A homozygous mutation in the endothelin-3 gene associated with a combined Waardenburg type 2 and Hirschsprung phenotype (Shah-Waardenburg syndrome).

PubMed

Hofstra, R M; Osinga, J; Tan-Sindhunata, G; Wu, Y; Kamsteeg, E J; Stulp, R P; van Ravenswaaij-Arts, C; Majoor-Krakauer, D; Angrist, M; Chakravarti, A; Meijers, C; Buys, C H

1996-04-01

Hirschsprung disease (HSCR) or colonic aganglionosis is a congenital disorder characterized by an absence of intramural ganglia along variable lengths of the colon resulting in intestinal obstruction. The incidence of HSCR is 1 in 5,000 live births. Mutations in the RET gene, which codes for a receptor tyrosine kinase, and in EDNRB which codes for the endothelin-B receptor, have been shown to be associated with HSCR in humans. The lethal-spotted mouse which has pigment abnormalities, but also colonic aganglionosis, carries a mutation in the gene coding for endothelin 3 (Edn3), the ligand for the receptor protein encoded by EDNRB. Here, we describe a mutation of the human gene for endothelin 3 (EDN3), homozygously present in a patient with a combined Waardenburg syndrome type 2 (WS2) and HSCR phenotype (Shah-Waardenburg syndrome). The mutation, Cys159Phe, in exon 3 in the ET-3 like domain of EDN3, presumably affects the proteolytic processing of the preproendothelin to the mature peptide EDN3. The patient's parents were first cousins. A previous child in this family had been diagnosed with a similar combination of HSCR, depigmentation and deafness. Depigmentation and deafness were present in other relatives. Moreover, we present a further indication for the involvement of EDNRB in HSCR by reporting a novel mutation detected in one of 40 unselected HSCR patients.

Polymorphisms in adenosine receptor genes are associated with infarct size in patients with ischemic cardiomyopathy.

PubMed

Tang, Z; Diamond, M A; Chen, J-M; Holly, T A; Bonow, R O; Dasgupta, A; Hyslop, T; Purzycki, A; Wagner, J; McNamara, D M; Kukulski, T; Wos, S; Velazquez, E J; Ardlie, K; Feldman, A M

2007-10-01

The goal of this experiment was to identify the presence of genetic variants in the adenosine receptor genes and assess their relationship to infarct size in a population of patients with ischemic cardiomyopathy. Adenosine receptors play an important role in protecting the heart during ischemia and in mediating the effects of ischemic preconditioning. We sequenced DNA samples from 273 individuals with ischemic cardiomyopathy and from 203 normal controls to identify the presence of genetic variants in the adenosine receptor genes. Subsequently, we analyzed the relationship between the identified genetic variants and infarct size, left ventricular size, and left ventricular function. Three variants in the 3'-untranslated region of the A(1)-adenosine gene (nt 1689 C/A, nt 2206 Tdel, nt 2683del36) and an informative polymorphism in the coding region of the A3-adenosine gene (nt 1509 A/C I248L) were associated with changes in infarct size. These results suggest that genetic variants in the adenosine receptor genes may predict the heart's response to ischemia or injury and might also influence an individual's response to adenosine therapy.

Mutation analysis of aryl hydrocarbon receptor interacting protein (AIP) gene in colorectal, breast, and prostate cancers

PubMed Central

Georgitsi, M; Karhu, A; Winqvist, R; Visakorpi, T; Waltering, K; Vahteristo, P; Launonen, V; Aaltonen, L A

2007-01-01

Germline mutations in the aryl hydrocarbon receptor interacting protein (AIP) gene were recently identified in individuals with pituitary adenoma predisposition (PAP). These patients have prolactin (PRL) or growth hormone (GH) oversecreting pituitary adenomas, the latter exhibiting acromegaly or gigantism. Loss-of-heterozygosity (LOH) analysis revealed that AIP is lost in PAP tumours, suggesting that it acts as a tumour-suppressor gene. Aryl hydrocarbon receptor interacting protein is involved in several pathways, but it is best characterised as a cytoplasmic partner of the aryl hydrocarbon receptor (AHR). To examine the possible role of AIP in the genesis of common cancers, we performed somatic mutation screening in a series of 373 colorectal cancers (CRCs), 82 breast cancers, and 44 prostate tumour samples. A missense R16H (47G>A) change was identified in two CRC samples, as well as in the respective normal tissues, but was absent in 209 healthy controls. The remaining findings were silent, previously unreported, changes of the coding, non-coding, or untranslated regions of AIP. These results suggest that somatic AIP mutations are not common in CRC, breast, and prostate cancers. PMID:17242703

The human serotonin 5-HT{sub 2C} receptor: Complete cDNA, genomic structure, and alternatively spliced variant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun

1996-08-01

The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less

Dm5-HT2B: Pharmacological Characterization of the Fifth Serotonin Receptor Subtype of Drosophila melanogaster.

PubMed

Blenau, Wolfgang; Daniel, Stöppler; Balfanz, Sabine; Thamm, Markus; Baumann, Arnd

2017-01-01

Serotonin (5-hydroxytryptamine, 5-HT) is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects) and deuterostomes (e.g., mammals). In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster , a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT 1A , Dm5-HT 1B , and Dm5-HT 7 couple to cAMP signaling cascades, the Dm5-HT 2A receptor leads to Ca 2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT 2B receptor. Knowledge about this receptor's pharmacological properties is very limited. This is quite surprising because Dm5-HT 2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT 2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT 2B 's pharmacology, we evaluated the receptor's response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT 2B signaling in vitro and in vivo .

The gene coding for the B cell surface protein CD19 is localized on human chromosome 16p11.

PubMed

Stapleton, P; Kozmik, Z; Weith, A; Busslinger, M

1995-02-01

The CD19 gene codes for one of the earliest markers of the human B cell lineage and is a target for the B lymphoid-specific transcription factor BSAP (Pax-5). The transmembrane protein CD19 has been implicated in controlling proliferation of mature B lymphocytes by modulating signal transduction through the antigen receptor. In this study, we have employed Southern blot and fluorescence in situ hybridization analyses to localize the CD19 gene to human chromosome 16p11.

Effect of a thymol application on olfactory memory and gene expression levels in the brain of the honeybee Apis mellifera.

PubMed

Bonnafé, Elsa; Drouard, Florian; Hotier, Lucie; Carayon, Jean-Luc; Marty, Pierre; Treilhou, Michel; Armengaud, Catherine

2015-06-01

Essential oils are used by beekeepers to control the Varroa mites that infest honeybee colonies. So, bees can be exposed to thymol formulations in the hive. The effects of the monoterpenoid thymol were explored on olfactory memory and gene expression in the brain of the honeybee. In bees previously exposed to thymol (10 or 100 ng/bee), the specificity of the response to the conditioned stimulus (CS) was lost 24 h after learning. Besides, the octopamine receptor OA1 gene Amoa1 showed a significant decrease of expression 3 h after exposure with 10 or 100 ng/bee of thymol. With the same doses, expression of Rdl gene, coding for a GABA receptor subunit, was not significantly modified but the trpl gene was upregulated 1 and 24 h after exposure to thymol. These data indicated that the genes coding for the cellular targets of thymol could be rapidly regulated after exposure to this molecule. Memory and sensory processes should be investigated in bees after chronic exposure in the hive to thymol-based preparations.

Expression and Role of Gonadotropin-Releasing Hormone 2 and Its Receptor in Mammals

PubMed Central

Desaulniers, Amy T.; Cederberg, Rebecca A.; Lents, Clay A.; White, Brett R.

2017-01-01

Gonadotropin-releasing hormone 1 (GnRH1) and its receptor (GnRHR1) drive mammalian reproduction via regulation of the gonadotropins. Yet, a second form of GnRH (GnRH2) and its receptor (GnRHR2) also exist in mammals. GnRH2 has been completely conserved throughout 500 million years of evolution, signifying high selection pressure and a critical biological role. However, the GnRH2 gene is absent (e.g., rat) or inactivated (e.g., cow and sheep) in some species but retained in others (e.g., human, horse, and pig). Likewise, many species (e.g., human, chimpanzee, cow, and sheep) retain the GnRHR2 gene but lack the appropriate coding sequence to produce a full-length protein due to gene coding errors; although production of GnRHR2 in humans remains controversial. Certain mammals lack the GnRHR2 gene (e.g., mouse) or most exons entirely (e.g., rat). In contrast, old world monkeys, musk shrews, and pigs maintain the coding sequence required to produce a functional GnRHR2. Like GnRHR1, GnRHR2 is a 7-transmembrane, G protein-coupled receptor that interacts with Gαq/11 to mediate cell signaling. However, GnRHR2 retains a cytoplasmic tail and is only 40% homologous to GnRHR1. A role for GnRH2 and its receptor in mammals has been elusive, likely because common laboratory models lack both the ligand and receptor. Uniquely, both GnRH2 and GnRHR2 are ubiquitously expressed; transcript levels are abundant in peripheral tissues and scarcely found in regions of the brain associated with gonadotropin secretion, suggesting a divergent role from GnRH1/GnRHR1. Indeed, GnRH2 and its receptor are not physiological modulators of gonadotropin secretion in mammals. Instead, GnRH2 and GnRHR2 coordinate the interaction between nutritional status and sexual behavior in the female brain. Within peripheral tissues, GnRH2 and its receptor are novel regulators of reproductive organs. GnRH2 and GnRHR2 directly stimulate steroidogenesis within the porcine testis. In the female, GnRH2 and its receptor may help mediate placental function, implantation, and ovarian steroidogenesis. Furthermore, both the GnRH2 and GnRHR2 genes are expressed in human reproductive tumors and represent emerging targets for cancer treatment. Thus, GnRH2 and GnRHR2 have diverse functions in mammals which remain largely unexplored. PMID:29312140

Non-redundant coding of aversive odours in the main olfactory pathway

PubMed Central

Dewan, Adam; Pacifico, Rodrigo; Zhan, Ross; Rinberg, Dmitry; Bozza, Thomas

2013-01-01

Many species are critically dependent on olfaction for survival. In the main olfactory system of mammals, odours are detected by sensory neurons which express a large repertoire of canonical odorant receptors (ORs) and a much smaller repertoire of Trace Amine-Associated Receptors (TAARs)1–4. Odours are encoded in a combinatorial fashion across glomeruli in the main olfactory bulb, with each glomerulus corresponding to a different receptor5–7. The degree to which individual receptor genes contribute to odour perception is unclear. Here we show that genetic deletion of the olfactory TAAR gene family, or even a single TAAR gene, eliminates aversion that mice display to low concentrations of volatile amines and to the odour of predator urine. Our findings identify a role for the TAARs in olfaction, namely in the high-sensitivity detection of innately aversive odours. In addition, our data reveal that aversive amines are represented in a non-redundant fashion, and that individual main olfactory receptor genes can contribute significantly to odour perception. PMID:23624375

Non-redundant coding of aversive odours in the main olfactory pathway.

PubMed

Dewan, Adam; Pacifico, Rodrigo; Zhan, Ross; Rinberg, Dmitry; Bozza, Thomas

2013-05-23

Many species are critically dependent on olfaction for survival. In the main olfactory system of mammals, odours are detected by sensory neurons that express a large repertoire of canonical odorant receptors and a much smaller repertoire of trace amine-associated receptors (TAARs). Odours are encoded in a combinatorial fashion across glomeruli in the main olfactory bulb, with each glomerulus corresponding to a specific receptor. The degree to which individual receptor genes contribute to odour perception is unclear. Here we show that genetic deletion of the olfactory Taar gene family, or even a single Taar gene (Taar4), eliminates the aversion that mice display to low concentrations of volatile amines and to the odour of predator urine. Our findings identify a role for the TAARs in olfaction, namely, in the high-sensitivity detection of innately aversive odours. In addition, our data reveal that aversive amines are represented in a non-redundant fashion, and that individual main olfactory receptor genes can contribute substantially to odour perception.

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

Regulation of Epidermal Growth Factor Receptor Expression by PML in Human Breast Cancer.

DTIC Science & Technology

1996-08-01

Characterization of a zinc finger gene disrupted by the t(15; 17) in acute promyelocytic leukemia. Science, 254:1371-1374. (32) Fagioli , M., Alcalay, M...DISTRIBUTION CODE Approved for public release; distribution unlimited 13. ABSTRACT (Maximum 200 We have determined that PML is a novel growth suppressor that...was found to be translocated from chromosome 15 and fused with the retinoic acid receptor- a gene on chromosome 17 (t(15; 17) in acute promyelogenous

Overlapping but distinct topology for zebrafish V2R-like olfactory receptors reminiscent of odorant receptor spatial expression zones.

PubMed

Ahuja, Gaurav; Reichel, Vera; Kowatschew, Daniel; Syed, Adnan S; Kotagiri, Aswani Kumar; Oka, Yuichiro; Weth, Franco; Korsching, Sigrun I

2018-05-23

The sense of smell is unrivaled in terms of molecular complexity of its input channels. Even zebrafish, a model vertebrate system in many research fields including olfaction, possesses several hundred different olfactory receptor genes, organized in four different gene families. For one of these families, the initially discovered odorant receptors proper, segregation of expression into distinct spatial subdomains within a common sensory surface has been observed both in teleost fish and in mammals. However, for the remaining three families, little to nothing was known about their spatial coding logic. Here we wished to investigate, whether the principle of spatial segregation observed for odorant receptors extends to another olfactory receptor family, the V2R-related OlfC genes. Furthermore we thought to examine, how expression of OlfC genes is integrated into expression zones of odorant receptor genes, which in fish share a single sensory surface with OlfC genes. To select representative genes, we performed a comprehensive phylogenetic study of the zebrafish OlfC family, which identified a novel OlfC gene, reduced the number of pseudogenes to 1, and brought the total family size to 60 intact OlfC receptors. We analyzed the spatial pattern of OlfC-expressing cells for seven representative receptors in three dimensions (height within the epithelial layer, horizontal distance from the center of the olfactory organ, and height within the olfactory organ). We report non-random distributions of labeled neurons for all OlfC genes analysed. Distributions for sparsely expressed OlfC genes are significantly different from each other in nearly all cases, broad overlap notwithstanding. For two of the three coordinates analyzed, OlfC expression zones are intercalated with those of odorant receptor zones, whereas in the third dimension some segregation is observed. Our results show that V2R-related OlfC genes follow the same spatial logic of expression as odorant receptors and their expression zones intermingle with those of odorant receptor genes. Thus, distinctly different expression zones for individual receptor genes constitute a general feature shared by teleost and tetrapod V2R/OlfC and odorant receptor families alike.

Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calabrese, G.; Morizio, E.; Palka, G.

1994-11-01

Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here themore » authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.« less

The EGF and FGF receptors mediate neuroglian function to control growth cone decisions during sensory axon guidance in Drosophila.

PubMed

García-Alonso, L; Romani, S; Jiménez, F

2000-12-01

Cell adhesion molecules (CAMs) implement the process of axon guidance by promoting specific selection and attachment to substrates. We show that, in Drosophila, loss-of-function conditions of either the Neuroglian CAM, the FGF receptor coded by the gene heartless, or the EGF receptor coded by DER display a similar phenotype of abnormal substrate selection and axon guidance by peripheral sensory neurons. Moreover, neuroglian loss-of-function phenotype can be suppressed by the expression of gain-of-function conditions of heartless or DER. The results are consistent with a scenario where the activity of these receptor tyrosine kinases is controlled by Neuroglian at choice points where sensory axons select between alternative substrates for extension.

Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).

PubMed

Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F

1996-05-01

Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.

Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

1995-10-09

In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains amore » functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.« less

Expression profiling of G-protein-coupled receptors in human urothelium and related cell lines.

PubMed

Ochodnický, Peter; Humphreys, Sian; Eccles, Rachel; Poljakovic, Mirjana; Wiklund, Peter; Michel, Martin C

2012-09-01

What's known on the subject? and What does the study add? Urothelium emerged as a crucial integrator of sensory inputs and outputs in the bladder wall, and urothelial G-protein-coupled receptors (GPCRs) may represent plausible targets for treatment of various bladder pathologies. Urothelial cell lines provide a useful tool to study urothelial receptor function, but their validity as models for native human urothelium remains unclear. We characterize the mRNA expression of genes coding for GPCRs in human freshly isolated urothelium and compare the expression pattern with those in human urothelial cell lines. To characterize the mRNA expression pattern of genes coding for G-protein-coupled receptors (GPCRs) in human freshly isolated urothelium. To compare GPCR expression in human urothelium-derived cell lines to explore the suitability of these cell lines as model systems to study urothelial function. Native human urothelium (commercially sourced) and human urothelium-derived non-cancer (UROtsa and TERT-NHUC) and cancer (J82) cell lines were used. For mRNA expression profiling we used custom-designed real-time polymerase chain reaction array for 40 receptors and several related genes. Native urothelium expressed a wide variety of GPCRs, including α(1A), α(1D) and all subtypes of α(2) and β adrenoceptors. In addition, M(2) and M(3) cholinergic muscarinic receptors, angiotensin II AT(1) receptor, serotonin 5-HT(2A) receptor and all subtypes of bradykinin, endothelin, cannabinoid, tachykinin and sphingosine-1-phosphate receptors were detected. Nerve growth factor and both its low- and high-affinity receptors were also expressed in urothelium. In all cell lines expression of most GPCRs was markedly downregulated, with few exceptions. In UROtsa cells, but much less in other cell lines, the expression of β(2) adrenoceptors, M(3) muscarinic receptors, B(1) and B(2) bradykinin receptors, ET(B) endothelin receptors and several subtypes of sphingosine-1-phosphate receptors was largely retained. Human urothelium expresses a wide range of receptors which enables sensing and integration of various extracellular signals. Human urothelium-derived cell lines, especially UROtsa cells, show comparable mRNA expression to native tissue for several physiologically relevant GPCRs, but lose expression of many other receptors. The use of cell lines as model systems of human urothelium requires careful validation of suitability for the genes of interest. © 2012 BJU INTERNATIONAL.

Dm5-HT2B: Pharmacological Characterization of the Fifth Serotonin Receptor Subtype of Drosophila melanogaster

PubMed Central

Blenau, Wolfgang; Daniel, Stöppler; Balfanz, Sabine; Thamm, Markus; Baumann, Arnd

2017-01-01

Serotonin (5-hydroxytryptamine, 5-HT) is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects) and deuterostomes (e.g., mammals). In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster, a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT1A, Dm5-HT1B, and Dm5-HT7 couple to cAMP signaling cascades, the Dm5-HT2A receptor leads to Ca2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT2B receptor. Knowledge about this receptor’s pharmacological properties is very limited. This is quite surprising because Dm5-HT2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT2B’s pharmacology, we evaluated the receptor’s response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT2B signaling in vitro and in vivo. PMID:28553207

LH-independent testosterone secretion is mediated by the interaction between GNRH2 and its receptor within porcine testes

USDA-ARS?s Scientific Manuscript database

Unlike the classical gonadotropin-releasing hormone (GNRH1), the second mammalian isoform (GNRH2) is an ineffective stimulant of gonadotropin release. Species that produce GNRH2 may not maintain a functional GNRH2 receptor (GNRHR2) due to coding errors. A full length GNRHR2 gene has been identified ...

A combinatorial code for pattern formation in Drosophila oogenesis.

PubMed

Yakoby, Nir; Bristow, Christopher A; Gong, Danielle; Schafer, Xenia; Lembong, Jessica; Zartman, Jeremiah J; Halfon, Marc S; Schüpbach, Trudi; Shvartsman, Stanislav Y

2008-11-01

Two-dimensional patterning of the follicular epithelium in Drosophila oogenesis is required for the formation of three-dimensional eggshell structures. Our analysis of a large number of published gene expression patterns in the follicle cells suggests that they follow a simple combinatorial code based on six spatial building blocks and the operations of union, difference, intersection, and addition. The building blocks are related to the distribution of inductive signals, provided by the highly conserved epidermal growth factor receptor and bone morphogenetic protein signaling pathways. We demonstrate the validity of the code by testing it against a set of patterns obtained in a large-scale transcriptional profiling experiment. Using the proposed code, we distinguish 36 distinct patterns for 81 genes expressed in the follicular epithelium and characterize their joint dynamics over four stages of oogenesis. The proposed combinatorial framework allows systematic analysis of the diversity and dynamics of two-dimensional transcriptional patterns and guides future studies of gene regulation.

8D.07: GENE EXPRESSION ANALYSIS AND BIOINFORMATICS REVEALED POTENTIAL TRANSCRIPTION FACTORS ASSOCIATED WITH RENIN-ANGIOTENSIN-ALDOSTERONE SYSTEM IN ATHEROMA.

PubMed

Nehme, A; Zibara, K; Cerutti, C; Bricca, G

2015-06-01

The implication of the renin-angiotensin-aldosterone system (RAAS) in atheroma development is well described. However, a complete view of the local RAAS in atheroma is still missing. In this study we aimed to reveal the organization of RAAS in atheroma at the transcriptomic level and identify the transcriptional regulators behind it. Extended RAAS (extRAAS) was defined as the set of 37 genes coding for classical and novel RAAS participants (Figure 1). Five microarray datasets containing overall 590 samples representing carotid and peripheral atheroma were downloaded from the GEO database. Correlation-based hierarchical clustering (R software) of extRAAS genes within each dataset allowed the identification of modules of co-expressed genes. Reproducible co-expression modules across datasets were then extracted. Transcription factors (TFs) having common binding sites (TFBSs) in the promoters of coordinated genes were identified using the Genomatix database tools and analyzed for their correlation with extRAAS genes in the microarray datasets. Expression data revealed the expressed extRAAS components and their relative abundance displaying the favored pathways in atheroma. Three co-expression modules with more than 80% reproducibility across datasets were extracted. Two of them (M1 and M2) contained genes coding for angiotensin metabolizing enzymes involved in different pathways: M1 included ACE, MME, RNPEP, and DPP3, in addition to 7 other genes; and M2 included CMA1, CTSG, and CPA3. The third module (M3) contained genes coding for receptors known to be implicated in atheroma (AGTR1, MR, GR, LNPEP, EGFR and GPER). M1 and M3 were negatively correlated in 3 of 5 datasets. We identified 19 TFs that have enriched TFBSs in the promoters of genes of M1, and two for M3, but none was found for M2. Among the extracted TFs, ELF1, MAX, and IRF5 showed significant positive correlations with peptidase-coding genes from M1 and negative correlations with receptors-coding genes from M3 (p < 0.05). The identified co-expression modules display the transcriptional organization of local extRAAS in human carotid atheroma. The identification of several TFs potentially associated to extRAAS genes may provide a frame for the discovery of atheroma-specific modulators of extRAAS activity.(Figure is included in full-text article.).

Divergent evolution of multiple virus-resistance genes from a progenitor in Capsicum spp.

PubMed

Kim, Saet-Byul; Kang, Won-Hee; Huy, Hoang Ngoc; Yeom, Seon-In; An, Jeong-Tak; Kim, Seungill; Kang, Min-Young; Kim, Hyun Jung; Jo, Yeong Deuk; Ha, Yeaseong; Choi, Doil; Kang, Byoung-Cheorl

2017-01-01

Plants have evolved hundreds of nucleotide-binding and leucine-rich domain proteins (NLRs) as potential intracellular immune receptors, but the evolutionary mechanism leading to the ability to recognize specific pathogen effectors is elusive. Here, we cloned Pvr4 (a Potyvirus resistance gene in Capsicum annuum) and Tsw (a Tomato spotted wilt virus resistance gene in Capsicum chinense) via a genome-based approach using independent segregating populations. The genes both encode typical NLRs and are located at the same locus on pepper chromosome 10. Despite the fact that these two genes recognize completely different viral effectors, the genomic structures and coding sequences of the two genes are strikingly similar. Phylogenetic studies revealed that these two immune receptors diverged from a progenitor gene of a common ancestor. Our results suggest that sequence variations caused by gene duplication and neofunctionalization may underlie the evolution of the ability to specifically recognize different effectors. These findings thereby provide insight into the divergent evolution of plant immune receptors. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

Molecular evolution of the odorant and gustatory receptor genes in lepidopteran insects: implications for their adaptation and speciation.

PubMed

Engsontia, Patamarerk; Sangket, Unitsa; Chotigeat, Wilaiwan; Satasook, Chutamas

2014-08-01

Lepidoptera (comprised of butterflies and moths) is one of the largest groups of insects, including more than 160,000 described species. Chemoreception plays important roles in the adaptation of these species to a wide range of niches, e.g., plant hosts, egg-laying sites, and mates. This study investigated the molecular evolution of the lepidopteran odorant (Or) and gustatory receptor (Gr) genes using recently identified genes from Bombyx mori, Danaus plexippus, Heliconius melpomene, Plutella xylostella, Heliothis virescens, Manduca sexta, Cydia pomonella, and Spodoptera littoralis. A limited number of cases of large lineage-specific gene expansion are observed (except in the P. xylostella lineage), possibly due to selection against tandem gene duplication. There has been strong purifying selection during the evolution of both lepidopteran odorant and gustatory genes, as shown by the low ω values estimated through CodeML analysis, ranging from 0.0093 to 0.3926. However, purifying selection has been relaxed on some amino acid sites in these receptors, leading to sequence divergence, which is a precursor of positive selection on these sequences. Signatures of positive selection were detected only in a few loci from the lineage-specific analysis. Estimation of gene gains and losses suggests that the common ancestor of the Lepidoptera had fewer Or genes compared to extant species and an even more reduced number of Gr genes, particularly within the bitter receptor clade. Multiple gene gains and a few gene losses occurred during the evolution of Lepidoptera. Gene family expansion may be associated with the adaptation of lepidopteran species to plant hosts, especially after angiosperm radiation. Phylogenetic analysis of the moth sex pheromone receptor genes suggested that chromosomal translocations have occurred several times. New sex pheromone receptors have arisen through tandem gene duplication. Positive selection was detected at some amino acid sites predicted to be in the extracellular and transmembrane regions of the newly duplicated genes, which might be associated with the evolution of the new pheromone receptors.

[Severe type A insulin resistance syndrome due to a mutation in the insulin receptor gene].

PubMed

Ros, P; Colino-Alcol, E; Grasso, V; Barbetti, F; Argente, J

2015-01-01

Insulin resistance syndromes without lipodystrophy are an infrequent and heterogeneous group of disorders with variable clinical phenotypes, associated with hyperglycemia and hyperinsulinemia. The three conditions related to mutations in the insulin receptor gene are leprechaunism or Donohue syndrome, Rabson-Mendenhall syndrome, and Type A syndrome. A case is presented on a patient diagnosed with type A insulin resistance, defined by the triad of extreme insulin resistance, acanthosis nigricans, and hyperandrogenism, carrying a heterozygous mutation in exon 19 of the insulin receptor gene coding for its tyrosine kinase domain that is crucial for the catalytic activity of the receptor. The molecular basis of the syndrome is reviewed, focusing on the structure-function relationships of the insulin receptor, knowing that the criteria for survival are linked to residual insulin receptor function. It is also pointed out that, although type A insulin resistance appears to represent a somewhat less severe condition, these patients have a high morbidity and their treatment is still unsatisfactory. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review.

PubMed

Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

2015-07-01

Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association.

K-sam, an amplified gene in stomach cancer, is a member of the heparin-binding growth factor receptor genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hattori, Yutaka; Odagiri, Hiroki; Nakatani, Hiroshi

1990-08-01

DNA fragments amplified in a stomach cancer-derived cell line, KATO-III, were previously identified by the in-gel DNA renaturation method, and a 0.2-kilobase-pair fragment of the amplified sequence was subsequently cloned. By genomic walking, a portion of the exon of the gene flanking this 0.2-kilobase-pair fragment was cloned, and the gene was designated as K-sam ({und K}ATO-III cell-derived {und s}tomach cancer {und am}plified gene). The K-sam cDNAs, corresponding to the 3.5-kilobase K-sam mRNA, were cloned from the KATO-III cells. Sequence analysis revealed that this gene coded for 682 amino acid residues that satisfied the characteristics of the receptor tyrosine kinase. Themore » K-sam gene had significant homologies with bek, FLG, and chicken basic fibroblast growth factor receptor gene. The K-sam gene was amplified in KATO-III cells with the major transcript of 3.5-kilobases in size. This gene was also expressed in some other stomach cancer cells, a small cell lung cancer, and germ cell tumors.« less

New target genes in endometrial tumors show a role for the estrogen-receptor pathway in microsatellite-unstable cancers.

PubMed

Ferreira, Ana M; Tuominen, Iina; Sousa, Sónia; Gerbens, Frans; van Dijk-Bos, Krista; Osinga, Jan; Kooi, Krista A; Sanjabi, Bahram; Esendam, Chris; Oliveira, Carla; Terpstra, Peter; Hardonk, Menno; van der Sluis, Tineke; Zazula, Monika; Stachura, Jerzy; van der Zee, Ate G; Hollema, Harry; Sijmons, Rolf H; Aaltonen, Lauri A; Seruca, Raquel; Hofstra, Robert M W; Westers, Helga

2014-12-01

Microsatellite instability (MSI) in tumors results in an accumulation of mutations in (target) genes. Previous studies suggest that the profile of target genes differs according to tumor type. This paper describes the first genome-wide search for target genes for mismatch repair-deficient endometrial cancers. Genes expressed in normal endometrium containing coding repeats were analyzed for mutations in tumors. We identified 44 possible genes of which seven are highly mutated (>15%). Some candidates were also found mutated in colorectal and gastric tumors. The most frequently mutated gene, NRIP1 encoding nuclear receptor-interacting protein 1, was silenced in an endometrial tumor cell line and expression microarray experiments were performed. Silencing of NRIP1 was associated with differences in the expression of several genes in the estrogen-receptor network. Furthermore, an enrichment of genes related to cell cycle (regulation) and replication was observed. We present a new profile of target genes, some of them tissue specific, whereas others seem to play a more general role in MSI tumors. The high-mutation frequency combined with the expression data suggest, for the first time, an involvement of NRIP1 in endometrial cancer development. © 2014 WILEY PERIODICALS, INC.

Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments.

PubMed Central

Nutt, S L; Morrison, A M; Dörfler, P; Rolink, A; Busslinger, M

1998-01-01

The Pax-5 gene codes for the transcription factor BSAP which is essential for the progression of adult B lymphopoiesis beyond an early progenitor (pre-BI) cell stage. Although several genes have been proposed to be regulated by BSAP, CD19 is to date the only target gene which has been genetically confirmed to depend on this transcription factor for its expression. We have now taken advantage of cultured pre-BI cells of wild-type and Pax-5 mutant bone marrow to screen a large panel of B lymphoid genes for additional BSAP target genes. Four differentially expressed genes were shown to be under the direct control of BSAP, as their expression was rapidly regulated in Pax-5-deficient pre-BI cells by a hormone-inducible BSAP-estrogen receptor fusion protein. The genes coding for the B-cell receptor component Ig-alpha (mb-1) and the transcription factors N-myc and LEF-1 are positively regulated by BSAP, while the gene coding for the cell surface protein PD-1 is efficiently repressed. Distinct regulatory mechanisms of BSAP were revealed by reconstituting Pax-5-deficient pre-BI cells with full-length BSAP or a truncated form containing only the paired domain. IL-7 signalling was able to efficiently induce the N-myc gene only in the presence of full-length BSAP, while complete restoration of CD19 synthesis was critically dependent on the BSAP protein concentration. In contrast, the expression of the mb-1 and LEF-1 genes was already reconstituted by the paired domain polypeptide lacking any transactivation function, suggesting that the DNA-binding domain of BSAP is sufficient to recruit other transcription factors to the regulatory regions of these two genes. In conclusion, these loss- and gain-of-function experiments demonstrate that BSAP regulates four newly identified target genes as a transcriptional activator, repressor or docking protein depending on the specific regulatory sequence context. PMID:9545244

Use of genetically engineered swine to elucidate testis function in the boar

USDA-ARS?s Scientific Manuscript database

The second mammalian GnRH isoform (GnRH-II) and its specific receptor (GnRHR-II) are abundant within the testis, suggesting a critical role. Gene coding errors prevent their production in many species, but both genes are functional in swine. We have demonstrated that GnRHR-II localizes to porcine Le...

The Genetics of the Thyroid Stimulating Hormone Receptor: History and Relevance

PubMed Central

Yin, Xiaoming; Latif, Rauf

2010-01-01

Background The thyroid stimulating hormone receptor (TSHR) is the key regulator of thyrocyte function. The gene for the TSHR on chromosome 14q31 has been implicated as coding for the major autoantigen in the autoimmune hyperthyroidism of Graves' disease (GD) to which T cells and autoantibodies are directed. Summary The TSHR is a seven-transmembrane domain receptor that undergoes complex posttranslational processing. In this brief review, we look at the genetics of this important autoantigen and its influence on a variety of tissue functions in addition to its role in the induction of GD. Conclusions There is convincing evidence that the TSH receptor gene confers increased susceptibility for GD, but not Hashimoto's thyroiditis. GD is associated with polymorphisms in the intron 1 gene region. How such noncoding nucleotide changes influence disease susceptibility remains uncertain, but is likely to involve TSHR splicing variants and/or microRNAs arising from this gene region. Whether such influences are confined to the thyroid gland or whether they influence cell function in the many extrathyroidal sites of TSHR expression remains unknown. PMID:20578897

The receptor for advanced glycation end-products (RAGE) is only present in mammals, and belongs to a family of cell adhesion molecules (CAMs).

PubMed

Sessa, Luca; Gatti, Elena; Zeni, Filippo; Antonelli, Antonella; Catucci, Alessandro; Koch, Michael; Pompilio, Giulio; Fritz, Günter; Raucci, Angela; Bianchi, Marco E

2014-01-01

The human receptor for advanced glycation endproducts (RAGE) is a multiligand cell surface protein belonging to the immunoglobulin superfamily, and is involved in inflammatory and immune responses. Most importantly, RAGE is considered a receptor for HMGB1 and several S100 proteins, which are Damage-Associated Molecular Pattern molecules (DAMPs) released during tissue damage. In this study we show that the Ager gene coding for RAGE first appeared in mammals, and is closely related to other genes coding for cell adhesion molecules (CAMs) such as ALCAM, BCAM and MCAM that appeared earlier during metazoan evolution. RAGE is expressed at very low levels in most cells, but when expressed at high levels, it mediates cell adhesion to extracellular matrix components and to other cells through homophilic interactions. Our results suggest that RAGE evolved from a family of CAMs, and might still act as an adhesion molecule, in particular in the lung where it is highly expressed or under pathological conditions characterized by an increase of its protein levels.

Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis

PubMed Central

Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L. M.; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana

2017-01-01

The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT. PMID:28704421

Transcriptional role of androgen receptor in the expression of long non-coding RNA Sox2OT in neurogenesis.

PubMed

Tosetti, Valentina; Sassone, Jenny; Ferri, Anna L M; Taiana, Michela; Bedini, Gloria; Nava, Sara; Brenna, Greta; Di Resta, Chiara; Pareyson, Davide; Di Giulio, Anna Maria; Carelli, Stephana; Parati, Eugenio A; Gorio, Alfredo

2017-01-01

The complex architecture of adult brain derives from tightly regulated migration and differentiation of precursor cells generated during embryonic neurogenesis. Changes at transcriptional level of genes that regulate migration and differentiation may lead to neurodevelopmental disorders. Androgen receptor (AR) is a transcription factor that is already expressed during early embryonic days. However, AR role in the regulation of gene expression at early embryonic stage is yet to be determinate. Long non-coding RNA (lncRNA) Sox2 overlapping transcript (Sox2OT) plays a crucial role in gene expression control during development but its transcriptional regulation is still to be clearly defined. Here, using Bicalutamide in order to pharmacologically inactivated AR, we investigated whether AR participates in the regulation of the transcription of the lncRNASox2OTat early embryonic stage. We identified a new DNA binding region upstream of Sox2 locus containing three androgen response elements (ARE), and found that AR binds such a sequence in embryonic neural stem cells and in mouse embryonic brain. Our data suggest that through this binding, AR can promote the RNA polymerase II dependent transcription of Sox2OT. Our findings also suggest that AR participates in embryonic neurogenesis through transcriptional control of the long non-coding RNA Sox2OT.

Taste Receptor Genes

PubMed Central

Bachmanov, Alexander A.; Beauchamp, Gary K.

2009-01-01

In the past several years, tremendous progress has been achieved with the discovery and characterization of vertebrate taste receptors from the T1R and T2R families, which are involved in recognition of bitter, sweet, and umami taste stimuli. Individual differences in taste, at least in some cases, can be attributed to allelic variants of the T1R and T2R genes. Progress with understanding how T1R and T2R receptors interact with taste stimuli and with identifying their patterns of expression in taste cells sheds light on coding of taste information by the nervous system. Candidate mechanisms for detection of salts, acids, fat, complex carbohydrates, and water have also been proposed, but further studies are needed to prove their identity. PMID:17444812

Overexpression of rice LRK1 restricts internode elongation by down-regulating OsKO2.

PubMed

Yang, Mengfei; Qi, Weiwei; Sun, Fan; Zha, Xiaojun; Chen, Mingluan; Huang, Yunqing; Feng, Yu-Qi; Yang, Jinshui; Luo, Xiaojin

2013-01-01

Rice (Oryza sativa) has the potential to undergo rapid internodal elongation which determines plant height. Gibberellin is involved in internode elongation. Leucine-rich repeat receptor-like kinases (LRR-RLKs) are the largest subfamily of transmembrane receptor-like kinases in plants. LRR-RLKs play important functions in mediating a variety of cellular processes and regulating responses to environmental signals. LRK1, a PSK receptor homolog, is a member of the LRR-RLK family. In the present study, differences in ectopic expression of LRK1 were consistent with extent of rice internode elongation. Analyses of gene expression demonstrated that LRK1 restricts gibberellin biosynthesis during the internode elongation process by down-regulation of the gibberellin biosynthetic gene coding for ent-kaurene oxidase.

Recurrent and functional regulatory mutations in breast cancer.

PubMed

Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad

2017-07-06

Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.

A high-level prokaryotic expression system: synthesis of human interleukin 1 alpha and its receptor antagonist.

PubMed

Birikh, K R; Lebedenko, E N; Boni, I V; Berlin, Y A

1995-10-27

Synthetic intronless genes, coding for human interleukin 1 alpha (IL 1 alpha) and interleukin 1 receptor antagonist (IL1ra), have been expressed efficiently in a specially designed prokaryotic vector, pGMCE (a pGEM1 derivative), where the target gene forms the second part of a two-cistron system. The first part of the system is a translation enhancer-containing mini-cistron, whose termination codon overlaps the start codon of the target gene. In the case of the IL1 alpha gene, the high expression level is largely due to the direct efficient translation initiation at the second cistron, whereas with the IL1ra gene in the same system, the proximal translation initiation region (TIR) provides a high level of coupled expression of the target gene. Thus, pGMCE is a potentially versatile vector for direct prokaryotic expression.

The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review

PubMed Central

Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

2015-01-01

Context: Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. Evidence Acquisition: The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. Results: The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. Conclusions: In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association. PMID:26425125

Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

PubMed

Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

1997-04-28

We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

Anti-Epidermal Growth Factor Receptor Gene Therapy for Glioblastoma

PubMed Central

Hicks, Martin J.; Chiuchiolo, Maria J.; Ballon, Douglas; Dyke, Jonathan P.; Aronowitz, Eric; Funato, Kosuke; Tabar, Viviane; Havlicek, David; Fan, Fan; Sondhi, Dolan; Kaminsky, Stephen M.; Crystal, Ronald G.

2016-01-01

Glioblastoma multiforme (GBM) is the most common and aggressive primary intracranial brain tumor in adults with a mean survival of 14 to 15 months. Aberrant activation of the epidermal growth factor receptor (EGFR) plays a significant role in GBM progression, with amplification or overexpression of EGFR in 60% of GBM tumors. To target EGFR expressed by GBM, we have developed a strategy to deliver the coding sequence for cetuximab, an anti-EGFR antibody, directly to the CNS using an adeno-associated virus serotype rh.10 gene transfer vector. The data demonstrates that single, local delivery of an anti-EGFR antibody by an AAVrh.10 vector coding for cetuximab (AAVrh.10Cetmab) reduces GBM tumor growth and increases survival in xenograft mouse models of a human GBM EGFR-expressing cell line and patient-derived GBM. AAVrh10.CetMab-treated mice displayed a reduction in cachexia, a significant decrease in tumor volume and a prolonged survival following therapy. Adeno-associated-directed delivery of a gene encoding a therapeutic anti-EGFR monoclonal antibody may be an effective strategy to treat GBM. PMID:27711187

AtPep3 is a hormone-like peptide that plays a role in the salinity stress tolerance of plants.

PubMed

Nakaminami, Kentaro; Okamoto, Masanori; Higuchi-Takeuchi, Mieko; Yoshizumi, Takeshi; Yamaguchi, Yube; Fukao, Yoichiro; Shimizu, Minami; Ohashi, Chihiro; Tanaka, Maho; Matsui, Minami; Shinozaki, Kazuo; Seki, Motoaki; Hanada, Kousuke

2018-05-29

Peptides encoded by small coding genes play an important role in plant development, acting in a similar manner as phytohormones. Few hormone-like peptides, however, have been shown to play a role in abiotic stress tolerance. In the current study, 17 Arabidopsis genes coding for small peptides were found to be up-regulated in response to salinity stress. To identify peptides leading salinity stress tolerance, we generated transgenic Arabidopsis plants overexpressing these small coding genes and assessed survivability and root growth under salinity stress conditions. Results indicated that 4 of the 17 overexpressed genes increased salinity stress tolerance. Further studies focused on AtPROPEP3 , which was the most highly up-regulated gene under salinity stress. Treatment of plants with synthetic peptides encoded by AtPROPEP3 revealed that a C-terminal peptide fragment (AtPep3) inhibited the salt-induced bleaching of chlorophyll in seedlings. Conversely, knockdown AtPROPEP3 transgenic plants exhibited a hypersensitive phenotype under salinity stress, which was complemented by the AtPep3 peptide. This functional AtPep3 peptide region overlaps with an AtPep3 elicitor peptide that is related to the immune response of plants. Functional analyses with a receptor mutant of AtPep3 revealed that AtPep3 was recognized by the PEPR1 receptor and that it functions to increase salinity stress tolerance in plants. Collectively, these data indicate that AtPep3 plays a significant role in both salinity stress tolerance and immune response in Arabidopsis .

Possible roles for products of polymorphic MHC and linked olfactory receptor genes during selection processes in reproduction.

PubMed

Ziegler, Andreas; Dohr, Gotrfried; Uchanska-Ziegler, Barbara

2002-07-01

Polymorphic genes of the human major histocompatibility complex [MHC; human leukocyte antigen (HLA)] are probably important in determining resistance to parasites and avoidance of inbreeding. We investigated whether HLA-associated sexual selection could also involve HLA-linked olfactory receptor (OR) genes, which might not only participate in olfaction-guided mate choice, but also in selection processes within the testis. The testicular expression status of HLA class I molecules (by immunohistology) and HLA-linked OR genes (by transcriptional analysis) was determined. Various HLA class I heavy chains, but not beta2-microglobulin (beta2m), were expressed, mainly at the spermatocyte I stage. Of 17 HLA-linked OR genes analyzed, eight were found to be transcribed in the testis. They exhibited varying numbers of 5'- or 3'-non-coding exons as well as differential splicing. We suggest that testis-expressed polymorphic HLA and OR proteins are functionally connected and serve the selection of spermatozoa, enabling them to distinguish 'self from 'non-self [the sperm-receptor-selection (SRS) hypothesis].

Novel insights into the response of Atlantic salmon (Salmo salar) to Piscirickettsia salmonis: Interplay of coding genes and lncRNAs during bacterial infection.

PubMed

Valenzuela-Miranda, Diego; Gallardo-Escárate, Cristian

2016-12-01

Despite the high prevalence and impact to Chilean salmon aquaculture of the intracellular bacterium Piscirickettsia salmonis, the molecular underpinnings of host-pathogen interactions remain unclear. Herein, the interplay of coding and non-coding transcripts has been proposed as a key mechanism involved in immune response. Therefore, the aim of this study was to evidence how coding and non-coding transcripts are modulated during the infection process of Atlantic salmon with P. salmonis. For this, RNA-seq was conducted in brain, spleen, and head kidney samples, revealing different transcriptional profiles according to bacterial load. Additionally, while most of the regulated genes annotated for diverse biological processes during infection, a common response associated with clathrin-mediated endocytosis and iron homeostasis was present in all tissues. Interestingly, while endocytosis-promoting factors and clathrin inductions were upregulated, endocytic receptors were mainly downregulated. Furthermore, the regulation of genes related to iron homeostasis suggested an intracellular accumulation of iron, a process in which heme biosynthesis/degradation pathways might play an important role. Regarding the non-coding response, 918 putative long non-coding RNAs were identified, where 425 were newly characterized for S. salar. Finally, co-localization and co-expression analyses revealed a strong correlation between the modulations of long non-coding RNAs and genes associated with endocytosis and iron homeostasis. These results represent the first comprehensive study of putative interplaying mechanisms of coding and non-coding RNAs during bacterial infection in salmonids. Copyright © 2016 Elsevier Ltd. All rights reserved.

Rearrangement and expression of the human {Psi}C{lambda}6 gene segment results in a surface Ig receptor with a truncated light chain constant region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stiernholm, N.B.J.; Verkoczy, L.K.; Berinstein, N.L.

1995-05-01

The constant region of the human Ig{lambda} locus consists of seven tandemly organized J-C gene segments. Although it has been established that the J-C{lambda}1, J-C{lambda}2, J-C{lambda}3, and J-C{lambda}7 gene segments are functional, and code for the four distinct Ig{lambda} isotypes found in human serum, the J-C{lambda}4, J-C{lambda}5, and J-C{lambda}6 gene segments are generally considered to be pseudogenes. Although one example of a functional J-C{lambda}6 gene segment has been documented, in the majority of cases, J-C{lambda}6 is rendered nonfunctional by virtue of a single duplication of four nucleotides, creating a premature translational arrest. We show here that rearrangements to the J-C{lambda}6more » gene segment do occur, and that such a rearrangement encodes an Ig{lambda} protein that lacks the terminal end of the constant region. We also show that this truncated protein is expressed on the surface with the IgH chain, creating an unusual surface Ig (sIg) receptor (sIg{triangle}CL). Cells that express this receptor on the surface do so at significantly reduced levels compared with clonally related variants, which express sIg receptors with conventional Ig{lambda} L chains. However, the effects of sIg cross-linking on tyrosine phosphorylation and surface expression of the CD25 and CD71 Ags are similar in cells that express conventional sIg receptors and in those that express sIg{triangle}CL receptors, suggesting that the latter could possibly function as an Ag receptor. 35 refs., 7 figs.« less

Mutation analysis of the muscarinic cholinergic receptor genes in isolated growth hormone deficiency type IB.

PubMed

Mohamadi, Ali; Martari, Marco; Holladay, Cindy D; Phillips, John A; Mullis, Primus E; Salvatori, Roberto

2009-07-01

Isolated GH deficiency (IGHD) is familial in 5-30% of patients. The most frequent form (IGHD-IB) has autosomal recessive inheritance, and it is known that it can be caused by mutations in the GHRH receptor (GHRHR) gene or in the GH gene. However, most forms of IGHD-IB have an unknown genetic cause. In normal subjects, muscarinic cholinergic stimulation causes an increase in pituitary GH release, whereas its blockade has the opposite effect, suggesting that a muscarinic acetylcholine receptor (mAchR) is involved in stimulating GH secretion. Five types of mAchR (M(1)-M(5)) exist. A transgenic mouse in which the function of the M(3) receptor was selectively ablated in the central nervous system has isolated GH deficiency similar to animals with defective GHRH or GHRHR gene. We hypothesized that mAchR mutations may cause a subset of familial IGHD. After confirming the expression of M(1)-M(5) receptor mRNA in human hypothalamus, we analyzed the index cases of 39 families with IGHD-IB for mutations in the genes encoding for the five receptors. Coding sequences for each of the five mAchRs were subjected to direct sequencing. In one family, an affected member was homozygous for a M(3) change in codon 65 that replaces valine with isoleucine (V65I). The V65I receptor was expressed in CHO cells where it had normal ability to transmit methacholine signaling. mAchR mutations are absent or rare (less than 2.6%) in familial IGHD type IB.

RARE VARIANTS IN THE NEUROTROPHIN SIGNALING PATHWAY IMPLICATED IN SCHIZOPHRENIA RISK

PubMed Central

Kranz, Thorsten M.; Goetz, Ray R.; Walsh-Messinger, Julie; Goetz, Deborah; Antonius, Daniel; Dolgalev, Igor; Heguy, Adriana; Seandel, Marco; Malaspina, Dolores; Chao, Moses V.

2015-01-01

Multiple lines of evidence corroborate impaired signaling pathways as relevant to the underpinnings of schizophrenia. There has been an interest in neurotrophins, since they are crucial mediators of neurodevelopment and in synaptic connectivity in the adult brain. Neurotrophins and their receptors demonstrate aberrant expression patterns in cortical areas for schizophrenia cases in comparison to control subjects. There is little known about the contribution of neurotrophin genes in psychiatric disorders. To begin to address this issue, we conducted high-coverage targeted exome capture in a subset of neurotrophin genes in 48 comprehensively characterized cases with schizophrenia-related psychosis. We herein report rare missense polymorphisms and novel missense mutations in neurotrophin receptor signaling pathway genes. Furthermore, we observed that several genes have a higher propensity to harbor missense coding variants than others. Based on this initial analysis we suggest that rare variants and missense mutations in neurotrophin genes might represent genetic contributions involved across psychiatric disorders. PMID:26215504

Regional localization of the human integrin {beta}{sub 6} gene (ITGB6) to chromosome 2q24-q31

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandez-Ruiz, E.; Sanchez-Madrid, F.

The heterodimer {alpha}{sub v}{beta}{sub 6} acts as a fibronectin receptor for human carcinoma cells. The authors report here the regional localization of the {beta}{sub 6} gene to 2q24-q31 by fluorescence in situ hybridization coupled with GTG-banding. This gene is located close to the region to which genes coding for the {alpha} subunits of the integrins VLA-4 and vitronectin receptor (ITGA4 and ITGAV, respectively) have been previously mapped (2q31-q32). These data suggest a proximal position of the integrin {beta}{sub 6} locus (ITGB6) on this integrin gene cluster. Futhermore, double-labeling in situ hybridization experiments performed with {alpha}{sub 4} and {alpha}{sub v} probesmore » indicated a telomeric position of ITGAV with respect to ITGA4. 22 refs., 2 figs.« less

Polymorphisms in Genes of Relevance for Oestrogen and Oxytocin Pathways and Risk of Barrett's Oesophagus and Oesophageal Adenocarcinoma: A Pooled Analysis from the BEACON Consortium.

PubMed

Lagergren, Katarina; Ek, Weronica E; Levine, David; Chow, Wong-Ho; Bernstein, Leslie; Casson, Alan G; Risch, Harvey A; Shaheen, Nicholas J; Bird, Nigel C; Reid, Brian J; Corley, Douglas A; Hardie, Laura J; Wu, Anna H; Fitzgerald, Rebecca C; Pharoah, Paul; Caldas, Carlos; Romero, Yvonne; Vaughan, Thomas L; MacGregor, Stuart; Whiteman, David; Westberg, Lars; Nyren, Olof; Lagergren, Jesper

2015-01-01

The strong male predominance in oesophageal adenocarcinoma (OAC) and Barrett's oesophagus (BO) continues to puzzle. Hormonal influence, e.g. oestrogen or oxytocin, might contribute. This genetic-epidemiological study pooled 14 studies from three continents, Australia, Europe, and North America. Polymorphisms in 3 key genes coding for the oestrogen pathway (receptor alpha (ESR1), receptor beta (ESR2), and aromatase (CYP19A1)), and 3 key genes of the oxytocin pathway (the oxytocin receptor (OXTR), oxytocin protein (OXT), and cyclic ADP ribose hydrolase glycoprotein (CD38)), were analysed using a gene-based approach, versatile gene-based test association study (VEGAS). Among 1508 OAC patients, 2383 BO patients, and 2170 controls, genetic variants within ESR1 were associated with BO in males (p = 0.0058) and an increased risk of OAC and BO combined in males (p = 0.0023). Genetic variants within OXTR were associated with an increased risk of BO in both sexes combined (p = 0.0035) and in males (p = 0.0012). We followed up these suggestive findings in a further smaller data set, but found no replication. There were no significant associations between the other 4 genes studied and risk of OAC, BO, separately on in combination, in males and females combined or in males only. Genetic variants in the oestrogen receptor alpha and the oxytocin receptor may be associated with an increased risk of BO or OAC, but replication in other large samples are needed.

De Novo Transcriptome Analysis Shows That SAV-3 Infection Upregulates Pattern Recognition Receptors of the Endosomal Toll-Like and RIG-I-Like Receptor Signaling Pathways in Macrophage/Dendritic Like TO-Cells.

PubMed

Xu, Cheng; Evensen, Øystein; Munang'andu, Hetron

2016-04-21

A fundamental step in cellular defense mechanisms is the recognition of "danger signals" made of conserved pathogen associated molecular patterns (PAMPs) expressed by invading pathogens, by host cell germ line coded pattern recognition receptors (PRRs). In this study, we used RNA-seq and the Kyoto encyclopedia of genes and genomes (KEGG) to identify PRRs together with the network pathway of differentially expressed genes (DEGs) that recognize salmonid alphavirus subtype 3 (SAV-3) infection in macrophage/dendritic like TO-cells derived from Atlantic salmon (Salmo salar L) headkidney leukocytes. Our findings show that recognition of SAV-3 in TO-cells was restricted to endosomal Toll-like receptors (TLRs) 3 and 8 together with RIG-I-like receptors (RLRs) and not the nucleotide-binding oligomerization domain-like receptors NOD-like receptor (NLRs) genes. Among the RLRs, upregulated genes included the retinoic acid inducible gene I (RIG-I), melanoma differentiation association 5 (MDA5) and laboratory of genetics and physiology 2 (LGP2). The study points to possible involvement of the tripartite motif containing 25 (TRIM25) and mitochondrial antiviral signaling protein (MAVS) in modulating RIG-I signaling being the first report that links these genes to the RLR pathway in SAV-3 infection in TO-cells. Downstream signaling suggests that both the TLR and RLR pathways use interferon (IFN) regulatory factors (IRFs) 3 and 7 to produce IFN-a2. The validity of RNA-seq data generated in this study was confirmed by quantitative real time qRT-PCR showing that genes up- or downregulated by RNA-seq were also up- or downregulated by RT-PCR. Overall, this study shows that de novo transcriptome assembly identify key receptors of the TLR and RLR sensors engaged in host pathogen interaction at cellular level. We envisage that data presented here can open a road map for future intervention strategies in SAV infection of salmon.

Water-Soluble Nanoparticle Receptors Supramolecularly Coded for Acidic Peptides.

PubMed

Fa, Shixin; Zhao, Yan

2018-01-02

Sequence-specific recognition of peptides is of enormous importance to many chemical and biological applications, but has been difficult to achieve due to the minute differences in the side chains of amino acids. Acidic peptides are known to play important roles in cell growth and gene expression. In this work, we report molecularly imprinted micelles coded with molecular recognition information for the acidic and hydrophobic side chains of acidic peptides. The imprinted receptors could distinguish acidic amino acids from other polar and nonpolar amino acids, with dissociation constants of tens of nanomolar for biologically active peptides containing up to 18 amino acids. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

NASA Astrophysics Data System (ADS)

Devanna, Paolo; Vernes, Sonja C.

2014-02-01

Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

Identification of a G protein coupled receptor induced in activated T cells.

PubMed

Kaplan, M H; Smith, D I; Sundick, R S

1993-07-15

Many genes are induced after T cell activation to make a cell competent for proliferation and ultimately, function. Many of these genes encode surface receptors for growth factors that signal a cell to proliferate. We have cloned a novel gene (clone 6H1) that codes for a member of the G protein-coupled receptor superfamily. This gene was isolated from a chicken activated T cell cDNA library by low level hybridization to mammalian IL-2 cDNA probes. The 308 amino acid open reading frame has seven hydrophobic, presumably transmembrane domains and a consensus site for interaction with G proteins. Tissue distribution studies suggest that gene expression is restricted to activated T cells. The message appears by 1 h after activation and is maintained for at least 45 h. Transcription of 6H1 is induced by a number of T cell stimuli and is inhibited by cyclosporin A, but not by cycloheximide. This is the first description of a member of this superfamily expressed specifically in activated T cells. The gene product may provide a link between T cell growth factors and G protein activation.

The clinical and molecular spectrum of androgen insensitivity syndromes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiort, O.; Sinnecker, G.H.G.; Holterhus, P.M.

1996-05-03

Androgen insensitivity syndromes (AIS) are due to end-organ resistance to androgenic steroids in males leading to defective virilization of the external genitalia. The phenotype encompasses a wide array of genital ambiguity and may range from completely female to undervirilized but unequivocally male with infertility. This disorder is caused by mutations of the androgen receptor and is an X-linked recessive trait. We have studied 47 patients with AIS and have characterized the underlying molecular abnormality in the androgen receptor gene. Twenty patients had complete AIS and twenty-seven had partial AIS. Of the latter, 11 were of predominantly female phenotypic appearance andmore » gender was assigned accordingly, while 16 were raised as males. Within the group of complete AIS, two patients had gross deletions within the gene, one had a small deletion, and one had an insertion. In the other patients with complete AIS, as well as all individuals with partial AIS, single nucleotide substitutions within the coding region were detected, each leading to an amino acid alteration. Seven codons were involved in more than one mutation in different cases. In addition, in one patient with spinal and bulbar muscular atrophy, an elongation of a glutamine-repeat was characterized. We conclude that mutations in the androgen receptor gene may be present throughout the whole coding region. However, our study provides evidence that several mutational hot spots exist. 18 refs., 2 figs.« less

The α3β4* nicotinic ACh receptor subtype mediates physical dependence to morphine: mouse and human studies.

PubMed

Muldoon, P P; Jackson, K J; Perez, E; Harenza, J L; Molas, S; Rais, B; Anwar, H; Zaveri, N T; Maldonado, R; Maskos, U; McIntosh, J M; Dierssen, M; Miles, M F; Chen, X; De Biasi, M; Damaj, M I

2014-08-01

Recent data have indicated that α3β4* neuronal nicotinic (n) ACh receptors may play a role in morphine dependence. Here we investigated if nACh receptors modulate morphine physical withdrawal. To assess the role of α3β4* nACh receptors in morphine withdrawal, we used a genetic correlation approach using publically available datasets within the GeneNetwork web resource, genetic knockout and pharmacological tools. Male and female European-American (n = 2772) and African-American (n = 1309) subjects from the Study of Addiction: Genetics and Environment dataset were assessed for possible associations of polymorphisms in the 15q25 gene cluster and opioid dependence. BXD recombinant mouse lines demonstrated an increased expression of α3, β4 and α5 nACh receptor mRNA in the forebrain and midbrain, which significantly correlated with increased defecation in mice undergoing morphine withdrawal. Mice overexpressing the gene cluster CHRNA5/A3/B4 exhibited increased somatic signs of withdrawal. Furthermore, α5 and β4 nACh receptor knockout mice expressed decreased somatic withdrawal signs compared with their wild-type counterparts. Moreover, selective α3β4* nACh receptor antagonists, α-conotoxin AuIB and AT-1001, attenuated somatic signs of morphine withdrawal in a dose-related manner. In addition, two human datasets revealed a protective role for variants in the CHRNA3 gene, which codes for the α3 nACh receptor subunit, in opioid dependence and withdrawal. In contrast, we found that the α4β2* nACh receptor subtype is not involved in morphine somatic withdrawal signs. Overall, our findings suggest an important role for the α3β4* nACh receptor subtype in morphine physical dependence. © 2014 The British Pharmacological Society.

Gene expression profiling reveals effects of Cimicifuga racemosa (L.) NUTT. (black cohosh) on the estrogen receptor positive human breast cancer cell line MCF-7

PubMed Central

Gaube, Friedemann; Wolfl, Stefan; Pusch, Larissa; Kroll, Torsten C; Hamburger, Matthias

2007-01-01

Background Extracts from the rhizome of Cimicifuga racemosa (black cohosh) are increasingly popular as herbal alternative to hormone replacement therapy (HRT) for the alleviation of postmenopausal disorders. However, the molecular mode of action and the active principles are presently not clear. Previously published data have been largely contradictory. We, therefore, investigated the effects of a lipophilic black cohosh rhizome extract and cycloartane-type triterpenoids on the estrogen receptor positive human breast cancer cell line MCF-7. Results Both extract and purified compounds clearly inhibited cellular proliferation. Gene expression profiling with the extract allowed us to identify 431 regulated genes with high significance. The extract induced expression pattern differed from those of 17β-estradiol or the estrogen receptor antagonist tamoxifen. We observed a significant enrichment of genes in an anti-proliferative and apoptosis-sensitizing manner, as well as an increase of mRNAs coding for gene products involved in several stress response pathways. These functional groups were highly overrepresented among all regulated genes. Also several transcripts coding for oxidoreductases were induced, as for example the cytochrome P450 family members 1A1 and 1B1. In addition, some transcripts associated with antitumor but also tumor-promoting activity were regulated. Real-Time RT-PCR analysis of 13 selected genes was conducted after treatment with purified compounds – the cycloartane-type triterpene glycoside actein and triterpene aglycons – showing similar expression levels compared to the extract. Conclusion No estrogenic but antiproliferative and proapoptotic gene expression was shown for black cohosh in MCF-7 cells at the transcriptional level. The effects may be results of the activation of different pathways. The cycloartane glycosides and – for the first time – their aglycons could be identified as an active principle in black cohosh. PMID:17880733

A novel mutation of the adrenocorticotropin receptor (ACTH-R) gene in a family with the syndrome of isolated glucocorticoid deficiency, but no ACTH-R abnormalities in two families with the triple A syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsigos, C.; Arai, K.; Latronico, A.C.

1995-07-01

Isolated glucocorticoid deficiency (IGD) is an autosomal recessive disorder characterized by primary adrenocortical insufficiency, usually without mineralocorticoid deficiency. Occasionally, the disorder is associated with alacrima and achalasia of the esophagus (triple A syndrome), suggesting potential heterogeneity in its etiology. Mutations in the ACTH receptor gene have been reported in several families with IGD. We have amplified and directly sequenced the entire intronless ACTH receptor gene in 1 other family with IGD and 2 famlies with triple A syndrome. The proband with IGD was a homozygote for an A {r_arrow}G substitution, changing tyrosine 254 to cysteine in the third extracellular loopmore » of the receptor protein, probably interfering with ligand binding. Both of her parents were heterozygotes for this mutation, which was not detected in 100 normal alleles. No mutations were identified in the entire coding area of the ACTH receptor in the 2 families with triple A syndrome, supporting the idea of a developmental or postreceptor defect in this syndrome. 19 refs., 1 fig.« less

A Brassica oleracea gene expressed in a variety-specific manner may encode a novel plant transmembrane receptor.

PubMed

Palmer, J E; Dikeman, D A; Fujinuma, T; Kim, B; Jones, J I; Denda, M; Martínez-Zapater, J M; Cruz-Alvarez, M

2001-04-01

The species Brassica oleracea includes several agricultural varieties characterized by the proliferation of different types of meristems. Using a combination of subtractive hybridization and PCR (polymerase chain reaction) techniques we have identified several genes which are expressed in the reproductive meristems of the cauliflower curd (B. oleracea var. botrytis) but not in the vegetative meristems of Brussels sprouts (B. oleracea var. gemmifera) axillary buds. One of the cloned genes, termed CCE1 (CAULIFLOWER CURD EXPRESSION 1) shows specific expression in the botrytis variety. Preferential expression takes place in this variety in the meristems of the curd and in the stem throughout the vegetative and reproductive stages of plant growth. CCE1 transcripts are not detected in any of the organs of other B. oleracea varieties analyzed. Based on the nucleotide sequence of a cDNA encompassing the complete coding region, we predict that this gene encodes a transmembrane protein, with three transmembrane domains. The deduced amino acid sequence includes motifs conserved in G-protein-coupled receptors (GPCRs) from yeast and animal species. Our results suggest that the cloned gene encodes a protein belonging to a new, so far unidentified, family of transmembrane receptors in plants. The expression pattern of the gene suggests that the receptor may be involved in the control of meristem development/arrest that takes place in cauliflower.

The D4 receptor gene and mood disorders: An association study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Macciardi, F.; Cavalini, M.C.; Petronis, A.

1994-09-01

The problem of a gene-disease association is of major relevance in the current research of Psychiatric Disorders, mostly because of the lack of unequivocal results obtained with the linkage approach. However, some points of an association study must also be carefully considered, namely the statistical methodology and the strategy to select a gene to be tested. The gene coding for the D4 receptor (DRD4) might be theoretically relevant as a component of the genetic susceptibility for mood disorders. We now know that DRD4 has at least 2 functional polymorphisms in the coding regions of the gene, in exon 3 andmore » exon 1, thus conferring etiologic relevance to a potentially positive association. In our work, we investigated the DRD4 genotypes of the 3rd and 1st exon for 93 patients with bipolar disorder and 57 patients with major depression, recurrent disorder. Patients have been diagnosed either by traditional DSMIII-R criteria or by clustering their lifetime psychopathological symptomatology. A random control group consisted of 151 subjects. A significant association has been found with DRD4 exon 3 genotypes, revealing an increase of genotypes 2-4 in Bipolar patients (chi-square=23.07, df=12, p=0.02). Even though a definitive confirmation of our finding requires an independent replication of the study, this result emphasizes the importance of DRD4 in mood disorders.« less

The single fgf receptor gene in the beetle Tribolium castaneum codes for two isoforms that integrate FGF8- and Branchless-dependent signals.

PubMed

Sharma, Rahul; Beer, Katharina; Iwanov, Katharina; Schmöhl, Felix; Beckmann, Paula Indigo; Schröder, Reinhard

2015-06-15

The precise regulation of cell-cell communication by numerous signal-transduction pathways is fundamental for many different processes during embryonic development. One important signalling pathway is the evolutionary conserved fibroblast-growth-factor (FGF)-pathway that controls processes like cell migration, axis specification and mesoderm formation in vertebrate and invertebrate animals. In the model insect Drosophila, the FGF ligand / receptor combinations of FGF8 (Pyramus and Thisbe) / Heartless (Htl) and Branchless (Bnl) / Breathless (Btl) are required for the migration of mesodermal cells and for the formation of the tracheal network respectively with both the receptors functioning independently of each other. However, only a single fgf-receptor gene (Tc-fgfr) has been identified in the genome of the beetle Tribolium. We therefore asked whether both the ligands Fgf8 and Bnl could transduce their signal through a common FGF-receptor in Tribolium. Indeed, we found that the function of the single Tc-fgfr gene is essential for mesoderm differentiation as well as for the formation of the tracheal network during early development. Ligand specific RNAi for Tc-fgf8 and Tc-bnl resulted in two distinct non-overlapping phenotypes of impaired mesoderm differentiation and abnormal formation of the tracheal network in Tc-fgf8- and Tc-bnl(RNAi) embryos respectively. We further show that the single Tc-fgfr gene encodes at least two different receptor isoforms that are generated through alternative splicing. We in addition demonstrate through exon-specific RNAi their distinct tissue-specific functions. Finally, we discuss the structure of the fgf-receptor gene from an evolutionary perspective. Copyright © 2015 Elsevier Inc. All rights reserved.

Utilization of genetic tests: analysis of gene-specific billing in Medicare claims data.

PubMed

Lynch, Julie A; Berse, Brygida; Dotson, W David; Khoury, Muin J; Coomer, Nicole; Kautter, John

2017-08-01

We examined the utilization of precision medicine tests among Medicare beneficiaries through analysis of gene-specific tier 1 and 2 billing codes developed by the American Medical Association in 2012. We conducted a retrospective cross-sectional study. The primary source of data was 2013 Medicare 100% fee-for-service claims. We identified claims billed for each laboratory test, the number of patients tested, expenditures, and the diagnostic codes indicated for testing. We analyzed variations in testing by patient demographics and region of the country. Pharmacogenetic tests were billed most frequently, accounting for 48% of the expenditures for new codes. The most common indications for testing were breast cancer, long-term use of medications, and disorders of lipid metabolism. There was underutilization of guideline-recommended tumor mutation tests (e.g., epidermal growth factor receptor) and substantial overutilization of a test discouraged by guidelines (methylenetetrahydrofolate reductase). Methodology-based tier 2 codes represented 15% of all claims billed with the new codes. The highest rate of testing per beneficiary was in Mississippi and the lowest rate was in Alaska. Gene-specific billing codes significantly improved our ability to conduct population-level research of precision medicine. Analysis of these data in conjunction with clinical records should be conducted to validate findings.Genet Med advance online publication 26 January 2017.

Individual differences in flow proneness are linked to a dopamine D2 receptor gene variant.

PubMed

Gyurkovics, Mate; Kotyuk, Eszter; Katonai, Eniko Rozsa; Horvath, Erzsebet Zsofia; Vereczkei, Andrea; Szekely, Anna

2016-05-01

Flow is a special mental state characterized by deep concentration that occurs during the performance of optimally challenging tasks. In prior studies, proneness to experience flow has been found to be moderately heritable. In the present study, we investigated whether individual differences in flow proneness are related to a polymorphism of the dopamine D2 receptor coding gene (DRD2 C957T rs6277). This polymorphism affects striatal D2 receptor availability, a factor that has been shown to be related to flow proneness. To our knowledge, this is the first study to investigate the association between this trait and a specific gene variant. In a sample of 236 healthy Hungarian adults, we found that CC homozygotes report higher flow proneness than do T allele carriers, but only during mandatory activities (i.e., studying and working), not during leisure time. We discuss implications of this result, e.g., the potential mediators of the relationship. Copyright © 2016 Elsevier Inc. All rights reserved.

The autoimmunity-associated gene PTPN22 potentiates toll-like receptor-driven, type 1 interferon-dependent immunity.

PubMed

Wang, Yaya; Shaked, Iftach; Stanford, Stephanie M; Zhou, Wenbo; Curtsinger, Julie M; Mikulski, Zbigniew; Shaheen, Zachary R; Cheng, Genhong; Sawatzke, Kristy; Campbell, Amanda M; Auger, Jennifer L; Bilgic, Hatice; Shoyama, Fernanda M; Schmeling, David O; Balfour, Henry H; Hasegawa, Kiminori; Chan, Andrew C; Corbett, John A; Binstadt, Bryce A; Mescher, Matthew F; Ley, Klaus; Bottini, Nunzio; Peterson, Erik J

2013-07-25

Immune cells sense microbial products through Toll-like receptors (TLR), which trigger host defense responses including type 1 interferons (IFNs) secretion. A coding polymorphism in the protein tyrosine phosphatase nonreceptor type 22 (PTPN22) gene is a susceptibility allele for human autoimmune and infectious disease. We report that Ptpn22 selectively regulated type 1 IFN production after TLR engagement in myeloid cells. Ptpn22 promoted host antiviral responses and was critical for TLR agonist-induced, type 1 IFN-dependent suppression of inflammation in colitis and arthritis. PTPN22 directly associated with TNF receptor-associated factor 3 (TRAF3) and promotes TRAF3 lysine 63-linked ubiquitination. The disease-associated PTPN22W variant failed to promote TRAF3 ubiquitination, type 1 IFN upregulation, and type 1 IFN-dependent suppression of arthritis. The findings establish a candidate innate immune mechanism of action for a human autoimmunity "risk" gene in the regulation of host defense and inflammation. Copyright © 2013 Elsevier Inc. All rights reserved.

Analysis of the Afrikaner mutation in exon 9 of the low-density lipoprotein receptor gene in a large Dutch kindred suffering from familial hypercholesterolaemia.

PubMed

Defesche, J C; Lansberg, P J; Reymer, P W; Lamping, R J; Kastelein, J J

1993-02-01

Familial hypercholesterolaemia (FH) is the most common genetic metabolic disorder, affecting about 1 in 500 persons in the general population. With novel techniques, it is possible to identify the molecular defects underlying FH in the gene coding for the low-density lipoprotein (LDL) receptor, thereby confirming the diagnosis of FH. In this study we present a large family with a specific mutation in exon 9 of the LDL-receptor gene (an Afrikaner mutation) and we demonstrate that by a large-scale case-finding study in this family, carriers of such a mutation can be detected. Of 63 family members, 13 were shown to be at risk for cardiovascular disease as judged by their lipoprotein profile or the presence of the Afrikaner mutation. Two persons were detected, affected with a dyslipidaemia other than FH. Medical management was initiated in order to reduce the high cardiovascular risk associated with this disorder.

Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

PubMed

Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

2017-04-01

This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of genomic structural variations in Guizhou indigenous pigs and the comparison with other breeds

PubMed Central

Ran, Xueqin; Wang, Jiafu; Li, Sheng; Liu, Jianfeng

2018-01-01

Genomic structural variation (SV) is noticed for the contribution to genetic diversity and phenotypic changes. Guizhou indigenous pig (GZP) has been raised for hundreds of years with many special characteristics. The present paper aimed to uncover the influence of SV on gene polymorphism and the genetic mechanisms of phenotypic traits for GZP. Eighteen GZPs were chosen for resequencing by Illumina sequencing platform. The confident SVs of GZP were called out by both programs of pindel and softSV simultaneously and compared with the SVs deduced from the genomic data of European pig (EUP) and the native pig outside of Guizhou, China (NPOG). A total of 39,166 SVs were detected and covered 27.37 Mb of pig genome. All of 76 SVs were confirmed in GZP pig population by PCR method. The SVs numbers in NPOG and GZP were about 1.8 to 1.9 times higher than that in EUP. And a SV hotspot was found out from the 20 Mb of chromosome X of GZP, which harbored 29 genes and focused on histone modification. More than half of SVs was positioned in the intergenic regions and about one third of SVs in the introns of genes. And we found that SVs tended to locate in genes produced multi-transcripts, in which a positive correlation was found out between the numbers of SV and the gene transcripts. It illustrated that the primary mode of SVs might function on the regulation of gene expression or the transcripts splicing process. A total of 1,628 protein-coding genes were disturbed by 1,956 SVs specific in GZP, in which 93 GZP-specific SV-related genes would lose their functions due to the SV interference and gathered in reproduction ability. Interestingly, the 1,628 protein-coding genes were mainly enriched in estrogen receptor binding, steroid hormone receptor binding, retinoic acid receptor binding, oxytocin signaling pathway, mTOR signaling pathway, axon guidance and cholinergic synapse pathways. It suggested that SV might be a reason for the strong adaptability and low fecundity of GZP, and 51 candidate genes would be useful for the configuration phenotype in Xiang pig breed. PMID:29558483

Detection of genomic structural variations in Guizhou indigenous pigs and the comparison with other breeds.

PubMed

Liu, Chang; Ran, Xueqin; Wang, Jiafu; Li, Sheng; Liu, Jianfeng

2018-01-01

Genomic structural variation (SV) is noticed for the contribution to genetic diversity and phenotypic changes. Guizhou indigenous pig (GZP) has been raised for hundreds of years with many special characteristics. The present paper aimed to uncover the influence of SV on gene polymorphism and the genetic mechanisms of phenotypic traits for GZP. Eighteen GZPs were chosen for resequencing by Illumina sequencing platform. The confident SVs of GZP were called out by both programs of pindel and softSV simultaneously and compared with the SVs deduced from the genomic data of European pig (EUP) and the native pig outside of Guizhou, China (NPOG). A total of 39,166 SVs were detected and covered 27.37 Mb of pig genome. All of 76 SVs were confirmed in GZP pig population by PCR method. The SVs numbers in NPOG and GZP were about 1.8 to 1.9 times higher than that in EUP. And a SV hotspot was found out from the 20 Mb of chromosome X of GZP, which harbored 29 genes and focused on histone modification. More than half of SVs was positioned in the intergenic regions and about one third of SVs in the introns of genes. And we found that SVs tended to locate in genes produced multi-transcripts, in which a positive correlation was found out between the numbers of SV and the gene transcripts. It illustrated that the primary mode of SVs might function on the regulation of gene expression or the transcripts splicing process. A total of 1,628 protein-coding genes were disturbed by 1,956 SVs specific in GZP, in which 93 GZP-specific SV-related genes would lose their functions due to the SV interference and gathered in reproduction ability. Interestingly, the 1,628 protein-coding genes were mainly enriched in estrogen receptor binding, steroid hormone receptor binding, retinoic acid receptor binding, oxytocin signaling pathway, mTOR signaling pathway, axon guidance and cholinergic synapse pathways. It suggested that SV might be a reason for the strong adaptability and low fecundity of GZP, and 51 candidate genes would be useful for the configuration phenotype in Xiang pig breed.

Long Non-Coding RNAs (lncRNAs) of Sea Cucumber: Large-Scale Prediction, Expression Profiling, Non-Coding Network Construction, and lncRNA-microRNA-Gene Interaction Analysis of lncRNAs in Apostichopus japonicus and Holothuria glaberrima During LPS Challenge and Radial Organ Complex Regeneration.

PubMed

Mu, Chuang; Wang, Ruijia; Li, Tianqi; Li, Yuqiang; Tian, Meilin; Jiao, Wenqian; Huang, Xiaoting; Zhang, Lingling; Hu, Xiaoli; Wang, Shi; Bao, Zhenmin

2016-08-01

Long non-coding RNA (lncRNA) structurally resembles mRNA but cannot be translated into protein. Although the systematic identification and characterization of lncRNAs have been increasingly reported in model species, information concerning non-model species is still lacking. Here, we report the first systematic identification and characterization of lncRNAs in two sea cucumber species: (1) Apostichopus japonicus during lipopolysaccharide (LPS) challenge and in heathy tissues and (2) Holothuria glaberrima during radial organ complex regeneration, using RNA-seq datasets and bioinformatics analysis. We identified A. japonicus and H. glaberrima lncRNAs that were differentially expressed during LPS challenge and radial organ complex regeneration, respectively. Notably, the predicted lncRNA-microRNA-gene trinities revealed that, in addition to targeting protein-coding transcripts, miRNAs might also target lncRNAs, thereby participating in a potential novel layer of regulatory interactions among non-coding RNA classes in echinoderms. Furthermore, the constructed coding-non-coding network implied the potential involvement of lncRNA-gene interactions during the regulation of several important genes (e.g., Toll-like receptor 1 [TLR1] and transglutaminase-1 [TGM1]) in response to LPS challenge and radial organ complex regeneration in sea cucumbers. Overall, this pioneer systematic identification, annotation, and characterization of lncRNAs in echinoderm pave the way for similar studies and future genetic, genomic, and evolutionary research in non-model species.

Rare variants in the neurotrophin signaling pathway implicated in schizophrenia risk.

PubMed

Kranz, Thorsten M; Goetz, Ray R; Walsh-Messinger, Julie; Goetz, Deborah; Antonius, Daniel; Dolgalev, Igor; Heguy, Adriana; Seandel, Marco; Malaspina, Dolores; Chao, Moses V

2015-10-01

Multiple lines of evidence corroborate impaired signaling pathways as relevant to the underpinnings of schizophrenia. There has been an interest in neurotrophins, since they are crucial mediators of neurodevelopment and in synaptic connectivity in the adult brain. Neurotrophins and their receptors demonstrate aberrant expression patterns in cortical areas for schizophrenia cases in comparison to control subjects. There is little known about the contribution of neurotrophin genes in psychiatric disorders. To begin to address this issue, we conducted high-coverage targeted exome capture in a subset of neurotrophin genes in 48 comprehensively characterized cases with schizophrenia-related psychosis. We herein report rare missense polymorphisms and novel missense mutations in neurotrophin receptor signaling pathway genes. Furthermore, we observed that several genes have a higher propensity to harbor missense coding variants than others. Based on this initial analysis we suggest that rare variants and missense mutations in neurotrophin genes might represent genetic contributions involved across psychiatric disorders. Copyright © 2015 Elsevier B.V. All rights reserved.

The N-Methyl-D-Aspartate Receptor in Heart Development: A Gene Knockdown Model Using siRNA

PubMed Central

Lie, Octavian V.; Bennett, Gregory D.; Rosenquist, Thomas H

2009-01-01

Antagonists of the N-methyl-D-aspartate receptor (NMDAR) may disrupt the development of the cardiac neural crest (CNC) and contribute to conotruncal heart defects. To test this interaction, a loss-of-function model was generated using small interfering RNAs (siRNA) directed against the critical NR1-subunit of this receptor in avian embryos. The coding sequence of the chicken NR1-gene and predicted protein sequences were characterized and found to be homologous with other vertebrate species. Analysis of its spatiotemporal expression demonstrated its expression within the neural tube at pre-migratory CNC sites. siRNA targeted to the NR1-mRNA in pre-migratory CNC lead to a significant decrease in NR1 protein expression. However, embryo survival and heart development were not adversely affected. These results indicate that the CNC may function normally in the absence of functional NMDAR, and that NMDAR antagonists may have a complex impact upon the CNC that transcends impairment of a single receptor type. PMID:19737608

MicroRNAs as New Characters in the Plot between Epigenetics and Prostate Cancer.

PubMed

Paone, Alessio; Galli, Roberta; Fabbri, Muller

2011-01-01

Prostate cancer (PCA) still represents a leading cause of death. An increasing number of studies have documented that microRNAs (miRNAs), a subgroup of non-coding RNAs with gene regulatory functions, are differentially expressed in PCA respect to the normal tissue counterpart, suggesting their involvement in prostate carcinogenesis and dissemination. Interestingly, it has been shown that miRNAs undergo the same regulatory mechanisms than any other protein coding gene, including epigenetic regulation. In turn, miRNAs can also affect the expression of oncogenes and tumor suppressor genes by targeting effectors of the epigenetic machinery, therefore indirectly affecting the epigenetic controls on these genes. Among the genes that undergo this complex regulation, there is the androgen receptor (AR), a key therapeutic target for PCA. This review will focus on the role of epigenetically regulated and epigenetically regulating miRNAs in PCA and on the fine regulation of AR expression, as mediated by this miRNA-epigenetics interaction.

Opioid system genes in alcoholism: a case-control study in Croatian population.

PubMed

Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

2013-10-01

Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.

Endothelin Receptor B2 (EDNRB2) Gene Is Associated with Spot Plumage Pattern in Domestic Ducks (Anas platyrhynchos).

PubMed

Li, Ling; Li, Dan; Liu, Li; Li, Shijun; Feng, Yanping; Peng, Xiuli; Gong, Yanzhang

2015-01-01

Endothelin receptor B subtype 2 (EDNRB2) is a seven-transmembrane G-protein coupled receptor. In this study, we investigated EDNRB2 gene as a candidate gene for duck spot plumage pattern according to studies of chicken and Japanese quail. The entire coding region was cloned by the reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis showed that duck EDNRB2 cDNA contained a 1311 bp open reading frame and encoded a putative protein of 436 amino acids residues. The transcript shared 89%-90% identity with the counterparts in other avian species. A phylogenetic tree based on amino acid sequences showed that duck EDNRB2 was evolutionary conserved in avian clade. The entire coding region of EDNRB2 were sequenced in 20 spot and 20 non-spot ducks, and 13 SNPs were identified. Two of them (c.940G>A and c.995G>A) were non-synonymous substitutions, and were genotyped in 647 ducks representing non-spot and spot phenotypes. The c.995G>A mutation, which results in the amino acid substitution of Arg332His, was completely associated with the spot phenotype: all 152 spot ducks were carriers of the AA genotype and the other 495 individuals with non-spot phenotype were carriers of GA or GG genotype, respectively. Segregation in 17 GA×GG and 22 GA×GA testing combinations confirmed this association since the segregation ratios and genotypes of the offspring were in agreement with the hypothesis. In order to investigate the underlying mechanism of the spot phenotype, MITF gene was used as cell type marker of melanocyte progenitor cells while TYR and TYRP1 gene were used as cell type markers of mature melanocytes. Transcripts of MITF, TYR and TYRP1 gene with expected size were identified in all pigmented skin tissues while PCR products were not obtained from non-pigmented skin tissues. It was inferred that melanocytes are absent in non-pigmented skin tissues of spot ducks.

Evolutionary Insights into Taste Perception of the Invasive Pest Drosophila suzukii.

PubMed

Crava, Cristina M; Ramasamy, Sukanya; Ometto, Lino; Anfora, Gianfranco; Rota-Stabelli, Omar

2016-12-07

Chemosensory perception allows insects to interact with the environment by perceiving odorant or tastant molecules; genes encoding chemoreceptors are the molecular interface between the environment and the insect, and play a central role in mediating its chemosensory behavior. Here, we explore how the evolution of these genes in the emerging pest Drosophila suzukii correlates with the peculiar ecology of this species. We annotated approximately 130 genes coding for gustatory receptors (GRs) and divergent ionotropic receptors (dIRs) in D. suzukii and in its close relative D. biarmipes We then analyzed the evolution, in terms of size, of each gene family as well of the molecular evolution of the genes in a 14 Drosophila species phylogenetic framework. We show that the overall evolution of GRs parallels that of dIRs not only in D. suzukii, but also in all other analyzed Drosophila Our results reveal an unprecedented burst of gene family size in the lineage leading to the suzukii subgroup, as well as genomic changes that characterize D. suzukii, particularly duplications and strong signs of positive selection in the putative bitter-taste receptor GR59d. Expression studies of duplicate genes in D. suzukii support a spatio-temporal subfunctionalization of the duplicate isoforms. Our results suggest that D. suzukii is not characterized by gene loss, as observed in other specialist Drosophila species, but rather by a dramatic acceleration of gene gains, compatible with a highly generalist feeding behavior. Overall, our analyses provide candidate taste receptors specific for D. suzukii that may correlate with its specific behavior, and which may be tested in functional studies to ultimately enhance its control in the field. Copyright © 2016 Crava et al.

RNA-Seq analysis of transcriptome responses in Atlantic cod (Gadus morhua) precision-cut liver slices exposed to benzo[a]pyrene and 17α-ethynylestradiol.

PubMed

Yadetie, Fekadu; Zhang, Xiaokang; Hanna, Eileen Marie; Aranguren-Abadía, Libe; Eide, Marta; Blaser, Nello; Brun, Morten; Jonassen, Inge; Goksøyr, Anders; Karlsen, Odd André

2018-06-07

Polycyclic aromatic hydrocarbons such as benzo[a]pyrene (BaP) that activate the aryl hydrocarbon receptor (Ahr) pathway, and endocrine disruptors acting through the estrogen receptor pathway are among environmental pollutants of major concern. In this work, we exposed Atlantic cod (Gadus morhua) precision-cut liver slices (PCLS) to BaP (10 nM and 1000 nM), ethynylestradiol (EE2) (10 nM and 1000 nM), and equimolar mixtures of BaP and EE2 (10 nM and 1000 nM) for 48 h, and performed RNA-Seq based transcriptome mapping followed by systematic bioinformatics analyses. Our gene expression analysis showed that several genes were differentially expressed in response to BaP and EE2 treatments in PCLS. Strong up-regulation of genes coding for the cytochrome P450 1a (Cyp1a) enzyme and the Ahr repressor (Ahrrb) was observed in BaP treated PCLS. EE2 treatment of liver slices strongly up-regulated genes coding for precursors of vitellogenin (Vtg) and eggshell zona pellucida (Zp) proteins. As expected, pathway enrichment and network analysis showed that the Ahr and estrogen receptor pathways are among the top affected by BaP and EE2 treatments, respectively. Interestingly, two genes coding for fibroblast growth factor 3 (Fgf3) and fibroblast growth factor 4 (Fgf4) were up-regulated by EE2 in this study. To our knowledge, the fgf3 and fgf4 genes have not previously been described in relation to estrogen signaling in fish liver, and these results suggest the modulation of the FGF signaling pathway by estrogens in fish. The signature expression profiles of top differentially expressed genes in response to the single compound (BaP or EE2) treatment were generally maintained in the expression responses to the equimolar binary mixtures. However, in the mixture-treated groups, BaP appeared to have anti-estrogenic effects as observed by lower number of differentially expressed putative EE2 responsive genes. Our in-depth quantitative analysis of changes in liver transcriptome in response to BaP and EE2, using PCLS tissue culture provides further mechanistic insights into effects of the compounds. Moreover, the analyses demonstrate the usefulness of PCLS in cod for omics experiments. Copyright © 2018 Elsevier B.V. All rights reserved.

[Novel nonsense mutation (p.Y113X) in the human growth hormone receptor gene in a Brazilian patient with Laron syndrome].

PubMed

Diniz, Erik Trovão; Jorge, Alexander A L; Arnhold, Ivo J P; Rosenbloom, Arlan L; Bandeira, Francisco

2008-11-01

To date, about sixty different mutations within GH receptor (GHR) gene have been described in patients with GH insensitivity syndrome (GHI). In this report, we described a novel nonsense mutation of GHR. The patient was evaluated at the age of 6 yr, for short stature associated to clinical phenotype of GHI. GH, IGF-1, and GHBP levels were determined. The PCR products from exons 2-10 were sequenced. The patient had high GH (26 microg/L), low IGF-1 (22.5 ng/ml) and undetectable GHBP levels. The sequencing of GHR exon 5 disclosed adenine duplication at nucleotide 338 of GHR coding sequence (c.338dupA) in homozygous state. We described a novel mutation that causes a truncated GHR and a loss of receptor function due to the lack of amino acids comprising the transmembrane and intracellular regions of GHR protein, leading to GHI.

Role of Growth Hormone in Prostate Cancer

DTIC Science & Technology

2007-02-01

syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci USA 94:13215... Laron mouse, in which the gene coding for both GHR and GH binding protein has been disrupted or knocked out, with the C3(1)/Tag mouse, which develops...the Laron mouse). Nevertheless, the new model presented here demonstrates that the loss of GHR produced a significant reduction in the level of PIN in

Evaluation of a Cys23Ser mutation within the human 5-HT2C receptor gene: no evidence for an association of the mutant allele with obesity or underweight in children, adolescents and young adults.

PubMed

Lentes, K U; Hinney, A; Ziegler, A; Rosenkranz, K; Wurmser, H; Barth, N; Jacob, K; Coners, H; Mayer, H; Grzeschik, K H; Schäfer, H; Remschmidt, H; Pirke, K M; Hebebrand, J

1997-01-01

Serotonin is a neurotransmitter involved in a large number of psychophysiological processes including the regulation of mood, arousal, aggression, sleep, learning, nociceptions, nerve growth and importantly, appetitive functions. Alterations of 5-HT receptor activity have been shown to occur in many psychiatric diseases including depression, anxiety, eating disorders, schizophrenia etc. Hence, genetic variation in genes coding for serotonin receptor proteins might well be involved in the genetic predisposition to these diseases and therefore are of great pharmacogenetic relevance. Knockout mice deficient of a functional 5-HT2C receptor have implicated a potential role of this receptor subtype in the serotonergic control of appetite. A Cys23Ser mutation in the human 5-HT2C receptor gene discovered recently prompted us to investigate this mutation with regard to the development of human obesity. We have evaluated this mutation in 241 obese children and adolescents (mean BMI > or = 97th percentile), 80 normal weight children (BMI 5th-85th percentile) and 92 underweight probands (BMI < or = 15th percentile) for a possible association with obesity. The frequencies of the mutant allele in all three weight groups (obese subjects: 0.1597; normal weight: 0.168; underweight: 0.1575) were very similar. Association as well as linkage studies were negative. Therefore it is unlikely that this receptor mutation plays a direct role in the development of human obesity.

Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

PubMed

Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

2015-04-01

Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

The α3β4* nicotinic ACh receptor subtype mediates physical dependence to morphine: mouse and human studies

PubMed Central

Muldoon, P P; Jackson, K J; Perez, E; Harenza, J L; Molas, S; Rais, B; Anwar, H; Zaveri, N T; Maldonado, R; Maskos, U; McIntosh, J M; Dierssen, M; Miles, M F; Chen, X; De Biasi, M; Damaj, M I

2014-01-01

BACKGROUND AND PURPOSE Recent data have indicated that α3β4* neuronal nicotinic (n) ACh receptors may play a role in morphine dependence. Here we investigated if nACh receptors modulate morphine physical withdrawal. EXPERIMENTAL APPROACHES To assess the role of α3β4* nACh receptors in morphine withdrawal, we used a genetic correlation approach using publically available datasets within the GeneNetwork web resource, genetic knockout and pharmacological tools. Male and female European-American (n = 2772) and African-American (n = 1309) subjects from the Study of Addiction: Genetics and Environment dataset were assessed for possible associations of polymorphisms in the 15q25 gene cluster and opioid dependence. KEY RESULTS BXD recombinant mouse lines demonstrated an increased expression of α3, β4 and α5 nACh receptor mRNA in the forebrain and midbrain, which significantly correlated with increased defecation in mice undergoing morphine withdrawal. Mice overexpressing the gene cluster CHRNA5/A3/B4 exhibited increased somatic signs of withdrawal. Furthermore, α5 and β4 nACh receptor knockout mice expressed decreased somatic withdrawal signs compared with their wild-type counterparts. Moreover, selective α3β4* nACh receptor antagonists, α-conotoxin AuIB and AT-1001, attenuated somatic signs of morphine withdrawal in a dose-related manner. In addition, two human datasets revealed a protective role for variants in the CHRNA3 gene, which codes for the α3 nACh receptor subunit, in opioid dependence and withdrawal. In contrast, we found that the α4β2* nACh receptor subtype is not involved in morphine somatic withdrawal signs. CONCLUSION AND IMPLICATIONS Overall, our findings suggest an important role for the α3β4* nACh receptor subtype in morphine physical dependence. PMID:24750073

Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

PubMed

Dass, J Febin Prabhu; Sudandiradoss, C

2012-07-15

5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.

Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

PubMed Central

Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia

2011-01-01

Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358

Molecular Characterization and Comparative Sequence Analysis of Defense-Related Gene, Oryza rufipogon Receptor-Like Protein Kinase 1

PubMed Central

Law, Yee-Song; Gudimella, Ranganath; Song, Beng-Kah; Ratnam, Wickneswari; Harikrishna, Jennifer Ann

2012-01-01

Many of the plant leucine rich repeat receptor-like kinases (LRR-RLKs) have been found to regulate signaling during plant defense processes. In this study, we selected and sequenced an LRR-RLK gene, designated as Oryza rufipogon receptor-like protein kinase 1 (OrufRPK1), located within yield QTL yld1.1 from the wild rice Oryza rufipogon (accession IRGC105491). A 2055 bp coding region and two exons were identified. Southern blotting determined OrufRPK1 to be a single copy gene. Sequence comparison with cultivated rice orthologs (OsI219RPK1, OsI9311RPK1 and OsJNipponRPK1, respectively derived from O. sativa ssp. indica cv. MR219, O. sativa ssp. indica cv. 9311 and O. sativa ssp. japonica cv. Nipponbare) revealed the presence of 12 single nucleotide polymorphisms (SNPs) with five non-synonymous substitutions, and 23 insertion/deletion sites. The biological role of the OrufRPK1 as a defense related LRR-RLK is proposed on the basis of cDNA sequence characterization, domain subfamily classification, structural prediction of extra cellular domains, cluster analysis and comparative gene expression. PMID:22942769

FH Tulsa-1 and -2: Two unique alleles for familial hypercholesterolemia presenting in an affected two-year-old African-American male

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blackett, P.R.; Altmiller, D.H.; Jelley, D.

1995-11-20

A two-year-old African American boy presented with cutaneous xanthomata and extreme hypercholesterolemia. Subsequent studies revealed that the LDL-cholesterol was 1,001 mg/dl and apoB 507 mg/dl. LDL-receptor activity was almost undetectable, which is compatible with the finding of two newly described defective alleles on exon 4 of the LDL-receptor gene coding for part of the ligand-binding domain. One allele contained a 21 base-pair insertion from codon 200 to 207 whereas the other had a point mutation at codon 207. The rarity of genes for FH reported in individuals of African ancestry is discussed. 16 refs., 2 figs., 2 tabs.

Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity: possible implications for opiate addiction.

PubMed

Bond, C; LaForge, K S; Tian, M; Melia, D; Zhang, S; Borg, L; Gong, J; Schluger, J; Strong, J A; Leal, S M; Tischfield, J A; Kreek, M J; Yu, L

1998-08-04

Opioid drugs play important roles in the clinical management of pain, as well as in the development and treatment of drug abuse. The mu opioid receptor is the primary site of action for the most commonly used opioids, including morphine, heroin, fentanyl, and methadone. By sequencing DNA from 113 former heroin addicts in methadone maintenance and 39 individuals with no history of drug or alcohol abuse or dependence, we have identified five different single-nucleotide polymorphisms (SNPs) in the coding region of the mu opioid receptor gene. The most prevalent SNP is a nucleotide substitution at position 118 (A118G), predicting an amino acid change at a putative N-glycosylation site. This SNP displays an allelic frequency of approximately 10% in our study population. Significant differences in allele distribution were observed among ethnic groups studied. The variant receptor resulting from the A118G SNP did not show altered binding affinities for most opioid peptides and alkaloids tested. However, the A118G variant receptor binds beta-endorphin, an endogenous opioid that activates the mu opioid receptor, approximately three times more tightly than the most common allelic form of the receptor. Furthermore, beta-endorphin is approximately three times more potent at the A118G variant receptor than at the most common allelic form in agonist-induced activation of G protein-coupled potassium channels. These results show that SNPs in the mu opioid receptor gene can alter binding and signal transduction in the resulting receptor and may have implications for normal physiology, therapeutics, and vulnerability to develop or protection from diverse diseases including the addictive diseases.

Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism.

PubMed Central

Amselem, S; Sobrier, M L; Duquesnoy, P; Rappaport, R; Postel-Vinay, M C; Gourmelen, M; Dallapiccola, B; Goossens, M

1991-01-01

In addition to its classical effects on growth, growth hormone (GH) has been shown to have a number of other actions, all of which are initiated by an interaction with specific high affinity receptors present in a variety of tissues. Purification of a rabbit liver protein via its ability to bind GH has allowed the isolation of a cDNA encoding a putative human growth hormone receptor that belongs to a new class of transmembrane receptors. We have previously shown that this putative growth hormone receptor gene is genetically linked to Laron dwarfism, a rare autosomal recessive syndrome caused by target resistance to GH. Nevertheless, the inability to express the corresponding full-length coding sequence and the lack of a test for growth-promoting function have hampered a direct confirmation of its role in growth. We have now identified three nonsense mutations within this growth hormone receptor gene, lying at positions corresponding to the amino terminal extremity and causing a truncation of the molecule, thereby deleting a large portion of both the GH binding domain and the full transmembrane and intracellular domains. Three independent patients with Laron dwarfism born of consanguineous parents were homozygous for these defects. Two defects were identical and consisted of a CG to TG transition. Not only do these results confirm the growth-promoting activity of this receptor but they also suggest that CpG doublets may represent hot spots for mutations in the growth hormone receptor gene that are responsible for hereditary dwarfism. Images PMID:1999489

Genes encoding cuticular proteins are components of the Nimrod gene cluster in Drosophila.

PubMed

Cinege, Gyöngyi; Zsámboki, János; Vidal-Quadras, Maite; Uv, Anne; Csordás, Gábor; Honti, Viktor; Gábor, Erika; Hegedűs, Zoltán; Varga, Gergely I B; Kovács, Attila L; Juhász, Gábor; Williams, Michael J; Andó, István; Kurucz, Éva

2017-08-01

The Nimrod gene cluster, located on the second chromosome of Drosophila melanogaster, is the largest synthenic unit of the Drosophila genome. Nimrod genes show blood cell specific expression and code for phagocytosis receptors that play a major role in fruit fly innate immune functions. We previously identified three homologous genes (vajk-1, vajk-2 and vajk-3) located within the Nimrod cluster, which are unrelated to the Nimrod genes, but are homologous to a fourth gene (vajk-4) located outside the cluster. Here we show that, unlike the Nimrod candidates, the Vajk proteins are expressed in cuticular structures of the late embryo and the late pupa, indicating that they contribute to cuticular barrier functions. Copyright © 2017 Elsevier Ltd. All rights reserved.

The oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical modulator of prostate cancer.

PubMed

Chakravarty, Dimple; Sboner, Andrea; Nair, Sujit S; Giannopoulou, Eugenia; Li, Ruohan; Hennig, Sven; Mosquera, Juan Miguel; Pauwels, Jonathan; Park, Kyung; Kossai, Myriam; MacDonald, Theresa Y; Fontugne, Jacqueline; Erho, Nicholas; Vergara, Ismael A; Ghadessi, Mercedeh; Davicioni, Elai; Jenkins, Robert B; Palanisamy, Nallasivam; Chen, Zhengming; Nakagawa, Shinichi; Hirose, Tetsuro; Bander, Neil H; Beltran, Himisha; Fox, Archa H; Elemento, Olivier; Rubin, Mark A

2014-11-21

The androgen receptor (AR) plays a central role in establishing an oncogenic cascade that drives prostate cancer progression. Some prostate cancers escape androgen dependence and are often associated with an aggressive phenotype. The oestrogen receptor alpha (ERα) is expressed in prostate cancers, independent of AR status. However, the role of ERα remains elusive. Using a combination of chromatin immunoprecipitation (ChIP) and RNA-sequencing data, we identified an ERα-specific non-coding transcriptome signature. Among putatively ERα-regulated intergenic long non-coding RNAs (lncRNAs), we identified nuclear enriched abundant transcript 1 (NEAT1) as the most significantly overexpressed lncRNA in prostate cancer. Analysis of two large clinical cohorts also revealed that NEAT1 expression is associated with prostate cancer progression. Prostate cancer cells expressing high levels of NEAT1 were recalcitrant to androgen or AR antagonists. Finally, we provide evidence that NEAT1 drives oncogenic growth by altering the epigenetic landscape of target gene promoters to favour transcription.

The oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical modulator of prostate cancer

PubMed Central

Chakravarty, Dimple; Sboner, Andrea; Nair, Sujit S.; Giannopoulou, Eugenia; Li, Ruohan; Hennig, Sven; Mosquera, Juan Miguel; Pauwels, Jonathan; Park, Kyung; Kossai, Myriam; MacDonald, Theresa Y.; Fontugne, Jacqueline; Erho, Nicholas; Vergara, Ismael A.; Ghadessi, Mercedeh; Davicioni, Elai; Jenkins, Robert B.; Palanisamy, Nallasivam; Chen, Zhengming; Nakagawa, Shinichi; Hirose, Tetsuro; Bander, Neil H.; Beltran, Himisha; Fox, Archa H.; Elemento, Olivier; Rubin, Mark A.

2014-01-01

The androgen receptor (AR) plays a central role in establishing an oncogenic cascade that drives prostate cancer progression. Some prostate cancers escape androgen dependence and are often associated with an aggressive phenotype. The oestrogen receptor alpha (ERα) is expressed in prostate cancers, independent of AR status. However, the role of ERα remains elusive. Using a combination of chromatin immunoprecipitation (ChIP) and RNA-sequencing data, we identified an ERα-specific non-coding transcriptome signature. Among putatively ERα-regulated intergenic long non-coding RNAs (lncRNAs), we identified nuclear enriched abundant transcript 1 (NEAT1) as the most significantly overexpressed lncRNA in prostate cancer. Analysis of two large clinical cohorts also revealed that NEAT1 expression is associated with prostate cancer progression. Prostate cancer cells expressing high levels of NEAT1 were recalcitrant to androgen or AR antagonists. Finally, we provide evidence that NEAT1 drives oncogenic growth by altering the epigenetic landscape of target gene promoters to favour transcription. PMID:25415230

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

The miR-199-dynamin regulatory axis controls receptor-mediated endocytosis.

PubMed

Aranda, Juan F; Canfrán-Duque, Alberto; Goedeke, Leigh; Suárez, Yajaira; Fernández-Hernando, Carlos

2015-09-01

Small non-coding RNAs (microRNAs) are important regulators of gene expression that modulate many physiological processes; however, their role in regulating intracellular transport remains largely unknown. Intriguingly, we found that the dynamin (DNM) genes, a GTPase family of proteins responsible for endocytosis in eukaryotic cells, encode the conserved miR-199a and miR-199b family of miRNAs within their intronic sequences. Here, we demonstrate that miR-199a and miR-199b regulate endocytic transport by controlling the expression of important mediators of endocytosis such as clathrin heavy chain (CLTC), Rab5A, low-density lipoprotein receptor (LDLR) and caveolin-1 (Cav-1). Importantly, miR-199a-5p and miR-199b-5p overexpression markedly inhibits CLTC, Rab5A, LDLR and Cav-1 expression, thus preventing receptor-mediated endocytosis in human cell lines (Huh7 and HeLa). Of note, miR-199a-5p inhibition increases target gene expression and receptor-mediated endocytosis. Taken together, our work identifies a new mechanism by which microRNAs regulate intracellular trafficking. In particular, we demonstrate that the DNM, miR-199a-5p and miR-199b-5p genes act as a bifunctional locus that regulates endocytosis, thus adding an unexpected layer of complexity in the regulation of intracellular trafficking. © 2015. Published by The Company of Biologists Ltd.

Homozygosity for a novel missense mutation in the leptin receptor gene (P316T) in two Egyptian cousins with severe early onset obesity.

PubMed

Mazen, I; El-Gammal, M; Abdel-Hamid, M; Farooqi, I S; Amr, K

2011-04-01

Congenital deficiency of the leptin receptor is a very rare cause of severe early-onset obesity. To date, only 9 families have been reported in the literature to have mutations in the leptin receptor gene. The clinical features include severe early onset obesity, severe hyperphagia, hypogonadotropic hypogonadism, and T cell and neuroendocrine/metabolic dysfunction. Here we report two cousins with severe early onset obesity and recurrent respiratory tract infections. Their serum leptin levels were elevated but they were within the range predicted by the elevated fat mass in both cousins. Direct sequencing of the entire coding sequence of the leptin receptor gene revealed a novel homozygous missense mutation in exon 6, P316T. The mutation was found in the homozygous form in both cousins and in the heterozygote state in their parents. This mutation was not found in 200 chromosomes from 100 unrelated normal weight control subjects of Egyptian origin using PCR-RFLP analysis. In conclusion, finding this new mutation in the LEPR beside our previous mutation in the LEP gene implies that monogenic obesity syndromes may be common in the Egyptian population owing to the high rates of consanguineous marriages. Further screening of more families for mutations in LEP, LEPR, and MC4 might confirm this assumption. Copyright © 2010 Elsevier Inc. All rights reserved.

Patients with autosomal nephrogenic diabetes insipidus homozygous for mutations in the aquaporin 2 water-channel gene.

PubMed Central

van Lieburg, A. F.; Verdijk, M. A.; Knoers, V. V.; van Essen, A. J.; Proesmans, W.; Mallmann, R.; Monnens, L. A.; van Oost, B. A.; van Os, C. H.; Deen, P. M.

1994-01-01

Mutations in the X-chromosomal V2 receptor gene are known to cause nephrogenic diabetes insipidus (NDI). Besides the X-linked form, an autosomal mode of inheritance has been described. Recently, mutations in the autosomal gene coding for water-channel aquaporin 2 (AQP2) of the renal collecting duct were reported in an NDI patient. In the present study, missense mutations and a single nucleotide deletion in the aquaporin 2 gene of three NDI patients from consanguineous matings are described. Expression studies in Xenopus oocytes showed that the missense AQP2 proteins are nonfunctional. These results prove that mutations in the AQP2 gene cause autosomal recessive NDI. PMID:7524315

IGF-1 modulates gene expression of proteins involved in inflammation, cytoskeleton, and liver architecture.

PubMed

Lara-Diaz, V J; Castilla-Cortazar, I; Martín-Estal, I; García-Magariño, M; Aguirre, G A; Puche, J E; de la Garza, R G; Morales, L A; Muñoz, U

2017-05-01

Even though the liver synthesizes most of circulating IGF-1, it lacks its receptor under physiological conditions. However, according to previous studies, a damaged liver expresses the receptor. For this reason, herein, we examine hepatic histology and expression of genes encoding proteins of the cytoskeleton, extracellular matrix, and cell-cell molecules and inflammation-related proteins. A partial IGF-1 deficiency murine model was used to investigate IGF-1's effects on liver by comparing wild-type controls, heterozygous igf1 +/- , and heterozygous mice treated with IGF-1 for 10 days. Histology, microarray for mRNA gene expression, RT-qPCR, and lipid peroxidation were assessed. Microarray analyses revealed significant underexpression of igf1 in heterozygous mice compared to control mice, restoring normal liver expression after treatment, which then normalized its circulating levels. IGF-1 receptor mRNA was overexpressed in Hz mice liver, while treated mice displayed a similar expression to that of the controls. Heterozygous mice showed overexpression of several genes encoding proteins related to inflammatory and acute-phase proteins and underexpression or overexpression of genes which coded for extracellular matrix, cytoskeleton, and cell junction components. Histology revealed an altered hepatic architecture. In addition, liver oxidative damage was found increased in the heterozygous group. The mere IGF-1 partial deficiency is associated with relevant alterations of the hepatic architecture and expression of genes involved in cytoskeleton, hepatocyte polarity, cell junctions, and extracellular matrix proteins. Moreover, it induces hepatic expression of the IGF-1 receptor and elevated acute-phase and inflammation mediators, which all resulted in liver oxidative damage.

Are There Genetic Paths Common to Obesity, Cardiovascular Disease Outcomes, and Cardiovascular Risk Factors?

PubMed Central

Rankinen, Tuomo; Sarzynski, Mark A.; Ghosh, Sujoy; Bouchard, Claude

2015-01-01

Clustering of obesity, coronary artery disease, and cardiovascular disease risk factors is observed in epidemiological studies and clinical settings. Twin and family studies have provided some supporting evidence for the clustering hypothesis. Loci nearest a lead single nucleotide polymorphism (SNP) showing genome-wide significant associations with coronary artery disease, body mass index, C-reactive protein, blood pressure, lipids, and type 2 diabetes mellitus were selected for pathway and network analyses. Eighty-seven autosomal regions (181 SNPs), mapping to 56 genes, were found to be pleiotropic. Most pleiotropic regions contained genes associated with coronary artery disease and plasma lipids, whereas some exhibited coaggregation between obesity and cardiovascular disease risk factors. We observed enrichment for liver X receptor (LXR)/retinoid X receptor (RXR) and farnesoid X receptor/RXR nuclear receptor signaling among pleiotropic genes and for signatures of coronary artery disease and hepatic steatosis. In the search for functionally interacting networks, we found that 43 pleiotropic genes were interacting in a network with an additional 24 linker genes. ENCODE (Encyclopedia of DNA Elements) data were queried for distribution of pleiotropic SNPs among regulatory elements and coding sequence variations. Of the 181 SNPs, 136 were annotated to ≥1 regulatory feature. An enrichment analysis found over-representation of enhancers and DNAse hypersensitive regions when compared against all SNPs of the 1000 Genomes pilot project. In summary, there are genomic regions exerting pleiotropic effects on cardiovascular disease risk factors, although only a few included obesity. Further studies are needed to resolve the clustering in terms of DNA variants, genes, pathways, and actionable targets. PMID:25722444

Noncoding RNA Shows Context-Dependent Function | Center for Cancer Research

Cancer.gov

In addition to well-studied protein coding sequences, it is known that the genomes of higher organisms produce numerous noncoding RNAs (ncRNAs). Important roles for some ncRNAs in cell function have been demonstrated, though usually on a case-by-case basis, leading some scientists to argue that the majority of ncRNA production is just “noise” that results from the imperfect transcription machinery. The fact that many ncRNAs overlap with coding genes has hampered studies of their activities. Thus, a general understanding of whether ncRNA production is functional or not is lacking. To address this issue, Daniel Larson, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues developed a new approach using single-molecule imaging in living cells. The researchers specifically labeled coding and ncRNAs from the GAL locus in yeast, which regulates the galactose response. Glucose is the preferred source of carbon for yeast, but when it is scarce, genes within the GAL locus, including GAL10 and GAL1, are activated to allow the metabolism of galactose.

Nephrogenic diabetes insipidus: an X chromosome-linked dominant inheritance pattern with a vasopressin type 2 receptor gene that is structurally normal.

PubMed Central

Friedman, E; Bale, A E; Carson, E; Boson, W L; Nordenskjöld, M; Ritzén, M; Ferreira, P C; Jammal, A; De Marco, L

1994-01-01

Nephrogenic diabetes insipidus is a rare hereditary disorder, most commonly transmitted in an X chromosome-linked recessive manner and characterized by the lack of renal response to the action of antidiuretic hormone [Arg8]vasopressin. The vasopressin type 2 receptor (V2R) has been suggested to be the gene that causes the disease, and its role in disease pathogenesis is supported by mutations within this gene in affected individuals. Using the PCR, denaturing gradient gel electrophoresis, and direct DNA sequencing, we examined the V2R gene in four unrelated kindreds. In addition, linkage analysis with chromosome Xq28 markers was done in one large Brazilian kindred with an apparent unusual X chromosome-linked dominant inheritance pattern. In one family, a mutation in codon 280, causing a Tyr-->Cys substitution in the sixth transmembrane domain of the receptor, was found. In the other three additional families with nephrogenic diabetes insipidus, the V2R-coding region was normal in sequence. In one large Brazilian kindred displaying an unusual X chromosome-linked dominant mode of inheritance, the disease-related gene was localized to the same region of the X chromosome as the V2R, but no mutations were found, thus raising the possibility that this disease is caused by a gene other than V2R. Images PMID:8078903

The effect of melatonin from slow-release implants on basic and TLR-4-mediated gene expression of inflammatory cytokines and their receptors in the choroid plexus in ewes.

PubMed

Kowalewska, M; Herman, A P; Szczepkowska, A; Skipor, J

2017-08-01

The present study concerns the effect of melatonin from slow-release implants on the expression of genes coding interleukin-1β (Il1B), inerleukin-6 (Il6), tumour necrosis factor α (Tnf) and their receptors: IL-1 receptor type I (Il1r1) and type II (Il1r2), IL-6 receptor (Il6r) and signal transducer (Il6st), TNFα receptor type I (Tnfrsf1a) and II (Tnfrsf1b) and retinoid-related orphan receptor α (RorA) and Rev.-erbα in the ovine choroid plexus (CP) under basal and lipopolysaccharide (LPS)-challenged conditions. Studies were performed on four groups: 1) sham-implanted and placebo-treated, 2) melatonin-implanted (Melovine, 18mg) and placebo-treated, 3) sham-implanted and LPS-treated (400ng/kg of body weight) and 4) melatonin-implanted and LPS-treated. Under basal conditions, we observed weak expression of Tnf, low expression of Il1B, Il6 and Il1r2 and intermediate expression of other cytokines receptors. LPS treatment induced (P≤0.05) expression in all cytokines and their receptors, except Il6r 3h after the administration. Melatonin attenuated (P≤0.05) LPS-induced up-regulation of Il6 but had no effect on other cytokines and their receptors and up-regulated (P≤0.05) Rev.-erbα expression under basal conditions. This indicates that melatonin from slow-release implants suppresses TLR4-mediated Il6 expression in the ovine CP via a mechanism likely involving clock genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Novel oxytocin receptor variants in laboring women requiring high doses of oxytocin.

PubMed

Reinl, Erin L; Goodwin, Zane A; Raghuraman, Nandini; Lee, Grace Y; Jo, Erin Y; Gezahegn, Beakal M; Pillai, Meghan K; Cahill, Alison G; de Guzman Strong, Cristina; England, Sarah K

2017-08-01

Although oxytocin commonly is used to augment or induce labor, it is difficult to predict its effectiveness because oxytocin dose requirements vary significantly among women. One possibility is that women requiring high or low doses of oxytocin have variations in the oxytocin receptor gene. To identify oxytocin receptor gene variants in laboring women with low and high oxytocin dosage requirements. Term, nulliparous women requiring oxytocin doses of ≤4 mU/min (low-dose-requiring, n = 83) or ≥20 mU/min (high-dose-requiring, n = 104) for labor augmentation or induction provided consent to a postpartum blood draw as a source of genomic DNA. Targeted-amplicon sequencing (coverage >30×) with MiSeq (Illumina) was performed to discover variants in the coding exons of the oxytocin receptor gene. Baseline relevant clinical history, outcomes, demographics, and oxytocin receptor gene sequence variants and their allele frequencies were compared between low-dose-requiring and high-dose-requiring women. The Scale-Invariant Feature Transform algorithm was used to predict the effect of variants on oxytocin receptor function. The Fisher exact or χ 2 tests were used for categorical variables, and Student t tests or Wilcoxon rank sum tests were used for continuous variables. A P value < .05 was considered statistically significant. The high-dose-requiring women had greater rates of obesity and diabetes and were more likely to have undergone labor induction and required prostaglandins. High-dose-requiring women were more likely to undergo cesarean delivery for first-stage arrest and less likely to undergo cesarean delivery for nonreassuring fetal status. Targeted sequencing of the oxytocin receptor gene in the total cohort (n = 187) revealed 30 distinct coding variants: 17 nonsynonymous, 11 synonymous, and 2 small structural variants. One novel variant (A243T) was found in both the low- and high-dose-requiring groups. Three novel variants (Y106H, A240_A249del, and P197delfs*206) resulting in an amino acid substitution, loss of 9 amino acids, and a frameshift stop mutation, respectively, were identified only in low-dose-requiring women. Nine nonsynonymous variants were unique to the high-dose-requiring group. These included 3 known variants (R151C, G221S, and W228C) and 6 novel variants (M133V, R150L, H173R, A248V, G253R, and I266V). Of these, R150L, R151C, and H173R were predicted by Scale-Invariant Feature Transform algorithm to damage oxytocin receptor function. There was no statistically significant association between the numbers of synonymous and nonsynonymous substitutions in the patient groups. Obesity, diabetes, and labor induction were associated with the requirement for high doses of oxytocin. We did not identify significant differences in the prevalence of oxytocin receptor variants between low-dose-requiring and high-dose-requiring women, but novel oxytocin receptor variants were enriched in the high-dose-requiring women. We also found 3 oxytocin receptor variants (2 novel, 1 known) that were predicted to damage oxytocin receptor function and would likely increase an individual's risk for requiring a high oxytocin dose. Further investigation of oxytocin receptor variants and their effects on protein function will inform precision medicine in pregnant women. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Emerging Putative Associations between Non-Coding RNAs and Protein-Coding Genes in Neuropathic Pain: Added Value from Reusing Microarray Data

PubMed Central

Raju, Hemalatha B.; Tsinoremas, Nicholas F.; Capobianco, Enrico

2016-01-01

Regeneration of injured nerves is likely occurring in the peripheral nervous system, but not in the central nervous system. Although protein-coding gene expression has been assessed during nerve regeneration, little is currently known about the role of non-coding RNAs (ncRNAs). This leaves open questions about the potential effects of ncRNAs at transcriptome level. Due to the limited availability of human neuropathic pain (NP) data, we have identified the most comprehensive time-course gene expression profile referred to sciatic nerve (SN) injury and studied in a rat model using two neuronal tissues, namely dorsal root ganglion (DRG) and SN. We have developed a methodology to identify differentially expressed bioentities starting from microarray probes and repurposing them to annotate ncRNAs, while analyzing the expression profiles of protein-coding genes. The approach is designed to reuse microarray data and perform first profiling and then meta-analysis through three main steps. First, we used contextual analysis to identify what we considered putative or potential protein-coding targets for selected ncRNAs. Relevance was therefore assigned to differential expression of neighbor protein-coding genes, with neighborhood defined by a fixed genomic distance from long or antisense ncRNA loci, and of parental genes associated with pseudogenes. Second, connectivity among putative targets was used to build networks, in turn useful to conduct inference at interactomic scale. Last, network paths were annotated to assess relevance to NP. We found significant differential expression in long-intergenic ncRNAs (32 lincRNAs in SN and 8 in DRG), antisense RNA (31 asRNA in SN and 12 in DRG), and pseudogenes (456 in SN and 56 in DRG). In particular, contextual analysis centered on pseudogenes revealed some targets with known association to neurodegeneration and/or neurogenesis processes. While modules of the olfactory receptors were clearly identified in protein–protein interaction networks, other connectivity paths were identified between proteins already investigated in studies on disorders, such as Parkinson, Down syndrome, Huntington disease, and Alzheimer. Our findings suggest the importance of reusing gene expression data by meta-analysis approaches. PMID:27803687

Emerging Putative Associations between Non-Coding RNAs and Protein-Coding Genes in Neuropathic Pain: Added Value from Reusing Microarray Data.

PubMed

Raju, Hemalatha B; Tsinoremas, Nicholas F; Capobianco, Enrico

2016-01-01

Regeneration of injured nerves is likely occurring in the peripheral nervous system, but not in the central nervous system. Although protein-coding gene expression has been assessed during nerve regeneration, little is currently known about the role of non-coding RNAs (ncRNAs). This leaves open questions about the potential effects of ncRNAs at transcriptome level. Due to the limited availability of human neuropathic pain (NP) data, we have identified the most comprehensive time-course gene expression profile referred to sciatic nerve (SN) injury and studied in a rat model using two neuronal tissues, namely dorsal root ganglion (DRG) and SN. We have developed a methodology to identify differentially expressed bioentities starting from microarray probes and repurposing them to annotate ncRNAs, while analyzing the expression profiles of protein-coding genes. The approach is designed to reuse microarray data and perform first profiling and then meta-analysis through three main steps. First, we used contextual analysis to identify what we considered putative or potential protein-coding targets for selected ncRNAs. Relevance was therefore assigned to differential expression of neighbor protein-coding genes, with neighborhood defined by a fixed genomic distance from long or antisense ncRNA loci, and of parental genes associated with pseudogenes. Second, connectivity among putative targets was used to build networks, in turn useful to conduct inference at interactomic scale. Last, network paths were annotated to assess relevance to NP. We found significant differential expression in long-intergenic ncRNAs (32 lincRNAs in SN and 8 in DRG), antisense RNA (31 asRNA in SN and 12 in DRG), and pseudogenes (456 in SN and 56 in DRG). In particular, contextual analysis centered on pseudogenes revealed some targets with known association to neurodegeneration and/or neurogenesis processes. While modules of the olfactory receptors were clearly identified in protein-protein interaction networks, other connectivity paths were identified between proteins already investigated in studies on disorders, such as Parkinson, Down syndrome, Huntington disease, and Alzheimer. Our findings suggest the importance of reusing gene expression data by meta-analysis approaches.

The FKBP51-Glucocorticoid Receptor Balance in Stress-Related Mental Disorders.

PubMed

Fries, Gabriel R; Gassen, Nils C; Schmidt, Ulrike; Rein, Theo

2015-01-01

The immunophilin FK506 binding protein 51 (FKBP51) has emerged as one of the most intensely investigated proteins in stress-related mental disorders. It was originally characterized as Hsp90 cochaperone and part of the receptor-chaperone heterocomplex that governs the activity of steroid receptors. It turned out that the presence of FKBP51 in this heterocomplex leads to diminished activity of the corticosteroid receptors. In particular, based on its inhibitory action on the glucocorticoid receptor (GR), FKBP51 was included in a candidate gene approach to discover gene polymorphisms that might be relevant for the development and treatment of major depression. The discovery that polymorphisms in the gene coding for FKBP51 were linked to the treatment response of depressed patients intensified the research on the role of FKBP51 in stress-related diseases worldwide. It has become evident that FKBP51 is not only a regulator of GR action, but also a GR target. The function of this ultrashort intracellular feedback loop is critically important for cellular and physiological stress regulation as it does not only calibrate the function of GR, but also the levels of FKBP51. Given the pleiotropic functions of FKBP51, its levels might be equally important for mental disorders as GR function and hence for the development of potential FKBP51 drug targets.

Coding and small non-coding transcriptional landscape of tuberous sclerosis complex cortical tubers: implications for pathophysiology and treatment.

PubMed

Mills, James D; Iyer, Anand M; van Scheppingen, Jackelien; Bongaarts, Anika; Anink, Jasper J; Janssen, Bart; Zimmer, Till S; Spliet, Wim G; van Rijen, Peter C; Jansen, Floor E; Feucht, Martha; Hainfellner, Johannes A; Krsek, Pavel; Zamecnik, Josef; Kotulska, Katarzyna; Jozwiak, Sergiusz; Jansen, Anna; Lagae, Lieven; Curatolo, Paolo; Kwiatkowski, David J; Pasterkamp, R Jeroen; Senthilkumar, Ketharini; von Oerthel, Lars; Hoekman, Marco F; Gorter, Jan A; Crino, Peter B; Mühlebner, Angelika; Scicluna, Brendon P; Aronica, Eleonora

2017-08-14

Tuberous Sclerosis Complex (TSC) is a rare genetic disorder that results from a mutation in the TSC1 or TSC2 genes leading to constitutive activation of the mechanistic target of rapamycin complex 1 (mTORC1). TSC is associated with autism, intellectual disability and severe epilepsy. Cortical tubers are believed to represent the neuropathological substrates of these disabling manifestations in TSC. In the presented study we used high-throughput RNA sequencing in combination with systems-based computational approaches to investigate the complexity of the TSC molecular network. Overall we detected 438 differentially expressed genes and 991 differentially expressed small non-coding RNAs in cortical tubers compared to autopsy control brain tissue. We observed increased expression of genes associated with inflammatory, innate and adaptive immune responses. In contrast, we observed a down-regulation of genes associated with neurogenesis and glutamate receptor signaling. MicroRNAs represented the largest class of over-expressed small non-coding RNA species in tubers. In particular, our analysis revealed that the miR-34 family (including miR-34a, miR-34b and miR-34c) was significantly over-expressed. Functional studies demonstrated the ability of miR-34b to modulate neurite outgrowth in mouse primary hippocampal neuronal cultures. This study provides new insights into the TSC transcriptomic network along with the identification of potential new treatment targets.

High throughput mutagenesis for identification of residues regulating human prostacyclin (hIP) receptor expression and function.

PubMed

Bill, Anke; Rosethorne, Elizabeth M; Kent, Toby C; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P; Renaud, Nicole A; Charlton, Steven J; Gosling, Martin; Gaither, L Alex; Groot-Kormelink, Paul J

2014-01-01

The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.

High Throughput Mutagenesis for Identification of Residues Regulating Human Prostacyclin (hIP) Receptor Expression and Function

PubMed Central

Kent, Toby C.; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T.; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P.; Renaud, Nicole A.; Charlton, Steven J.; Gosling, Martin; Gaither, L. Alex; Groot-Kormelink, Paul J.

2014-01-01

The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs. PMID:24886841

Associations between Cytokine/Cytokine Receptor SNPs and Humoral Immunity to Measles, Mumps and Rubella in a Somali Population

PubMed Central

Dhiman, Neelam; Ovsyannikova, Inna G.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2008-01-01

We genotyped a Somali population (n=85; age ≤ 30 years) for 617 cytokine and cytokine receptor SNPs using Illumina GoldenGate genotyping to determine associations with measles, mumps and rubella immunity. Overall, sixty-one significant associations (p≤0.01) were found between SNPs belonging to cytokine receptor genes regulating Th1 (IL12RB2, IL2RA and B) and Th2 (IL4R, IL10RB) immunity, and cytokine (IL1B, TNFA, IL6 and IFNB1) and cytokine receptor (IL1RA, IFNAR2, IL18R1, TNFRSF1A and B) genes regulating innate immunity, and variations in antibody levels to measles, mumps or rubella. SNPs within two major inflammatory cytokine genes, TNFA and IL6, demonstrated associations with measles-specific antibodies. Specifically, the minor allele variant of rs1799964 (TNFA -1211 C>T) was associated with primarily seronegative values (median EIA index values ≤0.87; p=0.002; q=0.23) in response to measles disease and/or vaccination. A heterozygous variant CT for rs2069849 (IL6 +4272C>T; Phe201Phe) was also associated with seronegative values and a lower median level of antibody response to measles disease and/or vaccination (p=0.004; q=0.36) or measles vaccination alone (p=0.008). Several SNPs within the coding and regulatory regions of cytokine and cytokine receptor genes demonstrated associations with mumps and rubella antibody levels, but were less informative as strong LD patterns and lower frequencies for minor alleles were observed among these SNPs. Our study identifies specific SNPs in innate immune response genes that may play a role in modulating antibody responses to measles vaccination and/or infection in Somali subjects. PMID:18715339

Retinoic Acid-inducible Gene I-inducible miR-23b Inhibits Infections by Minor Group Rhinoviruses through Down-regulation of the Very Low Density Lipoprotein Receptor*

PubMed Central

Ouda, Ryota; Onomoto, Koji; Takahasi, Kiyohiro; Edwards, Michael R.; Kato, Hiroki; Yoneyama, Mitsutoshi; Fujita, Takashi

2011-01-01

In mammals, viral infections are detected by innate immune receptors, including Toll-like receptor and retinoic acid inducible gene I (RIG-I)-like receptor (RLR), which activate the type I interferon (IFN) system. IFN essentially activates genes encoding antiviral proteins that inhibit various steps of viral replication as well as facilitate the subsequent activation of acquired immune responses. In this study, we investigated the expression of non-coding RNA upon viral infection or RLR activation. Using a microarray, we identified several microRNAs (miRNA) specifically induced to express by RLR signaling. As suggested by Bioinformatics (miRBase Target Data base), one of the RLR-inducible miRNAs, miR-23b, actually knocked down the expression of very low density lipoprotein receptor (VLDLR) and LDLR-related protein 5 (LRP5). Transfection of miR-23b specifically inhibited infection of rhinovirus 1B (RV1B), which utilizes the low density lipoprotein receptor (LDLR) family for viral entry. Conversely, introduction of anti-miRNA-23b enhanced the viral yield. Knockdown experiments using small interfering RNA (siRNA) revealed that VLDLR, but not LRP5, is critical for an efficient infection by RV1B. Furthermore, experiments with the transfection of infectious viral RNA revealed that miR-23b did not affect post-entry viral replication. Our results strongly suggest that RIG-I signaling results in the inhibitions of infections of RV1B through the miR-23b-mediated down-regulation of its receptor VLDLR. PMID:21642441

Retinoic acid-inducible gene I-inducible miR-23b inhibits infections by minor group rhinoviruses through down-regulation of the very low density lipoprotein receptor.

PubMed

Ouda, Ryota; Onomoto, Koji; Takahasi, Kiyohiro; Edwards, Michael R; Kato, Hiroki; Yoneyama, Mitsutoshi; Fujita, Takashi

2011-07-22

In mammals, viral infections are detected by innate immune receptors, including Toll-like receptor and retinoic acid inducible gene I (RIG-I)-like receptor (RLR), which activate the type I interferon (IFN) system. IFN essentially activates genes encoding antiviral proteins that inhibit various steps of viral replication as well as facilitate the subsequent activation of acquired immune responses. In this study, we investigated the expression of non-coding RNA upon viral infection or RLR activation. Using a microarray, we identified several microRNAs (miRNA) specifically induced to express by RLR signaling. As suggested by Bioinformatics (miRBase Target Data base), one of the RLR-inducible miRNAs, miR-23b, actually knocked down the expression of very low density lipoprotein receptor (VLDLR) and LDLR-related protein 5 (LRP5). Transfection of miR-23b specifically inhibited infection of rhinovirus 1B (RV1B), which utilizes the low density lipoprotein receptor (LDLR) family for viral entry. Conversely, introduction of anti-miRNA-23b enhanced the viral yield. Knockdown experiments using small interfering RNA (siRNA) revealed that VLDLR, but not LRP5, is critical for an efficient infection by RV1B. Furthermore, experiments with the transfection of infectious viral RNA revealed that miR-23b did not affect post-entry viral replication. Our results strongly suggest that RIG-I signaling results in the inhibitions of infections of RV1B through the miR-23b-mediated down-regulation of its receptor VLDLR.

Detection of genetic diversity and selection at the coding region of the melanocortin receptor 1 (MC1R) gene in Tibetan pigs and Landrace pigs.

PubMed

Liu, Rui; Jin, Long; Long, Keren; Chai, Jie; Ma, Jideng; Tang, Qianzi; Tian, Shilin; Hu, Yaodong; Lin, Ling; Wang, Xun; Jiang, Anan; Li, Xuewei; Li, Mingzhou

2016-01-10

Domestication and subsequent selective pressures have produced a large variety of pig coat colors in different regions and breeds. The melanocortin 1 receptor (MC1R) gene plays a crucial role in determining coat color of mammals. Here, we investigated genetic diversity and selection at the coding region of the porcine melanocortin receptor 1 (MC1R) in Tibetan pigs and Landrace pigs. By contrast, genetic variability was much lower in Landrace pigs than in Tibetan pigs. Meanwhile, haplotype analysis showed that Tibetan pigs possessed shared haplotypes, suggesting a possibility of recent introgression event by way of crossbreeding with neighboring domestic pigs or shared ancestral polymorphism. Additionally, we detected positive selection at the MC1R in both Tibetan pigs and Landrace pigs through the dN/dS analysis. These findings suggested that novel phenotypic change (dark coat color) caused by novel mutations may help Tibetan pigs against intensive solar ultraviolet (UV) radiation and camouflage in wild environment, whereas white coat color in Landrace were intentionally selected by human after domestication. Furthermore, both the phylogenetic analysis and the network analysis provided clues that MC1R in Asian and European wild boars may have initially experienced different selective pressures, and MC1R alleles diversified in modern domesticated pigs. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic Variability of the Heme Uptake System among Different Strains of the Fish Pathogen Vibrio anguillarum: Identification of a New Heme Receptor

PubMed Central

Mouriño, Susana; Rodríguez-Ares, Isabel; Osorio, Carlos R.; Lemos, Manuel L.

2005-01-01

The ability to utilize heme compounds as iron sources was investigated in Vibrio anguillarum strains belonging to serotypes O1 to O10. All strains, regardless of their serotype or isolation origin could utilize hemin and hemoglobin as sole iron sources. Similarly, all of the isolates could bind hemin and Congo red, and this binding was mediated by cell envelope proteins. PCR and Southern hybridization were used to assay the occurrence of heme transport genes huvABCD, which have been previously described in serotype O1. Of 23 strains studied, two serotype O3 isolates proved negative for all huvABCD genes, whereas nine strains included in serotypes O2, O3, O4, O6, O7, and O10 tested negative for the outer membrane heme receptor gene huvA. A gene coding for a novel outer membrane heme receptor was cloned and characterized in a V. anguillarum serotype O3 strain lacking huvA. The new heme receptor, named HuvS, showed significant similarity to other outer membrane heme receptors described in Vibrionaceae, but little homology (39%) to HuvA. This heme receptor was present in 9 out of 11 of the V. anguillarum strains that tested negative for HuvA. Furthermore, complementation experiments demonstrated that HuvS could substitute for the HuvA function in Escherichia coli and V. anguillarum mutants. The huvS and huvA sequences alignment, as well as the analysis of their respective upstream and downstream DNA sequences, suggest that horizontal transfer and recombination might be responsible for generating this genetic diversity. PMID:16332832

Polymorphisms in the dopamine D4 receptor gene (DRD4) contribute to individual differences in human sexual behavior: desire, arousal and sexual function.

PubMed

Ben Zion, I Z; Tessler, R; Cohen, L; Lerer, E; Raz, Y; Bachner-Melman, R; Gritsenko, I; Nemanov, L; Zohar, A H; Belmaker, R H; Benjamin, J; Ebstein, R P

2006-08-01

Although there is some evidence from twin studies that individual differences in sexual behavior are heritable, little is known about the specific molecular genetic design of human sexuality. Recently, a specific dopamine D4 receptor (DRD4) agonist was shown in rats to induce penile erection through a central mechanism. These findings prompted us to examine possible association between the well-characterized DRD4 gene and core phenotypes of human sexual behavior that included desire, arousal and function in a group of 148 nonclinical university students. We observed association between the exon 3 repeat region, and the C-521T and C-616G promoter region SNPs, with scores on scales that measure human sexual behavior. The single most common DRD4 5-locus haplotype (19%) was significantly associated with Desire, Function and Arousal scores. The current results are consistent with animal studies that show a role for dopamine and specifically the DRD4 receptor in sexual behavior and suggest that one pathway by which individual variation in human desire, arousal and function are mediated is based on allelic variants coding for differences in DRD4 receptor gene expression and protein concentrations in key brain areas.

Genomic characterization and regulation of CYP3a13: role of xenobiotics and nuclear receptors.

PubMed

Anakk, Sayeepriyadarshini; Kalsotra, Auinash; Shen, Qi; Vu, Mary T; Staudinger, Jeffrey L; Davies, Peter J A; Strobel, Henry W

2003-09-01

We report that CYP3a13 gene, located on mouse chromosome 5, spans 27.5 Kb and contains 13 exons. The transcription start site is 35 bp upstream of the coding region and results in a 109 bp 5' untranslated region. CYP3a13 promoter shows putative binding sites for retinoid X receptor, pregnane X receptor, and estrogen receptor. CYP3a13 shows a broad tissue distribution with predominant expression in liver. Although CYP3a13 shares 92% nucleotide identity with the female-specific rat CYP3A9, its expression does not exhibit sexual dimorphism. Ligand activation of peroxisomal proliferator-activated receptor-gamma and retinoid X receptor inhibit expression of CYP3a13 at the transcription level in a tissue-specific manner. Another novel finding is hepatic induction of CYP3a13 by dexamethasone occurring only in pregnane X receptor null mice. We also report that pregnane X receptor is essential to maintain robust in vivo basal levels of CYP3a13 in contrast to CYP3a11. CYP3a13 protein expressed in vitro can metabolize clinically active drugs ethylmorphine and erythromycin, as well as benzphetamine. We conclude that CYP3a13 is regulated differentially by various nuclear receptors. In humans this may lead to altered drug metabolism, as many of the newly synthesized ligands/drugs targeted toward these nuclear receptors could influence CYP3A gene expression.

Mapping of the serotonin 5-HT{sub 1D{alpha}} autoreceptor gene (HTR1D) on chromosome 1 using a silent polymorphism in the coding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozaki, N.; Lappalainen, J.; Linnoila, M.

Serotonin (5-HT){sub ID} receptors are 5-HT release-regulating autoreceptors in the human brain. Abnormalities in brain 5-HT function have been hypothesized in the pathophysiology of various psychiatric disorders, including obsessive-compulsive disorder, autism, mood disorders, eating disorders, impulsive violent behavior, and alcoholism. Thus, mutations occurring in 5-HT autoreceptors may cause or increase the vulnerability to any of these conditions. 5-HT{sub 1D{alpha}} and 5-HT{sub 1D{Beta}} subtypes have been previously localized to chromosomes 1p36.3-p34.3 and 6q13, respectively, using rodent-human hybrids and in situ localization. In this communication, we report the detection of a 5-HT{sub 1D{alpha}} receptor gene polymorphism by single strand conformation polymorphism (SSCP)more » analysis of the coding sequence. The polymorphism was used for fine scale linkage mapping of 5-HT{sub 1D{alpha}} on chromosome 1. This polymorphism should also be useful for linkage studies in populations and in families. Our analysis also demonstrates that functionally significant coding sequence variants of the 5-HT{sub 1D{alpha}} are probably not abundant either among alcoholics or in the general population. 14 refs., 1 fig., 1 tab.« less

Examination of AVPR1a as an autism susceptibility gene.

PubMed

Wassink, T H; Piven, J; Vieland, V J; Pietila, J; Goedken, R J; Folstein, S E; Sheffield, V C

2004-10-01

Impaired reciprocal social interaction is one of the core features of autism. While its determinants are complex, one biomolecular pathway that clearly influences social behavior is the arginine-vasopressin (AVP) system. The behavioral effects of AVP are mediated through the AVP receptor 1a (AVPR1a), making the AVPR1a gene a reasonable candidate for autism susceptibility. We tested the gene's contribution to autism by screening its exons in 125 independent autistic probands and genotyping two promoter polymorphisms in 65 autism affected sibling pair (ASP) families. While we found no nonconservative coding sequence changes, we did identify evidence of linkage and of linkage disequilibrium. These results were most pronounced in a subset of the ASP families with relatively less severe impairment of language. Thus, though we did not demonstrate a disease-causing variant in the coding sequence, numerous nontraditional disease-causing genetic abnormalities are known to exist that would escape detection by traditional gene screening methods. Given the emerging biological, animal model, and now genetic data, AVPR1a and genes in the AVP system remain strong candidates for involvement in autism susceptibility and deserve continued scrutiny.

Molecular evolution of a chordate specific family of G protein-coupled receptors

PubMed Central

2011-01-01

Background Chordate evolution is a history of innovations that is marked by physical and behavioral specializations, which led to the development of a variety of forms from a single ancestral group. Among other important characteristics, vertebrates obtained a well developed brain, anterior sensory structures, a closed circulatory system and gills or lungs as blood oxygenation systems. The duplication of pre-existing genes had profound evolutionary implications for the developmental complexity in vertebrates, since mutations modifying the function of a duplicated protein can lead to novel functions, improving the evolutionary success. Results We analyzed here the evolution of the GPRC5 family of G protein-coupled receptors by comprehensive similarity searches and found that the receptors are only present in chordates and that the size of the receptor family expanded, likely due to genome duplication events in the early history of vertebrate evolution. We propose that a single GPRC5 receptor coding gene originated in a stem chordate ancestor and gave rise by duplication events to a gene family comprising three receptor types (GPRC5A-C) in vertebrates, and a fourth homologue present only in mammals (GPRC5D). Additional duplications of GPRC5B and GPRC5C sequences occurred in teleost fishes. The finding that the expression patterns of the receptors are evolutionarily conserved indicates an important biological function of these receptors. Moreover, we found that expression of GPRC5B is regulated by vitamin A in vivo, confirming previous findings that linked receptor expression to retinoic acid levels in tumor cell lines and strengthening the link between the receptor expression and the development of a complex nervous system in chordates, known to be dependent on retinoic acid signaling. Conclusions GPRC5 receptors, a class of G protein-coupled receptors with unique sequence characteristics, may represent a molecular novelty that helped non-chordates to become chordates. PMID:21827690

Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module

PubMed Central

Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan

2015-01-01

Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873

Sequence and expression analyses of porcine ISG15 and ISG43 genes.

PubMed

Huang, Jiangnan; Zhao, Shuhong; Zhu, Mengjin; Wu, Zhenfang; Yu, Mei

2009-08-01

The coding sequences of porcine interferon-stimulated gene 15 (ISG15) and the interferon-stimulated gene (ISG43) were cloned from swine spleen mRNA. The amino acid sequences deduced from porcine ISG15 and ISG43 genes coding sequence shared 24-75% and 29-83% similarity with ISG15s and ISG43s from other vertebrates, respectively. Structural analyses revealed that porcine ISG15 comprises two ubiquitin homologues motifs (UBQ) domain and a conserved C-terminal LRLRGG conjugating motif. Porcine ISG43 contains an ubiquitin-processing proteases-like domain. Phylogenetic analyses showed that porcine ISG15 and ISG43 were mostly related to rat ISG15 and cattle ISG43, respectively. Using quantitative real-time PCR assay, significant increased expression levels of porcine ISG15 and ISG43 genes were detected in porcine kidney endothelial cells (PK15) cells treated with poly I:C. We also observed the enhanced mRNA expression of three members of dsRNA pattern-recognition receptors (PRR), TLR3, DDX58 and IFIH1, which have been reported to act as critical receptors in inducing the mRNA expression of ISG15 and ISG43 genes. However, we did not detect any induced mRNA expression of IFNalpha and IFNbeta, suggesting that transcriptional activations of ISG15 and ISG43 were mediated through IFN-independent signaling pathway in the poly I:C treated PK15 cells. Association analyses in a Landrace pig population revealed that ISG15 c.347T>C (BstUI) polymorphism and the ISG43 c.953T>G (BccI) polymorphism were significantly associated with hematological parameters and immune-related traits.

Variations in endothelin receptor B subtype 2 (EDNRB2) coding sequences and mRNA expression levels in 4 Muscovy duck plumage colour phenotypes.

PubMed

Wu, N; Qin, H; Wang, M; Bian, Y; Dong, B; Sun, G; Zhao, W; Chang, G; Xu, Q; Chen, G

2017-04-01

1. Endothelin receptor B subtype 2 (EDNRB2) is a paralog of EDNRB, which encodes a 7-transmembrane G-protein coupled receptor. Previous studies reported that EDNRB was essential for melanoblast migration in mammals and ducks. 2. Muscovy ducks have different plumage colour phenotypes. Variations in EDNRB2 coding sequences (CDSs) and mRNA expression levels were investigated in 4 different Muscovy duck plumage colour phenotypes, including black, black mutant, silver and white head. 3. The EDNRB2 gene from Muscovy duck was cloned; it had a length of 6435 bp and encoded 437 amino acids. The coding region was screened and potential single nucleotide polymorphisms were identified. Eight mutations were obtained, including one missense variant (c.64C > T) and 7 synonymous substitutions. The substitutions were associated with plumage colour phenotypes. 4. The EDNRB2 mRNA expression levels were compared between feather pulp from black birds and black mutant birds. The results indicated that EDNRB2 transcripts in feather pulp were significantly higher in black feathers than in white feathers. 5. The results determined the variation of EDNRB2 CDS and mRNA expression in Muscovy ducks of various plumage colours.

Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

1996-04-09

Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

Sequence analysis of the Ras-MAPK pathway genes SOS1, EGFR & GRB2 in silver foxes (Vulpes vulpes): candidate genes for hereditary hyperplastic gingivitis.

PubMed

Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H

2014-12-01

Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection.

Identification of Complete Repertoire of Apis florea Odorant Receptors Reveals Complex Orthologous Relationships with Apis mellifera

PubMed Central

Karpe, Snehal D.; Jain, Rikesh; Brockmann, Axel; Sowdhamini, Ramanathan

2016-01-01

Abstract We developed a computational pipeline for homology based identification of the complete repertoire of olfactory receptor (OR) genes in the Asian honey bee species, Apis florea. Apis florea is phylogenetically the most basal honey bee species and also the most distant sister species to the Western honey bee Apis mellifera, for which all OR genes had been identified before. Using our pipeline, we identified 180 OR genes in A. florea, which is very similar to the number of ORs identified in A. mellifera (177 ORs). Many characteristics of the ORs including gene structure, synteny of tandemly repeated ORs and basic phylogenetic clustering are highly conserved. The composite phylogenetic tree of A. florea and A. mellifera ORs could be divided into 21 clades which are in harmony with the existing Hymenopteran tree. However, we found a few nonorthologous OR relationships between both species as well as independent pseudogenization of ORs suggesting separate evolutionary changes. Particularly, a subgroup of the OR gene clade XI, which had been hypothesized to code cuticular hydrocarbon receptors showed a high number of species-specific ORs. RNAseq analysis detected a total number of 145 OR transcripts in male and 162 in female antennae. Most of the OR genes were highly expressed on the female antennae. However, we detected five distinct male-biased OR genes, out of which three genes (AfOr11, AfOr18, AfOr170P) were shown to be male-biased in A. mellifera, too, thus corroborating a behavioral function in sex-pheromone communication. PMID:27540087

Effects of prenatal stress and monoaminergic perturbations on the expression of serotonin 5-HT₄ and adrenergic β₂ receptors in the embryonic mouse telencephalon.

PubMed

Chen, Angela; Kelley, Lauren D S; Janušonis, Skirmantas

2012-06-12

The serotonin 5-HT(4) receptor (5-HT(4)R) is coded by a complex gene that produces four mRNA splice variants in mice (5-HT(4(a))R, 5-HT(4(b))R, 5-HT(4(e))R, 5-HT(4(f))R). This receptor has highly dynamic expression in brain development and its splice variants differ in their developmental trajectories. Since 5-HT(4)Rs are important in forebrain function (including forebrain control of serotonergic activity in the brainstem), we investigated the susceptibility of 5-HT(4)R expression in the mouse embryonic telencephalon to prenatal maternal stress and altered serotonin (5-hydroxytryptamine, 5-HT) levels. Because the gene coding the adrenergic β(2) receptor (β(2)AR) is embedded in the 5-HT(4)R gene, we also investigated whether 5-HT(4)R mRNA levels were modulated by selective β(2)AR agents. Timed-pregnant C57BL/6 mice were treated beginning at embryonic day (E) 14 and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was used to assess the mRNA levels of all 5-HT(4)R splice variants and β(2)AR in the embryonic telencephalon at E17. Maternal prenatal stress and 5-HT depletion with pCPA, a tryptophan hydroxylase inhibitor, reduced the levels of the 5-HT(4(b))R splice variant. Terbutaline (a selective β(2)AR agonist) and ICI 118,551 (a selective β(2)AR antagonist) had no effect on β(2)AR and 5-HT(4)R mRNA levels. These results show that prenatal stress and reduced 5-HT levels can alter 5-HT(4)R expression in the developing forebrain and that some 5-HT(4)R splice variants may be more susceptible than others. Copyright © 2012 Elsevier B.V. All rights reserved.

Endothelin Receptor B2 (EDNRB2) Gene Is Associated with Spot Plumage Pattern in Domestic Ducks (Anas platyrhynchos)

PubMed Central

Li, Ling; Li, Dan; Liu, Li; Li, Shijun; Feng, Yanping; Peng, Xiuli; Gong, Yanzhang

2015-01-01

Endothelin receptor B subtype 2 (EDNRB2) is a seven-transmembrane G-protein coupled receptor. In this study, we investigated EDNRB2 gene as a candidate gene for duck spot plumage pattern according to studies of chicken and Japanese quail. The entire coding region was cloned by the reverse transcription polymerase chain reaction (RT-PCR). Sequence analysis showed that duck EDNRB2 cDNA contained a 1311bp open reading frame and encoded a putative protein of 436 amino acids residues. The transcript shared 89%-90% identity with the counterparts in other avian species. A phylogenetic tree based on amino acid sequences showed that duck EDNRB2 was evolutionary conserved in avian clade. The entire coding region of EDNRB2 were sequenced in 20 spot and 20 non-spot ducks, and 13 SNPs were identified. Two of them (c.940G>A and c.995G>A) were non-synonymous substitutions, and were genotyped in 647 ducks representing non-spot and spot phenotypes. The c.995G>A mutation, which results in the amino acid substitution of Arg332His, was completely associated with the spot phenotype: all 152 spot ducks were carriers of the AA genotype and the other 495 individuals with non-spot phenotype were carriers of GA or GG genotype, respectively. Segregation in 17 GA×GG and 22 GA×GA testing combinations confirmed this association since the segregation ratios and genotypes of the offspring were in agreement with the hypothesis. In order to investigate the underlying mechanism of the spot phenotype, MITF gene was used as cell type marker of melanocyte progenitor cells while TYR and TYRP1 gene were used as cell type markers of mature melanocytes. Transcripts of MITF, TYR and TYRP1 gene with expected size were identified in all pigmented skin tissues while PCR products were not obtained from non-pigmented skin tissues. It was inferred that melanocytes are absent in non-pigmented skin tissues of spot ducks. PMID:25955279

Identification of a novel aminergic-like G protein-coupled receptor in the cnidarian Renilla koellikeri.

PubMed

Bouchard, Christelle; Ribeiro, Paula; Dubé, François; Demers, Christian; Anctil, Michel

2004-10-27

Biogenic amines exert various physiological effects in cnidarians, but the receptors involved in these responses are not known. We have cloned a novel G protein-coupled receptor cDNA from an anthozoan, the sea pansy Renilla koellikeri, that shows homology to mammalian catecholamine receptors and, to a lesser extent, to peptidergic receptors. This putative receptor, named Ren2, has a DRC pattern that replaces the well-conserved DRY motif on the cytoplasmic side of the transmembrane III and lacks the cysteine residues usually found in the second extracellular loop and C-terminus tail. Both the second extracellular loop and the N-terminal tail were seen to be short (six and three amino acids, respectively). Northern blot analysis suggests that the receptor gene codes for two transcripts. Localization of these transcripts by in situ hybridization demonstrated abundant expression in the epithelium of the pharyngeal wall, the oral disk and tentacles as well as in the endodermal epithelium lining the gastrovascular cavities.

Identification of Putative Olfactory Genes from the Oriental Fruit Moth Grapholita molesta via an Antennal Transcriptome Analysis

PubMed Central

Li, Yiping; Wu, Junxiang

2015-01-01

Background The oriental fruit moth, Grapholita molesta, is an extremely important oligophagous pest species of stone and pome fruits throughout the world. As a host-switching species, adult moths, especially females, depend on olfactory cues to a large extent in locating host plants, finding mates, and selecting oviposition sites. The identification of olfactory genes can facilitate investigation on mechanisms for chemical communications. Methodology/Principal Finding We generated transcriptome of female antennae of G.molesta using the next-generation sequencing technique, and assembled transcripts from RNA-seq reads using Trinity, SOAPdenovo-trans and Abyss-trans assemblers. We identified 124 putative olfactory genes. Among the identified olfactory genes, 118 were novel to this species, including 28 transcripts encoding for odorant binding proteins, 17 chemosensory proteins, 48 odorant receptors, four gustatory receptors, 24 ionotropic receptors, two sensory neuron membrane proteins, and one odor degrading enzyme. The identified genes were further confirmed through semi-quantitative reverse transcription PCR for transcripts coding for 26 OBPs and 17 CSPs. OBP transcripts showed an obvious antenna bias, whereas CSP transcripts were detected in different tissues. Conclusion Antennal transcriptome data derived from the oriental fruit moth constituted an abundant molecular resource for the identification of genes potentially involved in the olfaction process of the species. This study provides a foundation for future research on the molecules involved in olfactory recognition of this insect pest, and in particular, the feasibility of using semiochemicals to control this pest. PMID:26540284

A Comprehensive Pan-Cancer Molecular Study of Gynecologic and Breast Cancers. | Office of Cancer Genomics

Cancer.gov

We analyzed molecular data on 2,579 tumors from The Cancer Genome Atlas (TCGA) of four gynecological types plus breast. Our aims were to identify shared and unique molecular features, clinically significant subtypes, and potential therapeutic targets. We found 61 somatic copy-number alterations (SCNAs) and 46 significantly mutated genes (SMGs). Eleven SCNAs and 11 SMGs had not been identified in previous TCGA studies of the individual tumor types. We found functionally significant estrogen receptor-regulated long non-coding RNAs (lncRNAs) and gene/lncRNA interaction networks.

Genetic variants of adiponectin receptor 2 are associated with increased adiponectin levels and decreased triglyceride/VLDL levels in patients with metabolic syndrome.

PubMed

Broedl, Uli C; Lehrke, Michael; Fleischer-Brielmaier, Elisabeth; Tietz, Anne B; Nagel, Jutta M; Göke, Burkhard; Lohse, Peter; Parhofer, Klaus G

2006-05-15

Adiponectin acts as an antidiabetic, antiinflammatory and antiatherogenic adipokine. These effects are assumed to be mediated by the recently discovered adiponectin receptors AdipoR1 and AdipoR2. The purpose of this study was to determine whether variations in the AdipoR1 and AdipoR2 genes may contribute to insulin resistance, dyslipidemia and inflammation. We sequenced all seven coding exons of both genes in 20 unrelated German subjects with metabolic syndrome and tested genetic variants for association with glucose, lipid and inflammatory parameters. We identified three AdipoR2 variants (+795G/A, +870C/A and +963C/T) in perfect linkage disequilibrium (r2 = 1) with a minor allele frequency of 0.125. This haplotype was associated with higher plasma adiponectin levels and decreased fasting triglyceride, VLDL-triglyceride and VLDL-cholesterol levels. No association, however, was observed between the AdipoR2 SNP cluster and glucose metabolism. To our knowledge, this is the first study to identify an association between genetic variants of the adiponectin receptor genes and plasma adiponectin levels. Furthermore, our data suggest that AdipoR2 may play an important role in triglyceride/VLDL metabolism.

Nuclear export of RNA: Different sizes, shapes and functions.

PubMed

Williams, Tobias; Ngo, Linh H; Wickramasinghe, Vihandha O

2018-03-01

Export of protein-coding and non-coding RNA molecules from the nucleus to the cytoplasm is critical for gene expression. This necessitates the continuous transport of RNA species of different size, shape and function through nuclear pore complexes via export receptors and adaptor proteins. Here, we provide an overview of the major RNA export pathways in humans, highlighting the similarities and differences between each. Its importance is underscored by the growing appreciation that deregulation of RNA export pathways is associated with human diseases like cancer. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Distortion of maternal-fetal angiotensin II type 1 receptor allele transmission in pre-eclampsia.

PubMed Central

Morgan, L; Crawshaw, S; Baker, P N; Brookfield, J F; Broughton Pipkin, F; Kalsheker, N

1998-01-01

OBJECTIVE: To investigate the fetal angiotensin II type 1 receptor genotype in pre-eclampsia. DESIGN: Case-control study. POPULATION: Forty-one maternal-fetal pairs from pre-eclamptic pregnancies and 80 maternal-fetal pairs from normotensive pregnancies. METHODS: Maternal and fetal DNA was genotyped at three diallelic polymorphisms, at nucleotides 573, 1062, and 1166, in the coding exon of the angiotensin II type 1 receptor gene, and at a dinucleotide repeat polymorphism in its 3' flanking region. RESULTS: Allele and genotype frequencies at the four polymorphic regions investigated did not differ between pre-eclamptic and normotensive groups, in either fetal or maternal samples. Mothers heterozygous for the dinucleotide repeat allele designated A4 transmitted this allele to the fetus in 15 of 18 informative pre-eclamptic pregnancies and in eight of 26 normotensive pregnancies. This was greater than the expected probability in pre-eclamptic pregnancies (p=0.04) and less than expected in normotensive pregnancies (p<0.005). The 573T variant, which is in partial linkage disequilibrium with the A4 allele, showed a similar distortion of maternal-fetal transmission. CONCLUSION: Angiotensin II type 1 receptor gene expression in the fetus may contribute to the aetiology of pre-eclampsia. It is unclear whether susceptibility is conferred by the fetal genotype acting alone, or by allele sharing by mother and fetus. Possible mechanisms for the effect of the angiotensin II type 1 receptor gene are suggested by the association of the 573T variant with low levels of surface receptor expression on platelets. If receptor expression is similarly genetically determined in the placenta, responsiveness to angiotensin II may be affected, with the potential to influence placentation or placental prostaglandin secretion. PMID:9719367

Downregulation of cell surface molecules during noncytopathic infection of T cells with human immunodeficiency virus.

PubMed Central

Stevenson, M; Zhang, X H; Volsky, D J

1987-01-01

Noncytopathic infection of human T-lymphoid cell line CR-10 with human immunodeficiency virus (HIV) (CEM-N1T isolate) resulted in a gradual loss of cell surface receptors for OKT4/OKT4A (HIV receptor), OKT8, OKT3, and OKT11 but not for OKT9 (transferrin receptor) within 10 days after infection. Surface receptor decline was accompanied by a rapid increase in HIV antigens and mRNA expression. Multireceptor downregulation was also observed in three T-lymphoid cell lines (MT-4, CEM, and HBD-1) cytopathically infected with the HIV/N1T virus and in HUT-78 cells infected with the HIV/SF-2 isolate. HIV-infected and uninfected CR-10 cells contained similar levels of mRNAs coding for T3, T8, T9, T11, HLA-A2, and HLA-B7 proteins. By densitometry, fully infected CR-10 cells showed approximately 75% reduction in T4 and tubulin (beta chain) mRNA levels when compared with uninfected CR-10 cells. No such reduction was detected in HIV-infected MT-4 and HBD-1 cells. A T-cell receptor gene (beta chain) rearrangement study revealed that no distinct CR-10 subpopulation was selected out upon infection with HIV. Our results suggest that the reduction in cell surface receptors observed between 1 and 2 weeks postinfection cannot be directly attributed to similar reductions in mRNA levels coding for these receptor proteins. We conclude that HIV infection induces posttranscriptional downregulation of several T-cell surface receptors. Images PMID:3500327

Identification of a second murine interleukin-11 receptor alpha-chain gene (IL11Ra2) with a restricted pattern of expression.

PubMed

Robb, L; Hilton, D J; Brook-Carter, P T; Begley, C G

1997-03-15

The interleukin-11 receptor alpha-chain, a member of the hematopoietin receptor superfamily, forms, together with gp130, a functional high-affinity receptor complex for interleukin 11. We, and others, reported the cloning of the murine interleukin 11 receptor alpha-chain cDNA (IL11Ra) and recently described the structure of the IL11Ra locus. We also described the presence of a second IL11Ra-like locus in some mouse strains. In this study we report that the second locus, designated IL11Ra2, encodes an mRNA species. The transcript was 99% identical to the IL11Ra transcript in the coding and 3'-untranslated region, but had a different 5'-untranslated region. The complete genomic organization of the IL11Ra2 locus is presented, and the two loci are shown to be located on a 200-kb NaeI genomic fragment. Comparison of the expression pattern of the IL11Ra and IL11Ra2 genes using an RT-PCR restriction fragment length polymorphism strategy revealed that while the expression of IL11Ra was widespread, expression of IL11Ra2 was restricted to testis, lymph node, and thymus.

Gene-specific cell labeling using MiMIC transposons

PubMed Central

Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.

2015-01-01

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101

Human homolog of the mouse sperm receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chamberlin, M.E.; Dean, J.

1990-08-01

The human zona pellucida, composed of three glycoproteins (ZP1, ZP2, and ZP3), forms an extracellular matrix that surrounds ovulated eggs and mediates species-specific fertilization. The genes that code for at least two of the zona proteins (ZP2 and ZP3) cross-hybridize with other mammalian DNA. The recently characterized mouse sperm receptor gene (Zp-3) was used to isolate its human homolog. The human homolog spans {approx}18.3 kilobase pairs (kbp) (compared to 8.6 kbp for the mouse gene) and contains eight exons, the sizes of which are strictly conserved between the two species. Four short (8-15 bp) sequences within the first 250 bpmore » of the 5{prime} flanking region in the human Zp-3 homolog are also present upstream of mouse Zp-3. These elements may modulate oocyte-specific gene expression. By using the polymerase chain reaction, a full-length cDNA of human ZP3 was isolated from human ovarian poly(A){sup +} RNA and used to deduce the structure of human ZP3 mRNA. Certain features of the human and mouse ZP3 transcripts are conserved. Both have unusually short 5{prime} and 3{prime} untranslated regions, both contain a single open reading frame that is 74% identical, and both code for 424 amino acid polypeptides that are 67% the same. The similarity between the two proteins may define domains that are important in maintaining the structural integrity of the zona pellucida, while the differences may play a role in mediating the species-specific events of mammalian fertilization.« less

Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly.

PubMed

Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama

2015-01-01

Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.

Evolution of an Expanded Mannose Receptor Gene Family

PubMed Central

Staines, Karen; Hunt, Lawrence G.; Young, John R.; Butter, Colin

2014-01-01

Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens. PMID:25390371

GABA-A receptor beta3 and alpha5 subunit gene cluster on chromosome 15q11-q13 and bipolar disorder: a genetic association study.

PubMed

Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Stefanis, C N

2001-05-08

There is accumulated evidence that the genes coding for the receptor of gamma aminobutyric acid (GABA), the most important inhibitory neurotransmitter in the CNS, may be involved in the pathogenesis of affective disorders. In a previous study, we have found a genetic association between the GABA-A receptor alpha5 subunit gene locus (GABRA5) on chromosome 15q11-of 13 and bipolar affective disorder. The aim of the present study was to examine the same subjects to see if there exists a genetic association between bipolar affective disorder and the GABA receptor beta3 subunit gene (GABRB3), which is located within 100 kb from GABRA5. The sample consisted of 48 bipolar patients compared to 44 controls (blood donors). All subjects were Greek, unrelated, and personally interviewed. Diagnosis was based on DSM-IV and ICD-10 criteria. The marker used was a dinucleotide (CA) repeat polymorphism with 12 alleles 179 to 201 bp long; genotyping was successful in all patients and 43 controls. The distribution of GABRB3 genotypes among the controls did not deviate significantly from the Hardy-Weinberg equilibrium. No differences in allelic frequencies between bipolar patients and controls were found for GABRB3, while this locus and GABRA5 did not seem to be in significant linkage disequilibrium. In conclusion, the GABRB3 CA-repeat polymorphism we investigated does not present the observed association between bipolar affective illness and GABRA5. This could be due to higher mutation rate in the GABRB3 CA-repeat polymorphism, but it might also signify that GABRA5 is the gene actually associated with the disease. Copyright 2001 Wiley-Liss, Inc.

Identification of a cys-ser substitution in the 5-HT{sub 2C} (HTR2C) receptor gene and allelic association to violent behavior and alcoholism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lappalainen, J.; Ozaki, N.; Goldman, D.

1994-09-01

Several lines of evidence suggest that brain serotonergic functions, including behavioral and neurochemical responses to 5-HT{sub 2C} agonist, are abnormal in some individuals with alcoholism and aggressive behaviors. The aim of the present study was to identify coding sequence variants in the human 5-HT{sub 2C} receptor gene which may cause abnormal or variant function of this receptor. Using SSCP analysis, a non-conservative cys-ser substitution was found in the 5-HT{sub 2C} receptor (designated 5-HT{sub 2Ccys} and 5-HT{sub 2Cser}). The polymorphism was typed in CEPH families to genetically map the gene. To test for association of the variant to alcoholism, violent behaviormore » and serotonin function, the 5-HT{sub 2C} genotypes of 151 non-related Finnish male alcoholic violent offenders and impulsive fire setters and 127 Finnish psychiatrically interviewed healthy male volunteers were determined. CSF 5-HIAA concentrations were available for 74 alcoholic violent offenders and 25 healthy volunteers. Linkage analysis placed the 5-HT{sub 2C} gene on Xq21, a region that has been previously shown to contain genes for several mental retardation syndromes. The 5-HT{sub 2Ccys}/5-HT{sub 2Cser} genotype frequencies in alcoholic violent offenders and controls differed significantly (0.90/0.10 and 0.82/0.18, respectively, P=0.048). The association was found to be strongest in the violent offenders who did not fulfill the criteria for antisocial personality disorder (5-HT{sub 2Ccys}/5-HT{sub 2Cser} 0.93/0.07, p=0.021). No association was found between CSF 5-HIAA concentrations and 5-HT{sub 2C} genotype. These results implicate a 5-HT{sub 2C} receptor amino acid substitution in predisposition to alcohol abuse and violent behavior in a subgroup of alcoholics.« less

AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages.

PubMed

Kemmerer, Marina; Finkernagel, Florian; Cavalcante, Marcela Frota; Abdalla, Dulcineia Saes Parra; Müller, Rolf; Brüne, Bernhard; Namgaladze, Dmitry

2015-01-01

AMP-activated protein kinase (AMPK) maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO). The transcription factor peroxisome proliferator-activated receptor δ (PPARδ) also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL)-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload.

AMP-Activated Protein Kinase Interacts with the Peroxisome Proliferator-Activated Receptor Delta to Induce Genes Affecting Fatty Acid Oxidation in Human Macrophages

PubMed Central

Kemmerer, Marina; Finkernagel, Florian; Cavalcante, Marcela Frota; Abdalla, Dulcineia Saes Parra; Müller, Rolf; Brüne, Bernhard; Namgaladze, Dmitry

2015-01-01

AMP-activated protein kinase (AMPK) maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO). The transcription factor peroxisome proliferator-activated receptor δ (PPARδ) also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL)-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload. PMID:26098914

ADRA1A gene is associated with BMI in chronic schizophrenia patients exposed to antipsychotics.

PubMed

Liu, Y-R; Loh, E-W; Lan, T-H; Chen, S-F; Yu, Y-H; Chang, Y-H; Huang, C-J; Hu, T-M; Lin, K-M; Yao, Y-T; Chiu, H-J

2010-02-01

Noradrenaline and adrenaline are neurotransmitters of the sympathetic nervous system that interact with various adrenergic receptor (ADR) subtypes, and this regulates the basal metabolic rate, thermogenesis and efficiency of energy utilization. We examined a possible role of the gene coding for ADRA1A receptor in weight gain in schizophrenia subjects exposed to antipsychotics. A total of 401 schizophrenia in-patients treated with antipsychotics for >2 years were recruited and a final 394 DNA samples were genotyped. Their body mass indexes (BMIs) were recorded for 12 months and parameterized to be correlated in regression. Among the 58 single-nucleotide polymorphisms (SNPs) genotyped, 44 valid SNPs, which had minor allele frequency > or =0.03, were analyzed in statistics. Linear regression model with age, gender, diabetes, use of typical antipsychotics and use of atypical antipsychotics as covariates, with or without gender interaction, showed evidence of associations between the ADRA1A gene and BMI. Most of the SNPs associated with BMI are located in the promoter and intron regions, and being female appeared to enhance the gene effect. Our study suggests that the ADRA1A gene is involved in weight gain among schizophrenia patients treated with antipsychotics. Further molecular dissection of the ADRA1A gene warrants better understanding on weight gain mechanisms in schizophrenia.

Investigation of genes coding for inflammatory components in Parkinson's disease.

PubMed

Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans

2005-05-01

Several findings obtained recently indicate that inflammation may contribute to the pathogenesis in Parkinson's disease (PD). Genetic variants of genes coding for components involved in immune reactions in the brain might therefore influence the risk of developing PD or the age of disease onset. Five single nucleotide polymorphisms (SNPs) in the genes coding for interferon-gamma (IFN-gamma; T874A in intron 1), interferon-gamma receptor 2 (IFN-gamma R2; Gln64Arg), interleukin-10 (IL-10; G1082A in the promoter region), platelet-activating factor acetylhydrolase (PAF-AH; Val379Ala), and intercellular adhesion molecule 1 (ICAM-1; Lys469Glu) were genotyped, using pyrosequencing, in 265 patients with PD and 308 controls. None of the investigated SNPs was found to be associated with PD; however, the G1082A polymorphism in the IL-10 gene promoter was found to be related to the age of disease onset. Linear regression showed a significantly earlier onset with more A-alleles (P = 0.0095; after Bonferroni correction, P = 0.048), resulting in a 5-year delayed age of onset of the disease for individuals having two G-alleles compared with individuals having two A-alleles. The results indicate that the IL-10 G1082A SNP could possibly be related to the age of onset of PD. Copyright 2005 Movement Disorder Society.

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

PubMed Central

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

PubMed

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

What is special about the adolescent (JME) brain?

PubMed

Craiu, Dana

2013-07-01

Juvenile myoclonic epilepsy (JME) involves cortico-thalamo-cortical networks. Thalamic, frontal gray matter, connectivity, and neurotransmitter disturbances have been demonstrated by structural/functional imaging studies. Few patients with JME show mutations in genes coding ion channels or GABAA (gamma-aminobutyric acid) receptor subunits. Recent research points to EFHC1 gene mutations leading to microdysgenesis and possible aberrant circuitry. Imaging studies have shown massive structural/functional changes of normally developing adolescent brain structures maturing at strikingly different rates and times. Gray matter (GM) volume diminishes in cortical areas (frontal and parietal) and deep structures (anterior thalamus, putamen, and caudate). Diffusion tensor imaging (DTI) findings support continued microstructural change in WM (white matter) during late adolescence with robust developmental changes in thalamocortical connectivity. The GABAA receptor distribution and specific receptor subunits' expression patterns change with age from neonate to adolescent/adult, contributing to age-related changes in brain excitability. Hormonal influence on brain structure development during adolescence is presented. Possible implications of brain changes during adolescence on the course of JME are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

Lack of association between sigma receptor gene variants and schizophrenia.

PubMed

Satoh, Fumiaki; Miyatake, Ryosuke; Furukawa, Aizo; Suwaki, Hiroshi

2004-08-01

Several pharmacological studies suggest the possible involvement of sigma(1) receptors in the pathogenesis of schizophrenia. An association has been reported between schizophrenia and two variants (GC-241-240TT and Gln2Pro) in the sigma(1) receptor gene (SIGMAR1). We also previously reported that, along with T-485 A, these two variants alter SIGMAR1 function. To investigate the role of SIGMAR1 in conveying susceptibility to schizophrenia, we performed a case-control study. We initially screened for polymorphisms in the SIGMAR1 coding region using PCR-single strand conformation polymorphism analysis. The distribution of SIGMAR1 polymorphisms was analyzed in 100 schizophrenic and 104 control subjects. A novel G620A variant was detected in exon4. G620A was predicted to alter the amino acid represented by codon 211 from arginine to glutamine. Our case-control study showed no significant association between the T-485 A, GC-241-240TT, Gln2Pro, and G620A (Arg211Gln) variants and schizophrenia and clinical characteristics. These findings suggest that these SIGMAR1 variants may not affect susceptibility to schizophrenia.

Sequence of the fhuE outer-membrane receptor gene of Escherichia coli K12 and properties of mutants.

PubMed

Sauer, M; Hantke, K; Braun, V

1990-03-01

The fhuE gene of Escherichia coli codes for an outer-membrane receptor protein required for the uptake of iron(III) via coprogen, ferrioxamine B and rhodotorulic acid. The amino acid sequence, deduced from the nucleotide sequence, consisted of 729 residues. The mature form, composed of 693 residues, has a calculated molecular weight of 77,453, which agrees with the molecular weight of 76,000 determined by polyacrylamide gel electrophoresis. The FhuE protein contains four regions of homology with other TonB-dependent receptors. A valine to proline exchange in the 'TonB box' abolished transport activity. Phenotypic revertants with substitutions of arginine, glutamine, or leucine at the valine position exhibited increasing iron-coprogen transport rates. Point mutations resulting in the replacement of glycine (127) in the second homology region with either alanine, aspartate, valine, asparagine or histidine exhibited decreased transport rates (listed in descending order). A truncated FhuE protein lacking 24 amino acids at the C-terminal end was exported to the periplasm but failed to be inserted into the outer membrane.

Functional non-coding polymorphism in an EPHA2 promoter PAX2 binding site modifies expression and alters the MAPK and AKT pathways.

PubMed

Ma, Xiaoyin; Ma, Zhiwei; Jiao, Xiaodong; Hejtmancik, J Fielding

2017-08-30

To identify possible genetic variants influencing expression of EPHA2 (Ephrin-receptor Type-A2), a tyrosine kinase receptor that has been shown to be important for lens development and to contribute to both congenital and age related cataract when mutated, the extended promoter region of EPHA2 was screened for variants. SNP rs6603883 lies in a PAX2 binding site in the EPHA2 promoter region. The C (minor) allele decreased EPHA2 transcriptional activity relative to the T allele by reducing the binding affinity of PAX2. Knockdown of PAX2 in human lens epithelial (HLE) cells decreased endogenous expression of EPHA2. Whole RNA sequencing showed that extracellular matrix (ECM), MAPK-AKT signaling pathways and cytoskeleton related genes were dysregulated in EPHA2 knockdown HLE cells. Taken together, these results indicate a functional non-coding SNP in EPHA2 promoter affects PAX2 binding and reduces EPHA2 expression. They further suggest that decreasing EPHA2 levels alters MAPK, AKT signaling pathways and ECM and cytoskeletal genes in lens cells that could contribute to cataract. These results demonstrate a direct role for PAX2 in EPHA2 expression and help delineate the role of EPHA2 in development and homeostasis required for lens transparency.

Cloning and characterization of the mouse alpha1C/A-adrenergic receptor gene and analysis of an alpha1C promoter in cardiac myocytes: role of an MCAT element that binds transcriptional enhancer factor-1 (TEF-1).

PubMed

O'Connell, T D; Rokosh, D G; Simpson, P C

2001-05-01

alpha1-Adrenergic receptor (AR) subtypes in the heart are expressed by myocytes but not by fibroblasts, a feature that distinguishes alpha1-ARs from beta-ARs. Here we studied myocyte-specific expression of alpha1-ARs, focusing on the subtype alpha1C (also called alpha1A), a subtype implicated in cardiac hypertrophic signaling in rat models. We first cloned the mouse alpha1C-AR gene, which consisted of two exons with an 18 kb intron, similar to the alpha1B-AR gene. The receptor coding sequence was >90% homologous to that of rat and human. alpha1C-AR transcription in mouse heart was initiated from a single Inr consensus sequence at -588 from the ATG; this and a putative polyadenylation sequence 8.5 kb 3' could account for the predominant 11 kb alpha1C mRNA in mouse heart. A 5'-nontranscribed fragment of 4.4 kb was active as a promoter in cardiac myocytes but not in fibroblasts. Promoter activity in myocytes required a single muscle CAT (MCAT) element, and this MCAT bound in vitro to recombinant and endogenous transcriptional enhancer factor-1. Thus, alpha1C-AR transcription in cardiac myocytes shares MCAT dependence with other cardiac-specific genes, including the alpha- and beta-myosin heavy chains, skeletal alpha-actin, and brain natriuretic peptide. However, the mouse alpha1C gene was not transcribed in the neonatal heart and was not activated by alpha1-AR and other hypertrophic agonists in rat myocytes, and thus differed from other MCAT-dependent genes and the rat alpha1C gene.

Genomic Features of the Damselfly Calopteryx splendens Representing a Sister Clade to Most Insect Orders

PubMed Central

Ioannidis, Panagiotis; Simao, Felipe A.; Waterhouse, Robert M.; Manni, Mosè; Seppey, Mathieu; Robertson, Hugh M.; Misof, Bernhard; Niehuis, Oliver

2017-01-01

Insects comprise the most diverse and successful animal group with over one million described species that are found in almost every terrestrial and limnic habitat, with many being used as important models in genetics, ecology, and evolutionary research. Genome sequencing projects have greatly expanded the sampling of species from many insect orders, but genomic resources for species of certain insect lineages have remained relatively limited to date. To address this paucity, we sequenced the genome of the banded demoiselle, Calopteryx splendens, a damselfly (Odonata: Zygoptera) belonging to Palaeoptera, the clade containing the first winged insects. The 1.6 Gbp C. splendens draft genome assembly is one of the largest insect genomes sequenced to date and encodes a predicted set of 22,523 protein-coding genes. Comparative genomic analyses with other sequenced insects identified a relatively small repertoire of C. splendens detoxification genes, which could explain its previously noted sensitivity to habitat pollution. Intriguingly, this repertoire includes a cytochrome P450 gene not previously described in any insect genome. The C. splendens immune gene repertoire appears relatively complete and features several genes encoding novel multi-domain peptidoglycan recognition proteins. Analysis of chemosensory genes revealed the presence of both gustatory and ionotropic receptors, as well as the insect odorant receptor coreceptor gene (OrCo) and at least four partner odorant receptors (ORs). This represents the oldest known instance of a complete OrCo/OR system in insects, and provides the molecular underpinning for odonate olfaction. The C. splendens genome improves the sampling of insect lineages that diverged before the radiation of Holometabola and offers new opportunities for molecular-level evolutionary, ecological, and behavioral studies. PMID:28137743

Effects of in vivo exposure to UV filters (4-MBC, OMC, BP-3, 4-HB, OC, OD-PABA) on endocrine signaling genes in the insect Chironomus riparius.

PubMed

Ozáez, Irene; Martínez-Guitarte, José Luis; Morcillo, Gloria

2013-07-01

There is increasing evidence indicating that several UV filters might have endocrine disruptive effects. Numerous studies have evaluated hormonal effects in vertebrates, mainly reporting estrogenic and androgenic activities in mammals and fishes. There is only limited knowledge about potential endocrine activity in invertebrate hormonal systems. In this work, the effects on endocrine signaling genes of six frequently used UV filters were investigated in Chironomus riparius, a reference organism in aquatic toxicology. The UV filters studied were: octyl-p-methoxycinnamate (OMC) also called 2-ethylhexyl-4-methoxycinnamate (EHMC); 4-methylbenzylidene camphor (4-MBC); benzophenone-3 (BP-3); 4-hidroxybenzophenone (4-HB); octocrylene (OC); and octyldimethyl-p-aminobenzoate (OD-PABA). After in vivo exposure at different dosages, expression levels of the genes coding for the ecdysone receptor (EcR), the ultraspiracle (usp, ortholog of the RXR) and the estrogen-related receptor (ERR) were quantified by Real Time PCR. The EcR gene was significantly upregulated by 4-MBC, OMC/EHMC and OD-PABA, with a dose-related response following 24h exposure. In contrast, the benzophenones, BP-3 and 4-HB, as well as OC did not alter this gene at the same exposure conditions. The transcription profiles of the usp and ERR genes were not significantly affected, except for BP-3 that inhibited the usp gene at the highest concentration. To our knowledge, this is the first experimental evidence in invertebrates of a direct effect of UV filters on endocrine-related genes, and is consistent with the known effects on vertebrate hormonal receptor genes. The capability of 4-MBC, OMC/EHMC and OD-PABA to stimulate the expression of the ecdysone receptor, a key transcription factor for the ecdysone-genomic response in arthropods, suggests the possibility of a broad and long-term effect on this hormonal pathway. These findings strengthen the need for further research about the ecotoxicological implications of chronic exposure to these compounds in aquatic invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

A novel bioinformatics pipeline to discover genes related to arbuscular mycorrhizal symbiosis based on their evolutionary conservation pattern among higher plants.

PubMed

Favre, Patrick; Bapaume, Laure; Bossolini, Eligio; Delorenzi, Mauro; Falquet, Laurent; Reinhardt, Didier

2014-12-03

Genes involved in arbuscular mycorrhizal (AM) symbiosis have been identified primarily by mutant screens, followed by identification of the mutated genes (forward genetics). In addition, a number of AM-related genes has been identified by their AM-related expression patterns, and their function has subsequently been elucidated by knock-down or knock-out approaches (reverse genetics). However, genes that are members of functionally redundant gene families, or genes that have a vital function and therefore result in lethal mutant phenotypes, are difficult to identify. If such genes are constitutively expressed and therefore escape differential expression analyses, they remain elusive. The goal of this study was to systematically search for AM-related genes with a bioinformatics strategy that is insensitive to these problems. The central element of our approach is based on the fact that many AM-related genes are conserved only among AM-competent species. Our approach involves genome-wide comparisons at the proteome level of AM-competent host species with non-mycorrhizal species. Using a clustering method we first established orthologous/paralogous relationships and subsequently identified protein clusters that contain members only of the AM-competent species. Proteins of these clusters were then analyzed in an extended set of 16 plant species and ranked based on their relatedness among AM-competent monocot and dicot species, relative to non-mycorrhizal species. In addition, we combined the information on the protein-coding sequence with gene expression data and with promoter analysis. As a result we present a list of yet uncharacterized proteins that show a strongly AM-related pattern of sequence conservation, indicating that the respective genes may have been under selection for a function in AM. Among the top candidates are three genes that encode a small family of similar receptor-like kinases that are related to the S-locus receptor kinases involved in sporophytic self-incompatibility. We present a new systematic strategy of gene discovery based on conservation of the protein-coding sequence that complements classical forward and reverse genetics. This strategy can be applied to diverse other biological phenomena if species with established genome sequences fall into distinguished groups that differ in a defined functional trait of interest.

Clinical expression of C282Y homozygous HFE haemochromatosis at 14 years of age.

PubMed

Rossi, Enrico; Wallace, Daniel F; Subramaniam, V Nathan; St Pierre, Timothy G; Mews, Catherine; Jeffrey, Gary P

2006-05-01

A 14-year-old boy who presented with debilitating lethargy was shown to have an elevated serum ferritin of 572 microg/L and a C282Y homozygous HFE genotype. Liver iron concentration was measured non-invasively by magnetic resonance imaging, which revealed a liver iron concentration of 59 micromol/g dry weight (children's reference range < 14). The early phenotypic expression was further investigated by screening genomic DNA for the presence of co-inherited mutations in genes responsible for non-HFE haemochromatosis. Coding regions and splice sites in genes encoding hepcidin and haemojuvelin were sequenced and previously described mutations in ferroportin 1 and transferrin receptor 2 genes were screened. Although no mutations were found, the most likely cause for the early expression is the presence of novel mutations or gene(s).

The pig X and Y Chromosomes: structure, sequence, and evolution

PubMed Central

Skinner, Benjamin M.; Sargent, Carole A.; Churcher, Carol; Hunt, Toby; Herrero, Javier; Loveland, Jane E.; Dunn, Matt; Louzada, Sandra; Fu, Beiyuan; Chow, William; Gilbert, James; Austin-Guest, Siobhan; Beal, Kathryn; Carvalho-Silva, Denise; Cheng, William; Gordon, Daria; Grafham, Darren; Hardy, Matt; Harley, Jo; Hauser, Heidi; Howden, Philip; Howe, Kerstin; Lachani, Kim; Ellis, Peter J.I.; Kelly, Daniel; Kerry, Giselle; Kerwin, James; Ng, Bee Ling; Threadgold, Glen; Wileman, Thomas; Wood, Jonathan M.D.; Yang, Fengtang; Harrow, Jen; Affara, Nabeel A.; Tyler-Smith, Chris

2016-01-01

We have generated an improved assembly and gene annotation of the pig X Chromosome, and a first draft assembly of the pig Y Chromosome, by sequencing BAC and fosmid clones from Duroc animals and incorporating information from optical mapping and fiber-FISH. The X Chromosome carries 1033 annotated genes, 690 of which are protein coding. Gene order closely matches that found in primates (including humans) and carnivores (including cats and dogs), which is inferred to be ancestral. Nevertheless, several protein-coding genes present on the human X Chromosome were absent from the pig, and 38 pig-specific X-chromosomal genes were annotated, 22 of which were olfactory receptors. The pig Y-specific Chromosome sequence generated here comprises 30 megabases (Mb). A 15-Mb subset of this sequence was assembled, revealing two clusters of male-specific low copy number genes, separated by an ampliconic region including the HSFY gene family, which together make up most of the short arm. Both clusters contain palindromes with high sequence identity, presumably maintained by gene conversion. Many of the ancestral X-related genes previously reported in at least one mammalian Y Chromosome are represented either as active genes or partial sequences. This sequencing project has allowed us to identify genes—both single copy and amplified—on the pig Y Chromosome, to compare the pig X and Y Chromosomes for homologous sequences, and thereby to reveal mechanisms underlying pig X and Y Chromosome evolution. PMID:26560630

Whole genome annotation and comparative genomic analyses of bio-control fungus Purpureocillium lilacinum.

PubMed

Prasad, Pushplata; Varshney, Deepti; Adholeya, Alok

2015-11-25

The fungus Purpureocillium lilacinum is widely known as a biological control agent against plant parasitic nematodes. This research article consists of genomic annotation of the first draft of whole genome sequence of P. lilacinum. The study aims to decipher the putative genetic components of the fungus involved in nematode pathogenesis by performing comparative genomic analysis with nine closely related fungal species in Hypocreales. de novo genomic assembly was done and a total of 301 scaffolds were constructed for P. lilacinum genomic DNA. By employing structural genome prediction models, 13, 266 genes coding for proteins were predicted in the genome. Approximately 73% of the predicted genes were functionally annotated using Blastp, InterProScan and Gene Ontology. A 14.7% fraction of the predicted genes shared significant homology with genes in the Pathogen Host Interactions (PHI) database. The phylogenomic analysis carried out using maximum likelihood RAxML algorithm provided insight into the evolutionary relationship of P. lilacinum. In congruence with other closely related species in the Hypocreales namely, Metarhizium spp., Pochonia chlamydosporia, Cordyceps militaris, Trichoderma reesei and Fusarium spp., P. lilacinum has large gene sets coding for G-protein coupled receptors (GPCRs), proteases, glycoside hydrolases and carbohydrate esterases that are required for degradation of nematode-egg shell components. Screening of the genome by Antibiotics & Secondary Metabolite Analysis Shell (AntiSMASH) pipeline indicated that the genome potentially codes for a variety of secondary metabolites, possibly required for adaptation to heterogeneous lifestyles reported for P. lilacinum. Significant up-regulation of subtilisin-like serine protease genes in presence of nematode eggs in quantitative real-time analyses suggested potential role of serine proteases in nematode pathogenesis. The data offer a better understanding of Purpureocillium lilacinum genome and will enhance our understanding on the molecular mechanism involved in nematophagy.

Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.

PubMed

Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena

2015-04-01

Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.

Ancient genomic architecture for mammalian olfactory receptor clusters

PubMed Central

Aloni, Ronny; Olender, Tsviya; Lancet, Doron

2006-01-01

Background Mammalian olfactory receptor (OR) genes reside in numerous genomic clusters of up to several dozen genes. Whole-genome sequence alignment nets of five mammals allow their comprehensive comparison, aimed at reconstructing the ancestral olfactory subgenome. Results We developed a new and general tool for genome-wide definition of genomic gene clusters conserved in multiple species. Syntenic orthologs, defined as gene pairs showing conservation of both genomic location and coding sequence, were subjected to a graph theory algorithm for discovering CLICs (clusters in conservation). When applied to ORs in five mammals, including the marsupial opossum, more than 90% of the OR genes were found within a framework of 48 multi-species CLICs, invoking a general conservation of gene order and composition. A detailed analysis of individual CLICs revealed multiple differences among species, interpretable through species-specific genomic rearrangements and reflecting complex mammalian evolutionary dynamics. One significant instance involves CLIC #1, which lacks a human member, implying the human-specific deletion of an OR cluster, whose mouse counterpart has been tentatively associated with isovaleric acid odorant detection. Conclusion The identified multi-species CLICs demonstrate that most of the mammalian OR clusters have a common ancestry, preceding the split between marsupials and placental mammals. However, only two of these CLICs were capable of incorporating chicken OR genes, parsimoniously implying that all other CLICs emerged subsequent to the avian-mammalian divergence. PMID:17010214

Stop codon readthrough generates a C-terminally extended variant of the human vitamin D receptor with reduced calcitriol response

PubMed Central

Loughran, Gary; Jungreis, Irwin; Tzani, Ioanna; Power, Michael; Dmitriev, Ruslan I.; Ivanov, Ivaylo P.; Kellis, Manolis; Atkins, John F.

2018-01-01

Although stop codon readthrough is used extensively by viruses to expand their gene expression, verified instances of mammalian readthrough have only recently been uncovered by systems biology and comparative genomics approaches. Previously, our analysis of conserved protein coding signatures that extend beyond annotated stop codons predicted stop codon readthrough of several mammalian genes, all of which have been validated experimentally. Four mRNAs display highly efficient stop codon readthrough, and these mRNAs have a UGA stop codon immediately followed by CUAG (UGA_CUAG) that is conserved throughout vertebrates. Extending on the identification of this readthrough motif, we here investigated stop codon readthrough, using tissue culture reporter assays, for all previously untested human genes containing UGA_CUAG. The readthrough efficiency of the annotated stop codon for the sequence encoding vitamin D receptor (VDR) was 6.7%. It was the highest of those tested but all showed notable levels of readthrough. The VDR is a member of the nuclear receptor superfamily of ligand-inducible transcription factors, and it binds its major ligand, calcitriol, via its C-terminal ligand-binding domain. Readthrough of the annotated VDR mRNA results in a 67 amino acid–long C-terminal extension that generates a VDR proteoform named VDRx. VDRx may form homodimers and heterodimers with VDR but, compared with VDR, VDRx displayed a reduced transcriptional response to calcitriol even in the presence of its partner retinoid X receptor. PMID:29386352

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

cDNA cloning and characterization of the human THRAP2 gene which maps to chromosome 12q24, and its mouse ortholog Thrap2.

PubMed

Musante, Luciana; Bartsch, Oliver; Ropers, Hans-Hilger; Kalscheuer, Vera M

2004-05-12

Characterization of a balanced t(2;12)(q37;q24) translocation in a patient with suspicion of Noonan syndrome revealed that the chromosome 12 breakpoint lies in the vicinity of a novel human gene, thyroid hormone receptor-associated protein 2 (THRAP2). We therefore characterized this gene and its mouse counterpart in more detail. Human and mouse THRAP2/Thrap2 span a genomic region of about 310 and >170 kilobases (kb), and both contain 31 exons. Corresponding transcripts are approximately 9.5 kb long. Their open reading frames code for proteins of 2210 and 2203 amino acids, which are 93% identical. By northern blot analysis, human and mouse THRAP2/Thrap2 genes showed ubiquitous expression. Transcripts were most abundant in human skeletal muscle and in mouse heart. THRAP2 protein is 56% identical to human TRAP240, which belongs to the thyroid hormone receptor associated protein (TRAP) complex and is evolutionary conserved up to yeast. This complex is involved in transcriptional regulation and is believed to serve as adapting interface between regulatory proteins bound to specific DNA sequences and RNA polymerase II.

Mapping of the gene encoding the melanocortin-1 ([alpha]-melanocyte stimulating hormone) receptor (MC1R) to human chromosome 16q24. 3 by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gantz, I.; Yamada, Tadataka; Tashiro, Takao

1994-01-15

[alpha]-Melanocyte stimulating hormone ([alpha]-MSH), a hormone originally named for its ability to regulate pigmentation of melanocytes, is a 13-amino-acid post-translational product of the pro-opiomelanocortin (POMC) gene. [alpha]-MSH and the other products of POMC processing, which share the core heptapeptide amino acid sequence Met-Glu (Gly)-His-Phe-Arg-Trp-Gly (Asp), the adrenocorticotropic hormone (ACTH), [beta]-MSH, and [gamma]-MSH, are collectively referred to as melanocortins. While best known for their effects on the melanocyte (pigmentation) and adrenal cortical cells (steroidogenesis), melanocortins have been postulated to function in diverse activities, including enhancement of learning and memory, control of the cardiovascular system, analgesia, thermoregulation, immunomodulation, parturition, and neurotrophism. Tomore » identify the chromosomal band encoding the human melanocortin-1 receptor gene, 1 [mu]g of an EMBL clone coding region of the human MC1R and approximately 15 kb of surrounding DNA was labeled with biotin and hybridized to human metaphase chromosomes as previously described. The results indicate that the human MC1R gene is localized to 16q24.3. 15 refs., 1 fig.« less

Color differences among feral pigeons (Columba livia) are not attributable to sequence variation in the coding region of the melanocortin-1 receptor gene (MC1R)

PubMed Central

2013-01-01

Background Genetic variation at the melanocortin-1 receptor (MC1R) gene is correlated with melanin color variation in many birds. Feral pigeons (Columba livia) show two major melanin-based colorations: a red coloration due to pheomelanic pigment and a black coloration due to eumelanic pigment. Furthermore, within each color type, feral pigeons display continuous variation in the amount of melanin pigment present in the feathers, with individuals varying from pure white to a full dark melanic color. Coloration is highly heritable and it has been suggested that it is under natural or sexual selection, or both. Our objective was to investigate whether MC1R allelic variants are associated with plumage color in feral pigeons. Findings We sequenced 888 bp of the coding sequence of MC1R among pigeons varying both in the type, eumelanin or pheomelanin, and the amount of melanin in their feathers. We detected 10 non-synonymous substitutions and 2 synonymous substitution but none of them were associated with a plumage type. It remains possible that non-synonymous substitutions that influence coloration are present in the short MC1R fragment that we did not sequence but this seems unlikely because we analyzed the entire functionally important region of the gene. Conclusions Our results show that color differences among feral pigeons are probably not attributable to amino acid variation at the MC1R locus. Therefore, variation in regulatory regions of MC1R or variation in other genes may be responsible for the color polymorphism of feral pigeons. PMID:23915680

Genetic and physical interaction of the B-cell systemic lupus erythematosus-associated genes BANK1 and BLK.

PubMed

Castillejo-López, Casimiro; Delgado-Vega, Angélica M; Wojcik, Jerome; Kozyrev, Sergey V; Thavathiru, Elangovan; Wu, Ying-Yu; Sánchez, Elena; Pöllmann, David; López-Egido, Juan R; Fineschi, Serena; Domínguez, Nicolás; Lu, Rufei; James, Judith A; Merrill, Joan T; Kelly, Jennifer A; Kaufman, Kenneth M; Moser, Kathy L; Gilkeson, Gary; Frostegård, Johan; Pons-Estel, Bernardo A; D'Alfonso, Sandra; Witte, Torsten; Callejas, José Luis; Harley, John B; Gaffney, Patrick M; Martin, Javier; Guthridge, Joel M; Alarcón-Riquelme, Marta E

2012-01-01

Altered signalling in B cells is a predominant feature of systemic lupus erythematosus (SLE). The genes BANK1 and BLK were recently described as associated with SLE. BANK1 codes for a B-cell-specific cytoplasmic protein involved in B-cell receptor signalling and BLK codes for an Src tyrosine kinase with important roles in B-cell development. To characterise the role of BANK1 and BLK in SLE, a genetic interaction analysis was performed hypothesising that genetic interactions could reveal functional pathways relevant to disease pathogenesis. The GPAT16 method was used to analyse the gene-gene interactions of BANK1 and BLK. Confocal microscopy was used to investigate co-localisation, and immunoprecipitation was used to verify the physical interaction of BANK1 and BLK. Epistatic interactions between BANK1 and BLK polymorphisms associated with SLE were observed in a discovery set of 279 patients and 515 controls from northern Europe. A meta-analysis with 4399 European individuals confirmed the genetic interactions between BANK1 and BLK. As BANK1 was identified as a binding partner of the Src tyrosine kinase LYN, the possibility that BANK1 and BLK could also show a protein-protein interaction was tested. The co-immunoprecipitation and co-localisation of BLK and BANK1 were demonstrated. In a Daudi cell line and primary naive B cells endogenous binding was enhanced upon B-cell receptor stimulation using anti-IgM antibodies. This study shows a genetic interaction between BANK1 and BLK, and demonstrates that these molecules interact physically. The results have important consequences for the understanding of SLE and other autoimmune diseases and identify a potential new signalling pathway.

Genetic and Physical Interaction of the B-Cell SLE-Associated Genes BANK1 and BLK

PubMed Central

Castillejo-López, Casimiro; Delgado-Vega, Angélica M.; Wojcik, Jerome; Kozyrev, Sergey V.; Thavathiru, Elangovan; Wu, Ying-Yu; Sánchez, Elena; Pöllmann, David; López-Egido, Juan R.; Fineschi, Serena; Domínguez, Nicolás; Lu, Rufei; James, Judith A.; Merrill, Joan T.; Kelly, Jennifer A.; Kaufman, Kenneth M.; Moser, Kathy; Gilkeson, Gary; Frostegård, Johan; Pons-Estel, Bernardo A.; D’Alfonso, Sandra; Witte, Torsten; Callejas, José Luis; Harley, John B.; Gaffney, Patrick; Martin, Javier; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.

2012-01-01

Objectives Altered signaling in B-cells is a predominant feature of systemic lupus erythematosus (SLE). The genes BANK1 and BLK were recently described as associated with SLE. BANK1 codes for a B-cell-specific cytoplasmic protein involved in B-cell receptor signaling and BLK codes for an Src tyrosine kinase with important roles in B-cell development. To characterize the role of BANK1 and BLK in SLE, we performed a genetic interaction analysis hypothesizing that genetic interactions could reveal functional pathways relevant to disease pathogenesis. Methods We Used the method GPAT16 to analyze the gene-gene interactions of BANK1 and BLK. Confocal microscopy was used to investigate co-localization, and immunoprecipitation was used to verify the physical interaction of BANK1 and BLK. Results Epistatic interactions between BANK1 and BLK polymorphisms associated with SLE were observed in a discovery set of 279 patients and 515 controls from Northern Europe. A meta-analysis with 4399 European individuals confirmed the genetic interactions between BANK1 and BLK. As BANK1 was identified as a binding partner of the Src tyrosine kinase LYN, we tested the possibility that BANK1 and BLK could also show a protein-protein interaction. We demonstrated co-immunoprecipitation and co-localization of BLK and BANK1. In a Daudi cell line and primary naïve B-cells the endogenous binding was enhanced upon B-cell receptor stimulation using anti-IgM antibodies. Conclusions Here, we show a genetic interaction between BANK1 and BLK, and demonstrate that these molecules interact physically. Our results have important consequences for the understanding of SLE and other autoimmune diseases and identify a potential new signaling pathway. PMID:21978998

Variability of CAG tandem repeats in exon 1 of the androgen receptor gene is not related with dog intersexuality.

PubMed

Nowacka-Woszuk, J; Switonski, M

2010-02-01

Numerous mutations of the human androgen receptor (AR) gene cause an intersexual phenotype, called the androgen insensitivity syndrome. The intersexual phenotype is also quite often diagnosed in dogs. The aim of this study was to conduct a comparative analysis of the entire coding sequence (eight exons) of the AR gene in healthy and four intersex dogs, as well as in three other canids (the red fox, arctic fox and Chinese raccoon dog). The coding sequence of the studied species appeared to be conserved (similarity above 97%) and polymorphism was found in exon 1 only. Altogether, 2 SNPs were identified in healthy dogs, 14 in red foxes, 16 in arctic foxes and 6 were found in Chinese raccoon dogs, respectively. Moreover, a variable number of tandem repeats (CAG and CAA), encoding an array of glutamines, was also observed in this exon. The CAA codon numbers were invariable within species, but the CAG repeats were polymorphic. The highest number of the CAG and CAA repeats was found in dogs (from 40 to 42) and the observed variability was similar in intersex and healthy dogs. In the other canids the variability fell within the following ranges: 29-37 (red fox), 37-39 (arctic fox) and 29-32 (Chinese raccoon dog). In addition, a polymorphic microsatellite marker in intron 2 was found in the dog, red fox and Chinese raccoon dog. It was concluded that the polymorphism level of the AR gene in the dog was lower than in the other canids and none of the detected polymorphisms, including variability of the CAG tandem repeats, could be related with the intersexual phenotype of the studied dogs.

Gene-specific cell labeling using MiMIC transposons.

PubMed

Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

2015-04-30

Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Intronic Deletions That Disrupt mRNA Splicing of the tva Receptor Gene Result in Decreased Susceptibility to Infection by Avian Sarcoma and Leukosis Virus Subgroup A

PubMed Central

Reinišová, Markéta; Plachý, Jiří; Trejbalová, Kateřina; Šenigl, Filip; Kučerová, Dana; Geryk, Josef; Svoboda, Jan

2012-01-01

The group of closely related avian sarcoma and leukosis viruses (ASLVs) evolved from a common ancestor into multiple subgroups, A to J, with differential host range among galliform species and chicken lines. These subgroups differ in variable parts of their envelope glycoproteins, the major determinants of virus interaction with specific receptor molecules. Three genetic loci, tva, tvb, and tvc, code for single membrane-spanning receptors from diverse protein families that confer susceptibility to the ASLV subgroups. The host range expansion of the ancestral virus might have been driven by gradual evolution of resistance in host cells, and the resistance alleles in all three receptor loci have been identified. Here, we characterized two alleles of the tva receptor gene with similar intronic deletions comprising the deduced branch-point signal within the first intron and leading to inefficient splicing of tva mRNA. As a result, we observed decreased susceptibility to subgroup A ASLV in vitro and in vivo. These alleles were independently found in a close-bred line of domestic chicken and Indian red jungle fowl (Gallus gallus murghi), suggesting that their prevalence might be much wider in outbred chicken breeds. We identified defective splicing to be a mechanism of resistance to ASLV and conclude that such a type of mutation could play an important role in virus-host coevolution. PMID:22171251

Murine c-mpl: a member of the hematopoietic growth factor receptor superfamily that transduces a proliferative signal.

PubMed Central

Skoda, R C; Seldin, D C; Chiang, M K; Peichel, C L; Vogt, T F; Leder, P

1993-01-01

The murine myeloproliferative leukemia virus has previously been shown to contain a fragment of the coding region of the c-mpl gene, a member of the cytokine receptor superfamily. We have isolated cDNA and genomic clones encoding murine c-mpl and localized the c-mpl gene to mouse chromosome 4. Since some members of this superfamily function by transducing a proliferative signal and since the putative ligand of mpl is unknown, we have generated a chimeric receptor to test the functional potential of mpl. The chimera consists of the extracellular domain of the human interleukin-4 receptor and the cytoplasmic domain of mpl. A mouse hematopoietic cell line transfected with this construct proliferates in response to human interleukin-4, thereby demonstrating that the cytoplasmic domain of mpl contains all elements necessary to transmit a growth stimulatory signal. In addition, we show that 25-40% of mpl mRNA found in the spleen corresponds to a novel truncated and potentially soluble isoform of mpl and that both full-length and truncated forms of mpl protein can be immunoprecipitated from lysates of transfected COS cells. Interestingly, however, although the truncated form of the receptor possesses a functional signal sequence and lacks a transmembrane domain, it is not detected in the culture media of transfected cells. Images PMID:8334987

Perceptual variation in umami taste and polymorphisms in TAS1R taste receptor genes1234

PubMed Central

Chen, Qing-Ying; Alarcon, Suzanne; Tharp, Anilet; Ahmed, Osama M; Estrella, Nelsa L; Greene, Tiffani A; Rucker, Joseph; Breslin, Paul AS

2009-01-01

Background: The TAS1R1 and TAS1R3 G protein–coupled receptors are believed to function in combination as a heteromeric glutamate taste receptor in humans. Objective: We hypothesized that variations in the umami perception of glutamate would correlate with variations in the sequence of these 2 genes, if they contribute directly to umami taste. Design: In this study, we first characterized the general sensitivity to glutamate in a sample population of 242 subjects. We performed these experiments by sequencing the coding regions of the genomic TAS1R1 and TAS1R3 genes in a separate set of 87 individuals who were tested repeatedly with monopotassium glutamate (MPG) solutions. Last, we tested the role of the candidate umami taste receptor hTAS1R1-hTAS1R3 in a functional expression assay. Results: A subset of subjects displays extremes of sensitivity, and a battery of different psychophysical tests validated this observation. Statistical analysis showed that the rare T allele of single nucleotide polymorphism (SNP) R757C in TAS1R3 led to a doubling of umami ratings of 25 mmol MPG/L. Other suggestive SNPs of TAS1R3 include the A allele of A5T and the A allele of R247H, which both resulted in an approximate doubling of umami ratings of 200 mmol MPG/L. We confirmed the potential role of the human TAS1R1-TAS1R3 heteromer receptor in umami taste by recording responses, specifically to l-glutamate and inosine 5′-monophosphate (IMP) mixtures in a heterologous expression assay in HEK (human embryonic kidney) T cells. Conclusions: There is a reliable and valid variation in human umami taste of l-glutamate. Variations in perception of umami taste correlated with variations in the human TAS1R3 gene. The putative human taste receptor TAS1R1-TAS1R3 responds specifically to l-glutamate mixed with the ribonucleotide IMP. Thus, this receptor likely contributes to human umami taste perception. PMID:19587085

Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4

PubMed Central

Bondurand, Nadége; Fouquet, Virginie; Baral, Viviane; Lecerf, Laure; Loundon, Natalie; Goossens, Michel; Duriez, Benedicte; Labrune, Philippe; Pingault, Veronique

2012-01-01

Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15–35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders. PMID:22378281

Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

PubMed

Bondurand, Nadége; Fouquet, Virginie; Baral, Viviane; Lecerf, Laure; Loundon, Natalie; Goossens, Michel; Duriez, Benedicte; Labrune, Philippe; Pingault, Veronique

2012-09-01

Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders.

Pharmacogenetics: Implications of Race and Ethnicity on Defining Genetic Profiles for Personalized Medicine

PubMed Central

Ortega, Victor E.; Meyers, Deborah A.

2014-01-01

Pharmacogenetics is being used to develop personalized therapies specific to individuals from different ethnic or racial groups. Pharmacogenetic studies to date have been primarily performed in trial cohorts consisting of non-Hispanic whites of European descent. A “bottleneck” or collapse of genetic diversity associated with the first human colonization of Europe during the Upper Paleolithic period, followed by the recent mixing of African, European, and Native American ancestries has resulted in different ethnic groups with varying degrees of genetic diversity. Differences in genetic ancestry may introduce genetic variation which has the potential to alter the therapeutic efficacy of commonly used asthma therapies, for example β2-adrenergic receptor agonists (beta agonists). Pharmacogenetic studies of admixed ethnic groups have been limited to small candidate gene association studies of which the best example is the gene coding for the receptor target of beta agonist therapy, ADRB2. Large consortium-based sequencing studies are using next-generation whole-genome sequencing to provide a diverse genome map of different admixed populations which can be used for future pharmacogenetic studies. These studies will include candidate gene studies, genome-wide association studies, and whole-genome admixture-based approaches which account for ancestral genetic structure, complex haplotypes, gene-gene interactions, and rare variants to detect and replicate novel pharmacogenetic loci. PMID:24369795

Intraarticular expression of biologically active interleukin 1-receptor-antagonist protein by ex vivo gene transfer.

PubMed Central

Bandara, G; Mueller, G M; Galea-Lauri, J; Tindal, M H; Georgescu, H I; Suchanek, M K; Hung, G L; Glorioso, J C; Robbins, P D; Evans, C H

1993-01-01

Gene therapy offers a radical different approach to the treatment of arthritis. Here we have demonstrated that two marker genes (lacZ and neo) and cDNA coding for a potentially therapeutic protein (human interleukin 1-receptor-antagonist protein; IRAP or IL-1ra) can be delivered, by ex vivo techniques, to the synovial lining of joints; intraarticular expression of IRAP inhibited intraarticular responses to interleukin 1. To achieve this, lapine synoviocytes were first transduced in culture by retroviral infection. The genetically modified synovial cells were then transplanted by intraarticular injection into the knee joints of rabbits, where they efficiently colonized the synovium. Assay of joint lavages confirmed the in vivo expression of biologically active human IRAP. With allografted cells, IRAP expression was lost by 12 days after transfer. In contrast, autografted synoviocytes continued to express IRAP for approximately 5 weeks. Knee joints expressing human IRAP were protected from the leukocytosis that otherwise follows the intraarticular injection of recombinant human interleukin 1 beta. Thus, we report the intraarticular expression and activity of a potentially therapeutic protein by gene-transfer technology; these experiments demonstrate the feasibility of treating arthritis and other joint disorders with gene therapy. Images Fig. 1 Fig. 2 PMID:8248169

Major Breeding Plumage Color Differences of Male Ruffs (Philomachus pugnax) Are Not Associated With Coding Sequence Variation in the MC1R Gene

PubMed Central

Küpper, Clemens; Burke, Terry; Lank, David B.

2015-01-01

Sequence variation in the melanocortin-1 receptor (MC1R) gene explains color morph variation in several species of birds and mammals. Ruffs (Philomachus pugnax) exhibit major dark/light color differences in melanin-based male breeding plumage which is closely associated with alternative reproductive behavior. A previous study identified a microsatellite marker (Ppu020) near the MC1R locus associated with the presence/absence of ornamental plumage. We investigated whether coding sequence variation in the MC1R gene explains major dark/light plumage color variation and/or the presence/absence of ornamental plumage in ruffs. Among 821bp of the MC1R coding region from 44 male ruffs we found 3 single nucleotide polymorphisms, representing 1 nonsynonymous and 2 synonymous amino acid substitutions. None were associated with major dark/light color differences or the presence/absence of ornamental plumage. At all amino acid sites known to be functionally important in other avian species with dark/light plumage color variation, ruffs were either monomorphic or the shared polymorphism did not coincide with color morph. Neither ornamental plumage color differences nor the presence/absence of ornamental plumage in ruffs are likely to be caused entirely by amino acid variation within the coding regions of the MC1R locus. Regulatory elements and structural variation at other loci may be involved in melanin expression and contribute to the extreme plumage polymorphism observed in this species. PMID:25534935

Overexpression of vasopressin (V3) and corticotrophin-releasing hormone receptor genes in corticotroph tumours.

PubMed

de Keyzer, Y; René, P; Beldjord, C; Lenne, F; Bertagna, X

1998-10-01

The molecular mechanisms underlying ACTH-secreting tumour formation remain unknown. Transmembrane signalling pathways play an important role in several endocrine disorders including pituitary tumours. To investigate the role of the pituitary vasopressin (V3) receptor (R) in ACTH-secreting tumours we have qualitatively and quantitatively analysed its mRNA. RT-PCR, denaturing gradient gel electrophoresis and S1 nuclease protection experiments were used to analyse V3 mRNA structure in ACTH-secreting tumours. We also developed a competitive RT-PCR system to compare the levels of expression of POMC, V3 and CRH-R genes. This system used as competitor a single mutant template (termed multi-mutant) containing primers for the three genes flanking an unrelated core sequence allowing multiple quantifications from the same cDNA preparations. We analysed 12 normal pituitaries, 15 corticotroph pituitary adenomas and 6 ACTH-secreting bronchial carcinoids. The V3 mRNA structure and sequence were found to be identical in normal and tumoural pituitary indicating that the tumoural Vs mRNA codes for a normal receptor. POMC RT-PCR signals in the pituitary tumour group were approximately 7-fold higher than in the normal pituitary group. Similarly, V3 and CRH-R signal were increased in pituitary tumors (mean +/- SEM: 5.87 x 10(-6) +/- 1.73 x 10(-6), and 2.33 x 10(-4) +/- 1.4 x 10(-4), respectively), when compared to normal pituitaries (1.19 x 10(-7) +/- 2.39 x 10(-8), and 1.7 x 10(-6) +/- 4.65 x 10(-7), respectively) suggesting that these two genes are expressed at very high levels in corticotroph tumours. When expressed relative to the corresponding POMC signals, increases in V3 and CRH-R signals reached 49-fold and 137-fold, respectively, in pituitary tumours. In ACTH-secreting bronchial carcinoids V3 gene expression level was also higher than in normal pituitary, whereas CRH-R signals were detected in only 4 of the 6 tumours with wide variations. Our results show that both vasopressin and CRH receptor genes are overexpressed in ACTH-secreting pituitary tumours. They suggest that overexpression of G protein-coupled receptors may be an additional mechanism through which membrane receptors may play a role in human tumours.

Association between the GABA(A) receptor alpha5 subunit gene locus (GABRA5) and bipolar affective disorder.

PubMed

Papadimitriou, G N; Dikeos, D G; Karadima, G; Avramopoulos, D; Daskalopoulou, E G; Vassilopoulos, D; Stefanis, C N

1998-02-07

Genetic factors seem to play an important role in the pathogenesis of affective disorder. The candidate gene strategies are being used, among others, to identify the genes conferring vulnerability to the disease. The genes coding for the receptors of gamma-aminobutyric acid (GABA) have been proposed as candidates for affective disorder, since the GABA neurotransmitter system has been implicated in the pathogenesis of the illness. We examined the possible genetic association between the GABA(A) receptor alpha5 subunit gene locus (GABRA5) on chromosome 15 and affective disorder, in 48 bipolar patients (BP), 40 unipolar patients (UP), and 50 healthy individuals, age- and sex-matched to the patients. All patients and controls were unrelated Greeks. Diagnoses were made after direct interviews according to the DSM-IV and ICD-10 criteria. For the genotyping, a dinucleotide (CA) repeat marker was used. The polymerase chain reaction (PCR) products found were nine alleles with lengths between 272 and 290 base pairs (bp). The distribution of allelic frequencies of the GABRA5 locus differed significantly between BP patients and controls with the 282-bp allele found to be associated with BP affective disorder, while no such difference was observed between the groups of UP patients and controls nor between the two patient groups. The presence or absence of the 282-bp allele in the genotype of BP patients was not shown to influence the age of onset and the overall clinical severity, but was found to be associated with a preponderance of manic over depressive episodes in the course of the illness.

Analyses of sweet receptor gene (Tas1r2) and preference for sweet stimuli in species of Carnivora.

PubMed

Li, Xia; Glaser, Dieter; Li, Weihua; Johnson, Warren E; O'Brien, Stephen J; Beauchamp, Gary K; Brand, Joseph G

2009-01-01

The extent to which taste receptor specificity correlates with, or even predicts, diet choice is not known. We recently reported that the insensitivity to sweeteners shown by species of Felidae can be explained by their lacking of a functional Tas1r2 gene. To broaden our understanding of the relationship between the structure of the sweet receptors and preference for sugars and artificial sweeteners, we measured responses to 12 sweeteners in 6 species of Carnivora and sequenced the coding regions of Tas1r2 in these same or closely related species. The lion showed no preference for any of the 12 sweet compounds tested, and it possesses the pseudogenized Tas1r2. All other species preferred some of the natural sugars, and their Tas1r2 sequences, having complete open reading frames, predict functional sweet receptors. In addition to preferring natural sugars, the lesser panda also preferred 3 (neotame, sucralose, and aspartame) of the 6 artificial sweeteners. Heretofore, it had been reported that among vertebrates, only Old World simians could taste aspartame. The observation that the lesser panda highly preferred aspartame could be an example of evolutionary convergence in the identification of sweet stimuli.

Analyses of Sweet Receptor Gene (Tas1r2) and Preference for Sweet Stimuli in Species of Carnivora

PubMed Central

Glaser, Dieter; Li, Weihua; Johnson, Warren E.; O'Brien, Stephen J.; Beauchamp, Gary K.; Brand, Joseph G.

2009-01-01

The extent to which taste receptor specificity correlates with, or even predicts, diet choice is not known. We recently reported that the insensitivity to sweeteners shown by species of Felidae can be explained by their lacking of a functional Tas1r2 gene. To broaden our understanding of the relationship between the structure of the sweet receptors and preference for sugars and artificial sweeteners, we measured responses to 12 sweeteners in 6 species of Carnivora and sequenced the coding regions of Tas1r2 in these same or closely related species. The lion showed no preference for any of the 12 sweet compounds tested, and it possesses the pseudogenized Tas1r2. All other species preferred some of the natural sugars, and their Tas1r2 sequences, having complete open reading frames, predict functional sweet receptors. In addition to preferring natural sugars, the lesser panda also preferred 3 (neotame, sucralose, and aspartame) of the 6 artificial sweeteners. Heretofore, it had been reported that among vertebrates, only Old World simians could taste aspartame. The observation that the lesser panda highly preferred aspartame could be an example of evolutionary convergence in the identification of sweet stimuli. PMID:19366814

MouSensor: A Versatile Genetic Platform to Create Super Sniffer Mice for Studying Human Odor Coding.

PubMed

D'Hulst, Charlotte; Mina, Raena B; Gershon, Zachary; Jamet, Sophie; Cerullo, Antonio; Tomoiaga, Delia; Bai, Li; Belluscio, Leonardo; Rogers, Matthew E; Sirotin, Yevgeniy; Feinstein, Paul

2016-07-26

Typically, ∼0.1% of the total number of olfactory sensory neurons (OSNs) in the main olfactory epithelium express the same odorant receptor (OR) in a singular fashion and their axons coalesce into homotypic glomeruli in the olfactory bulb. Here, we have dramatically increased the total number of OSNs expressing specific cloned OR coding sequences by multimerizing a 21-bp sequence encompassing the predicted homeodomain binding site sequence, TAATGA, known to be essential in OR gene choice. Singular gene choice is maintained in these "MouSensors." In vivo synaptopHluorin imaging of odor-induced responses by known M71 ligands shows functional glomerular activation in an M71 MouSensor. Moreover, a behavioral avoidance task demonstrates that specific odor detection thresholds are significantly decreased in multiple transgenic lines, expressing mouse or human ORs. We have developed a versatile platform to study gene choice and axon identity, to create biosensors with great translational potential, and to finally decode human olfaction. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Statistical inference of the generation probability of T-cell receptors from sequence repertoires.

PubMed

Murugan, Anand; Mora, Thierry; Walczak, Aleksandra M; Callan, Curtis G

2012-10-02

Stochastic rearrangement of germline V-, D-, and J-genes to create variable coding sequence for certain cell surface receptors is at the origin of immune system diversity. This process, known as "VDJ recombination", is implemented via a series of stochastic molecular events involving gene choices and random nucleotide insertions between, and deletions from, genes. We use large sequence repertoires of the variable CDR3 region of human CD4+ T-cell receptor beta chains to infer the statistical properties of these basic biochemical events. Because any given CDR3 sequence can be produced in multiple ways, the probability distribution of hidden recombination events cannot be inferred directly from the observed sequences; we therefore develop a maximum likelihood inference method to achieve this end. To separate the properties of the molecular rearrangement mechanism from the effects of selection, we focus on nonproductive CDR3 sequences in T-cell DNA. We infer the joint distribution of the various generative events that occur when a new T-cell receptor gene is created. We find a rich picture of correlation (and absence thereof), providing insight into the molecular mechanisms involved. The generative event statistics are consistent between individuals, suggesting a universal biochemical process. Our probabilistic model predicts the generation probability of any specific CDR3 sequence by the primitive recombination process, allowing us to quantify the potential diversity of the T-cell repertoire and to understand why some sequences are shared between individuals. We argue that the use of formal statistical inference methods, of the kind presented in this paper, will be essential for quantitative understanding of the generation and evolution of diversity in the adaptive immune system.

IL-1 or TNF receptor gene deletion delays onset of encephalopathy and attenuates brain edema in experimental acute liver failure.

PubMed

Bémeur, Chantal; Qu, Hong; Desjardins, Paul; Butterworth, Roger F

2010-01-01

Previous reports suggested that brain-derived proinflammatory cytokines are involved in the pathogenesis of hepatic encephalopathy (HE) and brain edema in acute liver failure (ALF). To further address this issue, expression of interleukin-1beta (IL-1beta), tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) mRNAs were measured in the brains of mice with acute liver failure resulting from exposure to azoxymethane. In addition, time to severe encephalopathy (coma) was assessed in mice lacking genes coding for interferon-gamma, the tumor necrosis factor receptor-1 or the interleukin-1 type 1 receptor. Interleukin-1beta, tumor necrosis factor-alpha and interferon-gamma expression were quantified using RT-PCR. Significant increases in interleukin-1beta and tumor necrosis factor-alpha mRNA were observed in the frontal cortex of azoxymethane-treated wild-type mice at coma stages of encephalopathy. Interferon-gamma, however, could not be detected in the brains of these animals. Onset of severe encephalopathy (coma) and brain edema in ALF mice were significantly delayed in interleukin-1 type 1 receptor or tumor necrosis factor receptor-1 knockout mice. Deletion of the interferon-gamma gene, on the other hand, had no significative effect on the neurological status or brain water content of acute liver failure mice. These results demonstrate that toxic liver injury resulting from exposure to azoxymethane is associated with selective induction of proinflammatory cytokines in the brain and that deletion of tumor necrosis factor receptor-1 or interlukin-1 type 1 receptor delays the onset of coma and brain edema in this model of acute liver failure. These findings further support a role for selective brain-derived cytokines in the pathogenesis of the cerebral complications in acute liver failure and suggest that anti-inflammatory strategies could be beneficial in their prevention. Copyright 2009 Elsevier Ltd. All rights reserved.

In vivo Proton NMR spectroscopy of genetic mouse models BALB/cJ and C57BL/6By: variation in hippocampal glutamate level and the metabotropic glutamate receptor, subtype 7 (Grm7) gene.

PubMed

Guilfoyle, David N; Gerum, Scott; Vadasz, Csaba

2014-05-01

Glutamatergic neurotransmission in the brain is modulated by metabotropic glutamate receptors (mGluR). In recent studies, we identified a cis-regulated variant of a gene (Grm7) which codes for mGluR subtype 7 (mGluR7), a presynaptic inhibitory receptor. The genetic variant derived from the BALB/cJ mouse strain (Grm7 (BALB/cJ)) codes for higher abundance of mGluR7 mRNA in the hippocampus than the C57BL/6By strain-derived variant (Grm7 (C57BL/6By)). Here, we used localized in vivo (1)H NMR spectroscopy to test the hypothesis that Grm7 (BALB/cJ) is also associated with lower glutamate concentration in the same brain region. All data were obtained on a 7.0 T Agilent (Santa Clara, CA, USA) 40-cm bore system using experimentally naive adult male inbred C57BL/6By, BALB/cJ, and congenic mice (B6By.C.6.132.54) constructed in our laboratory carrying Grm7 (BALB/cJ) on C57BL/6By genetic background. The voxel of interest size was 6 μL (1 × 2 × 3 mm(3)) placed in the hippocampal CA1 region. The results showed that the hippocampal level of glutamate in the congenic mouse strain was significantly lower than that in the background C57BL/6By strain which carried the Grm7 (C57BL/6By) allele. Because the two inbred strains are genetically highly similar except at the region of the Grm7 gene, the results raise the possibility that allelic variation at the Grm7 locus contributes to the strain differences in both hippocampal mRNA abundance and glutamate level which may modulate complex behavioral traits, such as learning and memory, addiction, epilepsy, and mood disorders.

Polymorphisms of genes coding for ghrelin and its receptor in relation to anthropometry, circulating levels of IGF-I and IGFBP-3, and breast cancer risk: a case-control study nested within the European Prospective Investigation into Cancer and Nutrition (EPIC).

PubMed

Dossus, Laure; McKay, James D; Canzian, Federico; Wilkening, Stefan; Rinaldi, Sabina; Biessy, Carine; Olsen, Anja; Tjønneland, Anne; Jakobsen, Marianne U; Overvad, Kim; Clavel-Chapelon, Françoise; Boutron-Ruault, Marie-Christine; Fournier, Agnes; Linseisen, Jakob; Lukanova, Annekatrin; Boeing, Heiner; Fisher, Eva; Trichopoulou, Antonia; Georgila, Christina; Trichopoulos, Dimitrios; Palli, Domenico; Krogh, Vittorio; Tumino, Rosario; Vineis, Paolo; Quirós, José Ramon; Sala, Núria; Martínez-García, Carmen; Dorronsoro, Miren; Chirlaque, Maria-Dolores; Barricarte, Aurelio; van Duijnhoven, Fränzel J B; Bueno-de-Mesquita, H B; van Gils, Carla H; Peeters, Petra H M; Hallmans, Göran; Lenner, Per; Bingham, Sheila; Khaw, Kay Tee; Key, Tim J; Travis, Ruth C; Ferrari, Pietro; Jenab, Mazda; Riboli, Elio; Kaaks, Rudolf

2008-07-01

Ghrelin, an endogenous ligand for the growth hormone secretagogue receptor, has two major functions: the stimulation of the growth hormone production and the stimulation of food intake. Accumulating evidence also suggests a role of ghrelin in cancer development. We conducted a case-control study on 1359 breast cancer cases and 2389 matched controls, nested within the European Prospective Investigation into Cancer and Nutrition, to examine the association of common genetic variants in the genes coding for ghrelin (GHRL) and its receptor (GHSR) with anthropometric measures, circulating insulin growth factor I (IGF-I) and insulin-like growth factor-binding protein 3 and breast cancer risk. Pair-wise tagging was used to select the 15 polymorphisms that represent the majority of common genetic variants across the GHRL and GHSR genes. A significant increase in breast cancer risk was observed in carriers of the GHRL rs171407-G allele (odds ratio: 1.2; 95% confidence interval: 1.0-1.4; P = 0.02). The GHRL single-nucleotide polymorphism rs375577 was associated with a 5% increase in IGF-I levels (P = 0.01). A number of GHRL and GHSR polymorphisms were associated with body mass index (BMI) and height (P between <0.01 and 0.04). The false-positive report probability (FPRP) approach suggests that these results are noteworthy (FPRP < 0.20). The results presented here add to a growing body of evidence that GHRL variations are associated with BMI. Furthermore, we have observed evidence for association of GHRL polymorphisms with circulating IGF-I levels and with breast cancer risk. These associations, however, might also be due to chance findings and further large studies are needed to confirm our results.

Molecular neurobiology of Drosophila taste

PubMed Central

Freeman, Erica Gene; Dahanukar, Anupama

2015-01-01

Drosophila is a powerful model in which to study the molecular and cellular basis of taste coding. Flies sense tastants via populations of taste neurons that are activated by compounds of distinct categories. The past few years have borne witness to studies that define the properties of taste neurons, identifying functionally distinct classes of sweet and bitter taste neurons that express unique subsets of gustatory receptor (Gr) genes, as well as water, salt, and pheromone sensing neurons that express members of the pickpocket (ppk) or ionotropic receptor (Ir) families. There has also been significant progress in terms of understanding how tastant information is processed and conveyed to higher brain centers, and modulated by prior dietary experience or starvation. PMID:26102453

Mammalian touch catches up

PubMed Central

Walsh, Carolyn M.; Bautista, Diana M.; Lumpkin, Ellen A.

2015-01-01

An assortment of touch receptors innervate the skin and encode different tactile features of the environment. Compared with invertebrate touch and other sensory systems, our understanding of the molecular and cellular underpinnings of mammalian touch lags behind. Two recent breakthroughs have accelerated progress. First, an arsenal of cell-type-specific molecular markers allowed the functional and anatomical properties of sensory neurons to be matched, thereby unraveling a cellular code for touch. Such markers have also revealed key roles of non-neuronal cell types, such as Merkel cells and keratinocytes, in touch reception. Second, the discovery of Piezo genes as a new family of mechanically activated channels has fueled the discovery of molecular mechanisms that mediate and mechanotransduction in mammalian touch receptors. PMID:26100741

The human pregnane X receptor: genomic structure and identification and functional characterization of natural allelic variants.

PubMed

Zhang, J; Kuehl, P; Green, E D; Touchman, J W; Watkins, P B; Daly, A; Hall, S D; Maurel, P; Relling, M; Brimer, C; Yasuda, K; Wrighton, S A; Hancock, M; Kim, R B; Strom, S; Thummel, K; Russell, C G; Hudson, J R; Schuetz, E G; Boguski, M S

2001-10-01

The pregnane X receptor (PXR)/steroid and xenobiotic receptor (SXR) transcriptionally activates cytochrome P4503A4 (CYP3A4) when ligand activated by endobiotics and xenobiotics. We cloned the human PXR gene and analysed the sequence in DNAs of individuals whose CYP3A phenotype was known. The PXR gene spans 35 kb, contains nine exons, and mapped to chromosome 13q11-13. Thirty-eight single nucleotide polymorphisms (SNPs) were identified including six SNPs in the coding region. Three of the coding SNPs are non-synonymous creating new PXR alleles [PXR*2, P27S (79C to T); PXR*3, G36R (106G to A); and PXR*4, R122Q (4321G to A)]. The frequency of PXR*2 was 0.20 in African Americans and was never found in Caucasians. Hepatic expression of CYP3A4 protein was not significantly different between African Americans homozygous for PXR*1 compared to those with one PXR*2 allele. PXR*4 was a rare variant found in only one Caucasian person. Homology modelling suggested that R122Q, (PXR*4) is a direct DNA contact site variation in the third alpha-helix in the DNA binding domain. Compared with PXR*1, and variants PXR*2 and PXR*3, only the variant PXR*4 protein had significantly decreased affinity for the PXR binding sequence in electromobility shift assays and attenuated ligand activation of the CYP3A4 reporter plasmids in transient transfection assays. However, the person heterozygous for PXR*4 is normal for CYP3A4 metabolism phenotype. The relevance of each of the 38 PXR SNPs identified in DNA of individuals whose CYP3A basal and rifampin-inducible CYP3A4 expression was determined in vivo and/or in vitro was demonstrated by univariate statistical analysis. Because ligand activation of PXR and upregulation of a system of drug detoxification genes are major determinants of drug interactions, it will now be useful to extend this work to determine the association of these common PXR SNPs to human variation in induction of other drug detoxification gene targets.

A rare coding variant in TREM2 increases risk for Alzheimer's disease in Han Chinese.

PubMed

Jiang, Teng; Tan, Lan; Chen, Qi; Tan, Meng-Shan; Zhou, Jun-Shan; Zhu, Xi-Chen; Lu, Huan; Wang, Hui-Fu; Zhang, Ying-Dong; Yu, Jin-Tai

2016-06-01

Two recent studies have identified that a rare coding variant (p.R47H) in exon 2 of triggering receptor expressed on myeloid cells 2 (TREM2) gene is associated with Alzheimer's disease (AD) susceptibility in Caucasians. This association was not successfully replicated in Han Chinese, where this variant was rare or even absent. Previously, we resequenced TREM2 exon 2 to investigate whether additional rare variants conferred risk to AD in our cohort. Although several new variants had been identified, none of them was significantly associated with disease susceptibility. Here, to test whether TREM2 is truly a susceptibility gene of AD in Han Chinese, we extend our previous study by sequencing the other four exons of TREM2 in 988 AD patients and 1,354 healthy controls. We provided the first evidence that a rare coding variant (p.H157Y) in TREM2 exon 3 conferred a considerable risk of AD in our cohort (Pcorrected = 0.02, odds ratio = 11.01, 95% confidence interval: 1.38-88.05). This finding indicates that rare coding variants of TREM2 may play an important role in AD in Han Chinese. Copyright © 2016 Elsevier Inc. All rights reserved.

A functional SNP catalog of overlapping miRNA-binding sites in genes implicated in prion disease and other neurodegenerative disorders.

PubMed

Saba, Reuben; Medina, Sarah J; Booth, Stephanie A

2014-10-01

The involvement of SNPs in miRNA target sites remains poorly investigated in neurodegenerative disease. In addition to associations with disease risk, such genetic variations can also provide novel insight into mechanistic pathways that may be responsible for disease etiology and/or pathobiology. To identify SNPs associated specifically with degenerating neurons, we restricted our analysis to genes that are dysregulated in CA1 hippocampal neurons of mice during early, preclinical phase of Prion disease. The 125 genes chosen are also implicated in other numerous degenerative and neurological diseases and disorders and are therefore likely to be of fundamental importance. We predicted those SNPs that could increase, decrease, or have neutral effects on miRNA binding. This group of genes was more likely to possess DNA variants than were genes chosen at random. Furthermore, many of the SNPs are common within the human population, and could contribute to the growing awareness that miRNAs and associated SNPs could account for detrimental neurological states. Interestingly, SNPs that overlapped miRNA-binding sites in the 3'-UTR of GABA-receptor subunit coding genes were particularly enriched. Moreover, we demonstrated that SNP rs9291296 would strengthen miR-26a-5p binding to a highly conserved site in the 3'-UTR of gamma-aminobutyric acid receptor subunit alpha-4. © 2014 WILEY PERIODICALS, INC.

Mapping of the serotonin 5-HT{sub 1D{beta}} autoreceptor gene on chromosome 6 and direct analysis for sequence variants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lappalainen, J.; Dean, M.; Virkkunen, M.

1995-04-24

Abnormal brain serotonin function may be characteristic of several neuropsychiatric disorders. Thus, it is important to identify polymorphic genes and screen for functional variants at loci coding for genes that control normal serotonin functions. 5-HT{sub 1D{beta}} is a terminal serotonin autoreceptor which may play a role in regulating serotonin synthesis and release. Using an SSCP technique we screened for 5-HT{sub 1D{beta}} coding sequence variants in psychiatrically interviewed populations, which included controls, alcoholics, and alcoholic arsonists and alcoholic violent offenders with low CSF concentrations of the main serotonin metabolite 5-HIAA. A common polymorphism was identified in the 5-HT{sub 1D{beta}} gene withmore » allele frequencies of 0.72 and 0.28. The SSCP variant was caused by a silent G to C substitution at nucleotide 861 of the coding region. This polymorphism could also be detected as a HincII RFLP of amplified DNA. DNAs from informative CEPH families were typed for the HincII RFLP and analyzed with respect to 20 linked markers on chromosome 6. Multipoint analysis placed the 5-HT{sub 1D{beta}} receptor gene between markers D6S286 and D6S275. A maximum two-point lod score of 10.90 was obtained to D6S26, which had been previously localized on 6q14-15. Chromosomal aberrations involving this region have been previously shown to cause retinal anomalies, developmental delay, and abnormal brain development. This region also contains the gene for North Carolina-type macular dystrophy. 34 refs., 3 figs., 1 tab.« less

DRD4 dopamine receptor genotype and CSF monoamine metabolites in Finnish alcoholics and controls

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adamson, M.D.; Dean, M.; Goldman, D.

1995-06-19

The DRD4 dopamine receptor is thus far unique among neurotransmitter receptors in having a highly polymorphic gene structure that has been reported to produce altered receptor functioning. These allelic variations are caused by a 48-bp segment in exon III of the coding region which may be repeated from 2-10 times. Varying the numbers of repeated segments changes the length, structure, and, possibly, the functional efficiency of the receptor, which makes this gene an intriguing candidate for variations in dopamine-related behaviors, such as alcoholism and drug abuse. Thus far, these DRD4 alleles have been investigated for association with schizophrenia, bipolar disorder,more » Parkinson`s disease, and chronic alcoholism, and all have been largely negative for a direct association. We evaluated the DRD4 genotype in 226 Finish adult males, 113 of whom were alcoholics, many of the early onset type with features of impulsivity and antisocial traits. Genotype frequencies were compared to 113 Finnish controls who were free of alcohol abuse, substance abuse, and major mental illness. In 70 alcoholics and 20 controls, we measured CSF homovanillic acid (HVA), the major metabolite of dopamine, and 5-hydroxyindoleacetic acid (5-HIAA). No association was found between a particular DRD4 dopamine receptor allele and alcoholism. CSF concentrations of the monoamine metabolites showed no significant difference among the DRD4 genotypes. This study of the DRD4 dopamine receptor in alcoholics is the first to be conducted in a clinically and ethnically homogeneous population and to relate the DRD4 genotype to CSF monoamine concentrations. The results indicate that there is no association of the DRD4 receptor with alcoholism. 52 refs., 3 figs., 1 tab.« less

Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

PubMed

Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

2016-04-28

The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

Axon guidance pathways served as common targets for human speech/language evolution and related disorders.

PubMed

Lei, Huimeng; Yan, Zhangming; Sun, Xiaohong; Zhang, Yue; Wang, Jianhong; Ma, Caihong; Xu, Qunyuan; Wang, Rui; Jarvis, Erich D; Sun, Zhirong

2017-11-01

Human and several nonhuman species share the rare ability of modifying acoustic and/or syntactic features of sounds produced, i.e. vocal learning, which is the important neurobiological and behavioral substrate of human speech/language. This convergent trait was suggested to be associated with significant genomic convergence and best manifested at the ROBO-SLIT axon guidance pathway. Here we verified the significance of such genomic convergence and assessed its functional relevance to human speech/language using human genetic variation data. In normal human populations, we found the affected amino acid sites were well fixed and accompanied with significantly more associated protein-coding SNPs in the same genes than the rest genes. Diseased individuals with speech/language disorders have significant more low frequency protein coding SNPs but they preferentially occurred outside the affected genes. Such patients' SNPs were enriched in several functional categories including two axon guidance pathways (mediated by netrin and semaphorin) that interact with ROBO-SLITs. Four of the six patients have homozygous missense SNPs on PRAME gene family, one youngest gene family in human lineage, which possibly acts upon retinoic acid receptor signaling, similarly as FOXP2, to modulate axon guidance. Taken together, we suggest the axon guidance pathways (e.g. ROBO-SLIT, PRAME gene family) served as common targets for human speech/language evolution and related disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

Gene structure and expression characteristic of a novel odorant receptor gene cluster in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

PubMed

Wang, S-N; Shan, S; Zheng, Y; Peng, Y; Lu, Z-Y; Yang, Y-Q; Li, R-J; Zhang, Y-J; Guo, Y-Y

2017-08-01

Odorant receptors (ORs) expressed in the antennae of parasitoid wasps are responsible for detection of various lipophilic airborne molecules. In the present study, 107 novel OR genes were identified from Microplitis mediator antennal transcriptome data. Phylogenetic analysis of the set of OR genes from M. mediator and Microplitis demolitor revealed that M. mediator OR (MmedOR) genes can be classified into different subfamilies, and the majority of MmedORs in each subfamily shared high sequence identities and clear orthologous relationships to M. demolitor ORs. Within a subfamily, six MmedOR genes, MmedOR98, 124, 125, 126, 131 and 155, shared a similar gene structure and were tightly linked in the genome. To evaluate whether the clustered MmedOR genes share common regulatory features, the transcription profile and expression characteristics of the six closely related OR genes were investigated in M. mediator. Rapid amplification of cDNA ends-PCR experiments revealed that the OR genes within the cluster were transcribed as single mRNAs, and a bicistronic mRNA for two adjacent genes (MmedOR124 and MmedOR98) was also detected in female antennae by reverse transcription PCR. In situ hybridization experiments indicated that each OR gene within the cluster was expressed in a different number of cells. Moreover, there was no co-expression of the two highly related OR genes, MmedOR124 and MmedOR98, which appeared to be individually expressed in a distinct population of neurons. Overall, there were distinct expression profiles of closely related MmedOR genes from the same cluster in M. mediator. These data provide a basic understanding of the olfactory coding in parasitoid wasps. © 2017 The Royal Entomological Society.

AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

Cancer.gov

The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

Stage-specific control of early B cell development by the transcription factor Ikaros

PubMed Central

Gültekin, Sinan; Dakic, Aleksandar; Axelsson, Elin; Minnich, Martina; Ebert, Anja; Werner, Barbara; Roth, Mareike; Cimmino, Luisa; Dickins, Ross A.; Zuber, Johannes; Jaritz, Markus; Busslinger, Meinrad

2018-01-01

Ikaros is an essential regulator of lymphopoiesis. Here, we studied the B-cell-specific function of Ikaros by conditional Ikzf1 inactivation in pro-B cells. B-cell development was arrested at an aberrant ‘pro-B’ cell stage characterized by increased cell adhesion and loss of pre-B cell receptor signaling. Ikaros was found to activate genes coding for pre-BCR signal transducers and to repress genes involved in the downregulation of pre-BCR signaling and upregulation of the integrin signaling pathway. Unexpectedly, derepression of Aiolos expression could not compensate for the loss of Ikaros in pro-B cells. Ikaros induced or suppressed active chromatin at regulatory elements of activated or repressed target genes. Notably, Ikaros binding and target gene expression was dynamically regulated at distinct stages of early B-lymphopoiesis. PMID:24509509

Identification of Developmentally Regulated PCP-Responsive Non-Coding RNA, prt6, in the Rat Thalamus

PubMed Central

Umino, Asami; Nishikawa, Toru

2014-01-01

Schizophrenia and similar psychoses induced by NMDA-type glutamate receptor antagonists, such as phencyclidine (PCP) and ketamine, usually develop after adolescence. Moreover, adult-type behavioral disturbance following NMDA receptor antagonist application in rodents is observed after a critical period at around 3 postnatal weeks. These observations suggest that the schizophrenic symptoms caused by and psychotomimetic effects of NMDA antagonists require the maturation of certain brain neuron circuits and molecular networks, which differentially respond to NMDA receptor antagonists across adolescence and the critical period. From this viewpoint, we have identified a novel developmentally regulated phencyclidine-responsive transcript from the rat thalamus, designated as prt6, as a candidate molecule involved in the above schizophrenia-related systems using a DNA microarray technique. The transcript is a non-coding RNA that includes sequences of at least two microRNAs, miR132 and miR212, and is expressed strongly in the brain and testis, with trace or non-detectable levels in the spleen, heart, liver, kidney, lung and skeletal muscle, as revealed by Northern blot analysis. The systemic administration of PCP (7.5 mg/kg, subcutaneously (s.c.)) significantly elevated the expression of prt6 mRNA in the thalamus at postnatal days (PD) 32 and 50, but not at PD 8, 13, 20, or 24 as compared to saline-treated controls. At PD 50, another NMDA receptor antagonist, dizocilpine (0.5 mg/kg, s.c.), and a schizophrenomimetic dopamine agonist, methamphetamine (4.8 mg/kg, s.c.), mimicked a significant increase in the levels of thalamic prt6 mRNAs, while a D2 dopmamine receptor antagonist, haloperidol, partly inhibited the increasing influence of PCP on thalamic prt6 expression without its own effects. These data indicate that prt6 may be involved in the pathophysiology of the onset of drug-induced schizophrenia-like symptoms and schizophrenia through the possible dysregulation of target genes of the long non-coding RNA or microRNAs in the transcript. PMID:24886782

Evidence for chromosome 2p16.3 polycystic ovary syndrome susceptibility locus in affected women of European ancestry.

PubMed

Mutharasan, Priscilla; Galdones, Eugene; Peñalver Bernabé, Beatriz; Garcia, Obed A; Jafari, Nadereh; Shea, Lonnie D; Woodruff, Teresa K; Legro, Richard S; Dunaif, Andrea; Urbanek, Margrit

2013-01-01

A previous genome-wide association study in Chinese women with polycystic ovary syndrome (PCOS) identified a region on chromosome 2p16.3 encoding the LH/choriogonadotropin receptor (LHCGR) and FSH receptor (FSHR) genes as a reproducible PCOS susceptibility locus. The objective of the study was to determine the role of the LHCGR and/or FSHR gene in the etiology of PCOS in women of European ancestry. This was a genetic association study in a European ancestry cohort of women with PCOS. The study was conducted at an academic medical center. Participants in the study included 905 women with PCOS diagnosed by National Institutes of Health criteria and 956 control women. We genotyped 94 haplotype-tagging single-nucleotide polymorphisms and two coding single-nucleotide polymorphisms mapping to the coding region of LHCGR and FSHR plus 20 kb upstream and downstream of the genes and test for association in the case control cohort and for association with nine quantitative traits in the women with PCOS. We found strong evidence for an association of PCOS with rs7562215 (P = 0.0037) and rs10495960 (P = 0.0046). Although the marker with the strongest association in the Chinese PCOS genome-wide association study (rs13405728) was not informative in the European populations, we identified and genotyped three markers (rs35960650, rs2956355, and rs7562879) within 5 kb of rs13405728. Of these, rs7562879 was nominally associated with PCOS (P = 0.020). The strongest evidence for association mapping to FSHR was observed with rs1922476 (P = 0.0053). Furthermore, markers with the FSHR gene region were associated with FSH levels in women with PCOS. Fine mapping of the chromosome 2p16.3 Chinese PCOS susceptibility locus in a European ancestry cohort provides evidence for association with two independent loci and PCOS. The gene products LHCGR and FSHR therefore are likely to be important in the etiology of PCOS, regardless of ethnicity.

Long non-coding RNAs regulate effects of β-crystallin B2 on mouse ovary development.

PubMed

Gao, Qian; Ren, Hanxiao; Chen, Mingkun; Niu, Ziguang; Tao, Haibo; Jia, Yin; Zhang, Jianrong; Li, Wenjie

2016-11-01

β-crystallin B2 (CRYBB2) knockout mice exhibit morphological and functional abnormalities in the ovary. Long non‑coding RNAs (lncRNAs) regulate gene transcription and translation, and epigenetic modification of genomic DNA. The present study investigated the role of lncRNAs in mediating the effects of CRYBB2 in the regulation of ovary development in mice. In the current study, ovary tissues from wild‑type (WT) and CRYBB2 knockout mice were subjected to lncRNA and mRNA microarray profiling. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to group the differentially expressed lncRNAs into regulated gene pathways and functions. The correlation matrix method was used to establish a network of lncRNA and mRNA co‑expression. Quantitative reverse transcription-polymerase chain reaction (RT‑qPCR) was used to verify expression of a number of these differentially expressed lncRNAs and mRNAs. There were 157 differentially expressed lncRNAs and 1,085 differentially expressed mRNAs between ovary tissues from WT and CRYBB2 knockout mice. The GO and KEGG analyses indicated that these differentially expressed lncRNAs and mRNAs were important in Ca2+ signaling and ligand and receptor interactions. The correlation matrix method established an lncRNA and mRNA co‑expression network, consisting of 53 lncRNAs and 45 mRNAs with 98 nodes and 75 connections. RT‑qPCR confirmed downregulation of lncRNA A‑30‑P01019163 expression, which further downregulated its downstream gene purinergic receptor P2X, ligand‑gated ion channel, 7 (P2rx7) expression in ovary tissues from CRYBB2 knockout mice. In conclusion, CRYBB2 regulates expression of different lncRNAs to influence ovary development. lncRNA A‑30‑P01019163 may affect ovarian cell cycle and proliferation by regulating P2rx7 expression in the ovary.

Dimerization drives EGFR endocytosis through two sets of compatible endocytic codes.

PubMed

Wang, Qian; Chen, Xinmei; Wang, Zhixiang

2015-03-01

We have shown previously that epidermal growth factor (EGF) receptor (EGFR) endocytosis is controlled by EGFR dimerization. However, it is not clear how the dimerization drives receptor internalization. We propose that EGFR endocytosis is driven by dimerization, bringing two sets of endocytic codes, one contained in each receptor monomer, in close proximity. Here, we tested this hypothesis by generating specific homo- or hetero-dimers of various receptors and their mutants. We show that ErbB2 and ErbB3 homodimers are endocytosis deficient owing to the lack of endocytic codes. Interestingly, EGFR-ErbB2 or EGFR-ErbB3 heterodimers are also endocytosis deficient. Moreover, the heterodimer of EGFR and the endocytosis-deficient mutant EGFRΔ1005-1017 is also impaired in endocytosis. These results indicate that two sets of endocytic codes are required for receptor endocytosis. We found that an EGFR-PDGFRβ heterodimer is endocytosis deficient, although both EGFR and PDGFRβ homodimers are endocytosis-competent, indicating that two compatible sets of endocytic codes are required. Finally, we found that to mediate the endocytosis of the receptor dimer, the two sets of compatible endocytic codes, one contained in each receptor molecule, have to be spatially coordinated. © 2015. Published by The Company of Biologists Ltd.

Genetic evidence for role of integration of fast and slow neurotransmission in schizophrenia.

PubMed

Devor, A; Andreassen, O A; Wang, Y; Mäki-Marttunen, T; Smeland, O B; Fan, C-C; Schork, A J; Holland, D; Thompson, W K; Witoelar, A; Chen, C-H; Desikan, R S; McEvoy, L K; Djurovic, S; Greengard, P; Svenningsson, P; Einevoll, G T; Dale, A M

2017-06-01

The most recent genome-wide association studies (GWAS) of schizophrenia (SCZ) identified hundreds of risk variants potentially implicated in the disease. Further, novel statistical methodology designed for polygenic architecture revealed more potential risk variants. This can provide a link between individual genetic factors and the mechanistic underpinnings of SCZ. Intriguingly, a large number of genes coding for ionotropic and metabotropic receptors for various neurotransmitters-glutamate, γ-aminobutyric acid (GABA), dopamine, serotonin, acetylcholine and opioids-and numerous ion channels were associated with SCZ. Here, we review these findings from the standpoint of classical neurobiological knowledge of neuronal synaptic transmission and regulation of electrical excitability. We show that a substantial proportion of the identified genes are involved in intracellular cascades known to integrate 'slow' (G-protein-coupled receptors) and 'fast' (ionotropic receptors) neurotransmission converging on the protein DARPP-32. Inspection of the Human Brain Transcriptome Project database confirms that that these genes are indeed expressed in the brain, with the expression profile following specific developmental trajectories, underscoring their relevance to brain organization and function. These findings extend the existing pathophysiology hypothesis by suggesting a unifying role of dysregulation in neuronal excitability and synaptic integration in SCZ. This emergent model supports the concept of SCZ as an 'associative' disorder-a breakdown in the communication across different slow and fast neurotransmitter systems through intracellular signaling pathways-and may unify a number of currently competing hypotheses of SCZ pathophysiology.

Extracellular nucleotide and nucleoside signaling in vascular and blood disease

PubMed Central

Idzko, Marco; Ferrari, Davide; Riegel, Ann-Kathrin

2014-01-01

Nucleotides and nucleosides—such as adenosine triphosphate (ATP) and adenosine—are famous for their intracellular roles as building blocks for the genetic code or cellular energy currencies. In contrast, their function in the extracellular space is different. Here, they are primarily known as signaling molecules via activation of purinergic receptors, classified as P1 receptors for adenosine or P2 receptors for ATP. Because extracellular ATP is rapidly converted to adenosine by ectonucleotidase, nucleotide-phosphohydrolysis is important for controlling the balance between P2 and P1 signaling. Gene-targeted mice for P1, P2 receptors, or ectonucleotidase exhibit only very mild phenotypic manifestations at baseline. However, they demonstrate alterations in disease susceptibilities when exposed to a variety of vascular or blood diseases. Examples of phenotypic manifestations include vascular barrier dysfunction, graft-vs-host disease, platelet activation, ischemia, and reperfusion injury or sickle cell disease. Many of these studies highlight that purinergic signaling events can be targeted therapeutically. PMID:25001468

H-FABP and LEPR gene expression profile in skeletal muscles and liver during ontogenesis in various breeds of pigs.

PubMed

Tyra, M; Ropka-Molik, K; Eckert, R; Piórkowska, K; Oczkowicz, M

2011-04-01

The genes coding for H-FABP (heart acid-binding protein) and LEPR (leptin receptor) are considered to be candidates for lipid metabolism and thus affect fat deposition in pigs. The aim of our study was to assess the amount of H-FABP and LEPR transcript in the skeletal muscles (m. longissimus dorsi, m. semimembranosus) and liver of pigs of various ages. The experiments were carried out on 5 popular breeds of swine raised in Poland which exhibit different levels of fat tissue. Furthermore, we examined the effect of H-FABP and LEPR genotypes (HinfI, HpaII, and HaeIII for H-FABP and HpaII for LEPR) on the expression abundance of these genes. We confirmed a statistically significant relationship between the breed (P<.001), type of tissue (LEPR P<.001; H-FABP P<.01), and age of the animal (P<.05) on the abundance of mRNA transcript of both genes. In all breeds, the expression of the leptin receptor gene increased significantly (P<.01) with age in muscle tissue, whereas this relationship was not observed in liver tissue. However, the expression of the H-FABP gene in muscles did not change with age or breed, although in the liver expression levels were high in young (60 and 90 d) pigs. In conclusion, H-FABP and LEPR genes are strongly related to the development and function of fat tissue in pigs. Copyright © 2011 Elsevier Inc. All rights reserved.

Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary.

PubMed

Liu, Y; Lin, L; Zarnegar, R

1994-09-01

Hepatocyte growth factor (HGF) is expressed in a variety of tissues and cell types under normal conditions and in response to various stimuli such as tissue injury. In the present study, we demonstrate that the transcription of the HGF gene is stimulated by estrogen in mouse ovary. A single injection of 17 beta-estradiol results in a dramatic and transient elevation of the levels of mouse HGF mRNA. Sequence analysis has found that two putative estrogen responsive elements (ERE) reside at -872 in the 5'-flanking region and at +511 in the first intron, respectively, of the mouse HGF gene. To test whether these ERE elements are responsible for estrogen induction of HGF gene expression, chimeric plasmids containing variable regions of the 5'-flanking sequence of HGF gene and the coding region for chloramphenicol acetyltransferase (CAT) gene were transiently transfected into both human endometrial carcinoma RL 95-2 cells and mouse fibroblast NIH 3T3 cells to assess hormone responsiveness. Transfection results indicate that the ERE elements of the mouse HGF gene can confer estrogen action to either homologous or heterologous promoters. Nuclear protein extracts either from RL95-2 cells transfected with the estrogen receptor expression vector or from mouse liver bound in vitro to ERE elements specifically, as shown by band shift assay. Therefore, our results demonstrate that the HGF gene is transcriptionally regulated by estrogen in mouse ovary; and such regulation is mediated via a direct interaction of the estrogen receptor complex with cis-acting ERE elements identified in the mouse HGF gene.

Autism gene variant causes hyperserotonemia, serotonin receptor hypersensitivity, social impairment and repetitive behavior.

PubMed

Veenstra-VanderWeele, Jeremy; Muller, Christopher L; Iwamoto, Hideki; Sauer, Jennifer E; Owens, W Anthony; Shah, Charisma R; Cohen, Jordan; Mannangatti, Padmanabhan; Jessen, Tammy; Thompson, Brent J; Ye, Ran; Kerr, Travis M; Carneiro, Ana M; Crawley, Jacqueline N; Sanders-Bush, Elaine; McMahon, Douglas G; Ramamoorthy, Sammanda; Daws, Lynette C; Sutcliffe, James S; Blakely, Randy D

2012-04-03

Fifty years ago, increased whole-blood serotonin levels, or hyperserotonemia, first linked disrupted 5-HT homeostasis to Autism Spectrum Disorders (ASDs). The 5-HT transporter (SERT) gene (SLC6A4) has been associated with whole blood 5-HT levels and ASD susceptibility. Previously, we identified multiple gain-of-function SERT coding variants in children with ASD. Here we establish that transgenic mice expressing the most common of these variants, SERT Ala56, exhibit elevated, p38 MAPK-dependent transporter phosphorylation, enhanced 5-HT clearance rates and hyperserotonemia. These effects are accompanied by altered basal firing of raphe 5-HT neurons, as well as 5HT(1A) and 5HT(2A) receptor hypersensitivity. Strikingly, SERT Ala56 mice display alterations in social function, communication, and repetitive behavior. Our efforts provide strong support for the hypothesis that altered 5-HT homeostasis can impact risk for ASD traits and provide a model with construct and face validity that can support further analysis of ASD mechanisms and potentially novel treatments.

Looking for reward in all the wrong places: dopamine receptor gene polymorphisms indirectly affect aggression through sensation-seeking.

PubMed

Chester, David S; DeWall, C Nathan; Derefinko, Karen J; Estus, Steven; Lynam, Donald R; Peters, Jessica R; Jiang, Yang

2016-10-01

Individuals with genotypes that code for reduced dopaminergic brain activity often exhibit a predisposition toward aggression. However, it remains largely unknown how dopaminergic genotypes may increase aggression. Lower-functioning dopamine systems motivate individuals to seek reward from external sources such as illicit drugs and other risky experiences. Based on emerging evidence that aggression is a rewarding experience, we predicted that the effect of lower-functioning dopaminergic functioning on aggression would be mediated by tendencies to seek the environment for rewards. Caucasian female and male undergraduates (N = 277) were genotyped for five polymorphisms of the dopamine D2 receptor (DRD2) gene; they reported their previous history of aggression and their dispositional reward-seeking. Lower-functioning DRD2 profiles were associated with greater sensation-seeking, which then predicted greater aggression. Our findings suggest that lower-functioning dopaminergic activity puts individuals at risk for violence because it motivates them to experience aggression's hedonically rewarding qualities.

Lysophosphatidic acid as a lipid mediator with multiple biological actions.

PubMed

Aikawa, Shizu; Hashimoto, Takafumi; Kano, Kuniyuki; Aoki, Junken

2015-02-01

Lysophosphatidic acid (LPA) is one of the simplest glycerophospholipids with one fatty acid chain and a phosphate group as a polar head. Although LPA had been viewed just as a metabolic intermediate in de novo lipid synthetic pathways, it has recently been paid much attention as a lipid mediator. LPA exerts many kinds of cellular processes, such as cell proliferation and smooth muscle contraction, through cognate G protein-coupled receptors. Because lipids are not coded by the genome directly, it is difficult to know their patho- and physiological roles. However, recent studies have identified several key factors mediating the biological roles of LPA, such as receptors and producing enzymes. In addition, studies of transgenic and gene knockout animals for these LPA-related genes, have revealed the biological significance of LPA. In this review we will summarize recent advances in the studies of LPA production and its roles in both physiological and pathological conditions. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

ERβ regulates miR-21 expression and inhibits invasion and metastasis in cancer cells

NASA Astrophysics Data System (ADS)

Tian, Junmei; Tu, Zhenzhen; Chen, Wei R.; Gu, Yueqing

2012-03-01

In human, estrogens play important roles in many physiological processes, and is also found to be connected with numerous cancers. In these diseases, estrogen mediates its effects through the estrogen receptor (ER), which serves as the basis for many current clinical diagnosis. Two forms of the estrogen receptor have been identified, ERα and ERβ, and show different and specific functions. The two estrogen receptors belong to a family of ligand-regulated transcription factors. Estrogen via ERα stimulates proliferation in the breast, uterus, and developing prostate, while estrogen via ERβ inhibits proliferation and promotes differentiation in the prostate, mammary gland, colon, lung, and bone marrow stem cells. MicroRNAs (miRs) are small non-coding RNA molecules that occur naturally and downregulate protein expression by translational blockade of the target mRNA or by promoting mRNA decay. MiR-21 is one of the most studied miRNAs in cancers. MiR-21 is overexpressed in the most solid tumors, promoting progression and metastasis. The miR-21 gene is located on the chromosome 17, in the 10th intron of a protein-coding gene, TMEM49. While, the function of TMEM49 is currently unknown. Our experiment is designed to identity the relationship between miR-21 and ERβ in cancer progression. The human cancer cells were transfected with ERβ. Real-time PCR analysis showed that the expression level of miR-21 was significantly inhibited down by ERβ treatment. As MTT assay showed the tumor cell survival rate was also inhibited significantly. Go/Gl phase cell cycle arrest was founded and tumor cell apoptosis was induced in ERβ group.

Compound heterozygous mutations in the SRD5A2 gene exon 4 in a male pseudohermaphrodite patient of Chinese origin.

PubMed

Fernández-Cancio, Mónica; Nistal, Manuel; Gracia, Ricardo; Molina, M Antonia; Tovar, Juan Antonio; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

2004-01-01

The goal of this study was to perform 5-alpha-reductase type 2 gene (SRD5A2) analysis in a male pseudohermaphrodite (MPH) patient with normal testosterone (T) production and normal androgen receptor (AR) gene coding sequences. A patient of Chinese origin with ambiguous genitalia at 14 months, a 46,XY karyotype, and normal T secretion under human chorionic gonadotropin (hCG) stimulation underwent a gonadectomy at 20 months. Exons 1-8 of the AR gene and exons 1-5 of the SRD5A2 gene were sequenced from peripheral blood DNA. AR gene coding sequences were normal. SRD5A2 gene analysis revealed 2 consecutive mutations in exon 4, each located in a different allele: 1) a T nucleotide deletion, which predicts a frameshift mutation from codon 219, and 2) a missense mutation at codon 227, where the substitution of guanine (CGA) by adenine (CAA) predicts a glutamine replacement of arginine (R227Q). Testes located in the inguinal canal showed a normal morphology for age. The patient was a compound heterozygote for SRD5A2 mutations, carrying 2 mutations in exon 4. The patient showed an R227Q mutation that has been described in an Asian population and MPH patients, along with a novel frameshift mutation, Tdel219. Testis morphology showed that, during early infancy, the 5-alpha-reductase enzyme deficiency may not have affected interstitial or tubular development.

Implication of common and disease specific variants in CLU, CR1, and PICALM.

PubMed

Ferrari, Raffaele; Moreno, Jorge H; Minhajuddin, Abu T; O'Bryant, Sid E; Reisch, Joan S; Barber, Robert C; Momeni, Parastoo

2012-08-01

Two recent genome-wide association studies (GWAS) for late onset Alzheimer's disease (LOAD) revealed 3 new genes: clusterin (CLU), phosphatidylinositol binding clathrin assembly protein (PICALM), and complement receptor 1 (CR1). In order to evaluate association with these genome-wide association study-identified genes and to isolate the variants contributing to the pathogenesis of LOAD, we genotyped the top single nucleotide polymorphisms (SNPs), rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), and sequenced the entire coding regions of these genes in our cohort of 342 LOAD patients and 277 control subjects. We confirmed the association of rs3851179 (PICALM) (p = 7.4 × 10(-3)) with the disease status. Through sequencing we identified 18 variants in CLU, 3 of which were found exclusively in patients; 8 variants (out of 65) in CR1 gene were only found in patients and the 16 variants identified in PICALM gene were present in both patients and controls. In silico analysis of the variants in PICALM did not predict any damaging effect on the protein. The haplotype analysis of the variants in each gene predicted a common haplotype when the 3 single nucleotide polymorphisms rs11136000 (CLU), rs3818361 (CR1), and rs3851179 (PICALM), respectively, were included. For each gene the haplotype structure and size differed between patients and controls. In conclusion, we confirmed association of CLU, CR1, and PICALM genes with the disease status in our cohort through identification of a number of disease-specific variants among patients through the sequencing of the coding region of these genes. Published by Elsevier Inc.

Expression of drought tolerance genes in tropical upland rice cultivars (Oryza sativa).

PubMed

Silveira, R D D; Abreu, F R M; Mamidi, S; McClean, P E; Vianello, R P; Lanna, A C; Carneiro, N P; Brondani, C

2015-07-27

Gene expression related to drought response in the leaf tissues of two Brazilian upland cultivars, the drought-tolerant Douradão and the drought-sensitive Primavera, was analyzed. RNA-seq identified 27,618 transcripts in the Douradão cultivar, with 24,090 (87.2%) homologous to the rice database, and 27,221 transcripts in the Primavera cultivar, with 23,663 (86.9%) homologous to the rice database. Gene-expression analysis between control and water-deficient treatments revealed 493 and 1154 differentially expressed genes in Douradão and Primavera cultivars, respectively. Genes exclusively expressed under drought were identified for Douradão, including two genes of particular interest coding for the protein peroxidase precursor, which is involved in three distinct metabolic pathways. Comparisons between the two drought-exposed cultivars revealed 2314 genes were differentially expressed (978 upregulated, 1336 downregulated in Douradão). Six genes distributed across 4 different transcription factor families (bHLH, MYB, NAC, and WRKY) were identified, all of which were upregulated in Douradão compared to Primavera during drought. Most of the genes identified in Douradão activate metabolic pathways responsible for production of secondary metabolites and genes coding for enzymatically active signaling receptors. Quantitative PCR validation showed that most gene expression was in agreement with computational prediction of these transcripts. The transcripts identified here will define molecular markers for identification of Cis-acting elements to search for allelic variants of these genes through analysis of polymorphic SNPs in GenBank accessions of upland rice, aiming to develop cultivars with the best combination of these alleles, resulting in materials with high yield potential in the event of drought during the reproductive phase.

Variants in the CNR1 gene predispose to headache with nausea in the presence of life stress.

PubMed

Juhasz, G; Csepany, E; Magyar, M; Edes, A E; Eszlari, N; Hullam, G; Antal, P; Kokonyei, G; Anderson, I M; Deakin, J F W; Bagdy, G

2017-03-01

One of the main effects of the endocannabinoid system in the brain is stress adaptation with presynaptic endocannabinoid receptor 1 (CB1 receptors) playing a major role. In the present study, we investigated whether the effect of the CB1 receptor coding CNR1 gene on migraine and its symptoms is conditional on life stress. In a cross-sectional European population (n = 2426), recruited from Manchester and Budapest, we used the ID-Migraine questionnaire for migraine screening, the Life Threatening Experiences questionnaire to measure recent negative life events (RLE), and covered the CNR1 gene with 11 SNPs. The main genetic effects and the CNR1 × RLE interaction with age and sex as covariates were tested. None of the SNPs showed main genetic effects on possible migraine or its symptoms, but 5 SNPs showed nominally significant interaction with RLE on headache with nausea using logistic regression models. The effect of rs806366 remained significant after correction for multiple testing and replicated in the subpopulations. This effect was independent from depression- and anxiety-related phenotypes. In addition, a Bayesian systems-based analysis demonstrated that in the development of headache with nausea all SNPs were more relevant with higher a posteriori probability in those who experienced recent life stress. In summary, the CNR1 gene in interaction with life stress increased the risk of headache with nausea suggesting a specific pathological mechanism to develop migraine, and indicating that a subgroup of migraine patients, who suffer from life stress triggered migraine with frequent nausea, may benefit from therapies that increase the endocannabinoid tone. © 2016 The Authors. Genes, Brain and Behavior published by International Behavioural and Neural Genetics Society and John Wiley & Sons Ltd.

Molecular cloning, expression profile, polymorphism and the genetic effects of the dopamine D1 receptor gene on duck reproductive traits.

PubMed

Wang, Cui; Li, Shijun; Li, Chuang; Feng, Yanping; Peng, Xiuli; Gong, Yanzhang

2012-09-01

The dopamine D1 receptor (DRD1), a member of the dopamine receptor (DR) gene family, participates in the regulation of reproductive behaviors in birds. In this study, a 1,390 bp fragment covering the complete coding region (CDS) of duck DRD1 gene was obtained. The cDNA (GenBank: JQ346726) contains a 1,353 bp CDS and a 37 bp 3'- UTR including a TGA termination codon (nucleotides 1,354-1,356 bp). The duck DRD1 shares about 76-96 % nucleic acid identity and 82-98 % amino acid identity with their counterparts in other species. A phylogenetic tree based on amino acid sequences displays that duck DRD1 protein is closely related with those of chicken and zebra finch. The quantitative real-time PCR analysis indicates that the DRD1 mRNA is widely expressed in all examined tissues. Five single nucleotide polymorphisms (SNPs) (c.189A > T, c.507C > T, c.681C > T, c.765A > T, c.1044A > G) in the CDS of duck DRD1 gene were indentified, c.681C > T and c.765A > T were genotyped and analyzed in a two generations duck population by using of PCR-RFLP. Association analysis demonstrated that the c.681C > T genotypes were significantly associated with body weight at sexual maturity (when laying their first egg) (P < 0.01), egg production within 360 days (P < 0.05) and 420 days (P < 0.01); the c.765A > T genotypes were significantly associated with egg shape index and egg shell strength (P < 0.05). Those results suggest that the DRD1 gene may be a potential genetic marker to improve some reproductive traits in ducks.

Weaker control of the electrical properties of cerebellar granule cells by tonically active GABAA receptors in the Ts65Dn mouse model of Down’s syndrome

PubMed Central

2013-01-01

Background Down’s syndrome (DS) is caused by triplication of all or part of human chromosome 21 and is characterized by a decrease in the overall size of the brain. One of the brain regions most affected is the cerebellum, in which the number of granule cells (GCs) is markedly decreased. GCs process sensory information entering the cerebellum via mossy fibres and pass it on to Purkinje cells and inhibitory interneurons. How GCs transform incoming signals depends on their input–output relationship, which is adjusted by tonically active GABAA receptor channels. Results We report that in the Ts65Dn mouse model of DS, in which cerebellar volume and GC number are decreased as in DS, the tonic GABAA receptor current in GCs is smaller than in wild-type mice and is less effective in moderating input resistance and raising the minimum current required for action potential firing. We also find that tonically active GABAA receptors curb the height and broaden the width of action potentials in wild-type GCs but not in Ts65Dn GCs. Single-cell real-time quantitative PCR reveals that these electrical differences are accompanied by decreased expression of the gene encoding the GABAA receptor β3 subunit but not genes coding for some of the other GABAA receptor subunits expressed in GCs (α1, α6, β2 and δ). Conclusions Weaker moderation of excitability and action potential waveform in GCs of the Ts65Dn mouse by tonically active GABAA receptors is likely to contribute to atypical transfer of information through the cerebellum. Similar changes may occur in DS. PMID:23870245

SNPs of melanocortin 4 receptor (MC4R) associated with body weight in Beagle dogs.

PubMed

Zeng, Ruixia; Zhang, Yibo; Du, Peng

2014-01-01

Melanocortin 4 receptor (MC4R), which is associated with inherited human obesity, is involoved in food intake and body weight of mammals. To study the relationships between MC4R gene polymorphism and body weight in Beagle dogs, we detected and compared the nucleotide sequence of the whole coding region and 3'- and 5'- flanking regions of the dog MC4R gene (1214 bp). In 120 Beagle dogs, two SNPs (A420C, C895T) were identified and their relation with body weight was analyzed with RFLP-PCR method. The results showed that the SNP at A420C was significantly associated with canine body weight trait when it changed amino acid 101 of the MC4R protein from asparagine to threonine, while canine body weight variations were significant in female dogs when MC4R nonsense mutation at C895T. It suggested that the two SNPs might affect the MC4R gene's function which was relative to body weight in Beagle dogs. Therefore, MC4R was a candidate gene for selecting different size dogs with the MC4R SNPs (A420C, C895T) being potentially valuable as a genetic marker.

The nicotinic acetylcholine receptor gene family of the silkworm, Bombyx mori

PubMed Central

Shao, Ya-Ming; Dong, Ke; Zhang, Chuan-Xi

2007-01-01

Background Nicotinic acetylcholine receptors (nAChRs) mediate fast synaptic cholinergic transmission in the insect central nervous system. The insect nAChR is the molecular target of a class of insecticides, neonicotinoids. Like mammalian nAChRs, insect nAChRs are considered to be made up of five subunits, coded by homologous genes belonging to the same family. The nAChR subunit genes of Drosophila melanogaster, Apis mellifera and Anopheles gambiae have been cloned previously based on their genome sequences. The silkworm Bombyx mori is a model insect of Lepidoptera, among which are many agricultural pests. Identification and characterization of B. mori nAChR genes could provide valuable basic information for this important family of receptor genes and for the study of the molecular mechanisms of neonicotinoid action and resistance. Results We searched the genome sequence database of B. mori with the fruit fly and honeybee nAChRs by tBlastn and cloned all putative silkworm nAChR cDNAs by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. B. mori appears to have the largest known insect nAChR gene family to date, including nine α-type subunits and three β-type subunits. The silkworm possesses three genes having low identity with others, including one α and two β subunits, α9, β2 and β3. Like the fruit fly and honeybee counterparts, silkworm nAChR gene α6 has RNA-editing sites, and α4, α6 and α8 undergo alternative splicing. In particular, alternative exon 7 of Bmα8 may have arisen from a recent duplication event. Truncated transcripts were found for Bmα4 and Bmα5. Conclusion B. mori possesses a largest known insect nAChR gene family characterized to date, including nine α-type subunits and three β-type subunits. RNA-editing, alternative splicing and truncated transcripts were found in several subunit genes, which might enhance the diversity of the gene family. PMID:17868469

Interactions between the two surface proteins of rotavirus may alter the receptor-binding specificity of the virus.

PubMed Central

Méndez, E; Arias, C F; López, S

1996-01-01

The infection of target cells by most animal rotavirus strains requires the presence of sialic acids (SAs) on the cell surface. We recently isolated variants from simian rotavirus RRV whose infectivity is no longer dependent on SAs and showed that the mutant phenotype segregates with the gene coding for VP4, one of the two surface proteins of rotaviruses (the other one being VP7). The nucleotide sequence of the VP4 gene of four independently isolated variants showed three amino acid changes, at positions 37 (Leu to Pro), 187 (Lys to Arg), and 267 (Tyr to Cys), in all mutant VP4 proteins compared with RRV VP4. The characterization of revertant viruses from two independent mutants showed that the arginine residue at position 187 changed back to lysine, indicating that this amino acid is involved in the determination of the mutant phenotype. Surprisingly, sequence analysis of reassortant virus DS1XRRV, which depends on SAs to infect the cell, showed that its VP4 gene is identical to the VP4 gene of the variants. Since the only difference between DS1XRRV and the RRV variants is the parental origin of the VP7 gene (human rotavirus DS1 in the reassortant), these findings suggest that the receptor-binding specificity of rotaviruses, via VP4, may be influenced by the associated VP7 protein. PMID:8551583

From the ultrasonic to the infrared: molecular evolution and the sensory biology of bats

PubMed Central

Jones, Gareth; Teeling, Emma C.; Rossiter, Stephen J.

2013-01-01

Great advances have been made recently in understanding the genetic basis of the sensory biology of bats. Research has focused on the molecular evolution of candidate sensory genes, genes with known functions [e.g., olfactory receptor (OR) genes] and genes identified from mutations associated with sensory deficits (e.g., blindness and deafness). For example, the FoxP2 gene, underpinning vocal behavior and sensorimotor coordination, has undergone diversification in bats, while several genes associated with audition show parallel amino acid substitutions in unrelated lineages of echolocating bats and, in some cases, in echolocating dolphins, representing a classic case of convergent molecular evolution. Vision genes encoding the photopigments rhodopsin and the long-wave sensitive opsin are functional in bats, while that encoding the short-wave sensitive opsin has lost functionality in rhinolophoid bats using high-duty cycle laryngeal echolocation, suggesting a sensory trade-off between investment in vision and echolocation. In terms of olfaction, bats appear to have a distinctive OR repertoire compared with other mammals, and a gene involved in signal transduction in the vomeronasal system has become non-functional in most bat species. Bitter taste receptors appear to have undergone a “birth-and death” evolution involving extensive gene duplication and loss, unlike genes coding for sweet and umami tastes that show conservation across most lineages but loss in vampire bats. Common vampire bats have also undergone adaptations for thermoperception, via alternative splicing resulting in the evolution of a novel heat-sensitive channel. The future for understanding the molecular basis of sensory biology is promising, with great potential for comparative genomic analyses, studies on gene regulation and expression, exploration of the role of alternative splicing in the generation of proteomic diversity, and linking genetic mechanisms to behavioral consequences. PMID:23755015

Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

PubMed Central

Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

2000-01-01

OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

A Zn-Dependent Metallopeptidase Is Responsible for Sensitivity to LsbB, a Class II Leaderless Bacteriocin of Lactococcus lactis subsp. lactis BGMN1-5

PubMed Central

Uzelac, Gordana; Lozo, Jelena; Aleksandrzak-Piekarczyk, Tamara; Gabrielsen, Christina; Kristensen, Tom; Nes, Ingolf F.; Diep, Dzung B.; Topisirovic, Ljubisa

2013-01-01

Lactococcus lactis subsp. lactis BGMN1-5 produces a leaderless class II bacteriocin called LsbB. To identify the receptor for LsbB, a cosmid library of the LsbB-sensitive strain BGMN1-596 was constructed. About 150 cosmid clones were individually isolated and transferred to LsbB-resistant mutants of BGMN1-596. Cosmid pAZILcos/MN2, carrying a 40-kb insert, was found to restore LsbB sensitivity in LsbB-resistant mutants. Further subcloning revealed that a 1.9-kb fragment, containing only one open reading frame, was sufficient to restore sensitivity. The fragment contains the gene yvjB coding for a Zn-dependent membrane-bound metallopeptidase, suggesting that this gene may serve as the receptor for LsbB. Further support for this notion derives from several independent experiments: (i) whole-genome sequencing confirmed that all LsbB-resistant mutants contain mutations in yvjB; (ii) disruption of yvjB by direct gene knockout rendered sensitive strains BGMN1-596 and IL1403 resistant to LsbB; and (iii) most compellingly, heterologous expression of yvjB in naturally resistant strains of other species, such as Lactobacillus paracasei and Enterococcus faecalis, also rendered them sensitive to the bacteriocin. To our knowledge, this is the first time a membrane-bound peptidase gene has been shown to be involved in bacteriocin sensitivity in target cells. We also demonstrated a novel successful approach for identifying bacteriocin receptors. PMID:24123824

The molecular mechanism of human resistance to HIV-1 infection in persistently infected individuals--a review, hypothesis and implications.

PubMed

Becker, Yechiel

2005-08-01

Resistance to HIV-1 infection in Europeans is associated with a mutation in the gene that codes for the CCR5 protein that is present in Th2 cells and serves as a coreceptor for HIV-1 R5 strain. A deletion of 32 amino acids from the cytokine receptor prevents infection. This mutation prevails in Europeans and is absent in Africans. However, duplication of a gene that codes for a chemokine that binds to the CCR5 was discovered in Africans (mean gene copy 6 while in non-Africans the mean gene copy is 3). Higher expression of these genes protects T cells against HIV-1 infection in vitro. It should be noted that resistance to HIV-1 R5 variant does not protect against HIV-1 R4 variant. It was reported that a minority of highly HIV-1 exposed African professional sex workers (APSW) were resistant to the virus infection during a 10 years period. Recently, the analysis of the cytokines in the serum of the persistently infected seronegative women revealed that the latter hypo-expresses the cytokine IL-4. Since the molecular events during HIV-1 infection are associated with a marked increase in the levels of IL-4 and IgE in the sera of the infected individuals, it suggests that AIDS is an allergy. Thus, a very low level of IL-4 production may abrogate the virus infection. Studies on the human IL-4 gene revealed that together with the IL-4 mRNA a spliced variant with a deletion of exon 2 is synthesized. The latter is a natural antagonist of IL-4 and when expressed in an individual at a level higher than IL-4, the person will resist a microbial infection (e.g. Mycobacterium tuberculosis) or asthma. The present hypothesis suggests that the HIV-1 resistant APSWs produce more IL-4 delta 2 molecules than IL-4 molecules. The binding of IL-4 delta 2 to IL-4 receptors on T and B cells prevents their functions and the infection by HIV-1. The implications of these studies are that treatment of HIV-1 infected people with drugs that will block the IL-4 receptors will stop HIV-1 infections and the determination of the levels of IL-4 and IL-4 delta 2 in the sera of HIV-1+ patients will enable to identify the individuals that have a natural resistance to HIV-l/AIDS and those who need treatments.

Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.

PubMed

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.

Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview

PubMed Central

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582

A Genetic Basis for Functional Hypothalamic Amenorrhea

PubMed Central

Caronia, Lisa M.; Martin, Cecilia; Welt, Corrine K.; Sykiotis, Gerasimos P.; Quinton, Richard; Thambundit, Apisadaporn; Avbelj, Magdalena; Dhruvakumar, Sadhana; Plummer, Lacey; Hughes, Virginia A.; Seminara, Stephanie B.; Boepple, Paul A.; Sidis, Yisrael; Crowley, William F.; Martin, Kathryn A.; Hall, Janet E.; Pitteloud, Nelly

2011-01-01

BACKGROUND Functional hypothalamic amenorrhea is a reversible form of gonadotropin-releasing hormone (GnRH) deficiency commonly triggered by stressors such as excessive exercise, nutritional deficits, or psychological distress. Women vary in their susceptibility to inhibition of the reproductive axis by such stressors, but it is unknown whether this variability reflects a genetic predisposition to hypothalamic amenorrhea. We hypothesized that mutations in genes involved in idiopathic hypogonadotropic hypogonadism, a congenital form of GnRH deficiency, are associated with hypothalamic amenorrhea. METHODS We analyzed the coding sequence of genes associated with idiopathic hypogonadotropic hypogonadism in 55 women with hypothalamic amenorrhea and performed in vitro studies of the identified mutations. RESULTS Six heterozygous mutations were identified in 7 of the 55 patients with hypothalamic amenorrhea: two variants in the fibroblast growth factor receptor 1 gene FGFR1 (G260E and R756H), two in the prokineticin receptor 2 gene PROKR2 (R85H and L173R), one in the GnRH receptor gene GNRHR (R262Q), and one in the Kall-mann syndrome 1 sequence gene KAL1 (V371I). No mutations were found in a cohort of 422 controls with normal menstrual cycles. In vitro studies showed that FGFR1 G260E, FGFR1 R756H, and PROKR2 R85H are loss-of-function mutations, as has been previously shown for PROKR2 L173R and GNRHR R262Q. CONCLUSIONS Rare variants in genes associated with idiopathic hypogonadotropic hypogonadism are found in women with hypothalamic amenorrhea, suggesting that these mutations may contribute to the variable susceptibility of women to the functional changes in GnRH secretion that characterize hypothalamic amenorrhea. Our observations provide evidence for the role of rare variants in common multifactorial disease. (Funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development and others; ClinicalTrials.gov number, NCT00494169.) PMID:21247312

Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.

PubMed

Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

2017-04-01

Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on Alcoholism.

A genetic basis for functional hypothalamic amenorrhea.

PubMed

Caronia, Lisa M; Martin, Cecilia; Welt, Corrine K; Sykiotis, Gerasimos P; Quinton, Richard; Thambundit, Apisadaporn; Avbelj, Magdalena; Dhruvakumar, Sadhana; Plummer, Lacey; Hughes, Virginia A; Seminara, Stephanie B; Boepple, Paul A; Sidis, Yisrael; Crowley, William F; Martin, Kathryn A; Hall, Janet E; Pitteloud, Nelly

2011-01-20

Functional hypothalamic amenorrhea is a reversible form of gonadotropin-releasing hormone (GnRH) deficiency commonly triggered by stressors such as excessive exercise, nutritional deficits, or psychological distress. Women vary in their susceptibility to inhibition of the reproductive axis by such stressors, but it is unknown whether this variability reflects a genetic predisposition to hypothalamic amenorrhea. We hypothesized that mutations in genes involved in idiopathic hypogonadotropic hypogonadism, a congenital form of GnRH deficiency, are associated with hypothalamic amenorrhea. We analyzed the coding sequence of genes associated with idiopathic hypogonadotropic hypogonadism in 55 women with hypothalamic amenorrhea and performed in vitro studies of the identified mutations. Six heterozygous mutations were identified in 7 of the 55 patients with hypothalamic amenorrhea: two variants in the fibroblast growth factor receptor 1 gene FGFR1 (G260E and R756H), two in the prokineticin receptor 2 gene PROKR2 (R85H and L173R), one in the GnRH receptor gene GNRHR (R262Q), and one in the Kallmann syndrome 1 sequence gene KAL1 (V371I). No mutations were found in a cohort of 422 controls with normal menstrual cycles. In vitro studies showed that FGFR1 G260E, FGFR1 R756H, and PROKR2 R85H are loss-of-function mutations, as has been previously shown for PROKR2 L173R and GNRHR R262Q. Rare variants in genes associated with idiopathic hypogonadotropic hypogonadism are found in women with hypothalamic amenorrhea, suggesting that these mutations may contribute to the variable susceptibility of women to the functional changes in GnRH secretion that characterize hypothalamic amenorrhea. Our observations provide evidence for the role of rare variants in common multifactorial disease. (Funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development and others; ClinicalTrials.gov number, NCT00494169.).

Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nitsche, E.M.; Moquin, A.; Adams, P.S.

1996-05-03

Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

PubMed

Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

2009-01-01

Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

Establishment of a non-tumorigenic papillary thyroid cell line (FB-2) carrying the RET/PTC1 rearrangement.

PubMed

Basolo, Fulvio; Giannini, Riccardo; Toniolo, Antonio; Casalone, Rosario; Nikiforova, Marina; Pacini, Furio; Elisei, Rossella; Miccoli, Paolo; Berti, Piero; Faviana, Pinuccia; Fiore, Lisa; Monaco, Carmen; Pierantoni, Giovanna Maria; Fedele, Monica; Nikiforov, Yuri E; Santoro, Massimo; Fusco, Alfredo

2002-02-10

A novel human thyroid papillary carcinoma cell line (FB-2) has been established and characterized. FB-2 cells harbor the RET/PTC1 chimeric oncogene in which the RET kinase domain is fused to the H4 gene. FB-2 cells neither formed colonies in semisolid media nor induced tumors after heterotransplant into severe combined immunodeficient mice. However, HMGI(Y), HMGI-C and c-myc genes, which are associated to thyroid cell transformation, were abundantly expressed in FB-2 cells but not in normal thyroid cells. FB-2 cells only partially retained the differentiated thyroid phenotype. In fact, the PAX-8 gene, which codes for a transcriptional factor required for thyroid cell differentiation, was expressed, while thyroglobulin, TSH-receptor and thyroperoxidase genes were not. Moreover, FB-2 cells produced high levels of interleukin (IL)-6 and IL-8. Copyright 2001 Wiley-Liss, Inc.

Loss of Trem2 in microglia leads to widespread disruption of cell coexpression networks in mouse brain.

PubMed

Carbajosa, Guillermo; Malki, Karim; Lawless, Nathan; Wang, Hong; Ryder, John W; Wozniak, Eva; Wood, Kristie; Mein, Charles A; Dobson, Richard J B; Collier, David A; O'Neill, Michael J; Hodges, Angela K; Newhouse, Stephen J

2018-05-17

Rare heterozygous coding variants in the triggering receptor expressed in myeloid cells 2 (TREM2) gene, conferring increased risk of developing late-onset Alzheimer's disease, have been identified. We examined the transcriptional consequences of the loss of Trem2 in mouse brain to better understand its role in disease using differential expression and coexpression network analysis of Trem2 knockout and wild-type mice. We generated RNA-Seq data from cortex and hippocampus sampled at 4 and 8 months. Using brain cell-type markers and ontology enrichment, we found subnetworks with cell type and/or functional identity. We primarily discovered changes in an endothelial gene-enriched subnetwork at 4 months, including a shift toward a more central role for the amyloid precursor protein gene, coupled with widespread disruption of other cell-type subnetworks, including a subnetwork with neuronal identity. We reveal an unexpected potential role of Trem2 in the homeostasis of endothelial cells that goes beyond its known functions as a microglial receptor and signaling hub, suggesting an underlying link between immune response and vascular disease in dementia. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

New Type of BACE1 siRNA Delivery to Cells

PubMed Central

Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz

2014-01-01

Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230

A toolbox of lectins for translating the sugar code: the galectin network in phylogenesis and tumors.

PubMed

Kaltner, H; Gabius, H-J

2012-04-01

Lectin histochemistry has revealed cell-type-selective glycosylation. It is under dynamic and spatially controlled regulation. Since their chemical properties allow carbohydrates to reach unsurpassed structural diversity in oligomers, they are ideal for high density information coding. Consequently, the concept of the sugar code assigns a functional dimension to the glycans of cellular glycoconjugates. Indeed, multifarious cell processes depend on specific recognition of glycans by their receptors (lectins), which translate the sugar-encoded information into effects. Duplication of ancestral genes and the following divergence of sequences account for the evolutionary dynamics in lectin families. Differences in gene number can even appear among closely related species. The adhesion/growth-regulatory galectins are selected as an instructive example to trace the phylogenetic diversification in several animals, most of them popular models in developmental and tumor biology. Chicken galectins are identified as a low-level-complexity set, thus singled out for further detailed analysis. The various operative means for establishing protein diversity among the chicken galectins are delineated, and individual characteristics in expression profiles discerned. To apply this galectin-fingerprinting approach in histopathology has potential for refining differential diagnosis and for obtaining prognostic assessments. On the grounds of in vitro work with tumor cells a strategically orchestrated co-regulation of galectin expression with presentation of cognate glycans is detected. This coordination epitomizes the far-reaching physiological significance of sugar coding.

Unbiased View of Synaptic and Neuronal Gene Complement in Ctenophores: Are There Pan-neuronal and Pan-synaptic Genes across Metazoa?

PubMed Central

Moroz, Leonid L.; Kohn, Andrea B.

2015-01-01

Hypotheses of origins and evolution of neurons and synapses are controversial, mostly due to limited comparative data. Here, we investigated the genome-wide distribution of the bilaterian “synaptic” and “neuronal” protein-coding genes in non-bilaterian basal metazoans (Ctenophora, Porifera, Placozoa, and Cnidaria). First, there are no recognized genes uniquely expressed in neurons across all metazoan lineages. None of the so-called pan-neuronal genes such as embryonic lethal abnormal vision (ELAV), Musashi, or Neuroglobin are expressed exclusively in neurons of the ctenophore Pleurobrachia. Second, our comparative analysis of about 200 genes encoding canonical presynaptic and postsynaptic proteins in bilaterians suggests that there are no true “pan-synaptic” genes or genes uniquely and specifically attributed to all classes of synapses. The majority of these genes encode receptive and secretory complexes in a broad spectrum of eukaryotes. Trichoplax (Placozoa) an organism without neurons and synapses has more orthologs of bilaterian synapse-related/neuron-related genes than do ctenophores—the group with well-developed neuronal and synaptic organization. Third, the majority of genes encoding ion channels and ionotropic receptors are broadly expressed in unicellular eukaryotes and non-neuronal tissues in metazoans. Therefore, they cannot be viewed as neuronal markers. Nevertheless, the co-expression of multiple types of ion channels and receptors does correlate with the presence of neural and synaptic organization. As an illustrative example, the ctenophore genomes encode a greater diversity of ion channels and ionotropic receptors compared with the genomes of the placozoan Trichoplax and the demosponge Amphimedon. Surprisingly, both placozoans and sponges have a similar number of orthologs of “synaptic” proteins as we identified in the genomes of two ctenophores. Ctenophores have a distinct synaptic organization compared with other animals. Our analysis of transcriptomes from 10 different ctenophores did not detect recognized orthologs of synthetic enzymes encoding several classical, low-molecular-weight (neuro)transmitters; glutamate signaling machinery is one of the few exceptions. Novel peptidergic signaling molecules were predicted for ctenophores, together with the diversity of putative receptors including SCNN1/amiloride-sensitive sodium channel-like channels, many of which could be examples of a lineage-specific expansion within this group. In summary, our analysis supports the hypothesis of independent evolution of neurons and, as corollary, a parallel evolution of synapses. We suggest that the formation of synaptic machinery might occur more than once over 600 million years of animal evolution. PMID:26454853

Mutational analysis of genes coding for cell surface proteins in colorectal cancer cell lines reveal novel altered pathways, druggable mutations and mutated epitopes for targeted therapy

PubMed Central

Correa, Bruna R.; Bettoni, Fabiana; Koyama, Fernanda C.; Navarro, Fabio C.P.; Perez, Rodrigo O.; Mariadason, John; Sieber, Oliver M.; Strausberg, Robert L.; Simpson, Andrew J.G.; Jardim, Denis L.F.; Reis, Luiz Fernando L.; Parmigiani, Raphael B.; Galante, Pedro A.F.; Camargo, Anamaria A.

2014-01-01

We carried out a mutational analysis of 3,594 genes coding for cell surface proteins (Surfaceome) in 23 colorectal cancer cell lines, searching for new altered pathways, druggable mutations and mutated epitopes for targeted therapy in colorectal cancer. A total of 3,944 somatic non-synonymous substitutions and 595 InDels, occurring in 2,061 (57%) Surfaceome genes were catalogued. We identified 48 genes not previously described as mutated in colorectal tumors in the TCGA database, including genes that are mutated and expressed in >10% of the cell lines (SEMA4C, FGFRL1, PKD1, FAM38A, WDR81, TMEM136, SLC36A1, SLC26A6, IGFLR1). Analysis of these genes uncovered important roles for FGF and SEMA4 signaling in colorectal cancer with possible therapeutic implications. We also found that cell lines express on average 11 druggable mutations, including frequent mutations (>20%) in the receptor tyrosine kinases AXL and EPHA2, which have not been previously considered as potential targets for colorectal cancer. Finally, we identified 82 cell surface mutated epitopes, however expression of only 30% of these epitopes was detected in our cell lines. Notwithstanding, 92% of these epitopes were expressed in cell lines with the mutator phenotype, opening new venues for the use of “general” immune checkpoint drugs in this subset of patients. PMID:25193853

Roles of OA1 octopamine receptor and Dop1 dopamine receptor in mediating appetitive and aversive reinforcement revealed by RNAi studies

PubMed Central

Awata, Hiroko; Wakuda, Ryo; Ishimaru, Yoshiyasu; Matsuoka, Yuji; Terao, Kanta; Katata, Satomi; Matsumoto, Yukihisa; Hamanaka, Yoshitaka; Noji, Sumihare; Mito, Taro; Mizunami, Makoto

2016-01-01

Revealing reinforcing mechanisms in associative learning is important for elucidation of brain mechanisms of behavior. In mammals, dopamine neurons are thought to mediate both appetitive and aversive reinforcement signals. Studies using transgenic fruit-flies suggested that dopamine neurons mediate both appetitive and aversive reinforcements, through the Dop1 dopamine receptor, but our studies using octopamine and dopamine receptor antagonists and using Dop1 knockout crickets suggested that octopamine neurons mediate appetitive reinforcement and dopamine neurons mediate aversive reinforcement in associative learning in crickets. To fully resolve this issue, we examined the effects of silencing of expression of genes that code the OA1 octopamine receptor and Dop1 and Dop2 dopamine receptors by RNAi in crickets. OA1-silenced crickets exhibited impairment in appetitive learning with water but not in aversive learning with sodium chloride solution, while Dop1-silenced crickets exhibited impairment in aversive learning but not in appetitive learning. Dop2-silenced crickets showed normal scores in both appetitive learning and aversive learning. The results indicate that octopamine neurons mediate appetitive reinforcement via OA1 and that dopamine neurons mediate aversive reinforcement via Dop1 in crickets, providing decisive evidence that neurotransmitters and receptors that mediate appetitive reinforcement indeed differ among different species of insects. PMID:27412401

PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex.

PubMed

Surapureddi, Sailesh; Viswakarma, Navin; Yu, Songtao; Guo, Dongsheng; Rao, M Sambasiva; Reddy, Janardan K

2006-05-05

Ciprofibrate, a potent peroxisome proliferator, induces pleiotropic responses in liver by activating peroxisome proliferator-activated receptor alpha (PPARalpha), a nuclear receptor. Transcriptional regulation by liganded nuclear receptors involves the participation of coregulators that form multiprotein complexes possibly to achieve cell and gene specific transcription. SDS-PAGE and matrix-assisted laser desorption/ionization reflection time-of-flight mass spectrometric analyses of ciprofibrate-binding proteins from liver nuclear extracts obtained using ciprofibrate-Sepharose affinity matrix resulted in the identification of a new high molecular weight nuclear receptor coactivator, which we designated PRIC320. The full-length human cDNA encoding this protein has an open-reading frame that codes for a 320kDa protein containing 2882 amino acids. PRIC320 contains five LXXLL signature motifs that mediate interaction with nuclear receptors. PRIC320 binds avidly to nuclear receptors PPARalpha, CAR, ERalpha, and RXR, but only minimally with PPARgamma. PRIC320 also interacts with transcription cofactors CBP, PRIP, and PBP. Immunoprecipitation-immunoblotting as well as cellular localization studies confirmed the interaction between PPARalpha and PRIC320. PRIC320 acts as a transcription coactivator by stimulating PPARalpha-mediated transcription. We conclude that ciprofibrate, a PPARalpha ligand, binds a multiprotein complex and PRIC320 cloned from this complex functions as a nuclear receptor coactivator.

Roles of OA1 octopamine receptor and Dop1 dopamine receptor in mediating appetitive and aversive reinforcement revealed by RNAi studies.

PubMed

Awata, Hiroko; Wakuda, Ryo; Ishimaru, Yoshiyasu; Matsuoka, Yuji; Terao, Kanta; Katata, Satomi; Matsumoto, Yukihisa; Hamanaka, Yoshitaka; Noji, Sumihare; Mito, Taro; Mizunami, Makoto

2016-07-14

Revealing reinforcing mechanisms in associative learning is important for elucidation of brain mechanisms of behavior. In mammals, dopamine neurons are thought to mediate both appetitive and aversive reinforcement signals. Studies using transgenic fruit-flies suggested that dopamine neurons mediate both appetitive and aversive reinforcements, through the Dop1 dopamine receptor, but our studies using octopamine and dopamine receptor antagonists and using Dop1 knockout crickets suggested that octopamine neurons mediate appetitive reinforcement and dopamine neurons mediate aversive reinforcement in associative learning in crickets. To fully resolve this issue, we examined the effects of silencing of expression of genes that code the OA1 octopamine receptor and Dop1 and Dop2 dopamine receptors by RNAi in crickets. OA1-silenced crickets exhibited impairment in appetitive learning with water but not in aversive learning with sodium chloride solution, while Dop1-silenced crickets exhibited impairment in aversive learning but not in appetitive learning. Dop2-silenced crickets showed normal scores in both appetitive learning and aversive learning. The results indicate that octopamine neurons mediate appetitive reinforcement via OA1 and that dopamine neurons mediate aversive reinforcement via Dop1 in crickets, providing decisive evidence that neurotransmitters and receptors that mediate appetitive reinforcement indeed differ among different species of insects.

Research progress of the bitter taste receptor genes in primates.

PubMed

Feng, Ping; Luo, Rui-Jian

2018-02-20

Among the five basic tastes (umami, sweet, bitter, salty and sour), the perception of bitterness is believed to protect animals from digesting toxic and harmful substances, thus it is vital for animal survival. The taste of bitterness is triggered by the interaction between bitter substances and bitter taste receptors, which are encoded by Tas2rs. The gene numbers vary largely across species to meet different demands. So far, several ligands of bitter receptors have been identified in primates. They also discovered that the selective pressure of certain bitter taste receptor genes vary across taxa, genes or even different functional regions of the gene. In this review, we summarize the research progress of bitter taste receptor genes in primates by introducing the functional diversity of bitter receptors, the specific interaction between bitter taste receptors and ligands, the relationship between the evolutionary pattern of bitter taste receptors and diets, and the adaptive evolution of bitter taste receptor genes. We aim to provide a reference for further research on bitter receptor genes in primates.

Lysophosphatidic acid induces expression of genes in human oral keratinocytes involved in wound healing.

PubMed

Thorlakson, Hong Huynh; Engen, Stian Andre; Schreurs, Olav; Schenck, Karl; Blix, Inger Johanne Schytte

2017-08-01

Epithelial cells participate in wound healing by covering wounds, but also as important mediators of wound healing processes. Topical application of the phospholipid growth factor lysophosphatidic acid (LPA) accelerates dermal wound healing and we hypothesized that LPA can play a role in human oral wound healing through its effects on human oral keratinocytes (HOK). HOK were isolated from gingival biopsies and exposed to LPA. The LPA receptor profile, signal transduction pathways, gene expression and secretion of selected cytokines were analyzed. HOK expressed the receptors LPA 1 , LPA 5 and LPA 6 and LPA activated the ERK1/2, JNK and p38 intracellular pathways, substantiated by secretion of IL-6 and IL-8. The early (2h) and intermediate (6h) gene expression profiles of HOK after LPA treatment showed a wide array of regulated genes. The majority of the strongest upregulated genes were related to chemotaxis and inflammation, and became downregulated after 6h. At 6h, genes coding for factors involved in extracellular matrix remodeling and re-epithelialization became highly expressed. IL-36γ, not earlier known to be regulated by LPA, was strongly transcribed and translated but not secreted. After stimulation with LPA, HOK responded by regulating factors and genes that are essential in wound healing processes. As LPA is found in saliva and is released by activated cells after wounding, our results indicate that LPA has a favorable physiological role in oral wound healing. This may further point towards a beneficial role for application of LPA on oral surgical or chronic wounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genome Analysis of the Domestic Dog (Korean Jindo) by Massively Parallel Sequencing

PubMed Central

Kim, Ryong Nam; Kim, Dae-Soo; Choi, Sang-Haeng; Yoon, Byoung-Ha; Kang, Aram; Nam, Seong-Hyeuk; Kim, Dong-Wook; Kim, Jong-Joo; Ha, Ji-Hong; Toyoda, Atsushi; Fujiyama, Asao; Kim, Aeri; Kim, Min-Young; Park, Kun-Hyang; Lee, Kang Seon; Park, Hong-Seog

2012-01-01

Although pioneering sequencing projects have shed light on the boxer and poodle genomes, a number of challenges need to be met before the sequencing and annotation of the dog genome can be considered complete. Here, we present the DNA sequence of the Jindo dog genome, sequenced to 45-fold average coverage using Illumina massively parallel sequencing technology. A comparison of the sequence to the reference boxer genome led to the identification of 4 675 437 single nucleotide polymorphisms (SNPs, including 3 346 058 novel SNPs), 71 642 indels and 8131 structural variations. Of these, 339 non-synonymous SNPs and 3 indels are located within coding sequences (CDS). In particular, 3 non-synonymous SNPs and a 26-bp deletion occur in the TCOF1 locus, implying that the difference observed in cranial facial morphology between Jindo and boxer dogs might be influenced by those variations. Through the annotation of the Jindo olfactory receptor gene family, we found 2 unique olfactory receptor genes and 236 olfactory receptor genes harbouring non-synonymous homozygous SNPs that are likely to affect smelling capability. In addition, we determined the DNA sequence of the Jindo dog mitochondrial genome and identified Jindo dog-specific mtDNA genotypes. This Jindo genome data upgrade our understanding of dog genomic architecture and will be a very valuable resource for investigating not only dog genetics and genomics but also human and dog disease genetics and comparative genomics. PMID:22474061

Trace amine-associated receptors and their ligands

PubMed Central

Zucchi, R; Chiellini, G; Scanlan, T S; Grandy, D K

2006-01-01

Classical biogenic amines (adrenaline, noradrenaline, dopamine, serotonin and histamine) interact with specific families of G protein-coupled receptors (GPCRs). The term ‘trace amines' is used when referring to p-tyramine, β-phenylethylamine, tryptamine and octopamine, compounds that are present in mammalian tissues at very low (nanomolar) concentrations. The pharmacological effects of trace amines are usually attributed to their interference with the aminergic pathways, but in 2001 a new gene was identified, that codes for a GPCR responding to p-tyramine and β-phenylethylamine but not to classical biogenic amines. Several closely related genes were subsequently identified and designated as the trace amine-associated receptors (TAARs). Pharmacological investigations in vitro show that many TAAR subtypes may not respond to p-tyramine, β-phenylethylamine, tryptamine or octopamine, suggesting the existence of additional endogenous ligands. A novel endogenous thyroid hormone derivative, 3-iodothyronamine, has been found to interact with TAAR1 and possibly other TAAR subtypes. In vivo, micromolar concentrations of 3-iodothyronamine determine functional effects which are opposite to those produced on a longer time scale by thyroid hormones, including reduction in body temperature and decrease in cardiac contractility. Expression of all TAAR subtypes except TAAR1 has been reported in mouse olfactory epithelium, and several volatile amines were shown to interact with specific TAAR subtypes. In addition, there is evidence that TAAR1 is targeted by amphetamines and other psychotropic agents, while genetic linkage studies show a significant association between the TAAR gene family locus and susceptibility to schizophrenia or bipolar affective disorder. PMID:17088868

Identification of pathway-biased and deleterious melatonin receptor mutants in autism spectrum disorders and in the general population.

PubMed

Chaste, Pauline; Clement, Nathalie; Mercati, Oriane; Guillaume, Jean-Luc; Delorme, Richard; Botros, Hany Goubran; Pagan, Cécile; Périvier, Samuel; Scheid, Isabelle; Nygren, Gudrun; Anckarsäter, Henrik; Rastam, Maria; Ståhlberg, Ola; Gillberg, Carina; Serrano, Emilie; Lemière, Nathalie; Launay, Jean Marie; Mouren-Simeoni, Marie Christine; Leboyer, Marion; Gillberg, Christopher; Jockers, Ralf; Bourgeron, Thomas

2010-07-15

Melatonin is a powerful antioxidant and a synchronizer of many physiological processes. Alteration of the melatonin pathway has been reported in circadian disorders, diabetes and autism spectrum disorders (ASD). However, very little is known about the genetic variability of melatonin receptors in humans. Here, we sequenced the melatonin receptor MTNR1A and MTNR1B, genes coding for MT1 and MT2 receptors, respectively, in a large panel of 941 individuals including 295 patients with ASD, 362 controls and 284 individuals from different ethnic backgrounds. We also sequenced GPR50, coding for the orphan melatonin-related receptor GPR50 in patients and controls. We identified six non-synonymous mutations for MTNR1A and ten for MTNR1B. The majority of these variations altered receptor function. Particularly interesting mutants are MT1-I49N, which is devoid of any melatonin binding and cell surface expression, and MT1-G166E and MT1-I212T, which showed severely impaired cell surface expression. Of note, several mutants possessed pathway-selective signaling properties, some preferentially inhibiting the adenylyl cyclase pathway, others preferentially activating the MAPK pathway. The prevalence of these deleterious mutations in cases and controls indicates that they do not represent major risk factor for ASD (MTNR1A case 3.6% vs controls 4.4%; MTNR1B case 4.7% vs 3% controls). Concerning GPR50, we detected a significant association between ASD and two variations, Delta502-505 and T532A, in affected males, but it did not hold up after Bonferonni correction for multiple testing. Our results represent the first functional ascertainment of melatonin receptors in humans and constitute a basis for future structure-function studies and for interpreting genetic data on the melatonin pathway in patients.

Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

PubMed

Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

2015-08-01

The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Genetic assessment and folate receptor autoantibodies in infantile-onset cerebral folate deficiency (CFD) syndrome.

PubMed

Ramaekers, V Th; Segers, K; Sequeira, J M; Koenig, M; Van Maldergem, L; Bours, V; Kornak, U; Quadros, E V

2018-05-01

Cerebral folate deficiency (CFD) syndromes are defined as neuro-psychiatric conditions with low CSF folate and attributed to different causes such as autoantibodies against the folate receptor-alpha (FR) protein that can block folate transport across the choroid plexus, FOLR1 gene mutations or mitochondrial disorders. High-dose folinic acid treatment restores many neurologic deficits. Among 36 patients from 33 families the infantile-onset CFD syndrome was diagnosed based on typical clinical features and low CSF folate. All parents were healthy. Three families had 2 affected siblings, while parents from 4 families were first cousins. We analysed serum FR autoantibodies and the FOLR1 and FOLR2 genes. Among three consanguineous families homozygosity mapping attempted to identify a monogenetic cause. Whole exome sequencing (WES) was performed in the fourth consanguineous family, where two siblings also suffered from polyneuropathy as an atypical finding. Boys (72%) outnumbered girls (28%). Most patients (89%) had serum FR autoantibodies fluctuating over 5-6 weeks. Two children had a genetic FOLR1 variant without pathological significance. Homozygosity mapping failed to detect a single autosomal recessive gene. WES revealed an autosomal recessive polynucleotide kinase 3´phosphatase (PNKP) gene abnormality in the siblings with polyneuropathy. Infantile-onset CFD was characterized by serum FR autoantibodies as its predominant pathology whereas pathogenic FOLR1 gene mutations were absent. Homozygosity mapping excluded autosomal recessive inheritance of any single responsible gene. WES in one consanguineous family identified a PNKP gene abnormality that explained the polyneuropathy and also its contribution to the infantile CFD syndrome because the PNKP gene plays a dual role in both neurodevelopment and immune-regulatory function. Further research for candidate genes predisposing to FRα-autoimmunity is suggested to include X-chromosomal and non-coding DNA regions. Copyright © 2018 Elsevier Inc. All rights reserved.

Systematic reconstruction of autism biology from massive genetic mutation profiles

PubMed Central

Zhang, Chaolin; Jiang, Yong-hui

2018-01-01

Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3′,5′-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein–coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity. PMID:29651456

Systematic reconstruction of autism biology from massive genetic mutation profiles.

PubMed

Luo, Weijun; Zhang, Chaolin; Jiang, Yong-Hui; Brouwer, Cory R

2018-04-01

Autism spectrum disorder (ASD) affects 1% of world population and has become a pressing medical and social problem worldwide. As a paradigmatic complex genetic disease, ASD has been intensively studied and thousands of gene mutations have been reported. Because these mutations rarely recur, it is difficult to (i) pinpoint the fewer disease-causing versus majority random events and (ii) replicate or verify independent studies. A coherent and systematic understanding of autism biology has not been achieved. We analyzed 3392 and 4792 autism-related mutations from two large-scale whole-exome studies across multiple resolution levels, that is, variants (single-nucleotide), genes (protein-coding unit), and pathways (molecular module). These mutations do not recur or replicate at the variant level, but significantly and increasingly do so at gene and pathway levels. Genetic association reveals a novel gene + pathway dual-hit model, where the mutation burden becomes less relevant. In multiple independent analyses, hundreds of variants or genes repeatedly converge to several canonical pathways, either novel or literature-supported. These pathways define recurrent and systematic ASD biology, distinct from previously reported gene groups or networks. They also present a catalog of novel ASD risk factors including 118 variants and 72 genes. At a subpathway level, most variants disrupt the pathway-related gene functions, and in the same gene, they tend to hit residues extremely close to each other and in the same domain. Multiple interacting variants spotlight key modules, including the cAMP (adenosine 3',5'-monophosphate) second-messenger system and mGluR (metabotropic glutamate receptor) signaling regulation by GRKs (G protein-coupled receptor kinases). At a superpathway level, distinct pathways further interconnect and converge to three biology themes: synaptic function, morphology, and plasticity.

Function and distribution of 5-HT2 receptors in the honeybee (Apis mellifera).

PubMed

Thamm, Markus; Rolke, Daniel; Jordan, Nadine; Balfanz, Sabine; Schiffer, Christian; Baumann, Arnd; Blenau, Wolfgang

2013-01-01

Serotonin plays a pivotal role in regulating and modulating physiological and behavioral processes in both vertebrates and invertebrates. In the honeybee (Apis mellifera), serotonin has been implicated in division of labor, visual processing, and learning processes. Here, we present the cloning, heterologous expression, and detailed functional and pharmacological characterization of two honeybee 5-HT2 receptors. Honeybee 5-HT2 receptor cDNAs were amplified from brain cDNA. Recombinant cell lines were established constitutively expressing receptor variants. Pharmacological properties of the receptors were investigated by Ca(2+) imaging experiments. Quantitative PCR was applied to explore the expression patterns of receptor mRNAs. The honeybee 5-HT2 receptor class consists of two subtypes, Am5-HT2α and Am5-HT2β. Each receptor gene also gives rise to alternatively spliced mRNAs that possibly code for truncated receptors. Only activation of the full-length receptors with serotonin caused an increase in the intracellular Ca(2+) concentration. The effect was mimicked by the agonists 5-methoxytryptamine and 8-OH-DPAT at low micromolar concentrations. Receptor activities were blocked by established 5-HT receptor antagonists such as clozapine, methiothepin, or mianserin. High transcript numbers were detected in exocrine glands suggesting that 5-HT2 receptors participate in secretory processes in the honeybee. This study marks the first molecular and pharmacological characterization of two 5-HT2 receptor subtypes in the same insect species. The results presented should facilitate further attempts to unravel central and peripheral effects of serotonin mediated by these receptors.

Function and Distribution of 5-HT2 Receptors in the Honeybee (Apis mellifera)

PubMed Central

Thamm, Markus; Rolke, Daniel; Jordan, Nadine; Balfanz, Sabine; Schiffer, Christian; Baumann, Arnd; Blenau, Wolfgang

2013-01-01

Background Serotonin plays a pivotal role in regulating and modulating physiological and behavioral processes in both vertebrates and invertebrates. In the honeybee (Apis mellifera), serotonin has been implicated in division of labor, visual processing, and learning processes. Here, we present the cloning, heterologous expression, and detailed functional and pharmacological characterization of two honeybee 5-HT2 receptors. Methods Honeybee 5-HT2 receptor cDNAs were amplified from brain cDNA. Recombinant cell lines were established constitutively expressing receptor variants. Pharmacological properties of the receptors were investigated by Ca2+ imaging experiments. Quantitative PCR was applied to explore the expression patterns of receptor mRNAs. Results The honeybee 5-HT2 receptor class consists of two subtypes, Am5-HT2α and Am5-HT2β. Each receptor gene also gives rise to alternatively spliced mRNAs that possibly code for truncated receptors. Only activation of the full-length receptors with serotonin caused an increase in the intracellular Ca2+ concentration. The effect was mimicked by the agonists 5-methoxytryptamine and 8-OH-DPAT at low micromolar concentrations. Receptor activities were blocked by established 5-HT receptor antagonists such as clozapine, methiothepin, or mianserin. High transcript numbers were detected in exocrine glands suggesting that 5-HT2 receptors participate in secretory processes in the honeybee. Conclusions This study marks the first molecular and pharmacological characterization of two 5-HT2 receptor subtypes in the same insect species. The results presented should facilitate further attempts to unravel central and peripheral effects of serotonin mediated by these receptors. PMID:24324783

DNA Sequence Variants in PPARGC1A, a Gene Encoding a Coactivator of the ω-3 LCPUFA Sensing PPAR-RXR Transcription Complex, Are Associated with NV AMD and AMD-Associated Loci in Genes of Complement and VEGF Signaling Pathways

PubMed Central

SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M.; Stahl, Andreas; Clemons, Traci E.; Chew, Emily Y.; Smith, Lois E. H.

2013-01-01

Background Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). Methods We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. Results A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (P<0.005) with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P≤0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P≤0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice – these animals also showed 70% reduction in retinal NV (P≤0.001). Conclusion Ligands and co-activators of the ω-3 LCPUFA sensing PPAR-RXR axis may influence retinal angiogenesis in NV AMD via the complement and VEGF signaling systems. We have linked the co-activator of a lipid-sensing transcription factor (PPARG co-activator 1 alpha, PPARGC1A) to age-related macular degeneration (AMD) and AMD-associated genes. PMID:23335958

Regulatory Features for Odorant Receptor Genes in the Mouse Genome.

PubMed

Degl'Innocenti, Andrea; D'Errico, Anna

2017-01-01

The odorant receptor genes, seven transmembrane receptor genes constituting the vastest mammalian gene multifamily, are expressed monogenically and monoallelicaly in each sensory neuron in the olfactory epithelium. This characteristic, often referred to as the one neuron-one receptor rule, is driven by mostly uncharacterized molecular dynamics, generally named odorant receptor gene choice . Much attention has been paid by the scientific community to the identification of sequences regulating the expression of odorant receptor genes within their loci , where related genes are usually arranged in genomic clusters. A number of studies identified transcription factor binding sites on odorant receptor promoter sequences. Similar binding sites were also found on a number of enhancers that regulate in cis their transcription, but have been proposed to form interchromosomal networks. Odorant receptor gene choice seems to occur via the local removal of strongly repressive epigenetic markings, put in place during the maturation of the sensory neuron on each odorant receptor locus . Here we review the fast-changing state of art for the study of regulatory features for odorant receptor genes.

Evolution of the nuclear receptor gene superfamily.

PubMed Central

Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D

1992-01-01

Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460

The clonal and mutational evolution spectrum of primary triple-negative breast cancers.

PubMed

Shah, Sohrab P; Roth, Andrew; Goya, Rodrigo; Oloumi, Arusha; Ha, Gavin; Zhao, Yongjun; Turashvili, Gulisa; Ding, Jiarui; Tse, Kane; Haffari, Gholamreza; Bashashati, Ali; Prentice, Leah M; Khattra, Jaswinder; Burleigh, Angela; Yap, Damian; Bernard, Virginie; McPherson, Andrew; Shumansky, Karey; Crisan, Anamaria; Giuliany, Ryan; Heravi-Moussavi, Alireza; Rosner, Jamie; Lai, Daniel; Birol, Inanc; Varhol, Richard; Tam, Angela; Dhalla, Noreen; Zeng, Thomas; Ma, Kevin; Chan, Simon K; Griffith, Malachi; Moradian, Annie; Cheng, S-W Grace; Morin, Gregg B; Watson, Peter; Gelmon, Karen; Chia, Stephen; Chin, Suet-Feung; Curtis, Christina; Rueda, Oscar M; Pharoah, Paul D; Damaraju, Sambasivarao; Mackey, John; Hoon, Kelly; Harkins, Timothy; Tadigotla, Vasisht; Sigaroudinia, Mahvash; Gascard, Philippe; Tlsty, Thea; Costello, Joseph F; Meyer, Irmtraud M; Eaves, Connie J; Wasserman, Wyeth W; Jones, Steven; Huntsman, David; Hirst, Martin; Caldas, Carlos; Marra, Marco A; Aparicio, Samuel

2012-04-04

Primary triple-negative breast cancers (TNBCs), a tumour type defined by lack of oestrogen receptor, progesterone receptor and ERBB2 gene amplification, represent approximately 16% of all breast cancers. Here we show in 104 TNBC cases that at the time of diagnosis these cancers exhibit a wide and continuous spectrum of genomic evolution, with some having only a handful of coding somatic aberrations in a few pathways, whereas others contain hundreds of coding somatic mutations. High-throughput RNA sequencing (RNA-seq) revealed that only approximately 36% of mutations are expressed. Using deep re-sequencing measurements of allelic abundance for 2,414 somatic mutations, we determine for the first time-to our knowledge-in an epithelial tumour subtype, the relative abundance of clonal frequencies among cases representative of the population. We show that TNBCs vary widely in their clonal frequencies at the time of diagnosis, with the basal subtype of TNBC showing more variation than non-basal TNBC. Although p53 (also known as TP53), PIK3CA and PTEN somatic mutations seem to be clonally dominant compared to other genes, in some tumours their clonal frequencies are incompatible with founder status. Mutations in cytoskeletal, cell shape and motility proteins occurred at lower clonal frequencies, suggesting that they occurred later during tumour progression. Taken together, our results show that understanding the biology and therapeutic responses of patients with TNBC will require the determination of individual tumour clonal genotypes.

Variants in human papillomavirus receptor and associated genes are associated with type-specific HPV infection and lesion progression of the cervix

PubMed Central

Chen, Tingting; Yang, Shizhou; Huang, Yongjie; Hong, Die; Li, Yang; Chen, Xiaojing; Wang, Xinyu; Cheng, Xiaodong; Lu, Weiguo; Xie, Xing

2016-01-01

Human papillomavirus (HPV) infects cervical epithelial cells through cellular membrane receptors, and then induces the initiation and progression of cervical cancer. Single nucleotide polymorphisms (SNPs) may impact the susceptibility and outcome of diseases, but it's still unknown whether variant in HPV receptor and associated genes is associated with type-specific HPV infection and cervical lesion progression. We examined 96 SNPs in 8 genes which may participate in the HPV infection process in 875 samples with HPV negative or single HPV16, 18, 52, 58 positive from 3299 cervical exfoliated cell samples, by Illumina BeadXpress VeraCode platform, and analyzed the correlation between the SNPs and type-specific HPV infection and cervical lesions progression. We found rs28384376 in EGFR and rs12034979 in HSPG2 significantly correlated to HPV16 infection; rs2575738, rs2575712, rs2575735 in SDC2 and rs6697265 in HSPG2 significantly correlated to HPV18 infection; rs10510097 in FGFR2, rs12718946 in EGFR significantly correlated to HPV52 infection; rs4947972 in EGFR, rs2981451 in FGFR2, rs2575735 in SDC2 significantly correlated to HPV58 infection. And rs3135772, rs1047057 and rs2556537 in FGFR2, rs12034979 in HSPG2, rs16894821 in SDC2 significantly correlated to cervical lesion progression induced by HPV16 infection; rs6697265 and rs6680566 in HSPG2, rs16860426 in ITGA6 by HPV18 infection; rs878949 in HSPG2, rs12718946 and rs12668175 in EGFR by HPV52 infection; no SNP by HPV58 infection. Our findings suggest that HPV receptor and associated gene variants may influence the susceptibilities to HPV type-specific infection and cervical lesion progression, which might have a potential application value in cervical cancer screening and therapy. PMID:27223085

Binge eating as a major phenotype of melanocortin 4 receptor gene mutations.

PubMed

Branson, Ruth; Potoczna, Natascha; Kral, John G; Lentes, Klaus-Ulrich; Hoehe, Margret R; Horber, Fritz F

2003-03-20

Obesity, a multifactorial disease caused by the interaction of genetic factors with the environment, is largely polygenic. A few mutations in these genes, such as in the leptin receptor (LEPR) gene and melanocortin 4 receptor (MC4R) gene, have been identified as causes of monogenic obesity. We sequenced the complete MC4R coding region, the region of the proopiomelanocortin gene (POMC) encoding the alpha melanocyte-stimulating hormone, and the leptin-binding domain of LEPR in 469 severely obese white subjects (370 women and 99 men; mean [+/-SE] age, 41.0+/-0.5 years; body-mass index [the weight in kilograms divided by the square of the height in meters], 44.1+/-2.0). Fifteen women and 10 men without a history of dieting or a family history of obesity served as normal-weight controls (age, 47.7+/-2.0 years; body-mass index, 21.6+/-0.4). Detailed phenotypic data, including information on body fat, resting energy expenditure, diet-induced thermogenesis, serum concentrations of leptin, and eating behavior, were collected. Twenty-four obese subjects (5.1 percent) and one control subject (4 percent) had MC4R mutations, including five novel variants. Twenty of the 24 obese subjects with an MC4R mutation were matched for age, sex, and body-mass index with 120 of the 445 obese subjects without an MC4R mutation. All mutation carriers reported binge eating, as compared with 14.2 percent of obese subjects without mutations (P<0.001) and 0 percent of the normal-weight subjects without mutations. The prevalence of binge eating was similar among carriers of mutations in the leptin-binding domain of LEPR and noncarriers. No mutations were found in the region of POMC encoding alpha melanocyte-stimulating hormone. Binge eating is a major phenotypic characteristic of subjects with a mutation in MC4R, a candidate gene for the control of eating behavior. Copyright 2003 Massachusetts Medical Society

Antidepressant Effects of the Muscarinic Cholinergic Receptor Antagonist Scopolamine: A Review

PubMed Central

Drevets, Wayne C.; Zarate, Carlos A.; Furey, Maura L.

2014-01-01

The muscarinic cholinergic receptor system has been implicated in the pathophysiology of depression, with physiological evidence indicating this system is overactive or hyperresponsive in depression and with genetic evidence showing that variation in genes coding for receptors within this system are associated with higher risk for depression. In studies aimed at assessing whether a reduction in muscarinic cholinergic receptor function would improve depressive symptoms, the muscarinic receptor antagonist scopolamine manifested antidepressant effects that were robust and rapid relative to conventional pharmacotherapies. Here, we review the data from a series of randomized, double-blind, placebo-controlled studies involving subjects with unipolar or bipolar depression treated with parenteral doses of scopolamine. The onset and duration of the antidepressant response are considered in light of scopolamine's pharmacokinetic properties and an emerging literature that characterizes scopolamine's effects on neurobiological systems beyond the cholinergic system that appear relevant to the neurobiology of mood disorders. Scopolamine infused at 4.0 μg/kg intravenously produced robust antidepressant effects versus placebo, which were evident within 3 days after the initial infusion. Placebo-adjusted remission rates were 56% and 45% for the initial and subsequent replication studies, respectively. While effective in male and female subjects, the change in depression ratings was greater in female subjects. Clinical improvement persisted more than 2 weeks following the final infusion. The timing and persistence of the antidepressant response to scopolamine suggest a mechanism beyond that of direct muscarinic cholinergic antagonism. These temporal relationships suggest that scopolamine-induced changes in gene expression and synaptic plasticity may confer the therapeutic mechanism. PMID:23200525

Effect of paricalcitol and GcMAF on angiogenesis and human peripheral blood mononuclear cell proliferation and signaling.

PubMed

Pacini, Stefania; Morucci, Gabriele; Punzi, Tiziana; Gulisano, Massimo; Ruggiero, Marco; Amato, Marcello; Aterini, Stefano

2012-01-01

In addition to its role in calcium homeostasis and bone mineralization, vitamin D is involved in immune defence, cardiovascular function, inflammation and angiogenesis, and these pleiotropic effects are of interested in the treatment of chronic kidney disease. Here we investigated the effects of paricalcitol, a nonhypercalcemic vitamin D analogue, on human peripheral blood mononuclear cell proliferation and signaling, and on angiogenesis. These effects were compared with those of a known inhibitor of angiogenesis pertaining to the vitamin D axis, the vitamin D-binding protein-derived Gc-macrophage activating factor (GcMAF). Since the effects of vitamin D receptor agonists are associated with polymorphisms of the gene coding for the receptor, we measured the effects of both compounds on mononuclear cells harvested from subjects harboring different BsmI polymorphisms. Paricalcitol inhibited mononuclear cell viability with the bb genotype showing the highest effect. GcMAF, on the contrary, stimulated cell proliferation, with the bb genotype showing the highest stimulatory effect. Both compounds stimulated 3'-5'-cyclic adenosine monophosphate formation in mononuclear cells with the highest effect on the bb genotype. Paricalcitol and GcMAF inhibited the angiogenesis induced by proinflammatory prostaglandin E1. Polymorphisms of the vitamin D receptor gene, known to be associated with the highest responses to vitamin D receptor agonists, are also associated with the highest responses to GcMAF. These results highlight the role of the vitamin D axis in chronic kidney disease, an axis which includes vitamin D, its receptor and vitamin D-binding protein-derived GcMAF.

A 16-year-old girl with anti-NMDA-receptor encephalitis and family history of psychotic disorders.

PubMed

Cleland, Neil; Lieblich, Samuel; Schalling, Martin; Rahm, Christoffer

2015-12-01

Autoimmune NMDA-R encephalitis (ANRE) shares clinical features with schizophrenia. Recent research also indicates that both disorders are associated with dysfunction of the N-Methyl-D-Aspartate glutamate receptors (NMDA-R) subunit 1. We present the case of Ms A, 16 years old. Ms A presented with acute personality change, bizarre behaviour, delusional ideas and atypical seizures. She had a family history of psychotic disorders, and autistic traits diagnosed in childhood. She was initially diagnosed with a psychotic disorder. Delayed testing of CSF indicated ANRE. As the patient was a Jehovah's witness the treating team was unable to use gammaglobulin therapy; they instead relied on combined plasmapheresis and rituximab. To exclude the possibility that the affected members of this family shared a gene coding for an abnormal configuration of the NMDA receptor subunit 1 we sequenced the region of the GRIN1 gene in DNA extracted from blood in both Ms A and her grandmother. Ms A's condition improved dramatically, though her long-term memory is still demonstrably impaired. No genetic abnormality was detected. This case emphasizes how important it is, for a first episode psychosis, to exclude ANRE and other autoimmune synaptic encephalitides, even in the face of significant family history, and if seronegative, the importance of testing for CSF autoantibodies.

Rare variant in scavenger receptor BI raises HDL cholesterol and increases risk of coronary heart disease.

PubMed

Zanoni, Paolo; Khetarpal, Sumeet A; Larach, Daniel B; Hancock-Cerutti, William F; Millar, John S; Cuchel, Marina; DerOhannessian, Stephanie; Kontush, Anatol; Surendran, Praveen; Saleheen, Danish; Trompet, Stella; Jukema, J Wouter; De Craen, Anton; Deloukas, Panos; Sattar, Naveed; Ford, Ian; Packard, Chris; Majumder, Abdullah al Shafi; Alam, Dewan S; Di Angelantonio, Emanuele; Abecasis, Goncalo; Chowdhury, Rajiv; Erdmann, Jeanette; Nordestgaard, Børge G; Nielsen, Sune F; Tybjærg-Hansen, Anne; Schmidt, Ruth Frikke; Kuulasmaa, Kari; Liu, Dajiang J; Perola, Markus; Blankenberg, Stefan; Salomaa, Veikko; Männistö, Satu; Amouyel, Philippe; Arveiler, Dominique; Ferrieres, Jean; Müller-Nurasyid, Martina; Ferrario, Marco; Kee, Frank; Willer, Cristen J; Samani, Nilesh; Schunkert, Heribert; Butterworth, Adam S; Howson, Joanna M M; Peloso, Gina M; Stitziel, Nathan O; Danesh, John; Kathiresan, Sekar; Rader, Daniel J

2016-03-11

Scavenger receptor BI (SR-BI) is the major receptor for high-density lipoprotein (HDL) cholesterol (HDL-C). In humans, high amounts of HDL-C in plasma are associated with a lower risk of coronary heart disease (CHD). Mice that have depleted Scarb1 (SR-BI knockout mice) have markedly elevated HDL-C levels but, paradoxically, increased atherosclerosis. The impact of SR-BI on HDL metabolism and CHD risk in humans remains unclear. Through targeted sequencing of coding regions of lipid-modifying genes in 328 individuals with extremely high plasma HDL-C levels, we identified a homozygote for a loss-of-function variant, in which leucine replaces proline 376 (P376L), in SCARB1, the gene encoding SR-BI. The P376L variant impairs posttranslational processing of SR-BI and abrogates selective HDL cholesterol uptake in transfected cells, in hepatocyte-like cells derived from induced pluripotent stem cells from the homozygous subject, and in mice. Large population-based studies revealed that subjects who are heterozygous carriers of the P376L variant have significantly increased levels of plasma HDL-C. P376L carriers have a profound HDL-related phenotype and an increased risk of CHD (odds ratio = 1.79, which is statistically significant). Copyright © 2016, American Association for the Advancement of Science.

[Post partum depression: future perspectives].

PubMed

Pinna, Martina; Zompo, Maria Del

2012-01-01

Post partum depression (PPD) is a psychiatric illness approximately affecting 10-20% of women after childbirth. The objective of this work is to update our knowledge of PPD giving particular emphasis to etiopathogenetic hypotheses. An accurate search of the literature on this topic was conducted using free dedicated websites such as PubMed. The most recent studies reveal that PPD is a complex disease, whose pathogenesis is not yet clarified, determined by a mix of genetic, biological and environmental factors. Genetic studies have shown a possible involvement of polymorphisms of genes coding for serotonin transporter, 5HT2A and 5HT2C receptors, HMCN1 and METTL13 genes, D2 receptor and GABAA receptor (GABAAR). The involvement of these systems might provide an explanation of the relations among genetic alterations, hormonal fluctuations in the post partum, changes in neurotransmission and mood fluctuations typical of PPD. The results obtained so far are not exhaustive. However, there is a substantial evidence showing that patients with PPD may have a high genetic vulnerability, although we have not been able yet to pinpoint a specific biological marker of the disease. Recent research is focusing on the δ subunit of GABAAR and the possible role of selective agonists of this subunit, such as gaboxadol, in the treatment of PPD.

Dynamic evolution of the GnRH receptor gene family in vertebrates.

PubMed

Williams, Barry L; Akazome, Yasuhisa; Oka, Yoshitaka; Eisthen, Heather L

2014-10-25

Elucidating the mechanisms underlying coevolution of ligands and receptors is an important challenge in molecular evolutionary biology. Peptide hormones and their receptors are excellent models for such efforts, given the relative ease of examining evolutionary changes in genes encoding for both molecules. Most vertebrates possess multiple genes for both the decapeptide gonadotropin releasing hormone (GnRH) and for the GnRH receptor. The evolutionary history of the receptor family, including ancestral copy number and timing of duplications and deletions, has been the subject of controversy. We report here for the first time sequences of three distinct GnRH receptor genes in salamanders (axolotls, Ambystoma mexicanum), which are orthologous to three GnRH receptors from ranid frogs. To understand the origin of these genes within the larger evolutionary context of the gene family, we performed phylogenetic analyses and probabilistic protein homology searches of GnRH receptor genes in vertebrates and their near relatives. Our analyses revealed four points that alter previous views about the evolution of the GnRH receptor gene family. First, the "mammalian" pituitary type GnRH receptor, which is the sole GnRH receptor in humans and previously presumed to be highly derived because it lacks the cytoplasmic C-terminal domain typical of most G-protein coupled receptors, is actually an ancient gene that originated in the common ancestor of jawed vertebrates (Gnathostomata). Second, unlike previous studies, we classify vertebrate GnRH receptors into five subfamilies. Third, the order of subfamily origins is the inverse of previous proposed models. Fourth, the number of GnRH receptor genes has been dynamic in vertebrates and their ancestors, with multiple duplications and losses. Our results provide a novel evolutionary framework for generating hypotheses concerning the functional importance of structural characteristics of vertebrate GnRH receptors. We show that five subfamilies of vertebrate GnRH receptors evolved early in the vertebrate phylogeny, followed by several independent instances of gene loss. Chief among cases of gene loss are humans, best described as degenerate with respect to GnRH receptors because we retain only a single, ancient gene.

FOXC1 Regulates Expression of Prostaglandin Receptors Leading to an Attenuated Response to Latanoprost.

PubMed

Doucette, Lance P; Footz, Tim; Walter, Michael A

2018-05-01

This study examines the effect of FOXC1 on the prostaglandin pathway in order to explore FOXC1's role in the prostaglandin-resistant glaucoma phenotype commonly seen in Axenfeld-Rieger syndrome. Binding and transcriptional activity of FOXC1 to the gene coding for the EP3 prostaglandin receptor (PTGER3) were evaluated through ChIP-qPCR and luciferase-based assays. Immortalized trabecular meshwork cells (TM1) and HeLa cells had FOXC1 mRNA reduced via siRNA interference. qPCR and Western blot experiments were conducted to examine the changes in prostaglandin receptor expression brought about by lowered FOXC1. TM1 cells were then treated with 10 μM latanoprost acid and/or an siRNA for FOXC1. The expression of fibronectin and matrix metalloproteinase 9 were evaluated via qPCR in each treatment condition. ChIP-qPCR and luciferase experiments confirmed that FOXC1 binds to and activates transcription of the EP3 gene prostaglandin receptor. qPCR and Western experiments in HeLa and TM1 cells showed that FOXC1 siRNA knockdown results in significantly lowered EP3 levels (protein and RNA). In addition, RNA levels of the other prostaglandin receptor genes EP1 (PTGER1), EP2 (PTGER2), EP4 (PTGER4), and FP (PTGFR) were altered when FOXC1 was knocked down in TM1 and HeLa cells. Analysis of fibronectin expression in TM1 cells after treatment with 10 μM latanoprost acid showed a statistically significant increase in expression; this increase was abrogated by cotreatment with a siRNA for FOXC1. We show the abrogation of latanoprost signalling when FOXC1 is knocked down via siRNA in a trabecular meshwork cell line. We propose that the lower levels of active FOXC1 in Axenfeld-Rieger syndrome patients with glaucoma account for the lack of response to prostaglandin-based medications.

Alternative Pre-mRNA Splicing in Mammals and Teleost Fish: A Effective Strategy for the Regulation of Immune Responses Against Pathogen Infection.

PubMed

Chang, Ming Xian; Zhang, Jie

2017-07-15

Pre-mRNA splicing is the process by which introns are removed and the protein coding elements assembled into mature mRNAs. Alternative pre-mRNA splicing provides an important source of transcriptome and proteome complexity through selectively joining different coding elements to form mRNAs, which encode proteins with similar or distinct functions. In mammals, previous studies have shown the role of alternative splicing in regulating the function of the immune system, especially in the regulation of T-cell activation and function. As lower vertebrates, teleost fish mainly rely on a large family of pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) from various invading pathogens. In this review, we summarize recent advances in our understanding of alternative splicing of piscine PRRs including peptidoglycan recognition proteins (PGRPs), nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs), retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) and their downstream signaling molecules, compared to splicing in mammals. We also discuss what is known and unknown about the function of splicing isoforms in the innate immune responses against pathogens infection in mammals and teleost fish. Finally, we highlight the consequences of alternative splicing in the innate immune system and give our view of important directions for future studies.

Coding variants in NOD-like receptors: An association study on risk and survival of colorectal cancer.

PubMed

Huhn, Stefanie; da Silva Filho, Miguel I; Sanmuganantham, Tharmila; Pichulik, Tica; Catalano, Calogerina; Pardini, Barbara; Naccarati, Alessio; Polakova-Vymetálkova, Veronika; Jiraskova, Katerina; Vodickova, Ludmila; Vodicka, Pavel; Löffler, Markus W; Courth, Lioba; Wehkamp, Jan; Din, Farhat V N; Timofeeva, Maria; Farrington, Susan M; Jansen, Lina; Hemminki, Kari; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael; Dunlop, Malcolm G; Weber, Alexander N R; Försti, Asta

2018-01-01

Nod-like receptors (NLRs) are important innate pattern recognition receptors and regulators of inflammation or play a role during development. We systematically analysed 41 non-synonymous single nucleotide polymorphisms (SNPs) in 21 NLR genes in a Czech discovery cohort of sporadic colorectal cancer (CRC) (1237 cases, 787 controls) for their association with CRC risk and survival. Five SNPs were found to be associated with CRC risk and eight with survival at 5% significance level. In a replication analysis using data of two large genome-wide association studies (GWASs) from Germany (DACHS: 1798 cases and 1810 controls) and Scotland (2210 cases and 9350 controls) the associations found in the Czech discovery set were not confirmed. However, expression analysis in human gut-related tissues and immune cells revealed that the NLRs associated with CRC risk or survival in the discovery set were expressed in primary human colon or rectum cells, CRC tissue and/or cell lines, providing preliminary evidence for a potential involvement of NLRs in general in CRC development and/or progression. Most interesting was the finding that the enigmatic development-related NLRP5 (also known as MATER) was not expressed in normal colon tissue but in colon cancer tissue and cell lines. Future studies may show whether regulatory variants instead of coding variants might affect the expression of NLRs and contribute to CRC risk and survival.

Molecular cloning and evolutionary analysis of captive forest musk deer bitter taste receptor gene T2R16.

PubMed

Zhao, G J; Wu, N; Li, D Y; Zeng, D J; Chen, Q; Lu, L; Feng, X L; Zhang, C L; Zheng, C L; Jie, H

2015-12-08

Sensing bitter tastes is crucial for most animals because it can prevent them from ingesting harmful food. This process is mainly mediated by the bitter taste receptors (T2R) that are largely expressed in the taste buds. Previous studies have identified some T2R gene repertoires. Marked variation in repertoire size has been noted among species. However, research on T2Rs is still limited and the mechanisms underlying the evolution of vertebrate T2Rs remain poorly understood. In the present study, we analyzed the structure and features of the protein encoded by the forest musk deer (Moschus berezovskii) T2R16 and submitted the gene sequence to NCBI GenBank. The results showed that the full coding DNA sequence (CDS) of musk deer T2R16 (GenBank accession No. KP677279) was 906 bp, encoding 301 amino acids, which contained ATG start codon and TGA stop codon, with a calculated molecular weight of 35.03 kDa and an isoelectric point of 9.56. The T2R16 protein receptor had seven conserved transmembrane regions. Hydrophobicity analysis showed that most amino acid residues in T2R16 protein were hydrophobic, and the grand average of hydrophobicity (GRAVY) was 0.657. Phylogenetic analysis based on this gene revealed that forest musk deer had the closest association with sheep (Ovis aries), as compared to cow (Bos taurus), Tursiops truncatus, and other species, whereas it was genetically farthest from humans (Homo sapiens). We hope these results would complement the existing data on T2R16 and encourage further research in this respect.

Interaction of polymorphisms in the genes encoding interleukin-6 and estrogen receptor beta on the susceptibility to Parkinson's disease.

PubMed

Håkansson, Anna; Westberg, Lars; Nilsson, Staffan; Buervenich, Silvia; Carmine, Andrea; Holmberg, Björn; Sydow, Olof; Olson, Lars; Johnels, Bo; Eriksson, Elias; Nissbrandt, Hans

2005-02-05

The multifunctional cytokine interleukin-6 (IL-6) is involved in inflammatory processes in the central nervous system and increased levels of IL-6 have been found in patients with Parkinson's disease (PD). It is known that estrogen inhibits the production of IL-6, via action on estrogen receptors, thereby pointing to an important influence of estrogen on IL-6. In a previous study, we reported an association between a G/A single nucleotide polymorphism (SNP) at position 1730 in the gene coding for estrogen receptor beta (ERbeta) and age of onset of PD. To investigate the influence of a G/C SNP at position 174 in the promoter of the IL-6 gene, and the possible interaction of this SNP and the ERbeta G-1730A SNP on the risk for PD, the G-174C SNP was genotyped, by pyrosequencing, in 258 patients with PD and 308 controls. A significantly elevated frequency of the GG genotype of the IL-6 SNP was found in the patient group and this was most obvious among patients with an early age of onset (

Large-scale chromatin remodeling at the immunoglobulin heavy chain locus: a paradigm for multigene regulation.

PubMed

Bolland, Daniel J; Wood, Andrew L; Corcoran, Anne E

2009-01-01

V(D)J recombination in lymphocytes is the cutting and pasting together of antigen receptor genes in cis to generate the enormous variety of coding sequences required to produce diverse antigen receptor proteins. It is the key role of the adaptive immune response, which must potentially combat millions of different foreign antigens. Most antigen receptor loci have evolved to be extremely large and contain multiple individual V, D and J genes. The immunoglobulin heavy chain (Igh) and immunoglobulin kappa light chain (Igk) loci are the largest multigene loci in the mammalian genome and V(D)J recombination is one of the most complicated genetic processes in the nucleus. The challenge for the appropriate lymphocyte is one of macro-management-to make all of the antigen receptor genes in a particular locus available for recombination at the appropriate developmental time-point. Conversely, these large loci must be kept closed in lymphocytes in which they do not normally recombine, to guard against genomic instability generated by the DNA double strand breaks inherent to the V(D)J recombination process. To manage all of these demanding criteria, V(D)J recombination is regulated at numerous levels. It is restricted to lymphocytes since the Rag genes which control the DNA double-strand break step of recombination are only expressed in these cells. Within the lymphocyte lineage, immunoglobulin recombination is restricted to B-lymphocytes and TCR recombination to T-lymphocytes by regulation of locus accessibility, which occurs at multiple levels. Accessibility of recombination signal sequences (RSSs) flanking individual V, D and J genes at the nucleosomal level is the key micro-management mechanism, which is discussed in greater detail in other chapters. This chapter will explore how the antigen receptor loci are regulated as a whole, focussing on the Igh locus as a paradigm for the mechanisms involved. Numerous recent studies have begun to unravel the complex and complementary processes involved in this large-scale locus organisation. We will examine the structure of the Igh locus and the large-scale and higher-order chromatin remodelling processes associated with V(D)J recombination, at the level of the locus itself, its conformational changes and its dynamic localisation within the nucleus.

The Evolution and Expression Pattern of Human Overlapping lncRNA and Protein-coding Gene Pairs.

PubMed

Ning, Qianqian; Li, Yixue; Wang, Zhen; Zhou, Songwen; Sun, Hong; Yu, Guangjun

2017-03-27

Long non-coding RNA overlapping with protein-coding gene (lncRNA-coding pair) is a special type of overlapping genes. Protein-coding overlapping genes have been well studied and increasing attention has been paid to lncRNAs. By studying lncRNA-coding pairs in human genome, we showed that lncRNA-coding pairs were more likely to be generated by overprinting and retaining genes in lncRNA-coding pairs were given higher priority than non-overlapping genes. Besides, the preference of overlapping configurations preserved during evolution was based on the origin of lncRNA-coding pairs. Further investigations showed that lncRNAs promoting the splicing of their embedded protein-coding partners was a unilateral interaction, but the existence of overlapping partners improving the gene expression was bidirectional and the effect was decreased with the increased evolutionary age of genes. Additionally, the expression of lncRNA-coding pairs showed an overall positive correlation and the expression correlation was associated with their overlapping configurations, local genomic environment and evolutionary age of genes. Comparison of the expression correlation of lncRNA-coding pairs between normal and cancer samples found that the lineage-specific pairs including old protein-coding genes may play an important role in tumorigenesis. This work presents a systematically comprehensive understanding of the evolution and the expression pattern of human lncRNA-coding pairs.

Donohue syndrome and use of continuous subcutaneous insulin pump therapy.

PubMed

Huggard, Dean; Stack, Tom; Satas, Saulius; Gorman, Clodagh O

2015-10-27

Donohue syndrome is a rare autosomal recessive condition caused by severe loss-of-function mutations in the insulin receptor (INSR) gene. The diagnosis is made on clinical, biochemical and genetic grounds. Mutations are found on chromosome 19p13.2, and code for mutations in the INSR gene. Treatment is challenging and often unsuccessful, and relies on maintaining normoglycaemia and avoiding fasting; in some patients, recombinant human insulin-like growth factor (rhIGF-1) has been trialled. The prognosis is poor, with most babies dying in infancy. Ethically, it is important to consider the benefit versus burden of treatment, the quality of life of the surviving patient and the parents' wishes, when making decisions regarding withholding or withdrawing care. 2015 BMJ Publishing Group Ltd.

The evolving role of the orphan nuclear receptor ftz-f1, a pair-rule segmentation gene.

PubMed

Heffer, Alison; Grubbs, Nathaniel; Mahaffey, James; Pick, Leslie

2013-01-01

Segmentation is a critical developmental process that occurs by different mechanisms in diverse taxa. In insects, there are three common modes of embryogenesis-short-, intermediate-, and long-germ development-which differ in the number of segments specified at the blastoderm stage. While genes involved in segmentation have been extensively studied in the long-germ insect Drosophila melanogaster (Dm), it has been found that their expression and function in segmentation in short- and intermediate-germ insects often differ. Drosophila ftz-f1 encodes an orphan nuclear receptor that functions as a maternally expressed pair-rule segmentation gene, responsible for the formation of alternate body segments during Drosophila embryogenesis. Here we investigated the expression and function of ftz-f1 in the short-germ beetle, Tribolium castaneum (Tc). We found that Tc-ftz-f1 is expressed in stripes in Tribolium embryos. These stripes overlap alternate Tc-Engrailed (Tc-En) stripes, indicative of a pair-rule expression pattern. To test whether Tc-ftz-f1 has pair-rule function, we utilized embryonic RNAi, injecting double-stranded RNA corresponding to Tc-ftz-f1 coding or non-coding regions into early Tribolium embryos. Knockdown of Tc-ftz-f1 produced pair-rule segmentation defects, evidenced by loss of expression of alternate En stripes. In addition, a later role for Tc-ftz-f1 in cuticle formation was revealed. These results identify a new pair-rule gene in Tribolium and suggest that its role in segmentation may be shared among holometabolous insects. Interestingly, while Tc-ftz-f1 is expressed in pair-rule stripes, the gene is ubiquitously expressed in Drosophila embryos. Thus, the pair-rule function of ftz-f1 is conserved despite differences in expression patterns of ftz-f1 genes in different lineages. This suggests that ftz-f1 expression changed after the divergence of lineages leading to extant beetles and flies, likely due to differences in cis-regulatory sequences. We propose that the dependence of Dm-Ftz-F1 on interaction with the homeodomain protein Ftz which is expressed in stripes in Drosophila, loosened constraints on Dm-ftz-f1 expression, allowing for ubiquitous expression of this pair-rule gene in Drosophila. © 2013 Wiley Periodicals, Inc.

Silicon protects soybean plants against Phytophthora sojae by interfering with effector-receptor expression.

PubMed

Rasoolizadeh, Aliyeh; Labbé, Caroline; Sonah, Humira; Deshmukh, Rupesh K; Belzile, François; Menzies, James G; Bélanger, Richard R

2018-05-30

Silicon (Si) is known to protect against biotrophic and hemibiotrophic plant pathogens; however, the mechanisms by which it exerts its prophylactic role remain unknown. In an attempt to obtain unique insights into the mode of action of Si, we conducted a full comparative transcriptomic analysis of soybean (Glycine max) plants and Phytophthora sojae, a hemibiotroph that relies heavily on effectors for its virulence. Supplying Si to inoculated plants provided a strong protection against P. sojae over the course of the experiment (21 day). Our results showed that the response of Si-free (Si - ) plants to inoculation was characterized early (4 dpi) by a high expression of defense-related genes, including plant receptors, which receded over time as the pathogen progressed into the roots. The infection was synchronized with a high expression of effectors by P. sojae, the nature of which changed over time. By contrast, the transcriptomic response of Si-fed (Si + ) plants was remarkably unaffected by the presence of P. sojae, and the expression of effector-coding genes by the pathogen was significantly reduced. Given that the apoplast is a key site of interaction between effectors and plant defenses and receptors in the soybean-P. sojae complex, as well as the site of amorphous-Si accumulation, our results indicate that Si likely interferes with the signaling network between P. sojae and the plant, preventing or decreasing the release of effectors reaching plant receptors, thus creating a form of incompatible interaction.

The alpaca melanocortin 1 receptor: gene mutations, transcripts, and relative levels of expression in ventral skin biopsies.

PubMed

Chandramohan, Bathrachalam; Renieri, Carlo; La Manna, Vincenzo; La Terza, Antonietta

2015-01-01

The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5'-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3'UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation.

A Recurrent Germline Mutation in the 5'UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation.

PubMed

Hornig, Nadine C; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

2016-01-01

A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5' untranslated region (5'-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5'UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5'UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general.

A Recurrent Germline Mutation in the 5’UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation

PubMed Central

Hornig, Nadine C.; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E.; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

2016-01-01

A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5’ untranslated region (5’-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5′UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5′UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general. PMID:27110943

Autism gene variant causes hyperserotonemia, serotonin receptor hypersensitivity, social impairment and repetitive behavior

PubMed Central

Veenstra-VanderWeele, Jeremy; Muller, Christopher L.; Iwamoto, Hideki; Sauer, Jennifer E.; Owens, W. Anthony; Shah, Charisma R.; Cohen, Jordan; Mannangatti, Padmanabhan; Jessen, Tammy; Thompson, Brent J.; Ye, Ran; Kerr, Travis M.; Carneiro, Ana M.; Crawley, Jacqueline N.; Sanders-Bush, Elaine; McMahon, Douglas G.; Ramamoorthy, Sammanda; Daws, Lynette C.; Sutcliffe, James S.; Blakely, Randy D.

2012-01-01

Fifty years ago, increased whole-blood serotonin levels, or hyperserotonemia, first linked disrupted 5-HT homeostasis to Autism Spectrum Disorders (ASDs). The 5-HT transporter (SERT) gene (SLC6A4) has been associated with whole blood 5-HT levels and ASD susceptibility. Previously, we identified multiple gain-of-function SERT coding variants in children with ASD. Here we establish that transgenic mice expressing the most common of these variants, SERT Ala56, exhibit elevated, p38 MAPK-dependent transporter phosphorylation, enhanced 5-HT clearance rates and hyperserotonemia. These effects are accompanied by altered basal firing of raphe 5-HT neurons, as well as 5HT1A and 5HT2A receptor hypersensitivity. Strikingly, SERT Ala56 mice display alterations in social function, communication, and repetitive behavior. Our efforts provide strong support for the hypothesis that altered 5-HT homeostasis can impact risk for ASD traits and provide a model with construct and face validity that can support further analysis of ASD mechanisms and potentially novel treatments. PMID:22431635

A comparative analysis of MC4R gene sequence, polymorphism, and chromosomal localization in Chinese raccoon dog and Arctic fox.

PubMed

Skorczyk, Anna; Flisikowski, Krzysztof; Switonski, Marek

2012-05-01

Numerous mutations of the human melanocortin receptor type 4 (MC4R) gene are responsible for monogenic obesity, and some of them appear to be associated with predisposition or resistance to polygenic obesity. Thus, this gene is considered a functional candidate for fat tissue accumulation and body weight in domestic mammals. The aim of the study was comparative analysis of chromosome localization, nucleotide sequence, and polymorphism of the MC4R gene in two farmed species of the Canidae family, namely the Chinese raccoon dog (Nycterutes procyonoides procyonoides) and the arctic fox (Alopex lagopus). The whole coding sequence, including fragments of 3'UTR and 5'UTR, shows 89% similarity between the arctic fox (1276 bp) and Chinese raccoon dog (1213 bp). Altogether, 30 farmed Chinese raccoon dogs and 30 farmed arctic foxes were searched for polymorphisms. In the Chinese raccoon dog, only one silent substitution in the coding sequence was identified; whereas in the arctic fox, four InDels and two single-nucleotide polymorphisms (SNPs) in the 5'UTR and six silent SNPs in the exon were found. The studied gene was mapped by FISH to the Chinese raccoon dog chromosome 9 (NPP9q1.2) and arctic fox chromosome 24 (ALA24q1.2-1.3). The obtained results are discussed in terms of genome evolution of species belonging to the family Canidae and their potential use in animal breeding.

miRNA as a New Regulatory Mechanism of Estrogen Vascular Action.

PubMed

Pérez-Cremades, Daniel; Mompeón, Ana; Vidal-Gómez, Xavier; Hermenegildo, Carlos; Novella, Susana

2018-02-06

The beneficial effects of estrogen on the cardiovascular system have been reported extensively. In fact, the incidence of cardiovascular diseases in women is lower than in age-matched men during their fertile stage of life, a benefit that disappears after menopause. These sex-related differences point to sexual hormones, mainly estrogen, as possible cardiovascular protective factors. The regulation of vascular function by estrogen is mainly related to the maintenance of normal endothelial function and is mediated by both direct and indirect gene transcription through the activity of specific estrogen receptors. Some of these mechanisms are known, but many remain to be elucidated. In recent years, microRNAs have been established as non-coding RNAs that regulate the expression of a high percentage of protein-coding genes in mammals and are related to the correct function of human physiology. Moreover, within the cardiovascular system, miRNAs have been related to physiological and pathological conditions. In this review, we address what is known about the role of estrogen-regulated miRNAs and their emerging involvement in vascular biology.

The transcription factor NRSF contributes to epileptogenesis by selective repression of a subset of target genes

PubMed Central

McClelland, Shawn; Brennan, Gary P; Dubé, Celine; Rajpara, Seeta; Iyer, Shruti; Richichi, Cristina; Bernard, Christophe; Baram, Tallie Z

2014-01-01

The mechanisms generating epileptic neuronal networks following insults such as severe seizures are unknown. We have previously shown that interfering with the function of the neuron-restrictive silencer factor (NRSF/REST), an important transcription factor that influences neuronal phenotype, attenuated development of this disorder. In this study, we found that epilepsy-provoking seizures increased the low NRSF levels in mature hippocampus several fold yet surprisingly, provoked repression of only a subset (∼10%) of potential NRSF target genes. Accordingly, the repressed gene-set was rescued when NRSF binding to chromatin was blocked. Unexpectedly, genes selectively repressed by NRSF had mid-range binding frequencies to the repressor, a property that rendered them sensitive to moderate fluctuations of NRSF levels. Genes selectively regulated by NRSF during epileptogenesis coded for ion channels, receptors, and other crucial contributors to neuronal function. Thus, dynamic, selective regulation of NRSF target genes may play a role in influencing neuronal properties in pathological and physiological contexts. DOI: http://dx.doi.org/10.7554/eLife.01267.001 PMID:25117540

5HT-2C receptor polymorphism in suicide victims. Association studies in German and Slavic populations.

PubMed

Stefulj, Jasminka; Büttner, Andreas; Kubat, Milovan; Zill, Peter; Balija, Melita; Eisenmenger, Wolfgang; Bondy, Brigitta; Jernej, Branimir

2004-08-01

Sustainable observations suggest that suicidal behaviour by itself may have biological correlates, among which those related to the serotonergic synapse hold the key position. Based on the association of suicide and serotonergic dysfunction, it was proposed that genetic mechanisms affecting suicidal behaviour could be related to the alterations of the genes encoding the elements of 5HT synapse. The present study tested the association of the polymorphism in the serotonin 2C (5HT-2C) receptor coding region (Cys23Ser) with suicide commitment. Study was based on two independent samples, one of German (284 suicide victims versus 297 controls) and other of Slavic/Croatian (118 suicide victims versus 275 controls) ethnicity. No significant differences in allele or genotype frequencies between victims and controls were demonstrated. Results did not provide supporting evidence for the potential involvement of the investigated variants of 5HT-2C receptor in the susceptibility to suicide.

Mechanism of retinoic acid-induced transcription: histone code, DNA oxidation and formation of chromatin loops.

PubMed

Zuchegna, Candida; Aceto, Fabiana; Bertoni, Alessandra; Romano, Antonella; Perillo, Bruno; Laccetti, Paolo; Gottesman, Max E; Avvedimento, Enrico V; Porcellini, Antonio

2014-01-01

Histone methylation changes and formation of chromatin loops involving enhancers, promoters and 3' end regions of genes have been variously associated with active transcription in eukaryotes. We have studied the effect of activation of the retinoic A receptor, at the RARE-promoter chromatin of CASP9 and CYP26A1 genes, 15 and 45 min following RA exposure, and we found that histone H3 lysines 4 and 9 are demethylated by the lysine-specific demethylase, LSD1 and by the JMJ-domain containing demethylase, D2A. The action of the oxidase (LSD1) and a dioxygenase (JMJD2A) in the presence of Fe++ elicits an oxidation wave that locally modifies the DNA and recruits the enzymes involved in base and nucleotide excision repair (BER and NER). These events are essential for the formation of chromatin loop(s) that juxtapose the RARE element with the 5' transcription start site and the 3' end of the genes. The RARE bound-receptor governs the 5' and 3' end selection and directs the productive transcription cycle of RNA polymerase. These data mechanistically link chromatin loops, histone methylation changes and localized DNA repair with transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The ANKK1 kinase gene and psychiatric disorders.

PubMed

Ponce, Guillermo; Pérez-González, Rocío; Aragüés, María; Palomo, Tomás; Rodríguez-Jiménez, Roberto; Jiménez-Arriero, Miguel Angel; Hoenicka, Janet

2009-07-01

The TaqIA single nucleotide polymorphism (SNP, rs1800497), which is located in the gene that codes for the putative kinase ANKK1 (ANKK1) near the termination codon of the D2 dopamine receptor gene (DRD2; chromosome 11q22-q23), is the most studied genetic variation in a broad range of psychiatric disorders and personality traits. A large number of individual genetic association studies have found that the TaqIA SNP is linked to alcoholism and antisocial traits. In addition, it has also been related to other conditions such as schizophrenia, eating disorders, and some behavioral childhood disorders. The TaqIA A1 allele is mainly associated with addictions, antisocial disorders, eating disorders, and attention-deficit/hyperactivity disorders, while the A2 allele occurs more frequently in schizophrenic and obsessive-compulsive patients. Current data show that the TaqIA polymorphism may be a marker of both DRD2 and ANKK1 genetic variants. ANKK1 would belong to a family of kinases involved in signal transduction. This raises the question of whether signaling players intervene in the pathophysiology of psychiatric disorders. Basic research on the ANKK1 protein and its putative interaction with the D2 dopamine receptor could shed light on this issue.

Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

PubMed

Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

2014-03-07

To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants.

Monoterpenoid-based preparations in beehives affect learning, memory, and gene expression in the bee brain.

PubMed

Bonnafé, Elsa; Alayrangues, Julie; Hotier, Lucie; Massou, Isabelle; Renom, Allan; Souesme, Guillaume; Marty, Pierre; Allaoua, Marion; Treilhou, Michel; Armengaud, Catherine

2017-02-01

Bees are exposed in their environment to contaminants that can weaken the colony and contribute to bee declines. Monoterpenoid-based preparations can be introduced into hives to control the parasitic mite Varroa destructor. The long-term effects of monoterpenoids are poorly investigated. Olfactory conditioning of the proboscis extension reflex (PER) has been used to evaluate the impact of stressors on cognitive functions of the honeybee such as learning and memory. The authors tested the PER to odorants on bees after exposure to monoterpenoids in hives. Octopamine receptors, transient receptor potential-like (TRPL), and γ-aminobutyric acid channels are thought to play a critical role in the memory of food experience. Gene expression levels of Amoa1, Rdl, and trpl were evaluated in parallel in the bee brain because these genes code for the cellular targets of monoterpenoids and some pesticides and neural circuits of memory require their expression. The miticide impaired the PER to odors in the 3 wk following treatment. Short-term and long-term olfactory memories were improved months after introduction of the monoterpenoids into the beehives. Chronic exposure to the miticide had significant effects on Amoa1, Rdl, and trpl gene expressions and modified seasonal changes in the expression of these genes in the brain. The decrease of expression of these genes in winter could partly explain the improvement of memory. The present study has led to new insights into alternative treatments, especially on their effects on memory and expression of selected genes involved in this cognitive function. Environ Toxicol Chem 2017;36:337-345. © 2016 SETAC. © 2016 SETAC.

Unbiased View of Synaptic and Neuronal Gene Complement in Ctenophores: Are There Pan-neuronal and Pan-synaptic Genes across Metazoa?

PubMed

Moroz, Leonid L; Kohn, Andrea B

2015-12-01

Hypotheses of origins and evolution of neurons and synapses are controversial, mostly due to limited comparative data. Here, we investigated the genome-wide distribution of the bilaterian "synaptic" and "neuronal" protein-coding genes in non-bilaterian basal metazoans (Ctenophora, Porifera, Placozoa, and Cnidaria). First, there are no recognized genes uniquely expressed in neurons across all metazoan lineages. None of the so-called pan-neuronal genes such as embryonic lethal abnormal vision (ELAV), Musashi, or Neuroglobin are expressed exclusively in neurons of the ctenophore Pleurobrachia. Second, our comparative analysis of about 200 genes encoding canonical presynaptic and postsynaptic proteins in bilaterians suggests that there are no true "pan-synaptic" genes or genes uniquely and specifically attributed to all classes of synapses. The majority of these genes encode receptive and secretory complexes in a broad spectrum of eukaryotes. Trichoplax (Placozoa) an organism without neurons and synapses has more orthologs of bilaterian synapse-related/neuron-related genes than do ctenophores-the group with well-developed neuronal and synaptic organization. Third, the majority of genes encoding ion channels and ionotropic receptors are broadly expressed in unicellular eukaryotes and non-neuronal tissues in metazoans. Therefore, they cannot be viewed as neuronal markers. Nevertheless, the co-expression of multiple types of ion channels and receptors does correlate with the presence of neural and synaptic organization. As an illustrative example, the ctenophore genomes encode a greater diversity of ion channels and ionotropic receptors compared with the genomes of the placozoan Trichoplax and the demosponge Amphimedon. Surprisingly, both placozoans and sponges have a similar number of orthologs of "synaptic" proteins as we identified in the genomes of two ctenophores. Ctenophores have a distinct synaptic organization compared with other animals. Our analysis of transcriptomes from 10 different ctenophores did not detect recognized orthologs of synthetic enzymes encoding several classical, low-molecular-weight (neuro)transmitters; glutamate signaling machinery is one of the few exceptions. Novel peptidergic signaling molecules were predicted for ctenophores, together with the diversity of putative receptors including SCNN1/amiloride-sensitive sodium channel-like channels, many of which could be examples of a lineage-specific expansion within this group. In summary, our analysis supports the hypothesis of independent evolution of neurons and, as corollary, a parallel evolution of synapses. We suggest that the formation of synaptic machinery might occur more than once over 600 million years of animal evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

Oxycodone Self-Administration Induces Alterations in Expression of Integrin, Semaphorin and Ephrin Genes in the Mouse Striatum.

PubMed

Yuferov, Vadim; Zhang, Yong; Liang, Yupu; Zhao, Connie; Randesi, Matthew; Kreek, Mary J

2018-01-01

Oxycodone is one a commonly used medication for pain, and is also a widely abused prescription opioid, like other short-acting MOPr agonists. Neurochemical and structural adaptations in brain following chronic MOPr-agonist administration are thought to underlie pathogenesis and persistence of opiate addiction. Many axon guidance molecules, such as integrins, semaphorins, and ephrins may contribute to oxycodone-induced neuroadaptations through alterations in axon-target connections and synaptogenesis, that may be implicated in the behaviors associated with opiate addiction. However, little is known about this important area. The aim of this study is to investigate alterations in expression of selected integrin, semaphorin, ephrins, netrin, and slit genes in the nucleus accumbens (NAc) and caudate putamen (CPu) of mice following extended 14-day oxycodone self-administration (SA), using RNAseq. Methods: Total RNA from the NAc and CPu were isolated from adult male C57BL/6J mice within 1 h after the last session of oxycodone in a 14-day self-administration paradigm (4h/day, 0.25 mg/kg/infusion, FR1) or from yoked saline controls. Gene expressions were examined using RNA sequencing (RNA-Seq) technology. RNA-Seq libraries were prepared using Illumina's TruSeq® Stranded Total RNA LT kit. The reads were aligned to the mouse reference genome (version mm10) using STAR. DESeq2 was applied to the counts of protein coding genes to estimate the fold change between the treatment groups. False Discovery Rate (FDR) q < 0.1 were used to select genes that have a significant expression change. For selection of a subset of genes related to axon guidance pathway, REACTOME was used. Results: Among 38 known genes of the integrin, semaphorin, and ephrin gene families, RNA-seq data revealed up-regulation of six genes in the NAc: heterodimer receptor, integrins Itgal, Itgb2 , and Itgam , and its ligand semaphorin Sema7a , two semaphorin receptors, plexins Plxnd1 and Plxdc1 . There was down-regulation of eight genes in this region: two integrin genes Itga3 and Itgb8 , semaphorins Sema3c, Sema4g, Sema6a, Sema6d , semaphorin receptor neuropilin Nrp2 , and ephrin receptor Epha3 . In the CPu, there were five differentially expressed axon guidance genes: up-regulation of three integrin genes, Itgal, Itgb2, Itga1 , and down-regulation of Itga9 and ephrin Efna3 were thus observed. No significant alterations in expression of Netrin-1 or Slit were observed. Conclusion: We provide evidence for alterations in the expression of selective axon guidance genes in adult mouse brain following chronic self-administration of oxycodone. Further examination of oxycodone-induced changes in the expression of these specific axon guidance molecules and integrin genes in relation to behavior may provide new insights into development of addiction to oxycodone.

An androgen receptor negatively induced long non-coding RNA ARNILA binding to miR-204 promotes the invasion and metastasis of triple-negative breast cancer.

PubMed

Yang, Fang; Shen, Yan; Zhang, Wenwen; Jin, Juan; Huang, Doudou; Fang, Hehui; Ji, Wenfei; Shi, Yaqin; Tang, Lin; Chen, Weiwei; Zhou, Guohua; Guan, Xiaoxiang

2018-05-29

Androgen receptor (AR) is emerging as a novel prognostic biomarker in triple-negative breast cancer (TNBC), but the underlying mechanisms remain unknown. As accumulating evidence has shown that long non-coding RNAs (lncRNAs) regulate important cancer hallmarks, we hypothesised that AR-regulated lncRNAs might play roles in TNBC progression. Here, we performed experiments with or without DHT treatment in three TNBC cell lines, and we identified an AR negatively induced lncRNA (ARNILA), which correlated with poor progression-free survival (PFS) in TNBC patients and promoted epithelial-mesenchymal transition (EMT), invasion and metastasis in vitro and in vivo. Subsequently, we demonstrated that ARNILA functioned as a competing endogenous RNA (ceRNA) for miR-204 to facilitate expression of its target gene Sox4, which is known to induce EMT and contribute to breast cancer progression, thereby promoting EMT, invasion and metastasis of TNBC. Our findings not only provide new insights into the mechanisms of lncRNA in regulating AR but also suggest ARNILA as an alternative therapeutic target to suppress metastasis of TNBC patients.

A mechanistic explanation of popularity: genes, rule breaking, and evocative gene-environment correlations.

PubMed

Burt, Alexandra

2009-04-01

Previous work has suggested that the serotonergic system plays a key role in "popularity" or likeability. A polymorphism within the 5HT-sub(2A) serotonin receptor gene (-G1438A) has also been associated with popularity, suggesting that genes may predispose individuals to particular social experiences. However, because genes cannot code directly for others' reactions, any legitimate association should be mediated via the individual's behavior (i.e., genes-->behaviors-->social consequences), a phenomenon referred to as an evocative gene-environment correlation (rGE). The current study aimed to identify one such mediating behavior. The author focused on rule breaking given its prior links to both the serotonergic system and to increased popularity during adolescence. Two samples of previously unacquainted late-adolescent boys completed a peer-based interaction paradigm designed to assess their popularity. Analyses revealed that rule breaking partially mediated the genetic effect on popularity, thereby furthering our understanding of the biological mechanisms that underlie popularity. Moreover, the present results represent the first meaningfully explicated evidence that genes predispose individuals not only to particular behaviors but also to the social consequences of those behaviors. (c) 2009 APA, all rights reserved.

Mutations in the AVPR2, AVP-NPII, and AQP2 genes in Turkish patients with diabetes insipidus.

PubMed

Duzenli, Duygu; Saglar, Emel; Deniz, Ferhat; Azal, Omer; Erdem, Beril; Mergen, Hatice

2012-12-01

The aim of this study was to identify mutations in three different genes, the arginine-vasopressin-neurophysin II (AVP-NPII) gene, the arginine-vasopressin receptor 2 (AVPR2) gene, and the vasopressin-sensitive water channel aquaporin-2 (AQP2) gene in Turkish patients affected by central diabetes insipidus or nephrogenic diabetes insipidus. This study included 15 patients from unrelated families. Prospective clinical data were collected for all patients including the patients underwent a water deprivation-desmopressin test. The coding regions of the AVPR2, AQP2, and AVP-NPII genes were amplified by polymerase chain reaction and submitted to direct sequence analysis. Of the 15 patients with diabetes insipidus referred to Gulhane Military Medical Academy, Department of Endocrinology and Metabolism, eight patients have AVPR2 mutations, five patients have AQP2 mutations and two patients have AVP-NPII mutations. Of the patients, which have AVPR2 mutations, one is compound heterozygous for AVPR2 gene. Seven of these mutations are novel. Comparison of the clinical outcomes of these mutations may facilitate in understanding the functions of AVP-NPII, AQP2, and AVPR2 genes in future studies.

Genetic variation in glia-neuron signalling modulates ageing rate.

PubMed

Yin, Jiang-An; Gao, Ge; Liu, Xi-Juan; Hao, Zi-Qian; Li, Kai; Kang, Xin-Lei; Li, Hong; Shan, Yuan-Hong; Hu, Wen-Li; Li, Hai-Peng; Cai, Shi-Qing

2017-11-08

The rate of behavioural decline in the ageing population is remarkably variable among individuals. Despite the considerable interest in studying natural variation in ageing rate to identify factors that control healthy ageing, no such factor has yet been found. Here we report a genetic basis for variation in ageing rates in Caenorhabditis elegans. We find that C. elegans isolates show diverse lifespan and age-related declines in virility, pharyngeal pumping, and locomotion. DNA polymorphisms in a novel peptide-coding gene, named regulatory-gene-for-behavioural-ageing-1 (rgba-1), and the neuropeptide receptor gene npr-28 influence the rate of age-related decline of worm mating behaviour; these two genes might have been subjected to recent selective sweeps. Glia-derived RGBA-1 activates NPR-28 signalling, which acts in serotonergic and dopaminergic neurons to accelerate behavioural deterioration. This signalling involves the SIR-2.1-dependent activation of the mitochondrial unfolded protein response, a pathway that modulates ageing. Thus, natural variation in neuropeptide-mediated glia-neuron signalling modulates the rate of ageing in C. elegans.

De Novo Coding Variants Are Strongly Associated with Tourette Disorder

PubMed Central

Willsey, A. Jeremy; Fernandez, Thomas V.; Yu, Dongmei; King, Robert A.; Dietrich, Andrea; Xing, Jinchuan; Sanders, Stephan J.; Mandell, Jeffrey D.; Huang, Alden Y.; Richer, Petra; Smith, Louw; Dong, Shan; Samocha, Kaitlin E.; Neale, Benjamin M.; Coppola, Giovanni; Mathews, Carol A.; Tischfield, Jay A.; Scharf, Jeremiah M.; State, Matthew W.; Heiman, Gary A.

2017-01-01

SUMMARY Whole-exome sequencing (WES) and de novo variant detection have proven a powerful approach to gene discovery in complex neurodevelopmental disorders. We have completed WES of 325 Tourette disorder trios from the Tourette International Collaborative Genetics cohort and a replication sample of 186 trios from the Tourette Syndrome Association International Consortium on Genetics (511 total). We observe strong and consistent evidence for the contribution of de novo likely gene-disrupting (LGD) variants (rate ratio [RR] 2.32, p = 0.002). Additionally, de novo damaging variants (LGD and probably damaging missense) are overrepresented in probands (RR 1.37, p = 0.003). We identify four likely risk genes with multiple de novo damaging variants in unrelated probands: WWC1 (WW and C2 domain containing 1), CELSR3 (Cadherin EGF LAG seven-pass G-type receptor 3), NIPBL (Nipped-B-like), and FN1 (fibronectin 1). Overall, we estimate that de novo damaging variants in approximately 400 genes contribute risk in 12% of clinical cases. PMID:28472652

The first myriapod genome sequence reveals conservative arthropod gene content and genome organisation in the centipede Strigamia maritima.

PubMed

Chipman, Ariel D; Ferrier, David E K; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S T; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C; Alonso, Claudio R; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C J; Blankenburg, Kerstin P; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K; Du Pasquier, Louis; Duncan, Elizabeth J; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D; Extavour, Cassandra G; Francisco, Liezl; Gabaldón, Toni; Gillis, William J; Goodwin-Horn, Elizabeth A; Green, Jack E; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J P; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H L; Hunn, Julia P; Hunnekuhl, Vera S; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N; Jiggins, Francis M; Jones, Tamsin E; Kaiser, Tobias S; Kalra, Divya; Kenny, Nathan J; Korchina, Viktoriya; Kovar, Christie L; Kraus, F Bernhard; Lapraz, François; Lee, Sandra L; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C; Robertson, Helen E; Robertson, Hugh M; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E; Schurko, Andrew M; Siggens, Kenneth W; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M; Willis, Judith H; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M; Worley, Kim C; Gibbs, Richard A; Akam, Michael; Richards, Stephen

2014-11-01

Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific life history.

The First Myriapod Genome Sequence Reveals Conservative Arthropod Gene Content and Genome Organisation in the Centipede Strigamia maritima

PubMed Central

Chipman, Ariel D.; Ferrier, David E. K.; Brena, Carlo; Qu, Jiaxin; Hughes, Daniel S. T.; Schröder, Reinhard; Torres-Oliva, Montserrat; Znassi, Nadia; Jiang, Huaiyang; Almeida, Francisca C.; Alonso, Claudio R.; Apostolou, Zivkos; Aqrawi, Peshtewani; Arthur, Wallace; Barna, Jennifer C. J.; Blankenburg, Kerstin P.; Brites, Daniela; Capella-Gutiérrez, Salvador; Coyle, Marcus; Dearden, Peter K.; Du Pasquier, Louis; Duncan, Elizabeth J.; Ebert, Dieter; Eibner, Cornelius; Erikson, Galina; Evans, Peter D.; Extavour, Cassandra G.; Francisco, Liezl; Gabaldón, Toni; Gillis, William J.; Goodwin-Horn, Elizabeth A.; Green, Jack E.; Griffiths-Jones, Sam; Grimmelikhuijzen, Cornelis J. P.; Gubbala, Sai; Guigó, Roderic; Han, Yi; Hauser, Frank; Havlak, Paul; Hayden, Luke; Helbing, Sophie; Holder, Michael; Hui, Jerome H. L.; Hunn, Julia P.; Hunnekuhl, Vera S.; Jackson, LaRonda; Javaid, Mehwish; Jhangiani, Shalini N.; Jiggins, Francis M.; Jones, Tamsin E.; Kaiser, Tobias S.; Kalra, Divya; Kenny, Nathan J.; Korchina, Viktoriya; Kovar, Christie L.; Kraus, F. Bernhard; Lapraz, François; Lee, Sandra L.; Lv, Jie; Mandapat, Christigale; Manning, Gerard; Mariotti, Marco; Mata, Robert; Mathew, Tittu; Neumann, Tobias; Newsham, Irene; Ngo, Dinh N.; Ninova, Maria; Okwuonu, Geoffrey; Ongeri, Fiona; Palmer, William J.; Patil, Shobha; Patraquim, Pedro; Pham, Christopher; Pu, Ling-Ling; Putman, Nicholas H.; Rabouille, Catherine; Ramos, Olivia Mendivil; Rhodes, Adelaide C.; Robertson, Helen E.; Robertson, Hugh M.; Ronshaugen, Matthew; Rozas, Julio; Saada, Nehad; Sánchez-Gracia, Alejandro; Scherer, Steven E.; Schurko, Andrew M.; Siggens, Kenneth W.; Simmons, DeNard; Stief, Anna; Stolle, Eckart; Telford, Maximilian J.; Tessmar-Raible, Kristin; Thornton, Rebecca; van der Zee, Maurijn; von Haeseler, Arndt; Williams, James M.; Willis, Judith H.; Wu, Yuanqing; Zou, Xiaoyan; Lawson, Daniel; Muzny, Donna M.; Worley, Kim C.; Gibbs, Richard A.; Akam, Michael; Richards, Stephen

2014-01-01

Myriapods (e.g., centipedes and millipedes) display a simple homonomous body plan relative to other arthropods. All members of the class are terrestrial, but they attained terrestriality independently of insects. Myriapoda is the only arthropod class not represented by a sequenced genome. We present an analysis of the genome of the centipede Strigamia maritima. It retains a compact genome that has undergone less gene loss and shuffling than previously sequenced arthropods, and many orthologues of genes conserved from the bilaterian ancestor that have been lost in insects. Our analysis locates many genes in conserved macro-synteny contexts, and many small-scale examples of gene clustering. We describe several examples where S. maritima shows different solutions from insects to similar problems. The insect olfactory receptor gene family is absent from S. maritima, and olfaction in air is likely effected by expansion of other receptor gene families. For some genes S. maritima has evolved paralogues to generate coding sequence diversity, where insects use alternate splicing. This is most striking for the Dscam gene, which in Drosophila generates more than 100,000 alternate splice forms, but in S. maritima is encoded by over 100 paralogues. We see an intriguing linkage between the absence of any known photosensory proteins in a blind organism and the additional absence of canonical circadian clock genes. The phylogenetic position of myriapods allows us to identify where in arthropod phylogeny several particular molecular mechanisms and traits emerged. For example, we conclude that juvenile hormone signalling evolved with the emergence of the exoskeleton in the arthropods and that RR-1 containing cuticle proteins evolved in the lineage leading to Mandibulata. We also identify when various gene expansions and losses occurred. The genome of S. maritima offers us a unique glimpse into the ancestral arthropod genome, while also displaying many adaptations to its specific life history. PMID:25423365

Rare genetic variants in the endocannabinoid system genes CNR1 and DAGLA are associated with neurological phenotypes in humans.

PubMed

Smith, Douglas R; Stanley, Christine M; Foss, Theodore; Boles, Richard G; McKernan, Kevin

2017-01-01

Rare genetic variants in the core endocannabinoid system genes CNR1, CNR2, DAGLA, MGLL and FAAH were identified in molecular testing data from 6,032 patients with a broad spectrum of neurological disorders. The variants were evaluated for association with phenotypes similar to those observed in the orthologous gene knockouts in mice. Heterozygous rare coding variants in CNR1, which encodes the type 1 cannabinoid receptor (CB1), were found to be significantly associated with pain sensitivity (especially migraine), sleep and memory disorders-alone or in combination with anxiety-compared to a set of controls without such CNR1 variants. Similarly, heterozygous rare variants in DAGLA, which encodes diacylglycerol lipase alpha, were found to be significantly associated with seizures and neurodevelopmental disorders, including autism and abnormalities of brain morphology, compared to controls. Rare variants in MGLL, FAAH and CNR2 were not associated with any neurological phenotypes in the patients tested. Diacylglycerol lipase alpha synthesizes the endocannabinoid 2-AG in the brain, which interacts with CB1 receptors. The phenotypes associated with rare CNR1 variants are reminiscent of those implicated in the theory of clinical endocannabinoid deficiency syndrome. The severe phenotypes associated with rare DAGLA variants underscore the critical role of rapid 2-AG synthesis and the endocannabinoid system in regulating neurological function and development. Mapping of the variants to the 3D structure of the type 1 cannabinoid receptor, or primary structure of diacylglycerol lipase alpha, reveals clustering of variants in certain structural regions and is consistent with impacts to function.

Interleukin 1 receptor antagonist (IL1RN) genetic variations condition post-orthodontic external root resorption in endodontically-treated teeth.

PubMed

Iglesias-Linares, Alejandro; Yañez-Vico, Rosa Ma; Ballesta-Mudarra, Sofía; Ortiz-Ariza, Estefanía; Mendoza-Mendoza, Asunción; Perea-Pérez, Evelio; Moreno-Fernández, Ana Ma; Solano-Reina, Enrique

2013-06-01

External apical root resorption (EARR) is a frequent iatrogenic problem following orthodontic treatment in endodontically-treated teeth, about which the literature reports substantial variability in post-orthodontic treatment EARR responses. The main focus of the present study is to clarify whether variants in the interleukin-1 receptor antagonist gene coding for the IL-1ra protein have a positive/negative influence on EARR of endodontically-treated teeth. Ninety-three orthodontic patients were genetically screened for a single nucleotide polymorphism (SNP:rs419598) in the IL1 cluster. The sample was classified into 2 groups: group 1 (affected-group) showed radiographic EARR of more than 2mm; group 2 (control-group), had no EARR or EARR ≤ to 2mm following orthodontic treatment on root-filled teeth. Logistic regression analysis was performed to obtain an adjusted estimate between the SNPs studied and EARR. Genotype distributions, allelic frequencies, adjusted odds ratios (OR) and 95% confidence intervals were also calculated. We found that subjects homozygous [1/1(TT)] for the IL1RN gene [OR:10.85; p=0.001;CI:95%] were at risk of EARR in root-filled teeth. Genetic variants in the antagonist axis balance of the IL1RN (rs419598) have a direct repercussion on the predisposition to post-orthodontic EARR in root-filled teeth. Variants in allele 1 of the interleukin-1 receptor antagonist gene(rs419598) are associated(p=0.001**) with an increased risk of suffering post-orthodontic EARR in root-filled teeth.

Functional analysis of four naturally occurring variants of human constitutive androstane receptor.

PubMed

Ikeda, Shinobu; Kurose, Kouichi; Jinno, Hideto; Sai, Kimie; Ozawa, Shogo; Hasegawa, Ryuichi; Komamura, Kazuo; Kotake, Takeshi; Morishita, Hideki; Kamakura, Shiro; Kitakaze, Masafumi; Tomoike, Hitonobu; Tamura, Tomohide; Yamamoto, Noboru; Kunitoh, Hideo; Yamada, Yasuhide; Ohe, Yuichiro; Shimada, Yasuhiro; Shirao, Kuniaki; Kubota, Kaoru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Saito, Yoshiro; Sawada, Jun-ichi

2005-01-01

The human constitutive androstane receptor (CAR, NR1I3) is a member of the orphan nuclear receptor superfamily that plays an important role in the control of drug metabolism and disposition. In this study, we sequenced all the coding exons of the NR1I3 gene for 334 Japanese subjects. We identified three novel single nucleotide polymorphisms (SNPs) that induce non-synonymous alterations of amino acids (His246Arg, Leu308Pro, and Asn323Ser) residing in the ligand-binding domain of CAR, in addition to the Val133Gly variant, which was another CAR variant identified in our previous study. We performed functional analysis of these four naturally occurring CAR variants in COS-7 cells using a CYP3A4 promoter/enhancer reporter gene that includes the CAR responsive elements. The His246Arg variant caused marked reductions in both transactivation of the reporter gene and in the response to 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime (CITCO), which is a human CAR-specific agonist. The transactivation ability of the Leu308Pro variant was also significantly decreased, but its responsiveness to CITCO was not abrogated. The transactivation ability and CITCO response of the Val133Gly and Asn323Ser variants did not change as compared to the wild-type CAR. These data suggest that the His246Arg and Leu308Pro variants, especially His246Arg, may influence the expression of drug-metabolizing enzymes and transporters that are transactivated by CAR.

Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

PubMed

Miller, Andrew D

2015-02-01

A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

Crystal structures of two Bordetella pertussis periplasmic receptors contribute to defining a novel pyroglutamic acid binding DctP subfamily.

PubMed

Rucktooa, Prakash; Antoine, Rudy; Herrou, Julien; Huvent, Isabelle; Locht, Camille; Jacob-Dubuisson, Françoise; Villeret, Vincent; Bompard, Coralie

2007-06-29

Gram-negative bacteria have developed several different transport systems for solute uptake. One of these, the tripartite ATP independent periplasmic transport system (TRAP-T), makes use of an extracytoplasmic solute receptor (ESR) which captures specific solutes with high affinity and transfers them to their partner permease complex located in the bacterial inner membrane. We hereby report the structures of DctP6 and DctP7, two such ESRs from Bordetella pertussis. These two proteins display a high degree of sequence and structural similarity and possess the "Venus flytrap" fold characteristic of ESRs, comprising two globular alpha/beta domains hinged together to form a ligand binding cleft. DctP6 and DctP7 both show a closed conformation due to the presence of one pyroglutamic acid molecule bound by highly conserved residues in their respective ligand binding sites. BLAST analyses have revealed that the DctP6 and DctP7 residues involved in ligand binding are strictly present in a number of predicted TRAP-T ESRs from other bacteria. In most cases, the genes encoding these TRAP-T systems are located in the vicinity of a gene coding for a pyroglutamic acid metabolising enzyme. Both the high degree of conservation of these ligand binding residues and the genomic context of these TRAP-T-coding operons in a number of bacterial species, suggest that DctP6 and DctP7 constitute the prototypes of a novel TRAP-T DctP subfamily involved in pyroglutamic acid transport.

Ligand Receptor-Mediated Regulation of Growth in Plants.

PubMed

Haruta, Miyoshi; Sussman, Michael R

2017-01-01

Growth and development of multicellular organisms are coordinately regulated by various signaling pathways involving the communication of inter- and intracellular components. To form the appropriate body patterns, cellular growth and development are modulated by either stimulating or inhibiting these pathways. Hormones and second messengers help to mediate the initiation and/or interaction of the various signaling pathways in all complex multicellular eukaryotes. In plants, hormones include small organic molecules, as well as larger peptides and small proteins, which, as in animals, act as ligands and interact with receptor proteins to trigger rapid biochemical changes and induce the intracellular transcriptional and long-term physiological responses. During the past two decades, the availability of genetic and genomic resources in the model plant species, Arabidopsis thaliana, has greatly helped in the discovery of plant hormone receptors and the components of signal transduction pathways and mechanisms used by these immobile but highly complex organisms. Recently, it has been shown that two of the most important plant hormones, auxin and abscisic acid (ABA), act through signaling pathways that have not yet been recognized in animals. For example, auxins stimulate cell elongation by bringing negatively acting transcriptional repressor proteins to the proteasome to be degraded, thus unleashing the gene expression program required for increasing cell size. The "dormancy" inducing hormone, ABA, binds to soluble receptor proteins and inhibits a specific class of protein phosphatases (PP2C), which activates phosphorylation signaling leading to transcriptional changes needed for the desiccation of the seeds prior to entering dormancy. While these two hormone receptors have no known animal counterparts, there are also many similarities between animal and plant signaling pathways. For example, in plants, the largest single gene family in the genome is the protein kinase family (approximately 5% of the protein coding genes), although the specific function for only a few dozen of these kinases is clearly established. Recent comparative genomics studies have revealed that parasitic nematodes and pathogenic microbes produce plant peptide hormone mimics that target specific plant plasma membrane receptor-like protein kinases, thus usurping endogenous signaling pathways for their own pathogenic purposes. With biochemical, genetic, and physiological analyses of the regulation of hormone receptor signal pathways, we are thus just now beginning to understand how plants optimize the development of their body shape and cope with constantly changing environmental conditions. © 2017 Elsevier Inc. All rights reserved.

Genome-Wide Identification of Medicago Peptides Involved in Macronutrient Responses and Nodulation1[OPEN

PubMed Central

Dai, Xinbin; Zhuang, Zhaohong; Torres-Jerez, Ivone; Nogales, Joaquina

2017-01-01

Growing evidence indicates that small, secreted peptides (SSPs) play critical roles in legume growth and development, yet the annotation of SSP-coding genes is far from complete. Systematic reannotation of the Medicago truncatula genome identified 1,970 homologs of established SSP gene families and an additional 2,455 genes that are potentially novel SSPs, previously unreported in the literature. The expression patterns of known and putative SSP genes based on 144 RNA sequencing data sets covering various stages of macronutrient deficiencies and symbiotic interactions with rhizobia and mycorrhiza were investigated. Focusing on those known or suspected to act via receptor-mediated signaling, 240 nutrient-responsive and 365 nodulation-responsive Signaling-SSPs were identified, greatly expanding the number of SSP gene families potentially involved in acclimation to nutrient deficiencies and nodulation. Synthetic peptide applications were shown to alter root growth and nodulation phenotypes, revealing additional regulators of legume nutrient acquisition. Our results constitute a powerful resource enabling further investigations of specific SSP functions via peptide treatment and reverse genetics. PMID:29030416

Identification of new candidate therapeutic target genes in head and neck squamous cell carcinomas

PubMed Central

Klijanienko, Jerzy; Vacher, Sophie; Ouafi, Lamia; Chemlali, Walid; Caly, Martial; Sastre-Garau, Xavier; Lappartient, Emmanuelle; Mariani, Odette; Rodriguez, José; Jouffroy, Thomas; Girod, Angélique; Calugaru, Valentin; Hoffmann, Caroline; Lidereau, Rosette; Berger, Frédérique; Kamal, Maud; Bieche, Ivan; Le Tourneau, Christophe

2016-01-01

Background We aimed at identifying druggable molecular alterations at the RNA level from untreated HNSCC patients, and assessing their prognostic significance. Methods We retrieved 96 HNSCC patients who underwent primary surgery. Real-time quantitative RT-PCR was used to analyze a panel of 42 genes coding for major druggable proteins. Univariate and multivariate analyses were performed to assess the prognostic significance of overexpressed genes. Results Median age was 56 years [35–78]. Most of patients were men (80%) with a history of alcohol (70.4%) and/or tobacco consumption (72.5%). Twelve patients (12%) were HPV-positive. Most significantly overexpressed genes involved cell cycle regulation (CCND1 [27%], CDK6 [21%]), tyrosine kinase receptors (MET [18%], EGFR [14%]), angiogenesis (PGF [301%], VEGFA [14%]), and immune system (PDL1/CD274 [28%]). PIK3CA expression was an independent prognostic marker, associated with shorter disease-free survival. Conclusions We identified druggable overexpressed genes associated with a poor outcome that might be of interest for personalizing treatment of HNSCC patients. PMID:27329726

Mutation Screening of 1,237 Cancer Genes across Six Model Cell Lines of Basal-Like Breast Cancer.

PubMed

Olsson, Eleonor; Winter, Christof; George, Anthony; Chen, Yilun; Törngren, Therese; Bendahl, Pär-Ola; Borg, Åke; Gruvberger-Saal, Sofia K; Saal, Lao H

2015-01-01

Basal-like breast cancer is an aggressive subtype generally characterized as poor prognosis and lacking the expression of the three most important clinical biomarkers, estrogen receptor, progesterone receptor, and HER2. Cell lines serve as useful model systems to study cancer biology in vitro and in vivo. We performed mutational profiling of six basal-like breast cancer cell lines (HCC38, HCC1143, HCC1187, HCC1395, HCC1954, and HCC1937) and their matched normal lymphocyte DNA using targeted capture and next-generation sequencing of 1,237 cancer-associated genes, including all exons, UTRs and upstream flanking regions. In total, 658 somatic variants were identified, of which 378 were non-silent (average 63 per cell line, range 37-146) and 315 were novel (not present in the Catalogue of Somatic Mutations in Cancer database; COSMIC). 125 novel mutations were confirmed by Sanger sequencing (59 exonic, 48 3'UTR and 10 5'UTR, 1 splicing), with a validation rate of 94% of high confidence variants. Of 36 mutations previously reported for these cell lines but not detected in our exome data, 36% could not be detected by Sanger sequencing. The base replacements C/G>A/T, C/G>G/C, C/G>T/A and A/T>G/C were significantly more frequent in the coding regions compared to the non-coding regions (OR 3.2, 95% CI 2.0-5.3, P<0.0001; OR 4.3, 95% CI 2.9-6.6, P<0.0001; OR 2.4, 95% CI 1.8-3.1, P<0.0001; OR 1.8, 95% CI 1.2-2.7, P = 0.024, respectively). The single nucleotide variants within the context of T[C]T/A[G]A and T[C]A/T[G]A were more frequent in the coding than in the non-coding regions (OR 3.7, 95% CI 2.2-6.1, P<0.0001; OR 3.8, 95% CI 2.0-7.2, P = 0.001, respectively). Copy number estimations were derived from the targeted regions and correlated well to Affymetrix SNP array copy number data (Pearson correlation 0.82 to 0.96 for all compared cell lines; P<0.0001). These mutation calls across 1,237 cancer-associated genes and identification of novel variants will aid in the design and interpretation of biological experiments using these six basal-like breast cancer cell lines.

Sequence-defined cMET/HGFR-targeted Polymers as Gene Delivery Vehicles for the Theranostic Sodium Iodide Symporter (NIS) Gene

PubMed Central

Urnauer, Sarah; Morys, Stephan; Krhac Levacic, Ana; Müller, Andrea M; Schug, Christina; Schmohl, Kathrin A; Schwenk, Nathalie; Zach, Christian; Carlsen, Janette; Bartenstein, Peter; Wagner, Ernst; Spitzweg, Christine

2016-01-01

The sodium iodide symporter (NIS) as well-characterized theranostic gene represents an outstanding tool to target different cancer types allowing noninvasive imaging of functional NIS expression and therapeutic radioiodide application. Based on its overexpression on the surface of most cancer types, the cMET/hepatocyte growth factor receptor serves as ideal target for tumor-selective gene delivery. Sequence-defined polymers as nonviral gene delivery vehicles comprising polyethylene glycol (PEG) and cationic (oligoethanoamino) amide cores coupled with a cMET-binding peptide (cMBP2) were complexed with NIS-DNA and tested for receptor-specificity, transduction efficiency, and therapeutic efficacy in hepatocellular cancer cells HuH7. In vitro iodide uptake studies demonstrated high transduction efficiency and cMET-specificity of NIS-encoding polyplexes (cMBP2-PEG-Stp/NIS) compared to polyplexes without targeting ligand (Ala-PEG-Stp/NIS) and without coding DNA (cMBP2-PEG-Stp/Antisense-NIS). Tumor recruitment and vector biodistribution were investigated in vivo in a subcutaneous xenograft mouse model showing high tumor-selective iodide accumulation in cMBP2-PEG-Stp/NIS-treated mice (6.6 ± 1.6% ID/g 123I, biological half-life 3 hours) by 123I-scintigraphy. Therapy studies with three cycles of polyplexes and 131I application resulted in significant delay in tumor growth and prolonged survival. These data demonstrate the enormous potential of cMET-targeted sequence-defined polymers combined with the unique theranostic function of NIS allowing for optimized transfection efficiency while eliminating toxicity. PMID:27157666

Extracellular vesicle-mediated transfer of donor genomic DNA to recipient cells is a novel mechanism for genetic influence between cells

PubMed Central

Cai, Jin; Han, Yu; Ren, Hongmei; Chen, Caiyu; He, Duofen; Zhou, Lin; Eisner, Gilbert M.; Asico, Laureano D.; Jose, Pedro A.; Zeng, Chunyu

2013-01-01

Extracellular vesicles (EVs) carry signals within or at their limiting membranes, providing a mechanism by which cells can exchange more complex information than what was previously thought. In addition to mRNAs and microRNAs, there are DNA fragments in EVs. Solexa sequencing indicated the presence of at least 16434 genomic DNA (gDNA) fragments in the EVs from human plasma. Immunofluorescence study showed direct evidence that acridine orange-stained EV DNAs could be transferred into the cells and localize to and inside the nuclear membrane. However, whether the transferred EV DNAs are functional or not is not clear. We found that EV gDNAs could be homologously or heterologously transferred from donor cells to recipient cells, and increase gDNA-coding mRNA, protein expression, and function (e.g. AT1 receptor). An endogenous promoter of the AT1 receptor, NF-κB, could be recruited to the transferred DNAs in the nucleus, and increase the transcription of AT1 receptor in the recipient cells. Moreover, the transferred EV gDNAs have pathophysiological significance. BCR/ABL hybrid gene, involved in the pathogenesis of chronic myeloid leukemia, could be transferred from K562 EVs to HEK293 cells or neutrophils. Our present study shows that the gDNAs transferred from EVs to cells have physiological significance, not only to increase the gDNA-coding mRNA and protein levels, but also to influence function in recipient cells. PMID:23580760

[Molecular mechanisms of primary and secondary resistance, molecular-genetic features and characteristics of KIT/PDGFRA non-mutated GISTs].

PubMed

Kalfusová, Alena; Kodet, Roman

2017-01-01

Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. Most of them arise due to activating mutations in KIT (75 - 85 %) or PDGFRA (less than 10 %) genes. Identification of the activating mutations in KIT and PDGFRA genes, which code for receptor tyrosine kinases (RTKs), has improved the outcome of targeted therapy of metastatic, unresectable or recurrent GISTs. Primary and/or secondary resistance represents a significant problem in the targeted therapy by Imatinib mesylate (IM) in patients with GIST. An important mechanism of the secondary resistance is the evolvement of secondary mutations. Except for primary and secondary resistance, there is another problem of disease progression - a failure of tumor cells eradication even in the long term therapy of tyrosine kinase inhibitors. GISTs without mutations in KIT/PDGFRA genes constitute 10 - 15% GISTs in adults, and a majority (85 %) of pediatric GISTs. KIT/PDGFRA wild-type GISTs represent a heterogeneous group of tumors with several molecular-genetics and/or morphologic differences. KIT/PDGFRA wild-type GISTs are different in their molecular features, for example in mutations in the BRAF, KRAS, NF1 genes or defects of succinate dehydrogenase (SDH) subunits. KIT/PDGFRA wild-type GISTs are generally less sensitive to targeted therapy by tyrosine kinase inhibitors in comparison with KIT/PDGFRA mutated GISTs. Inhibitors of BRAF, PI3K (mTOR) or inhibitors of IGF1R and VEGFR receptors provide alternative therapeutic strategies.

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Neuroleptic Drugs and PACAP Differentially Affect the mRNA Expression of Genes Encoding PAC1/VPAC Type Receptors.

PubMed

Jóźwiak-Bębenista, Marta; Kowalczyk, Edward

2017-04-01

Several lines of evidence suggest that pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide playing an important role as a neuromodulator. It has been indicated that PACAP is associated with mental diseases, and that regulation of the PACAPergic signals could be a potential target for the treatment of such psychiatric states as schizophrenia. Recent studies have suggested that action of neuroleptic drugs is mediated not only by dopaminergic and serotonergic neurotransmission, but also via neuropeptides which may act both as neurotransmitters and as neuromodulators. The present study examines whether currently-used neuroleptics influence the action of PACAP receptors, whose expression is altered in a schizophrenic patient. Real-time polymerase chain reaction (PCR) was used to examine the effects of haloperidol, olanzapine and amisulpride on the expression of genes coding PAC1/VPAC type receptors in the T98G glioblastoma cell line, as an example of an in vitro model of glial cells. PAC1 mRNA expression fell after 24-h incubation with haloperidol or olanzapine; however the effect was not maintained after 72 h, and haloperidol even up-regulated PAC1 mRNA expression in a dose-dependent manner. All the examined drugs decreased VPAC2 mRNA expression, especially after 72-h incubation. Haloperidol (typical neuroleptic) was distinctly more potent than atypical neuroleptic drugs (olanzapine and amisulpride). In addition, PACAP increased PAC1 and VPAC2 mRNA expression. In conclusion, our findings suggest PACAP receptors may be involved in the mechanism of typical and atypical neuroleptic drugs.

Estrogen signaling through the G protein-coupled estrogen receptor regulates granulocyte activation in fish.

PubMed

Cabas, Isabel; Rodenas, M Carmen; Abellán, Emilia; Meseguer, José; Mulero, Victoriano; García-Ayala, Alfonsa

2013-11-01

Neutrophils are major participants in innate host responses. It is well known that estrogens have an immune-modulatory role, and some evidence exists that neutrophil physiology can be altered by these molecules. Traditionally, estrogens act via classical nuclear estrogen receptors, but the identification of a G protein-coupled estrogen receptor (GPER), a membrane estrogen receptor that binds estradiol and other estrogens, has opened up the possibility of exploring additional estrogen-mediated effects. However, information on the importance of GPER for immunity, especially, in neutrophils is scant. In this study, we report that gilthead seabream (Sparus aurata L.) acidophilic granulocytes, which are the functional equivalent of mammalian neutrophils, express GPER at both mRNA and protein levels. By using a GPER selective agonist, G1, it was found that GPER activation in vitro slightly reduced the respiratory burst of acidophilic granulocytes and drastically altered the expression profile of several genes encoding major pro- and anti-inflammatory mediators. In addition, GPER signaling in vivo modulated adaptive immunity. Finally, a cAMP analog mimicked the effects of G1 in the induction of the gene coding for PG-endoperoxide synthase 2 and in the induction of CREB phosphorylation, whereas pharmacological inhibition of protein kinase A superinduced PG-endoperoxide synthase 2. Taken together, our results demonstrate for the first time, to our knowledge, that estrogens are able to modulate vertebrate granulocyte functions through a GPER/cAMP/protein kinase A/CREB signaling pathway and could establish therapeutic targets for several immune disorders in which estrogens play a prominent role.

Expression of LLT1 and its receptor CD161 in lung cancer is associated with better clinical outcome.

PubMed

Braud, Véronique M; Biton, Jérôme; Becht, Etienne; Knockaert, Samantha; Mansuet-Lupo, Audrey; Cosson, Estelle; Damotte, Diane; Alifano, Marco; Validire, Pierre; Anjuère, Fabienne; Cremer, Isabelle; Girard, Nicolas; Gossot, Dominique; Seguin-Givelet, Agathe; Dieu-Nosjean, Marie-Caroline; Germain, Claire

2018-01-01

Co-stimulatory and inhibitory receptors expressed by immune cells in the tumor microenvironment modulate the immune response and cancer progression. Their expression and regulation are still not fully characterized and a better understanding of these mechanisms is needed to improve current immunotherapies. Our previous work has identified a novel ligand/receptor pair, LLT1/CD161, that modulates immune responses. Here, we extensively characterize its expression in non-small cell lung cancer (NSCLC). We show that LLT1 expression is restricted to germinal center (GC) B cells within tertiary lymphoid structures (TLS), representing a new hallmark of the presence of active TLS in the tumor microenvironment. CD161-expressing immune cells are found at the vicinity of these structures, with a global enrichment of NSCLC tumors in CD161 + CD4 + and CD8 + T cells as compared to normal distant lung and peripheral blood. CD161 + CD4 + T cells are more activated and produce Th1-cytokines at a higher frequency than their matched CD161-negative counterparts. Interestingly, CD161 + CD4 + T cells highly express OX40 co-stimulatory receptor, less frequently 4-1BB, and display an activated but not completely exhausted PD-1-positive Tim-3-negative phenotype. Finally, a meta-analysis revealed a positive association of CLEC2D (coding for LLT1) and KLRB1 (coding for CD161) gene expression with favorable outcome in NSCLC, independently of the size of T and B cell infiltrates. These data are consistent with a positive impact of LLT1/CD161 on NSCLC patient survival, and make CD161-expressing CD4 + T cells ideal candidates for efficient anti-tumor recall responses.

Re-Evaluation of the PBAN Receptor Molecule: Characterization of PBANR Variants Expressed in the Pheromone Glands of Moths

PubMed Central

Lee, Jae Min; Hull, J. Joe; Kawai, Takeshi; Goto, Chie; Kurihara, Masaaki; Tanokura, Masaru; Nagata, Koji; Nagasawa, Hiromichi; Matsumoto, Shogo

2011-01-01

Sex pheromone production in most moths is initiated following pheromone biosynthesis activating neuropeptide receptor (PBANR) activation. PBANR was initially cloned from pheromone glands (PGs) of Helicoverpa zea and Bombyx mori. The B. mori PBANR is characterized by a relatively long C-terminus that is essential for ligand-induced internalization, whereas the H. zea PBANR has a shorter C-terminus that lacks features present in the B. mori PBANR critical for internalization. Multiple PBANRs have been reported to be concurrently expressed in the larval CNS of Heliothis virescens. In the current study, we sought to examine the prevalence of multiple PBANRs in the PGs of three moths and to ascertain their potential functional relevance. Multiple PBANR variants (As, A, B, and C) were cloned from the PGs of all species examined with PBANR-C the most highly expressed. Alternative splicing of the C-terminal coding sequence of the PBAN gene gives rise to the variants, which are distinguishable only by the length and composition of their respective C-terminal tails. Transient expression of fluorescent PBANR chimeras in insect cells revealed that PBANR-B and PBANR-C localized exclusively to the cell surface while PBANR-As and PBANR-A exhibited varying degrees of cytosolic localization. Similarly, only the PBANR-B and PBANR-C variants underwent ligand-induced internalization. Taken together, our results suggest that PBANR-C is the principal receptor molecule involved in PBAN signaling regardless of moth species. The high GC content of the C-terminal coding sequence in the B and C variants, which makes amplification using conventional polymerases difficult, likely accounts for previous “preferential” amplification of PBANR-A like receptors from other species. PMID:22654850

The miiuy croaker microRNA transcriptome and microRNA regulation of RIG-I like receptor signaling pathway after poly(I:C) stimulation.

PubMed

Han, Jingjing; Xu, Guoliang; Xu, Tianjun

2016-07-01

MicroRNAs (miRNAs) as endogenous small non-coding RNAs play key regulatory roles in diverse biological processes via degrading the target mRNAs or inhibiting protein translation. Previously many researchers have reported the identification, characteristic of miRNAs and the interaction with its target gene. But, the study on the regulation of miRNAs to biological processes via regulatory the key signaling pathway was still limited. In order to comprehend the regulatory mechanism of miRNAs, two small RNA libraries from the spleen of miiuy croaker individuals with or without poly(I:C) infection were constructed. The 197 conserved miRNAs and 75 novel miRNAs were identified, and 14 conserved and 8 novel miRNAs appeared significant variations. Those differently expressed miRNAs relate to immune regulation of miiuy croaker. Furthermore, expressions of four differently expressed miRNAs were validated by qRT-PCR, and the result was consistent with sequencing data. The target genes of the differently expressed miRNAs in the two libraries were predicted, and some candidate target genes were involved in the RIG-I-like receptor (RLR) signaling pathway. The negative regulation of miRNAs to target genes were confirmed by comparing the expression pattern of miRNAs and their target genes. The results of regulating target genes were that firstly directly or indirectly activating the downstream signaling cascades and subsequent inducting the type I interferon, inflammatory cytokines and apoptosis. These studies could help us to deeper understand the roles of miRNAs played in the fish immune system, and provide a new way to investigate the defense mechanism of fish. Copyright © 2016 Elsevier Ltd. All rights reserved.

Major histocompatibility complex and other allergy-related candidate genes associated with insect bite hypersensitivity in Icelandic horses.

PubMed

Klumplerova, Marie; Vychodilova, Leona; Bobrova, Olga; Cvanova, Michaela; Futas, Jan; Janova, Eva; Vyskocil, Mirko; Vrtkova, Irena; Putnova, Lenka; Dusek, Ladislav; Marti, Eliane; Horin, Petr

2013-04-01

Insect bite hypersensitivity (IBH) is an allergic dermatitis of horses caused by bites of insects. IBH is a multifactorial disease with contribution of genetic and environmental factors. Candidate gene association analysis of IBH was performed in a group of 89 Icelandic horses all born in Iceland and imported to Europe. Horses were classified in IBH-affected and non-affected based on clinical signs and history of recurrent dermatitis, and on the results of an in vitro sulfidoleukotriene (sLT)-release assay with Culicoides nubeculosus and Simulium vittatum extract. Different genetic markers were tested for association with IBH by the Fisher's exact test. The effect of the major histocompatibility complex (MHC) gene region was studied by genotyping five microsatellites spanning the MHC region (COR112, COR113, COR114, UM011 and UMN-JH34-2), and exon 2 polymorphisms of the class II Eqca-DRA gene. Associations with Eqca-DRA and COR113 were identified (p < 0.05). In addition, a panel of 20 single nucleotide polymorphisms (SNPs) in 17 candidate allergy-related genes was tested. During the initial screen, no marker from the panel was significantly (p < 0.05) associated with IBH. Five SNPs associated with IBH at p < 0.10 were therefore used for analysis of combined genotypes. Out of them, SNPs located in the genes coding for the CD14 receptor (CD14), interleukin 23 receptor (IL23R), thymic stromal lymphopoietin (TSLP) and transforming growth factor beta 3 (TGFB3) molecules were associated with IBH as parts of complex genotypes. These results are supported by similar associations and by expression data from different horse populations and from human studies.

Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

PubMed Central

Manteniotis, Stavros; Lehmann, Ramona; Flegel, Caroline; Vogel, Felix; Hofreuter, Adrian; Schreiner, Benjamin S. P.; Altmüller, Janine; Becker, Christian; Schöbel, Nicole; Hatt, Hanns; Gisselmann, Günter

2013-01-01

The specific functions of sensory systems depend on the tissue-specific expression of genes that code for molecular sensor proteins that are necessary for stimulus detection and membrane signaling. Using the Next Generation Sequencing technique (RNA-Seq), we analyzed the complete transcriptome of the trigeminal ganglia (TG) and dorsal root ganglia (DRG) of adult mice. Focusing on genes with an expression level higher than 1 FPKM (fragments per kilobase of transcript per million mapped reads), we detected the expression of 12984 genes in the TG and 13195 in the DRG. To analyze the specific gene expression patterns of the peripheral neuronal tissues, we compared their gene expression profiles with that of the liver, brain, olfactory epithelium, and skeletal muscle. The transcriptome data of the TG and DRG were scanned for virtually all known G-protein-coupled receptors (GPCRs) as well as for ion channels. The expression profile was ranked with regard to the level and specificity for the TG. In total, we detected 106 non-olfactory GPCRs and 33 ion channels that had not been previously described as expressed in the TG. To validate the RNA-Seq data, in situ hybridization experiments were performed for several of the newly detected transcripts. To identify differences in expression profiles between the sensory ganglia, the RNA-Seq data of the TG and DRG were compared. Among the differentially expressed genes (> 1 FPKM), 65 and 117 were expressed at least 10-fold higher in the TG and DRG, respectively. Our transcriptome analysis allows a comprehensive overview of all ion channels and G protein-coupled receptors that are expressed in trigeminal ganglia and provides additional approaches for the investigation of trigeminal sensing as well as for the physiological and pathophysiological mechanisms of pain. PMID:24260241

Association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population.

PubMed

Park, Chul-Soo; Park, So-Young; Lee, Chul-Soon; Sohn, Jin-Wook; Hahn, Gyu-Hee; Kim, Bong-Jo

2006-06-01

Family, twin, and adoption studies have demonstrated that genes play an important role in the development of alcoholism. We investigated the association between alcoholism and the genetic polymorphisms of the GABAA receptor genes on chromosome 5q33-34 in Korean population. The genotype of the GABAA receptor gene polymorphisms were determined by performing polymerase chain reaction genotyping for 172 normal controls and 162 male alcoholics who are hospitalized in alcoholism treatment institute. We found a significant association between the genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene and alcoholism. The GG genotype of the GABAA alpha1 receptor gene was associated with the onset age of alcoholism and alcohol withdrawal symptoms, and a high score on the Korean version of the ADS. However, there was no association between the genetic polymorphisms of the GABAA beta2 and gamma2 receptor gene and alcoholisms. Our finding suggest that genetic polymorphisms of the GABAA alpha1 and GABAA alpha6 receptor gene may be associated with the development of alcoholism and that the GG genotype of the GABAA alpha1 receptor gene play an important role in the development of the early onset and the severe type of alcoholism.

The Maximal C³ Self-Complementary Trinucleotide Circular Code X in Genes of Bacteria, Archaea, Eukaryotes, Plasmids and Viruses.

PubMed

Michel, Christian J

2017-04-18

In 1996, a set X of 20 trinucleotides was identified in genes of both prokaryotes and eukaryotes which has on average the highest occurrence in reading frame compared to its two shifted frames. Furthermore, this set X has an interesting mathematical property as X is a maximal C 3 self-complementary trinucleotide circular code. In 2015, by quantifying the inspection approach used in 1996, the circular code X was confirmed in the genes of bacteria and eukaryotes and was also identified in the genes of plasmids and viruses. The method was based on the preferential occurrence of trinucleotides among the three frames at the gene population level. We extend here this definition at the gene level. This new statistical approach considers all the genes, i.e., of large and small lengths, with the same weight for searching the circular code X . As a consequence, the concept of circular code, in particular the reading frame retrieval, is directly associated to each gene. At the gene level, the circular code X is strengthened in the genes of bacteria, eukaryotes, plasmids, and viruses, and is now also identified in the genes of archaea. The genes of mitochondria and chloroplasts contain a subset of the circular code X . Finally, by studying viral genes, the circular code X was found in DNA genomes, RNA genomes, double-stranded genomes, and single-stranded genomes.

Odorant responses of olfactory sensory neurons expressing the odorant receptor MOR23: A patch clamp analysis in gene-targeted mice

PubMed Central

Grosmaitre, Xavier; Vassalli, Anne; Mombaerts, Peter; Shepherd, Gordon M.; Ma, Minghong

2006-01-01

A glomerulus in the mammalian olfactory bulb receives axonal inputs from olfactory sensory neurons (OSNs) that express the same odorant receptor (OR). Glomeruli are generally thought to represent functional units of olfactory coding, but there are no data on the electrophysiological properties of OSNs that express the same endogenous OR. Here, using patch clamp recordings in an intact epithelial preparation, we directly measured the transduction currents and receptor potentials from the dendritic knobs of mouse OSNs that express the odorant receptor MOR23 along with the green fluorescent protein. All of the 53 cells examined responded to lyral, a known ligand for MOR23. There were profound differences in response kinetics, particularly in the deactivation phase. The cells were very sensitive to lyral, with some cells responding to as little as 10 nM. The dynamic range was unexpectedly broad, with threshold and saturation in individual cells often covering three log units of lyral concentration. The potential causes and biological significance of this cellular heterogeneity are discussed. Patch clamp recording from OSNs that express a defined OR provides a powerful approach to investigate the sensory inputs to individual glomeruli. PMID:16446455

Odorant responses of olfactory sensory neurons expressing the odorant receptor MOR23: a patch clamp analysis in gene-targeted mice.

PubMed

Grosmaitre, Xavier; Vassalli, Anne; Mombaerts, Peter; Shepherd, Gordon M; Ma, Minghong

2006-02-07

A glomerulus in the mammalian olfactory bulb receives axonal inputs from olfactory sensory neurons (OSNs) that express the same odorant receptor (OR). Glomeruli are generally thought to represent functional units of olfactory coding, but there are no data on the electrophysiological properties of OSNs that express the same endogenous OR. Here, using patch clamp recordings in an intact epithelial preparation, we directly measured the transduction currents and receptor potentials from the dendritic knobs of mouse OSNs that express the odorant receptor MOR23 along with the green fluorescent protein. All of the 53 cells examined responded to lyral, a known ligand for MOR23. There were profound differences in response kinetics, particularly in the deactivation phase. The cells were very sensitive to lyral, with some cells responding to as little as 10 nM. The dynamic range was unexpectedly broad, with threshold and saturation in individual cells often covering three log units of lyral concentration. The potential causes and biological significance of this cellular heterogeneity are discussed. Patch clamp recording from OSNs that express a defined OR provides a powerful approach to investigate the sensory inputs to individual glomeruli.

Association of Genetic Variants of Small Non-Coding RNAs with Survival in Colorectal Cancer

PubMed Central

Pao, Jiunn-Bey; Lu, Te-Ling; Ting, Wen-Chien; Chen, Lu-Min; Bao, Bo-Ying

2018-01-01

Background: Single nucleotide polymorphisms (SNPs) of small non-coding RNAs (sncRNAs) can influence sncRNA function and target gene expression to mediate the risk of certain diseases. The aim of the present study was to evaluate the prognostic relevance of sncRNA SNPs for colorectal cancer, which has not been well characterized to date. Methods: We comprehensively examined 31 common SNPs of sncRNAs, and assessed the impact of these variants on survival in a cohort of 188 patients with colorectal cancer. Results: Three SNPs were significantly associated with survival of patients with colorectal cancer after correction for multiple testing, and two of the SNPs (hsa-mir-196a-2 rs11614913 and U85 rs714775) remained significant in multivariate analyses. Additional in silico analysis provided further evidence of this association, since the expression levels of the target genes of the hsa-miR-196a (HOXA7, HOXB8, and AKT1) were significantly correlated with colorectal cancer progression. Furthermore, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses indicated that hsa-miR-196a is associated with well-known oncogenic pathways, including cellular protein modification process, mitotic cell cycle, adherens junction, and extracellular matrix receptor interaction pathways. Conclusion: Our results suggest that SNPs of sncRNAs could play a critical role in cancer progression, and that hsa-miR-196a might be a valuable biomarker or therapeutic target for colorectal cancer patients. PMID:29483812

The Alpaca Melanocortin 1 Receptor: Gene Mutations, Transcripts, and Relative Levels of Expression in Ventral Skin Biopsies

PubMed Central

Renieri, Carlo; La Terza, Antonietta

2015-01-01

The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5′-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3′UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation. PMID:25685836

Introduction of the human AVPR1A gene substantially alters brain receptor expression patterns and enhances aspects of social behavior in transgenic mice

PubMed Central

Charles, Rhonda; Sakurai, Takeshi; Takahashi, Nagahide; Elder, Gregory A.; Gama Sosa, Miguel A.; Young, Larry J.; Buxbaum, Joseph D.

2014-01-01

Central arginine vasopressin receptor 1A (AVPR1A) modulates a wide range of behaviors, including stress management and territorial aggression, as well as social bonding and recognition. Inter- and intra-species variations in the expression pattern of AVPR1A in the brain and downstream differential behavioral phenotypes have been attributed to differences in the non-coding regions of the AVPR1A gene, including polymorphic elements within upstream regulatory areas. Gene association studies have suggested a link between AVPR1A polymorphisms and autism, and AVPR1A has emerged as a potential pharmacological target for treatment of social cognitive impairments and mood and anxiety disorders. To further investigate the genetic mechanism giving rise to species differences in AVPR1A expression patterns and associated social behaviors, and to create a preclinical mouse model useful for screening drugs targeting AVPR1A, we engineered and extensively characterized bacterial artificial chromosome (BAC) transgenic mice harboring the entire human AVPR1A locus with the surrounding regulatory elements. Compared with wild-type animals, the humanized mice displayed a more widely distributed ligand-AVPR1A binding pattern, which overlapped with that of primates. Furthermore, humanized AVPR1A mice displayed increased reciprocal social interactions compared with wild-type animals, but no differences in social approach and preference for social novelty were observed. Aspects of learning and memory, specifically novel object recognition and spatial relocation recognition, were unaffected. The biological alterations in humanized AVPR1A mice resulted in the rescue of the prepulse inhibition impairments that were observed in knockout mice, indicating conserved functionality. Although further behavioral paradigms and additional cohorts need to be examined in humanized AVPR1A mice, the results demonstrate that species-specific variations in the genomic content of regulatory regions surrounding the AVPR1A locus are responsible for differential receptor protein expression patterns across species and that they are likely to contribute to species-specific behavioral variation. The humanized AVPR1A mouse is a potential preclinical model for further understanding the regulation of receptor gene expression and the impact of variation in receptor expression on behaviors, and should be useful for screening drugs targeting human AVPR1A, taking advantage of the expression of human AVPR1A in human-relevant brain regions. PMID:24924430

Schizophrenia Susceptibility Genes Directly Implicated in the Life Cycles of Pathogens: Cytomegalovirus, Influenza, Herpes simplex, Rubella, and Toxoplasma gondii

PubMed Central

Carter, C.J.

2009-01-01

Many genes implicated in schizophrenia can be related to glutamatergic transmission and neuroplasticity, oligodendrocyte function, and other families clearly related to neurobiology and schizophrenia phenotypes. Others appear rather to be involved in the life cycles of the pathogens implicated in the disease. For example, aspartylglucosaminidase (AGA), PLA2, SIAT8B, GALNT7, or B3GAT1 metabolize chemical ligands to which the influenza virus, herpes simplex, cytomegalovirus (CMV), rubella, or Toxoplasma gondii bind. The epidermal growth factor receptor (EGR/EGFR) is used by the CMV to gain entry to cells, and a CMV gene codes for an interleukin (IL-10) mimic that binds the host cognate receptor, IL10R. The fibroblast growth factor receptor (FGFR1) is used by herpes simplex. KPNA3 and RANBP5 control the nuclear import of the influenza virus. Disrupted in schizophrenia 1 (DISC1) controls the microtubule network that is used by viruses as a route to the nucleus, while DTNBP1, MUTED, and BLOC1S3 regulate endosomal to lysosomal routing that is also important in viral traffic. Neuregulin 1 activates ERBB receptors releasing a factor, EBP1, known to inhibit the influenza virus transcriptase. Other viral or bacterial components bind to genes or proteins encoded by CALR, FEZ1, FYN, HSPA1B, IL2, HTR2A, KPNA3, MED12, MED15, MICB, NQO2, PAX6, PIK3C3, RANBP5, or TP53, while the cerebral infectivity of the herpes simplex virus is modified by Apolipoprotein E (APOE). Genes encoding for proteins related to the innate immune response, including cytokine related (CCR5, CSF2RA, CSF2RB, IL1B, IL1RN, IL2, IL3, IL3RA, IL4, IL10, IL10RA, IL18RAP, lymphotoxin-alpha, tumor necrosis factor alpha [TNF]), human leukocyte antigen (HLA) antigens (HLA-A10, HLA-B, HLA-DRB1), and genes involved in antigen processing (angiotensin-converting enzyme and tripeptidyl peptidase 2) are all concerned with defense against invading pathogens. Human microRNAs (Hsa-mir-198 and Hsa-mir-206) are predicted to bind to influenza, rubella, or poliovirus genes. Certain genes associated with schizophrenia, including those also concerned with neurophysiology, are intimately related to the life cycles of the pathogens implicated in the disease. Several genes may affect pathogen virulence, while the pathogens in turn may affect genes and processes relevant to the neurophysiology of schizophrenia. For such genes, the strength of association in genetic studies is likely to be conditioned by the presence of the pathogen, which varies in different populations at different times, a factor that may explain the heterogeneity that plagues such studies. This scenario also suggests that drugs or vaccines designed to eliminate the pathogens that so clearly interact with schizophrenia susceptibility genes could have a dramatic effect on the incidence of the disease. PMID:18552348

The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice.

PubMed

Degl'Innocenti, Andrea; Parrilla, Marta; Harr, Bettina; Teschke, Meike

2016-01-01

In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings favor Olfr266 as a model gene to investigate odorant receptor gene choice.

Evolution of the Antisense Overlap between Genes for Thyroid Hormone Receptor and Rev-erbα and Characterization of an Exonic G-Rich Element That Regulates Splicing of TRα2 mRNA

PubMed Central

Munroe, Stephen H.; Morales, Christopher H.; Duyck, Tessa H.; Waters, Paul D.

2015-01-01

The α-thyroid hormone receptor gene (TRα) codes for two functionally distinct proteins: TRα1, the α-thyroid hormone receptor; and TRα2, a non-hormone-binding variant. The final exon of TRα2 mRNA overlaps the 3’ end of Rev-erbα mRNA, which encodes another nuclear receptor on the opposite strand of DNA. To understand the evolution of this antisense overlap, we sequenced these genes and mRNAs in the platypus Orthorhynchus anatinus. Despite its strong homology with other mammals, the platypus TRα/Rev-erbα locus lacks elements essential for expression of TRα2. Comparative analysis suggests that alternative splicing of TRα2 mRNA expression evolved in a stepwise fashion before the divergence of eutherian and marsupial mammals. A short G-rich element (G30) located downstream of the alternative 3’splice site of TRα2 mRNA and antisense to the 3’UTR of Rev-erbα plays an important role in regulating TRα2 splicing. G30 is tightly conserved in eutherian mammals, but is absent in marsupials and monotremes. Systematic deletions and substitutions within G30 have dramatically different effects on TRα2 splicing, leading to either its inhibition or its enhancement. Mutations that disrupt one or more clusters of G residues enhance splicing two- to three-fold. These results suggest the G30 sequence can adopt a highly structured conformation, possibly a G-quadruplex, and that it is part of a complex splicing regulatory element which exerts both positive and negative effects on TRα2 expression. Since mutations that strongly enhance splicing in vivo have no effect on splicing in vitro, it is likely that the regulatory role of G30 is mediated through linkage of transcription and splicing. PMID:26368571

mRNAs coding for neurotransmitter receptors and voltage-gated sodium channels in the adult rabbit visual cortex after monocular deafferentiation

PubMed Central

Nguyen, Quoc-Thang; Matute, Carlos; Miledi, Ricardo

1998-01-01

It has been postulated that, in the adult visual cortex, visual inputs modulate levels of mRNAs coding for neurotransmitter receptors in an activity-dependent manner. To investigate this possibility, we performed a monocular enucleation in adult rabbits and, 15 days later, collected their left and right visual cortices. Levels of mRNAs coding for voltage-activated sodium channels, and for receptors for kainate/α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA), N-methyl-d-aspartate (NMDA), γ-aminobutyric acid (GABA), and glycine were semiquantitatively estimated in the visual cortices ipsilateral and contralateral to the lesion by the Xenopus oocyte/voltage-clamp expression system. This technique also allowed us to study some of the pharmacological and physiological properties of the channels and receptors expressed in the oocytes. In cells injected with mRNA from left or right cortices of monocularly enucleated and control animals, the amplitudes of currents elicited by kainate or AMPA, which reflect the abundance of mRNAs coding for kainate and AMPA receptors, were similar. There was no difference in the sensitivity to kainate and in the voltage dependence of the kainate response. Responses mediated by NMDA, GABA, and glycine were unaffected by monocular enucleation. Sodium channel peak currents, activation, steady-state inactivation, and sensitivity to tetrodotoxin also remained unchanged after the enucleation. Our data show that mRNAs for major neurotransmitter receptors and ion channels in the adult rabbit visual cortex are not obviously modified by monocular deafferentiation. Thus, our results do not support the idea of a widespread dynamic modulation of mRNAs coding for receptors and ion channels by visual activity in the rabbit visual system. PMID:9501250

Odor Coding by a Mammalian Receptor Repertoire

PubMed Central

Saito, Harumi; Chi, Qiuyi; Zhuang, Hanyi; Matsunami, Hiro; Mainland, Joel D.

2009-01-01

Deciphering olfactory encoding requires a thorough description of the ligands that activate each odorant receptor (OR). In mammalian systems, however, ligands are known for fewer than 50 of over 1400 human and mouse ORs, greatly limiting our understanding of olfactory coding. We performed high-throughput screening of 93 odorants against 464 ORs expressed in heterologous cells and identified agonists for 52 mouse and 10 human ORs. We used the resulting interaction profiles to develop a predictive model relating physicochemical odorant properties, OR sequences, and their interactions. Our results provide a basis for translating odorants into receptor neuron responses and unraveling mammalian odor coding. PMID:19261596

Update on the molecular biology of dyslipidemias.

PubMed

Ramasamy, I

2016-02-15

Dyslipidemia is a commonly encountered clinical condition and is an important determinant of cardiovascular disease. Although secondary factors play a role in clinical expression, dyslipidemias have a strong genetic component. Familial hypercholesterolemia is usually due to loss-of-function mutations in LDLR, the gene coding for low density lipoprotein receptor and genes encoding for proteins that interact with the receptor: APOB, PCSK9 and LDLRAP1. Monogenic hypertriglyceridemia is the result of mutations in genes that regulate the metabolism of triglyceride rich lipoproteins (eg LPL, APOC2, APOA5, LMF1, GPIHBP1). Conversely familial hypobetalipoproteinemia is caused by inactivation of the PCSK9 gene which increases the number of LDL receptors and decreases plasma cholesterol. Mutations in the genes APOB, and ANGPTL3 and ANGPTL4 (that encode angiopoietin-like proteins which inhibit lipoprotein lipase activity) can further cause low levels of apoB containing lipoproteins. Abetalipoproteinemia and chylomicron retention disease are due to mutations in the microsomal transfer protein and Sar1b-GTPase genes, which affect the secretion of apoB containing lipoproteins. Dysbetalipoproteinemia stems from dysfunctional apoE and is characterized by the accumulation of remnants of chylomicrons and very low density lipoproteins. ApoE deficiency can cause a similar phenotype or rarely mutations in apoE can be associated with lipoprotein glomerulopathy. Low HDL can result from mutations in a number of genes regulating HDL production or catabolism; apoAI, lecithin: cholesterol acyltransferase and the ATP-binding cassette transporter ABCA1. Patients with cholesteryl ester transfer protein deficiency have markedly increased HDL cholesterol. Both common and rare genetic variants contribute to susceptibility to dyslipidemias. In contrast to rare familial syndromes, in most patients, dyslipidemias have a complex genetic etiology consisting of multiple genetic variants as established by genome wide association studies. Secondary factors, obesity, metabolic syndrome, diabetes, renal disease, estrogen and antipsychotics can increase the likelihood of clinical presentation of an individual with predisposed genetic susceptibility to hyperlipoproteinemia. The genetic profiles studied are far from complete and there is room for further characterization of genes influencing lipid levels. Genetic assessment can help identify patients at risk for developing dyslipidemias and for treatment decisions based on 'risk allele' profiles. This review will present the current information on the genetics and pathophysiology of disorders that cause dyslipidemias. Copyright © 2015 Elsevier B.V. All rights reserved.

Postnatal Expression of V2 Vasopressin Receptor Splice Variants in the Rat Cerebellum

PubMed Central

Vargas, Karina J.; Sarmiento, José M.; Ehrenfeld, Pamela; Añazco, Carolina C.; Villanueva, Carolina I.; Carmona, Pamela L.; Brenet, Marianne; Navarro, Javier; Müller-Esterl, Werner; Figueroa, Carlos D.; González, Carlos B.

2010-01-01

The V2 vasopressin receptor gene contains an alternative splice site in exon-3, which leads to the generation of two splice variants (V2a and V2b) first identified in the kidney. The open reading frame of the alternatively spliced V2b transcripten codes a truncated receptor, showing the same amino acid sequence as the canonical V2a receptor up to the 6th transmembrane segment, but displaying a distinct sequence to the corresponding 7th transmembrane segment and C-terminal domain relative to the V2a receptor. Here, we demonstrate the postnatal expression of V2a and V2b variants in the rat cerebellum. Most importantly, we showed by in situ hybridization and immunocytochemistry that both V2 splice variants were preferentially expressed in Purkinje cells, from early to late postnatal development. In addition, both variants were transiently expressed in the neuroblastic external granule cells and Bergmann fibers. These results indicate that the cellular distributions of both splice variants are developmentally regulated, and suggest that the transient expression of the V2 receptor is involved in the mechanisms of cerebellar cytodifferentiation by AVP. Finally, transfected CHO-K1 .expressing similar amounts of both V2 splice variants, as that found in the cerebellum, showed a significant reduction in the surface expression of V2a receptors, suggesting that the differential expression of the V2 splice variants regulate the vasopressin signaling in the cerebellum. PMID:19281786

The Maximal C3 Self-Complementary Trinucleotide Circular Code X in Genes of Bacteria, Archaea, Eukaryotes, Plasmids and Viruses

PubMed Central

Michel, Christian J.

2017-01-01

In 1996, a set X of 20 trinucleotides was identified in genes of both prokaryotes and eukaryotes which has on average the highest occurrence in reading frame compared to its two shifted frames. Furthermore, this set X has an interesting mathematical property as X is a maximal C3 self-complementary trinucleotide circular code. In 2015, by quantifying the inspection approach used in 1996, the circular code X was confirmed in the genes of bacteria and eukaryotes and was also identified in the genes of plasmids and viruses. The method was based on the preferential occurrence of trinucleotides among the three frames at the gene population level. We extend here this definition at the gene level. This new statistical approach considers all the genes, i.e., of large and small lengths, with the same weight for searching the circular code X. As a consequence, the concept of circular code, in particular the reading frame retrieval, is directly associated to each gene. At the gene level, the circular code X is strengthened in the genes of bacteria, eukaryotes, plasmids, and viruses, and is now also identified in the genes of archaea. The genes of mitochondria and chloroplasts contain a subset of the circular code X. Finally, by studying viral genes, the circular code X was found in DNA genomes, RNA genomes, double-stranded genomes, and single-stranded genomes. PMID:28420220

V2R mutations and nephrogenic diabetes insipidus.

PubMed

Bichet, Daniel G

2009-01-01

Nephrogenic diabetes insipidus (NDI), which can be inherited or acquired, is characterized by an inability to concentrate urine despite normal or elevated plasma concentrations of the antidiuretic hormone, arginine vasopressin (AVP). Polyuria, with hyposthenuria, and polydipsia are the cardinal clinical manifestations of the disease. Nephrogenic failure to concentrate urine maximally may be due to a defect in vasopressin-induced water permeability of the distal tubules and collecting ducts, to insufficient buildup of the corticopapillary interstitial osmotic gradient, or to a combination of these two factors. Thus, the broadest definition of the term NDI embraces any antidiuretic hormone-resistant urinary-concentrating defect, including medullary disease with low interstitial osmolality, renal failure, and osmotic diuresis. About 90% of patients with congenital NDI are males with X-linked recessive NDI (OMIM 304800)(1) and have mutations in the AVP receptor 2 (AVPR2) gene that codes for the vasopressin V(2) receptor; the gene is located in chromosome region Xq28. In about 10% of the families studied, congenital NDI has an autosomal recessive or autosomal dominant mode of inheritance (OMIM 222000 and 125800)(1). Mutations have been identified in the aquaporin-2 gene (AQP2, OMIM 107777)(1), which is located in chromosome region 12q13 and codes for the vasopressin-sensitive water channel. NDI is clinically distinguishable from neurohypophyseal diabetes insipidus (OMIM 125700(1); also referred to as central or neurogenic diabetes insipidus) by a lack of response to exogenous AVP and by plasma levels of AVP that rise normally with increase in plasma osmolality. Hereditary neurohypophyseal diabetes insipidus is secondary to mutations in the gene encoding AVP (OMIM 192340)(1). Neurohypophyseal diabetes insipidus is also a component of autosomal recessive Wolfram syndrome 1 or DIDMOAD syndrome (diabetes insipidus, diabetes mellitus, optic atrophy, and deafness) (OMIM 222300)(1), an autosomal recessive disorder. Other inherited disorders with complex polyuro-polydipsic syndrome with loss of water, sodium, chloride, calcium, magnesium, and potassium include Bartter syndrome (OMIM 601678)(1) and cystinosis (OMIM 219800)(1), while long-term lithium administration is the main cause of acquired NDI. Here, we use the gene symbols approved by the HUGO Gene Nomenclature Committee (http://www.gene.ucl.ac.uk/nomenclature) and provide OMIM entry numbers [OMIM (Online Mendelian Inheritance in Man)(1); McKusick-Nathans Institute for Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD), 2000; World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/]. Copyright © 2009 Elsevier Inc. All rights reserved.

Genome-wide activity of unliganded estrogen receptor-α in breast cancer cells

PubMed Central

Caizzi, Livia; Ferrero, Giulio; Cutrupi, Santina; Cordero, Francesca; Ballaré, Cecilia; Miano, Valentina; Reineri, Stefania; Ricci, Laura; Friard, Olivier; Testori, Alessandro; Corà, Davide; Caselle, Michele; Di Croce, Luciano; De Bortoli, Michele

2014-01-01

Estrogen receptor-α (ERα) has central role in hormone-dependent breast cancer and its ligand-induced functions have been extensively characterized. However, evidence exists that ERα has functions that are independent of ligands. In the present work, we investigated the binding of ERα to chromatin in the absence of ligands and its functions on gene regulation. We demonstrated that in MCF7 breast cancer cells unliganded ERα binds to more than 4,000 chromatin sites. Unexpectedly, although almost entirely comprised in the larger group of estrogen-induced binding sites, we found that unliganded-ERα binding is specifically linked to genes with developmental functions, compared with estrogen-induced binding. Moreover, we found that siRNA-mediated down-regulation of ERα in absence of estrogen is accompanied by changes in the expression levels of hundreds of coding and noncoding RNAs. Down-regulated mRNAs showed enrichment in genes related to epithelial cell growth and development. Stable ERα down-regulation using shRNA, which caused cell growth arrest, was accompanied by increased H3K27me3 at ERα binding sites. Finally, we found that FOXA1 and AP2γ binding to several sites is decreased upon ERα silencing, suggesting that unliganded ERα participates, together with other factors, in the maintenance of the luminal-specific cistrome in breast cancer cells. PMID:24639548

Cloning and characterization of the canine receptor for advanced glycation end products.

PubMed

Murua Escobar, Hugo; Soller, Jan T; Sterenczak, Katharina A; Sperveslage, Jan D; Schlueter, Claudia; Burchardt, Birgit; Eberle, Nina; Fork, Melanie; Nimzyk, Rolf; Winkler, Susanne; Nolte, Ingo; Bullerdiek, Jörn

2006-03-15

Metastasis is one of the major problems when dealing with malignant neoplasias. Accordingly, the finding of molecular targets, which can be addressed to reduce tumour metastasising, will have significant impact on the development of new therapeutic approaches. Recently, the receptor for advanced glycation end products (RAGE)-high mobility group B1 (HMGB1) protein complex has been shown to have significant influence on invasiveness, growth and motility of tumour cells, which are essential characteristics required for metastatic behaviour. A set of in vitro and in vivo approaches showed that blocking of this complex resulted in drastic suppression of tumour cell growth. Due to the similarities of human and canine cancer the dog has joined the common rodent animal model for therapeutic and preclinical studies. However, complete characterisation of the protein complex is a precondition to a therapeutic approach based on the blocking of the RAGE-HMGB1 complex to spontaneously occurring tumours in dogs. We recently characterised the canine HMGB1 gene and protein completely. Here we present the complete characterisation of the canine RAGE gene including its 1384 bp mRNA, the 1215 bp protein coding sequence, the 2835 bp genomic structure, chromosomal localisation, gene expression pattern, and its 404 amino acid protein. Furthermore we compared the CDS of six different canine breeds and screened them for single nucleotide polymorphisms.

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Genetic differences in the ethanol sensitivity of GABA sub A receptors expressed in Xenopus oocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wafford, K.A.; Burnett, D.M.; Dunwiddie, T.V.

1990-07-20

Animal lines selected for differences in drug sensitivity can be used to help determine the molecular basis of drug action. Long-sleep (LS) and short-sleep (SS) mice differ markedly in their genetic sensitivity to ethanol. To investigate the molecular basis for this difference, mRNA from brains of LS and SS mice was expressed in Xenopus oocytes and the ethanol sensitivity of gamma-aminobutyric acid A (GABA{sub A})- and N-methyl D-aspartate (NMDA) - activated ion channels was tested. Ethanol facilitated GABA responses in oocytes injected with mRNA from LS mice but antagonized responses in oocytes injected with mRNA from SS animals. Ethanol inhibitedmore » NMDA responses equally in the two lines. Thus, genes coding for the GABA{sub A} receptor or associated proteins may be critical determinants of individual differences in ethanol sensitivity.« less

[Dopamine neurotransmission of peripheral blood lymphocytes is a potential biomarker of psychiatric and neurological disorders].

PubMed

Taraskina, A E; Nasyrova, R F; Grunina, M N; Zabotina, A M; Ivashchenko, D V; Ershov, E E; Sosin, D N; Kirnichnaya, K A; Ivanov, M V; Krupitsky, E M

2015-01-01

Current literature on a role of dopamine in the development of mental and neurological disorders suggests that the discovery of endogenous dopamine in peripheral blood lymphocytes gave rise to a new line of research. Dopamine receptors are not only found on cells of the innate immune response (nonspecific), but also on cells of adaptive immune response (specific): T and B lymphocytes. These facts bring a new evidence of interrelationships between the peripheral immune system, neuroinflammation and neurodegeneration and suggest new ways for investigation of the pathogenesis of different mental and neurological disorders, in particular Parkinson's disease, Alzheimer's disease and schizophrenia. There is strong evidence that ligands of dopamine receptors can change the expression of coding genes both in central neurons and in peripheral cells. Thus, peripheral blood lymphocytes may prove a cellular tool to identify dopamine transmission disturbances in neuropsychiatric diseases, as well as to monitor the effects of pharmacological treatment.

Armored long non-coding RNA MEG3 targeting EGFR based on recombinant MS2 bacteriophage virus-like particles against hepatocellular carcinoma.

PubMed

Chang, Le; Wang, Guojing; Jia, Tingting; Zhang, Lei; Li, Yulong; Han, Yanxi; Zhang, Kuo; Lin, Guigao; Zhang, Rui; Li, Jinming; Wang, Lunan

2016-04-26

Hepatocellular carcinoma (HCC) is one of the most frequently diagnosed cancers worldwide. However, the treatment of patients with HCC is particularly challenging. Long non-coding RNA maternally expressed gene 3 (MEG3) has been identified as a potential suppressor of several types of tumors, but the delivery of long RNA remains problematic, limiting its applications. In the present study, we designed a novel delivery system based on MS2 virus-like particles (VLPs) crosslinked with GE11 polypeptide. This vector was found to be fast, effective and safe for the targeted delivery of lncRNA MEG3 RNA to the epidermal growth factor receptor (EGFR)-positive HCC cell lines without the activation of EGFR downstream pathways, and significantly attenuated both in vitro and in vivo tumor cell growth. Our study also revealed that the targeted delivery was mainly dependent on clathrin-mediated endocytosis and MEG3 RNA suppresses tumor growth mainly via increasing the expression of p53 and its downstream gene GDF15, but decreasing the expression of MDM2. Thus, this vector is promising as a novel delivery system and may facilitate a new approach to lncRNA based cancer therapy.

Role of gabra2, GABAA receptor alpha-2 subunit, in CNS development.

PubMed

Gonzalez-Nunez, Veronica

2015-09-01

gabra2 gene codes for the alpha-2 subunit of the GABA A receptor, one of the ionotropic receptors which has been related to anxiety, depression and other behavioural disorders, including drug dependence and schizophrenia. GABAergic signalling also plays a role during development, by promoting neural stem cell maintenance and renewal. To investigate the role of gabra2 in CNS development, gabra2 deficient zebrafish were generated. The pattern of proliferation during the embryonic development was disrupted in morphant embryos, which also displayed an increase in the number of apoptotic nuclei mainly at the mid- and hindbrain regions. The expression of several genes ( notch1, pax2, fgf8 and wnt1 ) known to contribute to the development of the central nervous system was also affected in gabra2 morpholino-injected embryos, although no changes were found for pax6a and shh a expression. The transcriptional activity of neuroD (a proneural gene involved in early neuronal determination) was down-regulated in gabra2 deficient embryos, and the expression pattern of gad1b (GABA-synthesising enzyme GAD67) was clearly reduced in injected fish. I propose that gabra2 might be interacting with those signalling pathways that regulate proliferation, differentiation and neurogenesis during the embryonic development; thus, gabra2 might be playing a role in the differentiation of the mesencephalon and cerebellum. Given that changes in GABAergic circuits during development have been related to several psychiatric disorders, such as autism and schizophrenia, this work might be helpful to understand the role of neurotransmitter systems during CNS development and to assess the developmental effects of several GABAergic drugs.

Multifaceted Genomic Risk for Brain Function in Schizophrenia

PubMed Central

Chen, Jiayu; Calhoun, Vince D.; Pearlson, Godfrey D.; Ehrlich, Stefan; Turner, Jessica A.; Ho, Beng-Choon; Wassink, Thomas H.; Michael, Andrew M; Liu, Jingyu

2012-01-01

Recently, deriving candidate endophenotypes from brain imaging data has become a valuable approach to study genetic influences on schizophrenia (SZ), whose pathophysiology remains unclear. In this work we utilized a multivariate approach, parallel independent component analysis, to identify genomic risk components associated with brain function abnormalities in SZ. 5157 candidate single nucleotide polymorphisms (SNPs) were derived from genome-wide array based on their possible connections with SZ and further investigated for their associations with brain activations captured with functional magnetic resonance imaging (fMRI) during a sensorimotor task. Using data from 92 SZ patients and 116 healthy controls, we detected a significant correlation (r= 0.29; p= 2.41×10−5) between one fMRI component and one SNP component, both of which significantly differentiated patients from controls. The fMRI component mainly consisted of precentral and postcentral gyri, the major activated regions in the motor task. On average, higher activation in these regions was observed in participants with higher loadings of the linked SNP component, predominantly contributed to by 253 SNPs. 138 identified SNPs were from known coding regions of 100 unique genes. 31 identified SNPs did not differ between groups, but moderately correlated with some other group-discriminating SNPs, indicating interactions among alleles contributing towards elevated SZ susceptibility. The genes associated with the identified SNPs participated in four neurotransmitter pathways: GABA receptor signaling, dopamine receptor signaling, neuregulin signaling and glutamate receptor signaling. In summary, our work provides further evidence for the complexity of genomic risk to the functional brain abnormality in SZ and suggests a pathological role of interactions between SNPs, genes and multiple neurotransmitter pathways. PMID:22440650

Association testing of vasopressin receptor 1a microsatellite polymorphisms in non-clinical autism spectrum phenotypes.

PubMed

Procyshyn, Tanya L; Hurd, Peter L; Crespi, Bernard J

2017-05-01

Variation in the AVPR1a gene, which codes for a receptor for the neurohormone vasopressin, has been found to relate to autism risk. Interestingly, variation in this gene also relates to differences in social behaviour in non-clinical populations. Variation in this gene may affect expression of AVPR1a receptors in brain areas involved in social behaviour. Here, we tested whether AVPR1a variation was associated with Autism Quotient (AQ) scores, a questionnaire that measures non-clinical manifestations of autism, in a population of 873 healthy university students. The AVPR1a RS1 and RS3 microsatellites were examined, and variants were categorized as "long" or "short". The RS3 long/long genotype was significantly associated with a higher AQ score (i.e., a more autistic-like phenotype) for the combined population and for females only. Further examination showed that this relationship was due to a specific RS3 variant, termed the "target allele", which previous research has linked to reduced altruism and increased marital problems in healthy individuals. We also observed that the relationship between RS3 genotype and AQ score was mainly due to the "attention switching" (the ability to shift attention from one task to another) component of the questionnaire; this ability is commonly impaired in autism spectrum disorders. Overall, our study establishes continuity between the existing AVPR1a research in clinical and non-clinical populations. Our results suggest that vasopressin may exert its effects on social behaviour in part by modulating attentional focus between social and non-social cues. Autism Res 2017, 10: 750-756. © 2016 International Society for Autism Research, Wiley Periodicals, Inc. © 2016 International Society for Autism Research, Wiley Periodicals, Inc.

Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction.

PubMed

Do, Ron; Stitziel, Nathan O; Won, Hong-Hee; Jørgensen, Anders Berg; Duga, Stefano; Angelica Merlini, Pier; Kiezun, Adam; Farrall, Martin; Goel, Anuj; Zuk, Or; Guella, Illaria; Asselta, Rosanna; Lange, Leslie A; Peloso, Gina M; Auer, Paul L; Girelli, Domenico; Martinelli, Nicola; Farlow, Deborah N; DePristo, Mark A; Roberts, Robert; Stewart, Alexander F R; Saleheen, Danish; Danesh, John; Epstein, Stephen E; Sivapalaratnam, Suthesh; Hovingh, G Kees; Kastelein, John J; Samani, Nilesh J; Schunkert, Heribert; Erdmann, Jeanette; Shah, Svati H; Kraus, William E; Davies, Robert; Nikpay, Majid; Johansen, Christopher T; Wang, Jian; Hegele, Robert A; Hechter, Eliana; Marz, Winfried; Kleber, Marcus E; Huang, Jie; Johnson, Andrew D; Li, Mingyao; Burke, Greg L; Gross, Myron; Liu, Yongmei; Assimes, Themistocles L; Heiss, Gerardo; Lange, Ethan M; Folsom, Aaron R; Taylor, Herman A; Olivieri, Oliviero; Hamsten, Anders; Clarke, Robert; Reilly, Dermot F; Yin, Wu; Rivas, Manuel A; Donnelly, Peter; Rossouw, Jacques E; Psaty, Bruce M; Herrington, David M; Wilson, James G; Rich, Stephen S; Bamshad, Michael J; Tracy, Russell P; Cupples, L Adrienne; Rader, Daniel J; Reilly, Muredach P; Spertus, John A; Cresci, Sharon; Hartiala, Jaana; Tang, W H Wilson; Hazen, Stanley L; Allayee, Hooman; Reiner, Alex P; Carlson, Christopher S; Kooperberg, Charles; Jackson, Rebecca D; Boerwinkle, Eric; Lander, Eric S; Schwartz, Stephen M; Siscovick, David S; McPherson, Ruth; Tybjaerg-Hansen, Anne; Abecasis, Goncalo R; Watkins, Hugh; Nickerson, Deborah A; Ardissino, Diego; Sunyaev, Shamil R; O'Donnell, Christopher J; Altshuler, David; Gabriel, Stacey; Kathiresan, Sekar

2015-02-05

Myocardial infarction (MI), a leading cause of death around the world, displays a complex pattern of inheritance. When MI occurs early in life, genetic inheritance is a major component to risk. Previously, rare mutations in low-density lipoprotein (LDL) genes have been shown to contribute to MI risk in individual families, whereas common variants at more than 45 loci have been associated with MI risk in the population. Here we evaluate how rare mutations contribute to early-onset MI risk in the population. We sequenced the protein-coding regions of 9,793 genomes from patients with MI at an early age (≤50 years in males and ≤60 years in females) along with MI-free controls. We identified two genes in which rare coding-sequence mutations were more frequent in MI cases versus controls at exome-wide significance. At low-density lipoprotein receptor (LDLR), carriers of rare non-synonymous mutations were at 4.2-fold increased risk for MI; carriers of null alleles at LDLR were at even higher risk (13-fold difference). Approximately 2% of early MI cases harbour a rare, damaging mutation in LDLR; this estimate is similar to one made more than 40 years ago using an analysis of total cholesterol. Among controls, about 1 in 217 carried an LDLR coding-sequence mutation and had plasma LDL cholesterol > 190 mg dl(-1). At apolipoprotein A-V (APOA5), carriers of rare non-synonymous mutations were at 2.2-fold increased risk for MI. When compared with non-carriers, LDLR mutation carriers had higher plasma LDL cholesterol, whereas APOA5 mutation carriers had higher plasma triglycerides. Recent evidence has connected MI risk with coding-sequence mutations at two genes functionally related to APOA5, namely lipoprotein lipase and apolipoprotein C-III (refs 18, 19). Combined, these observations suggest that, as well as LDL cholesterol, disordered metabolism of triglyceride-rich lipoproteins contributes to MI risk.

Identification of natural killer cell receptor clusters in the platypus genome reveals an expansion of C-type lectin genes.

PubMed

Wong, Emily S W; Sanderson, Claire E; Deakin, Janine E; Whittington, Camilla M; Papenfuss, Anthony T; Belov, Katherine

2009-08-01

Natural killer (NK) cell receptors belong to two unrelated, but functionally analogous gene families: the immunoglobulin superfamily, situated in the leukocyte receptor complex (LRC) and the C-type lectin superfamily, located in the natural killer complex (NKC). Here, we describe the largest NK receptor gene expansion seen to date. We identified 213 putative C-type lectin NK receptor homologs in the genome of the platypus. Many have arisen as the result of a lineage-specific expansion. Orthologs of OLR1, CD69, KLRE, CLEC12B, and CLEC16p genes were also identified. The NKC is split into at least two regions of the genome: 34 genes map to chromosome 7, two map to a small autosome, and the remainder are unanchored in the current genome assembly. No NK receptor genes from the LRC were identified. The massive C-type lectin expansion and lack of Ig-domain-containing NK receptors represents the most extreme polarization of NK receptors found to date. We have used this new data from platypus to trace the possible evolutionary history of the NK receptor clusters.

Gene expression profiling of mucolipidosis type IV fibroblasts reveals deregulation of genes with relevant functions in lysosome physiology.

PubMed

Bozzato, Andrea; Barlati, Sergio; Borsani, Giuseppe

2008-04-01

Mucolipidosis type IV (MLIV, MIM 252650) is an autosomal recessive lysosomal storage disorder that causes mental and motor retardation as well as visual impairment. The lysosomal storage defect in MLIV is consistent with abnormalities of membrane traffic and organelle dynamics in the late endocytic pathway. MLIV is caused by mutations in the MCOLN1 gene, which codes for mucolipin-1 (MLN1), a member of the large family of transient receptor potential (TRP) cation channels. Although a number of studies have been performed on mucolipin-1, the pathological mechanisms underlying MLIV are not fully understood. To identify genes that characterize pathogenic changes in mucolipidosis type IV, we compared the expression profiles of three MLIV and three normal skin fibroblasts cell lines using oligonucleotide microarrays. Genes that were differentially expressed in patients' cells were identified. 231 genes were up-regulated, and 116 down-regulated. Real-Time RT-PCR performed on selected genes in six independent MLIV fibroblasts cell lines was generally consistent with the microarray findings. This study allowed to evidence the modulation at the transcriptional level of a discrete number of genes relevant in biological processes which are altered in the disease such as endosome/lysosome trafficking, lysosome biogenesis, organelle acidification and lipid metabolism.

In Silico Pattern-Based Analysis of the Human Cytomegalovirus Genome

PubMed Central

Rigoutsos, Isidore; Novotny, Jiri; Huynh, Tien; Chin-Bow, Stephen T.; Parida, Laxmi; Platt, Daniel; Coleman, David; Shenk, Thomas

2003-01-01

More than 200 open reading frames (ORFs) from the human cytomegalovirus genome have been reported as potentially coding for proteins. We have used two pattern-based in silico approaches to analyze this set of putative viral genes. With the help of an objective annotation method that is based on the Bio-Dictionary, a comprehensive collection of amino acid patterns that describes the currently known natural sequence space of proteins, we have reannotated all of the previously reported putative genes of the human cytomegalovirus. Also, with the help of MUSCA, a pattern-based multiple sequence alignment algorithm, we have reexamined the original human cytomegalovirus gene family definitions. Our analysis of the genome shows that many of the coded proteins comprise amino acid combinations that are unique to either the human cytomegalovirus or the larger group of herpesviruses. We have confirmed that a surprisingly large portion of the analyzed ORFs encode membrane proteins, and we have discovered a significant number of previously uncharacterized proteins that are predicted to be G-protein-coupled receptor homologues. The analysis also indicates that many of the encoded proteins undergo posttranslational modifications such as hydroxylation, phosphorylation, and glycosylation. ORFs encoding proteins with similar functional behavior appear in neighboring regions of the human cytomegalovirus genome. All of the results of the present study can be found and interactively explored online (http://cbcsrv.watson.ibm.com/virus/). PMID:12634390

In silico pattern-based analysis of the human cytomegalovirus genome.

PubMed

Rigoutsos, Isidore; Novotny, Jiri; Huynh, Tien; Chin-Bow, Stephen T; Parida, Laxmi; Platt, Daniel; Coleman, David; Shenk, Thomas

2003-04-01

More than 200 open reading frames (ORFs) from the human cytomegalovirus genome have been reported as potentially coding for proteins. We have used two pattern-based in silico approaches to analyze this set of putative viral genes. With the help of an objective annotation method that is based on the Bio-Dictionary, a comprehensive collection of amino acid patterns that describes the currently known natural sequence space of proteins, we have reannotated all of the previously reported putative genes of the human cytomegalovirus. Also, with the help of MUSCA, a pattern-based multiple sequence alignment algorithm, we have reexamined the original human cytomegalovirus gene family definitions. Our analysis of the genome shows that many of the coded proteins comprise amino acid combinations that are unique to either the human cytomegalovirus or the larger group of herpesviruses. We have confirmed that a surprisingly large portion of the analyzed ORFs encode membrane proteins, and we have discovered a significant number of previously uncharacterized proteins that are predicted to be G-protein-coupled receptor homologues. The analysis also indicates that many of the encoded proteins undergo posttranslational modifications such as hydroxylation, phosphorylation, and glycosylation. ORFs encoding proteins with similar functional behavior appear in neighboring regions of the human cytomegalovirus genome. All of the results of the present study can be found and interactively explored online (http://cbcsrv.watson.ibm.com/virus/).

Posttranscriptional regulation of the immediate-early gene EGR1 by light in the mouse retina.

PubMed

Simon, Perikles; Schott, Klaus; Williams, Robert W; Schaeffel, Frank

2004-12-01

Synaptic plasticity is modulated by differential regulation of transcription factors such as EGR1 which binds to DNA via a zinc finger binding domain. Inactivation of EGR1 has implicated this gene as a key regulator of memory formation and learning. However, it remains puzzling how synaptic input can lead to an up-regulation of the EGR-1 protein within only a few minutes. Here, we show by immunohistochemical staining that the EGR-1 protein is localized in synapses throughout the mouse retina. We demonstrate for the first time that two variants of Egr-1 mRNA are produced in the retina by alternative polyadenylation, with the longer version having an additional 293 base pairs at the end of the 3'UTR. Remarkably, the use of the alternative polyadenylation site is controlled by light. The additional 3'UTR sequence of the longer variant displays an even higher level of phylogenetic conservation than the coding region of this highly conserved gene. Additionally, it harbours a cytoplasmic polyadenylation element which is known to respond to NMDA receptor activation. The longer version of the Egr-1 mRNA could therefore rapidly respond to excitatory stimuli such as light or glutamate release whereas the short variant, which is predominantly expressed and contains the full coding sequence, lacks the regulatory elements for cytoplasmic polyadenylation in its 3'UTR.

A Rapid, Extensive, and Transient Transcriptional Response to Estrogen Signaling in Breast Cancer Cells

PubMed Central

Hah, Nasun; Danko, Charles G.; Core, Leighton; Waterfall, Joshua J.; Siepel, Adam; Lis, John T.; Kraus, W. Lee

2011-01-01

Summary We report the immediate effects of estrogen signaling on the transcriptome of breast cancer cells using Global Run-On and sequencing (GRO-seq). The data were analyzed using a new bioinformatic approach that allowed us to identify transcripts directly from the GRO-seq data. We found that estrogen signaling directly regulates a strikingly large fraction of the transcriptome in a rapid, robust, and unexpectedly transient manner. In addition to protein coding genes, estrogen regulates the distribution and activity of all three RNA polymerases, and virtually every class of non-coding RNA that has been described to date. We also identified a large number of previously undetected estrogen-regulated intergenic transcripts, many of which are found proximal to estrogen receptor binding sites. Collectively, our results provide the most comprehensive measurement of the primary and immediate estrogen effects to date and a resource for understanding rapid signal-dependent transcription in other systems. PMID:21549415

Evolution of trace amine associated receptor (TAAR) gene family in vertebrates: lineage-specific expansions and degradations of a second class of vertebrate chemosensory receptors expressed in the olfactory epithelium.

PubMed

Hashiguchi, Yasuyuki; Nishida, Mutsumi

2007-09-01

The trace amine-associated receptors (TAARs) form a specific family of G protein-coupled receptors in vertebrates. TAARs were initially considered neurotransmitter receptors, but recent study showed that mouse TAARs function as chemosensory receptors in the olfactory epithelium. To clarify the evolutionary dynamics of the TAAR gene family in vertebrates, near-complete repertoires of TAAR genes and pseudogenes were identified from the genomic assemblies of 4 teleost fishes (zebrafish, fugu, stickleback, and medaka), western clawed frogs, chickens, 3 mammals (humans, mice, and opossum), and sea lampreys. Database searches revealed that fishes had many putatively functional TAAR genes (13-109 genes), whereas relatively small numbers of TAAR genes (3-22 genes) were identified in tetrapods. Phylogenetic analysis of these genes indicated that the TAAR gene family was subdivided into 5 subfamilies that diverged before the divergence of ray-finned fishes and tetrapods. In tetrapods, virtually all TAAR genes were located in 1 specific region of their genomes as a gene cluster; however, in fishes, TAAR genes were scattered throughout more than 2 genomic locations. This possibly reflects a whole-genome duplication that occurred in the common ancestor of ray-finned fishes. Expression analysis of zebrafish and stickleback TAAR genes revealed that many TAARs in these fishes were expressed in the olfactory organ, suggesting the relatively high importance of TAARs as chemosensory receptors in fishes. A possible evolutionary history of the vertebrate TAAR gene family was inferred from the phylogenetic and comparative genomic analyses.

Identification and Functional Analysis of Pheromone and Receptor Genes in the B3 Mating Locus of Pleurotus eryngii

PubMed Central

Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

2014-01-01

Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency. PMID:25133513

Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

2008-04-11

Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

Structural Overview of the Nuclear Receptor Superfamily: Insights into Physiology and Therapeutics

PubMed Central

Huang, Pengxiang; Chandra, Vikas; Rastinejad, Fraydoon

2013-01-01

As ligand-regulated transcription factors, the nuclear hormone receptors are nearly ideal drug targets, with internal pockets that bind to hydrophobic, drug-like molecules and well-characterized ligand-induced conformational changes that recruit transcriptional coregulators to promoter elements. Yet, due to the multitude of genes under the control of a single receptor, the major challenge has been the identification of ligands with gene-selective actions, impacting disease outcomes through a narrow subset of target genes and not across their entire gene-regulatory repertoire. Here, we summarize the concepts and work to date underlying the development of steroidal and nonsteroidal receptor ligands, including the use of crystal structures, high-throughput screens, and rational design approaches for finding useful therapeutic molecules. Difficulties in finding selective receptor modulators require a more complete understanding of receptor interdomain communications, posttranslational modifications, and receptor-protein interactions that could be exploited for target gene selectivity. PMID:20148675

The Tla protein of Porphyromonas gingivalis W50: a homolog of the RI protease precursor (PrpRI) is an outer membrane receptor required for growth on low levels of hemin.

PubMed

Aduse-Opoku, J; Slaney, J M; Rangarajan, M; Muir, J; Young, K A; Curtis, M A

1997-08-01

The prpR1 gene of Porphyromonas gingivalis W50 encodes the polyprotein precursor (PrpRI) of an extracellular arginine-specific protease. PrpRI is organized into four distinct domains (pro, alpha, beta, and gamma) and is processed to a heterodimeric protease (RI) which comprises the alpha and beta components in a noncovalent association. The alpha component contains the protease active site, whereas the beta component appears to have a role in adherence and hemagglutination processes. DNA sequences homologous to the coding region for the RI beta component are present at multiple loci on the P. gingivalis chromosome and may represent a family of related genes. In this report, we describe the cloning, sequence analysis, and characterization of one of these homologous loci isolated in plasmid pJM7. The 6,041-bp P. gingivalis DNA fragment in pJM7 contains a major open reading frame of 3,291 bp with coding potential for a protein with an Mr 118,700. An internal region of the deduced sequence (V304 to N768) shows 98% identity to the beta domain of PrpRI, and the recombinant product of pJM7 is immunoreactive with an antibody specific to the RI beta component. The N terminus of the deduced sequence has regional similarity to TonB-linked receptors which are frequently involved in periplasmic translocation of hemin, iron, colicins, or vitamin B12 in other bacteria. We have therefore designated this gene tla (TonB-linked adhesin). In contrast to the parent strain, an isogenic mutant of P. gingivalis W50 in which the tla was insertionally inactivated was unable to grow in medium containing low concentrations of hemin (<2.5 mg liter(-1)), and hemin-depleted cells of this mutant failed to respond to hemin in an agar diffusion plate assay. These data suggest a role for this gene product in hemin acquisition and utilization. Furthermore, the mutant produced significantly less arginine- and lysine-specific protease activities than the parent strain, indicating that there may be a regulatory relationship between tla and other members of this gene family.

The Tla protein of Porphyromonas gingivalis W50: a homolog of the RI protease precursor (PrpRI) is an outer membrane receptor required for growth on low levels of hemin.

PubMed Central

Aduse-Opoku, J; Slaney, J M; Rangarajan, M; Muir, J; Young, K A; Curtis, M A

1997-01-01

The prpR1 gene of Porphyromonas gingivalis W50 encodes the polyprotein precursor (PrpRI) of an extracellular arginine-specific protease. PrpRI is organized into four distinct domains (pro, alpha, beta, and gamma) and is processed to a heterodimeric protease (RI) which comprises the alpha and beta components in a noncovalent association. The alpha component contains the protease active site, whereas the beta component appears to have a role in adherence and hemagglutination processes. DNA sequences homologous to the coding region for the RI beta component are present at multiple loci on the P. gingivalis chromosome and may represent a family of related genes. In this report, we describe the cloning, sequence analysis, and characterization of one of these homologous loci isolated in plasmid pJM7. The 6,041-bp P. gingivalis DNA fragment in pJM7 contains a major open reading frame of 3,291 bp with coding potential for a protein with an Mr 118,700. An internal region of the deduced sequence (V304 to N768) shows 98% identity to the beta domain of PrpRI, and the recombinant product of pJM7 is immunoreactive with an antibody specific to the RI beta component. The N terminus of the deduced sequence has regional similarity to TonB-linked receptors which are frequently involved in periplasmic translocation of hemin, iron, colicins, or vitamin B12 in other bacteria. We have therefore designated this gene tla (TonB-linked adhesin). In contrast to the parent strain, an isogenic mutant of P. gingivalis W50 in which the tla was insertionally inactivated was unable to grow in medium containing low concentrations of hemin (<2.5 mg liter(-1)), and hemin-depleted cells of this mutant failed to respond to hemin in an agar diffusion plate assay. These data suggest a role for this gene product in hemin acquisition and utilization. Furthermore, the mutant produced significantly less arginine- and lysine-specific protease activities than the parent strain, indicating that there may be a regulatory relationship between tla and other members of this gene family. PMID:9244265

Gene transfer mediated by alpha2-macroglobulin.

PubMed Central

Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

1996-01-01

alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

A Catalogue of Putative cis-Regulatory Interactions Between Long Non-coding RNAs and Proximal Coding Genes Based on Correlative Analysis Across Diverse Human Tumors.

PubMed

Basu, Swaraj; Larsson, Erik

2018-05-31

Antisense transcripts and other long non-coding RNAs are pervasive in mammalian cells, and some of these molecules have been proposed to regulate proximal protein-coding genes in cis For example, non-coding transcription can contribute to inactivation of tumor suppressor genes in cancer, and antisense transcripts have been implicated in the epigenetic inactivation of imprinted genes. However, our knowledge is still limited and more such regulatory interactions likely await discovery. Here, we make use of available gene expression data from a large compendium of human tumors to generate hypotheses regarding non-coding-to-coding cis -regulatory relationships with emphasis on negative associations, as these are less likely to arise for reasons other than cis -regulation. We document a large number of possible regulatory interactions, including 193 coding/non-coding pairs that show expression patterns compatible with negative cis -regulation. Importantly, by this approach we capture several known cases, and many of the involved coding genes have known roles in cancer. Our study provides a large catalog of putative non-coding/coding cis -regulatory pairs that may serve as a basis for further experimental validation and characterization. Copyright © 2018 Basu and Larsson.

Endurance Exercise Ability in the Horse: A Trait with Complex Polygenic Determinism

PubMed Central

Ricard, Anne; Robert, Céline; Blouin, Christine; Baste, Fanny; Torquet, Gwendoline; Morgenthaler, Caroline; Rivière, Julie; Mach, Nuria; Mata, Xavier; Schibler, Laurent; Barrey, Eric

2017-01-01

Endurance horses are able to run at more than 20 km/h for 160 km (in bouts of 30–40 km). This level of performance is based on intense aerobic metabolism, effective body heat dissipation and the ability to endure painful exercise. The known heritabilities of endurance performance and exercise-related physiological traits in Arabian horses suggest that adaptation to extreme endurance exercise is influenced by genetic factors. The objective of the present genome-wide association study (GWAS) was to identify single nucleotide polymorphisms (SNPs) related to endurance racing performance in 597 Arabian horses. The performance traits studied were the total race distance, average race speed and finishing status (qualified, eliminated or retired). We used three mixed models that included a fixed allele or genotype effect and a random, polygenic effect. Quantile-quantile plots were acceptable, and the regression coefficients for actual vs. expected log10 p-values ranged from 0.865 to 1.055. The GWAS revealed five significant quantitative trait loci (QTL) corresponding to 6 SNPs on chromosomes 6, 1, 7, 16, and 29 (two SNPs) with corrected p-values from 1.7 × 10−6 to 1.8 × 10−5. Annotation of these 5 QTL revealed two genes: sortilin-related VPS10-domain-containing receptor 3 (SORCS3) on chromosome 1 is involved in protein trafficking, and solute carrier family 39 member 12 (SLC39A12) on chromosome 29 is active in zinc transport and cell homeostasis. These two coding genes could be involved in neuronal tissues (CNS). The other QTL on chromosomes 6, 7, and 16 may be involved in the regulation of the gene expression through non-coding RNAs, CpG islands and transcription factor binding sites. On chromosome 6, a new candidate equine long non-coding RNA (KCNQ1OT1 ortholog: opposite antisense transcript 1 of potassium voltage-gated channel subfamily Q member 1 gene) was predicted in silico and validated by RT-qPCR in primary cultures of equine myoblasts and fibroblasts. This lncRNA could be one element of the cardiac rhythm regulation. Our GWAS revealed that equine performance during endurance races is a complex polygenic trait, and is partially governed by at least 5 QTL: two coding genes involved in neuronal tissues and three other loci with many regulatory functions such as slowing down heart rate. PMID:28702049

Endurance Exercise Ability in the Horse: A Trait with Complex Polygenic Determinism.

PubMed

Ricard, Anne; Robert, Céline; Blouin, Christine; Baste, Fanny; Torquet, Gwendoline; Morgenthaler, Caroline; Rivière, Julie; Mach, Nuria; Mata, Xavier; Schibler, Laurent; Barrey, Eric

2017-01-01

Endurance horses are able to run at more than 20 km/h for 160 km (in bouts of 30-40 km). This level of performance is based on intense aerobic metabolism, effective body heat dissipation and the ability to endure painful exercise. The known heritabilities of endurance performance and exercise-related physiological traits in Arabian horses suggest that adaptation to extreme endurance exercise is influenced by genetic factors. The objective of the present genome-wide association study (GWAS) was to identify single nucleotide polymorphisms (SNPs) related to endurance racing performance in 597 Arabian horses. The performance traits studied were the total race distance, average race speed and finishing status (qualified, eliminated or retired). We used three mixed models that included a fixed allele or genotype effect and a random, polygenic effect. Quantile-quantile plots were acceptable, and the regression coefficients for actual vs. expected log 10 p -values ranged from 0.865 to 1.055. The GWAS revealed five significant quantitative trait loci (QTL) corresponding to 6 SNPs on chromosomes 6, 1, 7, 16, and 29 (two SNPs) with corrected p -values from 1.7 × 10 -6 to 1.8 × 10 -5 . Annotation of these 5 QTL revealed two genes: sortilin-related VPS10-domain-containing receptor 3 ( SORCS3 ) on chromosome 1 is involved in protein trafficking, and solute carrier family 39 member 12 ( SLC39A12 ) on chromosome 29 is active in zinc transport and cell homeostasis. These two coding genes could be involved in neuronal tissues (CNS). The other QTL on chromosomes 6, 7, and 16 may be involved in the regulation of the gene expression through non-coding RNAs, CpG islands and transcription factor binding sites. On chromosome 6, a new candidate equine long non-coding RNA ( KCNQ1OT1 ortholog: opposite antisense transcript 1 of potassium voltage-gated channel subfamily Q member 1 gene) was predicted in silico and validated by RT-qPCR in primary cultures of equine myoblasts and fibroblasts. This lncRNA could be one element of the cardiac rhythm regulation. Our GWAS revealed that equine performance during endurance races is a complex polygenic trait, and is partially governed by at least 5 QTL: two coding genes involved in neuronal tissues and three other loci with many regulatory functions such as slowing down heart rate.

Competing endogenous RNA regulatory network in papillary thyroid carcinoma.

PubMed

Chen, Shouhua; Fan, Xiaobin; Gu, He; Zhang, Lili; Zhao, Wenhua

2018-05-11

The present study aimed to screen all types of RNAs involved in the development of papillary thyroid carcinoma (PTC). RNA‑sequencing data of PTC and normal samples were used for screening differentially expressed (DE) microRNAs (DE‑miRNAs), long non‑coding RNAs (DE‑lncRNAs) and genes (DEGs). Subsequently, lncRNA‑miRNA, miRNA‑gene (that is, miRNA‑mRNA) and gene‑gene interaction pairs were extracted and used to construct regulatory networks. Feature genes in the miRNA‑mRNA network were identified by topological analysis and recursive feature elimination analysis. A support vector machine (SVM) classifier was built using 15 feature genes, and its classification effect was validated using two microarray data sets that were downloaded from the Gene Expression Omnibus (GEO) database. In addition, Gene Ontology function and Kyoto Encyclopedia Genes and Genomes pathway enrichment analyses were conducted for genes identified in the ceRNA network. A total of 506 samples, including 447 tumor samples and 59 normal samples, were obtained from The Cancer Genome Atlas (TCGA); 16 DE‑lncRNAs, 917 DEGs and 30 DE‑miRNAs were screened. The miRNA‑mRNA regulatory network comprised 353 nodes and 577 interactions. From these data, 15 feature genes with high predictive precision (>95%) were extracted from the network and were used to form an SVM classifier with an accuracy of 96.05% (486/506) for PTC samples downloaded from TCGA, and accuracies of 96.81 and 98.46% for GEO downloaded data sets. The ceRNA regulatory network comprised 596 lines (or interactions) and 365 nodes. Genes in the ceRNA network were significantly enriched in 'neuron development', 'differentiation', 'neuroactive ligand‑receptor interaction', 'metabolism of xenobiotics by cytochrome P450', 'drug metabolism' and 'cytokine‑cytokine receptor interaction' pathways. Hox transcript antisense RNA, miRNA‑206 and kallikrein‑related peptidase 10 were nodes in the ceRNA regulatory network of the selected feature gene, and they may serve import roles in the development of PTC.

The Mouse Solitary Odorant Receptor Gene Promoters as Models for the Study of Odorant Receptor Gene Choice

PubMed Central

Degl'Innocenti, Andrea

2016-01-01

Background In vertebrates, several anatomical regions located within the nasal cavity mediate olfaction. Among these, the main olfactory epithelium detects most conventional odorants. Olfactory sensory neurons, provided with cilia exposed to the air, detect volatile chemicals via an extremely large family of seven-transmembrane chemoreceptors named odorant receptors. Their genes are expressed in a monogenic and monoallelic fashion: a single allele of a single odorant receptor gene is transcribed in a given mature neuron, through a still uncharacterized molecular mechanism known as odorant receptor gene choice. Aim Odorant receptor genes are typically arranged in genomic clusters, but a few are isolated (we call them solitary) from the others within a region broader than 1 Mb upstream and downstream with respect to their transcript's coordinates. The study of clustered genes is problematic, because of redundancy and ambiguities in their regulatory elements: we propose to use the solitary genes as simplified models to understand odorant receptor gene choice. Procedures Here we define number and identity of the solitary genes in the mouse genome (C57BL/6J), and assess the conservation of the solitary status in some mammalian orthologs. Furthermore, we locate their putative promoters, predict their homeodomain binding sites (commonly present in the promoters of odorant receptor genes) and compare candidate promoter sequences with those of wild-caught mice. We also provide expression data from histological sections. Results In the mouse genome there are eight intact solitary genes: Olfr19 (M12), Olfr49, Olfr266, Olfr267, Olfr370, Olfr371, Olfr466, Olfr1402; five are conserved as solitary in rat. These genes are all expressed in the main olfactory epithelium of three-day-old mice. The C57BL/6J candidate promoter of Olfr370 has considerably varied compared to its wild-type counterpart. Within the putative promoter for Olfr266 a homeodomain binding site is predicted. As a whole, our findings favor Olfr266 as a model gene to investigate odorant receptor gene choice. PMID:26794459

Integration of mRNP formation and export.

PubMed

Björk, Petra; Wieslander, Lars

2017-08-01

Expression of protein-coding genes in eukaryotes relies on the coordinated action of many sophisticated molecular machineries. Transcription produces precursor mRNAs (pre-mRNAs) and the active gene provides an environment in which the pre-mRNAs are processed, folded, and assembled into RNA-protein (RNP) complexes. The dynamic pre-mRNPs incorporate the growing transcript, proteins, and the processing machineries, as well as the specific protein marks left after processing that are essential for export and the cytoplasmic fate of the mRNPs. After release from the gene, the mRNPs move by diffusion within the interchromatin compartment, making up pools of mRNPs. Here, splicing and polyadenylation can be completed and the mRNPs recruit the major export receptor NXF1. Export competent mRNPs interact with the nuclear pore complex, leading to export, concomitant with compositional and conformational changes of the mRNPs. We summarize the integrated nuclear processes involved in the formation and export of mRNPs.

A conditional allele of Rspo3 reveals redundant function of R-spondins during mouse limb development.

PubMed

Neufeld, Stanley; Rosin, Jessica M; Ambasta, Anshula; Hui, Kristen; Shaneman, Venessa; Crowder, Ray; Vickerman, Lori; Cobb, John

2012-10-01

R-spondins are secreted ligands that bind cell surface receptors and activate Wnt/β-catenin signaling. Human mutations and gene inactivation studies in mice have revealed a role for these four proteins (RSPO1-4) in diverse developmental processes ranging from sex determination to limb development. Among the genes coding for R-spondins, only inactivation of Rspo3 shows early embryonic lethality (E10.5 in mice). Therefore, a conditional allele of this gene is necessary to understand the function of R-spondins throughout murine development. To address this need, we have produced an allele in which loxP sites flank exons 2-4 of Rspo3, allowing tissue-specific deletion of these exons in the presence of Cre recombinase. We used these mice to investigate the role of Rspo3 during limb development and found that limbs ultimately developed normally in the absence of Rspo3 function. However, severe hindlimb truncations resulted when Rspo3 and Rspo2 mutations were combined, demonstrating redundant function of these genes. Copyright © 2012 Wiley Periodicals, Inc.

De Novo Coding Variants Are Strongly Associated with Tourette Disorder.

PubMed

Willsey, A Jeremy; Fernandez, Thomas V; Yu, Dongmei; King, Robert A; Dietrich, Andrea; Xing, Jinchuan; Sanders, Stephan J; Mandell, Jeffrey D; Huang, Alden Y; Richer, Petra; Smith, Louw; Dong, Shan; Samocha, Kaitlin E; Neale, Benjamin M; Coppola, Giovanni; Mathews, Carol A; Tischfield, Jay A; Scharf, Jeremiah M; State, Matthew W; Heiman, Gary A

2017-05-03

Whole-exome sequencing (WES) and de novo variant detection have proven a powerful approach to gene discovery in complex neurodevelopmental disorders. We have completed WES of 325 Tourette disorder trios from the Tourette International Collaborative Genetics cohort and a replication sample of 186 trios from the Tourette Syndrome Association International Consortium on Genetics (511 total). We observe strong and consistent evidence for the contribution of de novo likely gene-disrupting (LGD) variants (rate ratio [RR] 2.32, p = 0.002). Additionally, de novo damaging variants (LGD and probably damaging missense) are overrepresented in probands (RR 1.37, p = 0.003). We identify four likely risk genes with multiple de novo damaging variants in unrelated probands: WWC1 (WW and C2 domain containing 1), CELSR3 (Cadherin EGF LAG seven-pass G-type receptor 3), NIPBL (Nipped-B-like), and FN1 (fibronectin 1). Overall, we estimate that de novo damaging variants in approximately 400 genes contribute risk in 12% of clinical cases. VIDEO ABSTRACT. Copyright © 2017 Elsevier Inc. All rights reserved.

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

PubMed

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

Corticosteroid receptor gene expression is related to sex and social behaviour in a social fish.

PubMed

O'Connor, Constance M; Rodela, Tammy M; Mileva, Viktoria R; Balshine, Sigal; Gilmour, Kathleen M

2013-03-01

Circulating corticosteroids have been related to social status in a variety of species. However, our understanding of corticosteroid receptor expression and its relationship with sociality is still in its infancy. Knowledge of variation in receptor expression is critical to understand the physiological relevance of differences in circulating corticosteroid concentrations. In this study, we examined corticosteroid receptor gene expression in relation to dominance rank, sex, and social behaviour in the highly social cichlid fish, Neolamprologus pulcher. We examined the relative gene expression of the three known teleost corticosteroid receptors: glucocorticoid receptor 1 (GR1), glucocorticoid receptor 2 (GR2), and the mineralocorticoid receptor (MR) in liver and brain tissue of dominant and subordinate N. pulcher males and females. Phylogenetic analysis revealed the N. pulcher gene originally described as GR2, clustered with other teleost GR1 genes, while the originally-described N. pulcher GR1 gene clustered with the GR2 genes of other teleosts. Therefore we propose a change in the original nomenclature of the N. pulcher GRs: GR1 (formerly GR2) and GR2 (formerly GR1) and adopt this new nomenclature throughout this manuscript. Liver MR transcript levels were higher in males than females, and positively related to submissive behaviour. Liver GR2 (formerly GR1) transcript levels were also higher in males than females. Collectively, the results demonstrate sex differences in corticosteroid receptor abundance, and suggest tissue- and receptor-specific roles for corticosteroid receptors in mediating aspects of social behaviour. Copyright © 2012. Published by Elsevier Inc.

Comprehensive Analysis of Mouse Bitter Taste Receptors Reveals Different Molecular Receptive Ranges for Orthologous Receptors in Mice and Humans*

PubMed Central

Lossow, Kristina; Hübner, Sandra; Roudnitzky, Natacha; Slack, Jay P.; Pollastro, Federica; Behrens, Maik; Meyerhof, Wolfgang

2016-01-01

One key to animal survival is the detection and avoidance of potentially harmful compounds by their bitter taste. Variable numbers of taste 2 receptor genes expressed in the gustatory end organs enable bony vertebrates (Euteleostomi) to recognize numerous bitter chemicals. It is believed that the receptive ranges of bitter taste receptor repertoires match the profiles of bitter chemicals that the species encounter in their diets. Human and mouse genomes contain pairs of orthologous bitter receptor genes that have been conserved throughout evolution. Moreover, expansions in both lineages generated species-specific sets of bitter taste receptor genes. It is assumed that the orthologous bitter taste receptor genes mediate the recognition of bitter toxins relevant for both species, whereas the lineage-specific receptors enable the detection of substances differently encountered by mice and humans. By challenging 34 mouse bitter taste receptors with 128 prototypical bitter substances in a heterologous expression system, we identified cognate compounds for 21 receptors, 19 of which were previously orphan receptors. We have demonstrated that mouse taste 2 receptors, like their human counterparts, vary greatly in their breadth of tuning, ranging from very broadly to extremely narrowly tuned receptors. However, when compared with humans, mice possess fewer broadly tuned receptors and an elevated number of narrowly tuned receptors, supporting the idea that a large receptor repertoire is the basis for the evolution of specialized receptors. Moreover, we have demonstrated that sequence-orthologous bitter taste receptors have distinct agonist profiles. Species-specific gene expansions have enabled further diversification of bitter substance recognition spectra. PMID:27226572

A new mutation in the calcium-sensing receptor gene causing hypocalcaemia: case report of a father and two sons.

PubMed

Schoutteten, M K; Bravenboer, B; Seneca, S; Stouffs, K; Velkeniers, B

2017-07-01

Regulation of calcium is mediated by parathyroid hormone (PTH) and 1.25-dihydroxyvitamine D3. The calcium-sensing receptor (CaSR) regulates PTH release by a negative feedback system. Gain-of-function mutations in the CaSR gene reset the calcium-PTH axis, leading to hypocalcaemia. We analysed a family with hypocalcaemia. The proband was a 47-year-old man (index, patient I1), who presented with paraesthesias in both limbs. He has two sons (patient II1 a nd I I2). The probands' lab results showed: serum calcium of 1.95 mmol/l, albumin 41 g/l, phosphate 0.81 mmol/l and PTH 6.6 ng/l (normal 15-65 ng/l). Based on this analysis, we suspected a hereditary form of hypocalcaemia and performed genetic testing by polymerase chain reaction and Sanger sequencing of the coding regions and intron boundaries of the CaSR gene. Genetic analysis revealed a new heterozygous mutation: c.2195A>G, p.(Asn732Ser) in exon 7. The lab results of patient II1 showed: serum calcium of 1.93 mmol/l, phosphate 1.31 mmol/l, albumin 41 g/l, and PTH 24.3 ng/l. His genotype revealed the same activating mutation and, like his father, he also lost his scalp hair at an early adolescent age. Patient II2 is asymptomatic, and has neither biochemical abnormalities, nor the familial CaSR gene mutation. He still has all his scalp hair. 1) The c.2195A>G, p.(Asn732Ser) mutation in exon 7 of the CaSR gene leads to hypocalcaemia, and has not been reported before in the medical literature. 2) Possibly, this mutation is linked to premature baldness.

Whole-body transcriptome of selectively bred, resistant-, control-, and susceptible-line rainbow trout following experimental challenge with Flavobacterium psychrophilum

PubMed Central

Marancik, David; Gao, Guangtu; Paneru, Bam; Ma, Hao; Hernandez, Alvaro G.; Salem, Mohamed; Yao, Jianbo; Palti, Yniv; Wiens, Gregory D.

2014-01-01

Genetic improvement for enhanced disease resistance in fish is an increasingly utilized approach to mitigate endemic infectious disease in aquaculture. In domesticated salmonid populations, large phenotypic variation in disease resistance has been identified but the genetic basis for altered responsiveness remains unclear. We previously reported three generations of selection and phenotypic validation of a bacterial cold water disease (BCWD) resistant line of rainbow trout, designated ARS-Fp-R. This line has higher survival after infection by either standardized laboratory challenge or natural challenge as compared to two reference lines, designated ARS-Fp-C (control) and ARS-Fp-S (susceptible). In this study, we utilized 1.1 g fry from the three genetic lines and performed RNA-seq to measure transcript abundance from the whole body of naive and Flavobacterium psychrophilum infected fish at day 1 (early time-point) and at day 5 post-challenge (onset of mortality). Sequences from 24 libraries were mapped onto the rainbow trout genome reference transcriptome of 46,585 predicted protein coding mRNAs that included 2633 putative immune-relevant gene transcripts. A total of 1884 genes (4.0% genome) exhibited differential transcript abundance between infected and mock-challenged fish (FDR < 0.05) that included chemokines, complement components, tnf receptor superfamily members, interleukins, nod-like receptor family members, and genes involved in metabolism and wound healing. The largest number of differentially expressed genes occurred on day 5 post-infection between naive and challenged ARS-Fp-S line fish correlating with high bacterial load. After excluding the effect of infection, we identified 21 differentially expressed genes between the three genetic lines. In summary, these data indicate global transcriptome differences between genetic lines of naive animals as well as differentially regulated transcriptional responses to infection. PMID:25620978

Disease-associated changes in the expression of ion channels, ion receptors, ion exchangers and Ca{sup 2+}-handling proteins in heart hypertrophy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zwadlo, Carolin; Borlak, Juergen

2005-09-15

The molecular pathology of cardiac hypertrophy is multifactorial with transcript regulation of ion channels, ion exchangers and Ca{sup 2+}-handling proteins being speculative. We therefore investigated disease-associated changes in gene expression of various ion channels and their receptors as well as ion exchangers, cytoskeletal proteins and Ca{sup 2+}-handling proteins in normotensive and spontaneously hypertensive (SHR) rats. We also compared experimental findings with results from hypertrophic human hearts, previously published (Borlak, J., and Thum, T., 2003. Hallmarks of ion channel gene expression in end-stage heart failure. FASEB J. 17, 1592-1608). We observed significant (P < 0.05) induction in transcript level of ATP-drivenmore » ion exchangers (Atp1A1, NCX-1, SERCA2a), ion channels (L-type Ca{sup 2+}-channel, K{sub ir}3.4, Na{sub v}1.5) and RyR-2 in hypertrophic hearts, while gene expression was repressed in diseased human hearts. Further, the genes coding for calreticulin and calmodulin, PMCA 1 and 4 as well as {alpha}-skeletal actin were significantly (P < 0.05) changed in hypertrophic human heart, but were unchanged in hypertrophic left ventricles of the rat heart. Notably, transcript level of {alpha}- and {beta}-MHC, calsequestrin, K{sub ir}6.1 (in the right ventricle only), phospholamban as well as troponin T were repressed in both diseased human and rat hearts. Our study enabled an identification of disease-associated candidate genes. Their regulation is likely to be the result of an imbalance between pressure load/stretch force and vascular tonus and the observed changes may provide a rational for the rhythm disturbances observed in patients with cardiac hypertrophy.« less

Predominance of a 6 bp deletion in exon 2 of the LDL receptor gene in Africans with familial hypercholesterolaemia

PubMed Central

Thiart, R.; Scholtz, C.; Vergotine, J.; Hoogendijk, C.; de Villiers, J N. P; Nissen, H.; Brusgaard, K.; Gaffney, D.; Hoffs, M.; Vermaak, W; Kotze, M.

2000-01-01

In South Africa, the high prevalence of familial hypercholesterolaemia (FH) among Afrikaners, Jews, and Indians as a result of founder genes is in striking contrast to its reported virtual absence in the black population in general. In this study, the molecular basis of primary hypercholesterolaemia was studied in 16 Africans diagnosed with FH. DNA analysis using three screening methods resulted in the identification of seven different mutations in the coding region of the low density lipoprotein (LDLR) gene in 10 of the patients analysed. These included a 6 bp deletion (GCGATG) accounting for 28% of defective alleles, and six point mutations (D151H, R232W, R385Q, E387K, P678L, and R793Q) detected in single families. The Sotho patient with missense mutation R232W was also heterozygous for a de novo splicing defect 313+1G→A. Several silent mutations/polymorphisms were detected in the LDLR and apolipoprotein B genes, including a base change (g→t) at nucleotide position −175 in the FP2 LDLR regulatory element. This promoter variant was detected at a significantly higher (p<0.05) frequency in FH patients compared to controls and occurred in cis with mutation E387K in one family. Analysis of four intragenic LDLR gene polymorphisms showed that the same chromosomal background was identified at this locus in the four FH patients with the 6 bp deletion. Detection of the 6 bp deletion in Xhosa, Pedi, and Tswana FH patients suggests that it is an ancient mutation predating tribal separation approximately 3000 years ago.


Keywords: apolipoprotein B; hypercholesterolaemia; low density lipoprotein receptor; mutation PMID:10882754

Associations between Vocal Symptoms and Genetic Variants in the Oxytocin Receptor and Arginine Vasopressin 1A Receptor Gene

ERIC Educational Resources Information Center

Jämsen, Sofia Holmqvist; Johansson, Ada; Westberg, Lars; Santtila, Pekka; von der Pahlen, Bettina; Simberg, Susanna

2017-01-01

Purpose: Oxytocin and arginine vasopressin are associated with different aspects of the stress response. As stress is regarded as a risk factor for vocal symptoms, we wanted to explore the association between the oxytocin receptor gene ("OXTR") and arginine vasopressin 1A receptor gene ("AVPR1A") single-nucleotide polymorphisms…

Glucocorticoid Receptor-Mediated Repression of Pro-Inflammatory Genes in Rheumatoid Arthritis

DTIC Science & Technology

2015-10-01

1 AWARD NUMBER: W81XWH-14-1-0314 TITLE: Glucocorticoid Receptor-Mediated Repression of Pro-Inflammatory Genes in Rheumatoid Arthritis ...19 Sep 2015 4. TITLE AND SUBTITLE Glucocorticoid Receptor-Mediated Repression of Pro- Inflammatory Genes in Rheumatoid Arthritis 5a. CONTRACT NUMBER...SUBJECT TERMS Rheumatoid arthritis , inflammation and autoimmunity, macrophages, glucocorticoid receptor, transcriptional regulation, coactivators and

Natural genomic amplification of cholinesterase genes in animals.

PubMed

Chatonnet, Arnaud; Lenfant, Nicolas; Marchot, Pascale; Selkirk, Murray E

2017-08-01

Tight control of the concentration of acetylcholine at cholinergic synapses requires precise regulation of the number and state of the acetylcholine receptors, and of the synthesis and degradation of the neurotransmitter. In particular, the cholinesterase activity has to be controlled exquisitely. In the genome of the first experimental models used (man, mouse, zebrafish and drosophila), there are only one or two genes coding for cholinesterases, whereas there are more genes for their closest relatives the carboxylesterases. Natural amplification of cholinesterase genes was first found to occur in some cancer cells and in insect species subjected to evolutionary pressure by insecticides. Analysis of the complete genome sequences of numerous representatives of the various metazoan phyla show that moderate amplification of cholinesterase genes is not uncommon in molluscs, echinoderms, hemichordates, prochordates or lepidosauria. Amplification of acetylcholinesterase genes is also a feature of parasitic nematodes or ticks. In these parasites, over-production of cholinesterase-like proteins in secreted products and the saliva are presumed to have effector roles related to host infection. These amplification events raise questions about the role of the amplified gene products, and the adaptation processes necessary to preserve efficient cholinergic transmission. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.

Histo-blood group carbohydrates as facilitators for infection by Helicobacter pylori.

PubMed

Brandão de Mattos, Cinara Cássia; de Mattos, Luiz Carlos

2017-09-01

Helicobacter pylori infect millions of people around the world. It occupies a niche in the human gastrointestinal tract characterized by high expression of a repertoire of carbohydrates. ABO and Lewis histo-blood group systems are controlled by genes coding for functional glycosyltransferases which synthesize great diversity of related fucosylated carbohydrate in different tissues, including gastrointestinal mucosa, and exocrine secretions. The structural diversity of histo-blood group carbohydrates is highly complex and depends on epistatic interactions among gene-encoding glycosyltransferases. The histo-blood group glycosyltransferases act in the glycosylation of proteins and lipids in the human gastrointestinal tract allowing the expression of a variety of potential receptors in which H. pylori can adhere. These oligosaccharide molecules are part of the gastrointestinal repertoire of carbohydrates which act as potential receptors for microorganisms, including H. pylori. This Gram-negative bacillus is one of the main causes of the gastrointestinal diseases such as chronic active gastritis, peptic ulcer, and cancer of stomach. Previous reports showed that some H. pylori strains use carbohydrates as receptors to adhere to the gastric and duodenal mucosa. Since some histo-blood group carbohydrates are highly expressed in one but not in others histo-blood group phenotypes it has pointed out that quantitative differences among them influence the susceptibility to diseases caused by H. pylori. Additionally, some experiments using animal model are helping us to understand how this bacillus explore histo-blood group carbohydrates as potential receptors, offering possibility to explore new strategies of management of infection, disease treatment, and prevention. This text highlights the importance of structural diversity of ABO and Lewis histo-blood group carbohydrates as facilitators for H. pylori infection. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Putative Chemosensory Receptor Genes from the Athetis dissimilis Antennal Transcriptome

PubMed Central

Dong, Junfeng; Song, Yueqin; Li, Wenliang; Shi, Jie; Wang, Zhenying

2016-01-01

Olfaction plays a crucial role in insect population survival and reproduction. Identification of the genes associated with the olfactory system, without the doubt will promote studying the insect chemical communication system. In this study, RNA-seq technology was used to sequence the antennae transcriptome of Athetis dissimilis, an emerging crop pest in China with limited genomic information, with the purpose of identifying the gene set involved in olfactory recognition. Analysis of the transcriptome of female and male antennae generated 13.74 Gb clean reads in total from which 98,001 unigenes were assembled, and 25,930 unigenes were annotated. Total of 60 olfactory receptors (ORs), 18 gustatory receptors (GRs), and 12 ionotropic receptors (IRs) were identified by Blast and sequence similarity analyzes. One obligated olfactory receptor co-receptor (Orco) and four conserved sex pheromone receptors (PRs) were annotated in 60 ORs. Among the putative GRs, five genes (AdisGR1, 6, 7, 8 and 94) clustered in the sugar receptor family, and two genes (AdisGR3 and 93) involved in CO2 detection were identified. Finally, AdisIR8a.1 and AdisIR8a.2 co-receptors were identified in the group of candidate IRs. Furthermore, expression levels of these chemosensory receptor genes in female and male antennae were analyzed by mapping the Illumina reads. PMID:26812239

Linkage disequilibria at the D[sub 2] dopamine receptor locus (DRD2) in alcoholics and controls

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suarez, B.K.; Parsian, A.; Hampe, C.L.

1994-01-01

Because of its central role in the neuromodulation of appetitive behaviors, the D[sub 2] dopamine receptor gene (DRD2) has received considerable scrutiny as a possible candidate that may affect susceptibility to addictive behaviors--especially alcoholism. Association studies that compare the frequencies of anonymous restriction fragment length polymorphisms (RFLPs) in alcoholics and controls have yielded equivocal results, suggesting that any role played by this receptor will account for only part of the variation. Since these RFLPs are not located in coding regions, the hypothesis has been advanced that the association seen in some studies results from linkage disequilibrium between these markers andmore » one or more functional DRD2 alleles that affect susceptibility. To test this hypothesis, the authors have assayed four DRD2 RFLPs that span coding regions as well as a 3[prime] flanking RFLP in an expanded sample of 88 unrelated Caucasian alcoholics and 89 unrelated race-matched controls. No significant difference for any RFLP frequency between these samples was observed, although for one marker (phD2-244), the alcoholic sample showed a significant departure from the Hardy-Weinberg equilibrium. The pattern of pairwise composite disequilibrium coefficients is broadly similar in the two samples, although when the five-marker haplotype frequencies are compared, a significant difference is revealed. This difference appears to be due to greater linkage disequilibrium of the control sample. These results do not support the involvement of the DRD2 region in the etiology of alcoholism. 64 refs., 2 figs., 6 tabs.« less

Sequence analysis and identification of new isoform of EP4 receptors in different atlantic salmon tissues (Salmo salar L.) and its role in PGE2 induced immunomodulation in vitro.

PubMed

Guo, Tz Chun; Gamil, Amr Ahmed Abdelrahim; Koenig, Melanie; Evensen, Øystein

2015-01-01

PGE2 plays an important role in a broad spectrum of physiological and pathological processes mediated through a membrane-bound G protein-coupled receptor (GPCR) called EP receptor. In mammals, four subtypes of EP receptor (EP 1-4) are identified and each of them functions through different signal transduction pathways. Orthologous EP receptors have also been identified in other non-mammalian species, such as chicken and zebrafish. EP4 is the only identified PGE2 receptor to date in Atlantic salmon but its tissue distribution and function have not been studied in any detail. In this study, we first sequenced EP4 receptor in different tissues and found that the presence of the 3nt deletion in the 5' untranslated region was accompanied by silent mutation at nt 668. While attempting to amplify the same sequence in TO cells (an Atlantic salmon macrophage-like cell line), we failed to obtain the full-length product. Further investigation revealed different isoform of EP4 receptor in TO cells and we subsequently documented its presence in different Atlantic salmon tissues. These two isoforms of EP4 receptor share high homology in their first half of sequence but differ in the second half part with several deletion segments though the final length of coding sequence is the same for two isoforms. We further studied the immunomodulation effect of PGE2 in TO cells and found that PGE2 inhibited the induction of CXCL-10, CCL-4, IL-8 and IL-1β genes expression in a time dependent manner and without cAMP upregulation.

Localization of the mRNA for the dopamine D sub 2 receptor in the rat brain by in situ hybridization histochemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mengod, G.; Martinez-Mir, M.I.; Vilaro, M.T.

1989-11-01

{sup 32}P-labeled oligonucleotides derived from the coding region of rat dopamine D{sub 2} receptor cDNA were used as probes to localize cells in the rat brain that contain the mRNA coding for this receptor by using in situ hybridization histochemistry. The highest level of hybridization was found in the intermediate lobe of the pituitary gland. High mRNA content was observed in the anterior lobe of the pituitary gland, the nuclei caudate-putamen and accumbens, and the olfactory tubercle. Lower levels were seen in the substantia nigra pars compacta and the ventral tegmental area, as well as in the lateral mammillary body.more » In these areas the distribution was comparable to that of the dopamine D{sub 2} receptor binding sites as visualized by autoradiography using ({sup 3}H)SDZ 205-502 as a ligand. However, in some areas such as the olfactory bulb, neocortex, hippocampus, superior colliculus, and cerebellum, D{sub 2} receptors have been visualized but no significant hybridization signal could be detected. The mRNA coding for these receptors in these areas could be contained in cells outside those brain regions, be different from the one recognized by our probes, or be present at levels below the detection limits of our procedure. The possibility of visualizing and quantifying the mRNA coding for dopamine D{sub 2} receptor at the microscopic level will yield more information about the in vivo regulation of the synthesis of these receptor and their alteration following selective lesions or drug treatments.« less

Characterization and distribution of natriuretic peptide receptors in the rat uterus.

PubMed

Dos Reis, A M; Fujio, N; Dam, T V; Mukaddam-Daher, S; Jankowski, M; Tremblay, J; Gutkowska, J

1995-10-01

Atrial natriuretic peptide (ANP) receptors were characterized in rat uterus. The binding of [125I]ANP to uterine membranes was completely competed for by increasing concentrations of unlabeled ANP (Kd = 0.39 nM) and brain natriuretic peptide (Kd = 1.24 nM) and partially by C-type natriuretic peptide (CNP; Kd = 80.4 nM), but not by C-ANF. Also, [125I]Tyr-CNP bound to uterine membranes was completely competed by unlabeled CNP (Kd = 1.12 nM). Cross-linking of [125I]ANP to uterine membranes revealed the presence of one band of 130 kilodaltons, corresponding to the guanylyl cyclase (GC-A and/or GC-B) subtypes of natriuretic peptide receptors. The presence of messenger RNA coding for genes of both GC-A and GC-B receptors was shown by quantitative reverse transcriptase polymerase chain reaction. Furthermore, ANP and, to a lesser degree, CNP stimulated the production of cGMP in rat uterus. Autoradiographic studies localized the highest binding of [125I]ANP in the endometrium, whereas [125I]Tyr-CNP binding was distributed in the endometrium as well as in the myometrium. These results demonstrate that rat uterine ANP receptors are of the guanylyl cyclase-coupled subtypes. The uterus is a target of natriuretic peptides where ANP induces its biological effects through the production of cGMP.

Distinct gene expression profiles characterize the histopathological stages of disease in Helicobacter-induced mucosa-associated lymphoid tissue lymphoma

PubMed Central

Mueller, Anne; O'Rourke, Jani; Grimm, Jan; Guillemin, Karen; Dixon, Michael F.; Lee, Adrian; Falkow, Stanley

2003-01-01

Long-term colonization of humans with Helicobacter pylori can cause the development of gastric B cell mucosa-associated lymphoid tissue lymphoma, yet little is known about the sequence of molecular steps that accompany disease progression. We used microarray analysis and laser microdissection to identify gene expression profiles characteristic and predictive of the various histopathological stages in a mouse model of the disease. The initial step in lymphoma development is marked by infiltration of reactive lymphocytes into the stomach and the launching of a mucosal immune response. Our analysis uncovered molecular markers of both of these processes, including genes coding for the immunoglobulins and the small proline-rich protein Sprr 2A. The subsequent step is characterized histologically by the antigen-driven proliferation and aggregation of B cells and the gradual appearance of lymphoepithelial lesions. In tissues of this stage, we observed increased expression of genes previously associated with malignancy, including the laminin receptor-1 and the multidrug-resistance channel MDR-1. Finally, we found that the transition to destructive lymphoepithelial lesions and malignant lymphoma is marked by an increase in transcription of a single gene encoding calgranulin A/Mrp-8. PMID:12552104

The Genetics of Pulmonary Arterial Hypertension

PubMed Central

Austin, Eric D.; Loyd, James E.

2014-01-01

Pulmonary arterial hypertension (PAH) is a progressive and fatal disease for which there is an ever-expanding body of genetic and related pathophysiological information on disease pathogenesis. A number of germline gene mutations have now been described, including mutations in the gene coding bone morphogenic protein receptor type 2 (BMPR2) and related genes. Recent advanced gene sequencing methods have facilitated the discovery of additional genes with mutations among those with and without familial forms of PAH (CAV1, KCNK3, EIF2AK4). The reduced penetrance, variable expressivity, and female predominance of PAH suggest that genetic, genomic and other factors modify disease expression. These multi-faceted variations are an active area of investigation in the field, including but not limited to common genetic variants and epigenetic processes, and may provide novel opportunities for pharmacologic intervention in the near future. They also highlight the need for a systems-oriented multi-level approach to incorporate the multitude of biologic variations now associated with PAH. Ultimately, improved understanding provides the opportunity for improved patient and family counseling about this devastating disease, but do require in depth understanding of the genetic factors relevant to PAH. PMID:24951767

The Activin A-Peroxisome Proliferator-Activated Receptor Gamma Axis Contributes to the Transcriptome of GM-CSF-Conditioned Human Macrophages.

PubMed

Nieto, Concha; Bragado, Rafael; Municio, Cristina; Sierra-Filardi, Elena; Alonso, Bárbara; Escribese, María M; Domínguez-Andrés, Jorge; Ardavín, Carlos; Castrillo, Antonio; Vega, Miguel A; Puig-Kröger, Amaya; Corbí, Angel L

2018-01-01

GM-CSF promotes the functional maturation of lung alveolar macrophages (A-MØ), whose differentiation is dependent on the peroxisome proliferator-activated receptor gamma (PPARγ) transcription factor. In fact, blockade of GM-CSF-initiated signaling or deletion of the PPARγ-encoding gene PPARG leads to functionally defective A-MØ and the onset of pulmonary alveolar proteinosis. In vitro , macrophages generated in the presence of GM-CSF display potent proinflammatory, immunogenic and tumor growth-limiting activities. Since GM-CSF upregulates PPARγ expression, we hypothesized that PPARγ might contribute to the gene signature and functional profile of human GM-CSF-conditioned macrophages. To verify this hypothesis, PPARγ expression and activity was assessed in human monocyte-derived macrophages generated in the presence of GM-CSF [proinflammatory GM-CSF-conditioned human monocyte-derived macrophages (GM-MØ)] or M-CSF (anti-inflammatory M-MØ), as well as in ex vivo isolated human A-MØ. GM-MØ showed higher PPARγ expression than M-MØ, and the expression of PPARγ in GM-MØ was found to largely depend on activin A. Ligand-induced activation of PPARγ also resulted in distinct transcriptional and functional outcomes in GM-MØ and M-MØ. Moreover, and in the absence of exogenous activating ligands, PPARγ knockdown significantly altered the GM-MØ transcriptome, causing a global upregulation of proinflammatory genes and significantly modulating the expression of genes involved in cell proliferation and migration. Similar effects were observed in ex vivo isolated human A-MØ, where PPARγ silencing led to enhanced expression of genes coding for growth factors and chemokines and downregulation of cell surface pathogen receptors. Therefore, PPARγ shapes the transcriptome of GM-CSF-dependent human macrophages ( in vitro derived GM-MØ and ex vivo isolated A-MØ) in the absence of exogenous activating ligands, and its expression is primarily regulated by activin A. These results suggest that activin A, through enhancement of PPARγ expression, help macrophages to switch from a proinflammatory to an anti-inflammatory polarization state, thus contributing to limit tissue damage and restore homeostasis.

Melatonin promotes Cashmere goat (Capra hircus) secondary hair follicle growth: A view from integrated analysis of long non-coding and coding RNAs.

PubMed

Ge, Wei; Wang, Shan-He; Sun, Bing; Zhang, Yue-Lang; Shen, Wei; Khatib, Hasan; Wang, Xin

2018-06-12

The role of melatonin in promoting the yield of Cashmere goat wool has been demonstrated for decades though there remains a lack of knowledge regarding melatonin mediated hair follicle growth. Recent studies have demonstrated that long non-coding RNAs (lncRNAs) are widely transcribed in the genome and play ubiquitous roles in regulating biological processes. However, the role of lncRNAs in regulating melatonin mediated hair follicle growth remains unclear. In this study, we established an in vitro Cashmere goat secondary hair follicle culture system, and demonstrated that 500 ng/L melatonin exposure promoted hair follicle fiber growth. Based on long intergenic RNA sequencing, we demonstrated that melatonin promoted hair follicle elongation via regulating genes involved in focal adhesion and extracellular matrix receptor pathways and further cis predicting of lncRNAs targeted genes indicated that melatonin mediated lncRNAs mainly targeted vascular smooth muscle contraction and signaling pathways regulating the pluripotency of stem cells. We proposed that melatonin exposure not only perturbed key signals secreted from hair follicle stem cells to regulate hair follicle development, but also mediated lncRNAs mainly targeted to pathways involved in the microvascular system and extracellular matrix, which constitute the highly orchestrated microenvironment for hair follicle stem cell. Taken together, our findings here provide a profound view of lncRNAs in regulating Cashmere goat hair follicle circadian rhythms and broaden our knowledge on melatonin mediated hair follicle morphological changes.

Gene Transfer and Molecular Cloning of the Human NGF Receptor

NASA Astrophysics Data System (ADS)

Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

1986-04-01

Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

Dog-Owner Attachment Is Associated With Oxytocin Receptor Gene Polymorphisms in Both Parties. A Comparative Study on Austrian and Hungarian Border Collies.

PubMed

Kovács, Krisztina; Virányi, Zsófia; Kis, Anna; Turcsán, Borbála; Hudecz, Ágnes; Marmota, Maria T; Koller, Dóra; Rónai, Zsolt; Gácsi, Márta; Topál, József

2018-01-01

Variations in human infants' attachment behavior are associated with single nucleotide polymorphisms (SNPs) in the oxytocin receptor (OXTR) gene, suggesting a genetic component to infant-mother attachment. However, due to the genetic relatedness of infants and their mothers, it is difficult to separate the genetic effects of infants' OXTR genotype from the environmental effects of mothers' genotype possibly affecting their parental behavior. The apparent functional analogy between child-parent and dog-owner relationship, however, offers a way to disentangle the effects of these factors because pet dogs are not genetically related to their caregivers. In the present study we investigated whether single nucleotide polymorphisms of pet dogs' OXTR gene (-213AG,-94TC,-74CG) and their owners' OXTR gene (rs53576, rs1042778, rs2254298) are associated with components of dog-owner attachment. In order to investigate whether social-environmental effects modulate the potential genetic influence on attachment, dogs and their owners from two different countries (Austria and Hungary, N = 135 in total) were tested in a modified version of the Ainsworth Strange Situation Test (SST) and questionnaires were also used to collect information about owner personality and attachment style. We coded variables related to three components of attachment behavior in dogs: their sensitivity to the separation from and interaction with the owner (Attachment), stress caused by the unfamiliar environment (Anxiety), and their responsiveness to the stranger (Acceptance). We found that (1) dogs' behavior was significantly associated with polymorphisms in both dogs' and owners' OXTR gene, (2) SNPs in dogs' and owners' OXTR gene interactively influenced dog-human relationship, (3) dogs' attachment behavior was affected by the country of origin, and (4) it was related to their owners' personality as well as attachment style. Thus, the present study provides evidence, for the first time, that both genetic variation in the OXTR gene and various aspects of pet dogs' environmental background are associated with their attachment to their human caregivers.

Mutation spectrum of the FZD-4, TSPAN12 AND ZNF408 genes in Indian FEVR patients.

PubMed

Musada, Ganeswara Rao; Syed, Hameed; Jalali, Subhadra; Chakrabarti, Subhabrata; Kaur, Inderjeet

2016-06-17

Mutations in candidate genes that encode for a ligand (NDP) and receptor complex (FZD4, LRP5 and TSPAN12) in the Norrin β-catenin signaling pathway are involved in the pathogenesis of familial exudative vitreoretinopathy (FEVR, MIM # 133780). Recently, a transcription factor (ZNF408) has also been implicated in FEVR. We had earlier characterized the variations in NDP among FEVR patients from India. The present study aimed at understanding the involvement of the remaining genes (FZD4, TSPAN12 and ZNF408) in the same cohort. The DNA of 110 unrelated FEVR patients and 115 unaffected controls were screened for variations in the entire coding and untranslated regions of these 3 genes by resequencing. Segregation of the disease-associated variants was assessed in the family members of the probands. The effect of the observed missense changes were further analyzed by SIFT and PolyPhen-2 scores. The screening of FZD4, TSPAN12 and ZNF408 genes identified 11 different mutations in 15/110 FEVR probands. Of the 11 identified mutations, 6 mutations were novel. The detected missense mutations were mainly located in the domains which are functionally crucial for the formation of ligand-receptor complex and as they replaced evolutionarily highly conserved amino acids with a SIFT score < 0.005, they are predicted to be pathogenic. Additionally 2 novel and 16 reported single nucleotide polymorphisms (SNP) were also detected. Our genetic screening revealed varying mutation frequencies in the FZD4 (8.0 %), TSPAN12 (5.4 %) and ZNF408 (2.7 %) genes among the FEVR patients, indicating their potential role in the disease pathogenesis. The observed mutations segregated with the disease phenotype and exhibited variable expressivity. The mutations in FZD4 and TSPAN12 were involved in autosomal dominant and autosomal recessive families and further validates the involvement of these gene in FEVR development.

Comprehensive Analysis of Mouse Bitter Taste Receptors Reveals Different Molecular Receptive Ranges for Orthologous Receptors in Mice and Humans.

PubMed

Lossow, Kristina; Hübner, Sandra; Roudnitzky, Natacha; Slack, Jay P; Pollastro, Federica; Behrens, Maik; Meyerhof, Wolfgang

2016-07-15

One key to animal survival is the detection and avoidance of potentially harmful compounds by their bitter taste. Variable numbers of taste 2 receptor genes expressed in the gustatory end organs enable bony vertebrates (Euteleostomi) to recognize numerous bitter chemicals. It is believed that the receptive ranges of bitter taste receptor repertoires match the profiles of bitter chemicals that the species encounter in their diets. Human and mouse genomes contain pairs of orthologous bitter receptor genes that have been conserved throughout evolution. Moreover, expansions in both lineages generated species-specific sets of bitter taste receptor genes. It is assumed that the orthologous bitter taste receptor genes mediate the recognition of bitter toxins relevant for both species, whereas the lineage-specific receptors enable the detection of substances differently encountered by mice and humans. By challenging 34 mouse bitter taste receptors with 128 prototypical bitter substances in a heterologous expression system, we identified cognate compounds for 21 receptors, 19 of which were previously orphan receptors. We have demonstrated that mouse taste 2 receptors, like their human counterparts, vary greatly in their breadth of tuning, ranging from very broadly to extremely narrowly tuned receptors. However, when compared with humans, mice possess fewer broadly tuned receptors and an elevated number of narrowly tuned receptors, supporting the idea that a large receptor repertoire is the basis for the evolution of specialized receptors. Moreover, we have demonstrated that sequence-orthologous bitter taste receptors have distinct agonist profiles. Species-specific gene expansions have enabled further diversification of bitter substance recognition spectra. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Expression changes of serotonin receptor gene subtype 5HT3a in peripheral blood mononuclear cells from schizophrenic patients treated with haloperidol and Olanzapin.

PubMed

Shariati, Gholam Reza; Ahangari, Ghasem; Hossein-nezhad, Arash; Asadi, Seyed Mohammad; Pooyafard, Farzaneh; Ahmadkhaniha, Hamid Reza

2009-09-01

Serotonin receptors are involved in pathophysiology of schizophrenia and may mediate other neurotransmitter effects. We investigated serotonin receptors gene expression in peripheral blood mononuclear cells (PBMC) of naïve schizophrenic patients, before and after treatment. Also serotonin receptor gene expression was compared in two treatment groups including Haloperidol and Olanzapine. The PBMC was separated from whole blood by Ficoll-hypaque. The total cellular RNA was extracted and the cDNA was synthesized. This process was followed by real-time PCR using primer pairs specific for 5HT(3a) serotonin receptor mRNA and beta-actin as internal control. The results showed the presence of subtype of serotonin receptor in lymphocytes. Serotonin gene expression showed significant changes in Olanzapine treatment group which correlated with Clinical Global Impression (CGI) score improvement. In conclusion, the present study has shown that human PBMC express serotonin receptors 5HT(3a). Moreover, clinical symptom improvement of Olanzapin may be demonstrated by a change in serotonin receptor gene expression.

The Mechanism of Functional Up-Regulation of P2X3 Receptors of Trigeminal Sensory Neurons in a Genetic Mouse Model of Familial Hemiplegic Migraine Type 1 (FHM-1)

PubMed Central

Hullugundi, Swathi K.; Ferrari, Michel D.; van den Maagdenberg, Arn M. J. M.; Nistri, Andrea

2013-01-01

A knock-in (KI) mouse model of FHM-1 expressing the R192Q missense mutation of the Cacna1a gene coding for the α1 subunit of CaV2.1 channels shows, at the level of the trigeminal ganglion, selective functional up-regulation of ATP -gated P2X3 receptors of sensory neurons that convey nociceptive signals to the brainstem. Why P2X3 receptors are constitutively more responsive, however, remains unclear as their membrane expression and TRPV1 nociceptor activity are the same as in wildtype (WT) neurons. Using primary cultures of WT or KI trigeminal ganglia, we investigated whether soluble compounds that may contribute to initiating (or maintaining) migraine attacks, such as TNFα, CGRP, and BDNF, might be responsible for increasing P2X3 receptor responses. Exogenous application of TNFα potentiated P2X3 receptor-mediated currents of WT but not of KI neurons, most of which expressed both the P2X3 receptor and the TNFα receptor TNFR2. However, sustained TNFα neutralization failed to change WT or KI P2X3 receptor currents. This suggests that endogenous TNFα does not regulate P2X3 receptor responses. Nonetheless, on cultures made from both genotypes, exogenous TNFα enhanced TRPV1 receptor-mediated currents expressed by a few neurons, suggesting transient amplification of TRPV1 nociceptor responses. CGRP increased P2X3 receptor currents only in WT cultures, although prolonged CGRP receptor antagonism or BDNF neutralization reduced KI currents to WT levels. Our data suggest that, in KI trigeminal ganglion cultures, constitutive up-regulation of P2X3 receptors probably is already maximal and is apparently contributed by basal CGRP and BDNF levels, thereby rendering these neurons more responsive to extracellular ATP. PMID:23577145

Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.

PubMed

Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F

1995-12-01

Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.

Kappa2 opioid receptor subtype binding requires the presence of the DOR-1 gene.

PubMed

Ansonoff, Michael A; Wen, Ting; Pintar, John E

2010-01-01

Over the past several years substantial evidence has documented that opioid receptor homo- and heterodimers form in cell lines expressing one or more of the opioid receptors. We used opioid receptor knockout mice to determine whether in vivo pharmacological characteristics of kappa1 and kappa2 opioid receptors changed following knockout of specific opioid receptors. Using displacement of the general opioid ligand diprenorphine, we observed that occupancy or knockout of the DOR-1 gene increases the binding density of kappa1 receptors and eliminates kappa2 receptors in crude membrane preparations while the total density of kappa opioid binding sites is unchanged. Further, the analgesic potency of U69,593 in cumulative dose response curves is enhanced in mice lacking the DOR-1 gene. These results demonstrate that the DOR-1 gene is required for the expression of the kappa2 opioid receptor subtype and are consistent with the possibility that a KOR-1/DOR-1 heterodimer mediates kappa2 pharmacology.

Identification of single nucleotide polymorphisms in the agouti signaling protein (ASIP) gene in some goat breeds in tropical and temperate climates.

PubMed

Adefenwa, Mufliat A; Peters, Sunday O; Agaviezor, Brilliant O; Wheto, Matthew; Adekoya, Khalid O; Okpeku, Moses; Oboh, Bola; Williams, Gabriel O; Adebambo, Olufunmilayo A; Singh, Mahipal; Thomas, Bolaji; De Donato, Marcos; Imumorin, Ikhide G

2013-07-01

The agouti-signaling protein (ASIP) plays a major role in mammalian pigmentation as an antagonist to melanocortin-1 receptor gene to stimulate pheomelanin synthesis, a major pigment conferring mammalian coat color. We sequenced a 352 bp fragment of ASIP gene spanning part of exon 2 and part of intron 2 in 215 animals representing six goat breeds from Nigeria and the United States: West African Dwarf, predominantly black; Red Sokoto, mostly red; and Sahel, mostly white from Nigeria; black and white Alpine, brown and white Spanish and white Saanen from the US. Twenty haplotypes from nine mutations representing three intronic, one silent and five missense (p.S19R, p.N35K, p.L36V, p.M42L and p.L45W) mutations were identified in Nigerian goats. Approximately 89 % of Nigerian goats carry haplotype 1 (TGCCATCCG) which seems to be the wild type configuration of mutations in this region of the gene. Although we found no association between these polymorphisms in the ASIP gene and coat color in Nigerian goats, in-silico functional analysis predicts putative deleterious functional impact of the p.L45W mutation on the basic amino-terminal domain of ASIP. In the American goats, two intronic mutations, g.293G>A and g.327C>A, were identified in the Alpine breed, although the g.293G>A mutation is common to American and Nigerian goat populations. All Sannen and Sahel goats in this study belong to haplotypes 1 of both populations which seem to be the wild-type composite ASIP haplotype. Overall, there was no clear association of this portion of the ASIP gene interrogated in this study with coat color variation. Therefore, additional genomic analyses of promoter sequence, the entire coding and non-coding regions of the ASIP gene will be required to obtain a definite conclusion.

Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study.

PubMed

Cribbs, David H; Berchtold, Nicole C; Perreau, Victoria; Coleman, Paul D; Rogers, Joseph; Tenner, Andrea J; Cotman, Carl W

2012-07-23

This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer's disease (AD). In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I and II. Unexpectedly, the extent of innate immune gene upregulation in AD was modest relative to the robust response apparent in the aged brain, consistent with the emerging idea of a critical involvement of inflammation in the earliest stages, perhaps even in the preclinical stage, of AD. Ultimately, our data suggest that an important strategy to maintain cognitive health and resilience involves reducing chronic innate immune activation that should be initiated in late midlife.

Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

PubMed Central

2012-01-01

Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I and II. Conclusions Unexpectedly, the extent of innate immune gene upregulation in AD was modest relative to the robust response apparent in the aged brain, consistent with the emerging idea of a critical involvement of inflammation in the earliest stages, perhaps even in the preclinical stage, of AD. Ultimately, our data suggest that an important strategy to maintain cognitive health and resilience involves reducing chronic innate immune activation that should be initiated in late midlife. PMID:22824372

Transmission disequilibrium testing of arginine vasopressin receptor 1A (AVPR1A) polymorphisms in autism.

PubMed

Kim, S-J; Young, L J; Gonen, D; Veenstra-VanderWeele, J; Courchesne, R; Courchesne, E; Lord, C; Leventhal, B L; Cook, E H; Insel, T R

2002-01-01

Impairment in social reciprocity is a central component of autism. In preclinical studies, arginine vasopressin (AVP) has been shown to increase a range of social behaviors, including affiliation and attachment, via the V(1a) receptor (AVPR1A) in the brain. Both the behavioral effects of AVP and the neural distribution of the V1a receptor vary greatly across mammalian species. This difference in regional receptor expression as well as differences in social behavior may result from a highly variable repetitive sequence in the 5' flanking region of the V1a gene (AVPR1A). Given this comparative evidence for a role in inter-species variation in social behavior, we explored whether within our own species, variation in the human AVPR1A may contribute to individual variations in social behavior, with autism representing an extreme form of social impairment. We genotyped two microsatellite polymorphisms from the 5' flanking region of AVPR1A for 115 autism trios and found nominally significant transmission disequilibrium between autism and one of the microsatellite markers by Multiallelic Transmission/Disequilibrium test (MTDT) that was not significant after Bonferroni correction. We also screened approximately 2 kb of the 5' flanking region and the coding region and identified 10 single nucleotide polymorphisms.

Adoptive immunotherapy for hematological malignancies: Current status and new insights in chimeric antigen receptor T cells.

PubMed

Allegra, Alessandro; Innao, Vanessa; Gerace, Demetrio; Vaddinelli, Doriana; Musolino, Caterina

2016-11-01

Hematological malignancies frequently express cancer-associated antigens that are shared with normal cells. Such tumor cells elude the host immune system because several T cells targeted against self-antigens are removed during thymic development, and those that persist are eliminated by a regulatory population of T cells. Chimeric antigen receptor-modified T cells (CAR-Ts) have emerged as a novel modality for tumor immunotherapy due to their powerful efficacy against tumor cells. These cells are created by transducing genes-coding fusion proteins of tumor antigen-recognition single-chain Fv connected to the intracellular signaling domains of T cell receptors, and are classed as first-, second- and third-generation, differing on the intracellular signaling domain number of T cell receptors. CAR-T treatment has emerged as a promising approach for patients with hematological malignancies, and there are several works reporting clinical trials of the use of CAR-modified T-cells in acute lymphoblastic leukemia, chronic lymphoblastic leukemia, multiple myeloma, lymphoma, and in acute myeloid leukemia by targeting different antigens. This review reports the history of adoptive immunotherapy using CAR-Ts, the CAR-T manufacturing process, and T cell therapies in development for hematological malignancies. Copyright © 2016 Elsevier Inc. All rights reserved.

Evolutionary dynamics of olfactory and other chemosensory receptor genes in vertebrates

PubMed Central

Niimura, Yoshihito

2007-01-01

The numbers of functional olfactory receptor (OR) genes in humans and mice are about 400 and 1,000 respectively. In both humans and mice, these genes exist as genomic clusters and are scattered over almost all chromosomes. The difference in the number of genes between the two species is apparently caused by massive inactivation of OR genes in the human lineage and a substantial increase of OR genes in the mouse lineage after the human–mouse divergence. Compared with mammals, fishes have a much smaller number of OR genes. However, the OR gene family in fishes is much more divergent than that in mammals. Fishes have many different groups of genes that are absent in mammals, suggesting that the mammalian OR gene family is characterized by the loss of many group genes that existed in the ancestor of vertebrates and the subsequent expansion of specific groups of genes. Therefore, this gene family apparently changed dynamically depending on the evolutionary lineage and evolved under the birth-and-death model of evolution. Study of the evolutionary changes of two gene families for vomeronasal receptors and two gene families for taste receptors, which are structurally similar, but remotely related to OR genes, showed that some of the gene families evolved in the same fashion as the OR gene family. It appears that the number and types of genes in chemosensory receptor gene families have evolved in response to environmental needs, but they are also affected by fortuitous factors. PMID:16607462

A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization.

PubMed Central

Duquesnoy, P; Sobrier, M L; Duriez, B; Dastot, F; Buchanan, C R; Savage, M O; Preece, M A; Craescu, C T; Blouquit, Y; Goossens, M

1994-01-01

Growth hormone (GH) elicits a variety of biological activities mainly mediated by the GH receptor (GHR), a transmembrane protein that, based on in vitro studies, seemed to function as a homodimer. To test this hypothesis directly, we investigated patients displaying the classic features of Laron syndrome (familial GH resistance characterized by severe dwarfism and metabolic dysfunction), except for the presence of normal binding activity of the plasma GH-binding protein, a molecule that derives from the exoplasmic-coding domain of the GHR gene. In two unrelated families, the same GHR mutation was identified, resulting in the substitution of a highly conserved aspartate residue by histidine at position 152 (D152H) of the exoplasmic domain, within the postulated interface sequence involved in homodimerization. The recombinant mutated receptor protein was correctly expressed at the plasma membrane. It displayed subnormal GH-binding activity, a finding in agreement with the X-ray crystal structure data inferring this aspartate residue outside the GH-binding domain. However, mAb-based studies suggested the critical role of aspartate 152 in the proper folding of the interface area. We show that a recombinant soluble form of the mutant receptor is unable to dimerize, the D152H substitution also preventing the formation of heterodimers of wild-type and mutant molecules. These results provide in vivo evidence that monomeric receptors are inactive and that receptor dimerization is involved in the primary signalling of the GH-associated growth-promoting and metabolic actions. Images PMID:8137822

A single amino acid substitution in the exoplasmic domain of the human growth hormone (GH) receptor confers familial GH resistance (Laron syndrome) with positive GH-binding activity by abolishing receptor homodimerization.

PubMed

Duquesnoy, P; Sobrier, M L; Duriez, B; Dastot, F; Buchanan, C R; Savage, M O; Preece, M A; Craescu, C T; Blouquit, Y; Goossens, M

1994-03-15

Growth hormone (GH) elicits a variety of biological activities mainly mediated by the GH receptor (GHR), a transmembrane protein that, based on in vitro studies, seemed to function as a homodimer. To test this hypothesis directly, we investigated patients displaying the classic features of Laron syndrome (familial GH resistance characterized by severe dwarfism and metabolic dysfunction), except for the presence of normal binding activity of the plasma GH-binding protein, a molecule that derives from the exoplasmic-coding domain of the GHR gene. In two unrelated families, the same GHR mutation was identified, resulting in the substitution of a highly conserved aspartate residue by histidine at position 152 (D152H) of the exoplasmic domain, within the postulated interface sequence involved in homodimerization. The recombinant mutated receptor protein was correctly expressed at the plasma membrane. It displayed subnormal GH-binding activity, a finding in agreement with the X-ray crystal structure data inferring this aspartate residue outside the GH-binding domain. However, mAb-based studies suggested the critical role of aspartate 152 in the proper folding of the interface area. We show that a recombinant soluble form of the mutant receptor is unable to dimerize, the D152H substitution also preventing the formation of heterodimers of wild-type and mutant molecules. These results provide in vivo evidence that monomeric receptors are inactive and that receptor dimerization is involved in the primary signalling of the GH-associated growth-promoting and metabolic actions.

Targeted Deep Resequencing Identifies Coding Variants in the PEAR1 Gene That Play a Role in Platelet Aggregation

PubMed Central

Kim, Yoonhee; Suktitipat, Bhoom; Yanek, Lisa R.; Faraday, Nauder; Wilson, Alexander F.; Becker, Diane M.; Becker, Lewis C.; Mathias, Rasika A.

2013-01-01

Platelet aggregation is heritable, and genome-wide association studies have detected strong associations with a common intronic variant of the platelet endothelial aggregation receptor1 (PEAR1) gene both in African American and European American individuals. In this study, we used a sequencing approach to identify additional exonic variants in PEAR1 that may also determine variability in platelet aggregation in the GeneSTAR Study. A 0.3 Mb targeted region on chromosome 1q23.1 including the entire PEAR1 gene was Sanger sequenced in 104 subjects (45% male, 49% African American, age = 52±13) selected on the basis of hyper- and hypo- aggregation across three different agonists (collagen, epinephrine, and adenosine diphosphate). Single-variant and multi-variant burden tests for association were performed. Of the 235 variants identified through sequencing, 61 were novel, and three of these were missense variants. More rare variants (MAF<5%) were noted in African Americans compared to European Americans (108 vs. 45). The common intronic GWAS-identified variant (rs12041331) demonstrated the most significant association signal in African Americans (p = 4.020×10−4); no association was seen for additional exonic variants in this group. In contrast, multi-variant burden tests indicated that exonic variants play a more significant role in European Americans (p = 0.0099 for the collective coding variants compared to p = 0.0565 for intronic variant rs12041331). Imputation of the individual exonic variants in the rest of the GeneSTAR European American cohort (N = 1,965) supports the results noted in the sequenced discovery sample: p = 3.56×10−4, 2.27×10−7, 5.20×10−5 for coding synonymous variant rs56260937 and collagen, epinephrine and adenosine diphosphate induced platelet aggregation, respectively. Sequencing approaches confirm that a common intronic variant has the strongest association with platelet aggregation in African Americans, and show that exonic variants play an additional role in platelet aggregation in European Americans. PMID:23704978

Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes.

PubMed

Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

2017-10-03

Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.

Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes

PubMed Central

Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

2017-01-01

Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes. PMID:29108274

Voltage-gated sodium channels in taste bud cells.

PubMed

Gao, Na; Lu, Min; Echeverri, Fernando; Laita, Bianca; Kalabat, Dalia; Williams, Mark E; Hevezi, Peter; Zlotnik, Albert; Moyer, Bryan D

2009-03-12

Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

75 FR 66104 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-27

... receptor gene exhibit impaired growth and resistance to thyroid hormone. Proc Natl Acad Sci U S A. 2000 Nov... overactivated. These mice have a knock-in dominantly negative mutant thyroid hormone receptor [beta] gene (TR... mutation in the thyroid hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse model...

Positive association between a DNA sequence variant in the serotonin 2A receptor gene and schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inayama, Y.; Yoneda, H.; Sakai, T.

Sixty-two patients with schizophrenia and 96 normal controls were investigated for genetic association with restriction fragment length polymorphisms (RFLPs) in the serotonin receptor genes. A positive association between the serotonin 2A receptor gene (HTR2A) and schizophrenia was found, but not between schizophrenia and the serotonin 1A receptor gene. The positive association we report here would suggest that the DNA region with susceptibility to schizophrenia lies in the HTR2A on the long arm of chromosome 13. 15 refs., 2 tabs.

A subset of conserved mammalian long non-coding RNAs are fossils of ancestral protein-coding genes.

PubMed

Hezroni, Hadas; Ben-Tov Perry, Rotem; Meir, Zohar; Housman, Gali; Lubelsky, Yoav; Ulitsky, Igor

2017-08-30

Only a small portion of human long non-coding RNAs (lncRNAs) appear to be conserved outside of mammals, but the events underlying the birth of new lncRNAs in mammals remain largely unknown. One potential source is remnants of protein-coding genes that transitioned into lncRNAs. We systematically compare lncRNA and protein-coding loci across vertebrates, and estimate that up to 5% of conserved mammalian lncRNAs are derived from lost protein-coding genes. These lncRNAs have specific characteristics, such as broader expression domains, that set them apart from other lncRNAs. Fourteen lncRNAs have sequence similarity with the loci of the contemporary homologs of the lost protein-coding genes. We propose that selection acting on enhancer sequences is mostly responsible for retention of these regions. As an example of an RNA element from a protein-coding ancestor that was retained in the lncRNA, we describe in detail a short translated ORF in the JPX lncRNA that was derived from an upstream ORF in a protein-coding gene and retains some of its functionality. We estimate that ~ 55 annotated conserved human lncRNAs are derived from parts of ancestral protein-coding genes, and loss of coding potential is thus a non-negligible source of new lncRNAs. Some lncRNAs inherited regulatory elements influencing transcription and translation from their protein-coding ancestors and those elements can influence the expression breadth and functionality of these lncRNAs.

Interaction between Calpain 5, Peroxisome proliferator-activated receptor-gamma and Peroxisome proliferator-activated receptor-delta genes: a polygenic approach to obesity

PubMed Central

Sáez, María E; Grilo, Antonio; Morón, Francisco J; Manzano, Luis; Martínez-Larrad, María T; González-Pérez, Antonio; Serrano-Hernando, Javier; Ruiz, Agustín; Ramírez-Lorca, Reposo; Serrano-Ríos, Manuel

2008-01-01

Context Obesity is a multifactorial disorder, that is, a disease determined by the combined effect of genes and environment. In this context, polygenic approaches are needed. Objective To investigate the possibility of the existence of a crosstalk between the CALPAIN 10 homologue CALPAIN 5 and nuclear receptors of the peroxisome proliferator-activated receptors family. Design Cross-sectional, genetic association study and gene-gene interaction analysis. Subjects The study sample comprise 1953 individuals, 725 obese (defined as body mass index ≥ 30) and 1228 non obese subjects. Results In the monogenic analysis, only the peroxisome proliferator-activated receptor delta (PPARD) gene was associated with obesity (OR = 1.43 [1.04–1.97], p = 0.027). In addition, we have found a significant interaction between CAPN5 and PPARD genes (p = 0.038) that reduces the risk for obesity in a 55%. Conclusion Our results suggest that CAPN5 and PPARD gene products may also interact in vivo. PMID:18657264

Arabidopsis ETR1 and ERS1 Differentially Repress the Ethylene Response in Combination with Other Ethylene Receptor Genes1[W

PubMed Central

Liu, Qian; Wen, Chi-Kuang

2012-01-01

The ethylene response is negatively regulated by a family of five ethylene receptor genes in Arabidopsis (Arabidopsis thaliana). The five members of the ethylene receptor family can physically interact and form complexes, which implies that cooperativity for signaling may exist among the receptors. The ethylene receptor gene mutations etr1-1(C65Y)(for ethylene response1-1), ers1-1(I62P) (for ethylene response sensor1-1), and ers1C65Y are dominant, and each confers ethylene insensitivity. In this study, the repression of the ethylene response by these dominant mutant receptor genes was examined in receptor-defective mutants to investigate the functional significance of receptor cooperativity in ethylene signaling. We showed that etr1-1(C65Y), but not ers1-1(I62P), substantially repressed various ethylene responses independent of other receptor genes. In contrast, wild-type receptor genes differentially supported the repression of ethylene responses by ers1-1(I62P); ETR1 and ETHYLENE INSENSITIVE4 (EIN4) supported ers1-1(I62P) functions to a greater extent than did ERS2, ETR2, and ERS1. The lack of both ETR1 and EIN4 almost abolished the repression of ethylene responses by ers1C65Y, which implied that ETR1 and EIN4 have synergistic effects on ers1C65Y functions. Our data indicated that a dominant ethylene-insensitive receptor differentially repressed ethylene responses when coupled with a wild-type ethylene receptor, which supported the hypothesis that the formation of a variety of receptor complexes may facilitate differential receptor signal output, by which ethylene responses can be repressed to different extents. We hypothesize that plants can respond to a broad ethylene concentration range and exhibit tissue-specific ethylene responsiveness with differential cooperation of the multiple ethylene receptors. PMID:22227969

A substitutional mutation in the DNA binding domain of the androgen receptor causes complete androgen insensitivity syndrome.

PubMed

Komori, S; Sakata, K; Kasumi, H; Tsuji, Y; Hamada, K; Koyama, K

1999-10-01

DNA analysis of the androgen receptor gene in a patient with complete androgen insensitivity syndrome identified a substitutional mutation (tyrosine converted to cysteine at position 571) in the DNA binding domain. In vitro transfection experiments with the patients' androgen receptor gene, indicated normal expression of the androgen receptor in transfected COS-7 cells compared to the wild type gene. There was also no evidence of impaired thermal stability of the 5 alpha-dihydrotestosterone-androgen receptor complex. However, the capacity of the androgen receptor to activate target gene transcription was found to be completely disrupted in a luciferase assay. These results confirmed that only one substitutional mutation in the DNA binding domain was related to the pathogenesis of the complete androgen insensitivity syndrome.

MAVS is not a Likely Susceptibility Locus for Addison's Disease and Type 1 Diabetes.

PubMed

Zurawek, Magdalena; Fichna, Marta; Kazimierska, Marta; Fichna, Piotr; Dzikiewicz-Krawczyk, Agnieszka; Przybylski, Grzegorz; Ruchala, Marek; Nowak, Jerzy

2017-06-01

Mitochondrial antiviral signaling (MAVS) protein is an intracellular adaptor molecule, downstream of viral sensors, retinoid acid-inducible gene I (RIG-I)-like receptors (RLRs). Impaired antiviral cell signaling might contribute to autoimmunity. Studies have recently shown variations in genes encoding RLRs as risk factors for autoimmune diseases. We investigated whether MAVS coding polymorphisms are associated with Addison's disease (AD) and type 1 diabetes (T1D) in Polish population. We genotyped 140 AD, 532 T1D patients and 600 healthy controls for MAVS rs17857295, rs7262903, rs45437096 and rs7269320. Genotyping was performed by TaqMan assays. Distribution of the MAVS genotypes and alleles did not reveal significant differences between patients and controls (p > 0.05). This analysis did not indicate the association of the MAVS locus with susceptibility to AD and T1D.

Genome-wide transcriptional profiling of human glioblastoma cells in response to ITE treatment.

PubMed

Kang, Bo; Zhou, Yanwen; Zheng, Min; Wang, Ying-Jie

2015-09-01

A ligand-activated transcription factor aryl hydrocarbon receptor (AhR) is recently revealed to play a key role in embryogenesis and tumorigenesis (Feng et al. [1], Safe et al. [2]) and 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) (Song et al. [3]) is an endogenous AhR ligand that possesses anti-tumor activity. In order to gain insights into how ITE acts via the AhR in embryogenesis and tumorigenesis, we analyzed the genome-wide transcriptional profiles of the following three groups of cells: the human glioblastoma U87 parental cells, U87 tumor sphere cells treated with vehicle (DMSO) and U87 tumor sphere cells treated with ITE. Here, we provide the details of the sample gathering strategy and show the quality controls and the analyses associated with our gene array data deposited into the Gene Expression Omnibus (GEO) under the accession code of GSE67986.

Widespread seasonal gene expression reveals annual differences in human immunity and physiology

PubMed Central

Dopico, Xaquin Castro; Evangelou, Marina; Ferreira, Ricardo C.; Guo, Hui; Pekalski, Marcin L.; Smyth, Deborah J.; Cooper, Nicholas; Burren, Oliver S.; Fulford, Anthony J.; Hennig, Branwen J.; Prentice, Andrew M.; Ziegler, Anette-G.; Bonifacio, Ezio; Wallace, Chris; Todd, John A.

2015-01-01

Seasonal variations are rarely considered a contributing component to human tissue function or health, although many diseases and physiological process display annual periodicities. Here we find more than 4,000 protein-coding mRNAs in white blood cells and adipose tissue to have seasonal expression profiles, with inverted patterns observed between Europe and Oceania. We also find the cellular composition of blood to vary by season, and these changes, which differ between the United Kingdom and The Gambia, could explain the gene expression periodicity. With regards to tissue function, the immune system has a profound pro-inflammatory transcriptomic profile during European winter, with increased levels of soluble IL-6 receptor and C-reactive protein, risk biomarkers for cardiovascular, psychiatric and autoimmune diseases that have peak incidences in winter. Circannual rhythms thus require further exploration as contributors to various aspects of human physiology and disease. PMID:25965853

A Comprehensive Pan-Cancer Molecular Study of Gynecologic and Breast Cancers.

PubMed

Berger, Ashton C; Korkut, Anil; Kanchi, Rupa S; Hegde, Apurva M; Lenoir, Walter; Liu, Wenbin; Liu, Yuexin; Fan, Huihui; Shen, Hui; Ravikumar, Visweswaran; Rao, Arvind; Schultz, Andre; Li, Xubin; Sumazin, Pavel; Williams, Cecilia; Mestdagh, Pieter; Gunaratne, Preethi H; Yau, Christina; Bowlby, Reanne; Robertson, A Gordon; Tiezzi, Daniel G; Wang, Chen; Cherniack, Andrew D; Godwin, Andrew K; Kuderer, Nicole M; Rader, Janet S; Zuna, Rosemary E; Sood, Anil K; Lazar, Alexander J; Ojesina, Akinyemi I; Adebamowo, Clement; Adebamowo, Sally N; Baggerly, Keith A; Chen, Ting-Wen; Chiu, Hua-Sheng; Lefever, Steve; Liu, Liang; MacKenzie, Karen; Orsulic, Sandra; Roszik, Jason; Shelley, Carl Simon; Song, Qianqian; Vellano, Christopher P; Wentzensen, Nicolas; Weinstein, John N; Mills, Gordon B; Levine, Douglas A; Akbani, Rehan

2018-04-09

We analyzed molecular data on 2,579 tumors from The Cancer Genome Atlas (TCGA) of four gynecological types plus breast. Our aims were to identify shared and unique molecular features, clinically significant subtypes, and potential therapeutic targets. We found 61 somatic copy-number alterations (SCNAs) and 46 significantly mutated genes (SMGs). Eleven SCNAs and 11 SMGs had not been identified in previous TCGA studies of the individual tumor types. We found functionally significant estrogen receptor-regulated long non-coding RNAs (lncRNAs) and gene/lncRNA interaction networks. Pathway analysis identified subtypes with high leukocyte infiltration, raising potential implications for immunotherapy. Using 16 key molecular features, we identified five prognostic subtypes and developed a decision tree that classified patients into the subtypes based on just six features that are assessable in clinical laboratories. Copyright © 2018 Elsevier Inc. All rights reserved.

TREM2 p.H157Y Variant and the Risk of Alzheimer's Disease: A Meta-Analysis Involving 14,510 Subjects.

PubMed

Jiang, Teng; Hou, Jian-Kang; Gao, Qing; Yu, Jin-Tai; Zhou, Jun-Shan; Zhao, Hong-Dong; Zhang, Ying-Dong

2016-01-01

We recently revealed that p.H157Y (rs2234255), a rare coding variant of triggering receptor expressed on myeloid cells 2 gene (TREM2), was associated with Alzheimer's disease (AD) susceptibility in Han Chinese. Contrastingly, although p.H157Y was previously identified in both AD cases and controls by several sequencing studies, no association of this variant with disease susceptibility was reported. To gain a credible conclusion on the association between p.H157Y and AD risk, a meta-analysis involving 7,102 cases and 7,408 controls was conducted. Our results indicated that p.H157Y was associated with an increased risk of AD (OR=3.65, 95% CI: 1.61-8.28; P=0.002), further establishing TREM2 as an important susceptibility gene for this disease.

Introduction of the human AVPR1A gene substantially alters brain receptor expression patterns and enhances aspects of social behavior in transgenic mice.

PubMed

Charles, Rhonda; Sakurai, Takeshi; Takahashi, Nagahide; Elder, Gregory A; Gama Sosa, Miguel A; Young, Larry J; Buxbaum, Joseph D

2014-08-01

Central arginine vasopressin receptor 1A (AVPR1A) modulates a wide range of behaviors, including stress management and territorial aggression, as well as social bonding and recognition. Inter- and intra-species variations in the expression pattern of AVPR1A in the brain and downstream differential behavioral phenotypes have been attributed to differences in the non-coding regions of the AVPR1A gene, including polymorphic elements within upstream regulatory areas. Gene association studies have suggested a link between AVPR1A polymorphisms and autism, and AVPR1A has emerged as a potential pharmacological target for treatment of social cognitive impairments and mood and anxiety disorders. To further investigate the genetic mechanism giving rise to species differences in AVPR1A expression patterns and associated social behaviors, and to create a preclinical mouse model useful for screening drugs targeting AVPR1A, we engineered and extensively characterized bacterial artificial chromosome (BAC) transgenic mice harboring the entire human AVPR1A locus with the surrounding regulatory elements. Compared with wild-type animals, the humanized mice displayed a more widely distributed ligand-AVPR1A binding pattern, which overlapped with that of primates. Furthermore, humanized AVPR1A mice displayed increased reciprocal social interactions compared with wild-type animals, but no differences in social approach and preference for social novelty were observed. Aspects of learning and memory, specifically novel object recognition and spatial relocation recognition, were unaffected. The biological alterations in humanized AVPR1A mice resulted in the rescue of the prepulse inhibition impairments that were observed in knockout mice, indicating conserved functionality. Although further behavioral paradigms and additional cohorts need to be examined in humanized AVPR1A mice, the results demonstrate that species-specific variations in the genomic content of regulatory regions surrounding the AVPR1A locus are responsible for differential receptor protein expression patterns across species and that they are likely to contribute to species-specific behavioral variation. The humanized AVPR1A mouse is a potential preclinical model for further understanding the regulation of receptor gene expression and the impact of variation in receptor expression on behaviors, and should be useful for screening drugs targeting human AVPR1A, taking advantage of the expression of human AVPR1A in human-relevant brain regions. © 2014. Published by The Company of Biologists Ltd.

Associations between dopamine D4 receptor gene variation with both infidelity and sexual promiscuity.

PubMed

Garcia, Justin R; MacKillop, James; Aller, Edward L; Merriwether, Ann M; Wilson, David Sloan; Lum, J Koji

2010-11-30

Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection), little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR) polymorphism in exon III of the human dopamine D4 receptor gene (DRD4) has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+) report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a "one-night stand") and report a more than 50% increase in instances of sexual infidelity. DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism.

Associations between Dopamine D4 Receptor Gene Variation with Both Infidelity and Sexual Promiscuity

PubMed Central

Garcia, Justin R.; MacKillop, James; Aller, Edward L.; Merriwether, Ann M.; Wilson, David Sloan; Lum, J. Koji

2010-01-01

Background Human sexual behavior is highly variable both within and between populations. While sex-related characteristics and sexual behavior are central to evolutionary theory (sexual selection), little is known about the genetic bases of individual variation in sexual behavior. The variable number tandem repeats (VNTR) polymorphism in exon III of the human dopamine D4 receptor gene (DRD4) has been correlated with an array of behavioral phenotypes and may be predicatively responsible for variation in motivating some sexual behaviors, particularly promiscuity and infidelity. Methodology/Principal Findings We administered an anonymous survey on personal history of sexual behavior and intimate relationships to 181 young adults. We also collected buccal wash samples and genotyped the DRD4 VNTR. Here we show that individuals with at least one 7-repeat allele (7R+) report a greater categorical rate of promiscuous sexual behavior (i.e., having ever had a “one-night stand”) and report a more than 50% increase in instances of sexual infidelity. Conclusions/Significance DRD4 VNTR genotype varies considerably within and among populations and has been subject to relatively recent, local selective pressures. Individual differences in sexual behavior are likely partially mediated by individual genetic variation in genes coding for motivation and reward in the brain. Conceptualizing these findings in terms of r/K selection theory suggests a mechanism for selective pressure for and against the 7R+ genotype that may explain the considerable global allelic variation for this polymorphism. PMID:21152404

Characterization of Conserved Tandem Donor Sites and Intronic Motifs Required for Alternative Splicing in Corticosteroid Receptor Genes

PubMed Central

Qian, Xiaoxiao; Matthews, Laura; Lightman, Stafford; Ray, David; Norman, Michael

2015-01-01

Alternative splicing events from tandem donor sites result in mRNA variants coding for additional amino acids in the DNA binding domain of both the glucocorticoid (GR) and mineralocorticoid (MR) receptors. We now show that expression of both splice variants is extensively conserved in mammalian species, providing strong evidence for their functional significance. An exception to the conservation of the MR tandem splice site (an A at position +5 of the MR+12 donor site in the mouse) was predicted to decrease U1 small nuclear RNA binding. In accord with this prediction, we were unable to detect the MR+12 variant in this species. The one exception to the conservation of the GR tandem splice site, an A at position +3 of the platypus GRγ donor site that was predicted to enhance binding of U1 snRNA, was unexpectedly associated with decreased expression of the variant from the endogenous gene as well as a minigene. An intronic pyrimidine motif present in both GR and MR genes was found to be critical for usage of the downstream donor site, and overexpression of TIA1/TIAL1 RNA binding proteins, which are known to bind such motifs, led to a marked increase in the proportion of GRγ and MR+12. These results provide striking evidence for conservation of a complex splicing mechanism that involves processes other than stochastic spliceosome binding and identify a mechanism that would allow regulation of variant expression. PMID:19819975

Soybean kinome: functional classification and gene expression patterns

PubMed Central

Liu, Jinyi; Chen, Nana; Grant, Joshua N.; Cheng, Zong-Ming (Max); Stewart, C. Neal; Hewezi, Tarek

2015-01-01

The protein kinase (PK) gene family is one of the largest and most highly conserved gene families in plants and plays a role in nearly all biological functions. While a large number of genes have been predicted to encode PKs in soybean, a comprehensive functional classification and global analysis of expression patterns of this large gene family is lacking. In this study, we identified the entire soybean PK repertoire or kinome, which comprised 2166 putative PK genes, representing 4.67% of all soybean protein-coding genes. The soybean kinome was classified into 19 groups, 81 families, and 122 subfamilies. The receptor-like kinase (RLK) group was remarkably large, containing 1418 genes. Collinearity analysis indicated that whole-genome segmental duplication events may have played a key role in the expansion of the soybean kinome, whereas tandem duplications might have contributed to the expansion of specific subfamilies. Gene structure, subcellular localization prediction, and gene expression patterns indicated extensive functional divergence of PK subfamilies. Global gene expression analysis of soybean PK subfamilies revealed tissue- and stress-specific expression patterns, implying regulatory functions over a wide range of developmental and physiological processes. In addition, tissue and stress co-expression network analysis uncovered specific subfamilies with narrow or wide interconnected relationships, indicative of their association with particular or broad signalling pathways, respectively. Taken together, our analyses provide a foundation for further functional studies to reveal the biological and molecular functions of PKs in soybean. PMID:25614662

De Novo ORFs in Drosophila Are Important to Organismal Fitness and Evolved Rapidly from Previously Non-coding Sequences

PubMed Central

Reinhardt, Josephine A.; Wanjiru, Betty M.; Brant, Alicia T.; Saelao, Perot; Begun, David J.; Jones, Corbin D.

2013-01-01

How non-coding DNA gives rise to new protein-coding genes (de novo genes) is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs), while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important. PMID:24146629

De Novo Origin of Human Protein-Coding Genes

PubMed Central

Wu, Dong-Dong; Irwin, David M.; Zhang, Ya-Ping

2011-01-01

The de novo origin of a new protein-coding gene from non-coding DNA is considered to be a very rare occurrence in genomes. Here we identify 60 new protein-coding genes that originated de novo on the human lineage since divergence from the chimpanzee. The functionality of these genes is supported by both transcriptional and proteomic evidence. RNA–seq data indicate that these genes have their highest expression levels in the cerebral cortex and testes, which might suggest that these genes contribute to phenotypic traits that are unique to humans, such as improved cognitive ability. Our results are inconsistent with the traditional view that the de novo origin of new genes is very rare, thus there should be greater appreciation of the importance of the de novo origination of genes. PMID:22102831

Diversity of the TLR4 Immunity Receptor in Czech Native Cattle Breeds Revealed Using the Pacific Biosciences Sequencing Platform.

PubMed

Novák, Karel; Pikousová, Jitka; Czerneková, Vladimíra; Mátlová, Věra

2017-07-03

The allelic variants of immunity genes in historical breeds likely reflect local infection pressure and therefore represent a reservoir for breeding. Screening to determine the diversity of the Toll-like receptor gene TLR4 was conducted in two conserved cattle breeds: Czech Red and Czech Red Pied. High-throughput sequencing of pooled PCR amplicons using the PacBio platform revealed polymorphisms, which were subsequently confirmed via genotyping techniques. Eight SNPs found in coding and adjacent regions were grouped into 18 haplotypes, representing a significant portion of the known diversity in the global breed panel and presumably exceeding diversity in production populations. Notably, the ancient Czech Red breed appeared to possess greater haplotype diversity than the Czech Red Pied breed, a Simmental variant, although the haplotype frequencies might have been distorted by significant crossbreeding and bottlenecks in the history of Czech Red cattle. The differences in haplotype frequencies validated the phenotypic distinctness of the local breeds. Due to the availability of Czech Red Pied production herds, the effect of intensive breeding on TLR diversity can be evaluated in this model. The advantages of the Pacific Biosciences technology for the resequencing of long PCR fragments with subsequent direct phasing were independently validated.

PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.

PubMed

Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur

2017-07-01

Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Cumulative risk on the oxytocin receptor gene (OXTR) underpins empathic communication difficulties at the first stages of romantic love

PubMed Central

Schneiderman, Inna; Kanat-Maymon, Yaniv; Ebstein, Richard P.

2014-01-01

Empathic communication between couples plays an important role in relationship quality and individual well-being and research has pointed to the role of oxytocin in providing the neurobiological substrate for pair-bonding and empathy. Here, we examined links between genetic variability on the oxytocin receptor gene (OXTR) and empathic behaviour at the initiation of romantic love. Allelic variations on five OXTR single nucleotide polymorphisms (SNPs) previously associated with susceptibility to disorders of social functioning were genotyped in 120 new lovers: OXTRrs13316193, rs2254298, rs1042778, rs2268494 and rs2268490. Cumulative genetic risk was computed by summing risk alleles on each SNP. Couples were observed in support-giving interaction and behaviour was coded for empathic communication, including affective congruence, maintaining focus on partner, acknowledging partner's distress, reciprocal exchange and non-verbal empathy. Hierarchical linear modelling indicated that individuals with high OXTR risk exhibited difficulties in empathic communication. OXTR risk predicted empathic difficulties above and beyond the couple level, relationship duration, and anxiety and depressive symptoms. Findings underscore the involvement of oxytocin in empathic behaviour during the early stages of social affiliation, and suggest the utility of cumulative risk and plasticity indices on the OXTR as potential biomarkers for research on disorders of social dysfunction and the neurobiology of empathy. PMID:23974948

Epidermal Growth Factor Receptor Activation in Glioblastoma through Novel Missense Mutations in the Extracellular Domain

PubMed Central

Lee, Jeffrey C; Vivanco, Igor; Beroukhim, Rameen; Huang, Julie H. Y; Feng, Whei L; DeBiasi, Ralph M; Yoshimoto, Koji; King, Jennifer C; Nghiemphu, Phioanh; Yuza, Yuki; Xu, Qing; Greulich, Heidi; Thomas, Roman K; Paez, J. Guillermo; Peck, Timothy C; Linhart, David J; Glatt, Karen A; Getz, Gad; Onofrio, Robert; Ziaugra, Liuda; Levine, Ross L; Gabriel, Stacey; Kawaguchi, Tomohiro; O'Neill, Keith; Khan, Haumith; Liau, Linda M; Nelson, Stanley F; Rao, P. Nagesh; Mischel, Paul; Pieper, Russell O; Cloughesy, Tim; Leahy, Daniel J; Sellers, William R; Sawyers, Charles L; Meyerson, Matthew; Mellinghoff, Ingo K

2006-01-01

Background Protein tyrosine kinases are important regulators of cellular homeostasis with tightly controlled catalytic activity. Mutations in kinase-encoding genes can relieve the autoinhibitory constraints on kinase activity, can promote malignant transformation, and appear to be a major determinant of response to kinase inhibitor therapy. Missense mutations in the EGFR kinase domain, for example, have recently been identified in patients who showed clinical responses to EGFR kinase inhibitor therapy. Methods and Findings Encouraged by the promising clinical activity of epidermal growth factor receptor (EGFR) kinase inhibitors in treating glioblastoma in humans, we have sequenced the complete EGFR coding sequence in glioma tumor samples and cell lines. We identified novel missense mutations in the extracellular domain of EGFR in 13.6% (18/132) of glioblastomas and 12.5% (1/8) of glioblastoma cell lines. These EGFR mutations were associated with increased EGFR gene dosage and conferred anchorage-independent growth and tumorigenicity to NIH-3T3 cells. Cells transformed by expression of these EGFR mutants were sensitive to small-molecule EGFR kinase inhibitors. Conclusions Our results suggest extracellular missense mutations as a novel mechanism for oncogenic EGFR activation and may help identify patients who can benefit from EGFR kinase inhibitors for treatment of glioblastoma. PMID:17177598

Functional Characterization of Soybean Glyma04g39610 as a Brassinosteroid Receptor Gene and Evolutionary Analysis of Soybean Brassinosteroid Receptors

PubMed Central

Peng, Suna; Tao, Ping; Xu, Feng; Wu, Aiping; Huo, Weige; Wang, Jinxiang

2016-01-01

Brassinosteroids (BR) play important roles in plant growth and development. Although BR receptors have been intensively studied in Arabidopsis, the BR receptors in soybean remain largely unknown. Here, in addition to the known receptor gene Glyma06g15270 (GmBRI1a), we identified five putative BR receptor genes in the soybean genome: GmBRI1b, GmBRL1a, GmBRL1b, GmBRL2a, and GmBRL2b. Analysis of their expression patterns by quantitative real-time PCR showed that they are ubiquitously expressed in primary roots, lateral roots, stems, leaves, and hypocotyls. We used rapid amplification of cDNA ends (RACE) to clone GmBRI1b (Glyma04g39160), and found that the predicted amino acid sequence of GmBRI1b showed high similarity to those of AtBRI1 and pea PsBRI1. Structural modeling of the ectodomain also demonstrated similarities between the BR receptors of soybean and Arabidopsis. GFP-fusion experiments verified that GmBRI1b localizes to the cell membrane. We also explored GmBRI1b function in Arabidopsis through complementation experiments. Ectopic over-expression of GmBRI1b in Arabidopsis BR receptor loss-of-function mutant (bri1-5 bak1-1D) restored hypocotyl growth in etiolated seedlings; increased the growth of stems, leaves, and siliques in light; and rescued the developmental defects in leaves of the bri1-6 mutant, and complemented the responses of BR biosynthesis-related genes in the bri1-5 bak1-D mutant grown in light. Bioinformatics analysis demonstrated that the six BR receptor genes in soybean resulted from three gene duplication events during evolution. Phylogenetic analysis classified the BR receptors in dicots and monocots into three subclades. Estimation of the synonymous (Ks) and the nonsynonymous substitution rate (Ka) and selection pressure (Ka/Ks) revealed that the Ka/Ks of BR receptor genes from dicots and monocots were less than 1.0, indicating that BR receptor genes in plants experienced purifying selection during evolution. PMID:27338344

[Association of polymorphisms in toll-like receptor genes with atopic dermatitis in the Republic of Bashkortostan].

PubMed

Gimalova, G F; Karunas, A S; Fedorova, Iu Iu; Gumennaia, É R; Levasheva, S V; Khismatullina, Z R; Prans, E; Koks, S; Étkina, É I; Khusnutdinova, É K

2014-01-01

Atopic dermatitis (AD) is a prevalent chronic inflammatory skin disease developing as a result of the interaction between genetic predisposition and environmental factors. Considerable role in allergic diseases development is played by polymorphisms of genes of pattern-recognition receptors (PRR) which are capable of recognizing conservative standard molecular structures (patterns) unique for large pathogen groups. In this study polymorphic variants of PRR genes--Toll-like receptors (TLR1, TLR2, TLR4, TLR5, TLR6, TLR9, TLR10), NOD-like receptors (NOD1, NOD2), lipopolysaccharide receptor CD14 gene, and C11orf30 and LRRC32 genes, located in 11q13.5 region, have been investigated in AD patients and control subjects from the Republic of Bashkortostan. An association of TLR1 (rs5743571 and rs5743604), TLR6 (rs5743794) and TLR10 (rs11466617) with AD was found. Our results confirm an important role of the innate immune system in the pathogenesis of AD and the significance of polymorphisms within the Toll-like receptor 2 subfamily genes in AD development.

Identification of protein-damaging mutations in 10 swine taste receptors and 191 appetite-reward genes.

PubMed

Clop, Alex; Sharaf, Abdoallah; Castelló, Anna; Ramos-Onsins, Sebastián; Cirera, Susanna; Mercadé, Anna; Derdak, Sophia; Beltran, Sergi; Huisman, Abe; Fredholm, Merete; van As, Pieter; Sánchez, Armand

2016-08-26

Taste receptors (TASRs) are essential for the body's recognition of chemical compounds. In the tongue, TASRs sense the sweet and umami and the toxin-related bitter taste thus promoting a particular eating behaviour. Moreover, their relevance in other organs is now becoming evident. In the intestine, they regulate nutrient absorption and gut motility. Upon ligand binding, TASRs activate the appetite-reward circuitry to signal the nervous system and keep body homeostasis. With the aim to identify genetic variation in the swine TASRs and in the genes from the appetite and the reward pathways, we have sequenced the exons of 201 TASRs and appetite-reward genes from 304 pigs belonging to ten breeds, wild boars and to two phenotypically extreme groups from a F2 resource with data on growth and fat deposition. We identified 2,766 coding variants 395 of which were predicted to have a strong impact on protein sequence and function. 334 variants were present in only one breed and at predicted alternative allele frequency (pAAF) ≥ 0.1. The Asian pigs and the wild boars showed the largest proportion of breed specific variants. We also compared the pAAF of the two F2 groups and found that variants in TAS2R39 and CD36 display significant differences suggesting that these genes could influence growth and fat deposition. We developed a 128-variant genotyping assay and confirmed 57 of these variants. We have identified thousands of variants affecting TASRs as well as genes involved in the appetite and the reward mechanisms. Some of these genes have been already associated to taste preferences, appetite or behaviour in humans and mouse. We have also detected indications of a potential relationship of some of these genes with growth and fat deposition, which could have been caused by changes in taste preferences, appetite or reward and ultimately impact on food intake. A genotyping array with 57 variants in 31 of these genes is now available for genotyping and start elucidating the impact of genetic variation in these genes on pig biology and breeding.

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

PubMed

Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

2018-04-12

Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton cultivars.

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

PubMed Central

Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

2018-01-01

Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton cultivars. PMID:29649144

Acoustic trauma triggers upregulation of serotonin receptor genes

PubMed Central

Smith, Adam R.; Kwon, Jae Hyun; Navarro, Marco; Hurley, Laura M.

2014-01-01

Hearing loss induces plasticity in excitatory and inhibitory neurotransmitter systems in auditory brain regions. Excitatory-inhibitory balance is also influenced by a range of neuromodulatory regulatory systems, but less is known about the effects of auditory damage on these networks. In this work, we studied the effects of acoustic trauma on neuromodulatory plasticity in the auditory midbrain of CBA/J mice. Quantitative PCR was used to measure the expression of serotonergic and GABAergic receptor genes in the inferior colliculus (IC) of mice that were unmanipulated, sham controls with no hearing loss, and experimental individuals with hearing loss induced by exposure to a 116 dB, 10 kHz pure tone for 3 hours. Acoustic trauma induced substantial hearing loss that was accompanied by selective upregulation of two serotonin receptor genes in the IC. The Htr1B receptor gene was upregulated tenfold following trauma relative to shams, while the Htr1A gene was upregulated threefold. In contrast, no plasticity in serotonin receptor gene expression was found in the hippocampus, a region also innervated by serotonergic projections. Analyses in the IC demonstrated that acoustic trauma also changed the coexpression of genes in relation to each other, leading to an overexpression of Htr1B compared to other genes.. These data suggest that acoustic trauma induces serotonergic plasticity in the auditory system, and that this plasticity may involve comodulation of functionally-linked receptor genes. PMID:24997228

A Single Dose of LSD Does Not Alter Gene Expression of the Serotonin 2A Receptor Gene (HTR2A) or Early Growth Response Genes (EGR1-3) in Healthy Subjects

PubMed Central

Dolder, Patrick C.; Grünblatt, Edna; Müller, Felix; Borgwardt, Stefan J.; Liechti, Matthias E.

2017-01-01

Rationale: Renewed interest has been seen in the use of lysergic acid diethylamide (LSD) in psychiatric research and practice. The repeated use of LSD leads to tolerance that is believed to result from serotonin (5-HT) 5-HT2A receptor downregulation. In rats, daily LSD administration for 4 days decreased frontal cortex 5-HT2A receptor binding. Additionally, a single dose of LSD acutely increased expression of the early growth response genes EGR1 and EGR2 in rat and mouse brains through 5-HT2A receptor stimulation. No human data on the effects of LSD on gene expression has been reported. Therefore, we investigated the effects of single-dose LSD administration on the expression of the 5-HT2A receptor gene (HTR2A) and EGR1-3 genes. Methods: mRNA expression levels were analyzed in whole blood as a peripheral biomarker in 15 healthy subjects before and 1.5 and 24 h after the administration of LSD (100 μg) and placebo in a randomized, double-blind, placebo-controlled, cross-over study. Results: LSD did not alter the expression of the HTR2A or EGR1-3 genes 1.5 and 24 h after administration compared with placebo. Conclusion: No changes were observed in the gene expression of LSD’s primary target receptor gene or genes that are implicated in its downstream effects. Remaining unclear is whether chronic LSD administration alters gene expression in humans. PMID:28701958

Evolution of melanocortin receptors in cartilaginous fish: melanocortin receptors and the stress axis in elasmobranches.

PubMed

Liang, Liang; Reinick, Christina; Angleson, Joseph K; Dores, Robert M

2013-01-15

There is general agreement that the presence of five melanocortin receptor genes in tetrapods is the result of two genome duplications that occurred prior to the emergence of the gnathostomes, and at least one local gene duplication that occurred early in the radiation of the ancestral gnathostomes. Hence, it is assumed that representatives from the extant classes of gnathostomes (i.e., Chondrichthyes, Actinopterygii, Sarcopterygii) should also have five paralogous melanocortin genes. Current studies on cartilaginous fishes indicate that while there is evidence for five paralogous melanocortin receptor genes in this class, to date all five paralogs have not been detected in the genome of a single species. This mini-review will discuss the ligand selectivity properties of the melanocortin-3 receptor of the elephant shark (subclass Holocephali) and the ligand selectivity properties of the melanocortin-3 receptor, melanocortin-4 receptor, and the melanocortin-5 receptor of the dogfish (subclass Elasmobranchii). The potential relationship of these melanocortin receptors to the hypothalamus/pituitary/interrenal axis will be discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

Network perturbation by recurrent regulatory variants in cancer

PubMed Central

Cho, Ara; Lee, Insuk; Choi, Jung Kyoon

2017-01-01

Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928

Expression of the Norrie disease gene (Ndp) in developing and adult mouse eye, ear, and brain.

PubMed

Ye, Xin; Smallwood, Philip; Nathans, Jeremy

2011-01-01

The Norrie disease gene (Ndp) codes for a secreted protein, Norrin, that activates canonical Wnt signaling by binding to its receptor, Frizzled-4. This signaling system is required for normal vascular development in the retina and for vascular survival in the cochlea. In mammals, the pattern of Ndp expression beyond the retina is poorly defined due to the low abundance of Norrin mRNA and protein. Here, we characterize Ndp expression during mouse development by studying a knock-in mouse that carries the coding sequence of human placental alkaline phosphatase (AP) inserted at the Ndp locus (Ndp(AP)). In the CNS, Ndp(AP) expression is apparent by E10.5 and is dynamic and complex. The anatomically delimited regions of Ndp(AP) expression observed prenatally in the CNS are replaced postnatally by widespread expression in astrocytes in the forebrain and midbrain, Bergman glia in the cerebellum, and Müller glia in the retina. In the developing and adult cochlea, Ndp(AP) expression is closely associated with two densely vascularized regions, the stria vascularis and a capillary plexus between the organ of Corti and the spiral ganglion. These observations suggest the possibility that Norrin may have developmental and/or homeostatic functions beyond the retina and cochlea. Copyright © 2010 Elsevier B.V. All rights reserved.

Whole-genome resequencing reveals candidate mutations for pig prolificacy.

PubMed

Li, Wen-Ting; Zhang, Meng-Meng; Li, Qi-Gang; Tang, Hui; Zhang, Li-Fan; Wang, Ke-Jun; Zhu, Mu-Zhen; Lu, Yun-Feng; Bao, Hai-Gang; Zhang, Yuan-Ming; Li, Qiu-Yan; Wu, Ke-Liang; Wu, Chang-Xin

2017-12-20

Changes in pig fertility have occurred as a result of domestication, but are not understood at the level of genetic variation. To identify variations potentially responsible for prolificacy, we sequenced the genomes of the highly prolific Taihu pig breed and four control breeds. Genes involved in embryogenesis and morphogenesis were targeted in the Taihu pig, consistent with the morphological differences observed between the Taihu pig and others during pregnancy. Additionally, excessive functional non-coding mutations have been specifically fixed or nearly fixed in the Taihu pig. We focused attention on an oestrogen response element (ERE) within the first intron of the bone morphogenetic protein receptor type-1B gene ( BMPR1B ) that overlaps with a known quantitative trait locus (QTL) for pig fecundity. Using 242 pigs from 30 different breeds, we confirmed that the genotype of the ERE was nearly fixed in the Taihu pig. ERE function was assessed by luciferase assays, examination of histological sections, chromatin immunoprecipitation, quantitative polymerase chain reactions, and western blots. The results suggest that the ERE may control pig prolificacy via the cis-regulation of BMPR1B expression. This study provides new insight into changes in reproductive performance and highlights the role of non-coding mutations in generating phenotypic diversity between breeds. © 2017 The Author(s).

Expression of the Norrie disease gene (Ndp) in developing and adult mouse eye, ear, and brain

PubMed Central

Ye, Xin; Smallwood, Philip; Nathans, Jeremy

2011-01-01

The Norrie disease gene (Ndp) codes for a secreted protein, Norrin, that activates canonical Wnt signaling by binding to its receptor, Frizzled-4. This signaling system is required for normal vascular development in the retina and for vascular survival in the cochlea. In mammals, the pattern of Ndp expression beyond the retina is poorly defined due to the low abundance of Norrin mRNA and protein. Here we characterize Ndp expression during mouse development by studying a knock-in mouse that carries the coding sequence of human placental alkaline phosphatase (AP) inserted at the Ndp locus (NdpAP). In the CNS, NdpAP expression is apparent by E10.5 and is dynamic and complex. The anatomically delimited regions of NdpAP expression observed prenatally in the CNS are replaced postnatally by widespread expression in astrocytes in the forebrain and midbrain, Bergman glia in the cerebellum, and Müller glia in the retina. In the developing and adult cochlea, NdpAP expression is closely associated with two densely vascularized regions, the stria vascularis and a capillary plexus between the organ of Corti and the spiral ganglion. These observations suggest the possibility that Norrin may have developmental and/or homeostatic functions beyond the retina and cochlea. PMID:21055480

SIGMAR1 mutation associated with autosomal recessive Silver-like syndrome.

PubMed

Horga, Alejandro; Tomaselli, Pedro J; Gonzalez, Michael A; Laurà, Matilde; Muntoni, Francesco; Manzur, Adnan Y; Hanna, Michael G; Blake, Julian C; Houlden, Henry; Züchner, Stephan; Reilly, Mary M

2016-10-11

To describe the genetic and clinical features of a simplex patient with distal hereditary motor neuropathy (dHMN) and lower limb spasticity (Silver-like syndrome) due to a mutation in the sigma nonopioid intracellular receptor-1 gene (SIGMAR1) and review the phenotypic spectrum of mutations in this gene. We used whole-exome sequencing to investigate the proband. The variants of interest were investigated for segregation in the family using Sanger sequencing. Subsequently, a larger cohort of 16 unrelated dHMN patients was specifically screened for SIGMAR1 mutations. In the proband, we identified a homozygous missense variant (c.194T>A, p.Leu65Gln) in exon 2 of SIGMAR1 as the probable causative mutation. Pathogenicity is supported by evolutionary conservation, in silico analyses, and the strong phenotypic similarities with previously reported cases carrying coding sequence mutations in SIGMAR1. No other mutations were identified in 16 additional patients with dHMN. We suggest that coding sequence mutations in SIGMAR1 present clinically with a combination of dHMN and pyramidal tract signs, with or without spasticity, in the lower limbs. Preferential involvement of extensor muscles of the upper limbs may be a distinctive feature of the disease. These observations should be confirmed in future studies. © 2016 American Academy of Neurology.

Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

PubMed

Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

2010-08-01

Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

The Long Non-Coding RNA MIR503HG Enhances Proliferation of Human ALK-Negative Anaplastic Large-Cell Lymphoma.

PubMed

Huang, Po-Shuan; Chung, I-Hsiao; Lin, Yang-Hsiang; Lin, Tzu-Kang; Chen, Wei-Jan; Lin, Kwang-Huei

2018-05-14

Anaplastic lymphoma kinase (ALK)-negative anaplastic large-cell lymphoma (ALCL) is a rare type of highly malignant, non-Hodgkin lymphoma. Currently, only a few gene rearrangements have been linked to ALK-negative ALCL progression. However, the specific molecular mechanisms underlying the growth of ALK-negative ALCL tumors remain unclear. Here, we investigated aberrantly expressed, long non-coding RNAs (lncRNAs) in ALK-negative ALCL and assessed their potential biological function. MIR503HG ( miR-503 host gene) was highly expressed in ALK-negative cell lines and was significantly upregulated in tumors in mice formed from ALK-negative ALCL cell lines. Depletion of MIR503HG suppressed tumor cell proliferation in vivo and in vitro; conversely, its overexpression enhanced tumor cell growth. MIR503HG -induced proliferation was mediated by the induction of microRNA-503 ( miR - 503 ) and suppression of Smurf2, resulting in stabilization of the tumor growth factor-β receptor (TGFBR) and enhanced tumor cell growth. Collectively, these findings support a potential role for MIR503HG in cancer cell proliferation through the miR-503 /Smurf2/TGFBR axis and indicate that MIR503HG is a potential marker in ALK-negative ALCL.

Identification of olfactory receptor genes in the Japanese grenadier anchovy Coilia nasus.

PubMed

Zhu, Guoli; Wang, Liangjiang; Tang, Wenqiao; Wang, Xiaomei; Wang, Cong

2017-01-01

Olfaction is essential for fish to detect odorant elements in the environment and plays a critical role in navigating, locating food and detecting predators. Olfactory function is produced by the olfactory transduction pathway and is activated by olfactory receptors (ORs) through the binding of odorant elements. Recently, four types of olfactory receptors have been identified in vertebrate olfactory epithelium, including main odorant receptors (MORs), vomeronasal type receptors (VRs), trace-amine associated receptors (TAARs) and formyl peptide receptors (FPRs). It has been hypothesized that migratory fish, which have the ability to perform spawning migration, use olfactory cues to return to natal rivers. Therefore, obtaining OR genes from migratory fish will provide a resource for the study of molecular mechanisms that underlie fish spawning migration behaviors. Previous studies of OR genes have mainly focused on genomic data, however little information has been gained at the transcript level. In this study, we identified the OR genes of an economically important commercial fish Coilia nasus through searching for olfactory epithelium transcriptomes. A total of 142 candidate MOR, 52 V2R/OlfC, 32 TAAR and two FPR putative genes were identified. In addition, through genomic analysis we identified several MOR genes containing introns, which is unusual for vertebrate MOR genes. The transcriptome-scale mining strategy proved to be fruitful in identifying large sets of OR genes from species whose genome information is unavailable. Our findings lay the foundation for further research into the possible molecular mechanisms underlying the spawning migration behavior in C. nasus .

Pheromones and Pheromone Receptors Are Required for Proper Sexual Development in the Homothallic Ascomycete Sordaria macrospora

PubMed Central

Mayrhofer, Severine; Weber, Jan M.; Pöggeler, Stefanie

2006-01-01

The homothallic, filamentous ascomycete Sordaria macrospora is self-fertile and produces sexual fruiting bodies (perithecia) without a mating partner. Even so, S. macrospora transcriptionally expresses two pheromone-precursor genes (ppg1 and ppg2) and two pheromone-receptor genes (pre1 and pre2). The proteins encoded by these genes are similar to α-factor-like and a-factor-like pheromones and to G-protein-coupled pheromone receptors of the yeast Saccharomyces cerevisiae. It has been suggested that in S. macrospora, PPG1/PRE2 and PPG2/PRE1 form two cognate pheromone–receptor pairs. To investigate their function, we deleted (Δ) pheromone-precursor genes (Δppg1, Δppg2) and receptor genes (Δpre1, Δpre2) and generated single- as well as double-knockout strains. No effect on vegetative growth, fruiting-body, and ascospore development was seen in the single pheromone-mutant and receptor-mutant strains, respectively. However, double-knockout strains lacking any compatible pheromone-receptor pair (Δpre2/Δppg2, Δpre1/Δppg1) and the double-pheromone mutant (Δppg1/Δppg2) displayed a drastically reduced number of perithecia and sexual spores, whereas deletion of both receptor genes (Δpre1/Δpre2) completely eliminated fruiting-body and ascospore formation. The results suggest that pheromones and pheromone receptors are required for optimal sexual reproduction of the homothallic S. macrospora. PMID:16387884

Pheromones and pheromone receptors are required for proper sexual development in the homothallic ascomycete Sordaria macrospora.

PubMed

Mayrhofer, Severine; Weber, Jan M; Pöggeler, Stefanie

2006-03-01

The homothallic, filamentous ascomycete Sordaria macrospora is self-fertile and produces sexual fruiting bodies (perithecia) without a mating partner. Even so, S. macrospora transcriptionally expresses two pheromone-precursor genes (ppg1 and ppg2) and two pheromone-receptor genes (pre1 and pre2). The proteins encoded by these genes are similar to alpha-factor-like and a-factor-like pheromones and to G-protein-coupled pheromone receptors of the yeast Saccharomyces cerevisiae. It has been suggested that in S. macrospora, PPG1/PRE2 and PPG2/PRE1 form two cognate pheromone-receptor pairs. To investigate their function, we deleted (delta) pheromone-precursor genes (delta ppg1, delta ppg2) and receptor genes (delta pre1, delta pre2) and generated single- as well as double-knockout strains. No effect on vegetative growth, fruiting-body, and ascospore development was seen in the single pheromone-mutant and receptor-mutant strains, respectively. However, double-knockout strains lacking any compatible pheromone-receptor pair (delta pre2/delta ppg2, delta pre1/delta ppg1) and the double-pheromone mutant (delta ppg1/delta ppg2) displayed a drastically reduced number of perithecia and sexual spores, whereas deletion of both receptor genes (delta pre1/delta pre2) completely eliminated fruiting-body and ascospore formation. The results suggest that pheromones and pheromone receptors are required for optimal sexual reproduction of the homothallic S. macrospora.

Transformation-specific interaction of the bovine papillomavirus E5 oncoprotein with the platelet-derived growth factor receptor transmembrane domain and the epidermal growth factor receptor cytoplasmic domain.

PubMed Central

Cohen, B D; Goldstein, D J; Rutledge, L; Vass, W C; Lowy, D R; Schlegel, R; Schiller, J T

1993-01-01

The bovine papillomavirus E5 transforming protein appears to activate both the epidermal growth factor receptor (EGF-R) and the platelet-derived growth factor receptor (PDGF-R) by a ligand-independent mechanism. To further investigate the ability of E5 to activate receptors of different classes and to determine whether this stimulation occurs through the extracellular domain required for ligand activation, we constructed chimeric genes encoding PDGF-R and EGF-R by interchanging the extracellular, membrane, and cytoplasmic coding domains. Chimeras were transfected into NIH 3T3 and CHO(LR73) cells. All chimeras expressed stable protein which, upon addition of the appropriate ligand, could be activated as assayed by tyrosine autophosphorylation and biological transformation. Cotransfection of E5 with the wild-type and chimeric receptors resulted in the ligand-independent activation of receptors, provided that a receptor contained either the transmembrane domain of the PDGF-R or the cytoplasmic domain of the EGF-R. Chimeric receptors that contained both of these domains exhibited the highest level of E5-induced biochemical and biological stimulation. These results imply that E5 activates the PDGF-R and EGR-R by two distinct mechanisms, neither of which specifically involves the extracellular domain of the receptor. Consistent with the biochemical and biological activation data, coimmunoprecipitation studies demonstrated that E5 formed a complex with any chimera that contained a PDGF-R transmembrane domain or an EGF-R cytoplasmic domain, with those chimeras containing both domains demonstrating the greatest efficiency of complex formation. These results suggest that although different domains of the PDGF-R and EGF-R are required for E5 activation, both receptors are activated directly by formation of an E5-containing complex. Images PMID:8394451

A Dual Origin of the Xist Gene from a Protein-Coding Gene and a Set of Transposable Elements

PubMed Central

Elisaphenko, Eugeny A.; Kolesnikov, Nikolay N.; Shevchenko, Alexander I.; Rogozin, Igor B.; Nesterova, Tatyana B.; Brockdorff, Neil; Zakian, Suren M.

2008-01-01

X-chromosome inactivation, which occurs in female eutherian mammals is controlled by a complex X-linked locus termed the X-inactivation center (XIC). Previously it was proposed that genes of the XIC evolved, at least in part, as a result of pseudogenization of protein-coding genes. In this study we show that the key XIC gene Xist, which displays fragmentary homology to a protein-coding gene Lnx3, emerged de novo in early eutherians by integration of mobile elements which gave rise to simple tandem repeats. The Xist gene promoter region and four out of ten exons found in eutherians retain homology to exons of the Lnx3 gene. The remaining six Xist exons including those with simple tandem repeats detectable in their structure have similarity to different transposable elements. Integration of mobile elements into Xist accompanies the overall evolution of the gene and presumably continues in contemporary eutherian species. Additionally we showed that the combination of remnants of protein-coding sequences and mobile elements is not unique to the Xist gene and is found in other XIC genes producing non-coding nuclear RNA. PMID:18575625

Promoter analysis reveals globally differential regulation of human long non-coding RNA and protein-coding genes

DOE PAGES

Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui; ...

2014-10-02

Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptionalmore » regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.« less

Promoter analysis reveals globally differential regulation of human long non-coding RNA and protein-coding genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alam, Tanvir; Medvedeva, Yulia A.; Jia, Hui

Transcriptional regulation of protein-coding genes is increasingly well-understood on a global scale, yet no comparable information exists for long non-coding RNA (lncRNA) genes, which were recently recognized to be as numerous as protein-coding genes in mammalian genomes. We performed a genome-wide comparative analysis of the promoters of human lncRNA and protein-coding genes, finding global differences in specific genetic and epigenetic features relevant to transcriptional regulation. These two groups of genes are hence subject to separate transcriptional regulatory programs, including distinct transcription factor (TF) proteins that significantly favor lncRNA, rather than coding-gene, promoters. We report a specific signature of promoter-proximal transcriptionalmore » regulation of lncRNA genes, including several distinct transcription factor binding sites (TFBS). Experimental DNase I hypersensitive site profiles are consistent with active configurations of these lncRNA TFBS sets in diverse human cell types. TFBS ChIP-seq datasets confirm the binding events that we predicted using computational approaches for a subset of factors. For several TFs known to be directly regulated by lncRNAs, we find that their putative TFBSs are enriched at lncRNA promoters, suggesting that the TFs and the lncRNAs may participate in a bidirectional feedback loop regulatory network. Accordingly, cells may be able to modulate lncRNA expression levels independently of mRNA levels via distinct regulatory pathways. Our results also raise the possibility that, given the historical reliance on protein-coding gene catalogs to define the chromatin states of active promoters, a revision of these chromatin signature profiles to incorporate expressed lncRNA genes is warranted in the future.« less

Analysis of copy number variations in Holstein-Friesian cow genomes based on whole-genome sequence data.

PubMed

Mielczarek, M; Frąszczak, M; Giannico, R; Minozzi, G; Williams, John L; Wojdak-Maksymiec, K; Szyda, J

2017-07-01

Thirty-two whole genome DNA sequences of cows were analyzed to evaluate inter-individual variability in the distribution and length of copy number variations (CNV) and to functionally annotate CNV breakpoints. The total number of deletions per individual varied between 9,731 and 15,051, whereas the number of duplications was between 1,694 and 5,187. Most of the deletions (81%) and duplications (86%) were unique to a single cow. No relation between the pattern of variant sharing and a family relationship or disease status was found. The animal-averaged length of deletions was from 5,234 to 9,145 bp and the average length of duplications was between 7,254 and 8,843 bp. Highly significant inter-individual variation in length and number of CNV was detected for both deletions and duplications. The majority of deletion and duplication breakpoints were located in intergenic regions and introns, whereas fewer were identified in noncoding transcripts and splice regions. Only 1.35 and 0.79% of the deletion and duplication breakpoints were observed within coding regions. A gene with the highest number of deletion breakpoints codes for protein kinase cGMP-dependent type I, whereas the T-cell receptor α constant gene had the most duplication breakpoints. The functional annotation of genes with the largest incidence of deletion/duplication breakpoints identified 87/112 Kyoto Encyclopedia of Genes and Genomes pathways, but none of the pathways were significantly enriched or depleted with breakpoints. The analysis of Gene Ontology (GO) terms revealed that a cluster with the highest enrichment score among genes with many deletion breakpoints was represented by GO terms related to ion transport, whereas the GO term cluster mostly enriched among the genes with many duplication breakpoints was related to binding of macromolecules. Furthermore, when considering the number of deletion breakpoints per gene functional category, no significant differences were observed between the "housekeeping" and "strong selection" categories, but genes representing the "low selection pressure" group showed a significantly higher number of breakpoints. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Improving the genome annotation of the acarbose producer Actinoplanes sp. SE50/110 by sequencing enriched 5'-ends of primary transcripts.

PubMed

Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred

2014-11-20

Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Gene-Auto: Automatic Software Code Generation for Real-Time Embedded Systems

NASA Astrophysics Data System (ADS)

Rugina, A.-E.; Thomas, D.; Olive, X.; Veran, G.

2008-08-01

This paper gives an overview of the Gene-Auto ITEA European project, which aims at building a qualified C code generator from mathematical models under Matlab-Simulink and Scilab-Scicos. The project is driven by major European industry partners, active in the real-time embedded systems domains. The Gene- Auto code generator will significantly improve the current development processes in such domains by shortening the time to market and by guaranteeing the quality of the generated code through the use of formal methods. The first version of the Gene-Auto code generator has already been released and has gone thought a validation phase on real-life case studies defined by each project partner. The validation results are taken into account in the implementation of the second version of the code generator. The partners aim at introducing the Gene-Auto results into industrial development by 2010.

[Nutrigenomics--bioactive dietary components].

PubMed

Gętek, Monika; Czech, Natalia; Fizia, Katarzyna; Białek-Dratwa, Agnieszka; Muc-Wierzgoń, Małgorzata; Kokot, Teresa; Nowakowska-Zajdel, Ewa

2013-04-05

Nutrigenomics analyzes relations between diet and genes, and identifies mechanisms in which food and nutrition affect health and lifestyles and noncommunicable diseases (R. Chadwick, 2004). Bioactive dietary components are signal molecules that carry information from the external environment and affect in terms of quantity and quality in the process of gene expression. The biological effect of bioactive dietary components depends on various of physiological processes that can occur within a few genes. Polymorphism of genes can change their function and physiological response of the body for nutrients. Bioactive dietary components work on at least two levels of the expression of genes as factors regulating chromatin structure and as factors directly regulate the activity of nuclear receptors. The processes of synthesis and DNA repair are regulated by some of vitamins, macro-and micro-elements. They provide, among others, cofactors of enzymes that catalyze the replication of DNA methylation and its repair. DNA methylation profile may change under the influence of diet, single nucleotide polymorphisms and environmental factors. Bioactive dietary components may directly affect the process of gene expression by acting as ligands for nuclear receptors. Sensitive to dietary group of nuclear receptors are sensory receptors. This group includes, among others receptor PPAR (peroxisome proliferator activated), responsible for energy metabolism and receptors LXR (liver X receptor), FXR (farnesoid X receptor) and RXR, which is responsible for the metabolism of cholesterol.

Beta2-adrenergic receptor allele frequencies in the Quechua, a high altitude native population.

PubMed

Rupert, J L; Monsalve, M V; Devine, D V; Hochachka, P W

2000-03-01

The beta2-adrenergic receptor is involved in the control of numerous physiological processes and, as the primary catecholamine receptor in the lungs, is of particular importance in the regulation of pulmonary function. There are several polymorphic loci in the beta2-adrenergic receptor gene that have alleles that alter receptor function, including two (A/G46, G/C79) that increase agonist sensitivity. As such a phenotype may increase vaso and bronchial dilation, thereby facilitating air and blood flow through the lungs, we hypothesized that selection may have favoured these alleles in high altitude populations as part of an adaptive strategy to deal with the hypoxic conditions characteristic of such environments. We tested this hypothesis by determining the allele frequencies for these two polymorphisms, as well one additional missense mutation (C/T491) and two silent mutations (G/A252 and C/A523) in 63 Quechua speaking natives from communities located between 3200 and 4200 m on the Peruvian altiplano. These frequencies were compared with those of two lowland populations, one native American (Na-Dene from the west coast of Canada) and one Caucasian of Western European descent. The Quechua manifest many of the pulmonary characteristics of high altitude populations and differences in allele frequencies between the Quechua and lowlanders could be indicative of a selective advantage conferred by certain genotypes in high altitude environments. Allele frequencies varied between populations at some loci and patterns of linkage disequilibrium differed between the old-world and new-world samples; however, as these populations are not closely related, significant variation would be expected due to stochastic effects alone. Neither of the alleles associated with increased receptor sensitivity (A46, G79) was significantly over-represented in the Quechua compared with either lowland group. The Quechua were monomorphic for the C allele at base 79. This variant has been associated with body mass index; however no clearly defined metabolic phenotype has been established. In addition, we sequenced the coding region of the gene in three unrelated Quechua to determine if there were any other polymorphisms common in this population. None were detected.

Ultrastructural localization of connexins (Cx36, Cx43, Cx45), glutamate receptors and aquaporin-4 in rodent olfactory mucosa, olfactory nerve and olfactory bulb

PubMed Central

RASH, JOHN E.; DAVIDSON, KIMBERLY G. V.; KAMASAWA, NAOMI; YASUMURA, THOMAS; KAMASAWA, MASAMI; ZHANG, CHUNBO; MICHAELS, ROBIN; RESTREPO, DIEGO; OTTERSEN, OLE P.; OLSON, CARL O.; NAGY, JAMES I.

2006-01-01

Odorant/receptor binding and initial olfactory information processing occurs in olfactory receptor neurons (ORNs) within the olfactory epithelium. Subsequent information coding involves high-frequency spike synchronization of paired mitral/tufted cell dendrites within olfactory bulb (OB) glomeruli via positive feedback between glutamate receptors and closely-associated gap junctions. With mRNA for connexins Cx36, Cx43 and Cx45 detected within ORN somata and Cx36 and Cx43 proteins reported in ORN somata and axons, abundant gap junctions were proposed to couple ORNs. We used freeze-fracture replica immunogold labeling (FRIL) and confocal immunofluorescence microscopy to examine Cx36, Cx43 and Cx45 protein in gap junctions in olfactory mucosa, olfactory nerve and OB in adult rats and mice and early postnatal rats. In olfactory mucosa, Cx43 was detected in gap junctions between virtually all intrinsic cell types except ORNs and basal cells; whereas Cx45 was restricted to gap junctions in sustentacular cells. ORN axons contained neither gap junctions nor any of the three connexins. In OB, Cx43 was detected in homologous gap junctions between almost all cell types except neurons and oligodendrocytes. Cx36 and, less abundantly, Cx45 were present in neuronal gap junctions, primarily at “mixed” glutamatergic/electrical synapses between presumptive mitral/tufted cell dendrites. Genomic analysis revealed multiple miRNA (micro interfering RNA) binding sequences in 3′-untranslated regions of Cx36, Cx43 and Cx45 genes, consistent with cell-type-specific post-transcriptional regulation of connexin synthesis. Our data confirm absence of gap junctions between ORNs, and support Cx36- and Cx45-containing gap junctions at glutamatergic mixed synapses between mitral/tufted cells as contributing to higher-order information coding within OB glomeruli. PMID:16841170

Identification of Modulators of the Nuclear Receptor Peroxisome Proliferator-Activated Receptor α (PPARα) in a Mouse Liver Gene Expression Compendium

EPA Science Inventory

The nuclear receptor family member peroxisome proliferator-activated receptor α (PPARα) is activated by therapeutic hypolipidemic drugs and environmentally-relevant chemicals to regulate genes involved in lipid transport and catabolism. Chronic activation of PPARα in rodents inc...

17A, a novel non-coding RNA, regulates GABA B alternative splicing and signaling in response to inflammatory stimuli and in Alzheimer disease.

PubMed

Massone, Sara; Vassallo, Irene; Fiorino, Gloria; Castelnuovo, Manuele; Barbieri, Federica; Borghi, Roberta; Tabaton, Massimo; Robello, Mauro; Gatta, Elena; Russo, Claudio; Florio, Tullio; Dieci, Giorgio; Cancedda, Ranieri; Pagano, Aldo

2011-02-01

Alternative splicing is a central component of human brain complexity; nonetheless, its regulatory mechanisms are still largely unclear. In this work, we describe a novel non-coding (nc) RNA (named 17A) RNA polymerase (pol) III-dependent embedded in the human G-protein-coupled receptor 51 gene (GPR51, GABA B2 receptor). The stable expression of 17A in SHSY5Y neuroblastoma cells induces the synthesis of an alternative splicing isoform that abolish GABA B2 intracellular signaling (i.e., inhibition of cAMP accumulation and activation of K(+) channels). Indeed, 17A is expressed in human brain, and we report that it is upregulated in cerebral tissues derived from Alzheimer disease patients. We demonstrate that 17A expression in neuroblastoma cells enhances the secretion of amyloid β peptide (Aβ) and the Aβ x-42/Αβ x-40 peptide ratio and that its synthesis is induced in response to inflammatory stimuli. These data correlate, for the first time, the activity of a novel pol III-dependent ncRNA to alternative splicing events and, possibly, to neurodegeneration induced by abnormal GABA B function. We anticipate that further analysis of pol III-dependent regulation of alternative splicing will disclose novel regulatory pathways associated to brain physiology and/or pathology. Copyright © 2010 Elsevier Inc. All rights reserved.

Development of a bioluminescence resonance energy transfer (BRET) for monitoring estrogen receptor alpha activation

NASA Astrophysics Data System (ADS)

Michelini, Elisa; Mirasoli, Mara; Karp, Matti; Virta, Marko; Roda, Aldo

2004-06-01

Estrogen receptor (ER) is a ligand-activated transcriptional factor, able to dimerize after activation and to bind specific DNA sequences (estrogen response elements), thus activating gene target transcription. Since ER homo- and hetero-dimerization (giving a-a and a-b isoforms) is a fundamental step for receptor activation, we developed an assay for detecting compounds that induce human ERa homo-dimerization based on bioluminescence resonance energy transfer (BRET). BRET is a non-radiative energy transfer, occurring between a luminescent donor and a fluorescent acceptor, that strictly depends on the closeness between the two proteins and can therefore be used for studying protein-protein interactions. We cloned ERa coding sequence in frame with either a variant of the green fluorescent protein (enhanced yellow fluorescent protein, EYFP) or Renilla luciferase (RLuc). Upon ERa homo-dimerization, BRET process takes place in the presence of the RLuc substrate coelenterazine resulting in EYFP emission at its characteristic wavelength. The ER alpha-Rluc and ER alpha-EYFP fusion proteins were cloned, then the occurrence of BRET in the presence of ER alpha activators was assayed both in vivo, within cells, and in vitro, with purified fusion proteins.

Reduced ability of C-type natriuretic peptide (CNP) to activate natriuretic peptide receptor B (NPR-B) causes dwarfism in lbab−/− mice

PubMed Central

Yoder, Andrea R.; Kruse, Andrew C.; Earhart, Cathleen A.; Ohlendorf, Douglas H.; Potter, Lincoln R.

2015-01-01

C-type natriuretic peptide (CNP) stimulates endochondrial ossification by activating the transmembrane guanylyl cyclase, natriuretic peptide receptor-B (NPR-B). Recently, a spontaneous autosomal recessive mutation that causes severe dwarfism in mice was identified. The mutant, called long bone abnormality (lbab), contains a single point mutation that converts an arginine to a glycine in a conserved coding region of the CNP gene, but how this mutation affects CNP activity has not been reported. Here, we determined that thirty to greater than one hundred-fold more CNPlbab was required to activate NPR-B as compared to wild-type CNP in whole cell cGMP elevation and membrane guanylyl cyclase assays. The reduced ability of CNPlbab to activate NPR-B was explained, at least in part, by decreased binding since ten-fold more CNPlbab than wild-type CNP was required to compete with [125I][Tyr0]CNP for receptor binding. Molecular modeling suggested that the conserved arginine is critical for binding to an equally conserved acidic pocket in NPR-B. These results indicate that reduced binding to and activation of NPR-B causes dwarfism in lbab−/− mice. PMID:18554750

Roles of ER, SRC-1, and CBP Phosphorylation in Estrogen Receptor-Regulated Gene Expression

DTIC Science & Technology

1999-06-01

J. S. Sutcliff, P. Fang, R. J. Galjaard, Y. H. Jiang, C. S. localization of three repair genes: the xeroderma pigmentosum group C gene Benton, J. M...receptor-mediated scription efficiency, a central DNA-binding domain, which me- transcription; SRC-1, p300/CBP, and RAC3/ACTR/AIB1 pos - diates receptor

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Splicing regulation and dysregulation of cholinergic genes expressed at the neuromuscular junction.

PubMed

Ohno, Kinji; Rahman, Mohammad Alinoor; Nazim, Mohammad; Nasrin, Farhana; Lin, Yingni; Takeda, Jun-Ichi; Masuda, Akio

2017-08-01

We humans have evolved by acquiring diversity of alternative RNA metabolisms including alternative means of splicing and transcribing non-coding genes, and not by acquiring new coding genes. Tissue-specific and developmental stage-specific alternative RNA splicing is achieved by tightly regulated spatiotemporal regulation of expressions and activations of RNA-binding proteins that recognize their cognate splicing cis-elements on nascent RNA transcripts. Genes expressed at the neuromuscular junction are also alternatively spliced. In addition, germline mutations provoke aberrant splicing by compromising binding of RNA-binding proteins, and cause congenital myasthenic syndromes (CMS). We present physiological splicing mechanisms of genes for agrin (AGRN), acetylcholinesterase (ACHE), MuSK (MUSK), acetylcholine receptor (AChR) α1 subunit (CHRNA1), and collagen Q (COLQ) in human, and their aberration in diseases. Splicing isoforms of AChE T , AChE H , and AChE R are generated by hnRNP H/F. Skipping of MUSK exon 10 makes a Wnt-insensitive MuSK isoform, which is unique to human. Skipping of exon 10 is achieved by coordinated binding of hnRNP C, YB-1, and hnRNP L to exon 10. Exon P3A of CHRNA1 is alternatively included to generate a non-functional AChR α1 subunit in human. Molecular dissection of splicing mutations in patients with CMS reveals that exon P3A is alternatively skipped by hnRNP H, polypyrimidine tract-binding protein 1, and hnRNP L. Similarly, analysis of an exonic mutation in COLQ exon 16 in a CMS patient discloses that constitutive splicing of exon 16 requires binding of serine arginine-rich splicing factor 1. Intronic and exonic splicing mutations in CMS enable us to dissect molecular mechanisms underlying alternative and constitutive splicing of genes expressed at the neuromuscular junction. This is an article for the special issue XVth International Symposium on Cholinergic Mechanisms. © 2017 International Society for Neurochemistry.

Testicular Dysgenesis Syndrome and Long-Lasting Epigenetic Silencing of Mouse Sperm Genes Involved in the Reproductive System after Prenatal Exposure to DEHP.

PubMed

Stenz, Ludwig; Escoffier, Jessica; Rahban, Rita; Nef, Serge; Paoloni-Giacobino, Ariane

2017-01-01

The endocrine disruptor bis(2-ethylhexyl) phthalate (DEHP) has been shown to exert adverse effects on the male animal reproductive system. However, its mode of action is unclear and a systematic analysis of its molecular targets is needed. In the present study, we investigated the effects of prenatal exposure to 300 mg/kg/day DEHP during a critical period for gonads differentiation to testes on male mice offspring reproductive parameters, including the genome-wide RNA expression and associated promoter methylation status in the sperm of the first filial generation. It was observed that adult male offspring displayed symptoms similar to the human testicular dysgenesis syndrome. A combination of sperm transcriptome and methylome data analysis allowed to detect a long-lasting DEHP-induced and robust promoter methylation-associated silencing of almost the entire cluster of the seminal vesicle secretory proteins and antigen genes, which are known to play a fundamental role in sperm physiology. It also resulted in the detection of a DEHP-induced promoter demethylation associated with an up-regulation of three genes apparently not relevant for sperm physiology and partially related to the immune system. As previously reported, DEHP induced an increase in mir-615 microRNA expression and a genome-wide decrease in microRNA promoter methylation. A functional analysis revealed DEHP-induced enrichments in down-regulated gene transcripts coding for peroxisome proliferator-activated receptors and tumor necrosis factor signaling pathways, and in up-regulated gene transcripts coding for calcium binding and numerous myosin proteins. All these enriched pathways and networks have been described to be associated in some way with the reproductive system. This study identifies a large new array of genes dysregulated by DEHP that may play a role in the complex system controlling the development of the male reproductive system.

Cardiac transcriptome profiling of diabetic Akita mice using microarray and next generation sequencing

PubMed Central

Kesherwani, Varun; Shahshahan, Hamid R.

2017-01-01

Although diabetes mellitus (DM) causes cardiomyopathy and exacerbates heart failure, the underlying molecular mechanisms for diabetic cardiomyopathy/heart failure are poorly understood. Insulin2 mutant (Ins2+/-) Akita is a mouse model of T1DM, which manifests cardiac dysfunction. However, molecular changes at cardiac transcriptome level that lead to cardiomyopathy remain unclear. To understand the molecular changes in the heart of diabetic Akita mice, we profiled cardiac transcriptome of Ins2+/- Akita and Ins2+/+ control mice using next generation sequencing (NGS) and microarray, and determined the implications of differentially expressed genes on various heart failure signaling pathways using Ingenuity pathway (IPA) analysis. First, we validated hyperglycemia, increased cardiac fibrosis, and cardiac dysfunction in twelve-week male diabetic Akita. Then, we analyzed the transcriptome levels in the heart. NGS analyses on Akita heart revealed 137 differentially expressed transcripts, where Bone Morphogenic Protein-10 (BMP10) was the most upregulated and hairy and enhancer of split-related (HELT) was the most downregulated gene. Moreover, twelve long non-coding RNAs (lncRNAs) were upregulated. The microarray analyses on Akita heart showed 351 differentially expressed transcripts, where vomeronasal-1 receptor-180 (Vmn1r180) was the most upregulated and WD Repeat Domain 83 Opposite Strand (WDR83OS) was the most downregulated gene. Further, miR-101c and H19 lncRNA were upregulated but Neat1 lncRNA was downregulated in Akita heart. Eleven common genes were upregulated in Akita heart in both NGS and microarray analyses. IPA analyses revealed the role of these differentially expressed genes in key signaling pathways involved in diabetic cardiomyopathy. Our results provide a platform to initiate focused future studies by targeting these genes and/or non-coding RNAs, which are differentially expressed in Akita hearts and are involved in diabetic cardiomyopathy. PMID:28837672

Prolactin receptor gene polymorphism and the risk of recurrent pregnancy loss: a case-control study.

PubMed

Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hwang, Kyu Ri; Hong, Min A

2018-02-01

Since the first study was published reporting the candidate association between the prolactin receptor gene intron C/T polymorphism (rs37389) and recurrent miscarriage, no replication study has been performed. In this study, we investigated the role of the prolactin receptor gene C/T polymorphism in 311 Korean women with recurrent pregnancy loss and 314 controls. Genotyping for prolactin receptor gene intron C/T polymorphism was performed using a TaqMan assay. The significance of difference in the genotype distribution was assessed using a chi-square test, and continuous variables were compared using a Student's t-test. The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent pregnancy loss group did not differ from that in the control group (CC/CT/TT rates were 49.8%/41.5%/8.7% and 52.5%/37.6%/9.9% for the recurrent pregnancy loss patient and control groups, respectively, p = .587). When the analysis was restricted to patients with three or more consecutive spontaneous miscarriages or patients without prior live birth, there were also no differences in the genotype distribution between these subgroups and controls. In conclusion, the findings of the current study suggest that the prolactin receptor gene intron C/T polymorphism is not a major determinant of the development of recurrent pregnancy loss. Impact statement What is already known: Many studies have investigated whether there is a genetic component for the risk of recurrent pregnancy loss. Recently, one study investigated whether genetic polymorphisms involved in the regulation of the hypothalamic-pituitary-ovarian axis would be associated with recurrent miscarriage. Among 35 polymorphisms in 20 candidate genes, genotype distribution with regard to the prolactin receptor gene intron C/T polymorphism (rs37389) differed between the recurrent miscarriage and the control groups. Since this study reporting the candidate association between the prolactin receptor gene and recurrent miscarriage, no replication study has been performed. What the results of this study add: The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent miscarriage group did not differ from that in the control group. What the implications are of these findings: Our study may be useful in that it is the first replication study since the initial report of the association of prolactin receptor gene polymorphism with recurrent miscarriage. Although no association was found, the potential role of prolactin in pregnancy loss needs to be further investigated because prolactin and its receptor have been postulated to play an important role in the maintenance of normal pregnancy.

Rapid evolution of chemosensory receptor genes in a pair of sibling species of orchid bees (Apidae: Euglossini).

PubMed

Brand, Philipp; Ramírez, Santiago R; Leese, Florian; Quezada-Euan, J Javier G; Tollrian, Ralph; Eltz, Thomas

2015-08-28

Insects rely more on chemical signals (semiochemicals) than on any other sensory modality to find, identify, and choose mates. In most insects, pheromone production is typically regulated through biosynthetic pathways, whereas pheromone sensory detection is controlled by the olfactory system. Orchid bees are exceptional in that their semiochemicals are not produced metabolically, but instead male bees collect odoriferous compounds (perfumes) from the environment and store them in specialized hind-leg pockets to subsequently expose during courtship display. Thus, the olfactory sensory system of orchid bees simultaneously controls male perfume traits (sender components) and female preferences (receiver components). This functional linkage increases the opportunities for parallel evolution of male traits and female preferences, particularly in response to genetic changes of chemosensory detection (e.g. Odorant Receptor genes). To identify whether shifts in pheromone composition among related lineages of orchid bees are associated with divergence in chemosensory genes of the olfactory periphery, we searched for patterns of divergent selection across the antennal transcriptomes of two recently diverged sibling species Euglossa dilemma and E. viridissima. We identified 3185 orthologous genes including 94 chemosensory loci from five different gene families (Odorant Receptors, Ionotropic Receptors, Gustatory Receptors, Odorant Binding Proteins, and Chemosensory Proteins). Our results revealed that orthologs with signatures of divergent selection between E. dilemma and E. viridissima were significantly enriched for chemosensory genes. Notably, elevated signals of divergent selection were almost exclusively observed among chemosensory receptors (i.e. Odorant Receptors). Our results suggest that rapid changes in the chemosensory gene family occurred among closely related species of orchid bees. These findings are consistent with the hypothesis that strong divergent selection acting on chemosensory receptor genes plays an important role in the evolution and diversification of insect pheromone systems.

Steric antisense inhibition of AMPA receptor Q/R editing reveals tight coupling to intronic editing sites and splicing

PubMed Central

Penn, Andrew C.; Balik, Ales; Greger, Ingo H.

2013-01-01

Adenosine-to-Inosine (A-to-I) RNA editing is a post-transcriptional mechanism, evolved to diversify the transcriptome in metazoa. In addition to wide-spread editing in non-coding regions protein recoding by RNA editing allows for fine tuning of protein function. Functional consequences are only known for some editing sites and the combinatorial effect between multiple sites (functional epistasis) is currently unclear. Similarly, the interplay between RNA editing and splicing, which impacts on post-transcriptional gene regulation, has not been resolved. Here, we describe a versatile antisense approach, which will aid resolving these open questions. We have developed and characterized morpholino oligos targeting the most efficiently edited site—the AMPA receptor GluA2 Q/R site. We show that inhibition of editing closely correlates with intronic editing efficiency, which is linked to splicing efficiency. In addition to providing a versatile tool our data underscore the unique efficiency of a physiologically pivotal editing site. PMID:23172291

LRP8-Reelin-regulated Neuronal (LRN) Enhancer Signature Underlying Learning and Memory Formation

PubMed Central

Telese, Francesca; Ma, Qi; Perez, Patricia Montilla; Notani, Dimple; Oh, Soohwan; Li, Wenbo; Comoletti, Davide; Ohgi, Kenneth A.; Taylor, Havilah; Rosenfeld, Michael G.

2015-01-01

Summary One of the exceptional properties of the brain is its ability to acquire new knowledge through learning and to store that information through memory. The epigenetic mechanisms linking changes in neuronal transcriptional programs to behavioral plasticity remain largely unknown. Here, we identify the epigenetic signature of the neuronal enhancers required for transcriptional regulation of synaptic plasticity genes during memory formation, linking this to Reelin signaling. The binding of Reelin to its receptor, LRP8, triggers activation of this cohort of LRP8-Reelin-regulated-Neuronal (LRN) enhancers that serve as the ultimate convergence point of a novel synapse-to-nucleus pathway. Reelin simultaneously regulates NMDA-receptor transmission, which reciprocally permits the required, γ-secretase-dependent cleavage of LRP8, revealing an unprecedented role for its intracellular domain in the regulation of synaptically generated signals. These results uncover an in vivo enhancer code serving as a critical molecular component of cognition and relevant to psychiatric disorders linked to defects in Reelin signaling. PMID:25892301

Exon-intron structure of the human neuronal nicotinic acetylcholine receptor {alpha}4 subunit (CHRNA4)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steinlein, O.; Weiland, S.; Stoodt, J.

1996-03-01

The human neuronal nicotinic acetylcholine receptor {alpha}4 subunit gene (CHRNA4) is located in the candidate region for three different phenotypes: benign familial neonatal convulsions, autosomal dominant nocturnal frontal lobe epilepsy, and low-voltage EEG. Recently, a missense mutation in transmembrane domain 2 of CHRNA4 was found to be associated with autosomal dominant nocturnal frontal lobe epilepsy in one extended pedigree. We have determined the genomic organization of CHRNA4, which consists of six exons distributed over approximately 17 kb of genomic DNA. The nucleotide sequence obtained from the genomic regions adjacent to the exon boundaries enabled us to develop a set ofmore » primer pairs for PCR amplification of the complete coding region. The sequence analysis provides the basis for a comprehensive mutation screening of CHRNA4 in the above-mentioned phenotypes and possibly in other types of idopathic epilepsies. 29 refs., 3 figs., 1 tab.« less

Pharmacotherapeutic implications of the association between genomic instability at chromosome 15q13.3 and autism spectrum disorders.

PubMed

Deutsch, Stephen I; Urbano, Maria R; Burket, Jessica A; Herndon, Amy L; Winebarger, Erin E

2011-01-01

Recurrent microdeletions of chromosome 15q13.3 are causally associated with autism spectrum disorders (ASDs), suggesting that haploinsufficiency of CHRNA7, the gene that codes for the α7 nicotinic acetylcholine receptor (α7 nAChR) subunit, is an etiological mechanism. Independent of these genetic data, given the location of α7 nAChRs on γ-aminobutyric acid-inhibitory neurons and their role in maintaining central inhibitory tone, a compelling pharmacological rationale exists for therapeutically targeting the α7 nAChR in persons with ASDs. Given the availability of positive allosteric modulators of nicotinic acetylcholine receptors and selective agonists for the α7 nAChR (eg, choline derived from dietary administration of cytidine 5'diphosphocholine and anabasine derivatives), it is possible to conduct "proof of concept" clinical trials, exploring the effects of α7 nAChR agonist interventional strategies on domains of psychopathology, such as attention, cognition, and memory, in persons with ASDs.

Acetyl-L-carnitine supplementation to old rats partially reverts the age-related mitochondrial decay of soleus muscle by activating peroxisome proliferator-activated receptor gamma coactivator-1alpha-dependent mitochondrial biogenesis.

PubMed

Pesce, Vito; Fracasso, Flavio; Cassano, Pierluigi; Lezza, Angela Maria Serena; Cantatore, Palmiro; Gadaleta, Maria Nicola

2010-01-01

The age-related decay of mitochondrial function is a major contributor to the aging process. We tested the effects of 2-month-daily acetyl-L-carnitine (ALCAR) supplementation on mitochondrial biogenesis in the soleus muscle of aged rats. This muscle is heavily dependent on oxidative metabolism. Mitochondrial (mt) DNA content, citrate synthase activity, transcript levels of some nuclear- and mitochondrial-coded genes (cytochrome c oxidase subunit IV [COX-IV], 16S rRNA, COX-I) and of some factors involved in the mitochondrial biogenesis signaling pathway (peroxisome proliferator-activated receptor gamma [PPARgamma] coactivator-1alpha [PGC-1alpha], mitochondrial transcription factor A mitochondrial [TFAM], mitochondrial transcription factor 2B [TFB2]), as well as the protein content of PGC-1alpha were determined. The results suggest that the ALCAR treatment in old rats activates PGC-1alpha-dependent mitochondrial biogenesis, thus partially reverting the age-related mitochondrial decay.

Leptin Receptor Gene Variant rs11804091 Is Associated with BMI and Insulin Resistance in Spanish Female Obese Children: A Case-Control Study

PubMed Central

Rupérez, Azahara I.; Gil-Campos, Mercedes; Leis, Rosaura; Cañete, Ramón; Tojo, Rafael

2017-01-01

Leptin is an endocrine hormone that has a critical role in body weight homoeostasis and mediates its effects via the leptin receptor (LEPR). Common polymorphisms in the genes coding leptin receptors have been associated with metabolic abnormalities. We assessed the association of 28 LEPR polymorphisms with body mass index (BMI) and their relationship with obesity-related phenotypes, inflammation and cardiovascular disease risk biomarkers. A multicentre case-control study was conducted in 522 children (286 with obesity and 236 with normal-BMI). All anthropometric, metabolic factors and biomarkers were higher in children with obesity except apolipoprotein (Apo)-AI, cholesterol, high-density lipoprotein cholesterol (HDL-c), and adiponectin, which were lower in the obesity group; and glucose, low-density lipoprotein cholesterol (LDL-c), and matrix metalloproteinase-9 that did not differ between groups. We identified the associations between rs11208659, rs11804091, rs10157275, rs9436303 and rs1627238, and BMI in the whole population, as well as the association of rs11804091, rs10157275, and rs1327118 with BMI in the female group, although only the rs11804091 remained associated after Bonferroni correction (p = 0.038). This single nucleotide polymorphisms (SNP) was also associated with insulin (p = 0.004), homeostasis model assessment for insulin resistance (HOMA-IR) (p = 0.006), quantitative insulin sensitivity check index (QUICKI) (p = 0.005) and adiponectin (p = 0.046) after adjusting for age, Tanner stage and BMI. Our results show a sex-specific association between the rs11804091 and obesity suggesting an influence of this SNP on insulin resistance. PMID:28771179

[Calcium kidney stones. Diagnostic and preventive prospects].

PubMed

Arcidiacono, T; Terranegra, A; Biasion, R; Soldati, L; Vezzoli, G

2007-01-01

Kidney stone disease is one of the main causes of hospitalization in Italy. Its prevalence increased in the last century and is probably still increasing. The pathogenesis of the disease is not known, although two main theories have been elaborated. The first hypothesizes that hydroxyapatite deposition in the interstitium of the renal papillae (Randall's plaque) precedes urinary calcium oxalate precipitation on the ulcered surface of the papilla to form a stone. The second presumes the tubular lumen of Bellini's duct to be the site where calcium-oxalate salts precipitate to form the nucleus for stone formation within the urinary tract. These pathogenetic processes may be favored by different dietary and genetic factors. The genes involved are not known, although many studies have been performed. Polymorphisms of genes coding for the vitamin D receptor, calcium-sensing receptor, interleukin-1 receptor antagonist, and urokinase were found to be associated with kidney stones, but these results have not been replicated. Different nutrients are suspected to predispose patients to calcium kidney stone disease. A high intake of animal proteins, sodium, vitamin C and oxalate has been implicated in stone formation, whereas calcium, alkalis and phytate may have a protective effect. The prevention of calcium stone formation is based on the recognition of risk factors like those already mentioned here. Furthermore, a family history of kidney stones may be useful in identifying subjects predisposed to become calcium stone formers. However, the expectations of the scientific community are turned to the advances in genetics and to the findings of genetic studies, which may provide diagnostic tools and criteria to define the risk profile of the single individual.

Electron Transport Chain Is Biochemically Linked to Pilus Assembly Required for Polymicrobial Interactions and Biofilm Formation in the Gram-Positive Actinobacterium Actinomyces oris

PubMed Central

Sanchez, Belkys C.; Chang, Chungyu; Wu, Chenggang; Tran, Bryan

2017-01-01

ABSTRACT The Gram-positive actinobacteria Actinomyces spp. are key colonizers in the development of oral biofilms due to the inherent ability of Actinomyces to adhere to receptor polysaccharides on the surface of oral streptococci and host cells. This receptor-dependent bacterial interaction, or coaggregation, requires a unique sortase-catalyzed pilus consisting of the pilus shaft FimA and the coaggregation factor CafA forming the pilus tip. While the essential role of the sortase machine SrtC2 in pilus assembly, biofilm formation, and coaggregation has been established, little is known about trans-acting factors contributing to these processes. We report here a large-scale Tn5 transposon screen for mutants defective in Actinomyces oris coaggregation with Streptococcus oralis. We obtained 33 independent clones, 13 of which completely failed to aggregate with S. oralis, and the remainder of which exhibited a range of phenotypes from severely to weakly defective coaggregation. The former had Tn5 insertions in fimA, cafA, or srtC2, as expected; the latter were mapped to genes coding for uncharacterized proteins and various nuo genes encoding the NADH dehydrogenase subunits. Electron microscopy and biochemical analyses of mutants with nonpolar deletions of nuo genes and ubiE, a menaquinone C-methyltransferase-encoding gene downstream of the nuo locus, confirmed the pilus and coaggregation defects. Both nuoA and ubiE mutants were defective in oxidation of MdbA, the major oxidoreductase required for oxidative folding of pilus proteins. Furthermore, supplementation of the ubiE mutant with exogenous menaquinone-4 rescued the cell growth and pilus defects. Altogether, we propose that the A. oris electron transport chain is biochemically linked to pilus assembly via oxidative protein folding. PMID:28634238

Dysfunctional growth hormone receptor in a strain of sex-linked dwarf chicken: evidence for a mutation in the intracellular domain.

PubMed

Agarwal, S K; Cogburn, L A; Burnside, J

1994-09-01

The sex-linked dwarf (dwdw) chicken represents a valuable animal model for studying GH insensitivity and the consequence of mutations in the GH receptor (GHR) gene. We have recently reported undetectable hepatic GH-binding activity and an aberrantly sized transcript in a strain of dwdw chickens obtained from Arbor Acre Farms, Inc. (Glastonbury, CT, USA). Southern blot analysis of the chicken GHR (cGHR) gene revealed a restriction-fragment length polymorphism in HindIII and EcoRI digests of genomic DNA in this strain of dwdw chicken. In order to localize the molecular mutation, we analysed the gene structure and determined the complete sequence of the 3' untranslated region (3' UTR) of the normal cGHR. With the use of this information, we located a large deletion in the 3' end of the cGHR gene of the Connecticut (CT) strain of dwdw chicken. This deletion (1773 bp) contained 27 highly conserved amino acids of the 3' end of the coding region, the in-frame stop codon, a less frequently used poly(A) signal that is normally found 445 bp downstream of the stop codon, and a large portion of the 3' UTR. Because of this deletion, 27 novel amino acids were substituted and the open reading frame was extended for an additional 26 amino acids before reaching the transcriptional termination site. The predicted amino acid sequence of the novel carboxyl-terminus of the dwdw cGHR is largely hydrophobic with a polylysine tail, whereas the carboxyl-terminus of the wild-type (DwDw) cGHR is composed of hydrophilic amino acids.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene variants and binge eating as predictors of comorbidity and outcome of treatment in severe obesity.

PubMed

Potoczna, Natascha; Branson, Ruth; Kral, John G; Piec, Grazyna; Steffen, Rudolf; Ricklin, Thomas; Hoehe, Margret R; Lentes, Klaus-Ulrich; Horber, Fritz F

2004-12-01

Melanocortin-4 receptor gene (MC4R) variants are associated with obesity and binge eating disorder (BED), whereas the more prevalent proopiomelanocortin (POMC) and leptin receptor gene (LEPR) mutations are rarely associated with obesity or BED. The complete coding regions of MC4R, POMC, and leptin-binding domain of LEPR were comparatively sequenced in 300 patients (233 women and 67 men; mean +/- SEM age, 42 +/- 1 years; mean +/- SEM body mass index, 43.5 +/- 0.3 kg/m2) undergoing laparoscopic gastric banding. Eating behavior, esophagogastric pathology, metabolic syndrome prevalence, and postoperative weight loss and complications were retrospectively compared between carriers and noncarriers of gene variants with and without BED during 36 +/- 3-month follow-up. Nineteen patients (6.3%) carried 8 MC4R variants, 144 (48.0%) carried 13 POMC variants, and 247 (82.3%) carried 11 LEPR variants. All MC4R variant carriers had BED, compared with 18.1% of noncarriers (P < 0.001). BED rates were similar among POMC and LEPR variant carriers and noncarriers. Gastroscopy revealed more erosive esophagitis in bingers than in nonbingers before and after banding (P < 0.04), regardless of genotype. MC4R variant carriers lost less weight (P=0.003), showed less improvement in metabolic syndrome (P < 0.001), had dilated esophagi (P < 0.001) and more vomiting (P < 0.05), and had fivefold more gastric complications (P < 0.001) than noncarriers. Overall outcome was poorest in MC4R variant carriers, better in noncarriers with BED (P < 0.05), and best in noncarriers without BED (P < 0.001). MC4R variants influence comorbidities and treatment outcomes in severe obesity.

Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes.

PubMed

Liu, Yangyang; Han, Xiao; Yuan, Junting; Geng, Tuoyu; Chen, Shihao; Hu, Xuming; Cui, Isabelle H; Cui, Hengmi

2017-04-07

The type II bacterial CRISPR/Cas9 system is a simple, convenient, and powerful tool for targeted gene editing. Here, we describe a CRISPR/Cas9-based approach for inserting a poly(A) transcriptional terminator into both alleles of a targeted gene to silence protein-coding and non-protein-coding genes, which often play key roles in gene regulation but are difficult to silence via insertion or deletion of short DNA fragments. The integration of 225 bp of bovine growth hormone poly(A) signals into either the first intron or the first exon or behind the promoter of target genes caused efficient termination of expression of PPP1R12C , NSUN2 (protein-coding genes), and MALAT1 (non-protein-coding gene). Both NeoR and PuroR were used as markers in the selection of clonal cell lines with biallelic integration of a poly(A) signal. Genotyping analysis indicated that the cell lines displayed the desired biallelic silencing after a brief selection period. These combined results indicate that this CRISPR/Cas9-based approach offers an easy, convenient, and efficient novel technique for gene silencing in cell lines, especially for those in which gene integration is difficult because of a low efficiency of homology-directed repair. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

CXCL4 induces a unique transcriptome in monocyte-derived macrophages

PubMed Central

Gleissner, Christian A.; Shaked, Iftach; Little, Kristina M.; Ley, Klaus

2012-01-01

In atherosclerotic arteries, blood monocytes differentiate to macrophages in the presence of growth factors like macrophage colony-stimulation factor (MCSF) and chemokines like platelet factor 4 (CXCL4). To compare the gene expression signature of CXCL4-induced macrophages with MCSF-induced macrophages or macrophages polarized with IFN-γ/LPS (M1) or IL-4 (M2), we cultured primary human peripheral blood monocytes for six days. mRNA expression was measured by Affymetrix gene chips and differences were analyzed by Local Pooled Error test, Profile of Complex Functionality and Gene Set Enrichment Analysis. 375 genes were differentially expressed between MCSF- and CXCL4-induced macrophages, 206 of them overexpressed in CXCL4 macrophages coding for genes implicated in the inflammatory/immune response, antigen processing/presentation, and lipid metabolism. CXCL4-induced macrophages overexpressed some M1 and M2 genes and the corresponding cytokines at the protein level, however, their transcriptome clustered with neither M1 nor M2 transcriptomes. They almost completely lost the ability to phagocytose zymosan beads. Genes linked to atherosclerosis were not consistently up- or downregulated. Scavenger receptors showed lower and cholesterol efflux transporters higher expression in CXCL4- than MCSF-induced macrophages, resulting in lower LDL content. We conclude that CXCL4 induces a unique macrophage transcriptome distinct from known macrophage types, defining a new macrophage differentiation that we propose to call M4. PMID:20335529

Why does the giant panda eat bamboo? A comparative analysis of appetite-reward-related genes among mammals.

PubMed

Jin, Ke; Xue, Chenyi; Wu, Xiaoli; Qian, Jinyi; Zhu, Yong; Yang, Zhen; Yonezawa, Takahiro; Crabbe, M James C; Cao, Ying; Hasegawa, Masami; Zhong, Yang; Zheng, Yufang

2011-01-01

The giant panda has an interesting bamboo diet unlike the other species in the order of Carnivora. The umami taste receptor gene T1R1 has been identified as a pseudogene during its genome sequencing project and confirmed using a different giant panda sample. The estimated mutation time for this gene is about 4.2 Myr. Such mutation coincided with the giant panda's dietary change and also reinforced its herbivorous life style. However, as this gene is preserved in herbivores such as cow and horse, we need to look for other reasons behind the giant panda's diet switch. Since taste is part of the reward properties of food related to its energy and nutrition contents, we did a systematic analysis on those genes involved in the appetite-reward system for the giant panda. We extracted the giant panda sequence information for those genes and compared with the human sequence first and then with seven other species including chimpanzee, mouse, rat, dog, cat, horse, and cow. Orthologs in panda were further analyzed based on the coding region, Kozak consensus sequence, and potential microRNA binding of those genes. Our results revealed an interesting dopamine metabolic involvement in the panda's food choice. This finding suggests a new direction for molecular evolution studies behind the panda's dietary switch.

Why Does the Giant Panda Eat Bamboo? A Comparative Analysis of Appetite-Reward-Related Genes among Mammals

PubMed Central

Jin, Ke; Xue, Chenyi; Wu, Xiaoli; Qian, Jinyi; Zhu, Yong; Yang, Zhen; Yonezawa, Takahiro; Crabbe, M. James C.; Cao, Ying; Hasegawa, Masami; Zhong, Yang; Zheng, Yufang

2011-01-01

Background The giant panda has an interesting bamboo diet unlike the other species in the order of Carnivora. The umami taste receptor gene T1R1 has been identified as a pseudogene during its genome sequencing project and confirmed using a different giant panda sample. The estimated mutation time for this gene is about 4.2 Myr. Such mutation coincided with the giant panda's dietary change and also reinforced its herbivorous life style. However, as this gene is preserved in herbivores such as cow and horse, we need to look for other reasons behind the giant panda's diet switch. Methodology/Principal Findings Since taste is part of the reward properties of food related to its energy and nutrition contents, we did a systematic analysis on those genes involved in the appetite-reward system for the giant panda. We extracted the giant panda sequence information for those genes and compared with the human sequence first and then with seven other species including chimpanzee, mouse, rat, dog, cat, horse, and cow. Orthologs in panda were further analyzed based on the coding region, Kozak consensus sequence, and potential microRNA binding of those genes. Conclusions/Significance Our results revealed an interesting dopamine metabolic involvement in the panda's food choice. This finding suggests a new direction for molecular evolution studies behind the panda's dietary switch. PMID:21818345

Novel Approaches for the Treatment of Familial Hypercholesterolemia: Current Status and Future Challenges.

PubMed

Jiang, Long; Wang, Lu-Ya; Cheng, Xiao-Shu

2018-06-13

Familial hypercholesterolemia (FH) is an autosomal-dominant disorder that is characterized by high plasma low-density lipoprotein cholesterol (LDL-c) levels and an increased risk of cardiovascular disease. Despite the use of high-dose statins and the recent addition of proprotein convertase subtilisin/kexin type 9 inhibitors as a treatment option, many patients with homozygous FH fail to achieve optimal reductions of LDL-c levels. Gene therapy has become one of the most promising research directions for contemporary life sciences and is a potential treatment option for FH. Recent studies have confirmed the efficacy of a recombinant adeno-associated virus 8 vector expressing the human LDL-c receptor gene in a mouse model, and this vector is currently in phase 2 clinical trials. Much progress has also been achieved in the fields of antisense oligonucleotide- and small interfering RNA-based gene therapies, which are in phase 1-2 clinical trials. In addition, novel approaches, such as the use of minicircle DNA vectors, microRNAs, long non-coding RNAs, and the CRISPR/Cas9 gene-editing system, have shown great potential for FH therapy. However, the delivery system, immunogenicity, accuracy, and specificity of gene therapies limit their clinical applications. In this article, we discuss the current status of gene therapy and recent advances that will likely affect the clinical application of gene therapy for the treatment of FH.

New Insights into Ligand-Receptor Pairing and Coevolution of Relaxin Family Peptides and Their Receptors in Teleosts

PubMed Central

Good, Sara; Yegorov, Sergey; Martijn, Joran; Franck, Jens; Bogerd, Jan

2012-01-01

Relaxin-like peptides (RLN/INSL) play diverse roles in reproductive and neuroendocrine processes in placental mammals and are functionally associated with two distinct types of receptors (RXFP) for each respective function. The diversification of RLN/INSL and RXFP gene families in vertebrates was predominantly driven by whole genome duplications (2R and 3R). Teleosts preferentially retained duplicates of genes putatively involved in neuroendocrine regulation, harboring a total of 10-11 receptors and 6 ligand genes, while most mammals have equal numbers of ligands and receptors. To date, the ligand-receptor relationships of teleost Rln/Insl peptides and their receptors have largely remained unexplored. Here, we use selection analyses based on sequence data from 5 teleosts and qPCR expression data from zebrafish to explore possible ligand-receptor pairings in teleosts. We find support for the hypothesis that, with the exception of RLN, which has undergone strong positive selection in mammalian lineages, the ligand and receptor genes shared between mammals and teleosts appear to have similar pairings. On the other hand, the teleost-specific receptors show evidence of subfunctionalization. Overall, this study underscores the complexity of RLN/INSL and RXFP ligand-receptor interactions in teleosts and establishes theoretical background for further experimental work in nonmammals. PMID:23008798

Double Dissociation of the Roles of Metabotropic Glutamate Receptor 5 and Oxytocin Receptor in Discrete Social Behaviors.

PubMed

Mesic, Ivana; Guzman, Yomayra F; Guedea, Anita L; Jovasevic, Vladimir; Corcoran, Kevin A; Leaderbrand, Katherine; Nishimori, Katsuhiko; Contractor, Anis; Radulovic, Jelena

2015-09-01

Social interactions in vertebrates are complex phenomena based on affective and cognitive processes. Multiple brain regions and neurotransmitter systems are involved in the expression of social behaviors, but their individual roles in specific aspects of social interactions are not well understood. Here we investigated how Gq-protein-coupled metabotropic glutamate receptor 5 (mGluR5) and oxytocin receptor (Oxtr) affect social affiliation and social memory. We used conditional genetic approaches in which the genes coding for these receptors were knocked out in the lateral septum by infusion of recombinant adeno-associated viral vectors containing Cre recombinase (AAV-Cre). Social behavior was assessed 2 weeks later using a three-chamber paradigm for sociability and preference for social novelty. Septal deletion of mGluR5 abolished sociability while leaving preference for social novelty intact. In contrast, deletion of Oxtr did not affect sociability but significantly impaired preference for social novelty. Nonsocial behaviors or memories, including novel object recognition or fear conditioning, were not affected by these genetic manipulations. Immunohistochemical analyses of the distribution of mGluR5 and Oxtr revealed non-overlapping localization of these receptors within the lateral septum, suggesting that not only different neurotransmitters but also different neuronal types contribute to sociability versus preference for social novelty. Our findings identify highly specialized roles of lateral septal mGluR5 and Oxtr in the the regulation of discrete social behaviors, and suggest that deficits in social interactions, which accompany many mental illnesses, would benefit from comprehensive treatments targeting different components of social functioning.

Double Dissociation of the Roles of Metabotropic Glutamate Receptor 5 and Oxytocin Receptor in Discrete Social Behaviors

PubMed Central

Mesic, Ivana; Guzman, Yomayra F; Guedea, Anita L; Jovasevic, Vladimir; Corcoran, Kevin A; Leaderbrand, Katherine; Nishimori, Katsuhiko; Contractor, Anis; Radulovic, Jelena

2015-01-01

Social interactions in vertebrates are complex phenomena based on affective and cognitive processes. Multiple brain regions and neurotransmitter systems are involved in the expression of social behaviors, but their individual roles in specific aspects of social interactions are not well understood. Here we investigated how Gq-protein-coupled metabotropic glutamate receptor 5 (mGluR5) and oxytocin receptor (Oxtr) affect social affiliation and social memory. We used conditional genetic approaches in which the genes coding for these receptors were knocked out in the lateral septum by infusion of recombinant adeno-associated viral vectors containing Cre recombinase (AAV-Cre). Social behavior was assessed 2 weeks later using a three-chamber paradigm for sociability and preference for social novelty. Septal deletion of mGluR5 abolished sociability while leaving preference for social novelty intact. In contrast, deletion of Oxtr did not affect sociability but significantly impaired preference for social novelty. Nonsocial behaviors or memories, including novel object recognition or fear conditioning, were not affected by these genetic manipulations. Immunohistochemical analyses of the distribution of mGluR5 and Oxtr revealed non-overlapping localization of these receptors within the lateral septum, suggesting that not only different neurotransmitters but also different neuronal types contribute to sociability versus preference for social novelty. Our findings identify highly specialized roles of lateral septal mGluR5 and Oxtr in the the regulation of discrete social behaviors, and suggest that deficits in social interactions, which accompany many mental illnesses, would benefit from comprehensive treatments targeting different components of social functioning. PMID:25824423

Expression of plasma membrane receptor genes during megakaryocyte development

PubMed Central

Sun, Sijie; Wang, Wenjing; Latchman, Yvette; Gao, Dayong; Aronow, Bruce

2013-01-01

Megakaryocyte (MK) development is critically informed by plasma membrane-localized receptors that integrate a multiplicity of environmental cues. Given that the current understanding about receptors and ligands involved in megakaryocytopoiesis is based on single targets, we performed a genome-wide search to identify a plasma membrane receptome for developing MKs. We identified 40 transmembrane receptor genes as being upregulated during MK development. Seven of the 40 receptor-associated genes were selected to validate the dataset. These genes included: interleukin-9 receptor (IL9R), transforming growth factor, β receptor II (TGFBR2), interleukin-4 receptor (IL4R), colony stimulating factor-2 receptor-beta (CSFR2B), adiponectin receptor (ADIPOR2), thrombin receptor (F2R), and interleukin-21 receptor (IL21R). RNA and protein analyses confirmed their expression in primary human MKs. Matched ligands to IL9R, TGFBR2, IL4R, CSFR2B, and ADIPOR2 affected megakaryocytopoiesis. IL9 was unique in its ability to increase the number of MKs formed. In contrast, MK colony formation was inhibited by adiponectin, TGF-β, IL4, and GM-CSF. The thrombin-F2R axis affected platelet function, but not MK development, while IL21 had no apparent detectable effects. ADP-induced platelet aggregation was suppressed by IL9, TGF-β, IL4, and adiponectin. Overall, six of seven of the plasma membrane receptors were confirmed to have functional roles in MK and platelet biology. Also, results show for the first time that adiponectin plays a regulatory role in MK development. Together these data support a strong likelihood that the 40 transmembrane genes identified as being upregulated during MK development will be an important resource to the research community for deciphering the complex repertoire of environmental cues regulating megakaryocytopoiesis and/or platelet function. PMID:23321270

The N-CoR complex enables chromatin remodeler SNF2H to enhance repression by thyroid hormone receptor

PubMed Central

Alenghat, Theresa; Yu, Jiujiu; Lazar, Mitchell A

2006-01-01

Unliganded thyroid hormone receptor (TR) actively represses transcription via the nuclear receptor corepressor (N-CoR)/histone deacetylase 3 (HDAC3) complex. Although transcriptional activation by liganded receptors involves chromatin remodeling, the role of ATP-dependent remodeling in receptor-mediated repression is unknown. Here we report that SNF2H, the mammalian ISWI chromatin remodeling ATPase, is critical for repression of a genomically integrated, TR-regulated reporter gene. N-CoR and HDAC3 are both required for recruitment of SNF2H to the repressed gene. SNF2H does not interact directly with the N-CoR/HDAC3 complex, but binds to unacetylated histone H4 tails, suggesting that deacetylase activity of the corepressor complex is critical to SNF2H function. Indeed, HDAC3 as well as SNF2H are required for nucleosomal organization on the TR target gene. Consistent with these findings, reduction of SNF2H induces expression of an endogenous TR-regulated gene, dio1, in liver cells. Thus, although not apparent from studies of transiently transfected reporter genes, gene repression by TR involves the targeting of chromatin remodeling factors to repressed genes by the HDAC activity of nuclear receptor corepressors. PMID:16917504

Missense polymorphisms in the MC1R gene of the dog, red fox, arctic fox and Chinese raccoon dog.

PubMed

Nowacka-Woszuk, J; Salamon, S; Gorna, A; Switonski, M

2013-04-01

Coat colour variation is determined by many genes, one of which is the melanocortin receptor type 1 (MC1R) gene. In this study, we examined the whole coding sequence of this gene in four species belonging to the Canidae family (dog, red fox, arctic fox and Chinese raccoon dog). Although the comparative analysis of the obtained nucleotide sequences revealed a high conservation, which varied between 97.9 and 99.1%, we altogether identified 22 SNPs (10 in dogs, six in farmed red foxes, two in wild red foxes, three in arctic foxes and one in Chinese raccoon dog). Among them, seven appeared to be novel: one silent in the dog, three missense and one silent in the red fox, one in the 3'-flanking region in the arctic fox and one silent in the Chinese raccoon dog. In dogs and red foxes, the SNPs segregated as 10 and four haplotypes, respectively. Taking into consideration the published reports and results of this study, the highest number of missense polymorphisms was until now found in the dog (9) and red fox (7). © 2012 Blackwell Verlag GmbH.

Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

PubMed

Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

2007-06-01

DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.