: Chromium electroplating of superconductor strand. Proceedings

    SciTech Connect

    1994-12-13

    The primary objective of the workshop was to inform US plating vendors about the opportunity to participate in the effort on Cr plating of large quantities of superconducting wires required for the ITER and the TPX projects and DOE`s interest in developing several reliable and high quality suppliers of Chromium plating services for the superconducting strand industry. The objective was also to inform plating vendors about the Cr plating technology developed in LLNL and invite interested plating vendors to get the technology. Finally the workshop was intended to inform the plating vendors about the plan to get verification of capability of two to four vendors for Cr plating of superconducting strands.

  15. Crystal structure of four-stranded Oxytricha telomeric DNA

    NASA Technical Reports Server (NTRS)

    Kang, C.; Zhang, X.; Ratliff, R.; Moyzis, R.; Rich, A.

    1992-01-01

    The sequence d(GGGGTTTTGGGG) from the 3' overhang of the Oxytricha telomere has been crystallized and its three-dimensional structure solved to 2.5 A resolution. The oligonucleotide forms hairpins, two of which join to make a four-stranded helical structure with the loops containing four thymine residues at either end. The guanine residues are held together by cyclic hydrogen bonding and an ion is located in the centre. The four guanine residues in each segment have a glycosyl conformation that alternates between anti and syn. There are two four-stranded molecules in the asymmetric unit showing that the structure has some intrinsic flexibility.

  16. Early Primary Invasion Scientists

    ERIC Educational Resources Information Center

    Spellman, Katie V.; Villano, Christine P.

    2011-01-01

    "We really need to get the government involved," said one student, holding his graph up to USDA scientist Steve Seefeldt. Dr. Steve studies methods to control "invasive" plants, plants that have been introduced to an area by humans and have potential to spread rapidly and negatively affect ecosystems. The first grader and his…

  17. Exotic invasive plants

    Treesearch

    Carolyn Hull Sieg; Barbara G. Phillips; Laura P. Moser

    2003-01-01

    Ecosystems worldwide are threatened by nonnative plant invasions that can cause undesirable, irreversible changes. They can displace native plants and animals, out-cross with native flora, alter nutrient cycling and other ecosystem functions, and even change an ecosystem's flammability (Walker and Smith 1997). After habitat loss, the spread of exotic species is...

  18. Early Primary Invasion Scientists

    ERIC Educational Resources Information Center

    Spellman, Katie V.; Villano, Christine P.

    2011-01-01

    "We really need to get the government involved," said one student, holding his graph up to USDA scientist Steve Seefeldt. Dr. Steve studies methods to control "invasive" plants, plants that have been introduced to an area by humans and have potential to spread rapidly and negatively affect ecosystems. The first grader and his…

  19. Minimally invasive valve surgery.

    PubMed

    Woo, Y Joseph

    2009-08-01

    Traditional cardiac valve replacement surgery is being rapidly supplanted by innovative, minimally invasive approaches toward the repair of these valves. Patients are experiencing benefits ranging from less bleeding and pain to faster recovery and greater satisfaction. These operations are proving to be safe, highly effective, and durable, and their use will likely continue to increase and become even more widely applicable.

  20. Mechanisms regulating glioma invasion.

    PubMed

    Paw, Ivy; Carpenter, Richard C; Watabe, Kounosuke; Debinski, Waldemar; Lo, Hui-Wen

    2015-06-28

    Glioblastoma (GBM) is the most aggressive, deadliest, and most common brain malignancy in adults. Despite the advances made in surgical techniques, radiotherapy and chemotherapy, the median survival for GBM patients has remained at a mere 14 months. GBM poses several unique challenges to currently available treatments for the disease. For example, GBM cells have the propensity to aggressively infiltrate/invade into the normal brain tissues and along the vascular tracks, which prevents complete resection of all malignant cells and limits the effect of localized radiotherapy while sparing normal tissue. Although anti-angiogenic treatment exerts anti-edematic effect in GBM, unfortunately, tumors progress with acquired increased invasiveness. Therefore, it is an important task to gain a deeper understanding of the intrinsic and post-treatment invasive phenotypes of GBM in hopes that the gained knowledge would lead to novel GBM treatments that are more effective and less toxic. This review will give an overview of some of the signaling pathways that have been shown to positively and negatively regulate GBM invasion, including, the PI3K/Akt, Wnt, sonic hedgehog-GLI1, and microRNAs. The review will also discuss several approaches to cancer therapies potentially altering GBM invasiveness. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  1. Invasion percolation with memory

    SciTech Connect

    Kharabaf, H.; Yortsos, Y.C.

    1997-06-01

    Motivated by the problem of finding the minimum threshold path (MTP) in a lattice of elements with random thresholds {tau}{sub i}, we propose a new class of invasion processes, in which the front advances by minimizing or maximizing the measure S{sub n}={summation}{sub i}{tau}{sub i}{sup n} for real n. This rule assigns long-time memory to the invasion process. If the rule minimizes S{sub n} (case of minimum penalty), the fronts are stable and connected to invasion percolation in a gradient [J. P. Hulin, E. Clement, C. Baudet, J. F. Gouyet, and M. Rosso, Phys. Rev. Lett. {bold 61}, 333 (1988)] but in a correlated lattice, with invasion percolation [D. Wilkinson and J. F. Willemsen, J. Phys. A {bold 16}, 3365 (1983)] recovered in the limit {vert_bar}n{vert_bar}={infinity}. For small n, the MTP is shown to be related to the optimal path of the directed polymer in random media (DPRM) problem [T. Halpin-Healy and Y.-C. Zhang, Phys. Rep. {bold 254}, 215 (1995)]. In the large n limit, however, it reduces to the backbone of a mixed site-bond percolation cluster. The algorithm allows for various properties of the MTP and the DPRM to be studied. In the unstable case (case of maximum gain), the front is a self-avoiding random walk. {copyright} {ital 1997} {ital The American Physical Society}

  2. Biogeography of plant invasions

    Treesearch

    Dean Pearson; Yvette Ortega

    2013-01-01

    The fact that most of our worst animal and weed pests come from other continents is no coincidence. Biological invasions are fundamentally a biogeographic phenomenon. That is to say, there is something rather significant about taking an organism from a specific evolutionary history and ecological context and casting it into an entirely new environment that can...

  3. A recombinase paralog from the hyperthermophilic crenarchaeon Sulfolobus solfataricus enhances SsoRadA ssDNA binding and strand displacement.

    PubMed

    Graham, William J; Haseltine, Cynthia A

    2013-02-15

    Homologous recombination (HR) is a major pathway for the repair of double-strand DNA breaks, a highly deleterious form of DNA damage. The main catalytic protein in HR is the essential RecA-family recombinase, which is conserved across all three domains of life. Eukaryotes and archaea encode varying numbers of proteins paralogous to their main recombinase. Although there is increasing evidence for the functions of some of these paralog proteins, overall their mechanism of action remains largely unclear. Here we present the first biochemical characterization of one of the paralog proteins, SsoRal3, from the crenarchaeaon Sulfolobus solfataricus. The SsoRal3 protein is a ssDNA-dependent ATPase that can catalyze strand invasion at both saturating and subsaturating concentrations. It can bind both ssDNA and dsDNA, but its binding preference is altered by the presence or absence of ATP. Addition of SsoRal3 to SsoRadA nucleoprotein filaments reduces total ATPase activity. Subsaturating concentrations of SsoRal3 increase the ssDNA binding activity of SsoRadA approximately 9-fold and also increase the persistence of SsoRadA catalyzed strand invasion products. Overall, these results suggest that SsoRal3 functions to stabilize the SsoRadA presynaptic filament. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Hop2 and Sae3 Are Required for Dmc1-Mediated Double-Strand Break Repair via Homolog Bias during Meiosis

    PubMed Central

    Cho, Hong-Rae; Kong, Yoon-Ju; Hong, Soo-Gil; Kim, Keun Pil

    2016-01-01

    During meiosis, exchange of DNA segments occurs between paired homologous chromosomes in order to produce recombinant chromosomes, helping to increase genetic diversity within a species. This genetic exchange process is tightly controlled by the eukaryotic RecA homologs Rad51 and Dmc1, which are involved in strand exchange of meiotic recombination, with Rad51 participating specifically in mitotic recombination. Meiotic recombination requires an interaction between homologous chromosomes to repair programmed double-strand breaks (DSBs). In this study, we investigated the budding yeast meiosis-specific proteins Hop2 and Sae3, which function in the Dmc1-dependent pathway. This pathway mediates the homology searching and strand invasion processes. Mek1 kinase participates in switching meiotic recombination from sister bias to homolog bias after DSB formation. In the absence of Hop2 and Sae3, DSBs were produced normally, but showed defects in the DSB-to-single-end invasion transition mediated by Dmc1 and auxiliary factors, and mutant strains failed to complete proper chromosome segregation. However, in the absence of Mek1 kinase activity, Rad51-dependent recombination progressed via sister bias in the hop2Δ or sae3Δ mutants, even in the presence of Dmc1. Thus, Hop2 and Sae3 actively modulate Dmc1-dependent recombination, effectively progressing homolog bias, a process requiring Mek1 kinase activation. PMID:27329041

  5. Invasion of the hybrids.

    PubMed

    Hegarty, M J

    2012-10-01

    Human activity and climate change are increasingly driving species, which were once separate together, leading to the potential for gene flow. Hybridization between diverged species brings together two genomes which have evolved to meet different adaptive requirements. The unique combination of these traits in a hybrid may be beneficial or maladaptive, but either way it results in increased phenotypic variation. A percentage of hybrid individuals may, therefore, find themselves able to exploit environmental niches which their progenitors cannot, leading to invasive hybrid swarms becoming established in new habitats. Previous research into hybrids, most famously that of Loren Rieseberg and co-workers (Rieseberg et al. 1999, 2003) in sunflowers, demonstrated that hybridization can give rise to transgressive segregation of adaptive traits, wherein the combination of favourable alleles from both parents in hybrids can enable them to outperform either. However, the question still remains as to how much of the competitive ability of hybrids is a direct result of admixture and how much is the result of selection after the fact. In this issue of Molecular Ecology, (Czypionka et al. 2012) describe their study of transcriptional changes resulting from hybridization in a fish hybrid termed invasive sculpins (Cottus). Using gene expression microarray assays, they compare gene expression in both wild and lab-reared invasive hybrids to the progenitor species and experimentally produced F(2) hybrids. They demonstrate that whilst hybridization alone does result in higher variance in gene expression (some of which is transgressive), many of the transgressive changes distinguishing the invasives appear to have come about subsequent to the initial natural hybridization event. They speculate that initial success of the hybrids in their new habitat is facilitated by hybridization, but that optimization of the invasive phenotype and removal of maladaptive traits rapidly reduces the

  6. Gene conversion and deletion frequencies during double-strand break repair in human cells are controlled by the distance between direct repeats.

    PubMed

    Schildkraut, Ezra; Miller, Cheryl A; Nickoloff, Jac A

    2005-01-01

    Homologous recombination (HR) repairs DNA double-strand breaks and maintains genome stability. HR between linked, direct repeats can occur by gene conversion without an associated crossover that maintains the gross repeat structure. Alternatively, direct repeat HR can occur by gene conversion with a crossover, or by single-strand annealing (SSA), both of which delete one repeat and the sequences between the repeats. Prior studies of different repeat structures in yeast and mammalian cells revealed disparate conversion:deletion ratios. Here, we show that a key factor controlling this ratio is the distance between the repeats, with conversion frequency increasing linearly with the distances from 850 to 3800 bp. Deletions are thought to arise primarily by SSA, which involves extensive end-processing to reveal complementary single-strands in each repeat. The results can be explained by a model in which strand-invasion leading to gene conversion competes more effectively with SSA as more extensive end-processing is required for SSA. We hypothesized that a transcription unit between repeats would inhibit end-processing and SSA, thereby increasing the fraction of conversions. However, conversion frequencies were identical for direct repeats separated by 3800 bp of transcriptionally silent or active DNA, indicating that end-processing and SSA are not affected by transcription.

  7. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    PubMed Central

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the single-stranded RNA changes during exponential and stationary phases of cell growth in a fashion consistent with a viral replicative intermediate or mRNA. The single-stranded species does not appear to be polyadenylated. Images PMID:2798099

  8. Characterization of Nb3Sn Strand for ITER

    SciTech Connect

    Cheggour, Najib; Goodrich, Loren F

    2012-05-03

    We have an ongoing research program for characterization of superconductor composite strands, the principal output of which is sensitive measurements of critical current Ic over a broad range of the essential parameters: longitudinal strain µ, temperature T, and magnetic field B. This features a new apparatus for integrated measurement of Ic(µ,T,B) on the same, long-conductor sample without remounting.

  9. Temperature dependence of unbinding forces between complementary DNA strands.

    PubMed

    Schumakovitch, Irina; Grange, Wilfried; Strunz, Torsten; Bertoncini, Patricia; Güntherodt, Hans-Joachim; Hegner, Martin

    2002-01-01

    Force probe techniques such as atomic force microscopy can directly measure the force required to rupture single biological ligand receptor bonds. Such forces are related to the energy landscape of these weak, noncovalent biological interactions. We report unbinding force measurements between complementary strands of DNA as a function of temperature. Our measurements emphasize the entropic contributions to the energy landscape of the bond.

  10. Euler buckling and nonlinear kinking of double-stranded DNA

    PubMed Central

    Fields, Alexander P.; Meyer, Elisabeth A.; Cohen, Adam E.

    2013-01-01

    The bending stiffness of double-stranded DNA (dsDNA) at high curvatures is fundamental to its biological activity, yet this regime has been difficult to probe experimentally, and literature results have not been consistent. We created a ‘molecular vise’ in which base-pairing interactions generated a compressive force on sub-persistence length segments of dsDNA. Short dsDNA strands (<41 base pairs) resisted this force and remained straight; longer strands became bent, a phenomenon called ‘Euler buckling’. We monitored the buckling transition via Förster Resonance Energy Transfer (FRET) between appended fluorophores. For low-to-moderate concentrations of monovalent salt (up to ∼150 mM), our results are in quantitative agreement with the worm-like chain (WLC) model of DNA elasticity, without the need to invoke any ‘kinked’ states. Greater concentrations of monovalent salts or 1 mM Mg2+ induced an apparent softening of the dsDNA, which was best accounted for by a kink in the region of highest curvature. We tested the effects of all single-nucleotide mismatches on the DNA bending. Remarkably, the propensity to kink correlated with the thermodynamic destabilization of the mismatched DNA relative the perfectly complementary strand, suggesting that the kinked state is locally melted. The molecular vise is exquisitely sensitive to the sequence-dependent linear and nonlinear elastic properties of dsDNA. PMID:23956222

  11. The Extra Strand of the Maori Science Curriculum

    ERIC Educational Resources Information Center

    Stewart, Georgina

    2011-01-01

    This paper comments on the process of re-development of the Maori-medium Science (Putaiao) curriculum, as part of overall curriculum development in Aotearoa New Zealand. A significant difference from the English Science curriculum was the addition of an "extra strand" covering the history and philosophy of science. It is recommended that…

  12. Solid phase sequencing of double-stranded nucleic acids

    DOEpatents

    Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.

    2002-01-01

    This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.

  13. Data centers as dispatchable loads to harness stranded power

    DOE PAGES

    Kim, Kibaek; Yang, Fan; Zavala, Victor M.; ...

    2016-07-20

    Here, we analyze how traditional data center placement and optimal placement of dispatchable data centers affect power grid efficiency. We use detailed network models, stochastic optimization formulations, and diverse renewable generation scenarios to perform our analysis. Our results reveal that significant spillage and stranded power will persist in power grids as wind power levels are increased. A counter-intuitive finding is that collocating data centers with inflexible loads next to wind farms has limited impacts on renewable portfolio standard (RPS) goals because it provides limited system-level flexibility. Such an approach can, in fact, increase stranded power and fossil-fueled generation. In contrast,more » optimally placing data centers that are dispatchable provides system-wide flexibility, reduces stranded power, and improves efficiency. In short, optimally placed dispatchable computing loads can enable better scaling to high RPS. In our case study, we find that these dispatchable computing loads are powered to 60-80% of their requested capacity, indicating that there are significant economic incentives provided by stranded power.« less

  14. Antiparallel Triple-strand Architecture for Prefibrillar Aβ42 Oligomers*

    PubMed Central

    Gu, Lei; Liu, Cong; Stroud, James C.; Ngo, Sam; Jiang, Lin; Guo, Zhefeng

    2014-01-01

    Aβ42 oligomers play key roles in the pathogenesis of Alzheimer disease, but their structures remain elusive partly due to their transient nature. Here, we show that Aβ42 in a fusion construct can be trapped in a stable oligomer state, which recapitulates characteristics of prefibrillar Aβ42 oligomers and enables us to establish their detailed structures. Site-directed spin labeling and electron paramagnetic resonance studies provide structural restraints in terms of side chain mobility and intermolecular distances at all 42 residue positions. Using these restraints and other biophysical data, we present a novel atomic-level oligomer model. In our model, each Aβ42 protein forms a single β-sheet with three β-strands in an antiparallel arrangement. Each β-sheet consists of four Aβ42 molecules in a head-to-tail arrangement. Four β-sheets are packed together in a face-to-back fashion. The stacking of identical segments between different β-sheets within an oligomer suggests that prefibrillar oligomers may interconvert with fibrils via strand rotation, wherein β-strands undergo an ∼90° rotation along the strand direction. This work provides insights into rational design of therapeutics targeting the process of interconversion between toxic oligomers and non-toxic fibrils. PMID:25118290

  15. Data centers as dispatchable loads to harness stranded power

    SciTech Connect

    Kim, Kibaek; Yang, Fan; Zavala, Victor M.; Chien, Andrew A.

    2016-07-20

    Here, we analyze how traditional data center placement and optimal placement of dispatchable data centers affect power grid efficiency. We use detailed network models, stochastic optimization formulations, and diverse renewable generation scenarios to perform our analysis. Our results reveal that significant spillage and stranded power will persist in power grids as wind power levels are increased. A counter-intuitive finding is that collocating data centers with inflexible loads next to wind farms has limited impacts on renewable portfolio standard (RPS) goals because it provides limited system-level flexibility. Such an approach can, in fact, increase stranded power and fossil-fueled generation. In contrast, optimally placing data centers that are dispatchable provides system-wide flexibility, reduces stranded power, and improves efficiency. In short, optimally placed dispatchable computing loads can enable better scaling to high RPS. In our case study, we find that these dispatchable computing loads are powered to 60-80% of their requested capacity, indicating that there are significant economic incentives provided by stranded power.

  16. The Ideological "Strands" of the 5-14 Educational Narrative.

    ERIC Educational Resources Information Center

    McAllister, John

    1993-01-01

    The Scottish 5-14 master educational narrative prescribes a rigid framework for curricular policies and planning. The ideological strands of 5-14 present education as a business, promote the maintenance of a common culture, and attack teacher professionalism. Argues that the program should be seen as a means of control over the practice and…

  17. Guide Strand 3'-End Modifications Regulate siRNA Specificity.

    PubMed

    Valenzuela, Rachel A P; Onizuka, Kazumitsu; Ball-Jones, Alexi A; Hu, Tiannan; Suter, Scott R; Beal, Peter A

    2016-12-14

    Short interfering RNA (siRNA)-triggered gene knockdown through the RNA interference (RNAi) pathway is widely used to study gene function, and siRNA-based therapeutics are in development. However, as the guide strand of an siRNA can function like a natural microRNA (miRNA), siRNAs often repress hundreds of off-target transcripts with complementarity only to the seed region (nucleotides 2-8) of the guide strand. Here, we describe novel guide strand 3'-end modifications derived from 1-ethynylribose (1-ER) and copper-catalyzed azide-alkyne cycloaddition reactions and evaluate their impact on target versus miRNA-like off-target knockdown. Surprisingly, when positioned at the guide strand 3'-end, the parent 1-ER modification substantially reduced off-target knockdown while having no measurable effect on on-target knockdown potency. In addition, these modifications were shown to modulate siRNA affinity for the hAgo2 PAZ domain. However, the change in PAZ domain binding affinity was not sufficient to predict the modification's effect on miRNA-like off targeting.

  18. Targeting DNA double-strand breaks with TAL effector nucleases.

    PubMed

    Christian, Michelle; Cermak, Tomas; Doyle, Erin L; Schmidt, Clarice; Zhang, Feng; Hummel, Aaron; Bogdanove, Adam J; Voytas, Daniel F

    2010-10-01

    Engineered nucleases that cleave specific DNA sequences in vivo are valuable reagents for targeted mutagenesis. Here we report a new class of sequence-specific nucleases created by fusing transcription activator-like effectors (TALEs) to the catalytic domain of the FokI endonuclease. Both native and custom TALE-nuclease fusions direct DNA double-strand breaks to specific, targeted sites.

  19. Euler buckling and nonlinear kinking of double-stranded DNA.

    PubMed

    Fields, Alexander P; Meyer, Elisabeth A; Cohen, Adam E

    2013-11-01

    The bending stiffness of double-stranded DNA (dsDNA) at high curvatures is fundamental to its biological activity, yet this regime has been difficult to probe experimentally, and literature results have not been consistent. We created a 'molecular vise' in which base-pairing interactions generated a compressive force on sub-persistence length segments of dsDNA. Short dsDNA strands (<41 base pairs) resisted this force and remained straight; longer strands became bent, a phenomenon called 'Euler buckling'. We monitored the buckling transition via Förster Resonance Energy Transfer (FRET) between appended fluorophores. For low-to-moderate concentrations of monovalent salt (up to ∼150 mM), our results are in quantitative agreement with the worm-like chain (WLC) model of DNA elasticity, without the need to invoke any 'kinked' states. Greater concentrations of monovalent salts or 1 mM Mg(2+) induced an apparent softening of the dsDNA, which was best accounted for by a kink in the region of highest curvature. We tested the effects of all single-nucleotide mismatches on the DNA bending. Remarkably, the propensity to kink correlated with the thermodynamic destabilization of the mismatched DNA relative the perfectly complementary strand, suggesting that the kinked state is locally melted. The molecular vise is exquisitely sensitive to the sequence-dependent linear and nonlinear elastic properties of dsDNA.

  20. Wavelength-selective light-triggered strand exchange reaction.

    PubMed

    Morihiro, K; Kodama, T; Mori, S; Tsunoda, S; Obika, S

    2016-02-07

    We prepared an oligodeoxynucleotide (ODN) bearing two 4-hydroxy-2-mercaptobenzimidazole nucleobase analogues (SB(NV) and SB(NB)) modified with different photolabile groups. This ODN enabled a light-triggered strand exchange reaction in a wavelength-selective manner.

  1. On the Distinction between Preposition Stranding and Orphan Prepositions

    ERIC Educational Resources Information Center

    Roberge, Yves

    2012-01-01

    Poplack, Zentz and Dion (PZD; Poplack, Zentz & Dion, 2011, this issue) examine the often unquestioned assumption that the existence of preposition stranding (PS) in Canadian French is linked to the presence of a contact situation with English in the North American context. Although this issue has been the topic of previous research from a…

  2. On the Distinction between Preposition Stranding and Orphan Prepositions

    ERIC Educational Resources Information Center

    Roberge, Yves

    2012-01-01

    Poplack, Zentz and Dion (PZD; Poplack, Zentz & Dion, 2011, this issue) examine the often unquestioned assumption that the existence of preposition stranding (PS) in Canadian French is linked to the presence of a contact situation with English in the North American context. Although this issue has been the topic of previous research from a…

  3. Applications of Strand-Specific in situ Hybridization

    SciTech Connect

    Goodwin, E.H.; Meyne, J.; Bailey, S.M.; Quigley, D.; Smith, L.; Tennyson, R.

    1997-01-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). Fluorescence in situ hybridization (FISH) is used to determine the location of specific DNA sequences on chromosomes. It is an effective tool in genomic mapping and is finding increasing use in medical diagnosis. A ''strand-specific'' version of FISH has been developed in the Life Sciences Division of LANL. The new procedure, named CO-FISH, reveals not only location but also the 5'-to-3'direction of a target sequence, such as the sense strand of a gene. This project was designed to investigate applications of the new technique. Strand-specific FISH was found to be useful and informative for genomic mapping of repetitive DNA sequences. The method provide a valuable new tool for investigating the mechanisms of aneuploidy inducing agents and the cytogenetic phenomena called lateral asymmetry. Finally, using strand-specific FISH, the authors were able to detect certain types of chromosome aberrations (isochromosomes, inversions and Robertsonian translocations) that can be difficult to observe with standard techniques.

  4. Dissipation of double-stranded RNA in aquatic microcosms

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) represents the next wave of pest management technologies. RNAi is initiated by double-stranded RNAs (dsRNA) that are ingested by the target pest and cleaved into small-interfering RNAs that silence a molecular target in the pest. Similar to Cry proteins, dsRNAs are being deve...

  5. The Ideological "Strands" of the 5-14 Educational Narrative.

    ERIC Educational Resources Information Center

    McAllister, John

    1993-01-01

    The Scottish 5-14 master educational narrative prescribes a rigid framework for curricular policies and planning. The ideological strands of 5-14 present education as a business, promote the maintenance of a common culture, and attack teacher professionalism. Argues that the program should be seen as a means of control over the practice and…

  6. RNA STRAND: the RNA secondary structure and statistical analysis database.

    PubMed

    Andronescu, Mirela; Bereg, Vera; Hoos, Holger H; Condon, Anne

    2008-08-13

    The ability to access, search and analyse secondary structures of a large set of known RNA molecules is very important for deriving improved RNA energy models, for evaluating computational predictions of RNA secondary structures and for a better understanding of RNA folding. Currently there is no database that can easily provide these capabilities for almost all RNA molecules with known secondary structures. In this paper we describe RNA STRAND - the RNA secondary STRucture and statistical ANalysis Database, a curated database containing known secondary structures of any type and organism. Our new database provides a wide collection of known RNA secondary structures drawn from public databases, searchable and downloadable in a common format. Comprehensive statistical information on the secondary structures in our database is provided using the RNA Secondary Structure Analyser, a new tool we have developed to analyse RNA secondary structures. The information thus obtained is valuable for understanding to which extent and with which probability certain structural motifs can appear. We outline several ways in which the data provided in RNA STRAND can facilitate research on RNA structure, including the improvement of RNA energy models and evaluation of secondary structure prediction programs. In order to keep up-to-date with new RNA secondary structure experiments, we offer the necessary tools to add solved RNA secondary structures to our database and invite researchers to contribute to RNA STRAND. RNA STRAND is a carefully assembled database of trusted RNA secondary structures, with easy on-line tools for searching, analyzing and downloading user selected entries, and is publicly available at http://www.rnasoft.ca/strand.

  7. Strand-Specific Transcriptome Sequencing Using SMART Technology.

    PubMed

    Bostick, Magnolia; Bolduc, Nathalie; Lehman, Alisa; Farmer, Andrew

    2016-10-10

    Next-generation sequencing is empowering a deeper understanding of biology by enabling RNA expression analysis over the entire transcriptome with high sensitivity and a wide dynamic range. One powerful application within this field is stranded RNA sequencing (RNA-seq), which is necessary to distinguish overlapping genes and to conduct comprehensive annotation and quantification of long non-coding RNAs. Commonly used methods for generating strand-specific RNA-seq libraries are often complicated by protocols that require several rounds of enzymatic treatments and clean-up steps, making them time-intensive, insensitive, and unsuitable for processing several samples simultaneously. An additional challenge in the generation of RNA-seq libraries from total RNA involves the high amount of ribosomal RNA (rRNA) in the starting material. This unit presents streamlined workflows for generating strand-specific RNA-seq libraries from 10 ng to 1 µg total RNA, representing a minimum of 1000 cells, in less than 7 hr with minimal carryover rRNA. These methods allow scientists to evaluate the expression of all transcripts, including non-polyadenylated long non-coding RNAs, even in limited biological samples. Combination of the RNase H-based RiboGone rRNA removal system and SMARTer Stranded RNA-seq technology enables depletion of over 95% of rRNA from mammalian samples, and direct production of Illumina-ready libraries that maintain strand-of-origin information. An alternate method for low input of highly degraded samples is also presented. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  8. Characterization of a parallel-stranded DNA hairpin

    SciTech Connect

    Germann, M.W.; Vogel, H.J.; Pon, R.T.; van de Sande, J.H. )

    1989-07-25

    Recently, the authors have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure. In the present study, they have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3{prime}-d(T){sub 8}C{sub 4}(A){sub 8}-3{prime} and the related antiparallel (APS) hair 5{prime}-d(T){sub 8}C{sub 4}(A){sub 8}-3{prime}. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5{prime}-5{prime} phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. {sup 31}P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. On the basis of NOESY measurements, they find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2{prime}-endo range. The results indicate a B-like conformation for each of the strands in the stem part of the PS hairpin and reverse Watson-Crick base pairing between the T and A residues. These data are consistent with a previously calculated structure for parallel-stranded DNA.

  9. Biogeography of Mediterranean Invasions

    NASA Astrophysics Data System (ADS)

    Groves, R. H.; di Castri, F.

    The Mediterranean basin, California, Chile, the western Cape of South Africa, and southern Australia share a Mediterranean climate characterized by cool, wet winters and hot, dry summers. These five regions have differing patterns of human settlement, but similarities in natural vegetation and some faunal assemblages. These likenesses are enhanced with time by an increasing level of biotic exchange among the regions. An initiative of a subcommittee of SCOPE (Scientific Committee on Problems of the Environment), which realized that the integrity of many natural ecosystems is being threatened by the ingress of invasive species, this book uniquely documents the introduced floras and faunas, especially plants, buds, and mammals, in these five regions of Mediterranean climate, and aims to increase our understanding of the ecology of biological invasions. In doing so, it points a way to more effectively manage the biota of these regions.

  10. Distinct roles for the RSC and Swi/Snf ATP-dependent chromatin remodelers in DNA double-strand break repair.

    PubMed

    Chai, Bob; Huang, Jian; Cairns, Bradley R; Laurent, Brehon C

    2005-07-15

    The failure of cells to repair damaged DNA can result in genomic instability and cancer. To efficiently repair chromosomal DNA lesions, the repair machinery must gain access to the damaged DNA in the context of chromatin. Here we report that both the RSC and Swi/Snf ATP-dependent chromatin-remodeling complexes play key roles in double-strand break (DSB) repair, specifically by homologous recombination (HR). RSC and Swi/Snf are each recruited to an in vivo DSB site but with distinct kinetics. We show that Swi/Snf is required earlier, at or preceding the strand invasion step of HR, while RSC is required following synapsis for completion of the recombinational repair event.

  11. [Emerging invasive fungal infections].

    PubMed

    Alvez, F; Figueras, C; Roselló, E

    2010-07-01

    The frequency and diversity of invasive fungal infections has changed over the last 25 years. The emergence of less common, but medically important fungi has increased, and the children at risk has expanded, with the inclusion of medical conditions such as cancer, mainly haematological malignancy or stem cell transplant, immunosuppressive therapy, prolonged neutropenia, and T-cell immunodeficiency. Among mould infections, fusariosis and phaeohyphomycosis (Dematiaceous fungi) have been increasingly reported in this group of patients. To successfully manage these challenging infections, it is imperative that paediatricians and sub-specialists remain aware of the optimal and timely diagnosis and therapeutic options. Unlike other common mycoses that cause human disease, there no simple antigen or serological tests available to detect these pathogens in tissue or blood. The outcome for these disseminate, and often refractory fungal infections in neutropenic patients and transplant recipients remains extremely poor, requiring early and aggressive therapy. Unfortunately there are no guidelines outlining the choices for optimal therapy in the treatment of paediatric invasive fungal infections do not exist, and on the other hand are limited paediatric data available comparing antifungal agents in children with proven, probable or suspected invasive fungal infection. The options for treatment rest mainly on some adult guidelines that comment on the treatment of these emerging and uncommon important fungi in children. Despite the sparse clinical trials available on treatment and its poor outcome, options for treatment of invasive fungal infections have increased with the advance of new antifungal agents, with improved tolerability and increased range of activity. The epidemiology, clinical manifestations, diagnosis and treatment of fusariosis and phaeohyphomycosis are discussed in this article.

  12. USGS invasive species solutions

    USGS Publications Warehouse

    Simpson, Annie

    2011-01-01

    Land managers must meet the invasive species challenge every day, starting with identification of problem species, then the collection of best practices for their control, and finally the implementation of a plan to remove the problem. At each step of the process, the availability of reliable information is essential to success. The U.S. Geological Survey (USGS) has developed a suite of resources for early detection and rapid response, along with data management and sharing.

  13. Stability of DNA-linked nanoparticle crystals: Effect of number of strands, core size, and rigidity of strand attachment

    NASA Astrophysics Data System (ADS)

    Padovan-Merhar, Olivia; Lara, Fernando Vargas; Starr, Francis W.

    2011-06-01

    Three-dimensional ordered lattices of nanoparticles (NPs) linked by DNA have potential applications in novel devices and materials, but most experimental attempts to form crystals result in amorphous packing. Here we use a coarse-grained computational model to address three factors that impact the stability of bcc and fcc crystals formed by DNA-linked NPs : (i) the number of attached strands to the NP surface, (ii) the size of the NP core, and (iii) the rigidity of the strand attachment. We find that allowing mobility in the attachment of DNA strands to the core NP can very slightly increase or decrease melting temperature TM. Larger changes to TM result from increasing the number of strands, which increases TM, or by increasing the core NP diameter, which decreases TM. Both results are consistent with experimental findings. Moreover, we show that the behavior of TM can be quantitatively described by the model introduced previously [F. Vargas Lara and F. W. Starr, Soft Matter, 7, 2085 (2011)], 10.1039/c0sm00989j.

  14. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    DTIC Science & Technology

    2013-09-30

    prepared and submitted to the Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in 3 New Zealand . Dr...component analysis. Springer, Berlin Heidelberg New York). Data collected from the calibration study (Aim 1), from stranded animals (Aim 2), from...Fraser, W. (1990). Complement activation involvement in decompression sickness of rabbits . Undersea Biomed Res. 17, 51-66.

  15. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA

    PubMed Central

    Wierer, Sebastian; Daldrop, Peter; Ud Din Ahmad, Misbha; Boos, Winfried; Drescher, Malte; Welte, Wolfram; Seidel, Ralf

    2016-01-01

    In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption) and the single-stranded (after disruption) DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure. PMID:27214207

  16. [Minimally invasive thymus surgery].

    PubMed

    Rückert, J C; Ismail, M; Swierzy, M; Braumann, C; Badakhshi, H; Rogalla, P; Meisel, A; Rückert, R I; Müller, J M

    2008-01-01

    There are absolute and relative indications for complete removal of the thymus gland. In the complex therapy of autoimmune-related myasthenia gravis, thymectomy plays a central role and is performed with relative indication. In case of thymoma with or without myasthenia, thymectomy is absolutely indicated. Thymus resection is further necessary for cases of hyperparathyroidism with ectopic intrathymic parathyroids or with certain forms of multiple endocrine neoplasia. The transcervical operation technique traditionally reflected the well-founded desire for minimal invasiveness for thymectomy. Due to the requirement of radicality however, most of these operations were performed using sternotomy. With the evolution of therapeutic thoracoscopy in thoracic surgery, several pure or extended minimally invasive operation techniques for thymectomy have been developed. At present uni- or bilateral, subxiphoid, and modified transcervical single or combination thoracoscopic techniques are in use. Recently a very precise new level of thoracoscopic operation technique was developed using robotic-assisted surgery. There are special advantages of this technique for thymectomy. An overview of the development and experiences with minimally invasive thymectomy is presented, including data from the largest series published so far.

  17. Detection of bacteriophage phi 6 minus-strand RNA and novel mRNA isoconformers synthesized in vivo and in vitro, by strand-separating agarose gels

    SciTech Connect

    Pagratis, N.; Revel, H.R. )

    1990-07-01

    Two urea-free agarose gel protocols that resolve the six individual strands of bacteriophage phi 6 dsRNA were developed and used to analyze phage RNA synthesis in vivo and in vitro. Citrate gels separate strands of the large and medium chromosomes while Tris-borate-EDTA (TBE) gels resolve the medium and small dsRNA segments. Minus strands migrate faster than plus strands on citrate gels but are retarded on TBE gels. A study of electrophoretic conditions showed that pH affects strand resolution on citrate gels, and that voltage gradient, agarose concentration, and ethidium bromide significantly alter strand migration on TBE gels. Analysis of native phi 6 RNA synthesized in vivo and in vitro showed that the large and medium message RNAs comigrate with the corresponding plus strands of denatured virion dsRNA. The small messenger RNA is exceptional. Native small mRNA was detected as three isoconformers in vivo and in vitro. The isoconformers were converted by heat denaturation to a single RNA species that comigrates with the virion s+ strand. Minus strands labeled in vivo were detected only after heat denaturation. Minus strand synthesis was detected also in heat-denatured samples from in vitro phi 6 nucleocapsid RNA polymerase reactions at pH values suboptimal for transcription.

  18. Homologous recombination between single-stranded DNA and chromosomal genes in Saccharomyces cerevisiae.

    PubMed Central

    Simon, J R; Moore, P D

    1987-01-01

    Transformation of Saccharomyces cerevisiae strains was examined by using the URA3 and TRP1 genes cloned into M13 vectors in the absence of sequences capable of promoting autonomous replication. These constructs transform S. cerevisiae cells to prototrophy by homologous recombination with the resident mutant gene. Single-stranded DNA was found to transform S. cerevisiae cells at efficiencies greater than that of double-stranded DNA. No conversion of single-stranded transforming DNA into duplex forms could be detected during the transformation process, and we conclude that single-stranded DNA may participate directly in recombination with chromosomal sequences. Transformation with single-stranded DNA gave rise to both gene conversion and reciprocal exchange events. Cotransformation with competing heterologous single-stranded DNA specifically inhibited transformation by single-stranded DNA, suggesting that one of the components in the transformation-recombination process has a preferential affinity for single-stranded DNA. Images PMID:3302673

  19. Measurements of current distribution in a 12-strand Nb 3Sn cable-in-conduit conductor

    NASA Astrophysics Data System (ADS)

    Vysotsky, Vitaly S.; Takayasu, Makoto; Jeong, Sangkwon; Michael, Philip C.; Schultz, Joel H.; Minervini, Joseph V.

    Experiments were performed to measure directly the current in each strand of a 12-strand Nb 3Sn cable-in-conduit superconductor during current and/or external magnetic field ramps. The goal of the experiment was to get straightforward evidence of current maldistribution in a cable-in-conduit conductor (CICC). A heavily instrumented sample coil from Nb 3Sn TPX-TF strands was specially prepared. Severe non-uniformity of the strand currents were found during field ramp. Immediately before a quench the individual strand currents within a triplet differed by as much as an order of magnitude. During field ramps with constant transport current, the currents in some strands were observed to drop rapidly and then recover. The data show that quench development in the CICC is a complicated phenomenon involving dynamic redistribution of current among the strands. Non-uniformity of current along the strands during quench was also observed.

  20. The invariance of the total direct DNA strand break yield

    SciTech Connect

    Bernal, M. A.; Almeida, C. E. de; Sampaio, C.; Incerti, S.; Champion, C.; Nieminen, P.

    2011-07-15

    Purpose: The invariance of the total direct strand break yield when DNA is irradiated by different types of particles and energies has been reported by previous works. This study is intended to explain the physical causes of this behavior. Methods: The geant4-dna extension of the geant4 general purpose Monte Carlo simulation toolkit has been used to determine direct strand break yields induced by protons and alpha particles impacting on a B-DNA geometrical model, including five organization levels of the human genetic material. The linear energy transfer (LET) of such particles ranges from 4.8 keV/{mu}m (10 MeV protons) to about 235 keV/{mu}m (2 MeV alpha particles), at 5.225 {mu}m depth (near the center of the region of interest). Direct total, single and double strand break probabilities have been determined in a liquid water homogeneous medium with a 1.06 g/cm {sup 3} density. The energetic spectra of single strand breaks (SSB), the number of energy deposition events, and the SSB/event ratio were determined. Results: The target-hit probability was found to be independent of both the type and the energy of the incident particle, even if this latter is a secondary electron. This probability is determined by the geometrical properties of the system. The total strand break yield and the number of energy deposition events required to reach a certain absorbed dose were found nearly independent of the type and energy of the incident ion (proton or alpha). In contrast, the double strand break (DSB) yield was found strongly dependent on the LET of the incident radiation. Conclusions: The SSB generation process is homogeneous and independent of the LET of the particles involved, at least within the proton and alpha particle energy range here studied. The target-hit probability is only determined by the ratio between the total volume occupied by targets and that of the ROI where the radiation deposits its energy. The maximum separation distance between two adjacent SSBs to

  1. Measles Virus Host Invasion and Pathogenesis

    PubMed Central

    Laksono, Brigitta M.; de Vries, Rory D.; McQuaid, Stephen; Duprex, W. Paul; de Swart, Rik L.

    2016-01-01

    Measles virus is a highly contagious negative strand RNA virus that is transmitted via the respiratory route and causes systemic disease in previously unexposed humans and non-human primates. Measles is characterised by fever and skin rash and usually associated with cough, coryza and conjunctivitis. A hallmark of measles is the transient immune suppression, leading to increased susceptibility to opportunistic infections. At the same time, the disease is paradoxically associated with induction of a robust virus-specific immune response, resulting in lifelong immunity to measles. Identification of CD150 and nectin-4 as cellular receptors for measles virus has led to new perspectives on tropism and pathogenesis. In vivo studies in non-human primates have shown that the virus initially infects CD150+ lymphocytes and dendritic cells, both in circulation and in lymphoid tissues, followed by virus transmission to nectin-4 expressing epithelial cells. The abilities of the virus to cause systemic infection, to transmit to numerous new hosts via droplets or aerosols and to suppress the host immune response for several months or even years after infection make measles a remarkable disease. This review briefly highlights current topics in studies of measles virus host invasion and pathogenesis. PMID:27483301

  2. Measles Virus Host Invasion and Pathogenesis.

    PubMed

    Laksono, Brigitta M; de Vries, Rory D; McQuaid, Stephen; Duprex, W Paul; de Swart, Rik L

    2016-07-28

    Measles virus is a highly contagious negative strand RNA virus that is transmitted via the respiratory route and causes systemic disease in previously unexposed humans and non-human primates. Measles is characterised by fever and skin rash and usually associated with cough, coryza and conjunctivitis. A hallmark of measles is the transient immune suppression, leading to increased susceptibility to opportunistic infections. At the same time, the disease is paradoxically associated with induction of a robust virus-specific immune response, resulting in lifelong immunity to measles. Identification of CD150 and nectin-4 as cellular receptors for measles virus has led to new perspectives on tropism and pathogenesis. In vivo studies in non-human primates have shown that the virus initially infects CD150⁺ lymphocytes and dendritic cells, both in circulation and in lymphoid tissues, followed by virus transmission to nectin-4 expressing epithelial cells. The abilities of the virus to cause systemic infection, to transmit to numerous new hosts via droplets or aerosols and to suppress the host immune response for several months or even years after infection make measles a remarkable disease. This review briefly highlights current topics in studies of measles virus host invasion and pathogenesis.

  3. Synthesis and properties of double-stranded antisense oligonucleotides connected with a pentaerythritol linker.

    PubMed

    Shibata, Aya; Ueno, Yoshihito; Matsuda, Akira; Kitade, Yukio

    2006-01-01

    This paper describes the synthesis and properties of double-stranded antisense oligonucleotides connected with a pentaerythritol linker. We found that double-stranded antisense oligonucleotides with aminomethyl residues have high affinity for single-stranded DNA or RNA in buffer solutions both with and without MgCl(2). Thus, these oligonucleotides would be useful as antisense oligonucleotides for targeting single-stranded RNA through triplex formation.

  4. 18 CFR 35.26 - Recovery of stranded costs by public utilities and transmitting utilities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... requirements contract if such contract does not contain an exit fee or other explicit stranded cost provision... an exit fee or other explicit stranded cost provision, and the seller under the contract is a public... utility, and if the contract does not contain an exit fee or other explicit stranded cost provision,...

  5. 18 CFR 35.26 - Recovery of stranded costs by public utilities and transmitting utilities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... requirements contract if such contract does not contain an exit fee or other explicit stranded cost provision... an exit fee or other explicit stranded cost provision, and the seller under the contract is a public... utility, and if the contract does not contain an exit fee or other explicit stranded cost provision,...

  6. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 11 2014-01-01 2014-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1,...

  7. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 11 2013-01-01 2013-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1,...

  8. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 11 2012-01-01 2012-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1,...

  9. Folding DNA origami from a double-stranded source of scaffold

    PubMed Central

    Högberg, Björn; Liedl, Tim; Shih, William M.

    2009-01-01

    Combined heat and chemical denaturation of double-stranded DNA scaffold strands in the presence of staple strands, followed by a sudden temperature drop and then stepwise dialysis to remove the chemical denaturant, leads to self-assembly of two distinct DNA-origami structures. PMID:19566089

  10. 75 FR 32747 - Prestressed Concrete Steel Wire Strand from Mexico: Rescission of Antidumping Duty Administrative...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-09

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE INTERNATIONAL TRADE ADMINISTRATION Prestressed Concrete Steel Wire Strand from Mexico: Rescission of Antidumping... prestressed concrete steel wire strand (``PC Strand'') from Mexico for the period January 1, 2009...

  11. 75 FR 28560 - Prestressed Concrete Steel Wire Strand From the People's Republic of China: Final Determination...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-21

    ... International Trade Administration Prestressed Concrete Steel Wire Strand From the People's Republic of China...'' section of this notice. \\1\\ See Prestressed Concrete Steel Wire Strand From the People's Republic of China...., Ltd. in the Antidumping Duty Investigation of Prestressed Concrete Steel Wire Strand From the...

  12. Characterization of wood strands from young, small-diameter Douglas-fir and western hemlock trees

    Treesearch

    Vikram Yadama; Eini C. Lowell; Christopher E. Langum

    2012-01-01

    Tensile properties of strands processed from small-diameter Douglas-fir and western hemlock trees grown on the Washington coast were analyzed and effects of location within the tree on properties was examined. Reduction factors for strand properties relative to small, clear solid wood specimen properties were determined by correlating strand properties to previously...

  13. Strand Line Observations for High School Students: An Exercise in the Marine Environment.

    ERIC Educational Resources Information Center

    Schlenker, Richard M.

    As tides ebb and flood, quantities of diving, dying, and dead materials are moved from place to place. Many of these materials are stranded at the littoral fringe as the tide changes from flood to ebb. This area of stranded material, sometimes a belt as much as a meter wide, is appropriately known as the strand line. In these activities, students…

  14. 7 CFR 1755.370 - RUS specification for seven wire galvanized steel strand.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 11 2011-01-01 2011-01-01 false RUS specification for seven wire galvanized steel... steel strand. (a) RUS incorporates by reference ASTM A475-78, Standard Specification for Zinc-Coated Steel Wire Strand, issued May 1978. All seven wire galvanized steel strand purchased after April 1, 1990...

  15. Oriented-strand-board- the wave of the future- for the building trade

    Treesearch

    Linda Ashton

    1984-01-01

    Move over, plywood. Oriented-strand board is here. It's less expensive. It's as durable. It has as many uses. And it is the wave of the future. "Oriented-strand board is a direct substitute for plywood" said Jerry Buckner, plant manager for the Martco oriented-strand board plant in Lemoyen. OSB, as it is commonly called, is a structural panel made...

  16. Melting of DNA double strand after binding to geroprotective tetrapeptide.

    PubMed

    Khavinson, V Kh; Solovyov, A Yu; Shataeva, L K

    2008-11-01

    Experimental relationship between the hyperchromic effect of DNA [poly(dA-dT):poly(dA-dT)] interacting with Ala-Glu-Asp-Gly peptide is presented by a saturation isotherm. The free DNA double strand is melting (the strands separate) at 69.5 degrees C and at higher energy expenditures (enthalpy increase by 976.4 kJ/mol b.p.) in comparison with melting of the DNA-peptide complex (28 degrees C and 444.6 kJ/mol b.p.). The detected regularities of melting of duplex DNA and the thermodynamic parameters of this process indicate the natural mechanism of interaction between DNA and regulatory peptides underlying functioning of the living matter.

  17. Morbillivirus infection in stranded common dolphins from the Pacific Ocean.

    PubMed

    Reidarson, T H; McBain, J; House, C; King, D P; Stott, J L; Krafft, A; Taubenberger, J K; Heyning, J; Lipscomb, T P

    1998-10-01

    From August 1995 to August 1997, six of 18 common dolphins (Delphinus delphis) that stranded along beaches of southern California (USA) tested antibody positive for dolphin morbillivirus (DMV). Titers ascertained by virus neutralization ranged from 1:50 to 1:910 while those determined by ELISA ranged from 1:80 to 1:195. The first individual to strand survived and was released back into the Pacific Ocean 14 mo later. Histopathologic examination of tissues from the other five dolphins did not reveal lesions characteristic of morbilliviral disease; however, morbilliviral RNA was detected in three of the five by reverse transcriptase-polymerase chain reaction testing. This is the first report of morbilliviral infection in any marine mammal species in the northern hemisphere of the Pacific Ocean. These data indicate that DMV, or a closely related morbillivirus, is present in the Pacific Ocean and infection of common dolphins may not be associated with morbillivirus disease.

  18. Single-Strand Stacking Free Energy from DNA Beacon Kinetics

    PubMed Central

    Aalberts, Daniel P.; Parman, John M.; Goddard, Noel L.

    2003-01-01

    DNA beacons are short single-stranded chains which can form closed hairpin shapes through complementary base pairing at their ends. Contrary to the common polymer theory assumption that only their loop length matters, experiments show that their closing kinetics depend on the loop composition. We have modeled the closing kinetics and in so doing have obtained stacking enthalpies and entropies for single-stranded nucleic acids. The resulting change of persistence length with temperature effects the dynamics. With a Monte Carlo study, we answer another polymer question of how the closing time scales with chain length, finding τ ∼ N2.44±0.02. There is a significant crossover for shorter chains, bringing the effective exponent into good agreement with experiment. PMID:12719250

  19. Chromatin remodeling in DNA double-strand break repair.

    PubMed

    Bao, Yunhe; Shen, Xuetong

    2007-04-01

    ATP-dependent chromatin remodeling complexes use ATP hydrolysis to remodel nucleosomes and have well-established functions in transcription. However, emerging lines of evidence suggest that chromatin remodeling complexes are important players in DNA double-strand break (DSB) repair as well. The INO80 and SWI2 subfamilies of chromatin remodeling complexes have been found to be recruited to the double-strand lesions and to function directly in both homologous recombination and non-homologous end-joining, the two major conserved DSB repair pathways. Improperly repaired DSBs are implicated in cancer development in higher organisms. Understanding how chromatin remodeling complexes contribute to DSB repair should provide new insights into the mechanisms of carcinogenesis and might suggest new targets for cancer treatment.

  20. STRaND-2: Visual inspection, proximity operations & nanosatellite docking

    NASA Astrophysics Data System (ADS)

    Bridges, C. P.; Taylor, B.; Horri, N.; Underwood, C. I.; Kenyon, S.; Barrera-Ars, J.; Pryce, L.; Bird, R.

    The Surrey Training Research and Nanosatellite Demonstrator (STRaND) programme has been success in identifying and creating a leading low-cost nanosatellite programme with advanced attitude and orbit control system (AOCS) and experimental computing platforms based on smart-phone technologies. The next demonstration capabilities, that provide a challenging mission to the existing STRaND platform, is to perform visual inspection, proximity operations and nanosatellite docking. Visual inspection is to be performed using a COTS LIDAR system to estimate range and pose under 100 m. Proximity operations are controlled using a comprehensive guidance, navigation and control (GNC) loop in a polar form of the Hills Clohessy Wiltshire (HCW) frame including J2 perturbations. And finally, nanosatellite docking is performed at under 30 cm using a series of tuned magnetic coils. This paper will document the initial experiments and calculations used to qualify LIDAR components, size the mission thrust and tank requirements, and air cushion table demonstrations of the docking mechanism.

  1. HOMFLY polynomials in representation [3, 1] for 3-strand braids

    NASA Astrophysics Data System (ADS)

    Mironov, A.; Morozov, A.; Morozov, An.; Sleptsov, A.

    2016-09-01

    This paper is a new step in the project of systematic description of colored knot polynomials started in [1]. In this paper, we managed to explicitly find the inclusive Racah matrix, i.e. the whole set of mixing matrices in channels R ⊗3 -→ Q with all possible Q, for R = [3 , 1]. The calculation is made possible by the use of a newly-developed efficient highest-weight method, still it remains tedious. The result allows one to evaluate and investigate [3 , 1]-colored polynomials for arbitrary 3-strand knots, and this confirms many previous conjectures on various factorizations, universality, and differential expansions. We consider in some detail the next-to-twist-knots three-strand family ( n, -1 | 1 , -1) and deduce its colored HOMFLY. Also confirmed and clarified is the eigenvalue hypothesis for the Racah matrices, which promises to provide a shortcut to generic formulas for arbitrary representations.

  2. Implementing Nonlinear Feedback Controllers using DNA Strand Displacement Reactions.

    PubMed

    Sawlekar, Rucha; Montefusco, Francesco; Kulkarni, Vishwesh V; Bates, Declan G

    2016-04-29

    We show how an important class of nonlinear feedback controllers can be designed using idealized abstract chemical reactions and implemented via DNA strand displacement (DSD) reactions. Exploiting chemical reaction networks (CRNs) as a programming language for the design of complex circuits and networks, we show how a set of unimolecular and bimolecular reactions can be used to realize input-output dynamics that produce a nonlinear quasi sliding mode (QSM) feedback controller. The kinetics of the required chemical reactions can then be implemented as enzyme-free, enthalpy/entropy driven DNA reactions using a toehold mediated strand displacement mechanism via Watson-Crick base pairing and branch migration. We demonstrate that the closed loop response of the nonlinear QSM controller outperforms a traditional linear controller by facilitating much faster tracking response dynamics without introducing overshoots in the transient response. The resulting controller is highly modular and is less affected by retroactivity effects than standard linear designs.

  3. Implementing Nonlinear Feedback Controllers Using DNA Strand Displacement Reactions.

    PubMed

    Sawlekar, Rucha; Montefusco, Francesco; Kulkarni, Vishwesh V; Bates, Declan G

    2016-07-01

    We show how an important class of nonlinear feedback controllers can be designed using idealized abstract chemical reactions and implemented via DNA strand displacement (DSD) reactions. Exploiting chemical reaction networks (CRNs) as a programming language for the design of complex circuits and networks, we show how a set of unimolecular and bimolecular reactions can be used to realize input-output dynamics that produce a nonlinear quasi sliding mode (QSM) feedback controller. The kinetics of the required chemical reactions can then be implemented as enzyme-free, enthalpy/entropy driven DNA reactions using a toehold mediated strand displacement mechanism via Watson-Crick base pairing and branch migration. We demonstrate that the closed loop response of the nonlinear QSM controller outperforms a traditional linear controller by facilitating much faster tracking response dynamics without introducing overshoots in the transient response. The resulting controller is highly modular and is less affected by retroactivity effects than standard linear designs.

  4. Cold plasma activation of continuously moving fiber glass strand

    SciTech Connect

    Das, B.

    1992-03-01

    A few selectively activated products were made using 13.6 MHz radio frequency cold plasma induced gases; such as, argon, oxygen, ammonia, Freon{trademark}, and the 30:70 mixture of Freon{trademark} and oxygen. Surface wetting force measurements of random filaments drawn from the activated strands were made using a Wilhelmy Balance. These measurements indicated that chemical modifications of filaments had indeed occurred on all the filaments drawn either from the interior or the surface of the activated strand bundle. In some cases, Ion Scattering Spectrometry was used at Pennsylvania State University to confirm that surface modification of the fiber glass surface had, in fact, taken place during cold plasma activation. While argon and ammonia induced plasma activation did not cause any strength degradation of Emery or organic size coated fibers, the oxygen and Freon{trademark} induced activation did. 16 refs., 7 figs., 3 tabs.

  5. Heart pathologies in dolphins stranded along the northwestern Italian coast.

    PubMed

    Scaglione, F E; Bollo, E; Pregel, P; Chiappino, L; Sereno, A; Mignone, W; Moschi, R; Garibaldi, F; Tittarelli, C; Guarda, F

    2013-11-25

    Nine striped dolphins Stenella coeruleoalba and 1 bottlenose dolphin Tursiops truncatus stranded along the Ligurian Sea coast of Italy were necropsied between February 2011 and April 2012. Macroscopic and histological findings were observed in the hearts of all animals and included saccular aneurysms of the pulmonary trunk (n = 3), cirsoid aneurysms (n = 1), right ventricular dilation (n = 1) associated with hypoplasia of the tricuspid chordae (n = 1), valvular fibrosis (n = 3), mitral leaflet thickening (n = 1), left ventricular hypertrophy (n = 1), lymphocytic myocarditis (n =1), and Lambl's excrescences (n = 4). To our best knowledge Lambl's excrescences, aneurysm of the pulmonary trunk, and cirsoid aneurysms have not previously been described in marine mammals, and some of these findings should be taken into account as possible causes of dolphin morbidity, mortality, and stranding.

  6. Scaling up digital circuit computation with DNA strand displacement cascades.

    PubMed

    Qian, Lulu; Winfree, Erik

    2011-06-03

    To construct sophisticated biochemical circuits from scratch, one needs to understand how simple the building blocks can be and how robustly such circuits can scale up. Using a simple DNA reaction mechanism based on a reversible strand displacement process, we experimentally demonstrated several digital logic circuits, culminating in a four-bit square-root circuit that comprises 130 DNA strands. These multilayer circuits include thresholding and catalysis within every logical operation to perform digital signal restoration, which enables fast and reliable function in large circuits with roughly constant switching time and linear signal propagation delays. The design naturally incorporates other crucial elements for large-scale circuitry, such as general debugging tools, parallel circuit preparation, and an abstraction hierarchy supported by an automated circuit compiler.

  7. Invasive mycoses: diagnostic challenges.

    PubMed

    Ostrosky-Zeichner, Luis

    2012-01-01

    Despite the availability of newer antifungal drugs, outcomes for patients with invasive fungal infections (IFIs) continue to be poor, in large part due to delayed diagnosis and initiation of appropriate antifungal therapy. Standard histopathologic diagnostic techniques are often untenable in at-risk patients, and culture-based diagnostics typically are too insensitive or nonspecific, or provide results after too long a delay for optimal IFI management. Newer surrogate markers of IFIs with improved sensitivity and specificity are needed to enable earlier diagnosis and, ideally, to provide prognostic information and/or permit therapeutic monitoring. Surrogate assays should also be accessible and easy to implement in the hospital. Several nonculture-based assays of newer surrogates are making their way into the medical setting or are currently under investigation. These new or up-and-coming surrogates include antigens/antibodies (mannan and antimannan antibodies) or fungal metabolites (d-arabinitol) for detection of invasive candidiasis, the Aspergillus cell wall component galactomannan used to detect invasive aspergillosis, or the fungal cell wall component and panfungal marker β-glucan. In addition, progress continues with use of polymerase chain reaction- or other nucleic acid- or molecular-based assays for diagnosis of either specific or generic IFIs, although the various methods must be better standardized before any of these approaches can be more fully implemented into the medical setting. Investigators are also beginning to explore the possibility of combining newer surrogate markers with each other or with more standard diagnostic approaches to improve sensitivity, specificity, and capacity for earlier diagnosis, at a time when fungal burden is still relatively low and more responsive to antifungal therapy.

  8. Minimally invasive mediastinal surgery

    PubMed Central

    Melfi, Franca M. A.; Mussi, Alfredo

    2016-01-01

    In the past, mediastinal surgery was associated with the necessity of a maximum exposure, which was accomplished through various approaches. In the early 1990s, many surgical fields, including thoracic surgery, observed the development of minimally invasive techniques. These included video-assisted thoracic surgery (VATS), which confers clear advantages over an open approach, such as less trauma, short hospital stay, increased cosmetic results and preservation of lung function. However, VATS is associated with several disadvantages. For this reason, it is not routinely performed for resection of mediastinal mass lesions, especially those located in the anterior mediastinum, a tiny and remote space that contains vital structures at risk of injury. Robotic systems can overcome the limits of VATS, offering three-dimensional (3D) vision and wristed instrumentations, and are being increasingly used. With regards to thymectomy for myasthenia gravis (MG), unilateral and bilateral VATS approaches have demonstrated good long-term neurologic results with low complication rates. Nevertheless, some authors still advocate the necessity of maximum exposure, especially when considering the distribution of normal and ectopic thymic tissue. In recent studies, the robotic approach has shown to provide similar neurological outcomes when compared to transsternal and VATS approaches, and is associated with a low morbidity. Importantly, through a unilateral robotic technique, it is possible to dissect and remove at least the same amount of mediastinal fat tissue. Preliminary results on early-stage thymomatous disease indicated that minimally invasive approaches are safe and feasible, with a low rate of pleural recurrence, underlining the necessity of a “no-touch” technique. However, especially for thymomatous disease characterized by an indolent nature, further studies with long follow-up period are necessary in order to assess oncologic and neurologic results through minimally

  9. Minimally invasive parathyroid surgery

    PubMed Central

    Noureldine, Salem I.; Gooi, Zhen

    2015-01-01

    Traditionally, bilateral cervical exploration for localization of all four parathyroid glands and removal of any that are grossly enlarged has been the standard surgical treatment for primary hyperparathyroidism (PHPT). With the advances in preoperative localization studies and greater public demand for less invasive procedures, novel targeted, minimally invasive techniques to the parathyroid glands have been described and practiced over the past 2 decades. Minimally invasive parathyroidectomy (MIP) can be done either through the standard Kocher incision, a smaller midline incision, with video assistance (purely endoscopic and video-assisted techniques), or through an ectopically placed, extracervical, incision. In current practice, once PHPT is diagnosed, preoperative evaluation using high-resolution radiographic imaging to localize the offending parathyroid gland is essential if MIP is to be considered. The imaging study results suggest where the surgeon should begin the focused procedure and serve as a road map to allow tailoring of an efficient, imaging-guided dissection while eliminating the unnecessary dissection of multiple glands or a bilateral exploration. Intraoperative parathyroid hormone (IOPTH) levels may be measured during the procedure, or a gamma probe used during radioguided parathyroidectomy, to ascertain that the correct gland has been excised and that no other hyperfunctional tissue is present. MIP has many advantages over the traditional bilateral, four-gland exploration. MIP can be performed using local anesthesia, requires less operative time, results in fewer complications, and offers an improved cosmetic result and greater patient satisfaction. Additional advantages of MIP are earlier hospital discharge and decreased overall associated costs. This article aims to address the considerations for accomplishing MIP, including the role of preoperative imaging studies, intraoperative adjuncts, and surgical techniques. PMID:26425454

  10. Temperature dependence of unbinding forces between complementary DNA strands.

    PubMed Central

    Schumakovitch, Irina; Grange, Wilfried; Strunz, Torsten; Bertoncini, Patricia; Güntherodt, Hans-Joachim; Hegner, Martin

    2002-01-01

    Force probe techniques such as atomic force microscopy can directly measure the force required to rupture single biological ligand receptor bonds. Such forces are related to the energy landscape of these weak, noncovalent biological interactions. We report unbinding force measurements between complementary strands of DNA as a function of temperature. Our measurements emphasize the entropic contributions to the energy landscape of the bond. PMID:11751338

  11. Neural network computation with DNA strand displacement cascades.

    PubMed

    Qian, Lulu; Winfree, Erik; Bruck, Jehoshua

    2011-07-20

    The impressive capabilities of the mammalian brain--ranging from perception, pattern recognition and memory formation to decision making and motor activity control--have inspired their re-creation in a wide range of artificial intelligence systems for applications such as face recognition, anomaly detection, medical diagnosis and robotic vehicle control. Yet before neuron-based brains evolved, complex biomolecular circuits provided individual cells with the 'intelligent' behaviour required for survival. However, the study of how molecules can 'think' has not produced an equal variety of computational models and applications of artificial chemical systems. Although biomolecular systems have been hypothesized to carry out neural-network-like computations in vivo and the synthesis of artificial chemical analogues has been proposed theoretically, experimental work has so far fallen short of fully implementing even a single neuron. Here, building on the richness of DNA computing and strand displacement circuitry, we show how molecular systems can exhibit autonomous brain-like behaviours. Using a simple DNA gate architecture that allows experimental scale-up of multilayer digital circuits, we systematically transform arbitrary linear threshold circuits (an artificial neural network model) into DNA strand displacement cascades that function as small neural networks. Our approach even allows us to implement a Hopfield associative memory with four fully connected artificial neurons that, after training in silico, remembers four single-stranded DNA patterns and recalls the most similar one when presented with an incomplete pattern. Our results suggest that DNA strand displacement cascades could be used to endow autonomous chemical systems with the capability of recognizing patterns of molecular events, making decisions and responding to the environment.

  12. Double-Stranded Water on Stepped Platinum Surfaces

    NASA Astrophysics Data System (ADS)

    Kolb, Manuel J.; Farber, Rachael G.; Derouin, Jonathan; Badan, Cansin; Calle-Vallejo, Federico; Juurlink, Ludo B. F.; Killelea, Daniel R.; Koper, Marc T. M.

    2016-04-01

    The interaction of platinum with water plays a key role in (electro)catalysis. Herein, we describe a combined theoretical and experimental study that resolves the preferred adsorption structure of water wetting the Pt(111)-step type with adjacent (111) terraces. Double stranded lines wet the step edge forming water tetragons with dissimilar hydrogen bonds within and between the lines. Our results qualitatively explain experimental observations of water desorption and impact our thinking of solvation at the Pt electrochemical interface.

  13. RNA STRAND: The RNA Secondary Structure and Statistical Analysis Database

    PubMed Central

    Andronescu, Mirela; Bereg, Vera; Hoos, Holger H; Condon, Anne

    2008-01-01

    Background The ability to access, search and analyse secondary structures of a large set of known RNA molecules is very important for deriving improved RNA energy models, for evaluating computational predictions of RNA secondary structures and for a better understanding of RNA folding. Currently there is no database that can easily provide these capabilities for almost all RNA molecules with known secondary structures. Results In this paper we describe RNA STRAND – the RNA secondary STRucture and statistical ANalysis Database, a curated database containing known secondary structures of any type and organism. Our new database provides a wide collection of known RNA secondary structures drawn from public databases, searchable and downloadable in a common format. Comprehensive statistical information on the secondary structures in our database is provided using the RNA Secondary Structure Analyser, a new tool we have developed to analyse RNA secondary structures. The information thus obtained is valuable for understanding to which extent and with which probability certain structural motifs can appear. We outline several ways in which the data provided in RNA STRAND can facilitate research on RNA structure, including the improvement of RNA energy models and evaluation of secondary structure prediction programs. In order to keep up-to-date with new RNA secondary structure experiments, we offer the necessary tools to add solved RNA secondary structures to our database and invite researchers to contribute to RNA STRAND. Conclusion RNA STRAND is a carefully assembled database of trusted RNA secondary structures, with easy on-line tools for searching, analyzing and downloading user selected entries, and is publicly available at . PMID:18700982

  14. Mismatch Repair Balances Leading and Lagging Strand DNA Replication Fidelity

    DTIC Science & Technology

    2012-10-11

    Pol e mutator variant to confirm that Pol e is the primary leading strand replicase in Saccharomyces cerevisiae . We then use polymerase-specific error...variables using Saccharomyces cerevisiae strains containing mutant alleles of the POL1 (Pol a), POL2 (Pol e) and POL3 (Pol d) genes. These mutant...AL, Johnston LH, Sugino A (1993) Pathway correcting DNA replication errors in Saccharomyces cerevisiae . Embo J 12: 1467–1473. 17. Morrison A, Sugino A

  15. Bioterrorism and invasive species.

    PubMed

    Chomel, B B; Sun, B

    2010-08-01

    The risk of dispersing invasive species, especially human pathogens, through acts of bioterrorism, cannot be neglected. However, that risk appears quite low in comparison with the risk of dispersing animal pathogens that could dramatically burden the agricultural economy of food animal producing countries, such as Australia and countries in Europe and North and South America. Although it is not directly related to bioterrorism, the intentional release of non-native species, particularly undesired companion animals or wildlife, may also have a major economic impact on the environment and, possibly, on animal and human health, in the case of accidental release of zoonotic agents.

  16. Analysis of DNA Double-Strand Breaks and Cytotoxicity after 7 Tesla Magnetic Resonance Imaging of Isolated Human Lymphocytes

    PubMed Central

    Guttek, Karina; Hartig, Roland; Godenschweger, Frank; Roggenbuck, Dirk; Ricke, Jens; Reinhold, Dirk; Speck, Oliver

    2015-01-01

    The global use of magnetic resonance imaging (MRI) is constantly growing and the field strengths increasing. Yet, only little data about harmful biological effects caused by MRI exposure are available and published research analyzing the impact of MRI on DNA integrity reported controversial results. This in vitro study aimed to investigate the genotoxic and cytotoxic potential of 7 T ultra-high-field MRI on isolated human peripheral blood mononuclear cells. Hence, unstimulated mononuclear blood cells were exposed to 7 T static magnetic field alone or in combination with maximum permissible imaging gradients and radiofrequency pulses as well as to ionizing radiation during computed tomography and γ-ray exposure. DNA double-strand breaks were quantified by flow cytometry and automated microscopy analysis of immunofluorescence stained γH2AX. Cytotoxicity was studied by CellTiter-Blue viability assay and [3H]-thymidine proliferation assay. Exposure of unstimulated mononuclear blood cells to 7 T static magnetic field alone or combined with varying gradient magnetic fields and pulsed radiofrequency fields did not induce DNA double-strand breaks, whereas irradiation with X- and γ-rays led to a dose-dependent induction of γH2AX foci. The viability assay revealed a time- and dose-dependent decrease in metabolic activity only among samples exposed to γ-radiation. Further, there was no evidence for altered proliferation response after cells were exposed to 7 T MRI or low doses of ionizing radiation (≤ 0.2 Gy). These findings confirm the acceptance of MRI as a safe non-invasive diagnostic imaging tool, but whether MRI can induce other types of DNA lesions or DNA double-strand breaks during altered conditions still needs to be investigated. PMID:26176601

  17. Carbon Fiber Strand Tensile Failure Dynamic Event Characterization

    NASA Technical Reports Server (NTRS)

    Johnson, Kenneth L.; Reeder, James

    2016-01-01

    There are few if any clear, visual, and detailed images of carbon fiber strand failures under tension useful for determining mechanisms, sequences of events, different types of failure modes, etc. available to researchers. This makes discussion of physics of failure difficult. It was also desired to find out whether the test article-to-test rig interface (grip) played a part in some failures. These failures have nothing to do with stress rupture failure, thus representing a source of waste for the larger 13-00912 investigation into that specific failure type. Being able to identify or mitigate any competing failure modes would improve the value of the 13-00912 test data. The beginnings of the solution to these problems lay in obtaining images of strand failures useful for understanding physics of failure and the events leading up to failure. Necessary steps include identifying imaging techniques that result in useful data, using those techniques to home in on where in a strand and when in the sequence of events one should obtain imaging data.

  18. Direct observation of single flexible polymers using single stranded DNA†

    PubMed Central

    Brockman, Christopher; Kim, Sun Ju

    2012-01-01

    Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981

  19. DNA Logic Gate Based on Metallo-Toehold Strand Displacement

    PubMed Central

    Deng, Wei; Xu, Huaguo; Ding, Wei; Liang, Haojun

    2014-01-01

    DNA is increasingly being used as an ideal material for the construction of nanoscale structures, circuits, and machines. Toehold-mediated DNA strand displacement reactions play a very important role in these enzyme-free constructions. In this study, the concept of metallo-toehold was utilized to further develop a mechanism for strand displacement driven by Ag+ ions, in which the intercalation of cytosine–cytosine mismatched base pairs on the toeholds provides additional control by varying of the concentration of Ag+ ions. The characteristics of displacement reaction in response to different concentration of Ag+ ions are investigated by fluorescence spectral and non-denaturing polyacrylamide gel electrophoresis. The reaction can successfully occur when the concentration of Ag+ ions is suitabe; excess Ag+ ions block the reaction. Furthermore, the displacement reaction can be tuned and controlled most efficiently under the condition of two C:C mismatched base pairs placed on the six-nt toehold. Based on our research, a mechanism was developed to construct Boolean logic gate AND and OR by employing strand displacement reaction as a tool, Ag+ and Hg2+ as input. PMID:25365381

  20. Load monitoring in multiwire strands by interwire ultrasonic measurements

    NASA Astrophysics Data System (ADS)

    Bartoli, Ivan; Phillips, Robert; Lanza di Scalea, Francesco; Salamone, Salvatore; Coccia, Stefano; Sikorsky, Charles S.

    2008-03-01

    Nearly 90% of the bridges in California are post-tensioned box-girders. Prestressing (PS) tendons are the main load-carrying components of these and other post-tensioned structures. Despite their criticality, much research is needed to develop and deploy techniques able to provide real-time information on the level of prestress and on the presence of structural defects (e.g. corrosion and broken wires) in the PS tendons. In collaboration with Caltrans, UCSD is investigating the combination of ultrasonic guided waves and embedded sensors as an approach to provide both prestress level monitoring and defect detection capabilities in concrete-embedded PS tendons. This paper will focus on the prestress level monitoring by first discussing the behavior of ultrasonic guided waves propagating in seven-wire, 0.6-in diameter twisted strands typically used in post-tensioned concrete structures. A semi-analytical finite element analysis is used to predict modal and forced wave solutions as a function of the applied prestress level. This analysis accounts for the changing inter-wire contact as a function of applied loads. A feature shown sensitive to load levels is the inter-wire energy leakage. In order to monitor such feature, the method uses low-profile piezoelectric sensors able to probe the individual, 0.2-in wires comprising the strand. Results of load monitoring in free and embedded strands during laboratory tests will be presented.

  1. Human DNA polymerase η accommodates RNA for strand extension.

    PubMed

    Su, Yan; Egli, Martin; Guengerich, F Peter

    2017-09-26

    Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase alpha, telomerase, and the mitochondrial DNA polymerase hpol gamma have been shown to tolerate an entire RNA strand. Y-family DNA polymerase eta] (hpol eta) is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer (CPD) and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol eta is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol eta--as well as another Y-family DNA polymerase, hpol kappa--accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions such as 8-oxo-2'-deoxyguanosine or CPD, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA accommodating ability of hpol eta redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol eta in vivo. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  2. Commercial possibilities for stranded conventional gas from Alaska's North Slope

    USGS Publications Warehouse

    Attanasi, E.D.; Freeman, P.A.

    2014-01-01

    Stranded gas resources are defined for this study as gas resources in discrete accumulations that are not currently commercially producible, or producible at full potential, for either physical or economic reasons. Approximately 35 trillion cubic feet (TCF) of stranded gas was identified on Alaska’s North Slope. The commercialization of this resource requires facilities to transport gas to markets where sales revenue will be sufficient to offset the cost of constructing and operating a gas delivery system. With the advent of the shale gas revolution, plans for a gas pipeline to the conterminous US have been shelved (at least temporarily) and the State and resource owners are considering a liquefied natural gas (LNG) export project that targets Asian markets. This paper focuses on competitive conditions for Asian gas import markets by estimating delivered costs of competing supplies from central Asia, Russia, Indonesia, Malaysia, and Australia in the context of a range of import gas demand projections for the period from 2020 to 2040. These suppliers’ costs are based on the cost of developing, producing, and delivering to markets tranches of the nearly 600 TCF of recoverable gas from their own conventional stranded gas fields. The results of these analyses imply that Alaska’s gas exports to Asia will likely encounter substantial competitive challenges. The sustainability of Asia’s oil-indexed LNG pricing is also discussed in light of a potentially intense level of competition.

  3. A novel bio-sensor based on DNA strand displacement.

    PubMed

    Shi, Xiaolong; Wang, Zhiyu; Deng, Chenyan; Song, Tao; Pan, Linqiang; Chen, Zhihua

    2014-01-01

    DNA strand displacement technology performs well in sensing and programming DNA segments. In this work, we construct DNA molecular systems based on DNA strand displacement performing computation of logic gates. Specifically, a class of so-called "DNA neurons" are achieved, in which a "smart" way inspired by biological neurons encoding information is developed to encode and deliver information using DNA molecules. The "DNA neuron" is bistable, that is, it can sense DNA molecules as input signals, and release "negative" or "positive" signals DNA molecules. We design intelligent DNA molecular systems that are constructed by cascading some particularly organized "DNA neurons", which could perform logic computation, including AND, OR, XOR logic gates, automatically. Both simulation results using visual DSD (DNA strand displacement) software and experimental results are obtained, which shows that the proposed systems can detect DNA signals with high sensitivity and accretion; moreover, the systems can process input signals automatically with complex nonlinear logic. The method proposed in this work may provide a new way to construct a sensitive molecular signal detection system with neurons spiking behavior in vitro, and can be used to develop intelligent molecular processing systems in vivo.

  4. Structure of the guide-strand-containing argonaute silencing complex

    SciTech Connect

    Wang, Yanli; Sheng, Gang; Juranek, Stefan; Tuschl, Thomas; Patel, Dinshaw J.

    2009-01-15

    The slicer activity of the RNA-induced silencing complex is associated with argonaute, the RNase H-like PIWI domain of which catalyses guide-strand-mediated sequence-specific cleavage of target messenger RNA. Here we report on the crystal structure of Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-base DNA guide strand, thereby identifying the nucleic-acid-binding channel positioned between the PAZ- and PIWI-containing lobes, as well as the pivot-like conformational changes associated with complex formation. The bound guide strand is anchored at both of its ends, with the solvent-exposed Watson-Crick edges of stacked bases 2 to 6 positioned for nucleation with the mRNA target, whereas two critically positioned arginines lock bases 10 and 11 at the cleavage site into an unanticipated orthogonal alignment. Biochemical studies indicate that key amino acid residues at the active site and those lining the 5'-phosphate-binding pocket made up of the Mid domain are critical for cleavage activity, whereas alterations of residues lining the 2-nucleotide 3'-end-binding pocket made up of the PAZ domain show little effect.

  5. Radiation Induced DNA Double-Strand Breaks in Radiology.

    PubMed

    Kuefner, M A; Brand, M; Engert, C; Schwab, S A; Uder, M

    2015-10-01

    Shortly after the discovery of X-rays, their damaging effect on biological tissues was observed. The determination of radiation exposure in diagnostic and interventional radiology is usually based on physical measurements or mathematical algorithms with standardized dose simulations. γ-H2AX immunofluorescence microscopy is a reliable and sensitive method for the quantification of radiation induced DNA double-strand breaks (DSB) in blood lymphocytes. The detectable amount of these DNA damages correlates well with the dose received. However, the biological radiation damage depends not only on dose but also on other individual factors like radiation sensitivity and DNA repair capacity. Iodinated contrast agents can enhance the x-ray induced DNA damage level. After their induction DSB are quickly repaired. A protective effect of antioxidants has been postulated in experimental studies. This review explains the prinicple of the γ-H2AX technique and provides an overview on studies evaluating DSB in radiologic examinations. Radiologic examinations including CT and angiography induce DNA double-strand breaks. Even after mammography a slight but significant increase is detectable in peripheral blood lymphocytes. The number of radiation induced double-strand breaks correlates well with the radiation dose. Individual factors including radiation sensitivity, DNA repair capacity and the application of iodinated contrast media has an influence on the DNA damage level. © Georg Thieme Verlag KG Stuttgart · New York.

  6. Single strand transposition at the host replication fork

    PubMed Central

    Lavatine, Laure; He, Susu; Caumont-Sarcos, Anne; Guynet, Catherine; Marty, Brigitte; Chandler, Mick; Ton-Hoang, Bao

    2016-01-01

    Members of the IS200/IS605 insertion sequence family differ fundamentally from classical IS essentially by their specific single-strand (ss) transposition mechanism, orchestrated by the Y1 transposase, TnpA, a small HuH enzyme which recognizes and processes ss DNA substrates. Transposition occurs by the ‘peel and paste’ pathway composed of two steps: precise excision of the top strand as a circular ss DNA intermediate; and subsequent integration into a specific ssDNA target. Transposition of family members was experimentally shown or suggested by in silico high-throughput analysis to be intimately coupled to the lagging strand template of the replication fork. In this study, we investigated factors involved in replication fork targeting and analysed DNA-binding properties of the transposase which can assist localization of ss DNA substrates on the replication fork. We showed that TnpA interacts with the β sliding clamp, DnaN and recognizes DNA which mimics replication fork structures. We also showed that dsDNA can facilitate TnpA targeting ssDNA substrates. We analysed the effect of Ssb and RecA proteins on TnpA activity in vitro and showed that while RecA does not show a notable effect, Ssb inhibits integration. Finally we discuss the way(s) in which integration may be directed into ssDNA at the replication fork. PMID:27466393

  7. High-pressure liquid-monopropellant strand combustion.

    NASA Technical Reports Server (NTRS)

    Faeth, G. M.

    1972-01-01

    Examination of the influence of dissolved gases on the state of the liquid surface during high-pressure liquid-monopropellant combustion through the use of a strand burning experiment. Liquid surface temperatures were measured, using fine-wire thermocouples, during the strand combustion of ethyl nitrate, normal propyl nitrate, and propylene glycol dinitrate at pressures up to 81 atm. These measurements were compared with the predictions of a variable-property gas-phase analysis assuming an infinite activation energy for the decomposition reaction. The state of the liquid surface was estimated using a conventional low-pressure phase equilibrium model, as well as a high-pressure version that considered the presence of dissolved combustion-product gases in the liquid phase. The high-pressure model was found to give a superior prediction of measured liquid surface temperatures. Computed total pressures required for the surface to reach its critical mixing point during strand combustion were found to be in the range from 2.15 to 4.62 times the critical pressure of the pure propellant. Computed dissolved gas concentrations at the liquid surface were in the range from 35 to 50% near the critical combustion condition.

  8. The dynamic DNA methylomes of double-stranded DNA viruses associated with human cancer

    PubMed Central

    Fernandez, Agustin F.; Rosales, Cecilia; Lopez-Nieva, Pilar; Graña, Osvaldo; Ballestar, Esteban; Ropero, Santiago; Espada, Jesus; Melo, Sonia A.; Lujambio, Amaia; Fraga, Mario F.; Pino, Irene; Javierre, Biola; Carmona, Francisco J.; Acquadro, Francesco; Steenbergen, Renske D.M.; Snijders, Peter J.F.; Meijer, Chris J.; Pineau, Pascal; Dejean, Anne; Lloveras, Belen; Capella, Gabriel; Quer, Josep; Buti, Maria; Esteban, Juan-Ignacio; Allende, Helena; Rodriguez-Frias, Francisco; Castellsague, Xavier; Minarovits, Janos; Ponce, Jordi; Capello, Daniela; Gaidano, Gianluca; Cigudosa, Juan Cruz; Gomez-Lopez, Gonzalo; Pisano, David G.; Valencia, Alfonso; Piris, Miguel Angel; Bosch, Francesc X.; Cahir-McFarland, Ellen; Kieff, Elliott; Esteller, Manel

    2009-01-01

    The natural history of cancers associated with virus exposure is intriguing, since only a minority of human tissues infected with these viruses inevitably progress to cancer. However, the molecular reasons why the infection is controlled or instead progresses to subsequent stages of tumorigenesis are largely unknown. In this article, we provide the first complete DNA methylomes of double-stranded DNA viruses associated with human cancer that might provide important clues to help us understand the described process. Using bisulfite genomic sequencing of multiple clones, we have obtained the DNA methylation status of every CpG dinucleotide in the genome of the Human Papilloma Viruses 16 and 18 and Human Hepatitis B Virus, and in all the transcription start sites of the Epstein-Barr Virus. These viruses are associated with infectious diseases (such as hepatitis B and infectious mononucleosis) and the development of human tumors (cervical, hepatic, and nasopharyngeal cancers, and lymphoma), and are responsible for 1 million deaths worldwide every year. The DNA methylomes presented provide evidence of the dynamic nature of the epigenome in contrast to the genome. We observed that the DNA methylome of these viruses evolves from an unmethylated to a highly methylated genome in association with the progression of the disease, from asymptomatic healthy carriers, through chronically infected tissues and pre-malignant lesions, to the full-blown invasive tumor. The observed DNA methylation changes have a major functional impact on the biological behavior of the viruses. PMID:19208682

  9. Dynamic control of chirality and self-assembly of double-stranded helicates with light

    NASA Astrophysics Data System (ADS)

    Zhao, Depeng; van Leeuwen, Thomas; Cheng, Jinling; Feringa, Ben L.

    2016-11-01

    Helicity switching in biological and artificial systems is a fundamental process that allows for the dynamic control of structures and their functions. In contrast to chemical approaches to responsive behaviour in helicates, the use of light as an external stimulus offers unique opportunities to invert the chirality of helical structures in a non-invasive manner with high spatiotemporal precision. Here, we report that unidirectional rotary motors with connecting oligobipyridyl ligands, which can dynamically change their chirality upon irradiation, assemble into metal helicates that are responsive to light. The motor function controls the self-assembly process as well as the helical chirality, allowing switching between oligomers and double-stranded helicates with distinct handedness. The unidirectionality of the light-induced motion governs the sequence of programmable steps, enabling the highly regulated self-assembly of fully responsive helical structures. This discovery paves the way for the future development of new chirality-dependent photoresponsive systems including smart materials, enantioselective catalysts and light-driven molecular machines.

  10. Dynamic control of chirality and self-assembly of double-stranded helicates with light.

    PubMed

    Zhao, Depeng; van Leeuwen, Thomas; Cheng, Jinling; Feringa, Ben L

    2017-03-01

    Helicity switching in biological and artificial systems is a fundamental process that allows for the dynamic control of structures and their functions. In contrast to chemical approaches to responsive behaviour in helicates, the use of light as an external stimulus offers unique opportunities to invert the chirality of helical structures in a non-invasive manner with high spatiotemporal precision. Here, we report that unidirectional rotary motors with connecting oligobipyridyl ligands, which can dynamically change their chirality upon irradiation, assemble into metal helicates that are responsive to light. The motor function controls the self-assembly process as well as the helical chirality, allowing switching between oligomers and double-stranded helicates with distinct handedness. The unidirectionality of the light-induced motion governs the sequence of programmable steps, enabling the highly regulated self-assembly of fully responsive helical structures. This discovery paves the way for the future development of new chirality-dependent photoresponsive systems including smart materials, enantioselective catalysts and light-driven molecular machines.

  11. Polymerase chain reaction-single strand conformation polymorphism applied to sex identification of Accipiter cooperii.

    PubMed

    Ramos, Pedro Silveira; Bastos, Estela; Mannan, Richard William; Guedes-Pinto, Henrique

    2009-04-01

    Determination of sex in birds is valuable for studying population dynamics and structure, habitat use, behavior and mating systems. The purpose of the present study was to optimize a DNA-based methodology to allow the sex identification in Accipiter cooperii nestlings. Chromo-helicase-DNA-binding (CHD1) gene was used in this work as a marker for sex identification. CHD-W and CHD-Z sequences should present length and/or sequence differences providing a way to identify gender. We used a non-invasive method for DNA extraction from feathers and performed polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) method. The length difference between CHD-W and CHD-Z amplified fragments observed by electrophoresis in conventional agarose gel was not enough to provide a clear differentiation between males and females. However, patterns obtained by PCR-SSCP differentiated undoubtedly males and females in A. cooperii. This tool provides a precise gender identification assay and will be applied to confirm and refine morphometrically based sexing techniques used in the field.

  12. Dynamic control of chirality and self-assembly of double-stranded helicates with light

    NASA Astrophysics Data System (ADS)

    Zhao, Depeng; van Leeuwen, Thomas; Cheng, Jinling; Feringa, Ben L.

    2017-03-01

    Helicity switching in biological and artificial systems is a fundamental process that allows for the dynamic control of structures and their functions. In contrast to chemical approaches to responsive behaviour in helicates, the use of light as an external stimulus offers unique opportunities to invert the chirality of helical structures in a non-invasive manner with high spatiotemporal precision. Here, we report that unidirectional rotary motors with connecting oligobipyridyl ligands, which can dynamically change their chirality upon irradiation, assemble into metal helicates that are responsive to light. The motor function controls the self-assembly process as well as the helical chirality, allowing switching between oligomers and double-stranded helicates with distinct handedness. The unidirectionality of the light-induced motion governs the sequence of programmable steps, enabling the highly regulated self-assembly of fully responsive helical structures. This discovery paves the way for the future development of new chirality-dependent photoresponsive systems including smart materials, enantioselective catalysts and light-driven molecular machines.

  13. Yields of single-strand breaks in double-stranded calf thymus DNA irradiated in aqueous solution in the presence of oxygen and scavengers

    SciTech Connect

    Udovicic, Lj.; Mark, F.; Bothe, E.

    1994-11-01

    Yields of radiation-induced single-strand breaks in double-stranded calf thymus DNA have been measured as a function of OH scavenger concentration in N{sub 2}O/O{sub 2}-saturated aqueous solution. The experimental data are well represented by a theoretical model based on non-homogeneous reaction kinetics, without the need to adjust any parameter. The good agreement between experimental and theoretical data is taken as evidence that, in the presence of oxygen, the main effect of added scavengers with respect to the formation of single-strand breaks in double-stranded DNA is OH radical scavenging. 30 refs., 3 figs., 1 tab.

  14. Spectroscopic characterization of the interaction of phenosafranin and safranin O with double stranded, heat denatured and single stranded calf thymus DNA.

    PubMed

    Saha, Ishita; Kumar, Gopinatha Suresh

    2011-01-01

    Interaction of phenosafranin and safranin O with double stranded, heat denatured and single stranded calf thymus DNA has been studied by fluorescence, absorbance and circular dichroic techniques. Binding to the double stranded and heat denatured DNA conformations induced strong quenching in the fluorescence spectra of both dyes. Linear Scatchard plots indicated the binding to be of one type and the affinity evaluated to be of the order of 10(5) M(-1) with double stranded and heat denatured DNAs. Fluorescence quenching was much weaker with the single stranded DNA and the binding affinity was one order lower. Ferrocyanide quenching studies revealed that the fluorescence emission of the dye molecules bound to the double stranded and heat denatured DNAs was quenched much less compared to that bound to the single stranded DNA. Further, there was significant emission polarization for the bound dyes and strong energy transfer from the DNA base pairs to the dye molecules indicating intercalative binding. Salt dependence of the binding phenomenon revealed that electrostatic forces have significant role in the binding process. The intercalation of these molecules to double stranded and heat denatured DNA and simple stacking to single strands was proved by these fluorescence techniques. Support to the fluorescence results have been derived from absorption and circular dichroic results. Phenosafranin was revealed to be a stronger binding species compared to safranin O.

  15. Slow repair of bulky DNA adducts along the nontranscribed strand of the human p53 gene may explain the strand bias of transversion mutations in cancers.

    PubMed

    Denissenko, M F; Pao, A; Pfeifer, G P; Tang, M

    1998-03-12

    Using UvrABC incision in combination with ligation-mediated PCR (LMPCR) we have previously shown that benzo(a)pyrene diol epoxide (BPDE) adduct formation along the nontranscribed strand of the human p53 gene is highly selective; the preferential binding sites coincide with the major mutation hotspots found in human lung cancers. Both sequence-dependent adduct formation and repair may contribute to these mutation hotspots in tumor tissues. To test this possibility, we have extended our previous studies by mapping the BPDE adduct distribution in the transcribed strand of the p53 gene and quantifying the rates of repair for individual damaged bases in exons 5, 7, and 8 for both DNA strands of this gene in normal human fibroblasts. We found that: (i) on both strands, BPDE adducts preferentially form at CpG sequences, and (ii) repair of BPDE adducts in the transcribed DNA strand is consistently faster than repair of adducts in the nontranscribed strand, while repair at the major damage hotspots (guanines at codons 157, 248 and 273) in the nontranscribed strand is two to four times slower than repair at other damage sites. These results strongly suggest that both preferential adduct formation and slow repair lead to hotspots for mutations at codons 157, 248 and 273, and that the strand bias of bulky adduct repair is primarily responsible for the strand bias of G to T transversion mutations observed in the p53 gene in human cancers.

  16. Coordination of Double Strand Break Repair and Meiotic Progression in Yeast by a Mek1- Ndt80 Negative Feedback Loop.

    PubMed

    Prugar, Evelyn; Burnett, Cameron; Chen, Xiangyu; Hollingsworth, Nancy M

    2017-03-01

    During meiosis, homologous chromosomes are physically connected by crossovers and sister chromatid cohesion. Interhomolog crossovers are generated by the highly regulated repair of programmed double strand breaks (DSBs). The meiosis-specific kinase, Mek1, is critical for this regulation. Mek1 down-regulates the mitotic recombinase Rad51, indirectly promoting interhomolog strand invasion by the meiosis-specific recombinase, Dmc1. Mek1 also promotes the formation of crossovers that are distributed throughout the genome by interference and is the effector kinase for a meiosis-specific checkpoint that delays entry into Meiosis I until DSBs have been repaired. The target of this checkpoint is a meiosis-specific transcription factor, Ndt80, which is necessary to express the polo-like kinase, CDC5, and the cyclin, CLB1, thereby allowing completion of recombination and meiotic progression. This work shows that Mek1 and Ndt80 negatively feedback on each other such that when DSB levels are high, Ndt80 is inactive due to high levels of Mek1 activity. As DSBs are repaired, chromosomes synapse and Mek1 activity is reduced below a threshold that allows activation of Ndt80. Ndt80 transcription of CDC5 results in degradation of Red1, a meiosis-specific protein required for Mek1 activation, thereby abolishing Mek1 activity completely. Elimination of Mek1 kinase activity allows Rad51-mediated repair of any remaining DSBs. In this way, cells do not enter Meiosis I until recombination is complete and all DSBs are repaired.

  17. The effect of strand bias in Illumina short-read sequencing data

    PubMed Central

    2012-01-01

    Background When using Illumina high throughput short read data, sometimes the genotype inferred from the positive strand and negative strand are significantly different, with one homozygous and the other heterozygous. This phenomenon is known as strand bias. In this study, we used Illumina short-read sequencing data to evaluate the effect of strand bias on genotyping quality, and to explore the possible causes of strand bias. Result We collected 22 breast cancer samples from 22 patients and sequenced their exome using the Illumina GAIIx machine. By comparing the consistency between the genotypes inferred from this sequencing data with the genotypes inferred from SNP chip data, we found that, when using sequencing data, SNPs with extreme strand bias did not have significantly lower consistency rates compared to SNPs with low or no strand bias. However, this result may be limited by the small subset of SNPs present in both the exome sequencing and the SNP chip data. We further compared the transition and transversion ratio and the number of novel non-synonymous SNPs between the SNPs with low or no strand bias and those with extreme strand bias, and found that SNPs with low or no strand bias have better overall quality. We also discovered that the strand bias occurs randomly at genomic positions across these samples, and observed no consistent pattern of strand bias location across samples. By comparing results from two different aligners, BWA and Bowtie, we found very consistent strand bias patterns. Thus strand bias is unlikely to be caused by alignment artifacts. We successfully replicated our results using two additional independent datasets with different capturing methods and Illumina sequencers. Conclusion Extreme strand bias indicates a potential high false-positive rate for SNPs. PMID:23176052

  18. Hydroxyapatite-mediated separation of double-stranded DNA, single-stranded DNA, and RNA genomes from natural viral assemblages.

    PubMed

    Andrews-Pfannkoch, Cynthia; Fadrosh, Douglas W; Thorpe, Joyce; Williamson, Shannon J

    2010-08-01

    Metagenomics can be used to determine the diversity of complex, often unculturable, viral communities with various nucleic acid compositions. Here, we report the use of hydroxyapatite chromatography to efficiently fractionate double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), dsRNA, and ssRNA genomes from known bacteriophages. Linker-amplified shotgun libraries were constructed to generate sequencing reads from each hydroxyapatite fraction. Greater than 90% of the reads displayed significant similarity to the expected genomes at the nucleotide level. These methods were applied to marine viruses collected from the Chesapeake Bay and the Dry Tortugas National Park. Isolated nucleic acids were fractionated using hydroxyapatite chromatography followed by linker-amplified shotgun library construction and sequencing. Taxonomic analysis demonstrated that the majority of environmental sequences, regardless of their source nucleic acid, were most similar to dsDNA viruses, reflecting the bias of viral metagenomic sequence databases.

  19. Carbohydrate radicals: from ethylene glycol to DNA strand breakage.

    PubMed

    von Sonntag, Clemens

    2014-06-01

    Radiation-induced DNA strand breakage results from the reactions of radicals formed at the sugar moiety of DNA. In order to elucidate the mechanism of this reaction investigations were first performed on low molecular weight model systems. Results from studies on deoxygenated aqueous solutions of ethylene glycol, 2-deoxy-d-ribose and other carbohydrates and, more relevantly, of d-ribose-5-phosphate have shown that substituents can be eliminated from the β-position of the radical site either proton and base-assisted (as in the case of the OH substituent), or spontaneously (as in the case of the phosphate substituent). In DNA the C(4') radical undergoes strand breakage via this type of reaction. In the presence of oxygen the carbon-centred radicals are rapidly converted into the corresponding peroxyl radicals. Again, low molecular weights models have been investigated to elucidate the key reactions. A typical reaction of DNA peroxyl radicals is the fragmentation of the C(4')-C(S') bond, a reaction not observed in the absence of oxygen. Although OH radicals may be the important direct precursors of the sugar radicals of DNA, results obtained with poly(U) indicate that base radicals may well be of even greater importance. The base radicals, formed by addition of the water radicals (H and OH) to the bases would in their turn attack the sugar moiety to produce sugar radicals which then give rise to strand breakage and base release. For a better understanding of strand break formation it is therefore necessary to investigate in more detail the reactions of the base radicals. For a start, the radiolysis of uracil in oxygenated solutions has been reinvestigated, and it has been shown that the major peroxyl radical in this system undergoes base-catalysed elimination of [Formula: see text], a reaction that involves the proton at N(l). In the nucleic acids the pyrimidines are bound at N(l) to the sugar moiety and this type of reaction can no longer occur. Therefore, with

  20. Effects of Rutherford Cable Parameters on Nb3Sn Extracted Strand Deformation and Performance

    SciTech Connect

    Turrioni, Daniele; Barzi, Emanuela; Bossert, M.; Collings, E.W.; Nazareth, V.; Sumptions, M.D.; Yamada, R.; Zlobin, A.V.; /Fermilab

    2008-06-01

    In order to optimize parameters for Rutherford cables used in accelerator magnets, a number of cables were fabricated with different keystone angles, packing factors and numbers of strands. The effect of these parameters was measured on Nb{sub 3}Sn strand performance and deformation for two different RRP designs. High and low field current carrying capabilities and RRR were measured for the extracted strands. To correlate strand deformation with performance, the former was measured for several cables and conditions as a function of the strand location in the cable cross section.

  1. Malignant cancer and invasive placentation

    PubMed Central

    D'Souza, Alaric W.; Wagner, Günter P.

    2014-01-01

    Cancer metastasis is an invasive process that involves the transplantation of cells into new environments. Since human placentation is also invasive, hypotheses about a relationship between invasive placentation in eutherian mammals and metastasis have been proposed. The relationship between metastatic cancer and invasive placentation is usually presented in terms of antagonistic pleiotropy. According to this hypothesis, evolution of invasive placentation also established the mechanisms for cancer metastasis. Here, in contrast, we argue that the secondary evolution of less invasive placentation in some mammalian lineages may have resulted in positive pleiotropic effects on cancer survival by lowering malignancy rates. These positive pleiotropic effects would manifest themselves as resistance to cancer cell invasion. To provide a preliminary test of this proposal, we re-analyze data from Priester and Mantel (Occurrence of tumors in domestic animals. Data from 12 United States and Canadian colleges of veterinary medicine. J Natl Cancer Inst 1971;47:1333-44) about malignancy rates in cows, horses, cats and dogs. From our analysis we found that equines and bovines, animals with less invasive placentation, have lower rates of metastatic cancer than felines and canines in skin and glandular epithelial cancers as well as connective tissue sarcomas. We conclude that a link between type of placentation and species-specific malignancy rates is more likely related to derived mechanisms that suppress invasion rather than different degrees of fetal placental aggressiveness. PMID:25324490

  2. Homologous DNA strand exchange activity of the human mitochondrial DNA helicase TWINKLE

    PubMed Central

    Sen, Doyel; Patel, Gayatri; Patel, Smita S.

    2016-01-01

    A crucial component of the human mitochondrial DNA replisome is the ring-shaped helicase TWINKLE—a phage T7-gene 4-like protein expressed in the nucleus and localized in the human mitochondria. Our previous studies showed that despite being a helicase, TWINKLE has unique DNA annealing activity. At the time, the implications of DNA annealing by TWINKLE were unclear. Herein, we report that TWINKLE uses DNA annealing function to actively catalyze strand-exchange reaction between the unwinding substrate and a homologous single-stranded DNA. Using various biochemical experiments, we demonstrate that the mechanism of strand-exchange involves active coupling of unwinding and annealing reactions by the TWINKLE. Unlike strand-annealing, the strand-exchange reaction requires nucleotide hydrolysis and greatly stimulated by short region of homology between the recombining DNA strands that promote joint molecule formation to initiate strand-exchange. Furthermore, we show that TWINKLE catalyzes branch migration by resolving homologous four-way junction DNA. These four DNA modifying activities of TWINKLE: strand-separation, strand-annealing, strand-exchange and branch migration suggest a dual role of TWINKLE in mitochondrial DNA maintenance. In addition to playing a major role in fork progression during leading strand DNA synthesis, we propose that TWINKLE is involved in recombinational repair of the human mitochondrial DNA. PMID:26887820

  3. The experimental evaluation of FBG sensors for strain measurement of prestressed steel strand

    NASA Astrophysics Data System (ADS)

    Li, Enbang; Xi, Jiangtao; Chicharo, Joe F.; Liu, Tiegen; Li, Xin; Jiang, Junfeng; Li, Lina; Wang, Yunxin; Zhang, Yimo

    2005-02-01

    Multi-wire steel strands have been widely used in various prestressed concrete structures. In this study, experimental evaluation of fiber Bragg grating (FBG) sensors for strain measurements in a seven-wire prestressed steel strand has been carried out. An installation technique of FBG sensors has been developed to fulfill the special requirements of the prestressed steel strand. The experiment results show that fiber Bragg gratings can represent the overall stress of the prestressed steel strand without being affected by the specific structure of the strand when it is only fixed on one wire. It is also demonstrated that the maximum strain that the FBG sensor can measure is 6260 μɛ, while the prestressed steel strand usually endures the strain greater than 10000 μɛ. This means that an offset of about 4000 μɛ is necessary to measure the maximum strain that the strand could experience in its applications.

  4. E. coli recA protein possesses a strand separating activity on short duplex DNAs.

    PubMed Central

    Bianchi, M; Riboli, B; Magni, G

    1985-01-01

    RecA protein was found to catalyze the dissociation of the strands of a DNA substrate consisting of a 20-nucleotide primer annealed to circular single-stranded M13mp DNA. The strand separation reaction requires ATP hydrolysis and the presence of single-stranded DNA flanking the duplex DNA region to be unwound. RecA-catalyzed strand separation is effective only for very short duplexes, not exceeding 30 bp, and is not stimulated by single-stranded DNA-binding protein. These results are consistent with the ability of recA protein to disrupt regions of secondary structure in single-stranded DNA and to incorporate large non-homologies into heteroduplex DNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 3. PMID:3905387

  5. Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

    PubMed

    Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

    2009-09-01

    Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

  6. Invasive and minimally invasive surgical techniques for back pain conditions.

    PubMed

    Lavelle, William; Carl, Allen; Lavelle, Elizabeth Demers

    2007-12-01

    This article summarizes current issues related to invasive and minimally invasive surgical techniques for back pain conditions. It describes pain generators and explains theories about how discs fail. The article discusses techniques for treating painful sciatica, painful motion segments, and spinal stenosis. Problems related to current imaging are also presented. The article concludes with a discussion about physical therapy.

  7. Dietary Flexibility Aids Asian Earthworm Invasion in North American Forests

    EPA Science Inventory

    On a local scale, invasiveness of introduced species and invasibility of habitats together determine invasion success. A key issue in invasion ecology has been how to quantify the contribution of species invasiveness and habitat invasibility separately. Conventional approaches, s...

  8. Dietary Flexibility Aids Asian Earthworm Invasion in North American Forests

    EPA Science Inventory

    On a local scale, invasiveness of introduced species and invasibility of habitats together determine invasion success. A key issue in invasion ecology has been how to quantify the contribution of species invasiveness and habitat invasibility separately. Conventional approaches, s...

  9. Transanal Minimally Invasive Surgery

    PubMed Central

    deBeche-Adams, Teresa; Nassif, George

    2015-01-01

    Transanal minimally invasive surgery (TAMIS) was first described in 2010 as a crossover between single-incision laparoscopic surgery and transanal endoscopic microsurgery (TEM) to allow access to the proximal and mid-rectum for resection of benign and early-stage malignant rectal lesions. The TAMIS technique can also be used for noncurative intent surgery of more advanced lesions in patients who are not candidates for radical surgery. Proper workup and staging should be done before surgical decision-making. In addition to the TAMIS port, instrumentation and set up include readily available equipment found in most operating suites. TAMIS has proven its usefulness in a wide range of applications outside of local excision, including repair of rectourethral fistula, removal of rectal foreign body, control of rectal hemorrhage, and as an adjunct in total mesorectal excision for rectal cancer. TAMIS is an easily accessible, technically feasible, and cost-effective alternative to TEM. PMID:26491410

  10. Defining an invasive species.

    PubMed

    Moutou, F; Pastoret, P P

    2010-04-01

    The definition of an invasive species will depend on the viewpoint of the observer, who in some cases may be responsible for introducing the species. History has taught us that humans are the species that has invaded the largest surface area of the planet. So, before going on to propose a few definitions, this article describes three different examples or types of example in which domestic animal species, wild animal species and microorganisms (for biological pest control) have been transported intentionally. By doing so, this paper uses a variety of situations to support the definitions. A contemporary argument would counter a strictly biogeographical definition with a more ecological definition. The two are probably complementary. In any case, these definitions should remain practical. The consequences of species movements vary. However, their health impacts should not be underestimated.

  11. Minimally invasive esophagectomy

    PubMed Central

    Herbella, Fernando A; Patti, Marco G

    2010-01-01

    Esophageal resection is associated with a high morbidity and mortality rate. Minimally invasive esophagectomy (MIE) might theoretically decrease this rate. We reviewed the current literature on MIE, with a focus on the available techniques, outcomes and comparison with open surgery. This review shows that the available literature on MIE is still crowded with heterogeneous studies with different techniques. There are no controlled and randomized trials, and the few retrospective comparative cohort studies are limited by small numbers of patients and biased by historical controls of open surgery. Based on the available literature, there is no evidence that MIE brings clear benefits compared to conventional esophagectomy. Increasing experience and the report of larger series might change this scenario. PMID:20698044

  12. Minimally invasive valve surgery.

    PubMed

    Woo, Y Joseph; Seeburger, Joerg; Mohr, Friedrich W

    2007-01-01

    As alternatives to standard sternotomy, surgeons have developed innovative, minimally invasive approaches to conducting valve surgery. Through very small skin incisions and partial upper sternal division for aortic valve surgery and right minithoracotomy for mitral surgery, surgeons have become adept at performing complex valve procedures. Beyond cosmetic appeal, apparent benefits range from decreased pain and bleeding to improved respiratory function and recovery time. The large retrospective studies and few small prospective randomized studies are herein briefly summarized. The focus is then directed toward describing specific intraoperative technical details in current clinical use, covering anesthetic preparation, incision, mediastinal access, cardiovascular cannulation, valve exposure, and valve reconstruction. Finally, unique situations such as pulmonic valve surgery, reoperations, beating heart surgery, and robotics are discussed.

  13. [Invasive gastroenteritis, anything new?].

    PubMed

    Echeita Sarrionandia, M Aurora; León, Silvia Herrera; Baamonde, Cristina Simón

    2011-03-01

    Invasive gastroenteritis is characterized by fever and inflammatory diarrhea and can be caused by nontyphoideal Salmonella serotypes and Shigella spp.-enteroinvasive Escherichia coli (EIEC), among other pathogens. This review describes emerging monophasic variants of Salmonella enterica serotype 1,4,[5],12:i:- and provides an evolutionary consideration of Shigella spp.-EIEC as a single pathotype. In 1997, a monophasic variant of S. enterica serotype 1,4,[5],12:i:-, phage-type U302, multidrug resistant (ACGSSuTSxT), lacking the fljBA operon, appeared in Spain constituting a "Spanish" clonal line. Subsequently, strains of S. 4[5],12:i:-, of different phage types with a new resistance genomic island (ASSuT) were detected in Italy, forming part of a European clonal line. Finally, an "American" clonal line with a deletion of fljBA different from the Spanish clonal line appeared. Therefore, probably by convergent evolution, different clonal lines of Salmonella 1,4,[5],12:i:-, which can carry resistance genes on chromosomes or plasmids, with Salmonella Typhimurium as ancestor, have emerged in the world. Although Shigella belongs to the E. coli species and despite the biological inconsistency involved, this genus has traditionally been considered to cause bacillary dysentery. The EIEC group shares virulence mechanisms and clinical manifestations with Shigella. Both lack some metabolic genes and harbor similar plasmids of invasion. Shigella spp. and EIEC evolved from independent clonal lines of E. coli, by horizontal acquisition of virulence factors, forming a single pathotype. IpaH gene detection is an alternative to attribute the corresponding pathogenic role to non-agglutinable strains that are biochemically compatible with Shigella spp.

  14. Integrated assessment of biological invasions

    USDA-ARS?s Scientific Manuscript database

    As the main annalists of the ecological and economic impacts of invasions on ecosystems around the world, ecologists should be able to provide information that can guide management practices. Managers often want to know about the potential for invasion of specific organisms in the sites under their ...

  15. Earthworm invasions in the tropics

    Treesearch

    Grizelle Gonzalez; Ching Yu Huang; Xiaoming Zou; Carlos Rodriguez

    2006-01-01

    The effects and implications of invasive species in belowground terrestrial ecosystems are not well known in comparison with aboveground terrestrial and marine environments. The study of earthworm invasions in the tropics is limited by a lack of taxonomic knowledge and the potential for loss of species in native habitats due to anthropogenic land use change. Alteration...

  16. Spread dynamics of invasive species.

    PubMed

    Arim, Matías; Abades, Sebastián R; Neill, Paula E; Lima, Mauricio; Marquet, Pablo A

    2006-01-10

    Species invasions are a principal component of global change, causing large losses in biodiversity as well as economic damage. Invasion theory attempts to understand and predict invasion success and patterns of spread. However, there is no consensus regarding which species or community attributes enhance invader success or explain spread dynamics. Experimental and theoretical studies suggest that regulation of spread dynamics is possible; however, the conditions for its existence have not yet been empirically demonstrated. If invasion spread is a regulated process, the structure that accounts for this regulation will be a main determinant of invasion dynamics. Here we explore the existence of regulation underlying changes in the rate of new site colonization. We employ concepts and analytical tools from the study of abundance dynamics and show that spread dynamics are, in fact, regulated processes and that the regulation structure is notably consistent among invasions occurring in widely different contexts. We base our conclusions on the analysis of the spread dynamics of 30 species invasions, including birds, amphibians, fish, invertebrates, plants, and a virus, all of which exhibited similar regulation structures. In contrast to current beliefs that species invasions are idiosyncratic phenomena, here we provide evidence that general patterns do indeed exist.

  17. Spread dynamics of invasive species

    PubMed Central

    Arim, Matías; Abades, Sebastián R.; Neill, Paula E.; Lima, Mauricio; Marquet, Pablo A.

    2006-01-01

    Species invasions are a principal component of global change, causing large losses in biodiversity as well as economic damage. Invasion theory attempts to understand and predict invasion success and patterns of spread. However, there is no consensus regarding which species or community attributes enhance invader success or explain spread dynamics. Experimental and theoretical studies suggest that regulation of spread dynamics is possible; however, the conditions for its existence have not yet been empirically demonstrated. If invasion spread is a regulated process, the structure that accounts for this regulation will be a main determinant of invasion dynamics. Here we explore the existence of regulation underlying changes in the rate of new site colonization. We employ concepts and analytical tools from the study of abundance dynamics and show that spread dynamics are, in fact, regulated processes and that the regulation structure is notably consistent among invasions occurring in widely different contexts. We base our conclusions on the analysis of the spread dynamics of 30 species invasions, including birds, amphibians, fish, invertebrates, plants, and a virus, all of which exhibited similar regulation structures. In contrast to current beliefs that species invasions are idiosyncratic phenomena, here we provide evidence that general patterns do indeed exist. PMID:16387862

  18. Three-dimensional Invasion of Human Glioblastoma Cells Remains Unchanged by X-ray and Carbon Ion Irradiation In Vitro

    SciTech Connect

    Eke, Iris; Storch, Katja; Kaestner, Ina; Vehlow, Anne; Faethe, Christina; Mueller-Klieser, Wolfgang; Taucher-Scholz, Gisela; Temme, Achim; Schackert, Gabriele

    2012-11-15

    Purpose: Cell invasion represents one of the major determinants that treatment has failed for patients suffering from glioblastoma. Contrary findings have been reported for cell migration upon exposure to ionizing radiation. Here, the migration and invasion capability of glioblastoma cells on and in collagen type I were evaluated upon irradiation with X-rays or carbon ions. Methods and Materials: Migration on and invasion in collagen type I were evaluated in four established human glioblastoma cell lines exposed to either X-rays or carbon ions. Furthermore, clonogenic radiation survival, proliferation (5-bromo-2-deoxyuridine positivity), DNA double-strand breaks ({gamma}H2AX/53BP1-positive foci), and expression of invasion-relevant proteins (eg, {beta}1 integrin, FAK, MMP2, and MMP9) were explored. Migration and invasion assays for primary glioblastoma cells also were carried out with X-ray irradiation. Results: Neither X-ray nor carbon ion irradiation affected glioblastoma cell migration and invasion, a finding similarly observed in primary glioblastoma cells. Intriguingly, irradiated cells migrated unhampered, despite DNA double-strand breaks and reduced proliferation. Clonogenic radiation survival was increased when cells had contact with extracellular matrix. Specific inhibition of the {beta}1 integrin or proliferation-associated signaling molecules revealed a critical function of JNK, PI3K, and p38 MAPK in glioblastoma cell invasion. Conclusions: These findings indicate that X-rays and carbon ion irradiation effectively reduce proliferation and clonogenic survival without modifying the migration and invasion ability of glioblastoma cells in a collagen type I environment. Addition of targeted agents against members of the MAPK and PI3K signaling axis to conventional chemoradiation therapy seems potentially useful to optimize glioblastoma therapy.

  19. Three-dimensional invasion of human glioblastoma cells remains unchanged by X-ray and carbon ion irradiation in vitro.

    PubMed

    Eke, Iris; Storch, Katja; Kästner, Ina; Vehlow, Anne; Faethe, Christina; Mueller-Klieser, Wolfgang; Taucher-Scholz, Gisela; Temme, Achim; Schackert, Gabriele; Cordes, Nils

    2012-11-15

    Cell invasion represents one of the major determinants that treatment has failed for patients suffering from glioblastoma. Contrary findings have been reported for cell migration upon exposure to ionizing radiation. Here, the migration and invasion capability of glioblastoma cells on and in collagen type I were evaluated upon irradiation with X-rays or carbon ions. Migration on and invasion in collagen type I were evaluated in four established human glioblastoma cell lines exposed to either X-rays or carbon ions. Furthermore, clonogenic radiation survival, proliferation (5-bromo-2-deoxyuridine positivity), DNA double-strand breaks (γH2AX/53BP1-positive foci), and expression of invasion-relevant proteins (eg, β1 integrin, FAK, MMP2, and MMP9) were explored. Migration and invasion assays for primary glioblastoma cells also were carried out with X-ray irradiation. Neither X-ray nor carbon ion irradiation affected glioblastoma cell migration and invasion, a finding similarly observed in primary glioblastoma cells. Intriguingly, irradiated cells migrated unhampered, despite DNA double-strand breaks and reduced proliferation. Clonogenic radiation survival was increased when cells had contact with extracellular matrix. Specific inhibition of the β1 integrin or proliferation-associated signaling molecules revealed a critical function of JNK, PI3K, and p38 MAPK in glioblastoma cell invasion. These findings indicate that X-rays and carbon ion irradiation effectively reduce proliferation and clonogenic survival without modifying the migration and invasion ability of glioblastoma cells in a collagen type I environment. Addition of targeted agents against members of the MAPK and PI3K signaling axis to conventional chemoradiation therapy seems potentially useful to optimize glioblastoma therapy. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Heavy Metal Exposure Influences Double Strand Break DNA Repair Outcomes.

    PubMed

    Morales, Maria E; Derbes, Rebecca S; Ade, Catherine M; Ortego, Jonathan C; Stark, Jeremy; Deininger, Prescott L; Roy-Engel, Astrid M

    2016-01-01

    Heavy metals such as cadmium, arsenic and nickel are classified as carcinogens. Although the precise mechanism of carcinogenesis is undefined, heavy metal exposure can contribute to genetic damage by inducing double strand breaks (DSBs) as well as inhibiting critical proteins from different DNA repair pathways. Here we take advantage of two previously published culture assay systems developed to address mechanistic aspects of DNA repair to evaluate the effects of heavy metal exposures on competing DNA repair outcomes. Our results demonstrate that exposure to heavy metals significantly alters how cells repair double strand breaks. The effects observed are both specific to the particular metal and dose dependent. Low doses of NiCl2 favored resolution of DSBs through homologous recombination (HR) and single strand annealing (SSA), which were inhibited by higher NiCl2 doses. In contrast, cells exposed to arsenic trioxide preferentially repaired using the "error prone" non-homologous end joining (alt-NHEJ) while inhibiting repair by HR. In addition, we determined that low doses of nickel and cadmium contributed to an increase in mutagenic recombination-mediated by Alu elements, the most numerous family of repetitive elements in humans. Sequence verification confirmed that the majority of the genetic deletions were the result of Alu-mediated non-allelic recombination events that predominantly arose from repair by SSA. All heavy metals showed a shift in the outcomes of alt-NHEJ repair with a significant increase of non-templated sequence insertions at the DSB repair site. Our data suggest that exposure to heavy metals will alter the choice of DNA repair pathway changing the genetic outcome of DSBs repair.

  1. Prostate brachytherapy postimplant dosimetry: Automatic plan reconstruction of stranded implants

    SciTech Connect

    Chng, N.; Spadinger, I.; Morris, W. J.; Usmani, N.; Salcudean, S.

    2011-01-15

    Purpose: Plan reconstruction for permanent implant prostate brachytherapy is the process of determining the correspondence between planned and implanted seeds in postimplant analysis. Plan reconstruction informs many areas of brachytherapy quality assurance, including the verification of seed segmentation, misplacement and migration assessment, implant simulations, and the dosimetry of mixed-activity or mixed-species implants. Methods: An algorithm has been developed for stranded implants which uses the interseed spacing constraints imposed by the suture to improve the accuracy of reconstruction. Seventy randomly selected clinical cases with a mean of 23.6 (range 18-30) needles and mean density of 2.0 (range 1.6-2.6) 2.0 (range 1.6-2.6) seeds/cm{sup 3} were automatically reconstructed and the accuracy compared to manual reconstructions performed using a custom 3D graphical interface. Results: Using the automatic algorithm, the mean accuracy of the assignment relative to manual reconstruction was found to be 97.7{+-}0.5%. Fifty-two of the 70 cases (74%) were error-free; of seeds in the remaining cases, 96.7{+-}0.3% were found to be attributed to the correct strand and 97.0{+-}0.3% were correctly connected to their neighbors. Any necessary manual correction using the interface is usually straightforward. For the clinical data set tested, neither the number of seeds or needles, average density, nor the presence of clusters was found to have an effect on reconstruction accuracy using this method. Conclusions: Routine plan reconstruction of stranded implants can be performed with a high degree of accuracy to support postimplant dosimetry and quality analyses.

  2. DNA in motion during double-strand break repair.

    PubMed

    Miné-Hattab, Judith; Rothstein, Rodney

    2013-11-01

    DNA organization and dynamics profoundly affect many biological processes such as gene regulation and DNA repair. In this review, we present the latest studies on DNA mobility in the context of DNA damage. Recent studies demonstrate that DNA mobility is dramatically increased in the presence of double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae. As a consequence, chromosomes explore a larger nuclear volume, facilitating homologous pairing but also increasing the rate of ectopic recombination. Increased DNA dynamics is dependent on several homologous recombination (HR) proteins and we are just beginning to understand how chromosome dynamics is regulated after DNA damage.

  3. Acoustic emission strand burning technique for motor burning rate prediction

    NASA Technical Reports Server (NTRS)

    Christensen, W. N.

    1978-01-01

    An acoustic emission (AE) method is being used to measure the burning rate of solid propellant strands. This method has a precision of 0.5% and excellent burning rate correlation with both subscale and large rocket motors. The AE procedure burns the sample under water and measures the burning rate from the acoustic output. The acoustic signal provides a continuous readout during testing, which allows complete data analysis rather than the start-stop clockwires used by the conventional method. The AE method helps eliminate such problems as inhibiting the sample, pressure increase and temperature rise, during testing.

  4. Strand Breaks in DNA Samples Induced with LASERIX

    NASA Astrophysics Data System (ADS)

    Zielbauer, B.; Habib, J.; Kazamias, S.; Guilbaud, O.; Pittman, M.; Ros, D.; Hervé Du Penhoat, M.-A.; Touati, A.; Sech, C. Le; Porcel, E.; Lacombe, S.

    Samples of plasmid DNA were irradiated with pulsed 18.9 nm radiation originating from a Mo X-ray laser pumped in GRIP configuration at the LASERIX facility [1]. Surface doses of up to 500 kGray were delivered with a repetition rate of 10 Hz and average pulse energy of 200 nJ. The occurrence of single and double strand breaks not present in controls having undergone the same treatment except for the XRL irradiation can be seen as a clear effect of the XRL irradiation. This confirms the role of direct effects in DNA damages as previously seen with low energy ions [2, 3] and electrons.

  5. Herpetic keratoconjunctivitis: Therapy with synthetic double-stranded RNA

    USGS Publications Warehouse

    Friedman, I.; Evans, C.; Meighan, C.W.; Foote, L.J.; Aiello, P.V.; Park, J.H.; Baron, S.

    1968-01-01

    A study was undertaken in rabbits to determine how late in the course of keratoconjunctivitis caused by herpes simplex recovery could be effected by an inducer of interferon. Interferon was induced by means of synthetic double-stranded RNA copolymer formed with polynosinic acid : polycytidilic acid RNA. Therapy promotes recovery from severe and fully established keratoconjunctivitis for which treatment was begun as late as 3 days after virus inoculation. No drug toxicity was observed in the therapeutic dose range. These findings further support the proposed role of the interferon mechanism in the natural recovery of already established viral infection. They also suggest the usefulness of interferon inducers in viral infections of man.

  6. Chromatin organization and dynamics in double-strand break repair.

    PubMed

    Seeber, Andrew; Gasser, Susan M

    2016-10-31

    Chromatin is organized and segmented into a landscape of domains that serve multiple purposes. In contrast to transcription, which is controlled by defined sequences at distinct sites, DNA damage can occur anywhere. Repair accordingly must occur everywhere, yet it is inevitably affected by its chromatin environment. In this review, we summarize recent work investigating how changes in chromatin organization facilitate and/or guide DNA double-strand break repair. In addition, we examine new live cell studies on the dynamics of chromatin and the mechanisms that regulate its movement.

  7. Nucleosome remodelers in double-strand break repair.

    PubMed

    Seeber, Andrew; Hauer, Michael; Gasser, Susan M

    2013-04-01

    ATP-dependent nucleosome remodelers use ATP hydrolysis to shift, evict and exchange histone dimers or octamers and have well-established roles in transcription. Earlier work has suggested a role for nucleosome remodelers such as INO80 in double-strand break (DSB) repair. This review will begin with an update on recent studies that explore how remodelers are recruited to DSBs. We then examine their impact on various steps of repair, focusing on resection and the formation of the Rad51-ssDNA nucleofilament. Finally, we will explore new studies that implicate remodelers in the physical movement of chromatin in response to damage.

  8. Adenosine triphosphatases of thermophilic archaeal double-stranded DNA viruses

    PubMed Central

    2014-01-01

    Adenosine triphosphatases (ATPases) of double-stranded (ds) DNA archaeal viruses are structurally related to the AAA+ hexameric helicases and translocases. These ATPases have been implicated in viral life cycle functions such as DNA entry into the host, and viral genome packaging into preformed procapsids. We summarize bioinformatical analyses of a wide range of archaeal ATPases, and review the biochemical and structural properties of those archaeal ATPases that have measurable ATPase activity. We discuss their potential roles in genome delivery into the host, virus assembly and genome packaging in comparison to hexameric helicases and packaging motors from bacteriophages. PMID:25105011

  9. Strict rules determine arrangements of strands in sandwich proteins

    PubMed Central

    Kister, A. E.; Fokas, A. S.; Papatheodorou, T. S.; Gelfand, I. M.

    2006-01-01

    From a computer analysis of the spatial organization of the secondary structures of β-sandwich proteins, we find certain sets of consecutive strands that are connected by hydrogen bonds, which we call “strandons.” The analysis of the arrangements of strandons in 491 protein structures that come from 69 different superfamilies reveals strict regularities in the arrangements of strandons and the formation of what we call “canonical supermotifs.” Six such supermotifs account for ≈90% of all observed structures. Simple geometric rules are described that dictate the formation of these supermotifs. PMID:16537492

  10. The growing problem of stranded used nuclear fuel.

    PubMed

    Alley, William M; Alley, Rosemarie

    2014-02-18

    By 2050, almost all U.S. nuclear reactors will have reached their 60 year maximum expected life. Many will shut down sooner. With no assurance that the current approach for finding a geologic repository or interim storage sites will succeed, used nuclear fuel could be stranded indefinitely at more than 70 sites in 35 states. Societal discussions about the future of nuclear waste should be framed in terms of the relative risks of all alternatives. We review and compare onsite storage, interim storage, and a geologic repository, as well as how these alternatives are presented to the public.

  11. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  12. Structure of a group A streptococcal phage-encoded virulence factor reveals a catalytically active triple-stranded beta-helix.

    PubMed

    Smith, Nicola L; Taylor, Edward J; Lindsay, Anna-Marie; Charnock, Simon J; Turkenburg, Johan P; Dodson, Eleanor J; Davies, Gideon J; Black, Gary W

    2005-12-06

    Streptococcus pyogenes (group A Streptococcus) causes severe invasive infections including scarlet fever, pharyngitis (streptococcal sore throat), skin infections, necrotizing fasciitis (flesh-eating disease), septicemia, erysipelas, cellulitis, acute rheumatic fever, and toxic shock. The conversion from nonpathogenic to toxigenic strains of S. pyogenes is frequently mediated by bacteriophage infection. One of the key bacteriophage-encoded virulence factors is a putative "hyaluronidase," HylP1, a phage tail-fiber protein responsible for the digestion of the S. pyogenes hyaluronan capsule during phage infection. Here we demonstrate that HylP1 is a hyaluronate lyase. The 3D structure, at 1.8-angstroms resolution, reveals an unusual triple-stranded beta-helical structure and provides insight into the structural basis for phage tail assembly and the role of phage tail proteins in virulence. Unlike the triple-stranded beta-helix assemblies of the bacteriophage T4 injection machinery and the tailspike endosialidase of the Escherichia coli K1 bacteriophage K1F, HylP1 possesses three copies of the active center on the triple-helical fiber itself without the need for an accessory catalytic domain. The triple-stranded beta-helix is not simply a structural scaffold, as previously envisaged; it is harnessed to provide a 200-angstroms-long substrate-binding groove for the optimal reduction in hyaluronan viscosity to aid phage penetration of the capsule.

  13. Caenorhabditis elegans ALG-1 antimorphic mutations uncover functions for Argonaute in microRNA guide strand selection and passenger strand disposal.

    PubMed

    Zinovyeva, Anna Y; Veksler-Lublinsky, Isana; Vashisht, Ajay A; Wohlschlegel, James A; Ambros, Victor R

    2015-09-22

    MicroRNAs are regulators of gene expression whose functions are critical for normal development and physiology. We have previously characterized mutations in a Caenorhabditis elegans microRNA-specific Argonaute ALG-1 (Argonaute-like gene) that are antimorphic [alg-1(anti)]. alg-1(anti) mutants have dramatically stronger microRNA-related phenotypes than animals with a complete loss of ALG-1. ALG-1(anti) miRISC (microRNA induced silencing complex) fails to undergo a functional transition from microRNA processing to target repression. To better understand this transition, we characterized the small RNA and protein populations associated with ALG-1(anti) complexes in vivo. We extensively characterized proteins associated with wild-type and mutant ALG-1 and found that the mutant ALG-1(anti) protein fails to interact with numerous miRISC cofactors, including proteins known to be necessary for target repression. In addition, alg-1(anti) mutants dramatically overaccumulated microRNA* (passenger) strands, and immunoprecipitated ALG-1(anti) complexes contained nonstoichiometric yields of mature microRNA and microRNA* strands, with some microRNA* strands present in the ALG-1(anti) Argonaute far in excess of the corresponding mature microRNAs. We show complex and microRNA-specific defects in microRNA strand selection and microRNA* strand disposal. For certain microRNAs (for example mir-58), microRNA guide strand selection by ALG-1(anti) appeared normal, but microRNA* strand release was inefficient. For other microRNAs (such as mir-2), both the microRNA and microRNA* strands were selected as guide by ALG-1(anti), indicating a defect in normal specificity of the strand choice. Our results suggest that wild-type ALG-1 complexes recognize structural features of particular microRNAs in the context of conducting the strand selection and microRNA* ejection steps of miRISC maturation.

  14. Caenorhabditis elegans ALG-1 antimorphic mutations uncover functions for Argonaute in microRNA guide strand selection and passenger strand disposal

    PubMed Central

    Zinovyeva, Anna Y.; Veksler-Lublinsky, Isana; Vashisht, Ajay A.; Wohlschlegel, James A.; Ambros, Victor R.

    2015-01-01

    MicroRNAs are regulators of gene expression whose functions are critical for normal development and physiology. We have previously characterized mutations in a Caenorhabditis elegans microRNA-specific Argonaute ALG-1 (Argonaute-like gene) that are antimorphic [alg-1(anti)]. alg-1(anti) mutants have dramatically stronger microRNA-related phenotypes than animals with a complete loss of ALG-1. ALG-1(anti) miRISC (microRNA induced silencing complex) fails to undergo a functional transition from microRNA processing to target repression. To better understand this transition, we characterized the small RNA and protein populations associated with ALG-1(anti) complexes in vivo. We extensively characterized proteins associated with wild-type and mutant ALG-1 and found that the mutant ALG-1(anti) protein fails to interact with numerous miRISC cofactors, including proteins known to be necessary for target repression. In addition, alg-1(anti) mutants dramatically overaccumulated microRNA* (passenger) strands, and immunoprecipitated ALG-1(anti) complexes contained nonstoichiometric yields of mature microRNA and microRNA* strands, with some microRNA* strands present in the ALG-1(anti) Argonaute far in excess of the corresponding mature microRNAs. We show complex and microRNA-specific defects in microRNA strand selection and microRNA* strand disposal. For certain microRNAs (for example mir-58), microRNA guide strand selection by ALG-1(anti) appeared normal, but microRNA* strand release was inefficient. For other microRNAs (such as mir-2), both the microRNA and microRNA* strands were selected as guide by ALG-1(anti), indicating a defect in normal specificity of the strand choice. Our results suggest that wild-type ALG-1 complexes recognize structural features of particular microRNAs in the context of conducting the strand selection and microRNA* ejection steps of miRISC maturation. PMID:26351692

  15. 75 FR 38977 - Pre-Stressed Concrete Steel Wire Strand from the People's Republic of China: Notice of Amended...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-07

    ... International Trade Administration Pre-Stressed Concrete Steel Wire Strand from the People's Republic of China... concrete steel wire strand (PC strand) from the People's Republic of China (PRC). On June 22, 2010, the ITC...-Stressed Concrete Steel Wire Strand from the People's Republic of China, USITC Pub. 4162, Inv. Nos....

  16. Language Variation and Change in the Australian Curriculum English: Integrating Sub-Strands through a Pedagogy of Metalogue

    ERIC Educational Resources Information Center

    Willis, Linda-Dianne; Exley, Beryl

    2016-01-01

    The Language Strand of the Australian Curriculum: English (Australian Curriculum, Assessment & Reporting Authority (ACARA), 2016b) includes the sub-strand of "Language Variation and Change". This sub-strand is a marked space for discovery and discussion of the history and politics of language use. As such, this sub-strand points to…

  17. Language Variation and Change in the Australian Curriculum English: Integrating Sub-Strands through a Pedagogy of Metalogue

    ERIC Educational Resources Information Center

    Willis, Linda-Dianne; Exley, Beryl

    2016-01-01

    The Language Strand of the Australian Curriculum: English (Australian Curriculum, Assessment & Reporting Authority (ACARA), 2016b) includes the sub-strand of "Language Variation and Change". This sub-strand is a marked space for discovery and discussion of the history and politics of language use. As such, this sub-strand points to…

  18. Verification and validation of the Spalart-Allmaras turbulence model for strand grids

    NASA Astrophysics Data System (ADS)

    Tong, Oisin

    The strand-Cartesian grid approach provides many advantages for complex moving- body flow simulations, including fully-automatic volume grid generation, highly scalable domain connectivity, and high-order accuracy. In this work the Spalart-Allmaras model is implemented, verified, and validated for high Reynolds number turbulent flows in a strand- Cartesian solver. Second-order convergence is achieved using the Method of Manufactured Solutions implying correct implementation of the turbulence model. By using the NASA- Langley online resource, specific flow cases are validated with two independent compressible codes: FUN3D and CFL3D. The strand solver is validated with zero-pressure gradient flat plate and bump-in-channel cases, and shows excellent agreement with FUN3D and CFL3D for various aspects of turbulent flow, including: velocity profiles, turbulent viscosity profile, coefficient of surface pressure, and drag. Methods of handling sharp corners with strand grids through combinations of strand vector smoothing, multiple strands emanating from a single surface node, and telescoping Cartesian refinement into corner regions of the near- body grid are investigated for a NACA 0012 case. For standard viscous high-aspect ratio grids, smoothed strands with telescoping Cartesian refinement provide the most accurate results with the least complexity. Mesh discontinuities associated with use of multiple strands at sharp corners produce more error than with smoothed strands. With both strand approaches -- vector smoothing and multiple strands -- targeted Cartesian refinement is critical to capture features near sharp corners where strand grids alone are too coarse to capture. Other results show agreement with FUN3D and CFL3D. By using strand vector smoothing and telescoping Cartesian refinement, a NACA 4412 trailing edge separation case is validated with comparison against CFL3D and FUN3D. Velocity profiles show reasonable agreement with CFL3D; however implementing

  19. Mechanical behaviors of multi-filament twist superconducting strand under tensile and cyclic loading

    NASA Astrophysics Data System (ADS)

    Wang, Xu; Li, Yingxu; Gao, Yuanwen

    2016-01-01

    The superconducting strand, serving as the basic unit cell of the cable-in-conduit-conductors (CICCs), is a typical multi-filament twist composite which is always subjected to a cyclic loading under the operating condition. Meanwhile, the superconducting material Nb3Sn in the strand is sensitive to strain frequently relating to the performance degradation of the superconductivity. Therefore, a comprehensive study on the mechanical behavior of the strand helps understanding the superconducting performance of the strained Nb3Sn strands. To address this issue, taking the LMI (internal tin) strand as an example, a three-dimensional structural finite element model, named as the Multi-filament twist model, of the strand with the real configuration of the LMI strand is built to study the influences of the plasticity of the component materials, the twist of the filament bundle, the initial thermal residual stress and the breakage and its evolution of the filaments on the mechanical behaviors of the strand. The effective properties of superconducting filament bundle with random filament breakage and its evolution versus strain are obtained based on the damage theory of fiber-reinforced composite materials proposed by Curtin and Zhou. From the calculation results of this model, we find that the occurrence of the hysteresis loop in the cyclic loading curve is determined by the reverse yielding of the elastic-plastic materials in the strand. Both the initial thermal residual stress in the strand and the pitch length of the filaments have significant impacts on the axial and hysteretic behaviors of the strand. The damage of the filaments also affects the axial mechanical behavior of the strand remarkably at large axial strain. The critical current of the strand is calculated by the scaling law with the results of the Multi-filament twist model. The predicted results of the Multi-filament twist model show an acceptable agreement with the experiment.

  20. 75 FR 29359 - Invasive Species Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-25

    .../coastal environments in the world, with over 50 invasive species that threaten the Bay's vibrant economy... within invasive species efforts, ballast water related issues, and the development of state invasive...

  1. Targeted guanine oxidation by a dinuclear copper(II) complex at single stranded/double stranded DNA junctions.

    PubMed

    Li, Lei; Murthy, Narasimha N; Telser, Joshua; Zakharov, Lev N; Yap, Glenn P A; Rheingold, Arnold L; Karlin, Kenneth D; Rokita, Steven E

    2006-09-04

    A dinuclear copper(II) complex [Cu(II)2(PD'O-)(H2O)2](ClO4)3 (5) with terminal Cu(II)-H(2)O moieties and a Cu...Cu distance of 4.13 A (X-ray structure) has been synthesized and characterized by EPR spectroscopy (ferromagnetic coupling observed) and cyclic voltammetry. Dizinc(II) and mononuclear copper(II) analogues [Zn(II)2(PD'O-)(H2O)2]3+ (7) and [Cu(II)(mPD'OH)(H2O)]2+ (6), respectively, have also been synthesized and structurally characterized. Reacting 5/MPA/O(2) (MPA = 3-mercaptopropionic acid) with DNA leads to a highly specific oxidation of guanine (G) at a junction between single- and double-stranded DNA. Mass spectrometric analysis of the major products indicates a gain of +18 and +34 amu relative to initial DNA strands. The most efficient reaction requires G at the first and second unpaired positions of each strand extending from the junction. Less reaction is observed for analogous targets in which the G cluster is farther from the junction or contains less than four Gs. Consistent with our previous systems, the multinuclear copper center is required for selective reaction; mononuclear complex 6 is not effective. Hydrogen peroxide as a substitute for MPA/O2 also does not lead to activity. Structural analysis of a [Cu(II)2(PD'O-)(G)]3+ complex (8) and dizinc analogue [Zn(II)(2)(PD'O-)(G)](ClO4)3 (9) (G = guanosine) reveals coordination of the G O6 and N7 atoms with the two copper (or zinc) centers and suggests that copper-G coordination likely plays a role in recognition of the DNA target. The Cu2-O2 intermediate responsible for guanine oxidation appears to be different from that responsible for direct-strand scission induced by other multinuclear copper complexes; the likely course of reaction is discussed.

  2. The fauna and rate of degradation of stranded kelp

    NASA Astrophysics Data System (ADS)

    Griffiths, C. L.; Stenton-Dozey, J.

    1981-06-01

    The moisture content, residual dry mass and fauna associated with kelp stranded on a South African beach were monitored for 30 days following its deposition. Plants that were cast up separately dried much more rapidly, but declined in dry mass more slowly, than those deposited in banks. Both types of deposit lost at least half their dry mass within the first 7 days. The fauna colonizing the two types of wrack was similar, a total of 22 species of Coleoptera, three Diptera and two Amphipoda being recorded. Amphipoda and Diptera dominated the early successional stages, but only Coleoptera colonized older, direr wrack. Amphipoda were dramatically more abundant in wrack banks, as compared with single plants. Calculated consumption rates of the fauna were compared with actual declines in kelp mass and showed a good correlation in the case of banked material. Single plants, however, lacked the expected biomass of consumers, probably because Amphipoda, the most important forms, desert single plants by day and migrate below the sand, and are underestimated in a diurnal sampling programme. The role of stranded kelp in enriching the economy of sandy beaches and adjoining marine ecosystems is considered.

  3. Interfacial and emulsifying properties of designed β-strand peptides.

    PubMed

    Dexter, Annette F

    2010-12-07

    The structural and surfactant properties of a series of amphipathic β-strand peptides have been studied as a function of pH. Each nine-residue peptide has a framework of hydrophobic proline and phenylalanine amino acid residues, alternating with acidic or basic amino acids to give a sequence closely related to known β-sheet formers. Surface activity, interfacial mechanical properties, electronic circular dichroism (ECD), droplet sizing and zeta potential measurements were used to gain an overview of the peptide behavior as the molecular charge varied from ±4 to 0 with pH. ECD data suggest that the peptides form polyproline-type helices in bulk aqueous solution when highly charged, but may fold to β-hairpins rather than β-sheets when uncharged. In the uncharged state, the peptides adsorb readily at a macroscopic fluid interface to form mechanically strong interfacial films, but tend to give large droplet sizes on emulsification, apparently due to flocculation at a low droplet zeta potential. In contrast, highly charged peptide states gave a low interfacial coverage, but retained good emulsifying activity as judged by droplet size. Best emulsification was generally seen for intermediate charged states of the peptides, possibly representing a compromise between droplet zeta potential and interfacial binding affinity. The emulsifying properties of β-strand peptides have not been previously reported. Understanding the interfacial properties of such peptides is important to their potential development as biosurfactants.

  4. The RNA synthesis machinery of negative-stranded RNA viruses

    SciTech Connect

    Ortín, Juan; Martín-Benito, Jaime

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  5. Giant Stark effect in double-stranded porphyrin ladder polymers

    NASA Astrophysics Data System (ADS)

    Pramanik, Anup; Kang, Hong Seok

    2011-03-01

    Using the first-principles calculations, we have investigated the stability and the electronic structure of two types of recently synthesized one-dimensional nanoribbons, i.e., double-stranded zinc(II) porphyrin ladder polymer (LADDER) arrays. First, electronic structure calculations were used to show that the LADDER is a semiconductor. Most importantly, the application of a transverse electric field significantly reduces the band gap of the LADDER, ultimately converting the LADDER to a metal at a field strength of 0.1 V/Å. The giant Stark effect in this case is almost as strong as that in boron nitride nanotubes and nanoribbons. In the presence of an electric field, hole conduction and electronic conduction will occur entirely through spatially separated strands, rendering these materials useful for nanoelectronic devices. Second, the substitution of hydrogen atoms in the porphyrin units or that of zinc ions with other kinds of chemical species is found to increase the binding strength of the LADDER and reduce the band gap.

  6. A double-strand break can trigger immunoglobulin gene conversion

    PubMed Central

    Bastianello, Giulia; Arakawa, Hiroshi

    2017-01-01

    All three B cell-specific activities of the immunoglobulin (Ig) gene re-modeling system—gene conversion, somatic hypermutation and class switch recombination—require activation-induced deaminase (AID). AID-induced DNA lesions must be further processed and dissected into different DNA recombination pathways. In order to characterize potential intermediates for Ig gene conversion, we inserted an I-SceI recognition site into the complementarity determining region 1 (CDR1) of the Ig light chain locus of the AID knockout DT40 cell line, and conditionally expressed I-SceI endonuclease. Here, we show that a double-strand break (DSB) in CDR1 is sufficient to trigger Ig gene conversion in the absence of AID. The pattern and pseudogene usage of DSB-induced gene conversion were comparable to those of AID-induced gene conversion; surprisingly, sometimes a single DSB induced multiple gene conversion events. These constitute direct evidence that a DSB in the V region can be an intermediate for gene conversion. The fate of the DNA lesion downstream of a DSB had more flexibility than that of AID, suggesting two alternative models: (i) DSBs during the physiological gene conversion are in the minority compared to single-strand breaks (SSBs), which are frequently generated following DNA deamination, or (ii) the physiological gene conversion is mediated by a tightly regulated DSB that is locally protected from non-homologous end joining (NHEJ) or other non-homologous DNA recombination machineries. PMID:27701075

  7. Dynamics of single-stranded DNA tethered to a solid

    NASA Astrophysics Data System (ADS)

    Radiom, Milad; Paul, Mark R.; Ducker, William A.

    2016-06-01

    Tethering is used to deliver specific biological and industrial functions. For example, single-stranded DNA (ssDNA) is tethered to polymerases and long sequences of double-stranded DNA (dsDNA) during replication, and to solids in DNA microarrays. However, tethering ssDNA to a large object limits not only the available ssDNA conformations, but also the range of time-scales over which the mechanical responses of ssDNA are important. In this work we examine the effect of tethering by measurement of the mechanical response of ssDNA that is tethered at each end to two separate atomic force microscope cantilevers in aqueous solution. Thermal motion of the cantilevers drives the ends of the ssDNA chain at frequencies near 2 kHz. The presence of a tethered molecule makes a large difference to the asymmetric cross-correlation of two cantilevers, which enables resolution of the mechanical properties in our experiments. By analysis of the correlated motion of the cantilevers we extract the friction and stiffness of the ssDNA. We find that the measured friction is much larger than the friction that is usually associated with the unencumbered motion of ssDNA. We also find that the measured relaxation time, ∼30 μs, is much greater than prior measurements of the free-molecule relaxation time. We attribute the difference to the loss of conformational possibilities as a result of constraining the ends of the ssDNA.

  8. RNA mapping on Drosophila mitochondrial DNA: precursors and template strands.

    PubMed Central

    Berthier, F; Renaud, M; Alziari, S; Durand, R

    1986-01-01

    Drosophila melanogaster mitochondrial DNA (mtDNA) is closely related to the mammalian and amphibian mtDNA except for gene organization. In Drosophila, genes are distributed in clusters alternatively coded on each strand. Besides the eleven major foreseeable transcripts previously described (MERTEN and PARDUE, 1981, J. Mol. Biol., 153, 1-21), we have characterized two poly A+ transcripts, one major and one minor which could correspond respectively to the ND3 and ND6 reading frames, and 27 poly A+ minor transcripts (0.2 to greater than 3.2 kb) which are distributed along the mtDNA except in the rRNAs, ND 1 and A+ T rich regions. The mapping and length of 25 of these transcripts strongly suggest a precursor role. They would be processed at the level of tRNA or tRNA-like sequences. Most of them are transcribed from the template strand of each gene cluster and their distribution is in agreement with the hypothesis of several transcription origins and terminations located near the extremities of each gene cluster. Quantitatively our results show a large variation in each presumptive mature transcript compared to the other, even in a given gene cluster, suggesting a specific degradation of some of the mature transcripts. Images PMID:3086843

  9. DNA strand scission induced by adriamycin and aclacinomycin A.

    PubMed

    Someya, A; Tanaka, N

    1979-08-01

    The binding of adriamycin and aclacinomycin A with PM2 DNA, and the consequent cleavage of DNA have been demonstrated by agarose gel electrophoresis, using an ethidium bromide assay. Adriamycin was observed to induce a single strand scission of DNA in the presence of a reducing agent, but aclacinomycin A caused much less degree of DNA breaks. The DNA cleavage was enhanced by Cu2+ and Fe2+, but not significantly by Ni2+, Zn2+, Mg2+ and Ca2+, suggesting that reduction and auto-oxidation of the quinone moiety and H2O2 production participate in the DNA-cutting effect. The DNA degradation was dependent upon concentrations of the anthracyclines and CuCl2. The degree of DNA cleavage at 0.04 mM adriamycin was similar to that at 0.4 mM aclacinomycin A in the presence of 1 mM NADPH and 0.4 mM CuCl2. DNA was degraded to small fragments at 0.4 mM adriamycin and 0.2 mM CuCl2. The anthracycline-induced DNA cleavage was stimulated by H2O2, but partially inhibited by potassium iodide, superoxide dismutase, catalase and nitrogen gas atmosphere. The results suggested that both free radical of anthracycline quinones and hydroxyl radical directly react with DNA strands.

  10. Characterization of CRISPR RNA transcription by exploiting stranded metatranscriptomic data.

    PubMed

    Ye, Yuzhen; Zhang, Quan

    2016-07-01

    CRISPR-Cas systems are bacterial adaptive immune systems, each typically composed of a locus of cas genes and a CRISPR array of spacers flanked by repeats. Processed transcripts of CRISPR arrays (crRNAs) play important roles in the interference process mediated by these systems, guiding targeted immunity. Here we developed computational approaches that allow us to characterize the expression of many CRISPRs in their natural environments, using community RNA-seq (metatranscriptomic) data. By exploiting public human gut metatranscriptomic data sets, we studied the expression of 56 repeat-sequence types of CRISPRs, revealing that most CRISPRs are transcribed in one direction (producing crRNAs). In rarer cases, including a type II system associated with Bacteroides fragilis, CRISPRs are transcribed in both directions. Type III CRISPR-Cas systems were found in the microbiomes, but metatranscriptomic reads were barely found for their CRISPRs. We observed individual-level variation of the crRNA transcription, and an even greater transcription of a CRISPR from the antisense strand than the crRNA strand in one sample. The orientations of CRISPR expression implicated by metatranscriptomic data are largely in agreement with prior predictions for CRISPRs, with exceptions. Our study shows the promise of exploiting community RNA-seq data for investigating the transcription of CRISPR-Cas systems. © 2016 Ye and Zhang; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Chromatin modifications and DNA repair: beyond double-strand breaks

    PubMed Central

    House, Nealia C. M.; Koch, Melissa R.; Freudenreich, Catherine H.

    2014-01-01

    DNA repair must take place in the context of chromatin, and chromatin modifications and DNA repair are intimately linked. The study of double-strand break repair has revealed numerous histone modifications that occur after induction of a DSB, and modification of the repair factors themselves can also occur. In some cases the function of the modification is at least partially understood, but in many cases it is not yet clear. Although DSB repair is a crucial activity for cell survival, DSBs account for only a small percentage of the DNA lesions that occur over the lifetime of a cell. Repair of single-strand gaps, nicks, stalled forks, alternative DNA structures, and base lesions must also occur in a chromatin context. There is increasing evidence that these repair pathways are also regulated by histone modifications and chromatin remodeling. In this review, we will summarize the current state of knowledge of chromatin modifications that occur during non-DSB repair, highlighting similarities and differences to DSB repair as well as remaining questions. PMID:25250043

  12. Single-Stranded DNA Curtains for Studying Homologous Recombination.

    PubMed

    Ma, C J; Steinfeld, J B; Greene, E C

    2017-01-01

    Homologous recombination is an important pathway involved in the repair of double-stranded DNA breaks. Genetic studies form the foundation of our knowledge on homologous recombination. Significant progress has also been made toward understanding the biochemical and biophysical properties of the proteins, complexes, and reaction intermediates involved in this essential DNA repair pathway. However, heterogeneous or transient recombination intermediates remain extremely difficult to assess through traditional ensemble methods, leaving an incomplete mechanistic picture of many steps that take place during homologous recombination. To help overcome some of these limitations, we have established DNA curtain methodologies as an experimental platform for studying homologous DNA recombination in real-time at the single-molecule level. Here, we present a detailed overview describing the preparation and use of single-stranded DNA curtains in applications related to the study of homologous DNA recombination with emphasis on recent work related to the study of the eukaryotic recombinase Rad51. © 2017 Elsevier Inc. All rights reserved.

  13. Entropy in DNA Double-Strand Break, Detection and Signaling

    NASA Astrophysics Data System (ADS)

    Zhang, Yang; Schindler, Christina; Heermann, Dieter

    2014-03-01

    In biology, the term entropy is often understood as a measure of disorder - a restrictive interpretation that can even be misleading. Recently it has become clearer and clearer that entropy, contrary to conventional wisdom, can help to order and guide biological processes in living cells. DNA double-strand breaks (DSBs) are among the most dangerous lesions and efficient damage detection and repair is essential for organism viability. However, what remains unknown is the precise mechanism of targeting the site of damage within billions of intact nucleotides and a crowded nuclear environment, a process which is often referred to as recruitment or signaling. Here we show that the change in entropy associated with inflicting a DSB facilitates the recruitment of damage sensor proteins. By means of computational modeling we found that higher mobility and local chromatin structure accelerate protein association at DSB ends. We compared the effect of different chromatin architectures on protein dynamics and concentrations in the vicinity of DSBs, and related these results to experiments on repair in heterochromatin. Our results demonstrate how entropy contributes to a more efficient damage detection. We identify entropy as the physical basis for DNA double-strand break signaling.

  14. Characterization of CRISPR RNA transcription by exploiting stranded metatranscriptomic data

    PubMed Central

    Ye, Yuzhen; Zhang, Quan

    2016-01-01

    CRISPR–Cas systems are bacterial adaptive immune systems, each typically composed of a locus of cas genes and a CRISPR array of spacers flanked by repeats. Processed transcripts of CRISPR arrays (crRNAs) play important roles in the interference process mediated by these systems, guiding targeted immunity. Here we developed computational approaches that allow us to characterize the expression of many CRISPRs in their natural environments, using community RNA-seq (metatranscriptomic) data. By exploiting public human gut metatranscriptomic data sets, we studied the expression of 56 repeat-sequence types of CRISPRs, revealing that most CRISPRs are transcribed in one direction (producing crRNAs). In rarer cases, including a type II system associated with Bacteroides fragilis, CRISPRs are transcribed in both directions. Type III CRISPR–Cas systems were found in the microbiomes, but metatranscriptomic reads were barely found for their CRISPRs. We observed individual-level variation of the crRNA transcription, and an even greater transcription of a CRISPR from the antisense strand than the crRNA strand in one sample. The orientations of CRISPR expression implicated by metatranscriptomic data are largely in agreement with prior predictions for CRISPRs, with exceptions. Our study shows the promise of exploiting community RNA-seq data for investigating the transcription of CRISPR–Cas systems. PMID:27190232

  15. Wheeling and stranded investment-is there a better way

    SciTech Connect

    Ferrar, T.

    1994-03-25

    Under current franchise law, retail wheeling must be addressed on a state-by-state basis, and (therefore) it will not sweep the electric power industry as deregulation has been visited upon the telecommunications, airline, natural gas and other industries. Nevertheless, many industry observers remain concerned that retail competition will create a significant stranded investment problem. That is, broadened competition among power generators for customers will result in the market value of some existing (previously market-protected) generation assets falling below book value. The significance of such asset revaluations, and the time required for adjustment, increases with the capital intensity of the industry; this is the reason for the heightened concern regarding the introduction of retail wheeling into the electric power industry. One policy direction that may be worthy of further debate and losses during the power market's transition to a more competitive equilibrium - i.e., until regulation-induced differentials between market and book values are mitigated. A two-part policy proposal is offered for consideration. First, the use of intra-pool transfer payments; second, if stranded investment continues to exist, a temporary uniform pool-wide wheeling surcharge.

  16. Genome-wide mapping of DNA strand breaks.

    PubMed

    Leduc, Frédéric; Faucher, David; Bikond Nkoma, Geneviève; Grégoire, Marie-Chantal; Arguin, Mélina; Wellinger, Raymund J; Boissonneault, Guylain

    2011-02-25

    Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP), uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL) to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  17. Amphipathic beta-strand mimics as potential membrane disruptive antibiotics.

    PubMed

    Watson, Jessica L; Gillies, Elizabeth R

    2009-08-21

    In recent years, there have been increasing numbers of bacterial strains emerging that are resistant to the currently available antibiotics. In the search for new antibiotics, attention has been focused on natural antimicrobial peptides that act by selectively disrupting the membranes of bacterial cells, a mechanism that is thought to be nonconducive to the development of resistance. It is desirable to mimic the structures and activities of these peptides while introducing properties such as resistance to proteolytic degradation, which make molecules more ideal for development as drugs. Described here is the design and synthesis of beta-strand mimetic oligomers based on alternating alpha-amino acids and azacyclohexenone units that segregate cationic lysine and hydrophobic valine side chains on opposite faces of the beta-strand. (1)H NMR dilution studies demonstrated that despite the incorporation of alternating d- and l-amino acids in order to obtain facial amphiphilicity, these oligomers are capable of dimerizing to beta-sheet mimics in a manner similar to the oligomers containing all l-amino acids. The ability of the molecules to disrupt phospholipid vesicles mimicking the membranes of both bacterial and mammalian cells was investigated using a fluorescent dye leakage assay. Several of the oligomers were found to exhibit activity and selectivity for the bacterial over mammalian membranes. Overall, these studies demonstrate the promise of this class of molecules for the development of new potential antibiotics and provide information on the structural features that are important for activity.

  18. Dynamic control of strand excision during human DNA mismatch repair.

    PubMed

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  19. DNA strand scission by the novel antitumor antibiotic leinamycin

    SciTech Connect

    Hara, Mitsunobu; Saitoh, Yutaka; Nakano, Hirofumi )

    1990-06-19

    Leinamycin is a recently discovered antitumor antibiotic with an unusual 1,3-dioxo-1,2-dithiolane structure. It preferentially inhibits the incorporation of ({sup 3}H)thymidine into the acid-insoluble fraction of Bacillus subtilis. In vitro, leinamycin causes single-strand cleavage of supercoiled double-helical pBR322 DNA in the presence of thiol cofactors. Scavengers of oxygen radical did not suppress the DNA-cleaving activity. Thiol-activated leinamycin binds calf thymus DNA at 4{degree}C and thermal treatment of the leinamycin-DNA adduct released a chemically modified leinamycin from the complex. The lack of cytotoxicity and DNA-cleaving activity for S-deoxyleinamycin indicates that the 1,3-dioxo-1,2-dithiolane moiety is essential for the activity of leinamycin. Thus, the primary cellular target of leinamycin appears to be DNA. It binds DNA and causes single-strand break at low concentrations, which may account for the potent antitumor activity.

  20. Disseminated mycobacteriosis in a stranded loggerhead sea turtle (Caretta caretta).

    PubMed

    Nardini, Giordano; Florio, Daniela; Di Girolamo, Nicola; Gustinelli, Andrea; Quaglio, Francesco; Fiorentini, Laura; Leopardi, Stefania; Fioravanti, Maria Letizia

    2014-06-01

    A loggerhead sea turtle (Caretta caretta) was found stranded alive along the Adriatic coast close to Ancona, Italy, displaying obtundation, tachypnea, and increased respiratory effort. It died a few hours after admission, and a postmortem examination was immediately performed. Miliary yellowish nodules were evident in the liver, and a lower number in the heart, stomach, and gut wall. Hundreds of whitish nodules were scattered in the lungs, with the majority of the pulmonary parenchyma being replaced by the lesions. Histologically, all nodular lesions consisted of a small central area of necrosis with acid-fast bacilli surrounded by epithelioid cells, macrophages, and lymphocytes. Giant cells were found in the spleen and the liver. Kidneys, lungs, liver, spleen, brain, and skin lesions were inoculated aseptically onto general isolation media and selective isolation media for mycobacteria. The isolate showed a restriction pattern identical to Mycobacterium chelonae by polymerase chain reaction-restriction fragment length polymorphism. To the best of the authors' knowledge, this is the first description of a disseminated infection caused by a potentially pathogenic mycobacteria in a stranded, free-ranging loggerhead sea turtle. Veterinary staff and biologists who handle sea turtles with suspected mycobacterial disease should protect themselves appropriately.

  1. An effective mesoscopic model of double-stranded DNA.

    PubMed

    Jeon, Jae-Hyung; Sung, Wokyung

    2014-01-01

    Watson and Crick's epochal presentation of the double helix structure in 1953 has paved the way to intense exploration of DNA's vital functions in cells. Also, recent advances of single molecule techniques have made it possible to probe structures and mechanics of constrained DNA at length scales ranging from nanometers to microns. There have been a number of atomistic scale quantum chemical calculations or molecular level simulations, but they are too computationally demanding or analytically unfeasible to describe the DNA conformation and mechanics at mesoscopic levels. At micron scales, on the other hand, the wormlike chain model has been very instrumental in describing analytically the DNA mechanics but lacks certain molecular details that are essential in describing the hybridization, nano-scale confinement, and local denaturation. To fill this fundamental gap, we present a workable and predictive mesoscopic model of double-stranded DNA where the nucleotides beads constitute the basic degrees of freedom. With the inter-strand stacking given by an interaction between diagonally opposed monomers, the model explains with analytical simplicity the helix formation and produces a generalized wormlike chain model with the concomitant large bending modulus given in terms of the helical structure and stiffness. It also explains how the helical conformation undergoes overstretch transition to the ladder-like conformation at a force plateau, in agreement with the experiment.

  2. Euler buckling and nonlinear kinking of double-stranded DNA

    NASA Astrophysics Data System (ADS)

    Fields, Alexander; Axelrod, Kevin; Cohen, Adam

    2012-02-01

    Bare double-stranded DNA is a stiff biopolymer with a persistence length of roughly 53 nm under physiological conditions. Cells and viruses employ extensive protein machinery to overcome this stiffness and bend, twist, and loop DNA to accomplish tasks such as packaging, recombination, gene regulation, and repair. The mechanical properties of DNA are of fundamental importance to the mechanism and thermodynamics of these processes, but physiologically relevant curvature has been difficult to access experimentally. We designed and synthesized a DNA hairpin construct in which base-pairing interactions generated a compressive force on a short segment of duplex DNA, inducing Euler buckling followed by bending to thermally inaccessible radii of curvature. The efficiency of F"orster resonance energy transfer (FRET) between two fluorophores covalently linked to the hairpin indicated the degree of buckling. Bulk and single-molecule measurements yielded distinctly different force-compression curves for intact DNA and for strands with single nicks, base pair mismatches, and damage sites. These results suggest that changes in local mechanical properties may play a significant role in the recognition of these features by DNA-binding proteins.

  3. Integrated assessment of biological invasions.

    PubMed

    Ibáñez, Ines; Diez, Jeffrey M; Miller, Luke P; Olden, Julian D; Sorte, Cascade J B; Blumenthal, Dana M; Bradley, Bethany A; D'Antonio, Carla M; Dukes, Jeffrey S; Early, Regan I; Grosholz, Edwin D; Lawler, Joshua J

    2014-01-01

    As the main witnesses of the ecological and economic impacts of invasions on ecosystems around the world, ecologists seek to provide the relevant science that informs managers about the potential for invasion of specific organisms in their region(s) of interest. Yet, the assorted literature that could inform such forecasts is rarely integrated to do so, and further, the diverse nature of the data available complicates synthesis and quantitative prediction. Here we present a set of analytical tools for synthesizing different levels of distributional and/or demographic data to produce meaningful assessments of invasion potential that can guide management at multiple phases of ongoing invasions, from dispersal to colonization to proliferation. We illustrate the utility of data-synthesis and data-model assimilation approaches with case studies of three well-known invasive species--a vine, a marine mussel, and a freshwater crayfish--under current and projected future climatic conditions. Results from the integrated assessments reflect the complexity of the invasion process and show that the most relevant climatic variables can have contrasting effects or operate at different intensities across habitat types. As a consequence, for two of the study species climate trends will increase the likelihood of invasion in some habitats and decrease it in others. Our results identified and quantified both bottlenecks and windows of opportunity for invasion, mainly related to the role of human uses of the landscape or to disruption of the flow of resources. The approach we describe has a high potential to enhance model realism, explanatory insight, and predictive capability, generating information that can inform management decisions and optimize phase-specific prevention and control efforts for a wide range of biological invasions.

  4. Chick heart invasion assay.

    PubMed

    Bracke, Marc E; Parmar, Virinder S; Depass, Anthony L; Stevens, Christian V; Vanhoecke, Barbara W; Mareel, Marc M

    2014-01-01

    Tumors are microecosystems in which a continuous cross talk between cancer cells and host cells decides on the invasive behavior of the tumor cell population as a whole (Mareel et al., Encyclopedia of cancer, San Diego, CA, Academic Press, 1997). Both compartments secrete activating and inhibitory factors that modulate activities such as cell-extracellular matrix (ECM) interaction, cell-cell adhesion, remodeling of the ECM, and cell motility. For this reason, confrontations of cancer cells with a living normal host tissue in organ culture have been introduced by several groups: Wolff and Schneider in France (Wolff and Schneider, C R S Soc Biol (Paris) 151:1291-1292, 1957), Easty and Easty in the United Kingdom (Easty and Easty, Nature 199:1104-1105, 1963), and Schleich in Germany (Schleich et al., J Natl Cancer Inst 56:221-237, 1976). Embryonic chick heart fragments in organ culture maintain many histological features of their tissue of origin: They are composed of myocytes, fibroblasts, and endothelial cells, and their ECM contains fibronectin, laminin, and several collagen types. Moreover, the fragments remain contractile, and this activity allows the monitoring of their functional integrity during organ culture.

  5. Neonatal invasive candidiasis.

    PubMed

    Stronati, M; Decembrino, L

    2006-12-01

    Over the last two decades, systemic fungal infections have emerged to play a primary role in hospital-acquired infections. C. albicans is involved in 75% of neonatal candidiasis; however, the incidence of infection from C. parapsilosis is also increasing significantly. The higher incidence observed in the high-risk group of very low birth weight (VLBW) infants is linked to their special physical characteristics and the diagnostic and therapeutic invasive procedures they undergo. Colonization is a relevant risk factor depending on the colonized site , the fungal species and the type of colonization. Serological tests have a low specificity and sensitivity; in many cases, they do not distinguish between colonization and infection. Blood culture, although the best diagnostic test for determining systemic infection, can result negative, even in cases of deep organ involvement. In addition, fungi grow more slowly than bacteria in cultures. So, the difficulty in diagnosing systemic candidiasis and its aspecific clinical features may make empirical therapy appropriate. Amphotericin B (AmB) alone or combined with 5-fluorocytosine remains the drug of choice. Fluconazole represents a valid alternative. Recently developed new formulations of amphotericin incapsulated in liposomes can avoid possible adverse effects. Prognosis depends on the specific micro-organism involved; mortality is higher in the presence of C. albicans. As prognosis is associated with high mortality, prevention measures to reduce risk factors are of critical importance.

  6. Non-invasive hemoglobin monitoring.

    PubMed

    Joseph, Bellal; Haider, Ansab; Rhee, Peter

    2016-09-01

    Technology has transformed the practice of medicine and surgery in particular over the last several decades. This change in practice has allowed diagnostic and therapeutic tests to be performed less invasively. Hemoglobin monitoring remains one of the most commonly performed diagnostic tests in the United States. Recently, non-invasive hemoglobin monitoring technology has gained popularity. The aim of this article is to review the principles of how this technology works, pros and cons, and the implications of non-invasive hemoglobin technology particularly in trauma surgery.

  7. Vacuum-ultraviolet circular dichroism reveals DNA duplex formation between short strands of adenine and thymine.

    PubMed

    Nielsen, Lisbeth Munksgaard; Hoffmann, Søren Vrønning; Brøndsted Nielsen, Steen

    2012-11-21

    Absorbance spectroscopy is used extensively to tell when two DNA single strands come together and form a double strand. Here we show that circular dichroism in the vacuum ultraviolet region provides an even stronger indication for duplex formation in the case of short strands of adenine and thymine (4 to 16 bases in each strand). Indeed, our results show that a strong positive CD band appears at 179 nm when double strands are formed. Melting experiments were done in aqueous solution with and without added Na(+) counter ions. With additional salt present a huge increase in the 179 nm CD band was observed when lowering the temperature. A 179 nm CD marker band for duplex formation can be used to measure the kinetics for the association of two single strands. Such experiments rely on large changes at one particular wavelength since it is too time-consuming to record a full-wavelength spectrum.

  8. Estimation of Prestress Force Distribution in the Multi-Strand System of Prestressed Concrete Structures

    PubMed Central

    Cho, Keunhee; Park, Sung Yong; Cho, Jeong-Rae; Kim, Sung Tae; Park, Young-Hwan

    2015-01-01

    Prestressed concrete (PSC) is one of the most reliable, durable and widely used construction materials, which overcomes the weakness of concrete in tension by the introduction of a prestress force. Smart strands enabling measurement of the prestress force have recently been developed to maintain PSC structures throughout their lifetime. However, the smart strand cannot give a representative indication of the whole prestress force when used in multi-strand systems since each strand sustains a different prestress force. In this paper, the actual distribution of the prestress force in a multi-strand system is examined using elastomagnetic (EM) sensors to develop a method for tracking representative indicators of the prestress force using smart strands. PMID:26083230

  9. Low-molecular-weight DNA replication intermediates in Escherichia coli: mechanism of formation and strand specificity.

    PubMed

    Amado, Luciana; Kuzminov, Andrei

    2013-11-15

    Chromosomal DNA replication intermediates, revealed in ligase-deficient conditions in vivo, are of low molecular weight (LMW) independently of the organism, suggesting discontinuous replication of both the leading and the lagging DNA strands. Yet, in vitro experiments with purified enzymes replicating sigma-structured substrates show continuous synthesis of the leading DNA strand in complete absence of ligase, supporting the textbook model of semi-discontinuous DNA replication. The discrepancy between the in vivo and in vitro results is rationalized by proposing that various excision repair events nick continuously synthesized leading strands after synthesis, producing the observed LMW intermediates. Here, we show that, in an Escherichia coli ligase-deficient strain with all known excision repair pathways inactivated, new DNA is still synthesized discontinuously. Furthermore, hybridization to strand-specific targets demonstrates that the LMW replication intermediates come from both the lagging and the leading strands. These results support the model of discontinuous leading strand synthesis in E. coli.

  10. Simulation of 125I induced DNA strand breaks in a CAP-DNA complex.

    PubMed

    Li, W; Friedland, W; Jacob, P; Paretzke, H G; Panyutin, I; Neumann, R D

    2002-01-01

    The E. coli catabolite gene activator protein (CAP)-DNA complex with 125I located at the position of the H5 atom of the cytosine near the centre was incorporated into the PARTRAC track structure code. DNA strand breaks due to irradiation were calculated by track structure and radical attack simulations; strand breaks due to neutralisation of the highly charged 125Te ion were derived from a semi-empirical distribution. According to the calculations, the neutralisation effect dominates the strand breakage frequency at 2 bases away from the 125I decay site on both strands. The first breakage distribution counted from a 32P labelled end on the strand with 125I agreed well with experimental data, but on the opposite strand, the calculated distribution is more concentrated around the decay site and its yield is about 20% larger than the measured data.

  11. Switching from single-stranded to double-stranded DNA limits the unwinding processivity of ring-shaped T7 DNA helicase.

    PubMed

    Jeong, Yong-Joo; Rajagopal, Vaishnavi; Patel, Smita S

    2013-04-01

    Phage T7 helicase unwinds double-stranded DNA (dsDNA) by encircling one strand while excluding the complementary strand from its central channel. When T7 helicase translocates on single-stranded DNA (ssDNA), it has kilobase processivity; yet, it is unable to processively unwind linear dsDNA, even 60 base-pairs long. Particularly, the GC-rich dsDNAs are unwound with lower amplitudes under single-turnover conditions. Here, we provide evidence that T7 helicase switches from ssDNA to dsDNA during DNA unwinding. The switching propensity is higher when dsDNA is GC-rich or when the 3'-overhang of forked DNA is <15 bases. Once helicase encircles dsDNA, it travels along dsDNA and dissociates from the end of linear DNA without strand separation, which explains the low unwinding amplitude of these substrates. Trapping the displaced strand with ssDNA binding protein or changing its composition to morpholino oligomer that does not interact with helicase increases the unwinding amplitude. We conclude that the displaced strand must be continuously excluded and kept away from the central channel for processive DNA unwinding. The finding that T7 helicase can switch from ssDNA to dsDNA binding mode during unwinding provides new insights into ways of limiting DNA unwinding and triggering fork regression when stalled forks need to be restarted.

  12. Altered Strand Transfer Activity of a Multi-drug-resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Mutant with a Dipeptide Fingers Domain Insertion

    PubMed Central

    Nguyen, Laura A.; Daddacha, Waaqo; Rigby, Sean; Bambara, Robert A.; Kim, Baek

    2013-01-01

    Prolonged highly active anti-retroviral therapy (HAART) with multiple nucleoside reverse transcriptase inhibitors (NRTI) for the treatment of human immunodeficiency virus type 1 (HIV-1) infected patients can induce the development of an HIV-1 RT harboring a dipeptide insertion at the RT fingers domain with a background thymidine analog mutation (TAM). This mutation renders viral resistance to multiple NRTIs. We investigated the effect of the dipeptide fingers domain insertion mutation on strand transfer activity using two clinical RT variants isolated during pre- and post-treatment of an infected patient, termed pre-drug RT without the dipeptide insertion and post-drug RT with the Ser-Gly insertion mutation, respectively. First, the post-drug RT displayed elevated strand transfer activity, compared to the pre-drug RT, with two different RNA templates. Second, the post-drug RT exhibited less RNA template degradation than the pre-drug RT, but higher polymerization-dependent RNase H activity. Third, the post-drug RT had a faster association rate for template binding (kon) and lower equilibrium binding constant KD to template, leading to the tighter template binding affinity than the pre-drug RT. The koff rates for pre-drug RT and post-drug RTs were similar. Finally, the removal of the dipeptide insertion from the post-drug RT abolished the elevated strand transfer activity and RNase H activity in addition to the loss of AZT resistance. These biochemical data suggests that the dipeptide insertion mutation elevates strand transfer activity by increasing the interaction of the RT with RNA donor template, promoting cleavage that generates more invasion site for the acceptor template during DNA synthesis. PMID:22100453

  13. Interpreting the spatio-temporal patterns of sea turtle strandings: Going with the flow

    USGS Publications Warehouse

    Hart, K.M.; Mooreside, P.; Crowder, L.B.

    2006-01-01

    Knowledge of the spatial and temporal distribution of specific mortality sources is crucial for management of species that are vulnerable to human interactions. Beachcast carcasses represent an unknown fraction of at-sea mortalities. While a variety of physical (e.g., water temperature) and biological (e.g., decomposition) factors as well as the distribution of animals and their mortality sources likely affect the probability of carcass stranding, physical oceanography plays a major role in where and when carcasses strand. Here, we evaluate the influence of nearshore physical oceanographic and wind regimes on sea turtle strandings to decipher seasonal trends and make qualitative predictions about stranding patterns along oceanfront beaches. We use results from oceanic drift-bottle experiments to check our predictions and provide an upper limit on stranding proportions. We compare predicted current regimes from a 3D physical oceanographic model to spatial and temporal locations of both sea turtle carcass strandings and drift bottle landfalls. Drift bottle return rates suggest an upper limit for the proportion of sea turtle carcasses that strand (about 20%). In the South Atlantic Bight, seasonal development of along-shelf flow coincides with increased numbers of strandings of both turtles and drift bottles in late spring and early summer. The model also predicts net offshore flow of surface waters during winter - the season with the fewest relative strandings. The drift bottle data provide a reasonable upper bound on how likely carcasses are to reach land from points offshore and bound the general timeframe for stranding post-mortem (< two weeks). Our findings suggest that marine turtle strandings follow a seasonal regime predictable from physical oceanography and mimicked by drift bottle experiments. Managers can use these findings to reevaluate incidental strandings limits and fishery takes for both nearshore and offshore mortality sources. ?? 2005 Elsevier Ltd

  14. Base specific binding of deoxyguanylate and deoxycytidylate antibodies to double stranded DNA.

    PubMed Central

    Jacob, A; Jacob, T M

    1982-01-01

    Antibodies raised in rabbits against deoxyguanylate and deoxycytidylate bind to 3H-lambda double stranded DNA and the binding is base specific. The concentrations of antibody populations that bind to double stranded DNA are much less than those binding to denatured DNA. Due to their low concentrations, these antibodies were not detected in earlier studies. These antibodies are expected to be useful to probe the conformational flexibilities of double stranded DNAs. PMID:6217448

  15. Edwardsiella tarda sepsis in a live-stranded sperm whale (Physeter macrocephalus).

    PubMed

    Cools, Piet; Haelters, Jan; Lopes dos Santos Santiago, Guido; Claeys, Geert; Boelens, Jerina; Leroux-Roels, Isabel; Vaneechoutte, Mario; Deschaght, Pieter

    2013-09-27

    Whale strandings remain poorly understood, although bacterial infections have been suggested to contribute. We isolated Edwardsiella tarda from the blood of a stranded sperm whale. The pathogen was identified with MALDI-TOF MS, confirmed by 16S rRNA gene sequencing and quantified in blood by qPCR. We report the first case of sepsis in a sperm whale. The zoonotic potential of E. tarda and the possible role of bacterial infections in the enigmatic strandings of cetaceans are discussed.

  16. Human Cell Assays for Synthesis-Dependent Strand Annealing and Crossing over During Double-Strand Break Repair

    PubMed Central

    Zapotoczny, Grzegorz; Sekelsky, Jeff

    2017-01-01

    DNA double-strand breaks (DSBs) are one of the most deleterious types of lesions to the genome. Synthesis-dependent strand annealing (SDSA) is thought to be a major pathway of DSB repair, but direct tests of this model have only been conducted in budding yeast and Drosophila. To better understand this pathway, we developed an SDSA assay for use in human cells. Our results support the hypothesis that SDSA is an important DSB repair mechanism in human cells. We used siRNA knockdown to assess the roles of a number of helicases suggested to promote SDSA. None of the helicase knockdowns reduced SDSA, but knocking down BLM or RTEL1 increased SDSA. Molecular analysis of repair products suggests that these helicases may prevent long-tract repair synthesis. Since the major alternative to SDSA (repair involving a double-Holliday junction intermediate) can lead to crossovers, we also developed a fluorescent assay that detects crossovers generated during DSB repair. Together, these assays will be useful in investigating features and mechanisms of SDSA and crossover pathways in human cells. PMID:28179392

  17. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    NASA Astrophysics Data System (ADS)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  18. Improvement of DNA adenylation using T4 DNA ligase with a template strand and a strategically mismatched acceptor strand

    PubMed Central

    Patel, Maha P.; Baum, Dana A.; Silverman, Scott K.

    2008-01-01

    DNA with a 5′-adenylpyrophosphoryl cap (5′-adenylated DNA; AppDNA) is an activated form of DNA that is the biochemical intermediate of the reactions catalyzed by DNA ligase, RNA ligase, polynucleotide kinase, and other nucleic acid modifying enzymes. 5′-Adenylated DNA is also useful for in vitro selection experiments. Efficient preparation of 5′-adenylated DNA is therefore desirable for several biochemical applications. Here we have developed a DNA adenylation procedure that uses T4 DNA ligase and is more reliable than a previously reported approach that used the 5′-phosphorylated donor DNA substrate to be adenylated, a DNA template, and ATP but no acceptor strand. Our improved DNA adenylation procedure uses the above components as well as an acceptor strand that has a strategically chosen C-T acceptor-template mismatch directly adjacent to the adenylation site. This mismatch permits adenylation of the donor DNA substrate but largely suppresses subsequent ligation of the donor with the acceptor, as assayed on nine different DNA substrates that collectively have all four DNA nucleotides represented at each of the first two positions. The new DNA adenylation procedure is successful using either laboratory-prepared or commercial T4 DNA ligase and works well on the preparative (2 nmol) scale for all nine of the test DNA substrates. PMID:18022669

  19. DNA ligase III acts as a DNA strand break sensor in the cellular orchestration of DNA strand break repair

    PubMed Central

    Abdou, Ismail; Poirier, Guy G.; Hendzel, Michael J.; Weinfeld, Michael

    2015-01-01

    In the current model of DNA SSBR, PARP1 is regarded as the sensor of single-strand breaks (SSBs). However, biochemical studies have implicated LIG3 as another possible SSB sensor. Using a laser micro-irradiation protocol that predominantly generates SSBs, we were able to demonstrate that PARP1 is dispensable for the accumulation of different single-strand break repair (SSBR) proteins at sites of DNA damage in live cells. Furthermore, we show in live cells for the first time that LIG3 plays a role in mediating the accumulation of the SSBR proteins XRCC1 and PNKP at sites of DNA damage. Importantly, the accumulation of LIG3 at sites of DNA damage did not require the BRCT domain-mediated interaction with XRCC1. We were able to show that the N-terminal ZnF domain of LIG3 plays a key role in the enzyme's SSB sensing function. Finally, we provide cellular evidence that LIG3 and not PARP1 acts as the sensor for DNA damage caused by the topoisomerase I inhibitor, irinotecan. Our results support the existence of a second damage-sensing mechanism in SSBR involving the detection of nicks in the genome by LIG3. PMID:25539916

  20. Double-stranded RNA under force and torque: Similarities to and striking differences from double-stranded DNA

    PubMed Central

    Lipfert, Jan; Skinner, Gary M.; Keegstra, Johannes M.; Hensgens, Toivo; Jager, Tessa; Dulin, David; Köber, Mariana; Yu, Zhongbo; Donkers, Serge P.; Chou, Fang-Chieh; Das, Rhiju; Dekker, Nynke H.

    2014-01-01

    RNA plays myriad roles in the transmission and regulation of genetic information that are fundamentally constrained by its mechanical properties, including the elasticity and conformational transitions of the double-stranded (dsRNA) form. Although double-stranded DNA (dsDNA) mechanics have been dissected with exquisite precision, much less is known about dsRNA. Here we present a comprehensive characterization of dsRNA under external forces and torques using magnetic tweezers. We find that dsRNA has a force–torque phase diagram similar to that of dsDNA, including plectoneme formation, melting of the double helix induced by torque, a highly overwound state termed “P-RNA,” and a highly underwound, left-handed state denoted “L-RNA.” Beyond these similarities, our experiments reveal two unexpected behaviors of dsRNA: Unlike dsDNA, dsRNA shortens upon overwinding, and its characteristic transition rate at the plectonemic buckling transition is two orders of magnitude slower than for dsDNA. Our results challenge current models of nucleic acid mechanics, provide a baseline for modeling RNAs in biological contexts, and pave the way for new classes of magnetic tweezers experiments to dissect the role of twist and torque for RNA–protein interactions at the single-molecule level. PMID:25313077

  1. Double-stranded RNA under force and torque: similarities to and striking differences from double-stranded DNA.

    PubMed

    Lipfert, Jan; Skinner, Gary M; Keegstra, Johannes M; Hensgens, Toivo; Jager, Tessa; Dulin, David; Köber, Mariana; Yu, Zhongbo; Donkers, Serge P; Chou, Fang-Chieh; Das, Rhiju; Dekker, Nynke H

    2014-10-28

    RNA plays myriad roles in the transmission and regulation of genetic information that are fundamentally constrained by its mechanical properties, including the elasticity and conformational transitions of the double-stranded (dsRNA) form. Although double-stranded DNA (dsDNA) mechanics have been dissected with exquisite precision, much less is known about dsRNA. Here we present a comprehensive characterization of dsRNA under external forces and torques using magnetic tweezers. We find that dsRNA has a force-torque phase diagram similar to that of dsDNA, including plectoneme formation, melting of the double helix induced by torque, a highly overwound state termed "P-RNA," and a highly underwound, left-handed state denoted "L-RNA." Beyond these similarities, our experiments reveal two unexpected behaviors of dsRNA: Unlike dsDNA, dsRNA shortens upon overwinding, and its characteristic transition rate at the plectonemic buckling transition is two orders of magnitude slower than for dsDNA. Our results challenge current models of nucleic acid mechanics, provide a baseline for modeling RNAs in biological contexts, and pave the way for new classes of magnetic tweezers experiments to dissect the role of twist and torque for RNA-protein interactions at the single-molecule level.

  2. Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae

    SciTech Connect

    Ivanov, E.L.; Sugawara, N.; Haber, J.E.

    1996-03-01

    HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. 43 refs., 8 figs., 3 tabs.

  3. Genetic Requirements for the Single-Strand Annealing Pathway of Double-Strand Break Repair in Saccharomyces Cerevisiae

    PubMed Central

    Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.

    1996-01-01

    HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880

  4. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    PubMed

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis.

  5. The isolation of strand-specific nicking endonucleases from a randomized SapI expression library.

    PubMed

    Samuelson, James C; Zhu, Zhenyu; Xu, Shuang-yong

    2004-01-01

    The Type IIS restriction endonuclease SapI recognizes the DNA sequence 5'-GCTCTTC-3' (top strand by convention) and cleaves downstream (N1/N4) indicating top- and bottom-strand spacing, respectively. The asymmetric nature of DNA recognition presented the possibility that one, if not two, nicking variants might be created from SapI. To explore this possibility, two parallel selection procedures were designed to isolate either top-strand nicking or bottom-strand nicking variants from a randomly mutated SapI expression library. These procedures take advantage of a SapI substrate site designed into the expression plasmid, which allows for in vitro selection of plasmid clones possessing a site-specific and strand-specific nick. A procedure designed to isolate bottom-strand nicking enzymes yielded Nb.SapI-1 containing a critical R420I substitution near the end of the protein. The top-strand procedure yielded several SapI variants with a distinct preference for top-strand cleavage. Mutations present within the selected clones were segregated to confirm a top-strand nicking phenotype for single variants Q240R, E250K, G271R or K273R. The nature of the amino acid substitutions found in the selected variants provides evidence that SapI may possess two active sites per monomer. This work presents a framework for establishing the mechanism of SapI DNA cleavage.

  6. Workshop on effects of chromium coating on Nb{sub 3}Sn superconductor strand: Proceedings

    SciTech Connect

    Not Available

    1994-04-12

    This report discusses the following topics: Chromium coating on superconductor strand -- an overview; technology of chromium plating; comparison of wires plated by different platers; search for chromium in copper; strand manufactures` presentations; chromium plating at the Lawrence Livermore National Laboratory; a first look at a chromium plating process development project tailored for T.P.X. and I.T.E.R. strand; and influence of chromium diffusion and related phenomena on the reference ratios of bare and chromium plated Nb{sub 3}Sn strand.

  7. Interruptions in gene expression drive highly expressed operons to the leading strand of DNA replication

    PubMed Central

    Price, Morgan N.; Alm, Eric J.; Arkin, Adam P.

    2005-01-01

    In bacteria, most genes are on the leading strand of replication, a phenomenon attributed to collisions between the DNA and RNA polymerases. In Escherichia coli, these collisions slow the movement of the replication fork through actively transcribed genes only if they are coded on the lagging strand. For genes on both strands, however, these collisions sever nascent transcripts and interrupt gene expression. Based on these observations, we propose a new theory to explain strand bias: genes whose expression is important for fitness are selected to the leading strand because this reduces the duration of these interruptions. Our theory predicts that multi-gene operons, which are subject to longer interruptions, should be more strongly selected to the leading strand than singleton transcripts. We show that this is true even after controlling for the tendency for essential genes, which are strongly biased to the leading strand, to occur in operons. Our theory also predicts that other factors that are associated with strand bias should have stronger effects for genes that are in operons. We find that expression level and phylogenetic ubiquity are correlated with strand bias for both essential and non-essential genes, but only for genes in operons. PMID:15942025

  8. Interruptions in gene expression drive highly expressed operons to the leading strand of DNA replication.

    PubMed

    Price, Morgan N; Alm, Eric J; Arkin, Adam P

    2005-01-01

    In bacteria, most genes are on the leading strand of replication, a phenomenon attributed to collisions between the DNA and RNA polymerases. In Escherichia coli, these collisions slow the movement of the replication fork through actively transcribed genes only if they are coded on the lagging strand. For genes on both strands, however, these collisions sever nascent transcripts and interrupt gene expression. Based on these observations, we propose a new theory to explain strand bias: genes whose expression is important for fitness are selected to the leading strand because this reduces the duration of these interruptions. Our theory predicts that multi-gene operons, which are subject to longer interruptions, should be more strongly selected to the leading strand than singleton transcripts. We show that this is true even after controlling for the tendency for essential genes, which are strongly biased to the leading strand, to occur in operons. Our theory also predicts that other factors that are associated with strand bias should have stronger effects for genes that are in operons. We find that expression level and phylogenetic ubiquity are correlated with strand bias for both essential and non-essential genes, but only for genes in operons.

  9. Conformational polymorphism in G-tetraplex structures: strand reversal by base flipover or sugar flipover.

    PubMed Central

    Mohanty, D; Bansal, M

    1993-01-01

    Guanine rich sequences adopt a variety of four stranded structures, which differ in strand orientation and conformation about the glycosidic bond even though they are all stabilised by Hoogsteen hydrogen bonded guanine tetrads. Detailed model building and molecular mechanics calculations have been carried out to investigate various possible conformations of guanines along a strand and different possible orientations of guanine strands in a G-tetraplex structure. It is found that for an oligo G stretch per se, a parallel four stranded structure with all guanines in anti conformation is favoured over other possible tetraplex structures. Hence an alternating syn-anti arrangement of guanines along a strand is likely to occur only in folded back tetraplex structures with antiparallel G strands. Our study provides a theoretical rationale for the observed alternation of glycosidic conformation and the inverted stacking arrangement arising from base flipover, in antiparallel G-tetraplex structures and also highlights the various structural features arising due to different types of strand orientations. The molecular mechanics calculations help in elucidating the various interactions which stabilize different G-tetraplex structures and indicate that screening of phosphate charge by counterions could have a dramatic effect on groove width in these four stranded structures. PMID:8493095

  10. Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

    PubMed Central

    Brennan, V E; Bobek, L A; Bruenn, J A

    1981-01-01

    ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH. Images PMID:7031603

  11. Cheatgrass invasion and wildlife habitat

    USDA-ARS?s Scientific Manuscript database

    The introduction and subsequent invasion of cheatgrass (Bromus tectorum) has altered native plant communities and the wildlife species that depend on these communities. Cheatgrass has truncated secondary succession by outcompeting native plant species for limited resources, thus building persistent...

  12. Invasiveness, chimerism and genetic diversity.

    PubMed

    Ben-Shlomo, Rachel

    2017-09-26

    Adaptation for invasiveness should comprise the capability to exploit and prosper in a wide range of ecological conditions, and is therefore expected to be associated with a certain level of genetic diversity. Paradoxically, however, invasive populations are established by only a few founders, resulting in low genetic diversity. As a conceivable way of attaining high genetic diversity and high variance of gene expression even when a small number of founders is involved in invasiveness, I suggest here chimerism, a fusion between different individuals-a common phenomenon found in numerous phyla. The composite entity offers the chimeric organism genetic flexibility and higher inclusive fitness that depends on the joint genomic fitness of the original partners. The ability to form a chimeric entity is also applied to subsequent generations and, consequently, the level of genetic diversity does not decline over generations of population establishment following invasion. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  13. [Non-invasive ventilation].

    PubMed

    Gallardo Romero, Jose Manuel; García, Teresa Gómez; Sancho Chust, José Norberto; González Martínez, Mónica

    2010-10-01

    The advent of non-invasive mechanical ventilation (NIMV) has radically changed the management of acute and chronic respiratory failure. Over the last few years, the number of possible applications of NIMV has progressively increased, both in the hospital and extrahospital setting. NIMV is now used in all hospitals and resident physicians currently receive specific training -nonexistent until a few years ago- in this modality. It falls to all of us to push forward the clinical and scientific advances represented by the development of NIMV, by promoting the events that accompany better knowledge of the physiopathological bases of ventilation and of its continuous applications in daily clinical practice and by perfecting the elements required for the correct application of this technique. The present review aims to provide a broad overview of NIMV, from the most theoretical knowledge (the physiopathology of NIMV) to the most practical skills (recognition of patient-ventilator asynchrony). Through this progression from the complex to the most basic, or from the basics to the most complex, depending on the perspective taken, we aim to provide deeper knowledge of the concepts required to understand the technical functioning of the ventilator, describing its distinct modes and parameters and the abilities that must be developed for the correct indication, use and monitoring of the technique. We provide a final reflection on other forms of respiratory support that can be offered to patients with ventilatory failure. Copyright © 2010 Sociedad Española de Neumología y Cirugía Torácica. Published by Elsevier Espana. All rights reserved.

  14. π-ELECTRONS in a Single Strand of Dna:

    NASA Astrophysics Data System (ADS)

    Iguchi, Kazumoto

    We revisit the problem of the electronic properties of a single strand of DNA, formulating the Hückel approximation for π-electrons in both the sugar-phosphate backbone chain and the π-stacking of nitrogenous bases in a single strand of DNA where the nitrogenous bases are adenine (A), guanine (G), cytosine (C) and thymine (T), respectively. We calculate the electronic band structure of π-electrons: (i) in the single nitrogenous base molecules such as A, G, C and T, (ii) in the single sugar-phosphate molecule, (iii) in the single nucleotide systems such as A, G, C, T with the single sugar-phosphate group, and (iv) in the system of a single strand of DNA with an infinite repetition of a nucleotide such as A, G, C and T, respectively. We find the following: In the case of (i), there is an energy gap between the energy levels for the HOMO and LUMO in the nitrogenous base. This guarantees the semiconducting character of the bases as a mother material. In the case of (ii), there are the HOMO localized at the oxygen site with a double bond and the LUMO localized around the phosphorus atom, which have a quite large energy gap. In the case of (iii), the energy levels for the HOMO and LUMO of the nitrogenous base remain almost the same as those of the nucleotide, while those of the sugar-phosphate group remain the same as well. The HOMO of the sugar-phosphate group exists right below the HOMO of the nitrogenous base. Therefore, comparing the energy levels for the HOMOs of the nitrogenous base group with those of the sugar-phosphate group, the nitrogenous base group behaves as a donor while the sugar-phosphate group behaves as an acceptor. In the case of (iv), there are energy bands and band gaps for the extended states in the nitrogenous base group and the sugar-phosphate group as well as the discrete levels for the localized states at the phosphate site in the spectrum. There is a transition from semiconductor to semimetal as the π-electron hopping between the

  15. Effects of terminal nonhomology and homeology on double-strand-break-induced gene conversion tract directionality.

    PubMed Central

    Nelson, H H; Sweetser, D B; Nickoloff, J A

    1996-01-01

    Double-strand breaks (DSBs) greatly enhance gene conversion in the yeast Saccharomyces cerevisiae. In prior plasmid x chromosome crosses, conversion tracts were often short ( < 53 bp) and usually extended in only one direction from a DSB in an HO recognition sequence inserted into ura3. To allow fine-structure analysis of short and unidirectional tracts, phenotypically silent markers were introduced at 3- and 6-bp intervals flanking the HO site. These markers, which created a 70-bp homeologous region (71% homology), greatly increased the proportion of bidirectional tracts. Among products with short or unidirectional tracts, 85% were highly directional, converting markers on only one side (the nearest marker being 6 bp from the HO site). A DSB in an HO site insertion creates terminal nonhomologies. The high degree of directionality is a likely consequence of the precise cleavage at homology/nonhomology borders in hybrid DNA by Rad1/10 endonuclease. In contrast, terminal homeology alone yielded mostly unidirectional tracts. Thus, nonhomology flanked by homeology yields primarily bidirectional tracts, but terminal homeology or nonhomology alone yields primarily unidirectional tracts. These results are inconsistent with uni- and bidirectional tracts arising from one- and two-ended invasion mechanisms, respectively, as reduced homology would be expected to favor one-ended events. Tract spectra with terminal homeology alone with similar in RAD1 and rad1 cells, indicating that the high proportion of bidirectional tracts seen with homeology flanking nonhomology is not a consequence of Rad1/10 cleavage at homology/homeology boundaries. Instead, tract directionality appears to reflect the influence of the degree of broken-end homology on mismatch repair. PMID:8649406

  16. Double strand RNA delivery system for plant-sap-feeding insects.

    PubMed

    Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

    2017-01-01

    Double-stranded RNA (dsRNA)-mediated gene silencing, also known as RNA interference (RNAi), has been a breakthrough technology for functional genomic studies and represents a potential tool for the management of insect pests. Since the inception of RNAi numerous studies documented successful introduction of exogenously synthesized dsRNA or siRNA into an organism triggering highly efficient gene silencing through the degradation of endogenous RNA homologous to the presented siRNA. Managing hemipteran insect pests, especially Halyomorpha halys (Stål) (Heteroptera: Pentatomidae), the brown marmorated stink bug (BMSB), is critical to food productivity. BMSB was recently introduced into North America where it is both an invasive agricultural pest of high value specialty, row, and staple crops, as well as an indoor nuisance pest. RNAi technology may serve as a viable tool to manage this voracious pest, but delivery of dsRNA to piercing-sucking insects has posed a tremendous challenge. Effective and practical use of RNAi as molecular biopesticides for biocontrol of insects like BMSB in the environment requires that dsRNAs be delivered in vivo through ingestion. Therefore, the key challenge for molecular biologists in developing insect-specific molecular biopesticides is to find effective and reliable methods for practical delivery of stable dsRNAs such as through oral ingestion. Here demonstrated is a reliable delivery system of effective insect-specific dsRNAs through oral feeding through a new delivery system to induce a significant decrease in expression of targeted genes such as JHAMT and Vg. This state-of-the-art delivery method overcomes environmental delivery challenges so that RNAi is induced through insect-specific dsRNAs orally delivered to hemipteran and other insect pests.

  17. Double strand RNA delivery system for plant-sap-feeding insects

    PubMed Central

    Ghosh, Saikat Kumar B.; Hunter, Wayne B.; Park, Alexis L.; Gundersen-Rindal, Dawn E.

    2017-01-01

    Double-stranded RNA (dsRNA)-mediated gene silencing, also known as RNA interference (RNAi), has been a breakthrough technology for functional genomic studies and represents a potential tool for the management of insect pests. Since the inception of RNAi numerous studies documented successful introduction of exogenously synthesized dsRNA or siRNA into an organism triggering highly efficient gene silencing through the degradation of endogenous RNA homologous to the presented siRNA. Managing hemipteran insect pests, especially Halyomorpha halys (Stål) (Heteroptera: Pentatomidae), the brown marmorated stink bug (BMSB), is critical to food productivity. BMSB was recently introduced into North America where it is both an invasive agricultural pest of high value specialty, row, and staple crops, as well as an indoor nuisance pest. RNAi technology may serve as a viable tool to manage this voracious pest, but delivery of dsRNA to piercing-sucking insects has posed a tremendous challenge. Effective and practical use of RNAi as molecular biopesticides for biocontrol of insects like BMSB in the environment requires that dsRNAs be delivered in vivo through ingestion. Therefore, the key challenge for molecular biologists in developing insect-specific molecular biopesticides is to find effective and reliable methods for practical delivery of stable dsRNAs such as through oral ingestion. Here demonstrated is a reliable delivery system of effective insect-specific dsRNAs through oral feeding through a new delivery system to induce a significant decrease in expression of targeted genes such as JHAMT and Vg. This state-of-the-art delivery method overcomes environmental delivery challenges so that RNAi is induced through insect-specific dsRNAs orally delivered to hemipteran and other insect pests. PMID:28182760

  18. Integrated affinity capture, purification, and capillary electrophoresis microdevice for quantitative double-stranded DNA analysis.

    PubMed

    Toriello, Nicholas M; Liu, Chung N; Blazej, Robert G; Thaitrong, Numrin; Mathies, Richard A

    2007-11-15

    A novel injection method is developed that utilizes a thermally switchable oligonucleotide affinity capture gel to mediate the concentration, purification, and injection of dsDNA for quantitative microchip capillary electrophoresis analysis. The affinity capture matrix consists of a 20 base acrydite modified oligonucleotide copolymerized into a 6% linear polyacrylamide gel that captures ssDNA or dsDNA analyte including PCR amplicons and synthetic oligonucleotides. Double stranded PCR amplicons with complementarity to the capture probe up to 81 bases from their 5' terminus are reproducibly captured via helix invasion. By integrating the oligo capture matrix directly with the CE separation channel, the electrophoretically mobilized target fragments are quantitatively captured and injected after thermal release for unbiased, efficient, and quantitative analysis. The capture process exhibits optimal efficiency at 44 degrees C and 100 V/cm with a 20 microM affinity capture probe (TM = 57.7 degrees C). A dsDNA titration assay with 20 bp fragments validated that dsDNA is captured at the same efficiency as ssDNA. Dilution studies with a duplex 20mer show that targets can be successfully captured and analyzed with a limit of detection of 1 pM from 250 nL of solution (approximately 150,000 fluorescent molecules). Simultaneous capture and injection of amplicons from E. coli K12 and M13mp18 using a mixture of two different capture probes demonstrates the feasibility of multiplex target capture. Unlike the traditional cross-injector, this method enables efficient capture and injection of dsDNA amplicons which will facilitate the quantitative analysis of products from integrated nanoliter-scale PCR reactors.

  19. Targeting cancer cell invasiveness using homing peptide-nanocomplexes

    NASA Astrophysics Data System (ADS)

    Suarato, Giulia; Cathcart, Jillian; Li, Weiyi; Cao, Jian; Meng, Yizhi

    Matrix metalloproteinase-14 (MMP-14) plays critical roles in digesting the basement membrane and extracellular matrix and inducing cancer migration. We recently unraveled a unique role in cell invasion of the hemopexin (PEX) domain of MMP-14. The minimal motif located at the outmost strand of the fourth blade of the PEX domain was identified to form homodimers of MMP-14. A peptide (IVS4) mimicking the binding motif was shown to interrupt MMP-14 dimerization and decrease MMP-14-mediated functions. Since most invasive cancer cells express upregulated MMP-14 at the surface, IVS4 could be used as a cancer homing peptide to specifically deliver cytotoxic drugs for cancer therapy. We developed cancer homing nanocarriers by linking IVS4 to polysaccharide-based micellar nanoparticles (NPs). To determine if conjugation of IVS4 to NPs maintains the IVS4 inhibition of MMP-14 function, substrate degradation and cell migration assays were performed. IVS4-NPs efficiently prevented MMP-14-mediated substrate degradation and cell migration, and were minimally uptaken by non-cancer cells. Importantly, IVS4 confers an uptake advantage compared to the control peptide in MMP-14-expressing cells. Taken together, our findings demonstrate the potential use of IVS4-NPs as novel cancer nanotherapeutics.

  20. Roles of chromatin remodellers in DNA double strand break repair.

    PubMed

    Jeggo, Penny A; Downs, Jessica A

    2014-11-15

    Now that we have a good understanding of the DNA double strand break (DSB) repair mechanisms and DSB-induced damage signalling, attention is focusing on the changes to the chromatin environment needed for efficient DSB repair. Mutations in chromatin remodelling complexes have been identified in cancers, making it important to evaluate how they impact upon genomic stability. Our current understanding of the DSB repair pathways suggests that each one has distinct requirements for chromatin remodelling. Moreover, restricting the extent of chromatin modifications could be a significant factor regulating the decision of pathway usage. In this review, we evaluate the distinct DSB repair pathways for their potential need for chromatin remodelling and review the roles of ATP-driven chromatin remodellers in the pathways.

  1. DNA double-strand break repair pathway choice and cancer.

    PubMed

    Aparicio, Tomas; Baer, Richard; Gautier, Jean

    2014-07-01

    Since DNA double-strand breaks (DSBs) contribute to the genomic instability that drives cancer development, DSB repair pathways serve as important mechanisms for tumor suppression. Thus, genetic lesions, such as BRCA1 and BRCA2 mutations, that disrupt DSB repair are often associated with cancer susceptibility. In addition, recent evidence suggests that DSB "mis-repair", in which DSBs are resolved by an inappropriate repair pathway, can also promote genomic instability and presumably tumorigenesis. This notion has gained currency from recent cancer genome sequencing studies which have uncovered numerous chromosomal rearrangements harboring pathological DNA repair signatures. In this perspective, we discuss the factors that regulate DSB repair pathway choice and their consequences for genome stability and cancer.

  2. Nuclear Proteins Hijacked by Mammalian Cytoplasmic Plus Strand RNA Viruses

    PubMed Central

    Lloyd, Richard E.

    2015-01-01

    Plus strand RNA viruses that replicate in the cytoplasm face challenges in supporting the numerous biosynthetic functions required for replication and propagation. Most of these viruses are genetically simple and rely heavily on co-opting cellular proteins, particularly cellular RNA-binding proteins, into new roles for support of virus infection at the level of virus-specific translation, and building RNA replication complexes. In the course of infectious cycles many nuclear-cytoplasmic shuttling proteins of mostly nuclear distribution are detained in the cytoplasm by viruses and re-purposed for their own gain. Many mammalian viruses hijack a common group of the same factors. This review summarizes recent gains in our knowledge of how cytoplasmic RNA viruses use these co-opted host nuclear factors in new functional roles supporting virus translation and virus RNA replication and common themes employed between different virus groups. PMID:25818028

  3. Repair of Double-Strand Breaks by End Joining

    PubMed Central

    Chiruvella, Kishore K.; Liang, Zhuobin; Wilson, Thomas E.

    2013-01-01

    Nonhomologous end joining (NHEJ) refers to a set of genome maintenance pathways in which two DNA double-strand break (DSB) ends are (re)joined by apposition, processing, and ligation without the use of extended homology to guide repair. Canonical NHEJ (c-NHEJ) is a well-defined pathway with clear roles in protecting the integrity of chromosomes when DSBs arise. Recent advances have revealed much about the identity, structure, and function of c-NHEJ proteins, but many questions exist regarding their concerted action in the context of chromatin. Alternative NHEJ (alt-NHEJ) refers to more recently described mechanism(s) that repair DSBs in less-efficient backup reactions. There is great interest in defining alt-NHEJ more precisely, including its regulation relative to c-NHEJ, in light of evidence that alt-NHEJ can execute chromosome rearrangements. Progress toward these goals is reviewed. PMID:23637284

  4. Repair of double-strand breaks by end joining.

    PubMed

    Chiruvella, Kishore K; Liang, Zhuobin; Wilson, Thomas E

    2013-05-01

    Nonhomologous end joining (NHEJ) refers to a set of genome maintenance pathways in which two DNA double-strand break (DSB) ends are (re)joined by apposition, processing, and ligation without the use of extended homology to guide repair. Canonical NHEJ (c-NHEJ) is a well-defined pathway with clear roles in protecting the integrity of chromosomes when DSBs arise. Recent advances have revealed much about the identity, structure, and function of c-NHEJ proteins, but many questions exist regarding their concerted action in the context of chromatin. Alternative NHEJ (alt-NHEJ) refers to more recently described mechanism(s) that repair DSBs in less-efficient backup reactions. There is great interest in defining alt-NHEJ more precisely, including its regulation relative to c-NHEJ, in light of evidence that alt-NHEJ can execute chromosome rearrangements. Progress toward these goals is reviewed.

  5. Heavy metals in dolphins stranded on the French Atlantic coast.

    PubMed

    Holsbeek, L; Siebert, U; Joiris, C R

    1998-07-03

    Heavy metal concentrations (total and organic Hg, Ti, Cr, Cu, Zn, Cd and Pb) were determined in the muscle, liver and kidney of 36 dolphins stranded on the French Atlantic coast between 1977 and 1990: 29 common dolphins Delphinus delphis, five bottlenose dolphins Tursiops truncatus and two striped dolphins Stenella coeruleoalba. Total Hg concentration in the liver increased with age, while relative methylmercury concentration decreased, reflecting the existence of a slow demethylation process. To a lower extent, a similar pattern was observed in the kidney and muscle. No age-related increase was found for other heavy metals, although the highest levels for Cd and Cr were always found in adults. No difference in contamination could be detected between the 1977-1980 and 1984-1990 periods.

  6. Nuclear proteins hijacked by mammalian cytoplasmic plus strand RNA viruses.

    PubMed

    Lloyd, Richard E

    2015-05-01

    Plus strand RNA viruses that replicate in the cytoplasm face challenges in supporting the numerous biosynthetic functions required for replication and propagation. Most of these viruses are genetically simple and rely heavily on co-opting cellular proteins, particularly cellular RNA-binding proteins, into new roles for support of virus infection at the level of virus-specific translation, and building RNA replication complexes. In the course of infectious cycles many nuclear-cytoplasmic shuttling proteins of mostly nuclear distribution are detained in the cytoplasm by viruses and re-purposed for their own gain. Many mammalian viruses hijack a common group of the same factors. This review summarizes recent gains in our knowledge of how cytoplasmic RNA viruses use these co-opted host nuclear factors in new functional roles supporting virus translation and virus RNA replication and common themes employed between different virus groups.

  7. Stranded cost recovery presents stumbling block to open access

    SciTech Connect

    Del Roccili, J.A.

    1996-04-01

    Much of the impetus for the movement to competitive power markets is a result of the tremendous variance in energy prices across the country. Large commercial and industrial customers are becoming increasingly aware of these discrepancies and are marshaling the market and political forces required to guarantee the eventual development of a national open-access transmission policy. Such a policy will facilitate competition and equalize prices on a regional, and to some extent, national level. The stumbling block, however, is the recovery of stranded investment. Under traditional regulation, historical costs could be collected through approved rates for a bundled service. With the protection of a monopoly franchise, average electricity prices provide the possibility of cost recovery for assets that might not be recoverable in a competitive market.

  8. Macrophages recognize streptococci through bacterial single-stranded RNA

    PubMed Central

    Deshmukh, Sachin D; Kremer, Bernhard; Freudenberg, Marina; Bauer, Stefan; Golenbock, Douglas T; Henneke, Philipp

    2011-01-01

    Group B streptococcus (GBS) is a leading cause of both neonatal sepsis and meningitis, two diseases that are characterized by inflammation. However, the manner in which GBS organisms are recognized by monocytes and macrophages is poorly understood. In this study, we report that the recognition of GBS and other Gram-positive bacteria by macrophages and monocytes relies on bacterial single-stranded RNA (ssRNA). ssRNA interacts with a signalling complex, which comprises the Toll-like receptor adaptors MyD88 and UNC-93B, but not the established MyD88-dependent ssRNA sensors. The role of ssRNA in the recognition of Gram-positive bacteria—leading to the induction of inflammatory cytokines—has potential implications for sepsis pathogenesis, diagnosis and treatment. PMID:21164516

  9. In-flight rescue of stranded TDRS-1 spacecraft

    NASA Technical Reports Server (NTRS)

    Schmeichel, H.; Ehlers, B. J.

    1984-01-01

    On April 4, 1983, the first Tracking and Data Relay Satellite (TDRS-1), one of six to be built for SPACECOM and NASA, was launched by the Space Shuttle Challenger. During the ascent to geosynchronous orbit, the Inertial Upper Stage (IUS) booster malfunctioned, leaving TDRS stranded in a low, elliptical orbit. This report describes the amazing satellite recovery from a wild tumble and the dramatic three-month rescue effort to move TDRS into synchronous orbit. It took a total burn time of 44 hours from a pair of tiny one-pound thrusters, about 800 pounds of propellant, an adaptable, robust attitude control system and much resourcefulness from ground operators to accomplish this feat. TDRS-1 reached its proper earth orbit on June 29, 1983 and then began its ten-year mission as a data relay satellite.

  10. DNA Strand Exchange and RecA Homologs in Meiosis

    PubMed Central

    Brown, M. Scott; Bishop, Douglas K.

    2015-01-01

    Homology search and DNA strand–exchange reactions are central to homologous recombination in meiosis. During meiosis, these processes are regulated such that the probability of choosing a homolog chromatid as recombination partner is enhanced relative to that of choosing a sister chromatid. This regulatory process occurs as homologous chromosomes pair in preparation for assembly of the synaptonemal complex. Two strand–exchange proteins, Rad51 and Dmc1, cooperate in regulated homology search and strand exchange in most organisms. Here, we summarize studies on the properties of these two proteins and their accessory factors. In addition, we review current models for the assembly of meiotic strand–exchange complexes and the possible mechanisms through which the interhomolog bias of recombination partner choice is achieved. PMID:25475089

  11. Strand-specific RNA-seq applied to malaria samples

    PubMed Central

    Ponts, Nadia; Chung, Duk-Won D.; Roch, Karine G. Le

    2014-01-01

    Summary Over the past few years only, next-generation sequencing technologies became accessible and many applications were rapidly derived, such as the development of RNA-seq, a technique that uses deep sequencing to profile whole transcriptomes. RNA-seq has the power to discover new transcripts and splicing variants, single nucleotide variations, fusion genes, and mRNA levels-based expression profiles. Preparing RNA-seq libraries can be delicate and usually obligates buying expensive kits that require large amounts of stating materials. The method presented here is flexible and cost-effective. Using this method, we prepared high quality strand-specific RNA-seq libraries from RNA extracted from the human malaria parasite Plasmodium falciparum. The libraries are compatible with Illumina®'s sequencers Genome Analyzer and Hi-Seq. The method can however be easily adapted to other platforms. PMID:22589124

  12. Electromagnetic fields and the induction of DNA strand breaks.

    PubMed

    Ruiz-Gómez, Miguel J; Martínez-Morillo, Manuel

    2009-01-01

    The International Agency for Research on Cancer (IARC) has classified the extremely low-frequency (ELF) electromagnetic fields (EMF) as "possible carcinogenic" based on the reported effects. The purpose of this work is to review and compare the recent findings related to the induction of DNA strand breaks (DNA-SB) by magnetic field (MF) exposure. We found 29 studies (genotoxic and epigenetic) about the induction of DNA-SB by MF. 50% showed effect of MF and 50% showed no DNA-SB. Nevertheless, considering only genotoxic or only epigenetic studies, 37.5% and 69.2% found induction of DNA-SB by MF, respectively. In relation to these data it seems that MF could act as a co-inductor of DNA damage rather than as a genotoxic agent per se. Nevertheless, the published results, in some cases conflicting with negative findings, do not facilitate to obtain a common consensus about MF effects and biophysical interaction mechanisms.

  13. Repair of DNA Double-Strand Breaks in Heterochromatin

    PubMed Central

    Watts, Felicity Z.

    2016-01-01

    DNA double-strand breaks (DSBs) are among the most damaging lesions in DNA, since, if not identified and repaired, they can lead to insertions, deletions or chromosomal rearrangements. DSBs can be in the form of simple or complex breaks, and may be repaired by one of a number of processes, the nature of which depends on the complexity of the break or the position of the break within the chromatin. In eukaryotic cells, nuclear DNA is maintained as either euchromatin (EC) which is loosely packed, or in a denser form, much of which is heterochromatin (HC). Due to the less accessible nature of the DNA in HC as compared to that in EC, repair of damage in HC is not as straightforward as repair in EC. Here we review the literature on how cells deal with DSBs in HC. PMID:27999260

  14. Assembly of large icosahedral double-stranded RNA viruses.

    PubMed

    Poranen, Minna M; Bamford, Dennis H

    2012-01-01

    Double-stranded RNA (dsRNA) viruses are a diverse group of viruses infecting hosts from bacteria to higher eukaryotes. Among the hosts are humans, domestic animals, and economically important plant species. Fine details of high-resolution virion structures have revealed common structural characteristics unique to these viruses including an internal icosahedral capsid built from 60 asymmetric dimers (120 monomers!) of the major coat protein. Here we focus mainly on the structures and assembly principles of large icosahedral dsRNA viruses belonging to the families of Cystoviridae and Reoviridae. It is obvious that there are a variety of assembly pathways utilized by different viruses starting from similar building blocks and reaching in all cases a similar capsid architecture. This is true even with closely related viruses indicating that the assembly pathway per se is not an indicator of relatedness and is achieved with minor changes in the interacting components.

  15. Catalysts of DNA Strand Cleavage at Apurinic/Apyrimidinic Sites

    PubMed Central

    Minko, Irina G.; Jacobs, Aaron C.; de Leon, Arnie R.; Gruppi, Francesca; Donley, Nathan; Harris, Thomas M.; Rizzo, Carmelo J.; McCullough, Amanda K.; Lloyd, R. Stephen

    2016-01-01

    Apurinic/apyrimidinic (AP) sites are constantly formed in cellular DNA due to instability of the glycosidic bond, particularly at purines and various oxidized, alkylated, or otherwise damaged nucleobases. AP sites are also generated by DNA glycosylases that initiate DNA base excision repair. These lesions represent a significant block to DNA replication and are extremely mutagenic. Some DNA glycosylases possess AP lyase activities that nick the DNA strand at the deoxyribose moiety via a β- or β,δ-elimination reaction. Various amines can incise AP sites via a similar mechanism, but this non-enzymatic cleavage typically requires high reagent concentrations. Herein, we describe a new class of small molecules that function at low micromolar concentrations as both β- and β,δ-elimination catalysts at AP sites. Structure-activity relationships have established several characteristics that appear to be necessary for the formation of an iminium ion intermediate that self-catalyzes the elimination at the deoxyribose ring. PMID:27363485

  16. Using both strands: The fundamental nature of antisense transcription.

    PubMed

    Murray, Struan C; Mellor, Jane

    2016-01-01

    Non-coding transcription across the antisense strands of genes is an abundant, pervasive process in eukaryotes from yeast to humans, however its biological function remains elusive. Here, we provide commentary on a recent study of ours, which demonstrates a genome-wide role for antisense transcription: establishing a unique, dynamic chromatin architecture over genes. Antisense transcription increases the level of nucleosome occupancy and histone acetylation at the promoter and body of genes, without necessarily modulating the level of protein-coding sense transcription. It is also associated with high levels of histone turnover. By allowing genes to sample a wider range of chromatin configurations, antisense transcription could serve to make genes more sensitive to changing signals, priming them for responses to developmental programs or stressful cellular environments. Given the abundance of antisense transcription and the breadth of these chromatin changes, we propose that antisense transcription represents a fundamental, canonical feature of eukaryotic genes.

  17. Membranous Replication Factories Induced by Plus-Strand RNA Viruses

    PubMed Central

    Romero-Brey, Inés; Bartenschlager, Ralf

    2014-01-01

    In this review, we summarize the current knowledge about the membranous replication factories of members of plus-strand (+) RNA viruses. We discuss primarily the architecture of these complex membrane rearrangements, because this topic emerged in the last few years as electron tomography has become more widely available. A general denominator is that two “morphotypes” of membrane alterations can be found that are exemplified by flaviviruses and hepaciviruses: membrane invaginations towards the lumen of the endoplasmatic reticulum (ER) and double membrane vesicles, representing extrusions also originating from the ER, respectively. We hypothesize that either morphotype might reflect common pathways and principles that are used by these viruses to form their membranous replication compartments. PMID:25054883

  18. Regulatory RNA design through evolutionary computation and strand displacement.

    PubMed

    Rostain, William; Landrain, Thomas E; Rodrigo, Guillermo; Jaramillo, Alfonso

    2015-01-01

    The discovery and study of a vast number of regulatory RNAs in all kingdoms of life over the past decades has allowed the design of new synthetic RNAs that can regulate gene expression in vivo. Riboregulators, in particular, have been used to activate or repress gene expression. However, to accelerate and scale up the design process, synthetic biologists require computer-assisted design tools, without which riboregulator engineering will remain a case-by-case design process requiring expert attention. Recently, the design of RNA circuits by evolutionary computation and adapting strand displacement techniques from nanotechnology has proven to be suited to the automated generation of DNA sequences implementing regulatory RNA systems in bacteria. Herein, we present our method to carry out such evolutionary design and how to use it to create various types of riboregulators, allowing the systematic de novo design of genetic control systems in synthetic biology.

  19. Current-voltage characteristics of double-strand DNA sequences

    NASA Astrophysics Data System (ADS)

    Bezerril, L. M.; Moreira, D. A.; Albuquerque, E. L.; Fulco, U. L.; de Oliveira, E. L.; de Sousa, J. S.

    2009-09-01

    We use a tight-binding formulation to investigate the transmissivity and the current-voltage (I-V) characteristics of sequences of double-strand DNA molecules. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for the genomic DNA sequence with those of artificial sequences (the long-range correlated Fibonacci and Rudin-Shapiro one) and a random sequence, which is a kind of prototype of a short-range correlated system. The random sequence is presented here with the same first neighbors pair correlations of the human DNA sequence. We found that the long-range character of the correlations is important to the transmissivity spectra, although the I-V curves seem to be mostly influenced by the short-range correlations.

  20. Electronic transport in double-strand DNA segments

    NASA Astrophysics Data System (ADS)

    Albuquerque, E. L.; Mauriz, P. W.; Moreira, D. A.

    2008-03-01

    We report in this work a numerical study of the electronic density of states in π-stacked arrays of DNA double-strand segments made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. In order to reveal the relevance of the underlying correlations in the nucleotides distribution, we compare the results for a genomic DNA sequence, considering a segment of the first sequenced human chromosome 22 (Ch 22), with those of two artificial sequences forming a Rudin-Shapiro (RS) as well as a Fibonacci (FB) polyGC quasiperiodic sequences. Our theoretical method uses an electronic tight-binding Hamiltonian suitable to describe the DNA segments modeled by the quasiperiodic chains.

  1. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  2. Regulation of UHRF1 by dual-strand tumor-suppressor microRNA-145 (miR-145-5p and miR-145-3p): inhibition of bladder cancer cell aggressiveness

    PubMed Central

    Matsushita, Ryosuke; Yoshino, Hirofumi; Enokida, Hideki; Goto, Yusuke; Miyamoto, Kazutaka; Yonemori, Masaya; Inoguchi, Satoru; Nakagawa, Masayuki; Seki, Naohiko

    2016-01-01

    In microRNA (miRNA) biogenesis, the guide-strand of miRNA integrates into the RNA induced silencing complex (RISC), whereas the passenger-strand is inactivated through degradation. Analysis of our miRNA expression signature of bladder cancer (BC) by deep-sequencing revealed that microRNA (miR)-145-5p (guide-strand) and miR-145-3p (passenger-strand) were significantly downregulated in BC tissues. It is well known that miR-145-5p functions as a tumor suppressor in several types of cancer. However, the impact of miR-145-3p on cancer cells is still ambiguous. The aim of the present study was to investigate the functional significance of miR-145-3p and BC oncogenic pathways and targets regulated by miR-145-5p/miR-145-3p. Ectopic expression of either miR-145-5p or miR-145-3p in BC cells significantly suppressed cancer cell growth, migration and invasion and it also induced apoptosis. The gene encoding ubiquitin-like with PHD and ring finger domains 1 (UHRF1) was a direct target of these miRNAs. Silencing of UHRF1 induced apoptosis and inhibited cancer cell proliferation, migration, and invasion in BC cells. In addition, overexpressed UHRF1 was confirmed in BC clinical specimens, and the high UHRF1 expression group showed a significantly poorer cause specific survival rate in comparison with the low expression group. Taken together, our present data demonstrated that both strands of miR-145 (miR-145-5p: guide-strand and miR-145-3p: passenger-strand) play pivotal roles in BC cells by regulating UHRF1. The identification of the molecular target of a tumor suppressive miRNAs provides novel insights into the potential mechanisms of BC oncogenesis and suggests novel therapeutic strategies. PMID:27072587

  3. Ribonuclease III mechanisms of double-stranded RNA cleavage.

    PubMed

    Nicholson, Allen W

    2014-01-01

    Double-stranded(ds) RNA has diverse roles in gene expression and regulation, host defense, and genome surveillance in bacterial and eukaryotic cells. A central aspect of dsRNA function is its selective recognition and cleavage by members of the ribonuclease III (RNase III) family of divalent-metal-ion-dependent phosphodiesterases. The processing of dsRNA by RNase III family members is an essential step in the maturation and decay of coding and noncoding RNAs, including miRNAs and siRNAs. RNase III, as first purified from Escherichia coli, has served as a biochemically well-characterized prototype, and other bacterial orthologs provided the first structural information. RNase III family members share a unique fold (RNase III domain) that can dimerize to form a structure that binds dsRNA and cleaves phosphodiesters on each strand, providing the characteristic 2 nt, 3'-overhang product ends. Ongoing studies are uncovering the functions of additional domains, including, inter alia, the dsRNA-binding and PAZ domains that cooperate with the RNase III domain to select target sites, regulate activity, confer processivity, and support the recognition of structurally diverse substrates. RNase III enzymes function in multicomponent assemblies that are regulated by diverse inputs, and at least one RNase III-related polypeptide can function as a noncatalytic, dsRNA-binding protein. This review summarizes the current knowledge of the mechanisms of catalysis and target site selection of RNase III family members, and also addresses less well understood aspects of these enzymes and their interactions with dsRNA. © 2013 The Authors. WIREs RNA published by John Wiley & Sons, Ltd.

  4. DNA Mismatch Repair-Induced Double-Strand Breaks

    PubMed Central

    Nowosielska, Anetta; Marinus, M. G.

    2007-01-01

    Escherichia coli dam mutants are sensitized to the cytotoxic action of base analogs, cisplatin and N-methyl-N’-nitro-N-nitrosoguanidine (MNNG), while their mismatch repair (MMR)-deficient derivatives are tolerant to these agents. We showed previously, using pulse field gel electrophoresis, that MMR-mediated double-strand breaks (DSBs) are produced by cisplatin in dam recB (Ts) cells at the non-permissive temperature. We demonstrate here that the majority of these DSBs require DNA replication for their formation, consistent with a model in which replication forks collapse at nicks or gaps formed during MMR. DSBs were also detected in dam recB(Ts) ada ogt cells exposed to MNNG in a dose- and MMR-dependent manner. In contrast to cisplatin, the formation of these DSBs was not affected by DNA replication and it is proposed that two separate mechanisms result in DSB formation. Replication-independent DSBs arise from overlapping base excision and MMR repair tracts on complementary strands and constitute the majority of detectable DSBs in dam recB(Ts) ada ogt cells exposed to MNNG. Replication-dependent DSBs result from replication fork collapse at O6-meG base pairs undergoing MMR futile cycling and are more likely to contribute to cytotoxicity. This model is consistent with the observation that fast-growing dam recB (Ts) ada ogt cells, which have more chromosome replication origins, are more sensitive to the cytotoxic effect of MNNG than the same cells growing slowly. PMID:17827074

  5. Dynamic profiling of double-stranded RNA binding proteins

    PubMed Central

    Wang, Xinlei; Vukovic, Lela; Koh, Hye Ran; Schulten, Klaus; Myong, Sua

    2015-01-01

    Double-stranded (ds) RNA is a key player in numerous biological activities in cells, including RNA interference, anti-viral immunity and mRNA transport. The class of proteins responsible for recognizing dsRNA is termed double-stranded RNA binding proteins (dsRBP). However, little is known about the molecular mechanisms underlying the interaction between dsRBPs and dsRNA. Here we examined four human dsRBPs, ADAD2, TRBP, Staufen 1 and ADAR1 on six dsRNA substrates that vary in length and secondary structure. We combined single molecule pull-down (SiMPull), single molecule protein-induced fluorescence enhancement (smPIFE) and molecular dynamics (MD) simulations to investigate the dsRNA-dsRBP interactions. Our results demonstrate that despite the highly conserved dsRNA binding domains, the dsRBPs exhibit diverse substrate specificities and dynamic properties when in contact with different RNA substrates. While TRBP and ADAR1 have a preference for binding simple duplex RNA, ADAD2 and Staufen1 display higher affinity to highly structured RNA substrates. Upon interaction with RNA substrates, TRBP and Staufen1 exhibit dynamic sliding whereas two deaminases ADAR1 and ADAD2 mostly remain immobile when bound. MD simulations provide a detailed atomic interaction map that is largely consistent with the affinity differences observed experimentally. Collectively, our study highlights the diverse nature of substrate specificity and mobility exhibited by dsRBPs that may be critical for their cellular function. PMID:26184879

  6. Elastic properties of alternative versus single-stranded leveling archwires.

    PubMed

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  7. Common Ground for Managing Invasive Annual Grasses

    USDA-ARS?s Scientific Manuscript database

    Invasive annual grasses often reach their full biological potential in ecosystems of the western United States. This suggests that crucial ecosystem "checks and balances" are not functioning. In other words, invasion occurs because ecosystems have lost resistance to invasion, and invasive plants a...

  8. Performance of Nb3Sn RRP strands and cables based on a 108/127 stack design

    SciTech Connect

    Barzi, E.; Ambrosio, G.; Andreev, N.; Bossert, R.; Carcagno, R.; Feher, S.; Kashikhin, V.S.; Kashikhin, V.V.; Lamm, M.J.; Nobrega, F.; Novitski, I.; /Fermilab /Oxford Supercond. Tech., Carteret

    2006-08-01

    The high performance Nb{sub 3}Sn strand produced by Oxford Superconducting Technology (OST) with the Restack Rod Process (RRP) is presently considered as a baseline conductor for the Fermilab's accelerator magnet R&D program. To improve the strand stability in the current and field range expected in magnet models, the number of subelements in the strand was increased by a factor of two (from 54 to 108), which resulted in a smaller effective filament size. The performance of the 1.0 and 0.7 mm strands of this design was studied using virgin and deformed strand samples. 27-strand Rutherford cables made of 1 mm strand were also tested using a superconducting transformer, small racetrack and 1-m shell-type dipole coils. This paper presents the RRP strand and cable parameters, and reports the results of strand, cable and coil testing.

  9. Complex shapes self-assembled from single-stranded DNA tiles.

    PubMed

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  10. Non-Specific Blocking of miR-17-5p Guide Strand in Triple Negative Breast Cancer Cells by Amplifying Passenger Strand Activity.

    PubMed

    Jin, Yuan-Yuan; Andrade, Jade; Wickstrom, Eric

    2015-01-01

    Conventional wisdom holds that only one of the two strands in a micro ribonucleic acid (miRNA) precursor duplex is selected as the active miRNA guide strand. The complementary miRNA passenger strand, however, is thought to be inactive. High levels of the oncogenic miRNA (oncomiR) guide strand called miR-17-5p is overexpressed in triple negative breast cancer (TNBC) and can inhibit ribosomal translation of tumor suppressor gene mRNAs, such as programmed cell death 4 (PDCD4) or phosphatase and tensin homolog (PTEN). We hypothesized that knocking down the oncogenic microRNA (oncomiR) miR-17-5p might restore the expression levels of PDCD4 and PTEN tumor suppressor proteins, illustrating a route to oligonucleotide therapy of TNBC. Contrary to conventional wisdom, antisense knockdown of oncomiR miR-17-5p guide strand reduced PDCD4 and PTEN proteins by 1.8±0.3 fold in human TNBC cells instead of raising them. Bioinformatics analysis and folding energy calculations revealed that mRNA targets of miR-17-5p guide strand, such as PDCD4 and PTEN, could also be regulated by miR-17-3p passenger strand. Due to high sequence homology between the antisense molecules and miR-17-3p passenger strand, as well as the excess binding sites for the passenger strand on the 3'UTR of PDCD4 and PTEN mRNAs, introducing a miR-17-3p DNA-LNA mimic to knock down miR-17-5p reduced PDCD4 and PTEN protein expression instead of raising them. Our results imply that therapeutic antisense sequences against miRNAs should be designed to target the miRNA strand with the greatest number of putative binding sites in the target mRNAs, while minimizing affinity for the minor strand.

  11. Non-Specific Blocking of miR-17-5p Guide Strand in Triple Negative Breast Cancer Cells by Amplifying Passenger Strand Activity

    PubMed Central

    Jin, Yuan-Yuan; Andrade, Jade; Wickstrom, Eric

    2015-01-01

    Conventional wisdom holds that only one of the two strands in a micro ribonucleic acid (miRNA) precursor duplex is selected as the active miRNA guide strand. The complementary miRNA passenger strand, however, is thought to be inactive. High levels of the oncogenic miRNA (oncomiR) guide strand called miR-17-5p is overexpressed in triple negative breast cancer (TNBC) and can inhibit ribosomal translation of tumor suppressor gene mRNAs, such as programmed cell death 4 (PDCD4) or phosphatase and tensin homolog (PTEN). We hypothesized that knocking down the oncogenic microRNA (oncomiR) miR-17-5p might restore the expression levels of PDCD4 and PTEN tumor suppressor proteins, illustrating a route to oligonucleotide therapy of TNBC. Contrary to conventional wisdom, antisense knockdown of oncomiR miR-17-5p guide strand reduced PDCD4 and PTEN proteins by 1.8±0.3 fold in human TNBC cells instead of raising them. Bioinformatics analysis and folding energy calculations revealed that mRNA targets of miR-17-5p guide strand, such as PDCD4 and PTEN, could also be regulated by miR-17-3p passenger strand. Due to high sequence homology between the antisense molecules and miR-17-3p passenger strand, as well as the excess binding sites for the passenger strand on the 3’UTR of PDCD4 and PTEN mRNAs, introducing a miR-17-3p DNA-LNA mimic to knock down miR-17-5p reduced PDCD4 and PTEN protein expression instead of raising them. Our results imply that therapeutic antisense sequences against miRNAs should be designed to target the miRNA strand with the greatest number of putative binding sites in the target mRNAs, while minimizing affinity for the minor strand. PMID:26629823

  12. Invasive and non-invasive assessment of portal hypertension.

    PubMed

    Leung, Jonathan Chung-Fai; Loong, Thomson Chi-Wang; Pang, James; Wei, Jeremy Lok; Wong, Vincent Wai-Sun

    2017-03-30

    Portal hypertension is the central driver of complications in patients with chronic liver diseases and cirrhosis. The diagnosis of portal hypertension has important prognostic and clinical implications. In particular, screening for varices in patients with portal hypertension can effectively reduce the morbidity and mortality of variceal bleeding. In this article, we review the invasive and non-invasive methods to assess portal hypertension. Hepatic venous pressure gradient remains the gold standard to measure portal pressure but is invasive and seldom performed outside expert centers and research settings. In recent years, a number of non-invasive tests of fibrosis have shown good correlation with liver histology. They also show promise in identifying patients with portal hypertension and large varices. As a result, the latest Baveno VI consensus guidelines endorse the use of liver stiffness measurement by transient elastography and platelet count as initial assessment to select patients for varices screening. On the other hand, the performance of non-invasive tests in assessing the response to non-selective beta-blockers or transjugular intrahepatic portosystemic shunting is either suboptimal or unclear.

  13. SOST Inhibits Prostate Cancer Invasion

    SciTech Connect

    Hudson, Bryan D.; Hum, Nicholas R.; Thomas, Cynthia B.; Kohlgruber, Ayano; Sebastian, Aimy; Collette, Nicole M.; Coleman, Matthew A.; Christiansen, Blaine A.; Loots, Gabriela G.

    2015-11-06

    Inhibitors of Wnt signaling have been shown to be involved in prostate cancer (PC) metastasis; however the role of Sclerostin (Sost) has not yet been explored. Here we show that elevated Wnt signaling derived from Sost deficient osteoblasts promotes PC invasion, while rhSOST has an inhibitory effect. In contrast, rhDKK1 promotes PC elongation and filopodia formation, morphological changes characteristic of an invasive phenotype. Furthermore, rhDKK1 was found to activate canonical Wnt signaling in PC3 cells, suggesting that SOST and DKK1 have opposing roles on Wnt signaling in this context. Gene expression analysis of PC3 cells co-cultured with OBs exhibiting varying amounts of Wnt signaling identified CRIM1 as one of the transcripts upregulated under highly invasive conditions. We found CRIM1 overexpression to also promote cell-invasion. These findings suggest that bone-derived Wnt signaling may enhance PC tropism by promoting CRIM1 expression and facilitating cancer cell invasion and adhesion to bone. We concluded that SOST and DKK1 have opposing effects on PC3 cell invasion and that bone-derived Wnt signaling positively contributes to the invasive phenotypes of PC3 cells by activating CRIM1 expression and facilitating PC-OB physical interaction. As such, we investigated the effects of high concentrations of SOST in vivo. In conclusion, we found that PC3-cells overexpressing SOST injected via the tail vein in NSG mice did not readily metastasize, and those injected intrafemorally had significantly reduced osteolysis, suggesting that targeting the molecular bone environment may influence bone metastatic prognosis in clinical settings.

  14. SOST Inhibits Prostate Cancer Invasion

    DOE PAGES

    Hudson, Bryan D.; Hum, Nicholas R.; Thomas, Cynthia B.; ...

    2015-11-06

    Inhibitors of Wnt signaling have been shown to be involved in prostate cancer (PC) metastasis; however the role of Sclerostin (Sost) has not yet been explored. Here we show that elevated Wnt signaling derived from Sost deficient osteoblasts promotes PC invasion, while rhSOST has an inhibitory effect. In contrast, rhDKK1 promotes PC elongation and filopodia formation, morphological changes characteristic of an invasive phenotype. Furthermore, rhDKK1 was found to activate canonical Wnt signaling in PC3 cells, suggesting that SOST and DKK1 have opposing roles on Wnt signaling in this context. Gene expression analysis of PC3 cells co-cultured with OBs exhibiting varyingmore » amounts of Wnt signaling identified CRIM1 as one of the transcripts upregulated under highly invasive conditions. We found CRIM1 overexpression to also promote cell-invasion. These findings suggest that bone-derived Wnt signaling may enhance PC tropism by promoting CRIM1 expression and facilitating cancer cell invasion and adhesion to bone. We concluded that SOST and DKK1 have opposing effects on PC3 cell invasion and that bone-derived Wnt signaling positively contributes to the invasive phenotypes of PC3 cells by activating CRIM1 expression and facilitating PC-OB physical interaction. As such, we investigated the effects of high concentrations of SOST in vivo. In conclusion, we found that PC3-cells overexpressing SOST injected via the tail vein in NSG mice did not readily metastasize, and those injected intrafemorally had significantly reduced osteolysis, suggesting that targeting the molecular bone environment may influence bone metastatic prognosis in clinical settings.« less

  15. Replication of simian virus 40 DNA after UV irradiation: evidence of growing fork blockage and single-stranded gaps in daughter strands

    SciTech Connect

    Mezzina, M.; Menck, C.F.M.; Courtin, P.; Sarasin, A.

    1988-11-01

    The molecular mechanisms of in vivo inhibition of mammalian DNA replication by exposure to UV light (at 254 nm) was studied in monkey and human cells infected with simian virus 40. Analysis of viral DNA by electron microscopy and sucrose gradients confirmed that the presence of UV-induced lesions severely blocks DNA synthesis, and thus the conversion of replicative intermediates (RIs) into fully replicated form I DNA is inhibited by UV irradiation. These blocked RI molecules present several special features when visualized by electron microscopy. In excision repair-proficient monkey and human cells they are composed of a double-stranded circular DNA with a double-stranded tail whose size corresponds to the average interpyrimidine dimer distance, as determined by the dimer-specific T4 endonuclease V. In excision repair-deficient human cells from patients with xeroderma pigmentosum, UV-irradiated RIs present a Carins-like structure similar to that observed for replicating molecules obtained from unirradiated infected cells. Single-stranded gaps are visualized in the replicated portions of UV-irradiated RI molecules; such regions are detected and clearly distinguishable from double-stranded DNA when probed by a specific single-stranded DNA-binding protein such as the bacteriophage T4 gene 32 product. Consistent with the presence of gaps in UV-irradiated RI molecules, single-strand-specific S1 nuclease digestion causes a shift in their sedimentation properties when analyzed in neutral sucrose gradients compared with undamaged molecules.

  16. Triplex formation at single-stranded nucleic acid target sites of unrestricted sequence by two added strands of oligonucleotides: A proposed model

    SciTech Connect

    Trapane, T.L.; Ts'o, P.O.P. )

    1994-11-16

    By using the standard purine nucleosides, guanosine and adenosine, and the pyrimidine C-nucleosides, pseudoisocytidine and pseudouridine, as complements on a probe strand, it is possible to construct a regular Watson-Crick helix with a single-stranded target sequence having any arrangement of the four naturally-occurring bases found in nucleic acids. The major groove of this helix will have a unique configuration of hydrogen-bonding sites on the probe strand for each of these four base pairs. By using this duplex as a framework, an ensemble of recognition patterns composed of base triads may be constructed. In these patterns, either a homopyrimidine or homopurine third strand binds in the major groove of the duplex formed by the target and probe strands. Ten distinct geometries, or motifs, are shown, each one consisting of four isomorphic base triads built upon recognition of C, G, A, or U(T) residues in the target strand. In order to maintain specific hydrogen bonding and to construct isomorphous triads, the use of several nonstandard bases is proposed. 33 refs., 9 figs., 3 tabs.

  17. The impact of tensioning device mal-positioning on strand tension during Anterior Cruciate Ligament reconstruction

    PubMed Central

    2011-01-01

    Background In order to confer optimal strength and stiffness to the graft in Anterior Cruciate Ligament (ACL) reconstruction, the maintenance of equal strand tension prior to fixation, is desired; positioning of the tensioning device can significantly affect strand tension This study aimed to determine the effect of tensioning device mal-positioning on individual strand tension in simulated cadaveric ACL reconstructions. Methods Twenty cadaveric specimens, comprising bovine tibia and tendon harvested from sheep, were used to simulate ACL reconstruction with a looped four-strand tendon graft. A proprietary tensioning device was used to tension the graft during tibial component fixation with graft tension recorded using load cells. The effects of the tensioning device at extreme angles, and in various locking states, was evaluated. Results Strand tension varied significantly when the tensioning device was held at extreme angles (p < 0.001) or in 'locked' configurations of the tensioning device (p < 0.046). Tendon position also produced significant effects (p < 0.016) on the resultant strand tension. Conclusion An even distribution of tension among individual graft strands is obtained by maintaining the tensioning device in an unlocked state, aligned with the longitudinal axis of the tibial tunnel. If the maintenance of equal strand tension during tibial fixation of grafts is important, close attention must be paid to positioning of the tensioning device in order to optimize the resultant graft tension and, by implication, the strength and stiffness of the graft and ultimately, surgical outcome. PMID:21711536

  18. Double-Stranded RNAs and their Use for Characterization of Recalcitrant Viruses

    USDA-ARS?s Scientific Manuscript database

    The presence of high molecular weight, virus-specific, double-stranded RNAs (dsRNAs) in virus-infected plants are probably formed during virus replication and consists of full-length and subgenomic RNAs of single-stranded RNA viruses or genomes of dsRNA viruses. The sizes and patterns of these viru...

  19. 77 FR 2958 - Prestressed Concrete Steel Wire Strand From Thailand: Correction to Notice of Opportunity To...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-20

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE International Trade Administration Prestressed Concrete Steel Wire Strand From Thailand: Correction to Notice of... administrative review of the antidumping duty order on prestressed concrete steel wire strand (``PC...

  20. Dolphin Morbillivirus Associated with a Mass Stranding of Sperm Whales, Italy

    PubMed Central

    Centelleghe, Cinzia; Di Provvido, Andrea; Di Renzo, Ludovica; Cardeti, Giusy; Cersini, Antonella; Fichi, Gianluca; Petrella, Antonio; Di Francesco, Cristina Esmeralda; Mignone, Walter; Casalone, Cristina; Di Guardo, Giovanni

    2017-01-01

    In September 2014, seven sperm whales were stranded along Italy’s Adriatic coastline. Postmortem investigations on 3 female adult whales and 1 male fetus carried by the largest female revealed molecular and immunohistochemical evidence of dolphin morbillivirus infection. A possible role of the virus in the stranding event was considered. PMID:27983493